Influenza vaccines
Nucleic acid and subunit-based vaccines combining multiple influenza antigens address the limitations of current vaccines by providing broad and potent immune responses against diverse strains, including H5Nx and influenza B, through optimized antigen sequences and flexible delivery systems.
Patent Information
- Application Number
- PCT/GB2025/052147
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-10
- Filing Date
- 2025-10-01
- Publication Date
- 2026-04-09
AI Technical Summary
Current influenza vaccines face challenges due to the rapid mutation and antigenic drift/shift of influenza viruses, leading to mismatches between vaccine strains and circulating viruses, resulting in limited effectiveness and the need for annual reformulation, and they fail to induce broad, potent immune responses against diverse strains, particularly H5Nx and influenza B viruses.
Development of nucleic acid and subunit-based vaccines that combine multiple broad-spectrum influenza antigens, including HA, NA, and M2 matrix proteins, administered as a mixture, simultaneously, or sequentially, to elicit a broadly neutralizing immune response across various influenza strains, utilizing mRNA vaccines encapsulated in LNPs and optimized antigen sequences.
The vaccines provide rapid and flexible protection against diverse influenza strains, including H5Nx and influenza B, with enhanced immune responses, addressing the limitations of current vaccines by offering broad and potent neutralization capabilities.
Smart Images

Figure IMGF000013_0001 
Figure IMGF000017_0001 
Figure IMGF000044_0001
Abstract
Description
[0001] Influenza Vaccines This invention relates to influenza vaccines, in particular multiple subunit influenza vaccines, and to pharmaceutical compositions, vectors, cells, polynucleotides, polypeptides, and their use as vaccines against influenza infection. Influenza viruses, particularly Influenza A, pose a significant threat to public health due to their potential for rapid mutation and interspecies transmission. There are at least 19 different influenza A virus subtypes circulating in animal reservoirs, occasionally infecting the human population and causing pandemics (Krammer et al., 2018, Nat Rev Dis Primers, 4:3). In animals, most influenza A viruses cause mild localized infections of the respiratory and intestinal tract. However, highly pathogenic influenza A strains, such as some within the H5N1 subtype, can cause systemic infections in poultry with spill-over human cases, which can have high mortality rates. Influenza A H5N1 is the predominant influenza virus subtype detected in wild birds and farmed flocks in the UK, with spillovers to mammals frequently documented since the 2022 outbreak. Only two influenza A virus subtypes A(H1N1)pdm09, and A(H3N2), are currently circulating among people, however H5N1 clade 2.3.4.4b is currently showing high risk of human spillover. 90 laboratory-confirmed cases of human infection with avian H5N6 have also been reported as of 31 January 2024. Notable pandemics in the last century have been caused by H1N1, H2N2, and H3N2 subtypes, and currently, H1N1, H3N2, and two distinct lineages of Influenza B viruses circulate seasonally in humans. Despite surveillance programs and advances in modelling studies (Nelson et al., 2019; Harrington et al., 2021), predicting which influenza subtype will cause the next pandemic remains difficult. Influenza A viruses are enveloped, negative-stranded RNA viruses of the Orthomyxoviridae family. Influenza A has an outer envelope that is coated with three integral membrane proteins: hemagglutinin (HA); neuraminidase (NA); and matrix ion channel (M2), which overlap a matrix protein (M1). The organisation of influenza B is similar, with HA and NA scattered across the lipid envelope, but with NB and BM2 transmembrane ion channels instead of M2. Influenza A viruses are subtyped based on their combination of surface glycoproteins (GP) namely HA and NA. Influenza B viruses, having much less antigenic variation than influenza A, are not differentiated in this way. HA and NA are membrane bound envelope GPs, responsible for virus attachment, penetration of viral particles into the cell (Buffin et al., 2019; Cohen et al., 2013), and subsequent release of the viral particle from the cell. They are the sources of the major immunodominant epitopes for virus neutralisation and protective immunity. Hence, both HA and NA proteins are considered the most important components for prophylactic influenza vaccines. RNA viruses generally have very high mutation rates compared to DNA viruses, because viral RNA polymerases lack the proofreading ability of DNA polymerases. This contributes towards antigenic drift, a continuous process of the accumulation of mutations in the genome of an infectious agent resulting in minor changes in antigens presented to the immune system of the host organism. Changes to antigenic regions of the proteins on the influenza virion result in its evasion of the host immune system and potentially increased pathogenicity and infectiousness. This is one reason why it is difficult to make effective vaccines to prevent influenza. Influenza can undergo antigenic shift, a process wherein there is a dramatic change in the antigens presented on the influenza virus. Gene segments from different subtypes of influenza can reassort and package into a new virion particle containing the genetic information from both of the subtypes. This can result in a virus that has antigenic characteristics not before seen in a human setting, to which we are naïve immunologically. The new quasi-species of the virus can cause a pandemic if no neutralising, or inhibitory antibodies to the new influenza virus are present in the human population. The continuous evolution of influenza, particularly through antigenic drift and shift, complicates vaccine development. New strains with novel antigenic properties can lead to pandemics, as demonstrated by the H5N1 and H1N1 outbreaks, both of which involved reassortment of genetic material from animal and human influenza strains, with H5N1 being especially concerning due to its high mortality rate upon infection. Influenza B, though restricted to human infections, also exhibits antigenic evolution, further emphasizing the need for universal vaccines, although the B / Yamagata lineage viruses have not been detected globally since March 2020. The fundamental principal of a vaccine is to prepare the immune system for an encounter with a pathogen. A vaccine triggers the immune system to produce antibodies and T-cell responses, which helps to combat infection. Historically, once a pathogen was isolated and grown, it was either mass produced and killed or attenuated, and used as a vaccine. Later recombinant genes from isolated pathogens were used to generate recombinant proteins that were mixed with adjuvants to stimulate immune responses. More recently the pathogen genes were cloned into vector systems (attenuated bacteria or viral delivery systems) to express and deliver the antigen in vivo. All of these strategies are dependent on pathogens isolated from past outbreaks to prevent future ones. For pathogens which do not change significantly, or slowly, this conventional technology is effective. However, some pathogens, are prone to accelerated mutation rate and previously generated antibodies do not always recognise evolved strains of the same pathogen. New emerging and re-emerging pathogens often hide or disguise their vulnerable antigens from the immune system to escape the immune response. Vaccination is still the primary prophylactic strategy against influenza infection; however, current seasonal vaccines require annual reformulation to protect against the continuous antigenic changes that occur in circulating influenza viruses. Furthermore, even when vaccine strains are closely matched to circulating viruses, existing commercial vaccines are not always completely effective in at-risk populations and can fail to induce long-lasting and broad protective immunity in the wider population. Current influenza vaccines, while effective in reducing seasonal infections, face challenges due to the virus’s ability to undergo antigenic drift and antigenic shift, which leads to mismatches between the vaccine strain and circulating viruses. The World Health Organization (WHO) estimates that annual influenza vaccines have an effectiveness ranging from only 10% to 60%, which underscores the need for more comprehensive vaccine strategies (https: / / www.cdc.gov / flu / vaccines-work / effectiveness-studies.htm). Several universal influenza vaccines are in development to provide broad protection against diverse subtypes (Erbelding et al., 2018; Arevalo et al., 2022), but many focus on a limited number of antigens, which restricts their effectiveness in addressing the antigenic variability of influenza viruses (Yassine et al., 2015; Corbett et al., 2019). Hence, there is a critical need for improved influenza vaccines that target conserved regions of the virus. There is a need to provide improved influenza vaccines that elicit a broader, potent immune response to influenza infection. In particular, there is a need to protect against more influenza strains than current vaccines, and to provide potent protection against those strains. In particular, there is a need to provide improved vaccines that elicit more broadly neutralising immune responses to influenza A H5 viruses, and emerging influenza viruses derived from zoonotic spillover from animals to humans. Particularly, there is a need to provide neutralising antibody protection across viruses of the H5Nx subtype of influenza A, especially clade 2.3.4.4 including 2.3.4.4b. Particularly, there is also a need to provide improved vaccines that elicit more broadly neutralising immune responses to influenza A N6 and N1 viruses. There is also a need to provide improved vaccines that elicit more broadly neutralising immune responses to seasonal influenza A and influenza B viruses, particularly influenza A H1N1 and H3N2, and influenza B lineage B / Victoria. There is also a need to provide vaccines with stronger neutralising capacity against viruses of a given type, subtype, clade or sub-clade. Vaccine Antigen Payloads (VAP) for a Seasonal Influenza Vaccine (SIV) and a Universal Influenza-type Vaccine (UIV) aim to overcome the limitations of current influenza vaccines by virtue of being highly potent against circulating influenza viruses as well as showing breadth against viruses that are considered as likely emerging seasonal and pandemic threats. We have appreciated that such broadly effective potent vaccines are provided by a combination of multiple broad spectrum influenza antigens, including influenza HA, NA, (M2) and optionally M1 Matrix protein antigens. Such vaccines may be provided as nucleic acid vaccines (in particular, mRNA vaccines), encoding the combination of HA, NA, (M2) and optionally M1 Matrix protein polypeptides. The separate nucleic acids may be administered as a mixture together (such as in a pharmaceutical composition comprising the separate nucleic acids), or separate nucleic acids may be co-administered simultaneously, or administered sequentially in any order. According to the invention, there is provided an influenza vaccine, which comprises nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, a first H5 haemagglutinin protein, a second N1 neuraminidase protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein, an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein, and optionally an M1 matrix protein. There is also provided according to the invention an influenza vaccine, which comprises nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, and optionally an M1 matrix protein. There is also provided according to the invention an influenza vaccine, which comprises nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, and optionally an M1 protein. There is also provided according to the invention an influenza vaccine, which comprises nucleic acid encoding: a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein. There is also provided according to the invention an influenza vaccine, which comprises nucleic acid encoding: a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein. There is also provided according to the invention an influenza vaccine, which comprises nucleic acid encoding: an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein. The Applicant has also appreciated that broad potent immune responses can also be provided by administration of subunit-based vaccines (whether as a mixture as part of a pharmaceutical composition, or separately for simultaneous co-administration or sequential administration). Optionally, each subunit comprises multiple separate nucleic acids, wherein each separate nucleic acid encodes one or more designed influenza antigens (typically, the nucleic acid sequence encoding a designed influenza antigen is a non-naturally occurring nucleic acid sequence, i.e. not a sequence that has been obtained from an isolated virus). In the case where a separate nucleic acid encodes more than one influenza antigen, the nucleic acids encoding each influenza antigen are pieced together in a string to form a separate nucleic encoding more than one antigen polypeptide. For example, a subunit may comprise nucleic acid encoding an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, and an M1 matrix protein, wherein a first isolated nucleic acid comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein, and a second isolated nucleic acid comprises nucleotide sequence encoding the M1 matrix protein. According to the invention, there is provided a multiple subunit influenza vaccine, which comprises: i) one or more subunits comprising nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, and optionally an M1 matrix protein; and ii) one or more further subunits comprising nucleic acid encoding: a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein; and iii) one or more additional subunits comprising nucleic acid encoding: an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein. Nucleic acid vaccines may be provided as DNA, RNA, or mRNA vaccines. It is particularly envisaged that the nucleic acid vaccines are provided as mRNA vaccines, wherein the mRNA is encapsulated in a lipid nanoparticle (LNP) or a lipidoid nanoparticle (LiNP). More particularly, it is envisaged that the vaccine is a subunit-based vaccine, wherein each subunit comprises mRNA encoding a combination of multiple broad spectrum influenza antigens, wherein each subunit comprises an LNP or an LiNP. Embodiments of the invention provide a multi-mRNA and multi-LNP approach to provide broad spectrum immunity, delivering rapid and flexible effective protection against diverse influenza strains in both seasonal and pandemic contexts. Furthermore, utilizing mRNA technology significantly accelerates vaccine development, allowing for rapid responses to emerging strains, and offers a more flexible and efficient alternative to traditional influenza vaccine production methods, which are often slow and complex. In other embodiments, the vaccines may be provided as polypeptide vaccines, comprising a combination of multiple broad spectrum influenza antigens, including HA, NA, and optionally Matrix protein polypeptides. Again, the polypeptides may be administered as a mixture together (for example, as a pharmaceutical composition comprising the separate polypeptides), or separate polypeptides may be administered simultaneously, or administered sequentially in any order. Nucleic acid subunit-based vaccines Subunit-based vaccines are provided, which comprise one or more subunits each comprising multiple separate nucleic acids, wherein each separate nucleic acid encodes one or more influenza antigens, optionally one or more designed influenza antigens (typically, the amino acid sequence of a designed influenza antigen is a non-naturally occurring amino acid sequence, i.e. not a sequence that has been obtained from an isolated virus). The separate nucleic acids may comprise isolated nucleic acids which each encode a separate antigen polypeptide, or may comprise isolated nucleic acid comprising nucleic acid pieced together in a string which encode more than one antigen polypeptide. The subunits may be administered as a mixture together (for example, as a pharmaceutical composition comprising the subunits), or administered simultaneously or sequentially in any order. For example, one or more subunits may comprise nucleic acid encoding an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, and optionally an M1 matrix protein. In an embodiment where a separate nucleic acid encodes more than one influenza antigen, the nucleic acid encoding each influenza antigen are pieced together in a string to form an isolated nucleic encoding more than one antigen polypeptide. For example, a subunit may comprise nucleic acid encoding an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, and optionally an M1 matrix protein, wherein a first isolated nucleic acid comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein, and optionally a second isolated nucleic acid comprises nucleotide sequence encoding the M1 matrix protein. The one or more subunits may be administered as a mixture together (for example, as a pharmaceutical composition comprising the subunits), or administered simultaneously or sequentially in any order. One or more further subunits may comprise nucleic acid encoding a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein. One or more additional subunits may comprise nucleic acid encoding an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein. Similarly, the subunits of the one or more further subunits, and / or one or more additional subunits may be administered as a mixture together (for example, as a pharmaceutical composition comprising the subunits), or administered simultaneously or sequentially in any order. Nucleic acid vaccines may be provided as DNA, RNA, or mRNA vaccines. According to the invention, there is provided a multiple subunit influenza vaccine, which comprises: i) one or more subunits comprising nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, and optionally an M1 matrix protein; and ii) one or more further subunits comprising nucleic acid encoding: a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein; and iii) one or more additional subunits comprising nucleic acid encoding: an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein. Such vaccines are particularly advantageous as they elicit broadly neutralising antibody responses to a panel of influenza A and influenza B viruses. In particular, such vaccines elicit a broad potent neutralising antibody response against the following influenza A viruses: H1, N1, H3, N2, H5, H7, H9, N2, N5, N7, N9, and H1N1. In the case of influenza H1, the Applicant has found that such vaccines elicit a broadly neutralising immune response against swine H1, seasonal H1 (particularly H1N1), and pandemic H1. Such vaccines also offer broad protection against a panel of influenza H5 viruses, including sub-clades 2.3.2.1c, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, and 2.3.4.4c. Such vaccines also provide neutralising immune protection against influenza B viruses, including B / Victoria (B / Colorado / 6 / 17) and B / Yamagata. Optionally, the antigens are optimised. The term “optimised” is used herein to refer to sequences that have been identified by carrying out a multiple sequence alignment of amino acid sequences (and / or encoding nucleotide sequences) of HA, NA, or matrix protein polypeptides, respectively, of different influenza isolates, and identifying from the multiple sequence alignment amino acid sequence (or encoded amino acid sequence) that is highly conserved between the polypeptides of the different isolates. For example, to optimise a H5 amino acid sequence of a H5 polypeptide, a multiple sequence alignment of amino acid sequences (and / or encoding nucleotide sequences) of H5 polypeptides of different influenza isolates is carried out, and amino acid sequence (or encoded amino acid sequence) that is highly conserved between the polypeptides of the different isolates is identified from the multiple sequence alignment. Optionally ancestral amino acid sequence is identified from the multiple sequence alignment, and included in an optimized polypeptide sequence. Ancestral sequence reconstruction (ASR) is discussed in Randall et al. (Nat. Commun. 7:12847 doi: 10.1038 / ncomms 12847 (2016)). The authors reference a definition of ASR as “the process of analyzing modern sequences within an evolutionary / phylogenetic context to infer the ancestral sequences at particular nodes of a tree”. Ancestral sequence reconstruction (ASR) is used in the study of molecular evolution. Unlike conventional evolutionary approaches to studying proteins, by horizontal comparison of related protein homologues from different branch ends of a phylogenetic tree, ASR probes the statistically inferred ancestral proteins within the nodes of the tree in a vertical manner. A phylogenetic tree is a branching diagram showing the evolutionary relationships among various biological species or other entities based upon similarities and differences in their physical or genetic characteristics. In a rooted phylogenetic tree, each node with descendants represents the inferred most recent common ancestor of those descendants. In ASR, several related homologues of a protein of interest are selected and aligned in a multiple sequence alignment (MSA), a phylogenetic tree is constructed with statistically inferred sequences at the nodes of the branches. These sequences are the so-called 'ancestors'. The process of synthesising the corresponding DNA, transforming it into a cell and producing a protein is the so-called 'reconstruction'. Ancestral sequences are typically calculated by maximum likelihood, however Bayesian methods are also implemented. Because the ancestors are inferred from a phylogeny, the topology and composition of the phylogeny plays a major role in the output ASR sequences. ASR does not claim to recreate the actual sequence of the ancient protein / DNA, but rather a sequence that is likely to be similar to the one that was at the node. Maximum likelihood (ML) methods work by generating a sequence where the residue at each position is predicted to be the most likely to occupy that position by the method of inference used. Typically, this is a scoring matrix (similar to those used in BLASTs or MSAs) calculated from extant sequences. Alternate methods include maximum parsimony (MP) that construct a sequence based on a model of sequence evolution, usually the idea that the minimum number of nucleotide sequence changes represents the most efficient route for evolution to take and the most likely. MP is often considered the least reliable method for reconstruction as it arguably oversimplifies evolution to a degree that is not applicable on the billion year scale. Other methods include Bayesian methods, which involve the consideration of residue uncertainty. Such methods are sometimes used to compliment ML methods, but typically produce more ambiguous sequences (i.e. sequences which include residue positions where no clear substitution can be predicted). Often in such cases, several ASR sequences are produced, encompassing most of the ambiguities, and compared to one-another. Suitable methods and algorithms for ASR (including Maximum Parsimony, Maximum Likelihood, Bayesian Interference) are described in WO 2020 / 065349 (the contents of which are incorporated herein by reference; see in particular pages 28-40), and in Joy et al., 2016, PLOS Computational Biology 12(7): DOI:10.1371 / journal.pcbi.1004763. Any suitable method of ARS may be used to identify amino acid sequence or encoded amino acid sequence that is ancestral amino acid sequence from the multiple sequence alignment. Optionally identification of ancestral amino acid sequence from the multiple sequence alignment comprises performing a maximum parsimony ancestral sequence reconstruction (MP-ASR). Optionally identification of ancestral amino acid sequence from the multiple sequence alignment comprises performing a maximum likelihood ancestral sequence reconstruction (ML-ASR). Optionally identification of ancestral amino acid sequence from the multiple sequence alignment comprises performing a Bayesian inference ancestral sequence reconstruction (BI-ASR). There are many software packages available that perform ancestral sequence reconstruction. The following table (taken from Joy et al., 2016, PLOS Computational Biology 12(7): DOI:10.1371 / journal.pcbi.1004763) provides a representative sample of the extensive variety of packages that implement methods of ancestral reconstruction with different strengths and features:
[0002] The majority of these software packages are designed for analyzing genetic sequence data. For example, PAML (Yang Z. PAML 4: phylogenetic analysis by maximum likelihood. Molecular biology and evolution. 2007;24(8):1586–91) is a collection of programs for the phylogenetic analysis of DNA and protein sequence alignments by ML. Ancestral reconstruction can be performed using the codeml program. HyPhy, Mesquite, and MEGA are also software packages for the phylogenetic analysis of sequence data, but are designed to be more modular and customizable. HyPhy (Pond SLK, Muse SV. HyPhy: hypothesis testing using phylogenies. Statistical methods in molecular evolution: Springer; 2005. p.125– 81) implements a joint ML method of ancestral sequence reconstruction (Pupko T, Pe I, Shamir R, Graur D. A fast algorithm for joint reconstruction of ancestral amino acid sequences. Molecular Biology and Evolution.2000;17(6):890–6) that can be readily adapted to reconstructing a more generalized range of discrete ancestral character states such as geographic locations by specifying a customized model in its batch language. Mesquite (Maddison W, Maddison D. Mesquite: a modular system for evolutionary analysis. 2.75 ed20011) provides ancestral state reconstruction methods for both discrete and continuous characters using both maximum parsimony and ML methods. It also provides several visualization tools for interpreting the results of ancestral reconstruction. MEGA (Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular biology and evolution. 2007;24(8):1596–9) is a modular system, too, but places greater emphasis on ease-of-use than customization of analyses. As of version 5, MEGA allows the user to reconstruct ancestral states using maximum parsimony, ML, and empirical Bayes methods. The Bayesian analysis of genetic sequences may confer greater robustness to model misspecification. MrBayes (Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics.2001;17(8):754–5) allows inference of ancestral states at ancestral nodes using the full hierarchical Bayesian approach. The PREQUEL program distributed in the PHAST package performs comparative evolutionary genomics using ancestral sequence reconstruction (Hubisz MJ, Pollard KS, Siepel A. PHAST and RPHAST: phylogenetic analysis with space / time models. Briefings in bioinformatics. 2011;12(1):41– 51). SIMMAP stochastically maps mutations on phylogenies (Bollback JP. SIMMAP: stochastic character mapping of discrete traits on phylogenies. BMC bioinformatics. 2006;7(1):88). BayesTraits (Pagel M. The maximum likelihood approach to reconstructing ancestral character states of discrete characters on phylogenies. Systematic biology. 1999;48(3):612–22) analyses discrete or continuous characters in a Bayesian framework to evaluate models of evolution, reconstruct ancestral states, and detect correlated evolution between pairs of traits. Other software packages are more oriented towards the analysis of qualitative and quantitative traits (phenotypes). For example, the ape package (Paradis E. Analysis of phylogenetics and evolution with R. New York: Springer; 2006) in the statistical computing environment R also provides methods for ancestral state reconstruction for both discrete and continuous characters through the ace function, including ML. Note that ace performs reconstruction by computing scaled conditional likelihoods instead of the marginal or joint likelihoods used by other ML-based methods for ancestral reconstruction, which may adversely affect the accuracy of reconstruction at nodes other than the root. Phyrex implements a maximum parsimony-based algorithm to reconstruct ancestral gene expression profiles in addition to a ML method for reconstructing ancestral genetic sequences (by wrapping around the baseml function in PAML) (Rossnes R, Eidhammer I, Liberles DA. Phylogenetic reconstruction of ancestral character states for gene expression and mRNA splicing data. BMC bioinformatics.2005;6(1):127). Several software packages also reconstruct phylogeography. BEAST (Bayesian Evolutionary Analysis by Sampling Trees (Bouckaert R, Heled J, Kühnert D, Vaughan T, Wu C- H, Xie D, et al. BEAST 2: a software platform for Bayesian evolutionary analysis. PLoS Comput Biol.2014;10(4):e1003537)) provides tools for reconstructing ancestral geographic locations from observed sequences annotated with location data using Bayesian MCMC sampling methods. Diversitree (FitzJohn RG. Diversitree: comparative phylogenetic analyses of diversification in R. Methods in Ecology and Evolution.2012;3(6):1084–92) is an R package providing methods for ancestral state reconstruction under Mk2 (a continuous time Markov model of binary character evolution (Pagel M. Detecting Correlated Evolution on Phylogenies—a General- Method for the Comparative-Analysis of Discrete Characters. Proceedings of the Royal Society of London Series B-Biological Sciences. 1994;255(1342):37–45)) and BiSSE models. Lagrange performs analyses on reconstruction of geographic range evolution on phylogenetic trees (Ree RH, Smith SA. Maximum likelihood inference of geographic range evolution by dispersal, local extinction, and cladogenesis. Systematic Biology. 2008;57(1):4–14). Phylomapper (Lemmon AR, Lemmon EM. A likelihood framework for estimating phylogeographic history on a continuous landscape. Systematic Biology. 2008;57(4):544–61) is a statistical framework for estimating historical patterns of gene flow and ancestral geographic locations. RASP (Yu Y, Harris AJ, Blair C, He X. RASP (Reconstruct Ancestral State in Phylogenies): a tool for historical biogeography. Molecular Phylogenetics and Evolution.2015;87:46–9) infers ancestral state using statistical DIVA, Lagrange, Bayes-Lagrange, BayArea, and BBM methods. VIP (Arias JS, Szumik CA, Goloboff PA. Spatial analysis of vicariance: a method for using direct geographical information in historical biogeography. Cladistics. 2011;27(6):617–28) infers historical biogeography by examining disjunct geographic distributions. Genome rearrangements provide valuable information in comparative genomics between species. ANGES (Jones BR, Rajaraman A, Tannier E, Chauve C. ANGES: reconstructing ANcestral GEnomeS maps. Bioinformatics.2012;28(18):2388–90) compares extant-related genomes through ancestral reconstruction of genetic markers. BADGER (Larget B, Kadane JB, Simon DL. A Bayesian approach to the estimation of ancestral genome arrangements. Molecular phylogenetics and evolution. 2005;36(2):214–23) uses a Bayesian approach to examining the history of gene rearrangement. Count (Csűös M. Count: evolutionary analysis of phylogenetic profiles with parsimony and likelihood. Bioinformatics.2010;26(15):1910–2) reconstructs the evolution of the size of gene families. EREM (Affre L, Thompson JD, Debussche M. Genetic structure of continental and island populations of the Mediterranean endemic Cyclamen balearicum (Primulaceae). American Journal of Botany.1997;84(4):437– 51) analyses the gain and loss of genetic features encoded by binary characters. PARANA (Patro R, Sefer E, Malin J, Marçais G, Navlakha S, Kingsford C. Parsimonious reconstruction of network evolution. Algorithms for Molecular Biology. 2012;7(1):1) performs parsimony- based inference of ancestral biological networks that represent gene loss and duplication. There are also several web server-based applications that allow investigators to use ML methods for ancestral reconstruction of different character types without having to install any software. For example, Ancestors (Diallo AB, Makarenkov V, Blanchette M. Ancestors 1.0: a web server for ancestral sequence reconstruction. Bioinformatics. 2010;26(1):130–1) is a web server for ancestral genome reconstruction by the identification and arrangement of syntenic regions. FastML (Ashkenazy H, Penn O, Doron-Faigenboim A, Cohen O, Cannarozzi G, Zomer O, et al. FastML: a web server for probabilistic reconstruction of ancestral sequences. Nucleic acids research.2012;40(W1):W580–W4) is a web server for probabilistic reconstruction of ancestral sequences by ML that uses a gap character model for reconstructing indel variation. MLGO (Hu F, Lin Y, Tang J. MLGO: phylogeny reconstruction and ancestral inference from gene-order data. BMC bioinformatics. 2014;15(1):1) is a web server for ML gene order analysis. Optionally nucleic acid encoding an optimized amino acid sequence includes one or more optimizing codons for optimal expression of the encoded optimized amino acid in an expression system. Codon optimization takes advantage of the degeneracy of the genetic code, and does not alter the amino acid sequence of the encoded polypeptide. Because of degeneracy, one protein can be encoded by many alternative nucleic acid sequences. Codon preference (codon usage bias) differs in each organism, and this can create challenges for expressing recombinant proteins in heterologous expression systems, resulting in low and unreliable expression. Any suitable expression system may be used. Several suitable examples are well known to the skilled person, including expression in a mammalian, yeast, insect, or bacterial cell. Optionally the expression system comprises a mammalian cell. Optionally the expression system comprises a yeast, an insect, or a bacterial cell. Methods of codon-optimization are well known to those of ordinary skill in the art. A codon optimization algorithm may be used to design a codon-optimized nucleotide sequence encoding an amino acid sequence. Such algorithms are aimed at providing codon-optimized sequences which maximise expression of a polypeptide or protein in a desired expression system. Examples of suitable codon optimization algorithms include GeneOptimizer™ algorithm (ThermoFisher), OptimumGene™ algorithm (GenScript), and GeneGPS®(ATUM). Optionally other sequence optimization is included to maximise protein expression in a desired expression system. Such gene optimization takes account of codon usage bias, as well as other sequence-related parameters involved in gene expression, such as transcription, splicing, translation, and mRNA degradation. Examples of such sequence- related parameters are given below (the parameters are classed below as affecting transcriptional efficiency, translational efficiency, or protein refolding, but several of the parameters may influence more than one of t e steps): Transcriptional Efficacy: · GC content · SD sequence · CpG dinucleotides content·TATA boxes · Cryptic splicing sites · Terminal signal · Negative CpG islands · Artificial recombination sites Translational Efficiency: · RNA instability motif (ARE) · Codon usage bias · · Stable free energy of mRNA GC content · Internal chi sites and ribosomal · mRNA secondary structure binding sites · Premature PolyA sites · Repetitive sequences Protein Refolding: · Codon usage bias · Codon-context · Interaction of codon and anti-codon · RNA secondary structures Gene optimization algorithms, such as GeneOptimizer™ and OptimumGene™, take account of several of these parameters. Gene optimization for expression of human proteins in E.coli is discussed by Maertens et al. (Protein Science 2010 Vol.19:1312—1326). Optionally ancestral amino acid sequence is identified from the multiple sequence alignment, and included in an optimized amino acid sequence for use according to the invention. Optionally an optimized amino acid sequence for use according to the invention (or nucleic acid encoding an optimized amino acid sequence) is optimized for antigenicity of the amino acid sequence. Antigenic optimization may include any of the following: (a) deletion or modification of nucleic acid sequence encoding amino acid sequence believed to inhibit production and / or function of anti-pathogen polypeptide antibody (for example, deletion or modification of a mucin-like domain – see Reynard et al., Journal of Virology, 2009, 9596-9601); (b) region swapping to recover one or more potential lost encoded epitopes; (c) site-specific mutation, for example of N-linked glycosylation sites. Typically site- specific mutation is designed to delete N-linked glycosylation sites, although there may be situations where additional sites might be desired to be introduced, for instance to mask epitopes that elicit non-neutralizing antibodies. The ability of glycosylation to sterically block antibody binding to HA and thus provide protection against the host immune response has been demonstrated for influenza viruses. Sun et al. (Journal of Virology, 2013, 87(15):8756-8766) demonstrate that antibodies induced by viruses with a high number of glycosylation sites have a broader neutralizing activity than the antibodies induced by the viruses with fewer glycosylation sites; (d) changes to enhance stability (e.g. disulphide bond formation, reduce degradation of the encoded polypeptide by a serine protease); (e) removal of glycans (improve access for B-cells); (f) insertion of nucleic acid sequence, for example to insert nucleic acid sequence encoding a desired epitope. Antigenic optimization of the outer domain of HIV-1 gp120 is described by Joyce et al. (J Virol.2013 Feb;87(4):2294-306). An example of a suitable method of optimization to provide an optimized amino acid sequence for use according to the invention is as follows: Primary sequences are downloaded, for example, from GenBank (and from any other available sources, such as outbreak data), and are filtered to remove identical sequences, sequences that do not span the protein of interest, and sequences that have a high number of ambiguous nucleotides. A multiple sequence alignment of the filtered sequences is generated (typically using MAFFT), and checked manually to ensure that sequences are in the correct open reading frame. A maximum likelihood phylogeny is generated using IQTREE, with automated model selection, and rooted using one of several methods; an outgroup sequence, midpoint rooting, centre-of-the-tree, or a tree that maximises the association between root-to-tip distance and sampling time. Ancestral sequences are generated using HyPhy assuming a MG94 by F3x4 model of codon substitution, and are checked to ensure that known epitopes have been preserved. A phylogenetic tree with both primary and ancestral sequences is generated using IQTREE to check the placement of the ancestral strains. Ancestral sequences are then modified in a number of ways: deletion of regions (e.g. removal of the mucin-like domain); region swapping (to recover potential lost epitopes); mutation of specific sites (e.g. in the fusion domain of the filoviruses), including editing of N-linked glycosylation sites and introduction of mutations to enhance stability”. Optionally an optimised amino acid sequence is a non-naturally occurring amino acid sequence. Optionally an optimised amino acid sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with amino acid sequence of a corresponding wild-type protein. Optionally an optimised amino acid sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with amino acid sequence of a recited amino acid sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21. Optionally, the one or more subunits of (i) of the vaccine comprise: a) a first subunit which comprises nucleic acid encoding: the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein, and optionally the M1 matrix protein; and b) a second subunit which comprises nucleic acid encoding: the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein. Optionally, the one or more subunits of (i) of the vaccine comprise: a) a first subunit which comprises nucleic acid encoding: the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein, and optionally the M1 matrix protein; and b) a second subunit which comprises nucleic acid encoding: the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein. Optionally, the first subunit comprises a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein, and optionally a second isolated nucleic acid which comprises nucleotide sequence encoding the M1 matrix protein; and the second subunit comprises nucleic acid encoding the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein, wherein the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein are each encoded by different nucleic acid molecules. Optionally, the one or more subunits of (i) of the vaccine comprise a single subunit which comprises nucleic acid encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein, the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 Matrix protein. Optionally, the single subunit comprises: a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein; a second isolated nucleic acid which comprises nucleotide sequence encoding the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, and the N2 neuraminidase protein; and a third isolated nucleic acid which comprises nucleotide sequence encoding the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 matrix protein. Optionally, the one or more further subunits of (ii) of the vaccine comprise: a subunit which comprises nucleic acid encoding the first H5 haemagglutinin protein, the second N1 neuraminidase protein, the M2 matrix protein, the second H5 haemagglutinin protein, and the N6 neuraminidase protein. Optionally, the subunit comprises a first isolated nucleic acid which comprises nucleic acid sequence encoding the first H5 haemagglutinin protein, the second N1 neuraminidase protein, and the M2 matrix protein, and a second isolated nucleic acid which comprises nucleic acid sequence encoding the second H5 haemagglutinin protein, the N6 neuraminidase protein, and the M2 matrix protein. Optionally, the one or more additional subunits of (iii) of the invention comprise: a subunit which comprises nucleic acid encoding the H7 haemagglutinin protein, the N7 neuraminidase protein, the N5 neuraminidase protein, the N9 neuraminidase protein, and the H9 haemagglutinin protein. This subunit is important as it carries mRNA encoding antigens which are potential future pandemic threats. Optionally, the H7 haemagglutinin protein, the N7 neuraminidase protein, the N5 neuraminidase protein, the N9 neuraminidase protein, and the H9 haemagglutinin protein are each encoded by different nucleic acid molecules. According to the invention there is also provided a seasonal influenza vaccine, which comprises one or more subunits comprising nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, and optionally an M1 matrix protein. Such vaccines are advantageous because they provide broad neutralising antibody responses against a broad panel of seasonal influenza. In particular, such vaccines provide broadly neutralising antibody responses against a panel of influenza A viruses including: H1, N1, H3, N2, and H1N1. Such vaccines also provide broadly neutralising immune responses against influenza B viruses B / Yamagata and B / Victoria. Optionally, the one or more subunits comprise: a) a first subunit which comprises nucleic acid encoding: the H1 haemagglutinin protein, the second N1 neuraminidase protein, the M2 matrix protein, and optionally the M1 matrix protein; and b) a second subunit which comprises nucleic acid encoding: the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein. Optionally, the first subunit comprises a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and M2 matrix protein, and optionally a second isolated nucleic acid which comprises nucleotide sequence encoding the M1 matrix protein; and the second subunit comprises nucleic acid encoding the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein, wherein the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein are each encoded by different nucleic acid molecules. Optionally, the one or more subunits comprise a subunit which comprises nucleic acid encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein, the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 matrix protein. Optionally, the subunit comprises: a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein; a second isolated nucleic acid which comprises nucleotide sequence encoding the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein; and a third isolated nucleic acid which comprises nucleotide sequence encoding the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 matrix protein. There is also provided according to the invention a pre-pandemic influenza vaccine which comprises one or more subunits comprising nucleic acid encoding: a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein. Here, reference to “a second N1 neuraminidase protein” in the pre-pandemic influenza vaccine in this embodiment is to distinguish the N1 neuraminidase protein in this embodiment from the first N1 neuraminidase protein referred to elsewhere in the specification (rather than meaning that the second N1 neuraminidase protein present in this embodiment is additional to a first N1 neuraminidase protein). Optionally, the one or more subunits comprise: a subunit comprising a first isolated nucleic acid which comprises nucleic acid sequence encoding the first H5 haemagglutinin protein, the second N1 neuraminidase protein, and the M2 matrix protein, and a second isolated nucleic acid encoding the second H5 haemagglutinin protein, the N6 neuraminidase protein, and the M2 matrix protein, wherein the second isolated nucleic acid is separate from the first isolated nucleic acid. Such vaccines are advantageous because they are effective at eliciting a broadly neutralising immune response against influenza viruses which have the potential to cause a future pandemic. In particular, such vaccines are effective against a panel of influenza H5 viruses, including the following clades and sub-clades: 7.1, 1, 2.2, 2.2.1, 2.3.2.1a, 2.3.4, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, 2.3.4.4c, 2.3.4.4h_2018, 2.3.4.4h_2020. Such vaccines are also effective at inducing a broadly neutralising immune response against influenza N6 and N1 viruses. There is also provided according to the invention an influenza vaccine which comprises one or more subunits comprising nucleic acid encoding an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein. Optionally, the H7 haemagglutinin protein, N7 neuraminidase protein, N5 neuraminidase protein, N9 neuraminidase protein, and H9 haemagglutinin protein are each encoded by different nucleic acid molecules. There is also provided according to the invention an influenza vaccine comprising a subunit which comprises nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, and optionally an M1 matrix protein. Optionally, the subunit comprises a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and M2 matrix protein, and optionally a second isolated nucleic acid which comprises nucleotide sequence encoding the M1 matrix protein. There is also provided according to the invention an influenza vaccine comprising a subunit which comprises nucleic acid encoding: a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, and an IBV neuraminidase protein. Optionally, the first H3 haemagglutinin protein, second H3 haemagglutinin protein, N2 neuraminidase protein, influenza B virus (IBV) haemagglutinin protein, and IBV neuraminidase protein are each encoded by different nucleic acid molecules. The M2 antigen of amino acid SEQ ID NO:3 has been designed to encompass all influenza strains, leveraging its high degree of conservation across the diverse influenza strains and this broad coverage is why the M2 antigen has been incorporated into multiple LNPs. Additionally, as the M2 ion channel is a relatively small protein and thus less inherently immunogenic, expressing it from more than one LNP will result in more protein that is expressed from cells and therefore it will increase its immunogenicity. Moreover, the co-expression with its naturally occurring protein partners, the HA and the NA, increases the likelihood of forming stable protein complexes on the cell membrane surface, which can improve viral neutralization. Specifically, where the M1 protein is included, this particular arrangement could facilitate the formation of virus-like particles, further augmenting the immune responses and enhancing the vaccine’s efficacy. Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and / or the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and / or the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and / or the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and / or the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4). Optionally: the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13). Optionally: the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13). Optionally: the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N9N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally, the first isolated nucleic acid comprises S3_T2_8 (SEQ ID NO:19) amino acid sequence. Optionally, the first isolated nucleic acid comprises S3_T2_12 (SEQ ID NO:20) amino acid sequence, and the second isolated nucleic acid comprises S3_T2_13 (SEQ ID NO:21) amino acid sequence. Optionally: the nucleic acid encoding the H1 haemagglutinin protein comprises T2_HA_3 nucleotide sequence (SEQ ID NO:22); and / or the nucleic acid encoding the first N1 neuraminidase protein comprises T3_NA_3 nucleotide sequence (SEQ ID NO:23); and / or the nucleic acid encoding the M2 matrix protein comprises T2_M2_1 nucleotide sequence (SEQ ID NO:24); and / or where present, the nucleic acid encoding the M1 matrix protein comprises T2_M1_1 nucleotide sequence (SEQ ID NO:25). Optionally: the nucleic acid encoding the H1 haemagglutinin protein comprises T2_HA_3 nucleotide sequence (SEQ ID NO:22); and the nucleic acid encoding the first N1 neuraminidase protein comprises T3_NA_3 nucleotide sequence (SEQ ID NO:23); and the nucleic acid encoding the M2 matrix protein comprises T2_M2_1 nucleotide sequence (SEQ ID NO:24); and where present, the nucleic acid encoding the M1 matrix protein comprises T2_M1_1 nucleotide sequence (SEQ ID NO:25). Optionally: the nucleic acid encoding the first H3 haemagglutinin protein comprises T2_HA_46 nucleotide sequence (SEQ ID NO:26); and / or the nucleic acid encoding the second H3 haemagglutinin protein comprises T2_HA_49 nucleotide sequence (SEQ ID NO:27); and / or the nucleic acid encoding the N2 neuraminidase protein comprises T2_NA_31 nucleotide sequence (SEQ ID NO:28); and / or the nucleic acid encoding the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 nucleotide sequence (SEQ ID NO:29); and / or the nucleic acid encoding the IBV neuraminidase protein comprises T3_NA_5 nucleotide sequence (SEQ ID NO:30). Optionally: the nucleic acid encoding the first H3 haemagglutinin protein comprises T2_HA_46 nucleotide sequence (SEQ ID NO:26); the nucleic acid encoding the second H3 haemagglutinin protein comprises T2_HA_49 nucleotide sequence (SEQ ID NO:27); the nucleic acid encoding the N2 neuraminidase protein comprises T2_NA_31 nucleotide sequence (SEQ ID NO:28); the nucleic acid encoding the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 nucleotide sequence (SEQ ID NO:29); and the nucleic acid encoding the IBV neuraminidase protein comprises T3_NA_5 nucleotide sequence (SEQ ID NO:30). Optionally: the nucleic acid encoding the first H5 haemagglutinin protein comprises T4_HA_2 nucleotide sequence (SEQ ID NO:31); and / or the nucleic acid encoding the second N1 neuraminidase protein comprises T2_NA_3 nucleotide sequence (SEQ ID NO:32); and / or the nucleic acid encoding the M2 matrix protein comprises T2_M2_1 nucleotide sequence (SEQ ID NO:24); and / or the nucleic acid encoding the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:33); and / or the nucleic acid encoding the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:34). Optionally: the nucleic acid encoding the first H5 haemagglutinin protein comprises T4_HA_2 nucleotide sequence (SEQ ID NO:31); the nucleic acid encoding the second N1 neuraminidase protein comprises T2_NA_3 nucleotide sequence (SEQ ID NO:32); the nucleic acid encoding the M2 matrix protein comprises T2_M2_1 nucleotide sequence (SEQ ID NO:24); the nucleic acid encoding the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:33); and the nucleic acid encoding the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:34). Optionally: the nucleic acid encoding the H7 haemagglutinin protein comprises T2_HA_12 nucleotide sequence (SEQ ID NO:35); and / or the nucleic acid encoding the H9 haemagglutinin protein comprises T2_HA_31 nucleotide sequence (SEQ ID NO:36); and / or the nucleic acid encoding the N5 neuraminidase protein comprises T2_NA_11 nucleotide sequence (SEQ ID NO:37); and / or the nucleic acid encoding the N7 neuraminidase protein comprises T2_NA_14 nucleotide sequence (SEQ ID NO:38); and / or the nucleic acid encoding the N9 neuraminidase protein comprises T2_NA_18 nucleotide sequence (SEQ ID NO:39). Optionally: the nucleic acid encoding the H7 haemagglutinin protein comprises T2_HA_12 nucleotide sequence (SEQ ID NO:35); the nucleic acid encoding the H9 haemagglutinin protein comprises T2_HA_31 nucleotide sequence (SEQ ID NO:36); the nucleic acid encoding the N5 neuraminidase protein comprises T2_NA_11 nucleotide sequence (SEQ ID NO:37); the nucleic acid encoding the N7 neuraminidase protein comprises T2_NA_14 nucleotide sequence (SEQ ID NO:38); and the nucleic acid encoding the N9 neuraminidase protein comprises T2_NA_18 nucleotide sequence (SEQ ID NO:39). Optionally, the vaccine comprises a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein, wherein the nucleotide sequence encoding the first isolated nucleic acid comprises S3_T2_8 (SEQ ID NO:40) nucleotide sequence. Optionally, the vaccine comprises a first isolated nucleic acid which comprises nucleic acid sequence encoding the first H5 haemagglutinin protein, the second N1 neuraminidase protein, and the M2 matrix protein, and a second isolated nucleic acid which comprises nucleic acid sequence encoding the second H5 haemagglutinin protein, the N6 neuraminidase protein, and the M2 matrix protein, wherein the nucleotide sequence encoding the first isolated nucleic acid comprises S3_T2_12 (SEQ ID NO:41) nucleotide sequence, and the nucleotide sequence encoding the second isolated nucleic acid comprises S3_T2_13 (SEQ ID NO:42) nucleotide sequence. Optionally, each nucleic acid of the vaccine comprises mRNA. Optionally, each nucleic acid of the vaccine is part of a vector. Optionally, each vector further comprises a promoter operably linked to nucleic acid encoding a protein of that vector. Optionally, where an isolated nucleic acid comprises nucleotide sequence encoding more than one protein, a separate promotor is operably linked to each nucleotide sequence encoding a different protein of that isolated nucleic acid. Optionally, the, or each, promoter is for expression of the protein encoded by the nucleic acid or nucleotide sequence to which it is operably linked in mammalian cells. Optionally, the, or each, promoter is for expression of the protein encoded by the nucleic acid or nucleotide sequence to which it is operably linked in yeast or insect cells. Optionally, each vector is a vaccine vector. Optionally, vaccine vector is a viral vaccine vector, a bacterial vaccine vector, an RNA vaccine vector, an mRNA vaccine vector, or a DNA vaccine vector. Optionally, each subunit comprises a lipid nanoparticle (LNP) or a lipidoid nanoparticle (LiNP) which encapsulates the nucleic acid, or the nucleic acids, of that subunit. Optionally, the vaccine is an mRNA vaccine, wherein the, or each, nucleic acid of each subunit comprises mRNA. Strategies for multigene co-expression include introduction of multiple vectors, use of multiple promoters in a single vector, fusion proteins, proteolytic cleavage sites between genes, internal ribosome entry sites (IRES), and “self-cleaving” 2A peptides. Multicistronic vectors (for example, where the subunits are provided in a string as an isolated nucleic acid) based on IRES nucleotide sequence and self-cleaving 2A peptides are reviewed in Shaimardanova et al. (Pharmaceutics 2019, 11, 580; doi:10.3390 / pharmaceutics11110580). 2A self-cleaving peptides are 18–22 amino-acid-long viral oligopeptides that mediate “cleavage” of polypeptides during translation in eukaryotic cells (Liu et al., Scientific Reports 7, Article number: 2193 (2017)). The designation “2A” refers to a specific region of the viral genome and different viral 2As have generally been named after the virus they were derived from. The first discovered 2A was F2A (foot-and-mouth disease virus), after which E2A (equine rhinitis A virus), P2A (porcine teschovirus-12A), and T2A (thosea asigna virus 2A) were also identified. The mechanism of 2A-mediated “self-cleavage” is ribosome skipping the formation of a glycyl-prolyl peptide bond at the C-terminus of the 2A. A highly conserved sequence GDVEXNPGP is shared by different 2As at the C-terminus, and is essential for the creation of steric hindrance and ribosome skipping. There are three possibilities for a 2A- mediated skipping event: (1) Successful skipping and recommencement of translation results in two “cleaved” proteins: the protein upstream of the 2A is attached to the complete 2A peptide except for the C-terminal proline, and the protein downstream of the 2A is attached to one proline at the N-terminus; (2) Successful skipping but ribosome fall-off and discontinued translation results in only the protein upstream of 2A; (3) Unsuccessful skipping and continued translation resulting in a fusion protein. Overall, 2A peptides lead to relatively high levels of downstream protein expression compared to other strategies for multi-gene co-expression, and they are small in size thus bearing a lower risk of interfering with the function of co-expressed genes. Examples of suitable 2A self-cleaving peptide sequences which may be encoded by nucleic acid between nucleic acid sequences encoding different subunits include: GSGEGRGSLLTCGDVEENPGP (SEQ ID NO:43) GSGATNFSLLKQAGDVEENPGP (SEQ ID NO:44) Messenger RNA (mRNA) vaccines A nucleic acid of a vaccine, a pharmaceutical composition, or a vector of the invention, or a polynucleotide of the invention, may be provided as part of an mRNA vaccine. There is also provided according to the invention an mRNA vaccine which comprises a nucleic acid of a vaccine of the invention, a vector of the invention, a pharmaceutical composition of the invention, or a polynucleotide of the invention, which comprises one or more nucleic acids, wherein the or each nucleic acid comprises an mRNA molecule. Messenger RNA (mRNA) vaccines are a new form of vaccine (recently reviewed in Pardi et al., Nature Reviews Drug Discovery Volume 17, pages 261–279(2018); Wang et al., Molecular Cancer (2021) 20:33: mRNA vaccine: a potential therapeutic strategy). The first mRNA vaccines to be approved for use were BNT162b2 (BioNTech’s vaccine manufactured by Pfizer) and mRNA-1273 (manufactured by Moderna) against SARS-CoV-2 during the COVID-19 pandemic. Since then, mRNA-based vaccines have been developed for seasonal influenza and are currently in clinical trials, such as mRNA-1010, a quadrivalent seasonal influenza vaccine encoding membrane-bound HA surface glycoproteins of four influenza strains (A / H1N1, A / H3N2, B / Victoria, and B / Yamagata). mRNA vaccines have a unique feature of temporarily promoting the expression of antigen (typically days). The expression of the exogenous antigen is controlled by the lifetime of encoding mRNA, which is regulated by cellular degradation pathways. While this transient nature of protein expression requires repeated administration for the treatment of genetic diseases and cancers, it is extremely beneficial for vaccines, where prime or prime-boost vaccination is sufficient to develop highly specific adaptive immunity without any exposure to the contagion. mRNA based vaccines trigger an immune response after the synthetic mRNA which encodes viral antigens transfects human cells. The cytosolic mRNA molecules are then translated by the host’s own cellular machinery into specific viral antigens. These antigens may then be presented on the cell surface where they can be recognised by immune cells, triggering an immune response. The structural elements of a vaccine vector mRNA molecule are similar to those of natural mRNA, comprising a 5’ cap, 5’ untranslated region (UTR), coding region (for example, comprising an open reading frame encoding a polypeptide of the invention), 3’ UTR, and a poly(A) tail. The 5′ UTR (also known as a leader sequence, transcript leader, or leader RNA) is the region of an mRNA that is directly upstream from the initiation codon. This region is important for the regulation of translation of a transcript. In many organisms, the 5′ UTR forms complex secondary structure to regulate translation. The 5′ UTR begins at the transcription start site and ends one nucleotide (nt) before the initiation sequence (usually AUG) of the coding region. In eukaryotes, the length of the 5′ UTR tends to be anywhere from 100 to several thousand nucleotides long. The differing sizes are likely due to the complexity of the eukaryotic regulation which the 5′ UTR holds as well as the larger pre-initiation complex that must form to begin translation. The eukaryotic 5′ UTR contains the Kozak consensus sequence (ACCAUG (initiation codon underlined) (SEQ ID NO:46), which contains the initiation codon AUG. An elongated Kozak sequence: GCCACCAUG (initiation codon underlined) (SEQ ID NO:47) may also be used for mRNA vaccine constructs. The 5′ and 3′ UTR elements flanking the coding sequence profoundly influence the stability and translation of mRNA, both of which are critical concerns for vaccines. These regulatory sequences can be derived from viral or eukaryotic genes and greatly increase the half-life and expression of therapeutic mRNAs. For example, a 5’UTR of an mRNA of the invention may comprise, with an initiation codon of the mRNA, a Kozak consensus sequence, or an elongated Kozak sequence. Optionally a 5’UTR of an mRNA of the invention comprises the following sequence: GGAGACGCCACC (SEQ ID NO:45) immediately upstream of an initiation codon sequence. A 5′ cap structure is required for efficient protein production from mRNA. Various versions of 5′ caps can be added during or after the transcription reaction using a vaccinia virus capping enzyme, or by incorporating synthetic cap or anti-reverse cap analogues (see Pardi et al., supra). Anti-Reverse Cap Analog (ARCA) is a cap analog used during in vitro transcription for the generation of capped transcripts. ARCA is modified in a way that ensures incorporation in the forward orientation only. Anti-Reverse Cap Analog (ARCA) is a modified cap analog in which the 3' OH group (closer to m7G) is replaced with –OCH3: Conventional Cap Analog: R=H, m7G(5’)pppG; ARCA: R=CH3, 3’-0-Me-m7G(5’)pppG Because of this substitution, the RNA polymerase can only initiate transcription with the remaining hydroxyl group thus forcing ARCA incorporation in the forward orientation. As a result, unlike transcripts synthesized with conventional cap analog, 100% of the transcripts synthesized with ARCA at the 5' end are translatable leading to a strong stimulatory effect on translation. The poly(A) tail also plays an important regulatory role in mRNA translation and stability; thus, an optimal length of poly(A) must be added to mRNA either directly from the encoding DNA template or by using poly(A) polymerase (see Pardi et al., supra). An example of a suitable length of poly(A) tail is poly(~A120). The codon usage additionally has an impact on protein translation. Replacing rare codons with frequently used synonymous codons that have abundant cognate tRNA in the cytosol is a common practice to increase protein production from mRNA. Enrichment of G:C content constitutes another form of sequence optimization that has been shown to increase steady- state mRNA levels in vitro and protein expression in vivo (see Pardi et al., supra). Two major types of RNA are currently studied as vaccines: non-replicating mRNA and virally derived, self-amplifying RNA. While both types of vaccines share a common structure in mRNA constructs, self-amplifying RNA vaccines contain additional sequences in the coding region for RNA replication, including RNA-dependent RNA polymerases. A nucleic acid vaccine (for example, a mRNA) of the invention may be formulated in a lipid nanoparticle (LNP). Betacoronavirus vaccine constructs BNT162b2, and mRNA-1273, and influenza vaccine construct mRNA-1010, all comprise a LNP encapsulated mRNA molecule encoding the respective viral antigens. BNT162b2 vaccine construct comprises a lipid nanoparticle (LNP) encapsulated mRNA molecule. The mRNA is encapsulated in 80 nm ionizable cationic lipid nanoparticles. mRNA-1273 vaccine construct is also based on an LNP vector. US Patent No. 10,702,600 B1 (ModernaTX) describes betacoronavirus mRNA vaccines, including suitable LNPs for use in such vaccines. There is also provided according to the invention an mRNA vaccine, which comprises an mRNA vaccine vector (or mRNA vaccine vectors, or a pharmaceutical composition of the invention comprising mRNA vectors) of the invention, encapsulated in a lipid nanoparticle (LNP), or a lipidoid nanoparticle (LiNP). mRNA vaccines have several advantages in comparison with conventional vaccines containing inactivated (or live attenuated) disease-causing organisms. Firstly, mRNA-based vaccines can be rapidly developed due to design flexibility and the ability of the constructs to mimic antigen structure and expression as seen in the course of a natural infection. mRNA vaccines can be developed within days or months based on sequencing information from a target virus, while conventional vaccines often take years and require a deep understanding of the target virus to make the vaccine effective and safe. Secondly, these novel vaccines can be rapidly produced. Due to high yields from in vitro transcription reactions, mRNA production can be rapid, inexpensive and scalable (due to chemical synthesis rather than biological growth of cells or bacteria). Thirdly, vaccine risks are low. mRNA does not contain infectious viral elements or cell debris that pose risks for infection and insertional mutagenesis (as the mRNA is generated synthetically). Anti-vector immunity is also avoided as mRNA is the minimally immunogenic genetic vector, allowing repeated administration of the vaccine. The challenge for effective application of mRNA vaccines lies in cytosolic delivery. mRNA isolates are rapidly degraded by extracellular RNases and cannot penetrate cell membranes to be transcribed in the cytosol. However, efficient in vivo delivery can be achieved by formulating mRNA into carrier molecules, allowing rapid uptake and expression in the cytoplasm. To date, numerous delivery methods have been developed including lipid- , polymer-, or peptide-based delivery, virus-like replicon particle, cationic nanoemulsion, naked mRNAs, and dendritic cell-based delivery (each reviewed in Wang et al., supra). Decationic lipid nanoparticle (LNP) delivery is the most appealing and commonly used mRNA vaccine delivery tool. Exogenous mRNA may be highly immunostimulatory. Single-stranded RNA (ssRNA) molecules are considered a pathogen associated molecular pattern (PAMP), and are recognised by various Toll-like receptors (TLR) which elicit a pro-inflammatory reaction. Although a strong cellular and humoral immune response is desirable in response to vaccination, the innate immune reaction elicited by exogenous mRNA may cause undesirable side-effects in the subject. The U-rich sequence of mRNA is a key element to activate TLR (Wang et al., supra). Additionally, enzymatically synthesised mRNA preparations contain double stranded RNA (dsRNA) contaminants as aberrant products of the in vitro transcription (IVT) process. dsRNA is a potent PAMP, and elicits downstream reactions resulting in the inhibition of translation and the degradation of cellular mRNA and ribosomal RNA (Pardi et al., supra). Thus, the mRNA may suppress antigen expression and thus reduce vaccine efficacy. Studies over the past decade have shown that the immunostimulatory effect of mRNA can be shaped by the purification of IVT mRNA, the introduction of modified nucleosides, complexing the mRNA with various carrier molecules (Pardi et al., supra), adding poly(A) tails or optimising mRNA with GC-rich sequence (Wang et al., supra). Chemical modification of uridine is a common approach to minimise the immunogenicity of foreign mRNA. Incorporation of pseudouridine (ψ) and N1- methylpseudouridine (m1ψ) to IVT mRNA prevents TLR activation and other innate immune sensors, thus reducing pro-inflammatory signalling in response to the exogenous mRNA. Such nucleoside modification also suppresses recognition of dsRNA species (Pardi et al., supra) and can reduce innate immune sensing of exogenous mRNA translation (Hou et al. Nature Reviews Materials, 2021, https: / / doi.org / 10.1038 / s41578-021-00358-0). Other nucleoside chemical modifications include, but are not limited to, 5-methylcytidine (m5C), 5-methyluridine (m5U), N1-methyladenosine (m1A), N6- methyladenosine (m6A), 2- thiouridine (s2U), and 5-methoxyuridine (5moU) (Wang et al., supra). The IVT mRNA molecules used in the mRNA-1273 and BNT162b2 COVID-19 vaccines were prepared by replacing uridine with m1ψ, and their sequences were optimized to encode a stabilized pre- fusion spike protein with two pivotal proline substitutions (Hou et al., supra). However, CureVac’s mRNA vaccine candidate, CVnCoV, uses unmodified nucleosides and relies on a combination of mRNA sequence alterations to allow immune evasion without affecting the expressed protein. Firstly, CVnCoV has a higher GC content (63%) than rival vaccines (BNT162b2 has 56%) and the original SARS-CoV-2 virus itself (37%). Secondly, the vaccine comprises C-rich motifs which bind to poly(C)-binding protein, enhancing both the stability and expression of the mRNA. A further modification of CVnCoV is that it contains a histone stem-loop sequence as well as a poly(A) tail, to enhance the longevity and translation of the mRNA (Hubert, B., 2021. The CureVac Vaccine, and a brief tour through some of the wonders of nature. URL https: / / berthub.eu / articles / posts / curevac-vaccine-and- wonders-of-biology / .(accessed 15.09.21). CureVac and Acuitas Therapeutics delivered erythropoietin (EPO)-encoding mRNA, which has rich GC codons, to pigs with lipid nanoparticles (LNPs). Their results indicated EPO-related responses were elicited without immunogenicity (Wang et al., supra). A nucleic acid of the invention may comprise an mRNA molecule. The or each nucleic acid of a vaccine, pharmaceutical composition, or a vector, of the invention may comprise an mRNA molecule. A vector of the invention may be an mRNA vector. The or each vector of a vaccine or a pharmaceutical composition of the invention may be an mRNA vector. A nucleic acid of the invention, or a nucleic acid of a vaccine, a pharmaceutical composition, or a vector, of the invention, may be provided as part of an mRNA vaccine. There is also provided according to the invention an mRNA vaccine which comprises a vaccine of the invention, a nucleic acid of the invention, a vector of the invention, or a pharmaceutical composition of the invention which comprises one or more nucleic acids, wherein the or each nucleic acid comprises an mRNA molecule. Optionally, each subunit of a vaccine of the invention comprises a lipid nanoparticle (LNP) or a lipidoid nanoparticle (LiNP) which encapsulates the nucleic acid, or the nucleic acids, of that subunit. RNA or mRNA of a polynucleotide of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention may be produced by in vitro transcription (IVT). A polynucleotide of the invention, or a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention may comprise one or more modified nucleosides. The one or more modified nucleosides may be present in DNA or RNA of a polynucleotide of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention. Optionally, at least one chemical modification is selected from pseudouridine, N1- methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2- thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O- methyl uridine. In some embodiments, the chemical modification is in the 5-position of the uracil. In some embodiments, the chemical modification is a N1-methylpseudouridine. In some embodiments, the chemical modification is a N1-ethylpseudouridine. For example, an RNA or an mRNA of a polynucleotide of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention may comprise one or more of the following modified nucleosides: pseudouridine (ψ); N1- methylpseudouridine (m1ψ) 5-methylcytidine (m5C) 5-methyluridine (m5U) N1-methyladenosine (m1A) N6- methyladenosine (m6A) 2-thiouridine (s2U) 5- methoxyuridine (5moU) In some embodiments, 100% of the uracil in the open reading frame have a chemical modification. In some embodiments, a chemical modification is in the 5-position of the uracil. In some embodiments, a chemical modification is a N1-methyl pseudouridine. In some embodiments, 100% of the uracil in the open reading frame have a N1-methyl pseudouridine in the 5-position of the uracil. The polynucleotide or nucleic acid may contain from about 1% to about 100% modified nucleotides (or nucleosides) (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). Any remaining percentage is accounted for by the presence of unmodified A, G, U, or C. Optionally at least 50% of the uridines in the ORF have been modified. Optionally at least 50% of the uridines in the ORF have been modified to m1ψ. Optionally a polynucleotide of the invention or of a vector of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention, comprises an RNA molecule in which the nucleic acid sequence of the polynucleotide or nucleic acid is the same as that recited in the respective SEQ ID, or the complement thereof, but with each ‘U’ replaced by m1ψ. Optionally a polynucleotide of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention, comprises an mRNA molecule in which the nucleic acid sequence of the polynucleotide or nucleic acid is the same as that recited in the respective SEQ ID, or the complement thereof, but with each ‘U’ replaced by m1ψ. Optionally a polynucleotide of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention, comprises an RNA molecule in which the nucleic acid sequence of the polynucleotide or nucleic acid is the same as that recited in the respective SEQ ID, or the complement thereof, but with at least 50% of the ‘U’s replaced by m1ψ. The remaining ‘U’s may all be unmodified, or may comprise unmodified and one or more other modified nucleosides. Optionally a polynucleotide of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention, comprises an mRNA molecule in which the nucleic acid sequence of the polynucleotide or nucleic acid is the same as that recited in the respective SEQ ID, or the complement thereof, but with at least 50% of the ‘U’s replaced by m1ψ. The remaining ‘U’s may all be unmodified, or may comprise unmodified and one or more other modified nucleosides. Optionally a polynucleotide of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention, comprises an RNA molecule in which the nucleic acid sequence of the polynucleotide or nucleic acid is the same as that recited in the respective SEQ ID, or the complement thereof, but with at least 90% of the ‘U’s replaced by m1ψ. The remaining ‘U’s may all be unmodified, or may comprise unmodified and one or more other modified nucleosides. Optionally a polynucleotide of the invention, or of a nucleic acid of a pharmaceutical composition, a vector, or a vaccine, of the invention, comprises an mRNA molecule in which the nucleic acid sequence of the polynucleotide or nucleic acid is the same as that recited in the respective SEQ ID, or the complement thereof, but with at least 90% of the ‘U’s replaced by m1ψ. The remaining ‘U’s may all be unmodified, or may comprise unmodified and one or more other modified nucleosides. mRNA vaccines of the invention may be co-administered with an immunological adjuvant, for example MF59 (Novartis), TriMix, RNActive (CureVac AG), RNAdjuvant (again reviewed in Wang et al., supra). Thus, in preferred embodiments, each vector or vector of a pharmaceutical composition of the invention is an mRNA vaccine vector. Polypeptides Vaccines of the invention may be provided as polypeptide vaccines, comprising multiple influenza antigen polypeptides, optionally multiple designed influenza antigen polypeptides. Again, the polypeptides may be administered as a mixture together (for example, as a pharmaceutical composition comprising the separate polypeptides), or separate polypeptides may be administered simultaneously, or administered sequentially in any order. Accordingly, there is also provided according to the invention an influenza vaccine comprising a plurality of isolated polypeptides, which comprise: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, a first H5 haemagglutinin protein, a second N1 neuraminidase protein, a second H5 haemagglutinin protein, an N6 neuraminidase protein, an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, an H9 haemagglutinin protein, and optionally an M1 matrix protein. According to the invention, there is also provided a seasonal influenza vaccine comprising a plurality of isolated polypeptides, which comprise: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, and optionally an M1 matrix protein. According to the invention, there is also provided a pre-pandemic influenza vaccine comprising a plurality of isolated polypeptides, which comprise: a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein. Again, here, reference to “a second N1 neuraminidase protein” in the pre-pandemic influenza vaccine in this embodiment is to distinguish the N1 neuraminidase protein in this embodiment from the first N1 neuraminidase protein referred to elsewhere in the specification (rather than meaning that the second N1 neuraminidase protein present in this embodiment is additional to a first N1 neuraminidase protein). According to the invention, there is also provided an influenza vaccine comprising a plurality of isolated polypeptides, which comprise: an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein. According to the invention, there is also provided an influenza vaccine comprising a plurality of isolated polypeptides, which comprise: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, and optionally an M1 matrix protein. According to the invention, there is also provided an influenza vaccine comprising a plurality of isolated polypeptides, which comprise: a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, and an IBV neuraminidase protein. Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present, the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present, the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4). Optionally: the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3). Optionally: the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3). Optionally, the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and / or the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and / or the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9). Optionally each protein (for example, comprising an optimised amino acid sequence) of a vaccine of the invention, or each protein (for example, comprising an optimised amino acid sequence) encoded by nucleic acid of a vaccine of the invention comprises an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a corresponding wild-type protein. For example: an H1 haemagglutinin protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type H1 haemagglutinin protein; a first N1 neuraminidase protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type N1 neuraminidase protein; an M2 matrix protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type M2 matrix protein; a first H3 haemagglutinin protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type H3 haemagglutinin protein; a second H3 haemagglutinin protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type H3 haemagglutinin protein; an N2 neuraminidase protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type N2 neuraminidase protein; an influenza B virus (IBV) haemagglutinin protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type influenza B virus (IBV) haemagglutinin protein; an IBV neuraminidase protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type IBV neuraminidase protein; an M1 matrix protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type M1 matrix protein; a first H5 haemagglutinin protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type H5 haemagglutinin protein; a second N1 neuraminidase protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type N1 neuraminidase protein; an M2 matrix protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type M2 matrix protein; a second H5 haemagglutinin protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type H5 haemagglutinin protein; an N6 neuraminidase protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type N6 neuraminidase protein; an H7 haemagglutinin protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type H7 haemagglutinin protein; an N7 neuraminidase protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type N7 neuraminidase protein; an N5 neuraminidase protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type N5 neuraminidase protein; an N9 neuraminidase protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type N9 neuraminidase protein; an H9 haemagglutinin protein of a vaccine of the invention, or encoded by a nucleic acid of a vaccine of the invention, may comprise an amino acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% amino acid identity over its entire length with an amino acid sequence of a wild-type H9 haemagglutinin protein. According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:13 (T2_NA_12). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:4 (T2_M1_1). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:5 (T2_HA_46). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:6 (T2_HA_49). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:7 (T2_NA_31). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:8 (T3_HA_10). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:9 (T3_NA_5). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:14 (T2_HA_12). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:15 (T2_HA_31). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:16 (T2_NA_11). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:17 (T2_NA_14). According to the invention there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:18 (T2_NA_18). According to the invention there is provided an isolated polypeptide which comprises the amino acid sequence of SEQ ID NO:1 (T2_HA_3), SEQ ID NO:2 (T3_NA_3), and SEQ ID NO:3 (T2_M2_1). Optionally, the isolated polypeptide comprises the amino acid sequence of SEQ ID NO:19 (S3_T2_8). According to the invention there is provided an isolated polypeptide which comprises the amino acid sequence of SEQ ID NO:12 (T2_HA_9), SEQ ID NO:13 (T2_NA_12), and SEQ ID NO:3 (T2_M2_1). Optionally, the isolated polypeptide comprises the amino acid sequence of SEQ ID NO:21 (S3_T2_13). According to the invention there is also provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:48 (FLU_S3_T1_1). Polynucleotides According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:13 (T2_NA_12), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:4 (T2_M1_1), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:5 (T2_HA_46), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:6 (T2_HA_49), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:7 (T2_NA_31), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:8 (T3_HA_10), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:9 (T3_NA_5), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:14 (T2_HA_12), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:15 (T2_HA_31), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:16 (T2_NA_11), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:17 (T2_NA_14), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:18 (T2_NA_18), or the complement thereof. According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:19 (S3_T2_8). According to the invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:21 (S3_T2_13). Optionally, the nucleotide sequence encoding SEQ ID NO:13 (T2_NA_12) comprises the nucleotide sequence of SEQ ID NO:34. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:4 (T2_M1_1) comprises the nucleotide sequence of SEQ ID NO:25. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:5 (T2_HA_46) comprises the nucleotide sequence of SEQ ID NO:26. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:6 (T2_HA_49) comprises the nucleotide sequence of SEQ ID NO:27. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:7 (T2_NA_31) comprises the nucleotide sequence of SEQ ID NO:28. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:8 (T3_HA_10) comprises the nucleotide sequence of SEQ ID NO:29. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:9 (T3_NA_5) comprises the nucleotide sequence of SEQ ID NO:30. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:14 (T2_HA_12) comprises the nucleotide sequence of SEQ ID NO:35. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:15 (T2_HA_31) comprises the nucleotide sequence of SEQ ID NO:36. Optionally, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:16 (T2_NA_11) comprises the nucleotide sequence of SEQ ID NO:37. Optionally, the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:17 (T2_NA_14) comprises the nucleotide sequence of SEQ ID NO:38. Optionally, the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:18 (T2_NA_18) comprises the nucleotide sequence of SEQ ID NO:39. Optionally, the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:19 (S3_T2_8) comprises the nucleotide sequence of SEQ ID NO:22 (T2_HA_3), SEQ ID NO:23 (T3_NA_3), and SEQ ID NO:24 (T2_M2_1). Optionally, the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:19 (S3_T2_8) comprises the nucleotide sequence of SEQ ID NO:40. Optionally, the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:21 (S3_T2_13) comprises the nucleotide sequence of SEQ ID NO:33 (T2_HA_9), SEQ ID NO:34 (T2_NA_12), and SEQ ID NO:24 (T2_M2_1). Optionally, the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:21 (S3_T2_13) comprises the nucleotide sequence of SEQ ID NO:42. According to the invention there is also provided an isolated polynucleotide comprising a nucleic acid sequence encoding an amino acid sequence of an influenza haemagglutinin (HA) protein, an amino acid sequence of a first self-cleaving peptide, an amino acid sequence of an influenza neuraminidase (NA) protein, an amino acid sequence of a second self- cleaving polypeptide, and an amino acid sequence of an influenza matrix 2 (M2) protein, or the complement thereof. Optionally, the proteins and peptides are encoded in the order recited. Optionally, the influenza HA, NA, and M2 amino acid sequences are sequences of an influenza A virus. Optionally, the influenza HA, NA, and M2 amino acid sequences are wild-type amino acid sequences. Optionally, the wild-type amino acid sequences are sequences of an influenza A / England / 2009 strain. Optionally, the first and second self-cleaving peptides are 2A self-cleaving peptides. Optionally, the first 2A self-cleaving peptide comprises an amino acid sequence of SEQ ID NO:43. Optionally, the second 2A self-cleaving peptide comprises an amino acid sequence of SEQ ID NO:44. Optionally, the polynucleotide comprises a nucleic acid sequence encoding an amino acid sequence of SEQ ID NO:48 (FLU_S3_T1_1), or the complement thereof. Optionally, the polynucleotide comprises a nucleotide sequence of SEQ ID NO:50, or the complement thereof. According to the invention there is also provided a pseudotyped virus particle comprising the HA, NA, and M2 proteins encoded by a polynucleotide of the invention. Vectors According to the invention there is also provided a vector comprising a polynucleotide according to the invention. Optionally, the vector further comprises a promoter operably linked to the nucleotide sequence encoding the amino acid sequence. Optionally, the vector comprises more than one nucleotide sequence encoding an amino acid sequence, wherein a separate promoter is operably linked to each different nucleotide sequence of the vector. Optionally, the, or each promoter is for expression of the encoded amino acid sequence in mammalian cells. Optionally, the, or each promoter is for expression of the encoded amino acid in yeast or insect cells. Optionally, the vector is a vaccine vector. Optionally, the vaccine vector is a viral vaccine vector, a bacterial vaccine vector, an RNA vaccine vector, an mRNA vaccine vector, or a DNA vaccine vector. Optionally, the vector is a pEVAC vector. Optionally, the vector comprises a nucleic acid sequence of SEQ ID NO:49, or the complement thereof. There is also provided according to the invention an isolated cell comprising or transfected with a vector of the invention. Pharmaceutical compositions A vaccine of the invention may be provided as a pharmaceutical composition for administration to a mammal, preferably a human. Multiple subunits may be administered as a mixture together, as a pharmaceutical composition comprising the subunits. For example, the subunit(s) of (i), and / or (ii), and / or (iii) of the vaccine of the invention can be administered as a mixture. Component (i) may optionally be provided together with a pharmaceutically acceptable carrier, excipient, or diluent, and / or component (ii) may optionally be provided together with a pharmaceutically acceptable carrier, excipient, or diluent, and / or component (iii) may optionally be provided together with a pharmaceutically acceptable carrier, excipient, or diluent. The ratio of the amount of a pharmaceutical composition comprising the subunit(s) of (i), (ii), and (iii) can be varied, for example in order to cope with the needs of a patient sub-population to be treated, or the needs of the single patient, which can be due, for example, to the particular disease, age, sex, or body weight of the patient. There is also provided according to the invention a pharmaceutical composition comprising a vaccine according to the invention, and pharmaceutically acceptable carrier, excipient, or diluent. There is also provided according to the invention a pharmaceutical composition comprising an isolated polypeptide according to the invention, and pharmaceutically acceptable carrier, excipient, or diluent. Optionally, the pharmaceutical composition further comprises a polypeptide comprising an amino acid sequence of an influenza M1 antigen. There is also provided according to the invention a pharmaceutical composition comprising an isolated polynucleotide according to the invention, and a pharmaceutically acceptable carrier, excipient, or diluent. Optionally, the pharmaceutical composition, further comprises a polynucleotide comprising a nucleotide sequence encoding an influenza M1 antigen. There is also provided according to the invention a pharmaceutical composition comprising a vector according to the invention, and a pharmaceutically acceptable carrier, excipient, or diluent. Optionally, the pharmaceutical composition further comprises a vector comprising nucleic acid sequence encoding an influenza M1 antigen. Optionally, the pharmaceutical composition according to the invention further comprises an adjuvant for enhancing an immune response in a subject to a polypeptide, or to a polypeptide encoded by a nucleotide, of the composition. Optionally, the influenza M1 antigen comprises an amino acid sequence of SEQ ID NO:51. Optionally, the nucleotide sequence encoding the influenza M1 antigen comprises a nucleic acid sequence of SEQ ID NO:52. Combined Preparations There is also provided according to the invention a combined preparation comprising (i) a polynucleotide according to the invention, and (ii) a polynucleotide comprising a nucleotide sequence encoding an influenza M1 antigen. There is also provided according to the invention a combined preparation comprising (i) the HA, NA, and M2 proteins encoded by a polynucleotide according to the invention, and (ii) a polypeptide comprising an amino acid sequence of an influenza M1 antigen. There is also provided according to the invention a combined preparation comprising (i) a vector according to the invention, and (ii) a vector comprising nucleic acid sequence encoding an influenza M1 antigen. Optionally, the influenza M1 antigen comprises an amino acid sequence of SEQ ID NO:51. Optionally, the nucleic sequence encoding the influenza M1 antigen comprises a nucleic acid sequence of SEQ ID NO:52. The term "combined preparation" as used herein refers to a "kit of parts" in the sense that the combination components (i) and (ii) as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination components (i) and (ii). The components can be administered simultaneously or one after the other. If the components are administered one after the other, preferably the time interval between administration is chosen such that the therapeutic effect of the combined use of the components is greater than the effect which would be obtained by use of only any one of the combination components (i) and (ii). The components of the combined preparation may be present in one combined unit dosage form, or as a first unit dosage form of component (i) and a separate, second unit dosage form of component (ii). The ratio of the total amounts of the combination component (i) to the combination component (ii) to be administered in the combined preparation can be varied, for example in order to cope with the needs of a patient sub-population to be treated, or the needs of the single patient, which can be due, for example, to the particular disease, age, sex, or body weight of the patient. Preferably, there is at least one beneficial effect, for example an enhancing of the effect of component (i), or component (ii), or a mutual enhancing of the effect of the combination components (i) and (ii), for example a more than additive effect, additional advantageous effects, fewer side effects, less toxicity, or a combined therapeutic effect compared with an effective dosage of one or both of the combination components (i) and (ii), and very preferably a synergism of the combination components (i) and (ii). A combined preparation of the invention may be provided as a pharmaceutical combined preparation for administration to a mammal, preferably a human. Component (i) may optionally be provided together with a pharmaceutically acceptable carrier, excipient, or diluent, and / or component (ii) may optionally be provided together with a pharmaceutically acceptable carrier, excipient, or diluent. String sequences Nucleic acid vaccines discussed above provide isolated nucleic acid comprising nucleotide sequence encoding one or more influenza antigens, optionally one or more designed influenza antigens. Where the isolated nucleic acid comprises nucleotide sequence encoding more than one influenza antigen, optionally more than one designed influenza antigen, the nucleic acid is pieced together in a string. For example, there is provided: a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein; a second isolated nucleic acid which comprises nucleotide sequence encoding the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, and the N2 neuraminidase protein; and a third isolated nucleic acid which comprises nucleotide sequence encoding the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 matrix protein. Optionally, the isolated nucleic acid comprises nucleic acid sequence encoding more than one wild type influenza antigen. For example, there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding an amino acid sequence of an influenza haemagglutinin (HA) protein, an amino acid sequence of a first self-cleaving peptide, an amino acid sequence of an influenza neuraminidase (NA) protein, an amino acid sequence of a second self-cleaving polypeptide, and an amino acid sequence of an influenza matrix 2 (M2) protein, or the complement thereof. The advantage of using a string arrangement for some of the antigens lies primarily in its manufacturing efficiency. From a production pint of view, a string is more cost-effective because you only need to generate a single mRNA rather than multiple individual mRNAs, significantly reducing resources-related costs. Additionally, like said above, with the antigens being expressed within the same cell, the likelihood of forming VLPs increases; and this is important because this mimics the natural infection process, potentially leading to a more robust and effective immune response. From the perspective of meeting the target product profile (TPP), the arrangement of the antigens within these four modular lipid nanoparticles (LNPs) has been specifically designed to achieve these objectives. Co-administration of vaccine subunits A vaccine of the invention may be provided for administration to a mammal, preferably a human. In particular, the subunit(s) of (i), (ii), and (iii) of a vaccine of the invention may be administered as a mixture, co-administered as separate components simultaneously, or sequentially. The subunit(s) of (i) may optionally be provided together with a pharmaceutically acceptable carrier, excipient, or diluent, and / or the subunit(s) of (ii) may optionally be provided together with a pharmaceutically acceptable carrier, excipient, or diluent, and / or the subunit(s) of (iii) may optionally be provided together with a pharmaceutically acceptable carrier, excipient, or diluent. Methods of treatment and medical uses There is also provided according to the invention a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention, for use as a medicament. There is also provided according to the invention a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention, for use in the prevention, treatment, or amelioration of an influenza infection. There is also provided according to the invention use of a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention, in the manufacture of a medicament for the prevention, treatment, or amelioration of an influenza infection. There is also provided according to the invention a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention, for use in inducing an immune response to an influenza virus in a subject. There is also provided according to the invention use of a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention, in the manufacture of a medicament for inducing an immune response to an influenza virus in a subject. There is also provided according to the invention a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention, for use in immunising a subject against an influenza virus. There is also provided according to the invention use of a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention, in the manufacture of a medicament for immunising a subject against an influenza virus. There is also provided according to the invention a method of inducing an immune response to an influenza virus in a subject, which comprises administering to the subject an effective amount of a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention. There is also provided according to the invention a method of immunising a subject against an influenza virus, which comprises administering to the subject an effective amount of a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention. Optionally, the method comprises administering to the subject an effective amount of a multiple subunit vaccine according to the invention, wherein the subunits of the vaccine are co-administered as a mixture. Optionally, the method comprises administering to the subject an effective amount of a multiple subunit vaccine according to the invention, wherein the subunits of the vaccine are co-administered simultaneously as separate subunits, or sequentially. Optionally, the method comprises administering a vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention, as part of a prime boost regimen. According to the invention there is also provided a method of inducing an immune response to an influenza virus in a subject, which comprises administering to the subject an effective amount of a combined preparation of the invention. According to the invention there is also provided a method of immunising a subject against an influenza virus, which comprises administering to the subject an effective amount of a combined preparation of the invention. Optionally, the vaccine is a universal influenza vaccine (comprising nucleic acid of subunits (i), (ii), and (iii) of the multiple subunit influenza vaccine, or polypeptides encoded by the nucleic acid subunits (i), (ii), and (iii)). Optionally the influenza virus is an influenza A or an influenza B virus. Optionally the influenza virus is a seasonal influenza virus. Optionally the seasonal influenza virus is an H1 influenza virus. Optionally the seasonal influenza virus is an N1 influenza virus. Optionally the seasonal influenza virus is an H1N1 influenza virus. Optionally the seasonal influenza virus is an H3 influenza virus. Optionally the seasonal influenza virus is an N2 influenza virus. Optionally seasonal the influenza virus is an H3N2 influenza virus. Optionally the seasonal influenza virus is an influenza B / Yamagata virus. Optionally the seasonal influenza virus is an influenza B / Victoria virus. Optionally the influenza virus is a potential future pandemic influenza virus. Optionally the potential future pandemic influenza virus is an H5 influenza virus. Optionally the H5 influenza virus is a clade 7.1, 1, 2.2, 2.2.1, 2.3.2.1a, 2.3.4, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, 2.3.4.4c, 2.3.4.4h_2018, or a 2.3.4.4h_2020, H5 influenza virus. Optionally the potential future pandemic influenza virus is an N6 influenza virus. Optionally the potential future pandemic influenza virus is an N1 influenza virus. Optionally the potential future pandemic influenza virus is an N5 influenza virus. Optionally the potential future pandemic influenza virus is an H9 influenza virus. Optionally the potential future pandemic influenza virus is an H7 influenza virus. Optionally the potential future pandemic the influenza virus is an N7 influenza virus. Optionally the potential future pandemic the influenza virus is an N9 influenza virus. Optionally, the vaccine is a seasonal influenza vaccine (comprising nucleic acid of subunit (i) of the multiple subunit influenza vaccine, or polypeptides encoded by the nucleic acid of subunit (i)). Optionally the influenza virus is an influenza A or an influenza B virus. Optionally the influenza virus is a seasonal influenza virus. Optionally the seasonal influenza virus is an H1 influenza virus. Optionally the seasonal influenza virus is an N1 influenza virus. Optionally the seasonal influenza virus is an H1N1 influenza virus. Optionally the seasonal influenza virus is an H3 influenza virus. Optionally the seasonal influenza virus is an N2 influenza virus. Optionally seasonal the influenza virus is an H3N2 influenza virus. Optionally the seasonal influenza virus is an influenza B / Yamagata virus. Optionally the seasonal influenza virus is an influenza B / Victoria virus. Optionally, the vaccine is a pre-pandemic influenza vaccine (comprising nucleic acid of subunit (ii) of the multiple subunit influenza vaccine, or polypeptides encoded by the nucleic acid of subunit (ii)). Optionally the influenza virus is an influenza A virus. Optionally the influenza A virus is a potential future pandemic influenza virus. Optionally the potential future pandemic influenza virus is an H5 influenza virus. Optionally the H5 influenza virus is a clade 7.1, 1, 2.2, 2.2.1, 2.3.2.1a, 2.3.4, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, 2.3.4.4c, 2.3.4.4h_2018, or a 2.3.4.4h_2020, H5 influenza virus. Optionally the H5 influenza virus is a clade 2.3.4.4b avian influenza virus. Optionally the H5 influenza virus is a clade 2.3.4.4b human influenza virus. Optionally the potential future pandemic influenza virus is an N6 influenza virus. Optionally the potential future pandemic influenza virus is an N1 influenza virus. An “effective amount” of a vaccine of the invention, an mRNA vaccine of the invention, a pharmaceutical composition of the invention, a vector of the invention, a polynucleotide of the invention, or a polypeptide of the invention (the “therapy”) may be an amount that results in a reduction of at least one pathological parameter associated with influenza infection. For example, in some embodiments, an effective amount of the therapy is an amount that is effective to achieve a reduction of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, in the pathological parameter, compared to the expected reduction in the parameter associated with the influenza infection without the therapy. For example, the pathological parameter may be viral load (for example, the number of influenza viral particles or amount of viral DNA per ml of blood). Suitable methods of measuring viral load are well-known to those of ordinary skill in the art. For example, methods of measuring viral load by ELISA are compared in Goldschmidt et al. (Clinical and Diagnostic Laboratory Immunology, July 1998, p. 513–518). Methods of measuring viral load using different commercial assays for detection of viral nucleic acid are compared in Holguin et al. (Eur J Clin Microbiol Infect Dis. 1999 Apr;18(4):256-9) and Swenson et al. (J. Clin. Microbiol. 2014 Feb; 52(2): 517–523). A list of FDA-approved screening assays to measure viral loads can be found on the FDA website at: www.fda.gov / BiologicsBloodVaccines / BloodBloodProducts / ApprovedProducts / LicensedPro ductsBLAs / BloodDonorScreening / InfectiousDisease / ucm080466.htm. Alternatively, an “effective amount” of the therapy may be an amount that results in an increase in a clinical benefit associated with prevention or treatment of infection. For example, in some embodiments, an “effective amount” of the therapy is an amount that is effective to achieve an increase of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, in the clinical benefit, compared to the expected clinical benefit without the therapy. Alternatively, an “effective amount” of the therapy may be an amount that results in a change of at least one beneficial parameter relating to prevention or treatment of infection. For example, in some embodiments, an “effective amount” of the therapy is an amount that is effective to achieve a change of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, in the parameter, compared to the expected change in the parameter relating to treatment without the therapy. For example, the parameter may be an increase in the number of circulating antigen-specific CD8+ T cells, or a reduction in the number of antigen-specific regulatory T cells, or an increase in the number of activated T cells, in particular activated CD8+ T cells, a reduction in the number of exhausted antigen-specific CD8+ T cells, or an increase in the number of circulating functional (i.e. non-exhausted) antigen-specific CD8+ T cells. The term “prevention” is used herein to refer to an immune response that is elicited in a subject that is sufficient to inhibit (i.e. reduce), neutralise or prevent influenza virus infection, and / or progress of influenza virus infection in the subject, or to inhibit (i.e. reduce), neutralise or prevent any symptom of influenza virus infection in the subject. The term “treatment” is used herein to refer to at least a reduction of one or more, or all, of the symptoms associated with an influenza infection in the subject. Treatment also includes situations where the influenza infection, or at least one or more, or all, of the symptoms associated therewith, are completely stopped from happening, such that the subject no longer suffers from the influenza infection, or at least from one or more, or all, of the symptoms associated with the influenza infection. The term “amelioration” is used herein to refer to a reduction of one or more of the symptoms associated with an influenza infection in the subject. Broadly neutralising immune responses Vaccines, polynucleotides, polypeptides, pharmaceutical compositions, and vectors of the invention may induce a broadly neutralising immune response to protect against disease caused by influenza viruses. The term “broadly neutralising immune response” is used herein to mean an immune response elicited in a subject that is sufficient to inhibit (i.e. reduce), neutralise or prevent infection, and / or progress of infection, of multiple viruses of the influenza family of viruses, particularly across the H5 subtype. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one type of influenza, for example influenza type A and influenza type B. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one type of subtype of influenza A, for example influenza H1, influenza H5, influenza H3, influenza H7, influenza H9, influenza N1, influenza N2, influenza N5, influenza N7, and / or N9. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one strain of influenza A, for example more than one strain of swine H1, seasonal H1 (for example, H1N1), and / or pandemic H1. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one strain of influenza A, for example more than one strain of non-human N1 and more than one strain of human N1. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one type of clade of influenza A H5 (for example, clades 2.1.3.2, 2.3.2.1a, 2.3.2.1c, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, and / or 2.3.4.4c). For example, there may be an immune response (including, for example, a neutralising antibody response) to different influenza types, subtypes, clades, or sub-clades. For example, there may be neutralising antibody protection across viruses of the H5Nx subtype of influenza A, especially clade 2.3.4.4 including 2.3.4.4b. For example, there may be an immune response (including, for example, a neutralising antibody response) to different H5 clades (including, for example, any, or any combination, of the following H5 clades: 2.1.3.2, 2.3.2.1a, 2.3.2.1c, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, and / or 2.3.4.4c). There may also be an immune response against influenza subtypes N6 and N1, including H1N1. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one type of influenza, for example influenza type A and influenza type B. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one type of subtype of influenza A, for example influenza H1, influenza H3, influenza N1 and influenza N2. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one strain of influenza A, for example more than one strain of swine H1, seasonal H1 (for example, H1N1), and / or pandemic H1. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one strain of influenza A, for example more than one strain of influenza N1. For example, there may be an immune response (including, for example, a neutralising antibody response) to different influenza types and / or subtypes and / or strain. For example, there may be neutralising antibody protection across viruses of H1 subtype, including sw / EN / 2009, sw / BJ / 18, MI / 45 / 15, WIS / 588 / 19, GM / 1536 / 19, VIC / 2454 / 19, ME-VO / 21, SYD / 5 / 21, NL / 5 / 22, SC / 1 / 1918, CA / 07 / 2009. There may also be neutralising antibody protection across different viruses of influenza N1 subtype. Particularly, there may be neutralising antibody protection across viruses of H1N1 subtype, including sw / EN / 09, sw / GX / 13, sw / NC / 20, MI / 45 / 15, BR / 2 / 18, GN / 1536 / 19, VIC / 2454 / 19, SYD / 5 / 21, NL / 5 / 22, CA / 07 / 09. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one type of subtype of influenza A, for example influenza N1 or influenza N6. Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of more than one type of clade of influenza A H5 (for example, clades 1, 2.1.3.2, 2.2, 2.2.1, 2.3.2.1a, 2.3.4, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, 2.3.4.4c, 2.3.4.4h_2018, 2.3.4.4h_2020, and 7.1). Optionally a broadly neutralising immune response is sufficient to inhibit, neutralise or prevent infection, and / or progress of infection, of most or all different H5 clades and subclades. For example, there may be an immune response (including, for example, a neutralising antibody response) to different influenza subtypes, clades, or sub-clades. For example, there may be neutralising antibody protection across viruses of the H5Nx subtype of influenza A, especially clade 2.3.4.4 including 2.3.4.4b. For example, there may be an immune response (including, for example, a neutralising antibody response) to different H5 clades (including, for example, any, or any combination, of the following H5 clades: 1, 2.1.3.2, 2.2, 2.2.1, 2.3.2.1a, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, 2.3.4.4c, 2.3.4.4h, and 7.1. Importantly, there may be an immune response (including, for example, a neutralising antibody response) to influenza subtypes N6 and N1. The immune response may be humoral and / or a cellular immune response. A cellular immune response is a response of a cell of the immune system, such as a B-cell, T-cell, macrophage or polymorphonucleocyte, to a stimulus such as an antigen or vaccine. An immune response can include any cell of the body involved in a host defence response, including for example, an epithelial cell that secretes an interferon or a cytokine. An immune response includes, but is not limited to, an innate immune response or inflammation. Optionally a vaccine, an mRNA vaccine, a polynucleotide, polypeptide, pharmaceutical composition of the invention induces a protective immune response. A protective immune response refers to an immune response that protects a subject from infection or disease (i.e. prevents infection or prevents the development of disease associated with infection). Methods of measuring immune responses are well known in the art and include, for example, measuring proliferation and / or activity of lymphocytes (such as B or T cells), secretion of cytokines or chemokines, inflammation, or antibody production. Optionally a vaccine, an mRNA vaccine, a polynucleotide, polypeptide, pharmaceutical composition of the invention is able to induce the production of antibodies and / or a T-cell response in a human or non-human animal to which the polypeptide has been administered (either as a polypeptide or, for example, expressed from an administered nucleic acid expression vector). Administration Any suitable route of administration may be used. Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, parenteral, intravenous, subcutaneous, vaginal, rectal, intranasal, inhalation or oral. Parenteral administration, such as subcutaneous, intravenous or intramuscular administration, is generally achieved by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Administration can be systemic or local. Routes for systemic administration in general include, for example, transdermal, oral, parenteral routes, including subcutaneous, intravenous, intramuscular, intraarterial, intradermal and intraperitoneal injections and / or intranasal administration routes. Routes for local administration in general include, for example, topical administration routes but also intradermal, transdermal, subcutaneous, or intramuscular injections or intralesional, intracranial, intrapulmonal, intracardial, and sublingual injections. For lipid nanoparticles, the administration route is often determined by the properties of the nanoparticles and therapeutic indications. After intravenous (i.v.) administration, many lipid nanoparticles can accumulate in the liver. The liver is inherently capable of producing secretory proteins and, therefore, i.v. administration of lipid nanoparticle–mRNA formulations can be used to produce proteins that are missing in inherited metabolic and haematological disorders, or to produce antibodies to neutralize pathogens or target cancer cells. These applications require protein translation without stimulation of an immune response, which may limit the efficiency of repeated dosing. However, i.v. administration may also lead to accumulation of lipid nanoparticles in multiple lymph nodes throughout the body, which could increase immune responses to mRNA vaccines. For example, i.v. administration of mRNA vaccines has been shown to induce stronger antigen-specific cytotoxic T cell responses compared with local injection. Broad distribution of mRNA vaccines in the body may lead to systemic adverse effects, and, thus, it may be necessary to develop lipid nanoparticles that allow targeted delivery of mRNA vaccines into tissues with abundant immune cells. Topical administration routes have also been explored for mRNA therapeutics. Topical administration aims at achieving local therapeutic effects; for example, local injection of lipid nanoparticle–mRNA formulations enables supplementation of therapeutic proteins in specific tissues, such as heart, eyes and brain. Moreover, lipid nanoparticle–mRNA formulations can be administered into the lungs by inhalation. Local administration of mRNA vaccines can also prime systemic responses; for example, intradermal (i.d.), intramuscular (i.m.) and subcutaneous (s.c.) injection are commonly used for vaccination, because resident and recruited antigen-presenting cells (APCs) are present in the skin and muscle, which can internalize and process mRNA-encoded antigens. Furthermore, the vascular and lymphatic vessels of these tissues help APCs and mRNA vaccines to centre the draining lymph nodes to stimulate T cell immunity. Indeed, both i.m. and i.d. administration of lipid nanoparticle–mRNA vaccines produce robust immune responses at a well-tolerated dose in human trials. Vaccination can also be done by intranasal administration, because APCs in the peripheral lymph nodes can readily endocytose administered lipid nanoparticle–mRNA formulations. mRNA vaccines delivered by lipid nanoparticle may comprise cationic lipids and / or ionisable lipids, see review: Lipid Nanoparticles for mRNA Delivery, Nature Reviews Materials, 61078- 1094, 2021. In addition to cationic or ionizable lipids, lipid nanoparticle–mRNA formulations typically contain other lipid components, such as phospholipids (for example, phosphatidylcholine and phosphatidylethanolamine), cholesterol or polyethylene glycol (PEG)-functionalized lipids (PEG-lipids). These lipids can improve nanoparticle properties, such as particle stability, delivery efficacy, tolerability and biodistribution. Compositions of the invention may be administered in any suitable manner, such as with pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Some of the compositions may potentially be administered as a pharmaceutically acceptable acid- or base-addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines. Administration can be accomplished by single or multiple doses. The dose administered to a subject in the context of the present disclosure should be sufficient to induce a beneficial therapeutic response in a subject over time, or to inhibit or prevent infection. The dose required will vary from subject to subject depending on the species, age, weight and general condition of the subject, the severity of the infection being treated, the particular composition being used and its mode of administration. An appropriate dose can be determined by one of ordinary skill in the art using only routine experimentation. Multiple doses may be administered to a subject with a period of several days or a few weeks between consecutive administrations. For example, a polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention may be administered as a first dose, and a second dose of the polypeptide, polynucleotide, vector, or pharmaceutical composition administered 3 to 12 weeks after the first dose. For example, a polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention may be administered at weeks 0, 4, and 12. Optionally a vaccine, mRNA vaccine, polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention may be administered as a booster. Optionally a vaccine, mRNA vaccine, polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention may be administered as part of a heterologous prime-boost protocol. For example, a first vaccine may be administered as a priming step, followed by vaccination using a vaccine, polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention vaccine as a booster. The first vaccine is a different vaccine to the booster. The first vaccine may be any suitable influenza vaccine. The booster may be administered at any suitable time after the first vaccine, for example within 4 weeks, 6 weeks, 8 weeks, 12 weeks, 6 months or more after the first vaccine. Optionally two or more doses of the first vaccine may be administered before administration of the booster. The booster may be administered at any suitable time after the second, third (or further) dose of the first vaccine, for example after 6 weeks, 8 weeks, 12 weeks, 6 months or more after the second (or further) dose of the first vaccine. Each dose of the first vaccine may be separate by at least 2 weeks, 3 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, 6 months or a year. Optionally a vaccine, polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention is administered intramuscularly. Optionally a vaccine, a polypeptide, polynucleotide, vector, pharmaceutical composition of the invention is administered intramuscularly, intradermally, or subcutaneously, for example by needle or by gene gun, or electroporation, or by needle-free injection (for example, using a needle-free injection device of Pharmajet). Optionally a vaccine, mRNA vaccine, polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention is administered by needle-free injection. Optionally a vaccine, mRNA vaccine, polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention is administered intradermally by needle-free injection. Optionally a vaccine of the invention is administered intradermally by needle-free injection. Optionally a vector of the invention is administered intradermally by needle-free injection. Optionally a pharmaceutical composition of the invention comprising a vector or a polynucleotide is administered intradermally by needle-free injection. Optionally a polynucleotide of the invention is administered intradermally by needle-free injection. A vaccine of the invention may comprise any polypeptide, polynucleotide, vector, or pharmaceutical composition of the invention. The present disclosure includes methods comprising administering an RNA vaccine, an mRNA vaccine, or a DNA vaccine to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. The RNA or DNA is typically formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the RNA may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts. The effective amount of the RNA or DNA, as provided herein, may be as low as 20 pg, administered for example as a single dose or as two 10 pg doses. In some embodiments, the effective amount is a total dose of 20 μg-300 μg or 25 μg-300 μg. For example, the effective amount may be a total dose of 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg. In some embodiments, the effective amount is a total dose of 20 μg. In some embodiments, the effective amount is a total dose of 25 pg. In some embodiments, the effective amount is a total dose of 50 μg. In some embodiments, the effective amount is a total dose of 75 μg. In some embodiments, the effective amount is a total dose of 100 μg. In some embodiments, the effective amount is a total dose of 150 μg. In some embodiments, the effective amount is a total dose of 200 μg. In some embodiments, the effective amount is a total dose of 250 pg. In some embodiments, the effective amount is a total dose of 300 μg. The RNA or DNA described herein can be formulated into a dosage form described herein, such as an intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous). Optionally, an RNA (e.g., mRNA) or DNA vaccine is formulated in an effective amount to produce an antigen specific immune response in a subject. In some embodiments, the effective amount is a total dose of 25 μg to 1000 μg, or 50 μg to 1000 μg. In some embodiments, the effective amount is a total dose of 100 μg. In some embodiments, the effective amount is a dose of 25 μg administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 100 μg administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 400 μg administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 500 μg administered to the subject a total of two times. Optionally, an effective amount is a dose of 100-300 μg administered to the subject at least two times. Optionally, an effective amount is a dose of 300-500 μg administered to the subject at least two times. Optionally, an effective amount is a dose of 500-700 μg administered to the subject at least two times. Optionally, an effective amount is a dose of 700-900 μg administered to the subject at least two times. Optionally, an effective amount is a dose of 900-1100 μg administered to the subject at least two times. Optionally, an effective amount is a dose of 1100-1300 μg administered to the subject at least two times. Optionally a first dose is administered to the subject at least two weeks before a second dose. Optionally a first dose is administered to the subject at least three weeks before a second dose. Optionally a dosage of between 10 μg / kg and 400 μg / kg of the nucleic acid vaccine is administered to the subject. In some embodiments the dosage of the RNA or DNA polynucleotide (or nucleic acid) is 1-5 μg, 5-10 μg, 10-15 μg, 15-20 μg, 10-25 μg, 20-25 μg, 20-50 μg, 30-50 μg, 40-50 μg, 40-60 μg, 60-80 μg, 60-100 μg, 50-100 μg, 80-120 μg, 40-120 μg, 40-150 μg, 50-150 μg, 50-200 μg, 80-200 μg, 100-200 μg, 120-250 μg, 150-250 μg, 180- 280 μg, 200-300 μg, 50-300 μg, 80-300 μg, 100-300 μg, 40-300 μg, 50-350 μg, 100-350 μg, 200-350 μg, 300-350 μg, 320-400 μg, 40-380 μg, 40-100 μg, 100-400 μg, 200-400 μg, or 300-400 μg per dose. In some embodiments, the nucleic acid vaccine is administered to the subject by intradermal or intramuscular injection. In some embodiments, the nucleic acid vaccine is administered to the subject on day zero. In some embodiments, a second dose of the nucleic acid vaccine is administered to the subject on day twenty one. In a strategy called “prime-boost”, a first dose of a vaccine (for example, a nucleic acid vaccine, or mRNA vaccine) is given as a priming step, followed by a second dose as a booster. The prime-boost strategy aims to provide a stronger overall immune response. The boost may be administered at least a day, at least a week, or at least two, three, four, five, six, or seven weeks, or at least two, three, four, five, or six months after the primer. For example, the boost may be administered at least three weeks after the primer. Pharmaceutically acceptable carriers, excipients, diluents Pharmaceutical compositions of the invention may be administered in any suitable manner, such as with pharmaceutically acceptable carriers, excipients or diluents. Pharmaceutically acceptable carriers, excipients or diluents are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers, excipients or diluents include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. An aqueous carrier, excipient, or diluent for parenteral administration (for example intradermal, or subcutaneous administration) may comprise phosphate-buffered saline (PBS). Some of the compositions may potentially be administered as a pharmaceutically acceptable acid- or base-addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines. Pharmaceutically acceptable carriers, excipients, or diluents include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and composition can be sterile, and the formulation suits the mode of administration. The composition can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. A pharmaceutically acceptable composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate. Any of the common pharmaceutical carriers, such as sterile saline solution or sesame oil, can be used. The medium can also contain conventional pharmaceutical adjunct materials such as, for example, pharmaceutically acceptable salts to adjust the osmotic pressure, buffers, preservatives and the like. Other media that can be used with the compositions and methods provided herein are normal saline and sesame oil. In some embodiments, the compositions comprise a pharmaceutically acceptable carrier and / or an adjuvant. For example, the adjuvant can be alum, Freund’s complete adjuvant, a biological adjuvant or immunostimulatory oligonucleotides (such as CpG oligonucleotides). Pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15thEdition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions, such as one or more influenza vaccines, and additional pharmaceutical agents. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate. A pharmaceutical composition of the invention may further comprise an adjuvant for enhancing an immune response in a subject to a polypeptide, or to a polypeptide encoded by a nucleotide, of the composition. Conservative Amino acid Substitutions A polypeptide of the invention, or for use in the invention, may include one or more conservative amino acid substitutions. Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original polypeptide, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Examples of conservative substitutions are shown below: Original Residue Conservative Substitutions Ala Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp His Asn; Gln Ile Leu, Val Leu Ile; Val Lys Arg; Gln; Met Leu; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, serine or threonine, is substituted for (or by) a hydrophobic residue, for example, leucine, isoleucine, phenylalanine, valine or alanine; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysine, arginine, or histidine, is substituted for (or by) an electronegative residue, for example, glutamate or aspartate; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine. Sequence identity The similarity between amino acid or nucleic acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or variants of a given gene or protein will possess a relatively high degree of sequence identity when aligned using standard methods. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A.85:2444, 1988; Higgins and Sharp, Gene 73:237-244, 1988; Higgins and Sharp, CABIOS 5:151-153, 1989; Corpet et al., Nucleic Acids’ Research 16:10881-10890, 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A.85:2444, 1988. Altschul et al., Nature Genet.6:119-129, 1994. The NCBI Basic Local Alignment Search Tool (BLASTTM) (Altschul et al., J. Mol. Biol. 215:403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Sequence identity between nucleic acid sequences, or between amino acid sequences, can be determined by comparing an alignment of the sequences. When an equivalent position in the compared sequences is occupied by the same nucleotide, or amino acid, then the molecules are identical at that position. Scoring an alignment as a percentage of identity is a function of the number of identical nucleotides or amino acids at positions shared by the compared sequences. When comparing sequences, optimal alignments may require gaps to be introduced into one or more of the sequences to take into consideration possible insertions and deletions in the sequences. Sequence comparison methods may employ gap penalties so that, for the same number of identical molecules in sequences being compared, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. Calculation of maximum percent identity involves the production of an optimal alignment, taking into consideration gap penalties. Suitable computer programs for carrying out sequence comparisons are widely available in the commercial and public sector. Examples include MatGat (Campanella et al., 2003, BMC Bioinformatics 4: 29; program available from http: / / bitincka.com / ledion / matgat), Gap (Needleman & Wunsch, 1970, J. Mol. Biol. 48: 443-453), FASTA (Altschul et al., 1990, J. Mol. Biol. 215: 403-410; program available from http: / / www.ebi.ac.uk / fasta), Clustal W 2.0 and X 2.0 (Larkin et al., 2007, Bioinformatics 23: 2947-2948; program available from http: / / www.ebi.ac.uk / tools / clustalw2) and EMBOSS Pairwise Alignment Algorithms (Needleman & Wunsch, 1970, supra; Kruskal, 1983, In: Time warps, string edits and macromolecules: the theory and practice of sequence comparison, Sankoff & Kruskal (eds), pp 1-44, Addison Wesley; programs available from http: / / www.ebi.ac.uk / tools / emboss / align). All programs may be run using default parameters. For example, sequence comparisons may be undertaken using the “needle” method of the EMBOSS Pairwise Alignment Algorithms, which determines an optimum alignment (including gaps) of two sequences when considered over their entire length and provides a percentage identity score. Default parameters for amino acid sequence comparisons (“Protein Molecule” option) may be Gap Extend penalty: 0.5, Gap Open penalty: 10.0, Matrix: Blosum 62. The sequence comparison may be performed over the full length of the reference sequence.The terms “polynucleotide”, “nucleotide”, and “nucleic acid” are used interchangeably herein. Embodiments of the invention are now described, by way of example only, with reference to the accompanying drawings, in which: Figure 1. Composition of the DIOSynVax first generation pan-H5Nx Pre-Pandemic VAP; Figure 2. Serum neutralising titers as shown by IC50 (IC50 is half-maximal inhibitory serum dilution) of sera (Terminal bleed, day 63) from mice vaccinated with H5Nx vaccine candidates and whole inactivated vaccine (WIV) controls. IC50 dilution values were determined via pseudotype neutralisation assay (pMN). Dashed line indicates an IC50 value of 1000, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group); Figure 3. “Heatmap" representation of immune responses of DIOS H5Nx vaccine antigens and WIV controls against H5 PV from indicated clades on Day 63. Legend indicates total mouse responders with an IC50 greater than 102for each group; Figure 4. Neuraminidase Inhibition (NAI) titers against N6 PV as shown by IC50 of sera (day 63) from mice vaccinated with DIOSynVax antigens (Table 1). IC50 dilution values were determined via pseudotype enzyme-linked lectin assay (pELLA). Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay; Figure 5. NAI titers against N1 PV as shown by IC50 of sera (day 63) from mice vaccinated with DIOSynVax antigens (Table 1). IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay; Figure 6. “Heatmap" representation of immune responses of DIOS H5Nx vaccine antigens and WIV controls against N1 PV on Day 63. Legend indicates number of mice and IC50 response threshold (200) for each color grouping; Figure 7. Antigenic composition of the DIOSynVax first generation Seasonal Influenza Vaccine Antigen Payload (VAP). H1, N1, and M2 are in “string” format and is denoted as S3_T2_8. Components are distributed into two Lipid Nanoparticles (LNP), LNP-1, and LNP- 2; Figure 8. Composition of the DIOSynVax first generation Universal-type Influenza VAP. The VAP contains the antigens from the Seasonal VAP (Figure 7), the pan-H5Nx pre-pandemic VAP (Figure 1), and additionally, LNP-4; Figure 9. Phylogenetic tree representation of DIOSynVax H1 subtype pseudotype virus (PV) repertoire. The various PV used represent relevant swine, and pandemic H1 strains, and the most recent seasonal strains; Figure 10. Neutralising titers against H1 as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests; Figure 11. Heatmap representation of immune responses of DIOSynVax VAPs and controls against H1 PV from Figure 10. Legend indicates number of mice (n) and their corresponding IC50 response. Figure 12. Neuraminidase inhibition (NAI) titers against N1 PV as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests; Figure 13. DIOSynVax VAPs induce high level of binding antibodies as tested via Enzyme- Linked Immunosorbent Assay (ELISA) against A / Darwin / 9 / 2021 (H3) on day 42. Values are shown as Area under the curve (AUC) of serum dilutions versus Absorbance at 450 nm. (n=12 / group) ****=p<0.0001 via One way ANOVA and Sidak’s multiple comparison’s test; Figure 14. NAI titers against N2 PV as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests; Figure 15. NAI titers against various N6 PV as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax Universal + M1. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group); Figure 16. NAI titers against various N5, N7, and N9 PV as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax Universal + M1. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group); Figure 17. Neutralising titers against IBV HA from both B / Yamagata (B / Yam) and B / Victoria (B / Vic) lineages as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group). nd=p>0.05 via Mann Whitney Multiple Discovery tests; Figure 18. NAI titers against B / NA PV from B / Yamagata and B / Victoria lineages as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests; Figure 19. Neutralising titers of DIOSynVax Universal + M1 (day 42) against representative PV strains from various IAV H5 clades. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. H5 PV strains are further subdivided into “interclade” H5 (all clades presented excluding 2.3.4.4) and clade 2.3.4.4. Plot shows the median and interquartile range of all samples (n=6 / group); Figure 20. Neutralising titers of DIOSynVax Universal + M1 (day 42) against representative H7 PV. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group); Figure 21. Neutralising titers of DIOSynVax Universal + M1 (day 42) against representative H9 PV. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group).; Figure 22. Summary of serum Hemagglutinin neutralisation titers (IC50) of QIV, DIOSynVax Seasonal + M1, and Universal + M1 at day 42; Figure 23. Summary of serum Neuraminidase inhibition titers (IC50) of QIV, DIOSynVax Seasonal + M1, and Universal + M1 at day 42. Responses from both DIOSynVax vaccines are markedly greater than that for QIV; Figure 24. Mouse challenge with A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) [GM / 19]. Study schedule of mice vaccinated with VAPs as stated in Table 3; Figure 25. Neutralising titers against the challenge virus A / Guangdong- Maonan / SWL1536 / 2019 (H1) as shown by IC50 of sera from mice vaccinated with DIOSynVax VAPs, QIV, and vehicle (Table 3) on day 42. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=12 / group). ns=p>0.05 via Kruskal Wallis Multiple comparison tests; Figure 26. Monitoring of neutralising titers against the challenge virus A / Guangdong- Maonan / SWL1536 / 2019 (H1) as shown by IC50 of sera from mice vaccinated with VAPs as described in Table 3 on day 21 and day 42. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=12 / group); Figure 27. Hemagglutination inhibition (HAI) titers of sera from mice vaccinated with VAPs as described in Table 3 on day 42 against the challenge virus A / Guangdong- Maonan / SWL1536 / 2019 (H1N1). HAI titers are expressed as the highest dilution of serum that inhibited hemagglutination completely. Dashed line indicates a HAI titer of 40, the accepted threshold for a seroprotective response in this assay. Plot shows the median and interquartile range of all samples (n=12 / group). *=p<0.05 via Kruskal Wallis Multiple comparison tests; Figure 28. Neuraminidase inhibition titers against the most recent seasonal N1 PV as shown by IC50 of sera from mice vaccinated with DIOSynVax VAPs, QIV, and vehicle (Table 3) pre- challenge on day 42. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=12 / group). ns=p>0.05 via Kruskal Wallis Multiple comparison tests; Figure 29. Protective efficacy of DIOSynVax VAPs in a lethal mouse challenge model of seasonal H1N1, A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) (GM / 19); Figure 30. Recovered viral titers as indicated by 50% Tissue Culture Infectious Dose (TCID50 per mL) of lung tissue. Plot shows the median and interquartile range of all samples (n=4 / group). ns=p>0.05 via Kruskal Wallis Multiple comparison tests; Figure 31. Histology scores for lung sections from mice immunised with VAPs (Table 3) obtained 3 days post-infection with GM / 19; Figure 32. Representative histological lung sections from mice immunised with VAPs (Table 3) 3 days post-infection with GM / 19. Scale bar = 100 μm; Figure 33. Study schedule of ferrets vaccinated with VAPs as stated in Table 4; Figure 34. Neutralising titers against H1 as shown by IC50 of sera (day 42) from ferrets vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 4). IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests; Figure 35. Heatmap representation of immune responses of DIOSynVax VAPs and controls against H1 PV panel from Figure 34. Legend indicates number of ferrets (n) and their corresponding IC50 response; Figure 36. Monitoring of hemagglutination inhibition (HI) titers of sera from ferrets on day 42 against the challenge virus A / Guangdong-Maonan / SWL1536 / 2019 (H1N1). HI titers are expressed as the highest dilution of serum that inhibited hemagglutination completely. Dashed line indicates a HI titer of 40, the accepted threshold for a seroprotective response in this assay. Figure 37. DIOSynVax VAPs induce high level of binding antibodies as tested via Enzyme- Linked Immunosorbent Assay (ELISA) against A / Darwin / 9 / 2021 (H3) on day 42. Values are shown as Area under the curve (AUC) of serum dilutions versus Absorbance at 450 nm. ****=p<0.0001 via One way ANOVA and Dunnett’s multiple comparison’s test; Figure 38. Neutralising titers against IBV HA from both B / Yamagata and B / Victoria lineages as shown by IC50 of sera (day 42) from vaccinated ferrets (Table 4). IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group). nd=p>0.05 via Mann Whitney Multiple Discovery tests; Figure 39. Hemagglutination inhibition (HI) titers of sera from ferrets as immunised in Table 4 on day 42 against pertinent H1 viruses and IBV candidate vaccine viruses. Dashed line indicates a HI titer of 40, the accepted threshold for a seroprotective response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group). *=p<0.05 via Mann Whitney Multiple comparison tests; Figure 40. Neutralising titers of DIOSynVax Universal (day 42) against representative PV strains from various IAV H5 clades. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group); Figure 41. Neutralising titers of DIOSynVax Universal (day 42) against representative H7 PV. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group); Figure 42. Neutralising titers of DIOSynVax Universal (day 42) against representative H9 PV. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group); Figure 43. Hemagglutination inhibition (HI) titers of sera from DIOS Universal and vehicle- vaccinated ferrets on day 42 against H5, H7, and H9 candidate vaccine viruses. Plot shows the median and interquartile range of all samples (n=5 / group); Figure 44. Neuraminidase inhibition (NAI) titers against N1 PV as shown by IC50 of sera (day 42) from ferrets vaccinated as stated in Table 2. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests; Figure 45. Neuraminidase inhibition (NAI) titers against N2, B / NA from B / Yamagata and B / Victoria lineages, N5, N7, and N9 PV as shown by IC50 of sera (day 42) from ferrets vaccinated as stated in Table 4. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests; Figure 46. Summary of serum Hemagglutinin neutralisation titers (IC50) of QIV, DIOSynVax Seasonal, and Universal at day 42; Figure 47. Summary of serum Neuraminidase inhibition titers (IC50) of QIV, DIOSynVax Seasonal, and Universal at day 42; Figure 48. Ferret serum samples were assessed at appointed days for presence of nucleoprotein (NP) by an Influenza A virus nucleoprotein (NP) competition ELISA (IDvet). Plot shows median and interquartile range of all samples (n=5 / group). *=p<0.05 via Kruskal Wallis Multiple Comparisons tests; Figure 49. Weight loss monitoring of DIOSynVax VAPs in a non-lethal ferret challenge model of seasonal H1N1, A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) (GM / 19). Solid line shows weight loss of 20%, the appointed severity end-point of the study; Figure 50. Clinical signs of infection in ferrets; Figure 51. Summary of clinical scoring for infection in ferrets as presented in Figure 50; Figure 52. Viral RNA load in ferrets nasal washes. Plot shows the median and interquartile range of all samples (n=5 / group). *p<0.05 via One way ANOVA and Kruskal Wallis multiple comparisons test; Figure 53. Curves of shedding of viral RNA (Figure 52) were plotted and Area Under the Curve (AUC) calculated. Greater AUC shows a higher peak and longer period of infection. Plot shows median and interquartile range of all animals (n=5 ferrets / group). *p<0.05 via Kruskal Wallis multiple comparisons test; Figure 54. Transmission electron microscopy image of the supernatant obtained from HEK cell (A.) transfected with 2µg of DNA plasmid expressing FLU_S3_T1_1 and supernatant collected 8hrs post transfection, (B.) co-transfection with 1µg each of DNA plasmids expressing FLU_S3_T1_1 andFLU_T1_M1_1, (C.) co-transfection with 1µg each of DNA plasmids expressing FLU_S3_T1_1 andFLU_T1_M1_1, and supernatant collected 8hrs post transfection (D.) co-transfection with 1.5µg each of DNA plasmids expressing FLU_S3_T1_1 andFLU_T1_M1_1, (E.) co-transfection with 1.5µg each of DNA plasmids expressing FLU_S3_T1_1 andFLU_T1_M1_1, and supernatant collected 8hrs post transfection, and (F) Supernatant from un-transfected HEK cells. VLPs were observed only in panel (E) and have been highlighted by red arrows; Figure 55 shows neutralisation data in mice (n=6) (A) and chickens (n=10) (B-D) vaccinated with DIOS-H5Nx. Values are calculated as fold dilution of sera that resulted in 50% neutralisation of virus via pMN (A-B), 50% inhibition of neuraminidase activity via pELLA (C), and HAI titers against relevant H5 viruses (D); Figure 56a shows a study schedule of ferrets vaccinated with indicated constructs as stated in Table 5 of Example 6, Figure 56b shows results of a neutralisation assay with ferrets vaccinated with either Pre-pandemic H5Nx vaccine (also referred to as pan-H5Nx vaccine) or WIV2.3.4.4bagainst Influenza A / H5 pseudotype virus strains representing the most relevant A / H5 clades; Figure 57a shows hemagglutination inhibition (HI) titres of sera taken from ferrets on day 42, following the immunisation schedule of Figure 56a and using vaccines described in Table 5 against a clade 2.3.4.4b H5, representative of the challenge virus, and a clade 1 H5; Figure 57b shows neuraminidase inhibition titres against multi-species N1 (from left to right: swine, mink, mute swan, human, and harbour seal) and N6 (yellow-billed teal, human) PV as shown by IC50 of sera from ferrets vaccinated with pre-pandemic H5Nx vaccine and vehicle, pre- challenge on day 42; Figure 58 shows the results of an ELISpot assay, displayed as spot forming units per million cells to measure antigen-specific T cells in ferret pBMCs on Day 42 of vaccine schedule of Figure 56a. The ferrets were vaccinated with Pre-pandemic H5Nx vaccine, WIV2.3.4.4b (control vaccine), and vehicle; Figure 59 shows protective efficacy of Pre-pandemic H5Nx vaccine in a lethal ferret challenge model of clade 2.3.4.4b H5N1, A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1). Figure 59a shows % survival of the vaccine groups tested; Figure 59b shows the proportion of ferrets alive at day 14 (end of the challenge window) for the vaccines tested; and Figure 60 shows clinical signs of an infection in the study ferrets vaccinated with the vaccines tested. Figure 60a shows clinical score given to ferrets parameters such as i) Alertness, ii) Breathing, iii) Ocular and Nasal discharge, and iv) Appetite were observed, with a Clinical Score of 0 given to ferrets with no symptoms, and 4 to ferrets with severe symptoms resulting in culling (indicated by X). Figure 60b shows a summary of clinical scoring in ferrets as presented in Figure 60a.
[0003] Sequence Listing Table SEQ ID NO Description 1 T2_HA_3 amino acid sequence (also referred to as FLU_T2_HA_3_I3 in other patent applications) 2 T3_NA_3 amino acid sequence 3 T2_M2_1 amino acid sequence 4 T2_M1_1 amino acid sequence 5 T2_HA_46 amino acid sequence 6 T2_HA_49 amino acid sequence 7 T2_NA_31 amino acid sequence 8 T3_HA_10 amino acid sequence 9 T3_NA_5 amino acid sequence 10 T4_HA_2 amino acid sequence 11 T2_NA_3 amino acid sequence 12 T2_HA_9 amino acid sequence (also referred to as T2_HA_1 in other patent applications) 13 T2_NA_12 amino acid sequence 14 T2_HA_12 (H7) amino acid sequence 15 T2_HA_31 (H9) amino acid sequence 16 T2_NA_11 (N5) amino acid sequence 17 T2_NA_14 (N7) amino acid sequence 18 T2_NA_18 (N9) amino acid sequence 19 S3_T2_8 (T2_HA_3 + T3_NA_3 + T2_M2_1) amino acid sequence 20 S3_T2_12 (T4_HA_2 + T2_NA_3 + T2_M2_1) amino acid sequence 21 S3_T2_13 (T2_HA_9 + T2_NA_12 + T2_M2_1) amino acid sequence 22 nucleotide sequence encoding T2_HA_3 amino acid sequence 23 nucleotide sequence encoding T3_NA_3 amino acid sequence 24 nucleotide sequence encoding T2_M2_1 amino acid sequence 25 nucleotide sequence encoding T2_M1_1 amino acid sequence 26 nucleotide sequence encoding T2_HA_46 amino acid sequence 27 nucleotide sequence encoding T2_HA_49 amino acid sequence 28 nucleotide sequence encoding T2_NA_31 amino acid sequence 29 nucleotide sequence encoding T3_HA_10 amino acid sequence 30 nucleotide sequence encoding T3_NA_5 amino acid sequence 31 nucleotide sequence encoding T4_HA_2 amino acid sequence 32 nucleotide sequence encoding T2_NA_3 amino acid sequence 33 nucleotide sequence encoding T2_HA_9 amino acid sequence (also referred to as T2_HA_1 in other patent applications) 34 nucleotide sequence encoding T2_NA_12 amino acid sequence 35 nucleotide sequence encoding T2_HA_12 (H7) amino acid sequence 36 nucleotide sequence encoding T2_HA_31 (H9) amino acid sequence 37 nucleotide sequence encoding T2_NA_11 (N5) amino acid sequence 38 nucleotide sequence encoding T2_NA_14 (N7) amino acid sequence 39 nucleotide sequence encoding T2_NA_18 (N9) amino acid sequence 40 S3_T2_8 (T2_HA_3 + T3_NA_3 + T2_M2_1) nucleotide sequence 41 S3_T2_12 (T4_HA_2 + T2_NA_3 + T2_M2_1) nucleotide sequence 42 S3_T2_13 (T2_HA_9 + T2_NA_12 + T2_M2_1) nucleotide sequence 43 2A self-cleaving peptide sequence GSGEGRGSLLTCGDVEENPGP 44 2A self-cleaving peptide sequence GSGATNFSLLKQAGDVEENPGP 45 5’-UTR sequence of an mRNA of the invention (Min UTR C) 46 Kozak consensus sequence 47 Elongated Kozak sequence 48 FLU_S3_T1_1 amino acid sequence 49 pEVAC_FLU_S3_T1_1 50 FLU_S3_T1_1 nucleic acid sequence 51 FLU_T1_M1_1 amino acid sequence 52 FLU_T1_M1_1 nucleic acid sequence AACCCCAACCAGAAGATCATCACCATCGGCAGCATCTGCATGGTCGTGGGCATCATCAGCCTGATCCTGCAGAT CGGCAACATCATCTCCATCTGGGTGTCCCACAGCATCCAGACCGGCAACCAGAATCACCCCGAGACATGCAACC AGTCCATCATCACCTACGAGAACAACACCTGGGTCAACCAGACCTACGTGAACATCAGCAACACCAACTTCGTG GCCGAGCAGGACGTGACATCTGTGGTGCTGGCCGGCAATAGCTCTCTGTGTCCTATCTCTGGCTGGGCCATCTA CAGCAAGGACAACGGCATCCGGATCGGCTCTAAGGGCGACGTGTTCGTGATCAGAGAGCCCTTCATCAGCTGCA GCCACCTGGAATGCCGGACATTCTTTCTGACCCAAGGCGCCCTGCTGAACGACAAGCACAGCAATGGCACCGTG AAGGACAGAAGCCCCTACAGAACCCTGATGAGCTGCCCTGTGGGAGAAGCCCCATCTCCTTACAACAGCAGATT CGAGTCCGTGGCTTGGAGCGCCTCTGCCTGTCACGATGGAATGAGCTGGCTGACAATCGGCATCAGCGGCCCTG ATTCTGGCGCTGTGGCTGTGCTGAAGTACAACGGAATCATCACCGACACCATCAAGAGCTGGCGGAACAACATC CTGCGGACCCAAGAGTCCGAGTGCGCCTGTATCAATGGCAGCTGCTTCACCATCATGACAGACGGCCCATCTGA TGGCCAGGCCAGCTACAAGATCTTCAAGATCGAGAAGGGCAAAGTGGTCAAGAGCGTGGAACTGAACGCCCCTA ACTACCACTACGAGGAATGCAGCTGCTACCCCGACGCCGGCAAAGTGATGTGCGTGTGCAGAGACAATTGGCAC GGCAGCAACAGACCTTGGGTGTCCTTCGACCAGAACCTGGAATACCAGATCGGCTATATCTGCAGCGGCGTGTT CGGCGACAACCCCAGACCTAATGATGGCACCGGATCTTGCGGCCCTGTGTCTAGCAATGGCGCCAATGGCGTGA AGGGCTTCAGCTTCAGATACGGCAACGGCGTGTGGATCGGCCGGACAAAGAGCATCAGCAGCAGAAAGGGCTTC GAGATGATCTGGGACCCCAACGGCTGGACCGAGACAGATAGCAGCTTCAGCGTGAAGCAGGACATCGTGGGAAT CAACGAGTGGAGCGGCTACAGCGGCAGCTTTGTGCAGCACCCTGAACTGACAGGCCTGGACTGCATGAGGCCCT GCTTTTGGGTCGAGCTGATCAGAGGCAGACCCGAGGAAAACACCATCTGGACCAGCGGCTCCAGCATCAGCTTT TGCGGCGTGAACAGCGATACCGTCGGCTGGTCTTGGCCTGATGGTGCCGAGCTGCCTTTCACCATCGACAAGCG GAGAAAGAGAGGCTCTGGCGAAGGCAGAGGCAGCCTGCTTACATGTGGCGACGTGGAAGAGAACCCCGGACCTA TGAGCCTGCTGACCGAGGTGGAAACCCCTACCAGAAATGGCTGGGAGTGCAGATGCAGCGACAGCAGCGATCCT CTGGTTATCGCCGCCAGCATCATCGGCATCCTGCACCTGATCCTGTGGATCCTGGACCGGCTGTTCTTCAAGTG CATCTACCGGCGGCTGAAGTACGGCCTGAAGAGAGGCCCTTCTACAGAGGGCGTGCCCGAGAGCATGCGGGAAG AGTACAGACAGAAACAGCAGAGCGCCGTGGACGTGGACGATGGCCACTTCGTGAACATCGAGCTGGAA >S3_T2_12 (T4_HA_2 + T2_NA_3 + T2_M2_1) (SEQ ID NO:41) Nucleic acid sequence: TACCTCTTCTAGCACGACGACGACCGGTAGCACTCGGACCAGTTTAGGCTGGTCTAGACGTAGCCGATGGTGCG GTTGTTGTCGTGGCTTGTTCACCTGTGGTAGTACCTCTTCTTGCACTGGCACTGGGTGCGGGTCCTGTAGGACC TCTTCTGGGTGTTGCCGTTCGACACGCTGGACTTGCCGCACTTCGGGGACTAGGACTTCCTGACGTCGCACCGG CCGACCGACGACCCGTTGGGGTACACGCTGCTCAAGTAGGCGCACGGGCTCACCTCGATGTAGCACCTCGCGCG GTTGGGGCGGTTGCTGGACACGAAGGGGCCGTTGGACTTGCTGATGCTCCTCGACTTCGTAGAGGACTCGGCGT AGTTGGTGAAGCTCTTCTAGGACTAGTAGGGGTTCTCGTCGACCGGGTTGGTGCTCTGGTCGGACCCGCACTCG CGGCGGACGGGGATGGTCCCGTGGGGGTCGAAGAAGGCGTTGCACCACACCGACTAGTTCTTCTTGCTGCGGAT GGGGTGGTAGTTCTAGTCGATGTTGTTGTGGTTGGCGCTCCTAGAGGACTAGGACACCCCGTAGGTGGTGTCGT TGTTGCGGCGGCTCGTCTGGTTGGACATGTTCTTGGGGTGGTGGATGTAGTCGCACCCGTGGTCGTGGGACTTG GTCGCGGACCACGGGTTCTAGCGGTGGGCGTCGGTCCACTTGCCGCTCGCGCCGGCGTACCTGAAGAAGACCTG GTAGGACTTCGGGTTGCTGCGGTAGGTGAAGCTCTCGTTGCCGTTGAAGTAGCGGGGGCTCATGCGGATGTTCT AGCACTTCTTCCCGCTGTCGTGGTAGTACTTTAGGCTCCACCTCATGCCGGTGACGTTGTGGTTCACGGTCTGG GGGTAGCCGCGGTAGTTGTCGTCGTACGGGAAGGTGTTGTAGGTGGGGGACTGGTAGCCGCTCACGGGGTTCAT GCAGTTTAGGTTGTTCGACCACGACCGGTGGCCGGACGCGTTGTCGGGGGACGCGCTCTTCGCGGCGGCGTTCT TCGCGCCGGACAAGCCGCGGTAGCGGCCGAAGTAGCTCCCGCCGACCGTCCCGTACCACCTGCCGACCATGCCG ATGGTGGTGTCGTTGCTCGTCCCGTCGCCGATGCGGCGGCTGTTCCTCTCGTGGGTCTTCCGGTAGCTGCCGCA CTGGTTGTTCCACTTGTCGTAGTAGCTGTTCTACTTGTGGGTCAAGCTCCGGCACCCGGCGCTCAAGTTGTTGG ACCTCGCGGCGTAGCTCTTGGACTTGTTCTTCTACCTCCTGCCGAAGGACCTGCACACCTGGATGTTGCGGCTC GACGACCACGACTACCTCTTGCTCGCGTGGGACCTGAAGGTGCTGTCGTTGCACTTCTTGGACATGCTGTTCCA CGCGGACGTCGACGCGCTGTTGCGGTTCCTCGACCCGTTGCCGACGAAGCTCAAGATGGTGTTCACGCTGTTGC TCACGTACCTCTCGCACGCGTTGCCGTGGATGCTGATGGGGGTCATGTCGCTCCTCCGGGCGGACTTCGCGCTC CTCTAGTCGCCGCACTTCGACCTCTCGTAGCCGTGGATGGTCTAGGACTCGTAGATGTCGTGGCACCGGTCGTC GGACCGGGACCGGTAGTACCACCGGCCGGACTCGGACACCTACACGTCGTTGCCGTCGGACGTCACGGCGTAGA CGTAGCCGTCGCCGCTCCCGGCGCCGTCGGACGACTGTACACCGCTGCACCTCCTCTTGGGGCCGGGGTACTTG GGGTTGGTCTTCTAGTAGTGGTAGCCGTCGTAGACGTACCACCACCCGTAGTAGTCGGACTAGGACGTCTAGCC GTTGTAGTAGTCGTAGACCCACTCGGTGTCGTAGGTCTGGCCGTTGGTCTTGGTCGGGCTCTGTACATTGGTCT CGTAGTAGTGGATGCTCTTGTTGTGGACCCACTTGGTCTGGATGCACTTGTAGTCGTTGTGGTTGAAGCACCGG
[0004] Example 1 Pre-Pandemic H5 Vaccine This example provides immunogenicity data for the Pre-Pandemic H5 Vaccine. This vaccine offers the optimal vaccine antigen payload against the broad diversity of influenza A H5 encompassing multiple clades in circulation both past and present, providing effective neutralisation against a broad spectrum of H5Nx in the case of a novel pandemic without the need for a lengthy selection and alteration process required by classic influenza vaccines. For the examples provided below, SEQ ID NOs corresponding to the encoded amino acid sequences are used. The vaccine candidates and controls are immunised as mRNA sequences, corresponding to the nucleic acid sequences. Current avian influenza outbreaks cause devastation in wild and domestic bird populations. Spillovers to mammals and potential mammal to human transmission from infected dairy cattle has raised additional concerns of human adaptation. In 2024, human infections with distinctly different H5Nx clades have been reported; these are unlikely to be protected from a single whole inactivated vaccine (WIV) from a mismatched H5Nx clade. To address this, we utilised Digitally designed, Immune Optimised, Synthetic vaccine antigens (DIOSynVax) to induce broad subtype H5Nx immunity and assess protection against representative H5 clades in mouse, chicken, and ferret models. Figure 1 shows the composition of the DIOSynVax first generation pan-H5Nx Pre-Pandemic VAP. The VAP contains two influenza A (IAV) virus H5 antigens, T4_HA_2 (SEQ ID NO:10) covering H5 clade 2.3.4.4, and T2_HA_9 (denoted as interclade) (SEQ ID NO:12), covering all other H5 clades; IAV NA subtypes N1 (T2_NA_3; SEQ ID NO:11), and N6 (T2_NA_12; SEQ ID NO:13), and IAV M2 (T2_M2_1; SEQ ID NO:3). The combination of H52.3.4.4, N1, and M2 is denoted as S3_T2_12 (T4_HA_2 + T2_NA_3 + T2_M2_1)(SEQ ID NO:20); likewise the combination of H5 interclade, N6, and M2 is denoted as S3_T2_13 (T2_HA_9 + T2_NA_12 + T2_M2_1)(SEQ ID NO:21), both are in string format and are combined in one LNP, LNP-3. DIOSynVax H5Nx immunogens were administered intramuscularly on D0 and D21 in mice. Serum neutralising titers were monitored using pseudotype neutralisation (pMN), enzyme- linked lectin assay (pELLA), and neuraminidase inhibition (NAI). Table 1. Study design for immunogenicity of DIOSynVax panH5Nx pre-pandemic vaccine. Figure 2 shows serum neutralising titers as shown by IC50 (IC50 is half-maximal inhibitory serum dilution) of sera (Terminal bleed, day 63) from mice vaccinated with H5Nx vaccinecandidates and whole inactivated vaccine (WIV) controls. IC50 dilution values weredetermined via pseudotype neutralisation assay (pMN). Dashed line indicates an IC50 value of 1000, the baseline for a strong immune response in this assay. The plot shows the median and interquartile range of all samples (n=6 / group). After day 63, S3_T2_12 maintained its high titers (IC50~105) against pseudotype virus (PV)from clade 2.3.4.4. The positive control counterpart, WIV A / Astrakhan / 3212 / 2020 (H5N8)[WIV 2.3.4.4b] also had similar titers from an earlier bleed (IC50~103). Nevertheless, serum neutralising titers are higher for S3_T2_12 compared to WIV 2.3.4.4b by about 2logs against 2.3.4.4 representative strains. S3_T2_13 demonstrated IC50 titers >103against all “interclade” H5, with the greatest neutralising titers seen against clade 2.2. Although modest, neutralisation can also be observed against the divergent 2.3.4.4h strains from 2018 and 2020, as well as both 2.3.4.4b representatives. Neutralisation profile of S3_T2_13 is broader than that of its whole inactivated vaccine counterpart A / Vietnam / 1194 / 2004 (H5N1) [WIV 1] as the latter was unable to hit PV from 2.3.4.4h with titers reaching a maximum of 103across the board. The combination of S3_T2_12 and S3_T2_13, designated as DIOS panH5Nx, demonstrates broader neutralisation against all strains from representative H5 clades tested compared to its individual components. A slight decrease in potency can be seen against clade 2.2.1.1 but neutralisation against 2.3.4.4h which was harder to achieve using the single components is now apparent. Neutralising responses are similar for DIOS panH5Nx and WIV 1 + 2.3.4.4b against PV from clades 7.1 and 1 respectively, but for everything else, DIOS panH5Nx has IC50 titers that are at least a log greater (IC50 > 103) than the combination WIV. Figure 3 shows a “heatmap" representation of immune responses of DIOS H5Nx vaccine antigens and WIV controls against H5 PV from indicated clades on Day 63. Legend indicates total mouse responders with an IC50 greater than 102for each group. The DIOS H5 antigens, S3_T2_12, and S3_T2_13, are seen here to neutralise clade 2.3.4.4 apart from 2.3.4.4h, and interclade H5 including 2.3.4.4h, respectively. On the other hand, the narrow specificity of the WIVs can also be visualised (Figures 2-3). WIV 2.3.4.4b only covers clades 2.3.4.4a, 2.3.4.4b, and 2.3.4.4c; and WIV 1 is only showing neutralising responses against clade 7.1, 1, and 2.1.3.2. Moreover, combining S3_T2_12 and S3_T2_13 as DIOS panH5Nx now enables it to broadly cover all H5 clades tested. The WIV combination also shows improved coverage compared to its individual counterparts but not to the extent, breadth, and potency achieved by DIOS panH5Nx. Figure 61 shows additional heatmap data for DIOS H5 antigens, S3_T2_12 and S3_T2_13 against a panel of further H5 PVs. Figure 4 shows neuraminidase Inhibition (NAI) titers against N6 PV as shown by IC50 of sera (day 63) from mice vaccinated with DIOSynVax antigens (Table 1). IC50 dilution values were determined via pseudotype enzyme-linked lectin assay (pELLA). Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. S3_T2_13 (with an N6 component) and DIOS panH5Nx demonstrate good anti-N6 titers (IC50>103) against the avian N6, A / duck / NgheAn / 5382VTC / 2019 (N6) but very moderate titers against A / Anhui / 2021-00011 / 2020 (N6). There does not seem to be any effect on the immune responses if the N6 component is in a single string (S3_T2_13) or in combination (DIOS pan- H5Nx). Plot shows the median and interquartile range of all samples (n=6 / group). Figure 62 is a continuation of the NAI assay of Figure 4 against further N6 PVs. S3_T2_13 (with an N6 component) and DIOS panH5Nx demonstrate good anti-N6 titers (IC50>103) against the avian N6 strains, A / duck / NgheAn / 5382VTC / 2019 (N6) and A / yellow-billed teal / Chile / 8 / 2013, and the human A / Sichuan / 26221 / 2014, but very moderate titers against A / Anhui / 2021-00011 / 2020 (N6). S3_T2_13 (with an N6 component) and DIOS panH5Nx (also denoted FLU_MX_S_4) demonstrate good anti-N6 titers (IC50>103) against the avian N6, A / duck / NgheAn / 5382VTC / 2019 (N6) but very moderate titers against A / Anhui / 2021- 00011 / 2020 (N6) (Figure 4). There does not seem to be any effect on the immune responses if the N6 component is in a single string (S3_T2_13) or in combination (DIOS panH5Nx). Figure 5 shows NAI titers against N1 PV as shown by IC50 of sera (day 63) from mice vaccinated with DIOSynVax antigens (Table 1). IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. S3_T2_12 (with an N1 component) and DIOS panH5Nx demonstrate excellent anti-N1 titers (IC50 >104) against N1 from different species. WIV clade 1 containing an N1 component also shows some inhibition after day 63 but has inhibition titers at least 2 logs lower than the DIOS candidates. The combination WIVs (WIV clade 1 + 2.3.4.4b) also has lower titers compared to WIV clade 1 alone, with at least 2 mice with no immune responses. DIOS pan-H5Nx, a combination of S3_T2_12 and S3_T2_13, does not suffer from a decrease in titer that the WIV combination does. Figure 63 shows a continuation of the NAI data of Figure 5. S3_T2_12 (with an N1 component) and DIOS panH5Nx demonstrate excellent anti-N1 titers (IC50>103) against N1 from different species. WIV clade 1 containing an N1 component also shows some inhibition but has titres that are overall lower than the DIOS candidates. The combination WIVs (WIV clade 1 + 2.3.4.4b) also has lower titres compared to WIV clade 1 alone, with at least 2 mice with no immune responses. DIOS pan-H5Nx, a combination of S3_T2_12 and S3_T2_13, does not suffer from a decrease in titre that the WIV combination does. Figure 6 shows a “heatmap" representation of immune responses of DIOS H5Nx vaccine antigens and WIV controls against N1 PV on Day 63. Legend indicates number of mice and IC50 response threshold (200), depending on shading. NA inhibition data gathered demonstrated the ability of the N1 and N6 antigen components, as part of S3_T2_12 and S3_T2_13 respectively, to inhibit heterologous N1 and N6 PV (Figure 4-5). This is also observed but to a lesser extent in WIV Clade 1 and WIV 1 + 2.3.4.4b which also contain N1. Figure 64 shows a continuation of the heatmap data of Figure 6, showing the immune responses of DIOS H5Nx vaccine antigens and WIV controls against further N1 PV on day 63. NA inhibition data gathered demonstrated the ability of the N1 and N6 antigen components, as part of S3_T2_12 and S3_T2_13 respectively, to inhibit heterologous N1 and N6 PV (Figure 62-63). This is also observed but to a lesser extent in WIV Clade 1 and WIV 1 + 2.3.4.4b which also contain N1. This vaccine offers the optimal vaccine antigen payload against the broad diversity of IAV H5 encompassing multiple clades in circulation both past and present, with the benefit of availability in the case of an H5Nx pandemic without the need for a lengthy selection and alteration process required by classic influenza vaccines. Example 2 Seasonal and Universal Influenza Vaccine Candidates This example shows the immunogenicity and efficacy of seasonal and universal influenza vaccine candidates with or without M1 matrix protein antigen in mice. The antigenic composition of the seasonal vaccine (SIV) candidate is shown in Figure 7, whereas the composition and antigens used for the universal vaccine (UIV) formulation is displayed in Figure 8 and Table 2. Figure 7 shows the antigenic composition of the DIOSynVax first generation Seasonal Influenza Vaccine Antigen Payload (VAP) containing Influenza A virus (IAV) Hemagglutinin (HA) subtypes H1 (T2_HA_3; SEQ ID NO:1), and H3 (T2_HA_46 and T2_HA_49; SEQ ID NO:5 and SEQ ID NO:6), and Influenza B virus (IBV) HA (T3_HA_10; SEQ ID NO:8), IAV Neuraminidase (NA) subtypes N1 (T3_NA_3; SEQ ID NO:2), and N2 (T2_NA_31; SEQ ID NO:7), and IBV NA (T3_NA_5; SEQ ID NO:9). Also included are IAV Matrix 1 (M1; SEQ ID NO:4) and Matrix 2 (M2; SEQ ID NO:3) antigens. H1, N1, and M2 are in “string” format and is denoted as S3_T2_8 (SEQ ID NO:19). Components are distributed into two Lipid Nanoparticles (LNP), LNP-1, and LNP-2. The M1 protein is optionally present in LNP-1. Figure 8 shows the composition of the DIOSynVax first generation Universal-type Influenza VAP. The VAP contains the antigens from the Seasonal VAP (Figure 7), the pan-H5Nx pre- pandemic VAP (Figure 1), and additionally, LNP-4 containing IAV H7 (T2_HA_12; SEQ ID NO:14), H9 (T2_HA_31; SEQ ID NO:15), N5 (T2_NA_11; SEQ ID NO:16), N7 (T2_NA_14; SEQ ID NO:17), and N9 (T2_NA_18; SEQ ID NO:18). The M1 protein in the Seasonal VAP is optionally present in LNP-1.
[0005] The seasonal and the universal influenza vaccine candidates (with and without the M1 component), Seqirus Quadrivalent Influenza vaccine (QIV), and vehicle (see Figures 7-8) were used to vaccinate mice on day 0 and day 21 as per the studies described in Table 3. Table 3. Study design for immunogenicity and efficacy of DIOSynVax Seasonal and Universal-type Influenza VAPs in mice. Sera taken on day 42 from mice vaccinated with the SIV and UIV candidates demonstrated robust and broad immune responses to all of the antigenic components within the vaccine (Figures 10-23). High neutralising responses were elicited against a diverse panel of H1 viruses including those from swine, human seasonal strains, and pandemic isolates (Figures 10-11). As expected, mice vaccinated with Seqirus QIV showed higher anti-H1 neutralising responses to only the most recent human seasonal strains and less robust responses to pandemic strains and swine isolates. To assess protective efficacy, vaccinated and control mice were challenged on day 49 with A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) (GM / 19) and monitored for the development of influenza-like symptoms (Figures 24-32). All vaccinated mice survived challenge with no significant differences in either viral lung titres (3 days post-challenge) or weight loss over a 13 day period between the two seasonal vaccine groups and the group vaccinated with Seqirus QIV. No statistical differences were observed instead when comparing the universal vaccine groups with Seqirus QIV (Figures 29-30). All control mice succumbed to infection and were culled on day 6. Note that the M2 antigen is consistent among all three string formulations, however the N1 antigens are specific for their respective H1 or H5 counterparts. Also note, we saw optimal anti-H3 responses using a combination of two individual H3 antigens, one coding for the hemagglutinin (HA) head region and one for the stem region when compared to any single pan-H3 antigen in our mRNA library, hence the inclusion of two H3 antigens at individual half doses. The amino acid sequence of the head region is T2_HA_49 (SEQ ID NO:6), and the amino acid sequence of the stem region is T2_HA_46 (SEQ ID NO:5). Additional advice from our mRNA manufacturers indicated that no more than five individual mRNA species should be formulated together in a single LNP population, primarily to avoid potential issues with mRNA encapsulation efficiency. Accordingly, these antigens were distributed and encapsulated in four separate LNP formulations which were subsequently combined in appropriate amounts to create a Universal-type influenza vaccine candidate (see Figure 7 below). This final formulation was used to vaccinate mice and ferrets to: i) demonstrate breadth of immunogenicity against all the antigens in the vaccine candidate, ii) demonstrate protective efficacy against challenge with a contemporary H1N1 virus and iii) demonstrate comparability (non-inferiority) of immune responses to a commercially available seasonal quadrivalent inactivated vaccine. Figure 9 shows a phylogenetic tree representation of DIOSynVax H1 subtype pseudotype virus (PV) repertoire. We have employed these H1 PV to assess the breadth of the DIOSynVax Seasonal and Universal-type H1 neutralising titers. The various PV used represent relevant swine, and pandemic H1 strains, and the most recent seasonal strains. Figure 10 shows neutralising titers against H1 as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=6 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests. The Seasonal + M1 demonstrates the broadest immune response against all swine, seasonal, and pandemic H1 PV tested, compared to all other VAPs (Figures 10 and 11). The Seasonal + M1 shows a greater immune response against swine and pandemic H1 that is not as strong in the QIV. Additionally, there is no significant difference between IC50 values of Seasonal + M1 and QIV against the seasonal strains, except for SYD / 5 / 21 and VIC / 4897 / 22, the latter is homologous to the H1N1 component of the QIV. Universal + M1 is showing a similar neutralisation profile in terms of breadth as Seasonal + M1, but is weaker in potency. Figure 12 shows neuraminidase inhibition (NAI) titers against N1 PV as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Both the Seasonal + M1 and the Universal + M1 groups demonstrate impressive anti-N1 titers against N1 from different species such as swine, bird, seal, and mink. The QIV and vehicle are negative for N2 inhibition. Plot shows the median and interquartile range of all samples (n=6 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests. Figure 13 shows DIOSynVax VAPs induce high level of binding antibodies as tested via Enzyme-Linked Immunosorbent Assay (ELISA) against A / Darwin / 9 / 2021 (H3) on day 42. Values are shown as Area under the curve (AUC) of serum dilutions versus Absorbance at 450 nm. The DIOS Seasonal VAPs with or without M1 demonstrate the same H3 binding antibody profile, that are higher than the DIOS Universal VAPs. All DIOSynVax vaccines have significantly higher anti-A / Darwin / 9 / 2021 (H3) binding antibodies compared to QIV and vehicle. (n=12 / group) ****=p<0.0001 via One way ANOVA and Sidak’s multiple comparison’s test. Figure 14 shows NAI titers against N2 PV as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. DIOS Seasonal + M1, Universal + M1, and QIV, display anti-N2 titers, with Seasonal + M1 having the highest IC50 values and showing a significant difference against QIV. Plot shows the median and interquartile range of all samples (n=6 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests. Figure 15 shows NAI titers against various N6 PV as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax Universal + M1. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. DIOS Universal + M1 only inhibited A / Sichuan / 26221 / 2014 (N6) and not the other N6 PV tested. Plot shows the median and interquartile range of all samples (n=6 / group). Figure 16 shows NAI titers against various N5, N7, and N9 PV as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax Universal + M1. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. DIOS Universal + M1 showed good titers against all N5, N7, and N9 PV tested. Plot shows the median and interquartile range of all samples (n=6 / group). Figure 17 shows neutralising titers against IBV HA from both B / Yamagata (B / Yam) and B / Victoria (B / Vic) lineages as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. DIOS Seasonal + M1 demonstrated the highest neutralising titers against all B / HA PV it was tested against, and showing no significant difference with QIV. DIOS Universal + M1 also displayed neutralising titers albeit lower than Seasonal + M1. Plot shows the median and interquartile range of all samples (n=6 / group). nd=p>0.05 via Mann Whitney Multiple Discovery tests. Figure 18 shows NAI titers against B / NA PV from B / Yamagata and B / Victoria lineages as shown by IC50 of sera (day 42) from mice vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 3). IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Against the selected B / NA PV, only DIOSynVax Seasonal + M1 displayed anti-B / NA activity of all VAPs tested. Inhibition titers were the same regardless of the IBV NA lineage. Plot shows the median and interquartile range of all samples (n=6 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests. Figure 19 shows neutralising titers of DIOSynVax Universal + M1 (day 42) against representative PV strains from various IAV H5 clades. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. H5 PV strains are further subdivided into “interclade” H5 (all clades presented excluding 2.3.4.4) and clade 2.3.4.4. Neutralisation is poor against all of the interclade H5 strains, with no titers reaching 1000. However, titers are impressive against clade 2.3.4.4 PV with DIOS Universal + M1 showing good titers against all PV tested except for PV from clade 2.3.4.4h. Nonetheless, titers against 2.3.4.4h PV are beginning to increase at this time point. Plot shows the median and interquartile range of all samples (n=6 / group). Figure 20 shows neutralising titers of DIOSynVax Universal + M1 (day 42) against representative H7 PV. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Universal + M1 demonstrates high titers against H7 PV that have caused human outbreaks in the past, as well as that from avian reservoirs. Plot shows the median and interquartile range of all samples (n=6 / group). Figure 21 shows neutralising titers of DIOSynVax Universal + M1 (day 42) against representative H9 PV. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Universal + M1 demonstrates titers that are on the threshold of a strong immune response against H9 PV from the Y280 / G9 (T1_HA_40) and G1 (T1_HA_76) lineages that are in current circulation in both humans and avian reservoirs. Plot shows the median and interquartile range of all samples (n=6 / group). Figure 22 shows a summary of serum Hemagglutinin neutralisation titers (IC50) of QIV, DIOSynVax Seasonal + M1, and Universal + M1 at day 42. Seasonal + M1 demonstrate excellent IC50 titers against all HA PV it was tested against. Universal + M1 also show immune responses against all HA tested, except for H5interclade. Overall, immune responses are apparent against all components of the Seasonal + M1 and Universal + M1 vaccines. Figure 23 shows a summary of serum Neuraminidase inhibition titers (IC50) of QIV, DIOSynVax Seasonal + M1, and Universal + M1 at day 42. Seasonal + M1 demonstrate excellent IC50 titers against all NA PV it was tested against. Universal + M1 also show immune responses against most NA tested. Responses from both DIOSynVax vaccines are markedly greater than that for QIV. Figure 24 shows a mouse challenge with A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) [GM / 19]. Study schedule of mice vaccinated with VAPs as stated in Table 3. All mice are immunised on day 0 and 21, and bled on day 20 and day 42. Day 42 bleeds are used to decide whether challenge will proceed on day 49. Four (4) mice out of 12 were culled 3 days post-challenge at day 52 following the schedule stated above; eight mice (8) went on to ascertain survival. Challenge window is 14 days, from day 49 to day 63. Figure 25 shows neutralising titers against the challenge virus A / Guangdong- Maonan / SWL1536 / 2019 (H1) as shown by IC50 of sera from mice vaccinated with DIOSynVax VAPs, QIV, and vehicle (Table 3) on day 42. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Highest titers (~104) can be observed for both DIOS Seasonal vaccines (with or without M1), followed by QIV, and then the DIOS Universals (with or without M1) at around 103. All vaccination groups, with the exception of vehicle, displayed titers exceeding or at the threshold, and as such, we proceeded to challenge with A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) (GM / 19) on day 49 . Plot shows the median and interquartile range of all samples (n=12 / group). ns=p>0.05 via Kruskal Wallis Multiple comparison tests. Figure 26 shows the monitoring of neutralising titers against the challenge virus A / Guangdong-Maonan / SWL1536 / 2019 (H1) as shown by IC50 of sera from mice vaccinated with VAPs as described in Table 3 on day 21 and day 42. IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. DIOS Seasonal and Seasonal + M1 demonstrate titers of about 102at day 21, increasing 2 logs to around 104at day 42. For DIOS Universal, Universal + M1, and QIV, very low to no serum neutralisation titers were observed on day 21, rising to around 103on day 42. Titers highlight the value of boosting for all vaccination groups on day 21 to achieve titers at or above 103pre-challenge. Plot shows the median and interquartile range of all samples (n=12 / group). Figure 27 shows hemagglutination inhibition (HAI) titers of sera from mice vaccinated with VAPs as described in Table 3 on day 42 against the challenge virus A / Guangdong- Maonan / SWL1536 / 2019 (H1N1). HAI titers are expressed as the highest dilution of serum that inhibited hemagglutination completely. Dashed line indicates a HAI titer of 40, the accepted threshold for a seroprotective response in this assay. Three quarters of the mice (n=8) vaccinated with DIOS Seasonal and Seasonal + M1 demonstrate seroprotective titers of 40, whereas only a few mice immunised with the other VAPs reached this threshold. These pre-challenge HAI for DIOS vaccinated groups suggest protective efficacy in the subsequent in vivo challenge. Plot shows the median and interquartile range of all samples (n=12 / group). *=p<0.05 via Kruskal Wallis Multiple comparison tests. Figure 28 shows neuraminidase inhibition titers against the most recent seasonal N1 PV as shown by IC50 of sera from mice vaccinated with DIOSynVax VAPs, QIV, and vehicle (Table 3) pre-challenge on day 42. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Strong anti-N1 titers are achieved by all DIOSynVax vaccinated groups, whereas QIV and vehicle show no observable anti-N1 titers. Plot shows the median and interquartile range of all samples (n=12 / group). ns=p>0.05 via Kruskal Wallis Multiple comparison tests. Figure 29 shows protective efficacy of DIOSynVax VAPs in a lethal mouse challenge model of seasonal H1N1, A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) (GM / 19). Weight loss was monitored for 13 days. Solid line shows weight loss of 20%, the appointed severity end- point of the study. All mice were culled 14 days post-challenge for DIOSynVax Seasonal, Seasonal + M1, Universal, Universal + M1, and QIV; these mice did not reach the severity limit at any point in the challenge window. All mice given vehicle were culled 6 days post- challenge due to weight loss and clinical symptoms including difficulty in breathing, pinched waists, and ruffled coats, that exceeded the moderate severity limit of the study. In contrast, there was very minimal weight loss or symptoms of influenza infection observed in mice given DIOS Seasonal and DIOS Seasonal + M1 for the duration of the study demonstrating complete protection from influenza. Mice given DIOS Universal, Universal + M1, and QIV lost around 10% of body weight around day 3 post-challenge but recovered very quickly. Figure 30 shows recovered viral titers as indicated by 50% Tissue Culture Infectious Dose (TCID50 per mL) of lung tissue. Lungs were harvested from all mice (n=4 per group) as they were culled 3 days post-challenge and a TCID50 assay was performed on the homogenised lung samples to determine the amount of virus present. No virus was detected in all mice given DIOS Seasonal + M1. One mouse given DIOS Seasonal had very minimal virus present. Mice given DIOS Universal and Universal + M1 showed viral titers above 102TCID50 / mL. There was no significant difference in viral load among groups immunised with DIOS Seasonal + M1, Universal + M1, and QIV. These findings correlate viral load, weight loss, and survival, with all mice showing minimal viral load surviving until the end of the study. Plot shows the median and interquartile range of all samples (n=4 / group). ns=p>0.05 via Kruskal Wallis Multiple comparison tests. Figure 31 shows histology scores for lung sections from mice immunised with VAPs (Table 3) obtained 3 days post-infection with GM / 19. Scoring is as follows: 3 - mass infiltration of bronchioles, thickening of perivascular walls, lung rupture; 2 – mass infiltration, thickening of perivascular walls; 1 – occasional infiltration of bronchioles; 0 – clear to no infiltration of bronchioles. DIOS Universal + M1 and Seasonal + M1 showed very favourable histology scores, with almost all mice showing clear lungs. This is followed by DIOS Universal and Seasonal groups. Mice immunised with Seqirus QIV and vehicle showed extensive lung damage with at least 3 mice scoring 2 and higher. Overall, reduced lung damage is evident for groups immunised with DIOS Seasonal and Universal VAPs with M1. Figure 32 shows representative histological lung sections from mice immunised with VAPs (Table 3) 3 days post-infection with GM / 19. Lung sections were stained with Hematoxylin and Eosin (H&E) and scored (Figure 31). Lung ruptures are indicated by dashed lines and thickening of perivascular and alveolar walls by arrows. Scale bar = 100 μm. Example 3 Seasonal and Universal Influenza Vaccine Candidates in Ferrets In this study, ferrets were immunised with the version of the Seasonal Influenza Vaccine (SIV) and Universal Influenza Vaccine (UIV) candidates containing the M1 antigen and, as a comparator, with a commercially-available adjuvanted quadrivalent inactivated seasonal vaccine (Seqirus QIV) on day 0 and day 21 (Figure 33 and Table 4). In contrast to the mouse study (Example 2), the Seqirus used to vaccinate ferrets contained adjuvant to ensure the animals generated robust immune responses. Control ferrets were vaccinated with vehicle only on day 0 and day 21. Sera taken on day 42 from ferrets vaccinated with the SIV and UIV candidates demonstrated robust and broad immune responses to the majority of antigenic components within the vaccine (see heatmaps Figures 42-43). As per the results obtained in the mouse study, high neutralising responses were elicited against a diverse panel of H1 viruses including those from swine, human seasonal strains, and pandemic isolates (Figure 34-35). Also as expected, ferrets vaccinated with adjuvanted Seqirus QIV showed high anti-H1 neutralising responses to human seasonal strains and less robust responses to pandemic strains and swine isolates due to the strain-specific nature of the commercial vaccine. Protective efficacy in vaccinated and control ferrets was assessed following challenge on day 49 with A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) (GM / 19). It should be noted that inoculation of ferrets with seasonal H1N1 influenza viruses typically results in a milder, non- lethal infection so differences between control and vaccinated groups are less apparent than those seen in the analogous challenge study in mice described above. During the 9 day post-challenge monitoring period, all ferrets survived challenge and no significant differences in weight loss were noted between the vaccinated vaccine groups (SIV, UIV and adjuvanted Seqirus QIV) and the control ferrets. However, ferrets vaccinated with the SIV and UIV candidates had lower cumulative clinical scores (Figure 50) and a significant reduction in viral RNA shedding compared to those vaccinated with QIV or control animals (Figures 51-52). Figure 33 shows study schedule of ferrets vaccinated with VAPs as stated in Table 4. All ferrets are immunised on day 0 and 21, and bled on day 20 and day 42. Day 42 bleeds are used to decide whether challenge will proceed on day 49. Challenge window is 14 days, from day 49 to day 63.
[0006] Universal-type Influenza VAPs in ferrets. Vaccinations: Animals were vaccinated as follows: A. Group 1: 1.0mL (150µg total mRNA content) of DIOS Seasonal Influenza VAP administered as two 0.5 mL doses in separate sites, intramuscularly (IM) on Day 1 and again on Day 21. B. Group 2: 1.0mL (350µg total mRNA content) of DIOS Universal-Type Influenza VAP administered as two 0.5 mL doses in separate sites, intramuscularly (IM) on Day 1 and again on Day 21. C. Group 3: 0.5mL (10µg total HA content) of adjuvanted Seqirus Seasonal Quadrivalent Influenza vaccine (QIV) administered as two 0.25mL doses in separate sites intramuscularly (IM) on Day 1 and again on Day 21. D. Group 4: 1.0mL of Vehicle administered as two 0.5mL doses in separate sites, intramuscularly (IM) on Day 1 and again on Day 21. Challenge: All ferrets were challenged on Day 49 with A / Guangdong- Maonan / SWL1536 / 2019 (H1N1) influenza virus at a concentration of 2 x 106 TCID50 / mL via the intranasal route (0.25mL / nostril). Post-challenge analysis: All ferrets were observed daily and scored for body weight, temperature and clinical signs of illness. Nasal washes were taken daily from all animals and tested by qPCR to determine viral load. Post-mortem: All animals were culled on Day 63. One lung was collected from all animals and processed to paraffin-embedded tissue blocks for histology and immunohistochemistry. Results Sera taken on day 42 from ferrets vaccinated with the Seasonal and Universal-type vaccine candidates demonstrated robust neutralising immune responses to the majority of antigenic components (HA and NA) within the vaccine (Figures 46-47). Importantly, with respect to the H1N1 challenge virus, high neutralising responses were observed against a diverse panel of H1 viruses including those from swine, human seasonal strains, and pandemic isolates following vaccination with the seasonal and to a lesser extent the Universal-type vaccine candidate (Figures 34-35), demonstrating the remarkable breadth of immunity elicited by a single DIOSynVax antigen within a complex multi-antigen formulation. In contrast, ferrets vaccinated with adjuvanted Seqirus QIV only showed high anti-H1 neutralising responses to human seasonal strains closely related to the strain used to manufacture the vaccine and less robust responses to pandemic strains and swine isolates demonstrating the strain-specific nature of commercial seasonal vaccines (Figure 34). Figure 34 shows neutralising titers against H1 as shown by IC50 of sera (day 42) from ferrets vaccinated with DIOSynVax VAPs with M1, QIV, and vehicle (Table 4). IC50 dilution values were determined via pMN. Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Plot shows the median and interquartile range of all samples (n=5 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests. Figure 35 shows a heatmap representation of immune responses of DIOSynVax VAPs and controls against H1 PV panel from Figure 34. Legend indicates number of ferrets (n) and their corresponding IC50 response. Figure 36 shows monitoring of hemagglutination inhibition (HI) titers of sera from ferrets on day 42 against the challenge virus A / Guangdong-Maonan / SWL1536 / 2019 (H1N1). HI titers are expressed as the highest dilution of serum that inhibited hemagglutination completely. Dashed line indicates a HI titer of 40, the accepted threshold for a seroprotective response in this assay. All DIOS Seasonal ferrets have impressive titers exceeding 40 on day 42. DIOS Universal has 3 out of 5 ferrets with HI ≥ 40, whereas QIV only has 1 ferret that has reached this threshold. For all vaccination groups excluding vehicle, HI titers improved from day 21 to day 42. (n=5 / group). Figure 37 shows DIOSynVax VAPs induce high level of binding antibodies as tested via Enzyme-Linked Immunosorbent Assay (ELISA) against A / Darwin / 9 / 2021 (H3) on day 42. Values are shown as Area under the curve (AUC) of serum dilutions versus Absorbance at 450 nm. The DIOS Seasonal and Universal vaccines demonstrate the same H3 binding antibody profiles that are significantly higher compared to QIV and vehicle. ****=p<0.0001 via One way ANOVA and Dunnett’s multiple comparison’s test. Figure 38 shows neutralising titers against IBV HA from both B / Yamagata and B / Victoria lineages as shown by IC50of sera (day 42) from vaccinated ferrets (Table 4). IC50dilution values were determined via pMN. Dashed line indicates an IC50value of 1000, the baseline for a predicted protective immune response in this assay. There was no significant difference in the titers of DIOS Seasonal and DIOS Universal compared to QIV against three of the 4 B / HA PV tested. Against B / Colorado / 6 / 2017, both DIOS vaccines outperformed QIV. Overall, the DIOS Seasonal vaccine displayed the highest neutralising titers against all B / HA PV it was tested against. Plot shows the median and interquartile range of all samples (n=5 / group). nd=p>0.05 via Mann Whitney Multiple Discovery tests. Figure 39 shows hemagglutination inhibition (HI) titers of sera from ferrets as immunised in Table 4 on day 42 against pertinent H1 viruses and IBV candidate vaccine viruses. HI titers are expressed as the highest dilution of serum that inhibited hemagglutination completely. Dashed line indicates a HI titer of 40, the accepted threshold for a seroprotective response in this assay. DIOS Seasonal showed the highest titers that all surpassed the threshold against the challenge virus, A / Guangdong-Maonan / SWL1536 / 2019 (H1N1). As expected, Seqirus adjuvanted QIV displayed very good titers against A / Sydney / 5 / 2021 (H1N1) (as mirrored by its serum neutralising titers (Figures 34-35)), and both IBV strains tested. Although, not exceptional, HI titers for the DIOS vaccines against all virus tested are very good indications of immune responses from these ferrets, as HI titers are accepted to be very strain-specific. Even if not homologous to the viruses, the DIOS vaccines are still able to elicit HI titers. These pre-challenge HI titers for DIOS vaccinated groups suggest protective efficacy in the subsequent in vivo challenge. Plot shows the median and interquartile range of all samples (n=5 / group). *=p<0.05 via Mann Whitney Multiple comparison tests. Figure 45 shows neuraminidase inhibition (NAI) titers against N2, B / NA from B / Yamagata and B / Victoria lineages, N5, N7, and N9 PV as shown by IC50 of sera (day 42) from ferrets vaccinated as stated in Table 4. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. DIOS Seasonal, DIOS Universal, and Seqirus adjuvanted QIV show good titers against N2 and B / NA. DIOS Universal displays anti-N5, anti-N7, and anti-N9 titers against majority of PV tested. Plot shows the median and interquartile range of all samples (n=5 / group). *=p<0.05 via Mann Whitney Multiple Discovery tests. Figure 46 shows a summary of serum Hemagglutinin neutralisation titers (IC50) of QIV, DIOSynVax Seasonal, and Universal at day 42. DIOS Seasonal demonstrates excellent IC50 titers against all HA PV, it was tested against. Immune responses for DIOS Seasonal are also better generally compared to QIV. DIOS Universal also shows immune responses against all HA tested, except for H5 interclade. Overall, immune responses are apparent against all components of the DIOS Seasonal and Universal Seasonal vaccines. Figure 47 shows a summary of serum Neuraminidase inhibition titers (IC50) of QIV, DIOSynVax Seasonal, and Universal at day 42. DIOS Seasonal exhibits excellent IC50 titers against all NA PV it was tested against. Universal also shows immune responses against all NA tested except for N6. Efficacy Results: Protective efficacy in vaccinated and control ferrets was assessed following challenge on day 49 with A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) (GM / 19). Inoculation of ferrets with seasonal H1N1 influenza viruses typically results in a mild, non-lethal infection thus observed clinical differences between control and vaccinated groups are often relatively similar. During the 9-day post-challenge monitoring period, all ferrets survived challenge and no significant differences in weight loss (Figure 49) were noted between any of the vaccinated groups and unvaccinated control ferrets. In contrast to weight, ferrets vaccinated with the DIOSynVax Seasonal and Universal-type influenza vaccine candidates had lower cumulative clinical scores and resolved their clinical symptoms more quickly than those vaccinated with QIV or control animals (Figures 50-51). Furthermore, ferrets vaccinated with the DIOSynVax Seasonal and Universal-type influenza vaccine candidates demonstrated a significant reduction in viral RNA shedding compared to those vaccinated with QIV or control animals following challenge (Figures 52-53). Ferrets vaccinated with the DIOS candidate Seasonal and Universal-type influenza vaccines generated robust immune responses that resulted in a milder and shorter-lived infection and reduced viral load compared to ferrets vaccinated with a commercial 2023 / 2024 seasonal inactivated quadrivalent vaccine (adjuvanted Seqirus QIV) following challenge with a relevant contemporary H1N1 seasonal influenza virus. Importantly, vaccine efficacy was not compromised by the number of antigens contained within either vaccine candidate, demonstrating a lack of antigenic competition or dominance. Breadth and in most cases, potent neutralising immune responses were observed against all the influenza antigens contained within the Seasonal vaccine and the majority of the antigens within the Universal-type vaccine candidate (with the exception of some H5 clades and the N6 neuraminidase) demonstrating the utility of the multi-mRNA / multi-LNP approach to polyvalent vaccine antigen delivery in a gold-standard animal model of influenza infection. We have demonstrated that the DIOSynVax Seasonal and Universal-type influenza vaccine candidate generate robust and broad anti-influenza immune responses in a relevant animal model (ferret challenge) and that these responses are non-inferior to those generated by commercially available seasonal influenza vaccines. Importantly, these immune responses result in a reduced severity and duration of infection in ferrets following challenge with a contemporary H1N1 virus. Figure 48 shows ferret serum samples were assessed at appointed days for presence of nucleoprotein (NP) by an Influenza A virus nucleoprotein (NP) competition ELISA (IDvet). The anti-NP antibody response is expressed as the mean (+SEM) of the inverse of the percentage competition (1-(OD sample / OD negative) x 100%). Results below the 50% threshold (dotted line) are considered negative. All ferrets were negative for NP on days -1 and day 41 pre-challenge. This is as expected since the DIOS vaccinated groups do not have NP as a component. All groups are positive for NP 9 days post-challenge indicating a successful H1N1 challenge with GM / 19; as all anti-NP antibodies will come from natural infection with a live virus and not from vaccination. Plot shows median and interquartile range of all samples (n=5 / group). *=p<0.05 via Kruskal Wallis Multiple Comparisons tests. Figure 49 shows weight loss monitoring of DIOSynVax VAPs in a non-lethal ferret challenge model of seasonal H1N1, A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) (GM / 19). Weight loss was monitored for 9 days. Solid line shows weight loss of 20%, the appointed severity end-point of the study. All ferrets were culled 9 days post-challenge regardless if they reached the severity end-point or not. For all groups, no significant weight loss was observed due to challenge. This is expected as challenge with a seasonal H1N1 virus is non-lethal and protective efficacy will not be measured via inhibition of weight loss. Figure 50 shows clinical signs of infection in ferrets were recorded twice daily during the challenge window. Parameters are as follows: i) Alertness – (0) attentive, curious, (1) hesitant, disinterested, (2) inactive, only gets up when stimulated, (3) recumbent, does not get up when stimulated ; ii) Breathing – (0) normal, (1) sneezing and coughing, (2) intermittent breathing difficulties, increase in respiratory rate, (3) persistent breathing distress, wheezing; iii) Eyes / Nose Discharge – (0) eyes bright and clear, (1) clear discharge from eyes and nose, (2) conjunctivitis, yellow discharge from eyes and nose; iv) Appetite – (0) normal, eats most food offered, (1) little food eaten, slight interest in treats, (2) shows no interest in food or drinks, nothing eaten or drunk; v) Temperature – (0) less than 1ºC (+ / -) increase from baseline, (1) 1-1.5ºC increase from baseline, (2) more than 1.6-2ºC increase from baseline, (3) more than 2ºC increase from baseline, more than 42ºC or more than 2ºC decrease within 24 hours. Each parameter can score a maximum of 15 (total for 5 ferrets in a group). All ferrets were scored for alertness, appetite and temperature, at 2 days post-infection (dpi). DIOSynVax Seasonal ferrets suffered from alertness issues from 2-4 dpi, DIOS Universal from 2-5 dpi, and both QIV and vehicle scored for alertness from 2-8 dpi. DIOS vaccinated ferrets showed less lethargy than QIV and vehicle for the duration of the challenge window. Slight breathing issues from 4-5 dpi were observed in DIOS vaccinated ferrets, however QIV and vehicle groups scored for breathing from 5 dpi until the end of the study. There was some slight nasal discharge observed from DIOS Seasonal and QIV ferrets, while all was normal for DIOS Universal and vehicle. All groups suffered some appetite loss and changes in temperature 2 dpi, but regained appetite quickly afterwards and temperature stabilised to baseline. (n=5 ferrets / group). Figure 51 shows a summary of clinical scoring for infection in ferrets as presented in Figure 50. Clinical scores are added for each parameter for each vaccination group and totalled. DIOS Seasonal ferrets demonstrated the lowest clinical scores followed by DIOS Universal. Adjuvanted and QIV scored the highest for clinical symptoms during the challenge window. DIOS Seasonal ferrets were showing very mild symptoms of disease from 3 dpi onwards. DIOS Universal results were similar to DIOS Seasonal, however, some loss of appetite occurred at 5 dpi. Adjuvanted QIV group was scoring consistently from 2 dpi to 9 dpi, similar to vehicle, showing that ferrets in this group were suffering from infection more so than the DIOS vaccination groups. It can be interpreted that the period of convalescence was shorter and recovery from infection was quicker for both DIOS vaccinated groups. Figure 52 shows nasal washes were taken from ferrets once daily until day 9 post-challenge to monitor shedding of viral RNA in ferrets during the infection window. Viral RNA shedding was assessed by reverse transcription real time quantitative polymerase chain reaction (RRT-qPCR) and is expressed as mean log10 Relative Equivalent Units REU / mL (+ / - SEM) over time. Data beyond the dotted line denotes the lowest limit of detection. Viral RNA shedding was highest for all groups 2 dpi, with vehicle > QIV > DIOS Universal > DIOS Seasonal. A decrease of about 2 logs was observed for DIOS Seasonal and DIOS Universal groups 3 dpi, a log down for QIV and vehicle on the same day. A continued decrease was seen for all groups 4 dpi. DIOS Seasonal and DIOS Universal had nasal shedding that was less than 3log REU / mL units by 5 dpi, going down to the lowest limit of detection by 6 dpi. From 6 dpi to 8 dpi, there is a significant difference in viral shedding between the DIOS vaccinated groups and those immunised with QIV. These results corroborate clinical scores (Figures 50-51) and indicate that DIOS Seasonal and DIOS Universal vaccinated groups were better protected against infection than animals immunised with QIV and vehicle. Plot shows the median and interquartile range of all samples (n=5 / group). *p<0.05 via One way ANOVA and Kruskal Wallis multiple comparisons test. Figure 53 shows curves of shedding of viral RNA (Figure 52) were plotted and Area Under the Curve (AUC) calculated. Greater AUC shows a higher peak and longer period of infection. Nasal Viral RNA shedding, as expressed in AUC units, of the challenge virus, A / Guangdong- Maonan / SWL1536 / 2019 (H1N1) showed a significant reduction (p<0.05) in the shedding profile of the DIOSynVax Seasonal and Universal Vaccines compared to that of the Seqirus adjuvanted QIV and vehicle. Plot shows median and interquartile range of all animals (n=5 ferrets / group). *p<0.05 via Kruskal Wallis multiple comparisons test. Example 4 M1 enables the formation of Influenza secreted particles Figure 54 shows transmission electron microscopy image of the supernatant obtained from HEK cell (A.) transfected with 2µg of DNA plasmid expressing FLU_S3_T1_1 (SEQ ID NO:48) and supernatant collected 8hrs post transfection, (B.) co-transfection with 1µg each of DNA plasmids expressing FLU_S3_T1_1 (SEQ ID NO:48) and FLU_T1_M1_1 (SEQ ID NO:51), (C.) co-transfection with 1µg each of DNA plasmids expressing FLU_S3_T1_1 (SEQ ID NO:48) and FLU_T1_M1_1, and supernatant collected 8hrs post transfection (D.) co- transfection with 1.5µg each of DNA plasmids expressing FLU_S3_T1_1 (SEQ ID NO:48) and FLU_T1_M1_1, (E.) co-transfection with 1.5µg each of DNA plasmids expressing FLU_S3_T1_1 (SEQ ID NO:48) and FLU_T1_M1_1, and supernatant collected 8hrs post transfection, and (F) Supernatant from un-transfected HEK cells. VLPs were observed only in panel (E) and have been highlighted by arrows. FLU_T1_M1_1 (SEQ ID NO:51) is wild-type M1 protein from influenza A / England / 195 / 2009. The DNA sequence encoding the amino acid sequence of SEQ ID NO:51 comprises nucleotide sequence of SEQ ID NO:52. FLU_S3_T1_1 is a String DNA construct expressing HA, NA, and M2 from Influenza A / England / 2009. The nucleic acids encoding each influenza antigen are pieced together in a string to form a separate nucleic encoding more than one antigen polypeptide. Although HA, NA, and M2 are wild-type sequences, these antigens are arranged in a specific order within a string DNA of our own design. The technical effect of combining this string with M1 is the release of influenza viral-like particles, as exemplified in Example 4 of the specification. Example 5 An Immune Optimised Influenza Pan-subtype H5Nx Vaccine Generates Broad Neutralising Immune Responses Background Current avian influenza outbreaks cause devastation in wild and domestic bird populations. Spillovers to mammals and potential mammal to human transmission from infected dairy cattle has raised additional concerns of human adaptation. In 2024, human infections with distinctly different H5Nx clades have been reported; these are unlikely to be protected from a single whole inactivated vaccine (WIV) from a mismatched H5Nx clade. To address this, we utilised Digitally designed, Immune Optimised, Synthetic vaccine antigens (DIOSynVax) to induce broad subtype H5Nx immunity and assess protection against representative H5 clades in mouse, chicken, and ferret models. Methods DIOSynVax H5Nx immunogens were administered intramuscularly on D0 and D21 in mice and ferrets, and on D0 and D14 in chickens. Serum neutralising titers were monitored using pseudotype neutralisation (pMN), enzyme-linked lectin assay (pELLA), and hemagglutination inhibition (HAI). Protection in mice and ferrets will be assessed by monitoring a) body weight, b) temperature, c) signs and symptoms of illness, and d) viral titers. Results Figure 55 shows a broad immune responses against H5 strains from representative clades were demonstrated in mice (n=6) (A) and chickens (n=10) (B-D) vaccinated with DIOS-H5Nx. Values are calculated as fold dilution of sera that resulted in 50% neutralisation of virus via pMN (A-B), 50% inhibition of neuraminidase activity via pELLA (C), and HAI titers against relevant H5 viruses (D). Results from mice and ferrets challenged with 2.3.4.4b and other circulating H5N1 virus strains will be compared to protection from WIV-strain specific vaccines to confirm pan-H5Nx protection against infection. Conclusion This vaccine offers the optimal vaccine antigen payload against the broad diversity of IAV H5 encompassing multiple clades in circulation both past and present, with the benefit of availability in the case of an H5Nx pandemic without the need for a lengthy selection and alteration process required by classic influenza vaccines. Example 6 Efficacy of Pre-pandemic H5Nx vaccine in Ferrets Background The globally dispersed avian influenza of A / H5N1 subtype consists of genetically and antigenically variable clades making it panzootic, spilling over to a variety of mammalian species resulting in over 900 human infections to date. Furthermore, neuraminidase reassortants, such as H5N2, H5N6, and H5N8, are also rampant, with different patterns of morbidity and mortality observed. Not knowing which A / H5 viruses will successfully sustain human to human transmission leading to a human epidemic or pandemic, we developed a vaccine capable of protecting from broad spectrum A / H5 viruses. Summary of Findings In this study, ferrets were immunised with pre-pandemic H5Nx vaccine (also referred to as pan-H5Nx or pan-subtype), as previously shown in mice, and, as a comparator, with a commercially-available whole inactivated antigen (WIV) of clade 2.3.4.4b subtype, of the candidate vaccine virus (CVV) A / Astrakhan / 321 / 2020 (H5N8) obtained from Therapeutic Goods Administration Australia (Table 5). The WIV was administered 1:1 with Addavax® adjuvant to ensure that animals generated robust immune responses. Control ferrets were vaccinated with vehicle only on day 0 and day 21. As detailed in Example 1, Figure 1 shows the composition of the first generation pre- pandemic H5Nx VAP. The vaccine contains two influenza A (IAV) virus H5 antigens, T4_HA_2 (SEQ ID NO:10) covering H5 clade 2.3.4.4, and T2_HA_9 (denoted as interclade) (SEQ ID NO:12), covering all other H5 clades; IAV NA subtypes N1 (T2_NA_3; SEQ ID NO:11), and N6 (T2_NA_12; SEQ ID NO:13), and IAV M2 (T2_M2_1; SEQ ID NO:3). The combination of H52.3.4.4 (SEQ ID NO:10), N1 (SEQ ID NO:11), and M2 (SEQ ID NO:3) is denoted as S3_T2_12 (T4_HA_2 + T2_NA_3 + T2_M2_1)(SEQ ID NO:20); likewise the combination of H5 interclade (SEQ ID NO:12), N6 (SEQ ID NO:13), and M2 (SEQ ID NO:3) is denoted as S3_T2_13 (T2_HA_9 + T2_NA_12 + T2_M2_1)(SEQ ID NO:21), both are in string format and are combined in one LNP, denoted LNP-3. Sera taken on day 42 from ferrets vaccinated with the pre-pandemic H5Nx and WIV2.3.4.4b demonstrated robust immune responses against H5 pseudotype viruses from the most relevant emerging pandemic clades (Figure 56b). Pre-pandemic H5Nx vaccine immunised ferrets showed protective HI titres against a 2.3.4.4b virus, and additionally against a clade 1 virus (Figure 57a), whereas WIV2.3.4.4b only showed homologous HI clade specificity. Moreover, serum neuraminidase inhibition activity was detected in pre-pandemic H5Nx ferrets against N1 and N6 pseudotypes from different species (Figure 57b) highlighting its potential as a pre-pandemic vaccine. T cell responses were also observed in pre-pandemic H5Nx vaccine immunised ferrets with values significantly different to those vaccinated with vehicle (Figure 58). Protective efficacy in vaccinated and negative control (vehicle) ferrets was assessed following lethal challenge on day 49 with A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1) [clade 2.3.4.4b] (Figure 59). During the 14-day post-challenge monitoring period, 5 out of 6 (83%)pre-pandemic H5Nx vaccine immunised ferrets, and 3 out of 6 (50%) WIV2.3.4.4b vaccinatedferrets survived challenge (Figure 59a), while all vehicle ferrets were culled by day 10. The proportion of ferrets alive at day 14 (end of the challenge window) is shown and P-values via Benjamini-Hochberg correction of the proportion of ferrets alive at day 14 (end of the challenge window) indicate a significant difference in the probability of survival between pre-pandemic H5Nx and vehicle vaccine groups, however, WIV2.3.4.4b did not have asignificantly better chance of survival than ferrets vaccinated with vehicle (Figure 59b).Employing the Cox proportional hazard model, the risk of death (HR) for WIV2.3.4.4b(HR):0.182 is 3.41 times higher than pre-pandemic H5Nx group (HR):0.05.Moreover, pre-pandemic H5Nx vaccine immunised ferrets had lower cumulative clinical scores and were able to resolve their clinical symptoms resulting in survival in comparison to WIV2.3.4.4b ferrets during the challenge window (Figure 60). We have demonstrated that the pre-pandemic H5Nx influenza vaccine candidate generated robust and anti-influenza immune responses in the gold-standard animal model for influenza (ferret) and that these responses were non-inferior to those of a clade homologous to the challenge virus whole inactivated antigen designated as a 2.3.4.4b candidate vaccine virus from a World Health Organisation reference laboratory. Importantly, these findings show greater protection with a lesser probability of death in pre-pandemic H5Nx ferrets following a lethal challenge with an avian 2.3.4.4b H5N1 virus that is phylogenetically and antigenically similar to circulating 2.3.4.4b avian viruses worldwide with the highest chance of spillover to humans. Table 5. Study design for immunogenicity and efficacy of pre-pandemic H5Nx vaccine in ferrets. Method The vaccination and bleed schedule is shown in Figure 56a. Study schedule of ferrets vaccinated with indicated constructs as stated in Table 5, or with A / chicken / Italy / 23VIR3799- 1 / 2023 WIV 2.3.4.4b control vaccine for challenge data. All ferrets are immunised on day 0 and 21, and bled on day 20 and day 42. Day 42 bleeds are used to decide whether challenge will proceed on day 49. Challenge window is 14 days, from day 49 to day 63. Vaccinations: Animals were vaccinated as follows: A. Group 1: 0.8 mL (100 µg total mRNA content) of pre-pandemic H5Nx vaccine administered as three 0.266 mL doses in three separate sites intramuscularly (IM) on Day 1 and again on Day 21. B. Group 2: 0.8 mL (3.8 µg total HA) of Whole Inactivated antigen A / Astrakhan / 321 / 2020 (H5N8) (WIV2.3.4.4b) from Therapeutic Goods Administration (TGA) Australia, adjuvanted 1:1 with Addavax®, administered as three 0.266 mL doses in three separate sites IM on Day 0 and again on Day 21. C. Group 3: 0.8 mL of vehicle administered as three 0.266 mL doses in three separate sites IM on Day 1 and again on Day 21. Challenge: All ferrets were lethally challenged on Day 49 with 1.0 x 104TCID50 / mL of A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1) [clade 2.3.4.4b] influenza virus. Ferrets were dosed with 0.5 mL of live virus administered via the intranasal route (0.25 mL / nostril). Post-challenge analysis: All ferrets were observed daily and scored for body weight, temperature and clinical signs of illness. Nasal washes were taken daily from all animals and tested by qPCR to determine viral load. Post-mortem: All animals were culled on Day 63. One lung was collected from all animals and processed to paraffin-embedded tissue blocks for histology and immunohistochemistry. Results Figure 56b shows neutralising titres against A / H5 pseudotype virus strains representing the most relevant A / H5 clades. IC50 dilution values were determined via pseudotype neutralisation assay (pMN). Dashed line indicates an IC50 value of 1000, the baseline for a predicted protective immune response in this assay. Serum neutralisation titres greater than ~103can be observed for both pre-pandemic H5Nx and WIV2.3.4.4b vaccinated ferrets. Plot shows the median and interquartile range of all samples (n=6 / group). nd=p>0.05 via Mann- Whitney Multiple discovery tests. Figure 57a shows hemagglutination inhibition (HI) titres of sera from ferrets vaccinated with vaccines as described in Table 5 on day 42 against a clade 2.3.4.4b H5, representative of the challenge virus, and a clade 1 H5. HI titres are expressed as the highest dilution of serum that inhibited hemagglutination completely. Dashed line indicates a HI titre of 40, the accepted threshold for a seroprotective response in this assay. Five out of six ferrets vaccinated with pre-pandemic H5Nx showed titres ≥40 against the clade 2.3.4.4b virus while all ferrets vaccinated with WIV2.3.4.4b showed HI titres ≥64, as expected. Against the clade 1 virus, only pre-pandemic H5Nx vaccinated ferrets demonstrated HI titres (HI≥8). HI titres for pre-pandemic vaccine against all virus tested are very good indications of immune responses from these ferrets, as HI titres are accepted to be very strain-specific. Even if not homologous to the viruses, pre-pandemic H5Nx is still able to elicit HI titres, which is not apparent for WIV2.3.4.4b. These pre-challenge HI titres for pre-pandemic H5Nx and WIV2.3.4.4b ferrets suggest protective efficacy in the subsequent in vivo challenge. Plot shows the median and interquartile range of all samples (n=6 / group). nd=p>0.05 via Mann- Whitney Multiple discovery tests. Figure 57b shows neuraminidase inhibition titres against multi-species N1 (from left to right: swine, mink, mute swan, human, and harbour seal) and N6 (yellow-billed teal, human) PV as shown by IC50 of sera from ferrets vaccinated with pre-pandemic H5Nx and vehicle, pre- challenge on day 42. IC50 dilution values were determined via pELLA. Dashed line indicates an IC50 value of 200, the baseline for a strong immune response in this assay. Strong anti- N1 titres were achieved by pre-pandemic H5Nx vaccinated ferrets, whereas anti-N6 titres against a human N6 PV were also observed. Plot shows the median and interquartile range of all samples (n=6 / group). Figure 58 shows spot forming units per million cells obtained via ELISpot were plotted to measure antigen-specific T cells in ferret pBMCs on Day 42. IFN-γ secretion is evaluated after stimulation with 100 HA units of inactivated A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1) [clade 2.3.4.4b] (challenge virus). It can be deduced that ferrets vaccinated with pre- pandemic H5Nx elicited T cell responses prior to challenge. There was no significant difference in the responses of WIV2.3.4.4b ferrets and vehicle. Plot shows the median and interquartile range of all samples (n=5 / group). *=p<0.05 via Mann-Whitney Multiple discovery tests. Figure 59 shows protective efficacy of pre-pandemic H5Nx in a lethal ferret challenge model of clade 2.3.4.4b H5N1, A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1). (A) Survival curves are shown for the challenge window. Five out of 6 ferrets (83%) vaccinated with pre-pandemic H5Nx survived the challenge. Three out of 6 ferrets (50%) immunised with WIV2.3.4.4b were culled based on humane endpoints on days 8-9, with another 50% surviving until day 14. All ferrets given vehicle (100%) were culled around 8 days post-challenge due to clinical symptoms, including difficulty in breathing, loss of appetite, hypothermia, lethargy, and neurological symptoms, that exceeded the severity limits of the study. A significant difference in survival (p=0.00055) among all three groups is indicated by the Log-Rank test. (B) The proportion of ferrets alive at day 14 (end of the challenge window) is shown. P-values indicate the results of a pairwise proportions test (with Benjamini-Hochberg correction); pre- pandemic H5Nx vs vehicle (p=0.029), and WIV2.3.4.4b vs vehicle (p=0.137). There was a significant difference in the probability of survival between pre-pandemic H5Nx and vehicle, however, WIV2.3.4.4b did not have a significantly better chance of survival than ferrets vaccinated with vehicle. Employing the Cox proportional hazard model, the risk of death (HR) for WIV2.3.4.4b (HR):0.182 is 3.41 times higher than pre-pandemic H5Nx (HR):0.05. Figure 60 shows clinical signs of infection in ferrets were recorded twice daily during the challenge window. Ferrets were vaccinated with pre-pandemic H5Nx vaccine, control, and vehicle, and challenged with lethal ferret challenge model of clade 2.3.4.4b H5N1, A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1) as per the schedule in Figure 56a. (A) Parameters such as i) Alertness, ii) Breathing, iii) Ocular and Nasal discharge, and iv) Appetite were observed, with a Clinical Score of 0 given to ferrets with no symptoms, and 4 to ferrets with severe symptoms resulting in culling (indicated by X) as humane endpoints are reached. Symptoms started to appear in pre-pandemic H5Nx and WIV2.3.4.4b vaccinated ferrets on day 4, day 3 for vehicle, with the height of infection recorded at day 9 for all groups. All ferrets given vehicle were culled on day 9. Half of the ferrets (n=3) immunised with WIV2.3.4.4b were culled by day 10, while only 1 ferret from pre-pandemic H5Nx group was culled during the challenge window. (B) Summary of clinical scoring in ferrets as presented in (A). Clinical scores are added for each vaccination group per day and totalled resulting in Cumulative Clinical Scores. Pre-pandemic H5Nx vaccinated ferrets demonstrated the lowest cumulative clinical scores followed by WIV2.3.4.4b. Scores for the WIV2.3.4.4b were higher than pre- pandemic H5Nx vaccinated ferrets from day 10 onwards, as three WIV2.3.4.4b ferrets were already culled at this time point. Only 1 pre-pandemic H5Nx vaccinated ferret had clinical scores on day 12, and it can be interpreted that all other surviving ferrets had already cleared the infection at this time point. Efficacy of Pre-pandemic H5Nx vaccine in Mice This example is a continuation of the experiments in Example 1 of the current application. H5Nx (also referred to as DIOS pan-H5Nx, or pan-H5Nx) comprises S3_T2_12 (T4_HA_2 + T2_NA_3 + T2_M2_1)(comprising amino acid sequence of SEQ ID NO:20), and S3_T2_13 (T2_HA_9 + T2_NA_12 + T2_M2_1)(comprising amino acid sequence of SEQ ID NO:21), both are in string format and are combined in one LNP, termed LNP-3. Figure 65 shows a “heatmap" representation of immune responses of H5Nx vaccine antigens against N6 PV on Day 63. This figure reproduces the data shown in Figure 62 of the specification, as a heatmap representation. Figure 66 shows binding activity of M2-specific IgG antibodies, shown as MFI values, of serum from mice immunised with DIOSynVax-pan-H5Nx against commercial recombinant M2 protein from A / chicken / Hebei / 326 / 2005 (H5N1) as tested by Luminex Assay. Each sample (n=6) was tested in duplicate. This plot shows that the H5Nx vaccine is capable of inducing binding antibodies against M2 protein from a representative antigen. Example 8 Efficacy of Pre-pandemic H5Nx vaccine in Mice This vaccine offers the optimal vaccine antigen payload against the broad diversity of IAV H5 encompassing multiple clades in circulation both past and present, with the benefit of availability in the case of an H5Nx pandemic without the need for a lengthy selection and alteration process required by classic influenza vaccines. Following successful immunogenicity studies, vaccine efficacy in mice immunised with DIOS pan-H5Nx was compared to the A / Astrakhan / 3212 / 2020 (H5N8) (WIV2.3.4.4b)-based antigen according to Table 6. WIV2.3.4.4b was specifically chosen as it is a strain for which a candidate vaccine virus (CVV) vaccine has been pre-authorised for use in the event of an H5Nx outbreak in humans. H5Nx (also referred to as DIOS pan-H5Nx, or pan-H5Nx) comprises S3_T2_12 (T4_HA_2 + T2_NA_3 + T2_M2_1)(comprising amino acid sequence of SEQ ID NO:20), and S3_T2_13 (T2_HA_9 + T2_NA_12 + T2_M2_1)(comprising amino acid sequence of SEQ ID NO:21), both are in string format and are combined in one LNP, termed LNP-3. Figure 67 shows a study schedule of mice vaccinated with DIOS panH5Nx and controls as detailed in Table 6 below. Table 6. Immunisation and challenge schedule for the vaccine candidate panH5Nx and control WIV in mice against multiple H5N1 viruses. Figure 68 shows serum neutralising titres as shown by IC50 values determined by pMN against the selected H5N1 challenge viruses from immunised mice taken on D49 prior to challenge. Dashed line indicates an IC50 value of 1000. Plots show the median and interquartile range of individual mouse serum samples. Mice immunised with DIOS pan- H5Nx displayed titres (IC50≥103) against A / British Columbia / PHL-2032 / 2024 (H5) (clade 2.3.4.4b), and A / Vietnam / 1203 / 2004 (H5) (clade 1). Titres were more modest for all groups against A / Cambodia / NPH230032 / 2023 (H5) (clade 2.3.2.1c). WIV2.3.4.4b only elicited titres against the clade 2.3.4.4b PV and was significantly inferior to DIOS pan-H5Nx against all PV tested. Figure 69 shows NAI titres against N1, N6, and N8 (Table 7) PV panels as shown by IC50 values determined by pELLA. Dashed line indicates an IC50 value of 200. DIOS pan-H5Nx showed considerable N1 and N6 inhibition (IC50≥102) against all PV tested, whereas the WIV2.3.4.4bmice did not inhibit any of the PV tested including the N8 PV despite having an N8 component. Table 7 Accession id of the NA proteins of the virus strains used for generating the pseudotype virus panel for pseudotype enzyme-linked lectin assay (pELLA). Mice were then challenged in parallel with three distinctly different clades of H5N1 (clades 1, 2.3.2.1c, and 2.3.4.4b) that have caused human infections, thereby representing potential pandemic threats. Weight loss and clinical symptoms of influenza infection were observed during the 14-day study window or until mice were culled for reaching the humane endpoint (Figures 70 to 72, discussed below). Figure 70 shows efficacy data for all immunisation groups as observed post-challenge with A / British Columbia / PHL-2032 / 2024 (H5N1) (clade 2.3.4.4b) [BC / 2024]. A) Kaplan-Meier survival curves with p values indicating the result of Log-Rank (Mantel-Cox) test of all immunisation groups challenged. B) Weights as monitored for all immunisation groups for 14 days and changes to initial weight indicated as % on the y-axis. C) Tissue culture 50% infectious dose (TCID50) values per gram of lung and spleen tissue collected 4dpc. Plots show the median and interquartile range of individual mouse serum samples. The results show that the H5Nx vaccine and WIV2.3.4.4b elicited comparable results regarding % survival and 50% infectious dose values per gram in the spleen against clade 2.3.4.4b. H5Nx elicited superior results regarding % change to initial weight and 50% infectious dose values per gram in the lung against clade 2.3.4.4b. Figure 71 shows efficacy data for all immunisation groups as observed post-challenge with A / Cambodia / NPH230032 / 2023 (H5N1) (clade 2.3.2.1c) [KHM / 2023HN]. A) Kaplan-Meier survival curves with p values indicating the result of Log-Rank (Mantel-Cox) test of all immunisation groups challenged. B) Weights as monitored for all immunisation groups for 14 days and changes to initial weight indicated as % on the y-axis. C) Tissue culture 50% infectious dose (TCID50) values per gram of lung and spleen tissue collected 4dpc. Plots show the median and interquartile range of individual mouse serum samples. The results show that the H5Nx vaccine elicited superior results across figure 71(a), (b), and (c). Figure 72 shows efficacy data for all immunisation groups as observed post-challenge with A / Vietnam / 1203 / 2004 (H5N1) (clade 1) [VN / 2004]. A) Kaplan-Meier survival curves with p values indicating the result of Log-Rank (Mantel-Cox) test of all immunisation groups challenged. B) Weights as monitored for all immunisation groups for 14 days and changes to initial weight indicated as % on the y-axis. C) Tissue culture 50% infectious dose (TCID50) values per gram of lung and spleen tissue collected 4dpc. Plots show the median and interquartile range of individual mouse serum samples. The results show that the H5Nx vaccine elicited superior results across figure 72(a), (b), and (c). There was 100% survival, supported by no weight loss or symptoms of influenza infection observed in mice immunised with DIOS pan-H5Nx against all viruses for the duration of the study demonstrating complete protection from multi-clade H5 HPAI challenge (Fig.70-72). In contrast, animals immunised with WIV2.3.4.4bwere only protected in the matched clade 2.3.4.4b challenge (Fig. 70a); 67% survival with weight loss and clinical symptoms commencing 5 days post-challenge (dpc) against 2.3.2.1c H5N1 (Fig.71a); and 50% survival with weight loss observed as early as 4dpc against clade 1 H5N1 (Fig.72a). All mice from the naive group did not survive any of the challenges and were culled due to reaching humane endpoints as early as 5dpc. The extent of protection conferred by DIOS pan-H5Nx compared to WIV2.3.4.4bimmunisation was further characterised by determining infectious viral titres in lung and spleen. For this, 6 mice per group were culled 4dpc and tissues harvested. Virus titres in lung and spleen were below the limit of detection (LOD) in mice immunised with DIOS pan-H5Nx (Fig.70c, 71c, 72c). In contrast, virus could be detected in the lungs of WIV2.3.4.4b mice challenged with clade 1 H5N1 (Fig.72c). Virus titres were observed in lungs of naive mice (Fig.70-72c) and the clade 2.3.4.4b virus was also detected in their spleens (Fig.70c). This evidence suggests that DIOS pan-H5Nx protects mice against lethal challenge of divergent H5N1 viruses by limiting viral replication in the lungs, thereby controlling infection which then correlated with survival. Example 9 Efficacy of Pre-pandemic H5Nx vaccine in ferrets The data presented in this example is a continuation of the data in Example 6. To correlate immunogenicity with efficacy in ferrets, a well-characterised and widely accepted model of human influenza infection, we administered DIOS pan-H5Nx in its original lipid nanoparticle (LNP) formulation, and in another improved dose-sparing LNP, designated as DIOS pan-H5Nx_FML2, and compared it to adjuvanted inactivated antigen A / Astrakhan / 3212 / 2020 (H5N8) (WIV2.3.4.4b). This is to determine a lower formulation dose in a ferret study that would maintain or exceed the immune responses observed in mice. Figure 73 shows a study schedule of ferrets vaccinated with DIOS pan-H5Nx, DIOS pan- H5Nx_FML2, a dose-sparing version of the same antigen in a different LNP formulation, and indicated controls as detailed in Table 8. Bleeds taken on D42 were used for all subsequent serological assays. Ferrets were challenged on D49 with the highly pathogenic A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1), a clade 2.3.4.4b H5N1 virus. DIOS pan-H5Nx was given at a dose of 100 µg, and DIOS pan-H5Nx_FML2 at a dose of 25 µg. Table 8 Immunisation and challenge schedule for the vaccine candidates and control WIV in ferrets. Figure 74 shows strain-specific binding antibodies against antigens from relevant H5 clades using ELISA. The y axis represents the logarithm of area under the curve (AUC) values from ELISA binding curves. Plots show the median and interquartile range of individual ferret serum samples (n=6 in DIOS pan-H5Nx, WIV2.3.4.4b, and naive; n=8 in DIOS pan- H5NX_FML2). All immunised groups seroconverted as measured by ELISA assays with sera from the WIV2.3.4.4bgroup showing superior antibody binding. Figure 75 shows serum neutralising titres as shown by IC50 values determined by pMN against a H5 pseudotype virus panel from immunised ferrets. Dashed line indicates an IC50 value of 1000. Plots show the median and interquartile range of individual ferret serum samples (n=6 in DIOS pan-H5Nx, WIV2.3.4.4b, and naive; n=8 in DIOS pan-H5NX_FML2). Serum collected from DIOS pan-H5Nx and DIOS pan-H5NX_FML2 ferrets on D42 showed appreciable neutralising titres, with the latter demonstrating the highest IC50 titres among all test groups against all H5 PV tested. There was a difference in neutralisation of clades 2.1.3.2, 2.2, 2.2.1, 2.2..1.1, and 2.3.2.1a between DIOS pan-H5NX_FML2 and WIV2.3.4.4b, where the WIV showed no reactivity. As expected, all groups except for naive induced considerable serum neutralisation (~104) against all 2.3.4.4 PV tested, with DIOS pan- H5NX_FML2 and WIV2.3.4.4b showing higher responses than the DIOS pan-H5Nx ferrets. Only DVX-panH5NX_FML2 demonstrated titres against 2.3.4.4h PV. Figure 76 shows NAI titres against N1 and N6 pseudotype virus panels as shown by IC50 values determined by pELLA of sera from immunised ferrets and controls. Dashed line indicates an IC50 value of 200. Plots show the median and interquartile range of individual ferret serum samples (n=6 in DIOS pan-H5Nx, WIV2.3.4.4b, and naive; n=8 in DIOS pan- H5NX_FML2). Neuraminidase inhibition (IC50>102) was detected for DIOS pan-H5Nx and DIOS pan-H5NX_FML2 against majority of N1 and N6 PV tested, while WIV2.3.4.4b with an N8 component was not able to inhibit the N8 PV. Figure 77 shows hemagglutination inhibition (HI) titres of sera from immunised ferrets against a H5 virus panel representing various A / H5 clades. H5 clade is denoted in brackets. HI titres are expressed as the highest dilution of serum that inhibited hemagglutination completely. Dashed line indicates a HI titre of 40, the accepted threshold for a seroprotective response in this assay. Plots show the median and interquartile range of individual ferret serum samples (n=6 in DIOS pan-H5Nx, and WIV2.3.4.4b; n=8 in DIOS pan-H5NX_FML2). Hemagglutination inhibition (HI) revealed comparable HI titres in all immunised groups. Notably, for DIOS pan-H5Nx sera, 4-10-fold higher HI titres was recorded for viruses from clades 1 and 2.2.1, and a 2-fold increase against 2.3.2.1c compared to WIV2.3.4.4b, emphasising the breadth of cross-reactivity induced by DIOS pan-H5Nx compared to the narrow specificity of WIV2.3.4.4b. Despite lower levels of antibodies detected against clade 1 and clade 2.3.2.1c antigens by the DVX-panH5Nx and DVX-panH5NX_FML2 groups (Figure 74), these groups recorded higher median values in both HA neutralisation, NA inhibition and HI assays (Fig.75-77). To evaluate the induction of T-cell responses that were cross-reactive to the challenge virus, ferret PBMCs were stimulated with whole inactivated A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1). Figure 78(a) (left-hand figure) shows representative wells showing spot-forming units (SFU) from various stimulations obtained by ELISpot, shown for all immunisation groups. Relative SFU per million cells obtained by ELISpot were plotted to measure antigen- specific T cells in ferret pBMCs (right-hand figure). IFN-γ secretion was evaluated after stimulation with 100 HA units / mL of inactivated A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1) challenge virus, indicated as ch / ITA / 2023. Plots show the median and interquartile range of individual ferret serum samples (n=6 in DIOS pan-H5Nx, WIV2.3.4.4b, and naive; n=8 in DIOS pan-H5NX_FML2). Representative IFN-γ ELISpot results for both DIOS and WIV groups showed more spot-forming units (SFU) when compared to naive controls. Taken together, these findings demonstrated that DIOS pan-H5Nx and DIOS pan- H5NX_FML2 elicit robust B-cell responses including broad neutralisation across diverse H5 clades, N1 and N6 inhibition, as well as T-cell responses. DIOS pan-H5NX_FML2, which was given at a quarter of the dose of DIOS pan-H5Nx, was able to induce comparable and even superior immune responses suggesting that a lower dose in the new LNP formulation may improve efficacy. Figure 78 (b) shows superior efficacy of DIOS pan-H5Nx_FML2 and DIOS pan-H5Nx in ferrets compared to WIV2.3.4.4bin a heterologous 2.3.4.4b challenge with A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1), a representative virus of the current panzootic of 2.3.4.4b. A / chicken / Italy / 23VIR3799-1 / 2023 also contains a 4-amino acid difference in the HA with WIV2.3.4.4b, as shown by Kaplan-Meier survival curves for all immunisation groups during the 14-day challenge window. p value indicates the result of Log-Rank (Mantel-Cox) test among all groups. During the 14-day post-challenge (dpc) monitoring period, all naive control ferrets, and 50% of animals immunised with WIV2.3.4.4b, reached clinical endpoint or succumbed to disease by 8dpc. In contrast, DIOS pan-H5Nx_FManimals all survived (100%), and only 1 animal from the DIOS pan-H5Nx group reached the humane endpoint requiring culling. Figure 79 (a) shows change in initial weights for the ferrets from each immunisation group. Ferrets were challenged on D49 with the highly pathogenic A / chicken / Italy / 23VIR3799- 1 / 2023 (H5N1), a clade 2.3.4.4b H5N1 virus. Weights were monitored for all immunisation groups for 14 days and changes to initial weight are indicated in % on the y-axis. Plot shows the mean values with standard deviation. There was no weight loss observed in the DIOS pan-H5Nx_FML2 ferrets. There was minimal weight loss and higher temperatures observed in DIOS pan-H5Nx compared to WIV2.3.4.4b animals. Nonetheless, DIOS pan-H5Nx and DIOS pan-H5Nx_FML2 mRNA immunisation better protected ferrets from weight loss in comparison to WIV2.3.4.4b, as indicated by the significantly higher weight of animals between 4-8dpc. Figure 79(b) shows that rectal temperature for all immunisation groups monitored for 14 days and changes to baseline temperature (0dpc) indicated on the y-axis. Plot shows the mean values with standard deviation. There was no change in temperature observed in the DIOS pan-H5Nx_FML2 ferrets while there were higher temperatures observed in DIOS pan-H5Nx compared to WIV2.3.4.4b animals. Figure 80 shows cumulative clinical score for the ferret groups as summarised from clinical signs of infection in ferrets recorded twice daily during the challenge window with a Clinical Score of 0 given to ferrets with no symptoms, and 4 to ferrets with severe symptoms resulting in culling. Ferrets were challenged on D49 with the highly pathogenic A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1), a clade 2.3.4.4b H5N1 virus. Evidence of clinical disease was first detected at 3dpc in naive controls, and at 1dpc in some of the vaccinated animals, with peak severity recorded 7-9dpc. In comparison to all groups, DIOS pan- H5Nx_FML2 showed significantly lower clinical scores on 7-10dpc, the peak of infection, followed by ferrets immunised with DIOS pan-H5Nx that achieved significantly lower clinical scores between 5-8dpc, and WIV2.3.4.4b ferrets with significantly lower scores on 5-6dpc compared to naive. All survivors had improved clinical outcomes reflected by less weight loss and lower clinical scores (Figure 79(a) and 80). To make sense of the clinical outcomes shown in Figure 80, HI titres were monitored on 21, 42, and 50 dpi, against challenge viruses A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1), and A / Astrakhan / 3212 / 2020 (H5N8), homologous to WIV2.3.4.4b (Figure 81). The dashed line indicates a HI titre of 40. The plot shows the median and interquartile range of individual ferret serum samples. Peak responses were observed at 42dpi for all groups against both viruses. WIV2.3.4.4b, DIOS pan-H5NX_FML2, and DIOS pan-H5Nx groups showed decreased HI titres against the challenge strain of 1:40, 1:20, and 1:15, respectively on day 50, suggesting that correlates of protection other than HI titres impact vaccine efficacy. All groups except for naive demonstrated seroprotective titres (HI>40) post-challenge. Figure 82 shows shedding of viral RNA from nasal washes detected using droplet digital polymerase chain reaction (ddPCR). Nasal shedding is indicated as log10 genome copies / mL on the y-axis, with days post challenge (dpc) on the x-axis. Ferrets were challenged on D49 with the highly pathogenic A / chicken / Italy / 23VIR3799-1 / 2023 (H5N1), a clade 2.3.4.4b H5N1 virus. From 8-12 dpc, only surviving ferret numbers per group are presented. The limit of detection (LOD) at 2.65 (log10 genome copies / mL) is indicated by a dashed line. The plot shows the median and interquartile range of individual ferret serum samples. There was no difference in viral shedding from collected nasal washes between DIOS pan-H5NX_FML2 and WIV2.3.4.4b ferrets. Interestingly, despite superior clinical protection, higher shedding was observed in some DIOS pan-H5Nx ferrets in the early days of infection (prior to 6dpc) compared to WIV2.3.4.4b. This decreased from 6dpc onwards while in naive disease progressors, viral RNA copies remained high, suggesting that immunisation-related survival was linked to low viral RNA loads during the latter part of the challenge window. In ferrets that survived, there were no significant differences in viral RNA loads in immunised animals. Figure 83 shows viral RNA in post-mortem tissues and organs detected using ddPCR and indicated as genome copies / µL RNA on the y-axis with days post challenge (dpc) on the x- axis. Ferrets were challenged on D49 with the highly pathogenic A / chicken / Italy / 23VIR3799- 1 / 2023 (H5N1), a clade 2.3.4.4b H5N1 virus. Viral RNA was extracted from samples on the day of culling for each individual ferret. LOD is indicated by dotted line. The plot shows the median and interquartile range of individual ferret serum samples. Viral assays from post- mortem samples from bronchoalveolar lavages, lung, liver, spleen, and pancreas, demonstrated low values (below the limit of detection) in all survivors (14dpc). For non- survivors, titres are shown from post-mortem samples taken at the time of death. Figure 84 shows representative wells showing spot-forming units (SFU) from various stimulations obtained by ELISpot for all immunisation groups (left-hand figure). Days post- challenge when PBMCs were collected are indicated, with those obtained at 7dpc and 8dpc coming from ferrets from each vaccination group that were culled for reaching humane endpoints. Wells showing 14dpc indicate ferrets that survived the challenge. Relative SFU per million cells obtained by ELISpot were plotted to measure antigen-specific T cells in ferret PBMCs (right-hand figure). For all plots, n=6 ferrets / group; n=8 for DIOS pan-H5Nx_FML_2. Additionally, greater T-cell responses in DIOS pan-H5Nx vaccinated animals was observed post-challenge, indicating robust effector immune responses that facilitated viral clearance. There were lower spot forming units (SFU) detected in DIOS pan-H5Nx_FML_2, all of which survived challenge, suggesting that protection may have been mainly driven by humoral responses. Example 10 Seasonal and Universal Influenza Vaccine Candidates This example shows immunogenicity and efficacy of seasonal and universal Influenza vaccine candidates with or without M1 antigen in mice and ferrets. The antigenic composition of the seasonal vaccine (SIV) candidate is shown in Figure 7, whereas the composition and antigens used for the universal vaccine (UIV) formulation is displayed in Figure 8 and Table 2. Figure 7 shows the antigenic composition of the DIOSynVax first generation Seasonal Influenza Vaccine Antigen Payload (VAP) containing Influenza A virus (IAV) Hemagglutinin (HA) subtypes H1 (T2_HA_3; SEQ ID NO:1), and H3 (T2_HA_46 and T2_HA_49; SEQ ID NO:5 and SEQ ID NO:6), and Influenza B virus (IBV) HA (T3_HA_10; SEQ ID NO:8), IAV Neuraminidase (NA) subtypes N1 (T3_NA_3; SEQ ID NO:2), and N2 (T2_NA_31; SEQ ID NO:7), and IBV NA (T3_NA_5; SEQ ID NO:9). Also included are IAV Matrix 1 (M1; SEQ ID NO:4) and Matrix 2 (M2; SEQ ID NO:3) antigens. H1, N1, and M2 are in “string” format and is denoted as S3_T2_8 (SEQ ID NO:19). Components are distributed into two Lipid Nanoparticles (LNP), LNP-1, and LNP-2. The M1 protein is optionally present in LNP-1. Figure 8 shows the composition of the DIOSynVax first generation Universal-type Influenza VAP. The VAP contains the antigens from the Seasonal VAP (Figure 7), the pan-H5Nx pre- pandemic VAP (Figure 1), and additionally, LNP-4 containing IAV H7 (T2_HA_12; SEQ ID NO:14), H9 (T2_HA_31; SEQ ID NO:15), N5 (T2_NA_11; SEQ ID NO:16), N7 (T2_NA_14; SEQ ID NO:17), and N9 (T2_NA_18; SEQ ID NO:18). The M1 protein in the Seasonal VAP is optionally present in LNP-1. Figure 85(a) shows hemagglutination inhibition (HI) titres of sera from immunised mice against a relevant H3 virus panel representing current and emerging seasonal H3 viruses. HI titres are expressed as the highest dilution of serum that inhibited hemagglutination completely. The dashed line indicates a HI titre of 40, the accepted threshold for a seroprotective response in this assay. The plots show the median and interquartile range of individual mouse serum samples. Hemagglutination inhibition (HI) revealed comparable HI titres in all immunised groups. DIOS Seasonal + M1 appears to have more breadth than the strain-specific quadrivalent influenza vaccine (QIV) which does not produce HI titres against A / Darwin / 9 / 2021. Figure 85(b) shows hemagglutination inhibition (HI) titres of sera from immunised ferrets against a relevant H3 virus panel representing current and emerging seasonal H3 viruses. The ferrets were immunised with either the Seasonal VAP containing the M1 protein, QIV, or naive control. HI titres are expressed as the highest dilution of serum that inhibited hemagglutination completely. The dashed line indicates a HI titre of 40, the accepted threshold for a seroprotective response in this assay. The plots show the median and interquartile range of individual ferret serum samples. Hemagglutination inhibition (HI) revealed comparable HI titres in all immunised groups. DIOS Seasonal appears to have more breadth than the strain-specific QIV, which only has titres above the threshold against its homologous A / Darwin / 6 / 2021 virus. Figure 86(a) shows a schematic representation of the H3 head construct, T2_HA_49 (A / Darwin / 9 / 2021), engineered as a membrane-tethered construct by fusing the C-terminus of the protein sequence to the vesicular stomatitis virus (VSV) membrane anchor through a flexible linker ((GGGS)\₅), and incorporating a tissue-type plasminogen activator (t-PA) signal peptide to enhance protein trafficking and membrane expression. The wild-type head region was selected to preserve strain-specific antigenic determinants. Figure 86(b) shows a schematic representation of the H3 stem construct, (T2_HA_46), designed based on phylogenetic analysis of multiple H3N2 sequences to generate a broadly representative consensus stem. Separation of the stem from the head reduces immunodominance of the variable head, and enhances the potential for eliciting cross- reactive antibody responses.
Claims
Claims 1. A multiple subunit influenza vaccine, which comprises: i) one or more subunits comprising nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, and optionally an M1 matrix protein; and ii) one or more further subunits comprising nucleic acid encoding: a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein; and iii) one or more additional subunits comprising nucleic acid encoding: an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein.
2. A vaccine according to claim 1, wherein the one or more subunits of (i) comprise: a) a first subunit which comprises nucleic acid encoding: the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein, and optionally the M1 matrix protein; and b) a second subunit which comprises nucleic acid encoding: the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein.
3. A vaccine according to claim 2, wherein: the first subunit comprises a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein, and optionally a second isolated nucleic acid which comprises nucleotide sequence encoding the M1 matrix protein; andthe second subunit comprises nucleic acid encoding the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein, wherein the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein are each encoded by different nucleic acid molecules.
4. A vaccine according to claim 1, wherein the one or more subunits of (i) comprise a single subunit which comprises nucleic acid encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein, the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 Matrix protein.
5. A vaccine according to claim 4, wherein the single subunit comprises: a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein; a second isolated nucleic acid which comprises nucleotide sequence encoding the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, and the N2 neuraminidase protein; and a third isolated nucleic acid which comprises nucleotide sequence encoding the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 matrix protein.
6. A vaccine according to any preceding claim, wherein the one or more further subunits of (ii) comprise: a subunit which comprises nucleic acid encoding the first H5 haemagglutinin protein, the second N1 neuraminidase protein, the M2 matrix protein, the second H5 haemagglutinin protein, and the N6 neuraminidase protein.
7. A vaccine according to claim 6, wherein the subunit comprises a first isolated nucleic acid which comprises nucleic acid sequence encoding the first H5 haemagglutinin protein, the second N1 neuraminidase protein, and the M2 matrix protein, and a second isolated nucleic acid comprises nucleic acid sequence encoding the second H5 haemagglutinin protein, the N6 neuraminidase protein, and the M2 matrix protein.
8. A vaccine according to any preceding claim, wherein the one or more additional subunits of (iii) comprise: a subunit which comprises nucleic acid encoding the H7 haemagglutinin protein, the N7 neuraminidase protein, the N5 neuraminidase protein, the N9 neuraminidase protein, and the H9 haemagglutinin protein.
9. A vaccine according to claim 8, wherein the H7 haemagglutinin protein, the N7 neuraminidase protein, the N5 neuraminidase protein, the N9 neuraminidase protein, and the H9 haemagglutinin protein are each encoded by different nucleic acid molecules.
10. A seasonal influenza vaccine, which comprises one or more subunits comprising nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, and optionally an M1 matrix protein.
11. A vaccine according to claim 10, wherein the one or more subunits comprise: a) a first subunit which comprises nucleic acid encoding: the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein, and optionally the M1 matrix protein; and b) a second subunit which comprises nucleic acid encoding: the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein.
12. A vaccine according to claim 11, wherein: the first subunit comprises a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and M2 matrix protein, and optionally a second isolated nucleic acid which comprises nucleotide sequence encoding the M1 matrix protein; andthe second subunit comprises nucleic acid encoding the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein, wherein the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, and the IBV neuraminidase protein are each encoded by different nucleic acid molecules.
13. A vaccine according to claim 10, wherein the one or more subunits comprise a subunit which comprises nucleic acid encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein, the first H3 haemagglutinin protein, the second H3 haemagglutinin protein, the N2 neuraminidase protein, the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 matrix protein.
14. A vaccine according to claim 13, wherein the subunit comprises: a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, the M2 matrix protein; a second isolated nucleic acid which comprises nucleotide sequence encoding the first H3 haemagglutinin protein, the N2 neuraminidase protein, and the second H3 haemagglutinin protein; and a third isolated nucleic acid which comprises nucleotide sequence encoding the influenza B virus (IBV) haemagglutinin protein, the IBV neuraminidase protein, and optionally the M1 matrix protein.
15. A pre-pandemic influenza vaccine which comprises one or more subunits comprising nucleic acid encoding: a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein.
16. A vaccine according to claim 15, wherein the one or more subunits comprise: a subunit comprising a first isolated nucleic acid which comprises nucleic acid sequence encoding the first H5 haemagglutinin protein, the second N1 neuraminidase protein, and the M2 matrix protein, and a second isolated nucleic acid encoding the secondH5 haemagglutinin protein, the N6 neuraminidase protein, and the M2 matrix protein, wherein the second isolated nucleic acid is separate from the first isolated nucleic acid.
17. An influenza vaccine which comprises one or more subunits comprising nucleic acid encoding an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein.
18. A vaccine according to claim 17, wherein the H7 haemagglutinin protein, N7 neuraminidase protein, N5 neuraminidase protein, N9 neuraminidase protein, and H9 haemagglutinin protein are each encoded by different nucleic acid molecules.
19. An influenza vaccine comprising a subunit which comprises nucleic acid encoding: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, and optionally an M1 matrix protein.
20. A vaccine according to claim 19, wherein the subunit comprises a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and M2 matrix protein, and optionally a second isolated nucleic acid which comprises nucleotide sequence encoding the M1 matrix protein.
21. An influenza vaccine comprising a subunit which comprises nucleic acid encoding: a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, and an IBV neuraminidase protein.
22. A vaccine according to claim 21, wherein the first H3 haemagglutinin protein, second H3 haemagglutinin protein, N2 neuraminidase protein, influenza B virus (IBV) haemagglutinin protein, and IBV neuraminidase protein are each encoded by different nucleic acid molecules.
23. A vaccine according to any of claims 1 to 9 (in relation to the one or more subunits of (i)), or any of claims 10 to 14, or 19, or 20, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / orthe first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present, the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4).
24. A vaccine according to any of claims 1 to 9 (in relation to the one or more subunits of (i)), or any of claims 10 to 14, or 19, or 20, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4).
25. A vaccine according to any of claims 1 to 14, 21, 22, 23, or 24, wherein: the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
26. A vaccine according to any of claims 1 to 14, 21, 22, 23, or 24, wherein: the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
27. A vaccine according to any of claims 1 to 9 (in relation to the one or more further subunits of (ii)), or according to any of claims 15, 16, or 23 to 26, wherein: the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13).
28. A vaccine according to any of claims 1 to 9 (in relation to the one or more further subunits of (ii)), or according to any of claims 15, 16, or 23 to 26, wherein: the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); andthe second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13).
29. A vaccine according to any of claims 1 to 9 (in relation to the one or more additional subunits of (iii)), or according to any of claims 17, 18, or 23 to 28, wherein: the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
30. A vaccine according to any of claims 1 to 9 (in relation to the one or more additional subunits of (iii)), or according to any of claims 17, 18, or 23 to 28, wherein: the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); andthe N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
31. A vaccine according to any of claims 1 to 30, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and / orthe first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and / or the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
32. A vaccine according to any of claims 1 to 30, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); andthe first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); andthe N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
33. A vaccine according to any of claims 1 to 30, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and / or the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / orthe N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and / or the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
34. A vaccine according to any of claims 1 to 30, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); andthe IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
35. A vaccine according to any of claims 1 to 30, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / orthe M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
36. A vaccine according to any of claims 1 to 30, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); andthe N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
37. A vaccine according to any of claims 1 to 30, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
38. A vaccine according to any of claims 1 to 30, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); andthe first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
39. A vaccine according to any of claims 3, 5, 12, 14, 20, or 23 to 38, wherein the first isolated nucleic acid comprises S3_T2_8 (SEQ ID NO:19) amino acid sequence.
40. A vaccine according to claim 7 or 16, wherein the first isolated nucleic acid comprises S3_T2_12 (SEQ ID NO:20) amino acid sequence, and the second isolated nucleic acid comprises S3_T2_13 (SEQ ID NO:21) amino acid sequence.
41. A vaccine according to any of claims 1 to 14, 19, 20, or 23 to 40, wherein: the nucleic acid encoding the H1 haemagglutinin protein comprises T2_HA_3 nucleotide sequence (SEQ ID NO:22); and / or the nucleic acid encoding the first N1 neuraminidase protein comprises T3_NA_3 nucleotide sequence (SEQ ID NO:23); and / or the nucleic acid encoding the M2 matrix protein comprises T2_M2_1 nucleotide sequence (SEQ ID NO:24); and / orwhere present, the nucleic acid encoding the M1 matrix protein comprises T2_M1_1 nucleotide sequence (SEQ ID NO:25).
42. A vaccine according to any of claims 1 to 14, 19, 20, or 23 to 40, wherein: the nucleic acid encoding the H1 haemagglutinin protein comprises T2_HA_3 nucleotide sequence (SEQ ID NO:22); and the nucleic acid encoding the first N1 neuraminidase protein comprises T3_NA_3 nucleotide sequence (SEQ ID NO:23); and the nucleic acid encoding the M2 matrix protein comprises T2_M2_1 nucleotide sequence (SEQ ID NO:24); and where present, the nucleic acid encoding the M1 matrix protein comprises T2_M1_1 nucleotide sequence (SEQ ID NO:25).
43. A vaccine according to any of claims 1 to 14, or 21 to 42, wherein: the nucleic acid encoding the first H3 haemagglutinin protein comprises T2_HA_46 nucleotide sequence (SEQ ID NO:26); and / or the nucleic acid encoding the second H3 haemagglutinin protein comprises T2_HA_49 nucleotide sequence (SEQ ID NO:27); and / or the nucleic acid encoding the N2 neuraminidase protein comprises T2_NA_31 nucleotide sequence (SEQ ID NO:28); and / or the nucleic acid encoding the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 nucleotide sequence (SEQ ID NO:29); and / or the nucleic acid encoding the IBV neuraminidase protein comprises T3_NA_5 nucleotide sequence (SEQ ID NO:30).
44. A vaccine according to any of claims 1 to 14, or 21 to 42, wherein: the nucleic acid encoding the first H3 haemagglutinin protein comprises T2_HA_46 nucleotide sequence (SEQ ID NO:26); andthe nucleic acid encoding the second H3 haemagglutinin protein comprises T2_HA_49 nucleotide sequence (SEQ ID NO:27); and the nucleic acid encoding the N2 neuraminidase protein comprises T2_NA_31 nucleotide sequence (SEQ ID NO:28); and the nucleic acid encoding the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 nucleotide sequence (SEQ ID NO:29); and the nucleic acid encoding the IBV neuraminidase protein comprises T3_NA_5 nucleotide sequence (SEQ ID NO:30).
45. A vaccine according to any of claims 1 to 9, 15, 16, or 23 to 44, wherein: the nucleic acid encoding the first H5 haemagglutinin protein comprises T4_HA_2 nucleotide sequence (SEQ ID NO:31); and / or the nucleic acid encoding the second N1 neuraminidase protein comprises T2_NA_3 nucleotide sequence (SEQ ID NO:32); and / or the nucleic acid encoding the M2 matrix protein comprises T2_M2_1 nucleotide sequence (SEQ ID NO:24); and / or the nucleic acid encoding the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:33); and / or the nucleic acid encoding the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:34).
46. A vaccine according to any of claims 1 to 9, 15, 16, or 23 to 44, wherein: the nucleic acid encoding the first H5 haemagglutinin protein comprises T4_HA_2 nucleotide sequence (SEQ ID NO:31); and the nucleic acid encoding the second N1 neuraminidase protein comprises T2_NA_3 nucleotide sequence (SEQ ID NO:32); and the nucleic acid encoding the M2 matrix protein comprises T2_M2_1 nucleotide sequence (SEQ ID NO:24); andthe nucleic acid encoding the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:33); and the nucleic acid encoding the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:34).
47. A vaccine according to any of claims 1 to 9, 17, 18, or 23 to 46, wherein: the nucleic acid encoding the H7 haemagglutinin protein comprises T2_HA_12 nucleotide sequence (SEQ ID NO:35); and / or the nucleic acid encoding the H9 haemagglutinin protein comprises T2_HA_31 nucleotide sequence (SEQ ID NO:36); and / or the nucleic acid encoding the N5 neuraminidase protein comprises T2_NA_11 nucleotide sequence (SEQ ID NO:37); and / or the nucleic acid encoding the N7 neuraminidase protein comprises T2_NA_14 nucleotide sequence (SEQ ID NO:38); and / or the nucleic acid encoding the N9 neuraminidase protein comprises T2_NA_18 nucleotide sequence (SEQ ID NO:39).
48. A vaccine according to any of claims 1 to 9, 17, 18, or 23 to 46, wherein: the nucleic acid encoding the H7 haemagglutinin protein comprises T2_HA_12 nucleotide sequence (SEQ ID NO:35); and the nucleic acid encoding the H9 haemagglutinin protein comprises T2_HA_31 nucleotide sequence (SEQ ID NO:36); and the nucleic acid encoding the N5 neuraminidase protein comprises T2_NA_11 nucleotide sequence (SEQ ID NO:37); and the nucleic acid encoding the N7 neuraminidase protein comprises T2_NA_14 nucleotide sequence (SEQ ID NO:38); and the nucleic acid encoding the N9 neuraminidase protein comprises T2_NA_18 nucleotide sequence (SEQ ID NO:39).
49. A vaccine according to any of claims 3, 5 to 9, 12, 14, 20, 23 to 31, or 33 to 48, which comprises a first isolated nucleic acid which comprises nucleotide sequence encoding the H1 haemagglutinin protein, the first N1 neuraminidase protein, and the M2 matrix protein, wherein the nucleotide sequence encoding the first isolated nucleic acid comprises S3_T2_8 (SEQ ID NO:40) nucleotide sequence.
50. A vaccine according to any of claims 7 to 9, 16, 23 to 30, or 32 to 48, which comprises a first isolated nucleic acid which comprises nucleic acid sequence encoding the first H5 haemagglutinin protein, the second N1 neuraminidase protein, and the M2 matrix protein, and a second isolated nucleic acid which comprises nucleic acid sequence encoding the second H5 haemagglutinin protein, the N6 neuraminidase protein, and the M2 matrix protein, wherein the nucleotide sequence encoding the first isolated nucleic acid comprises S3_T2_12 (SEQ ID NO:41) nucleotide sequence, and the nucleotide sequence encoding the second isolated nucleic acid comprises S3_T2_13 (SEQ ID NO:42) nucleotide sequence.
51. A vaccine according to any preceding claim, wherein each nucleic acid of the vaccine comprises mRNA.
52. A vaccine according to any preceding claim, wherein each nucleic acid of the vaccine is part of a vector.
53. A vaccine according to claim 52, wherein each vector further comprises a promoter operably linked to nucleic acid encoding a protein of that vector.
54. A vaccine according to claim 53, which comprises an isolated nucleic acid comprising nucleotide sequence encoding more than one protein, wherein a separate promotor is operably linked to each nucleotide sequence encoding a different protein of that isolated nucleic acid.
55. A vaccine according to claim 53 or 54, wherein the, or each, promoter is for expression of the protein encoded by the nucleic acid or nucleotide sequence to which it is operably linked in mammalian cells.
56. A vaccine according to claim 53 or 54, wherein the, or each, promoter is for expression of the protein encoded by the nucleic acid or nucleotide sequence to which it is operably linked in yeast or insect cells.
57. A vaccine according to any of claims 52 to 56, wherein each vector is a vaccine vector.
58. A vaccine according to claim 57, wherein each vaccine vector is a viral vaccine vector, a bacterial vaccine vector, an RNA vaccine vector, an mRNA vaccine vector, or a DNA vaccine vector.
59. A vaccine according to any preceding claim, wherein each subunit comprises a lipid nanoparticle (LNP) or a lipidoid nanoparticle (LiNP) which encapsulates the nucleic acid, or the nucleic acids, of that subunit.
60. A vaccine according to claim 59, which is an mRNA vaccine, wherein the, or each, nucleic acid of each subunit comprises mRNA.
61. An influenza vaccine comprising a plurality of isolated polypeptides, which comprise: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, a first H5 haemagglutinin protein, a second N1 neuraminidase protein, a second H5 haemagglutinin protein, an N6 neuraminidase protein, an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, an H9 haemagglutinin protein, and optionally an M1 matrix protein.
62. A seasonal influenza vaccine comprising a plurality of isolated polypeptides, which comprise: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, an IBV neuraminidase protein, and optionally an M1 matrix protein.
63. A pre-pandemic influenza vaccine comprising a plurality of isolated polypeptides, which comprise: a first H5 haemagglutinin protein, a second N1 neuraminidase protein, an M2 matrix protein, a second H5 haemagglutinin protein, and an N6 neuraminidase protein.
64. An influenza vaccine comprising a plurality of isolated polypeptides, which comprise: an H7 haemagglutinin protein, an N7 neuraminidase protein, an N5 neuraminidase protein, an N9 neuraminidase protein, and an H9 haemagglutinin protein.
65. An influenza vaccine comprising a plurality of isolated polypeptides, which comprise: an H1 haemagglutinin protein, a first N1 neuraminidase protein, an M2 matrix protein, and optionally an M1 matrix protein.
66. An influenza vaccine comprising a plurality of isolated polypeptides, which comprise: a first H3 haemagglutinin protein, a second H3 haemagglutinin protein, an N2 neuraminidase protein, an influenza B virus (IBV) haemagglutinin protein, and an IBV neuraminidase protein.
67. A vaccine according to any of claims 61, 62, or 65, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present, the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4).
68. A vaccine according to any of claims 61, 62, or 65, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); andwhere present, the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4).
69. A vaccine according to any of claims 61, 62, 66, 67, or 68, wherein: the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
70. A vaccine according to any of claims 61, 62, 66, 67, or 68, wherein: the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
71. A vaccine according to any of claims 61, 63, or 67 to 70, wherein:the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3).
72. A vaccine according to any of claims 61, 63, or 67 to 70, wherein: the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3).
73. A vaccine according to any of claims 61, 64, or 67 to 72, wherein: the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / orthe N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / or the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
74. A vaccine according to any of claims 61, 64, or 67 to 72, wherein: the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
75. A vaccine according to claim 61, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and / orthe first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and / or the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and / or the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and / or the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); and / or the N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and / or the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and / or the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and / or the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and / or the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and / orthe N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
76. A vaccine according to claim 61, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9); and the first H5 haemagglutinin protein comprises T4_HA_2 amino acid sequence (SEQ ID NO:10); and the second N1 neuraminidase protein comprises T2_NA_3 amino acid sequence (SEQ ID NO:11); and the second H5 haemagglutinin protein comprises T2_HA_9 amino acid sequence (SEQ ID NO:12); andthe N6 neuraminidase protein comprises T2_NA_12 amino acid sequence (SEQ ID NO:13); and the H7 haemagglutinin protein comprises T2_HA_12 amino acid sequence (SEQ ID NO:14); and the H9 haemagglutinin protein comprises T2_HA_31 amino acid sequence (SEQ ID NO:15); and the N5 neuraminidase protein comprises T2_NA_11 amino acid sequence (SEQ ID NO:16); and the N7 neuraminidase protein comprises T2_NA_14 amino acid sequence (SEQ ID NO:17); and the N9 neuraminidase protein comprises T2_NA_18 amino acid sequence (SEQ ID NO:18).
77. A vaccine according to claim 61 or 62, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / or the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / orthe N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
78. A vaccine according to claim 61 or 62, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and where present the M1 matrix protein comprises T2_M1_1 amino acid sequence (SEQ ID NO:4); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
79. A vaccine according to claim 61 or 62, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and / orthe first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and / or the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and / or the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and / or the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and / or the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); and / or the influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and / or the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
80. A vaccine according to claim 61 or 62, wherein: the H1 haemagglutinin protein comprises T2_HA_3 amino acid sequence (SEQ ID NO:1); and the first N1 neuraminidase protein comprises T3_NA_3 amino acid sequence (SEQ ID NO:2); and the M2 matrix protein comprises T2_M2_1 amino acid sequence (SEQ ID NO:3); and the first H3 haemagglutinin protein comprises T2_HA_46 amino acid sequence (SEQ ID NO:5); and the second H3 haemagglutinin protein comprises T2_HA_49 amino acid sequence (SEQ ID NO:6); and the N2 neuraminidase protein comprises T2_NA_31 amino acid sequence (SEQ ID NO:7); andthe influenza B virus (IBV) haemagglutinin protein comprises T3_HA_10 amino acid sequence (SEQ ID NO:8); and the IBV neuraminidase protein comprises T3_NA_5 amino acid sequence (SEQ ID NO:9).
81. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:13 (T2_NA_12).
82. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:4 (T2_M1_1).
83. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:5 (T2_HA_46).
84. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:6 (T2_HA_49).
85. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:7 (T2_NA_31).
86. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:8 (T3_HA_10).
87. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:9 (T3_NA_5).
88. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:14 (T2_HA_12).
89. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:15 (T2_HA_31).
90. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:16 (T2_NA_11).
91. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:17 (T2_NA_14).
92. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:18 (T2_NA_18).
93. An isolated polypeptide which comprises the amino acid sequence of SEQ ID NO:1 (T2_HA_3), SEQ ID NO:2 (T3_NA_3), and SEQ ID NO:3 (T2_M2_1).
94. An isolated polypeptide according to claim 85, which comprises the amino acid sequence of SEQ ID NO:19 (S3_T2_8).
95. An isolated polypeptide which comprises the amino acid sequence of SEQ ID NO:12 (T2_HA_9), SEQ ID NO:13 (T2_NA_12), and SEQ ID NO:3 (T2_M2_1).
96. An isolated polypeptide according to claim 87, which comprises the amino acid sequence of SEQ ID NO:21 (S3_T2_13).
97. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:13 (T2_NA_12), or the complement thereof.
98. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:4 (T2_M1_1), or the complement thereof.
99. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:5 (T2_HA_46), or the complement thereof.
100. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:6 (T2_HA_49), or the complement thereof.
101. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:7 (T2_NA_31), or the complement thereof.
102. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:8 (T3_HA_10), or the complement thereof.
103. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:9 (T3_NA_5), or the complement thereof.
104. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:14 (T2_HA_12), or the complement thereof.
105. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:15 (T2_HA_31), or the complement thereof.
106. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:16 (T2_NA_11), or the complement thereof.
107. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:17 (T2_NA_14), or the complement thereof.
108. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:18 (T2_NA_18), or the complement thereof.
109. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:19 (S3_T2_8).
110. An isolated polynucleotide comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:21 (S3_T2_13).
111. An isolated polynucleotide according to claim 97, wherein the nucleotide sequence encoding SEQ ID NO:13 (T2_NA_12) comprises the nucleotide sequence of SEQ ID NO:
34.
112. An isolated polynucleotide according to claim 98, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:4 (T2_M1_1) comprises the nucleotide sequence of SEQ ID NO:
25.
113. An isolated polynucleotide according to claim 99, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:5 (T2_HA_46) comprises the nucleotide sequence of SEQ ID NO:
26.
114. An isolated polynucleotide according to claim 100, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:6 (T2_HA_49) comprises the nucleotide sequence of SEQ ID NO:
27.
115. An isolated polynucleotide according to claim 101, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:7 (T2_NA_31) comprises the nucleotide sequence of SEQ ID NO:28.
116. An isolated polynucleotide according to claim 102, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:8 (T3_HA_10) comprises the nucleotide sequence of SEQ ID NO:
29.
117. An isolated polynucleotide according to claim 103, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:9 (T3_NA_5) comprises the nucleotide sequence of SEQ ID NO:
30.
118. An isolated polynucleotide according to claim 104, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:14 (T2_HA_12) comprises the nucleotide sequence of SEQ ID NO:
35.
119. An isolated polynucleotide according to claim 105, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:15 (T2_HA_31) comprises the nucleotide sequence of SEQ ID NO:
36.
120. An isolated polynucleotide according to claim 106, wherein the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:16 (T2_NA_11) comprises the nucleotide sequence of SEQ ID NO:
37.
121. An isolated polynucleotide according to claim 107, wherein the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:17 (T2_NA_14) comprises the nucleotide sequence of SEQ ID NO:
38.
122. An isolated polynucleotide according to claim 108, wherein the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:18 (T2_NA_18) comprises the nucleotide sequence of SEQ ID NO:
39.
123. An isolated polynucleotide according to claim 109, wherein the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:19 (S3_T2_8) comprises the nucleotide sequence of SEQ ID NO:22 (T2_HA_3), SEQ ID NO:23 (T3_NA_3), and SEQ ID NO:24 (T2_M2_1).
124. An isolated polynucleotide according to claim 123, wherein the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:19 (S3_T2_8) comprises the nucleotide sequence of SEQ ID NO:40.
125. An isolated polynucleotide according to claim 110, wherein the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:21 (S3_T2_13) comprises the nucleotide sequence of SEQ ID NO:33 (T2_HA_9), SEQ ID NO:34 (T2_NA_12), and SEQ ID NO:24 (T2_M2_1).
126. An isolated polynucleotide according to claim 125, wherein the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:21 (S3_T2_13) comprises the nucleotide sequence of SEQ ID NO:
42.
127. A vector comprising a polynucleotide of any of claims 97 to 126.
128. A vector according to claim 127, which further comprises a promoter operably linked to the nucleotide sequence encoding the amino acid sequence.
129. A vector according to claim 127, which comprises more than one nucleotide sequence encoding an amino acid sequence, wherein a separate promoter is operably linked to each different nucleotide sequence of the vector.
130. A vector according to claim 128 or 129, wherein the, or each promoter is for expression of the encoded amino acid sequence in mammalian cells.
131. A vector according to claim 128 or 129, wherein the, or each promoter is for expression of the encoded amino acid in yeast or insect cells.
132. A vector according to any of claims 128 to 129, wherein the vector is a vaccine vector.
133. A vector according to claim 132, wherein the vaccine vector is a viral vaccine vector, a bacterial vaccine vector, an RNA vaccine vector, an mRNA vaccine vector, or a DNA vaccine vector.
134. An isolated cell comprising a vector according to any of claims 128 to 133.
135. A pharmaceutical composition comprising a vaccine according to any of claims 1 to 80, and pharmaceutically acceptable carrier, excipient, or diluent.
136. A pharmaceutical composition comprising an isolated polypeptide according to any of claims 81 to 96, and pharmaceutically acceptable carrier, excipient, or diluent.
137. A pharmaceutical composition comprising an isolated polynucleotide according to any of claims 97 to 126, and a pharmaceutically acceptable carrier, excipient, or diluent.
138. A pharmaceutical composition comprising a vector according to any of claims 127 to 133, and a pharmaceutically acceptable carrier, excipient, or diluent.
139. A pharmaceutical composition according to any of claims 135 to 138, which further comprises an adjuvant for enhancing an immune response in a subject to a polypeptide, or to a polypeptide encoded by a nucleotide, of the composition.
140. A vaccine according to any of claims 1 to 80, a polypeptide according to any of claims 81 to 96, a polynucleotide according to any of claims 97 to 126, a vector according to any of claims 127 to 133, or a pharmaceutical composition according to any of claims 135 to 139, for use as a medicament.
141. A vaccine according to any of claims 1 to 80, a polypeptide according to any of claims 81 to 96, a polynucleotide according to any of claims 97 to 126, a vector according to any of claims 127 to 133, or a pharmaceutical composition according to any of claims 135 to 139, for use in the prevention, treatment, or amelioration of an influenza infection.
142. Use of a vaccine according to any of claims 1 to 80, a polypeptide according to any of claims 81 to 96, a polynucleotide according to any of claims 97 to 126, a vector according to any of claims 127 to 133, or a pharmaceutical composition according to any of claims 135 to 139, in the manufacture of a medicament for the prevention, treatment, or amelioration of an influenza infection.
143. A method of inducing an immune response to an influenza virus in a subject, which comprises administering to the subject an effective amount of: a vaccine according to any of claims 1 to 80; a polypeptide according to any of claims 81 to 96; a polynucleotide according to any of claims 97 to 126; a vector according to any of claims 127 to 133; or a pharmaceutical composition according to any of claims 135 to 139.
144. A method of immunising a subject against an influenza virus, which comprises administering to the subject an effective amount of: a vaccine according to any of claims 1 to 80; a polypeptide according to any of claims 81 to 96; a polynucleotide according to any of claims 97 to 126; a vector according to any of claims 127 to 133; or a pharmaceutical composition according to any of claims 135 to 139.
145. A method according to claim 143 or 144, which comprises administering to the subject an effective amount of a multiple subunit vaccine according to any of claims 1 to 60, wherein the subunits of the vaccine are co-administered as a mixture.
146. A method according to claim 143 or 144, which comprises administering to the subject an effective amount of a multiple subunit vaccine according to any of claims 1 to 60, wherein the subunits of the vaccine are co-administered simultaneously as separate subunits, or sequentially.
147. A method according to any of claims 143 to 146, which comprises administering: a vaccine according to any of claims 1 to 80; a polypeptide according to any of claims 81 to 96; a polynucleotide according to any of claims 97 to 126; a vector according to any of claims 127 to 133; or a pharmaceutical composition according to any of claims 135 to 139; as part of a prime boost regimen.
148. A method according to any of claims 143 to 147, wherein the vaccine comprises the nucleic acid of subunits (i), (ii), and (iii) as recited in any of claims 1 to 60, or polypeptides encoded by the nucleic acid of subunits (i), (ii), and (iii) as recited in any of claims 1 to 60, and wherein the influenza is an influenza A or influenza B virus, optionally wherein:the influenza virus is a seasonal influenza virus, wherein the seasonal influenza virus is an H1, an N1, an H1N1, an H3, an N2, an H3N2, a B / Yamagata, and / or a B / Victoria influenza virus; the influenza virus is a potential future pandemic influenza virus, wherein the virus is an H5 influenza virus, wherein the H5 influenza virus is a clade 7.1, 1, 2.2, 2.2.1, 2.3.2.1a, 2.3.4, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, 2.3.4.4c, 2.3.4.4h_2018, and / or 2.3.4.4h_2020 H5 influenza virus, and / or wherein the virus is an N6, N1, H5, H9, H7, N7, and / or an N9 influenza virus.
149. A method according to any of claims 143 to 147, wherein the vaccine comprises the nucleic acid of subunit (i) as recited in any of claims 1 to 60, or polypeptides encoded by the nucleic acid of subunit (i) as recited in any of claims 1 to 60, and wherein the influenza is an influenza A or influenza B virus, optionally wherein: the influenza virus is a seasonal influenza virus, wherein the seasonal influenza virus is an H1, an N1, an H1N1, an H3, an N2, an H3N2, a B / Yamagata, and / or a B / Victoria influenza virus.
150. A method according to any of claims 143 to 147, wherein the vaccine comprises nucleic acid encoding subunit (ii) as recited in any of claims 1 to 60, or polypeptides encoded by the nucleic acid of subunit (ii) as recited in any of claims 1 to 60, and wherein the influenza virus is a potential future pandemic influenza virus, optionally wherein the influenza virus is an influenza A virus, optionally wherein the influenza A virus is an H5 influenza virus, wherein the H5 influenza virus is a clade 7.1, 1, 2.2, 2.2.1, 2.3.2.1a, 2.3.4, 2.3.4.4a, 2.3.4.4b avian, 2.3.4.4b human, 2.3.4.4c, 2.3.4.4h_2018, or a 2.3.4.4h_2020, and / or H5 influenza virus, and / or wherein the virus is an N6 and / or N1 influenza virus.
151. An isolated polynucleotide comprising a nucleic acid sequence encoding an amino acid sequence of an influenza haemagglutinin (HA) protein, an amino acid sequence of a first self-cleaving peptide, an amino acid sequence of an influenza neuraminidase (NA) protein, an amino acid sequence of a second self-cleaving polypeptide, and an amino acid sequence of an influenza matrix 2 (M2) protein, or the complement thereof.
152. An isolated polynucleotide according to claim 151, wherein the proteins and peptides are encoded in the order recited.
153. An isolated polynucleotide according to claim 151 or 152, wherein the influenza HA, NA, and M2 amino acid sequences are wild-type amino acid sequences.
154. An isolated polynucleotide according to claim 153, wherein the wild-type amino acid sequences are sequences of an influenza A / England / 2009 strain.
155. An isolated polynucleotide according to any of claims 151 to 154, wherein the first and second self-cleaving peptides are 2A self-cleaving peptides.
156. An isolated polynucleotide according to claim 155, wherein the first 2A self-cleaving peptide comprises an amino acid sequence of SEQ ID NO:
43.
157. An isolated polynucleotide according to claim 155 or 156, wherein the second 2A self-cleaving peptide comprises an amino acid sequence of SEQ ID NO:
44.
158. An isolated polynucleotide according to any of claims 151 to 157, encoding an amino acid sequence of SEQ ID NO:48 (FLU_S3_T1_1), or the complement thereof.
159. An isolated polynucleotide according to any of claims 151 to 158, wherein the nucleic acid sequence comprises the nucleotide sequence of SEQ ID NO:50, or the complement thereof.
160. A vector comprising a polynucleotide according to any of claims 151 to 159.
161. A vector according to claim 160, which further comprises a promoter operably linked to the nucleotide sequence encoding the amino acid sequence.
162. A vector according to claim 161, wherein the promoter is for expression of the encoded amino acid sequence in mammalian cells.
163. A vector according to claim 161, wherein the promoter is for expression of the encoded amino acid in yeast or insect cells.
164. A vector according to any of claims 160 to 163, wherein the vector is a vaccine vector.
165. A vector according to claim 164, wherein the vaccine vector is a DNA vaccine vector.
166. A vector according to any of claims 160 to 165, wherein the vector is a pEVAC vector.
167. A vector according to claim 166, which comprises a nucleic acid sequence of SEQ ID NO:49, or the complement thereof.
168. A vector according to claim 164, wherein the vaccine vector is an mRNA vaccine vector.
169. An isolated cell comprising a vector according to any of claims 160 to 168.
170. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:48 (FLU_S3_T1_1).
171. A pseudotyped virus particle comprising the HA, NA, and M2 proteins encoded by a polynucleotide of any of claims 151 to 154.
172. A pharmaceutical composition comprising a polynucleotide according to any of claims 151 to 159, and a pharmaceutically acceptable carrier, excipient, or diluent.
173. A pharmaceutical according to claim 172, further comprising a polynucleotide comprising a nucleotide sequence encoding an influenza M1 antigen.
174. A pharmaceutical composition comprising the HA, NA, and M2 proteins encoded by a polynucleotide according to any of claims 151 to 154, and a pharmaceutically acceptable carrier, excipient, or diluent.
175. A pharmaceutical composition according to claim 174, further comprising a polypeptide comprising an amino acid sequence of an influenza M1 antigen.
176. A pharmaceutical composition comprising a vector according to any of claims 160 to 168, and a pharmaceutically acceptable carrier, excipient, or diluent.
177. A pharmaceutical composition according to claim 176, further comprising a vector comprising nucleic acid sequence encoding an influenza M1 antigen.
178. A pharmaceutical composition according to any of claims 173, 175, or 177, wherein the influenza M1 antigen comprises an amino acid sequence of SEQ ID NO:
51.
179. A pharmaceutical composition according to claim 173, 175, 177, or 178, wherein nucleotide sequence encoding the influenza M1 antigen comprises a nucleic acid sequence of SEQ ID NO:52.
180. A pharmaceutical composition according to any of claims 172 to 179, which further comprises an adjuvant for enhancing an immune response in a subject to the polypeptide, or to a polypeptide encoded by the nucleic acid, of the composition.
181. A combined preparation comprising a polynucleotide according to any of claims 151 to 159, and a polynucleotide comprising a nucleotide sequence encoding an influenza M1 antigen.
182. A combined preparation comprising the HA, NA, and M2 proteins encoded by a polynucleotide according to any of claims 151 to 154, and a polypeptide comprising an amino acid sequence of an influenza M1 antigen.
183. A combined preparation comprising a vector according to any of claims 160 to 168 and a vector comprising nucleic acid sequence encoding an influenza M1 antigen.
184. A combined preparation according to any of claims 181 to 183, wherein the influenza M1 antigen comprises an amino acid sequence of SEQ ID NO:
51.
185. A combined preparation according to claim 183 or 184, wherein nucleic sequence encoding the influenza M1 antigen comprises a nucleic acid sequence of SEQ ID NO:
52.
186. A polynucleotide according to any of claims 151 to 159, a vector according to any of claims 160 to 168, a pseudotyped virus particle according to claim 171, a pharmaceutical composition according to any of claims 172 to 180, or a combined preparation according to any of claims 181 to 185, for use as a medicament.
187. A polynucleotide according to any of claims 151 to 159, a vector according to any of claims 160 to 168, a pseudotyped virus particle according to claim 171, a pharmaceutical composition according to any of claims 172 to 180, or a combined preparation according to any of claims 181 to 185, for use in the prevention, treatment, or amelioration of an influenza infection.
188. A polynucleotide according to any of claims 151 to 159, a vector according to any of claims 160 to 168, a pseudotyped virus particle according to claim 171, a pharmaceutical composition according to any of claims 172 to 180, or a combined preparation according to any of claims 181 to 185, for use in inducing an immune response to an influenza virus in a subject.
189. A polynucleotide according to any of claims 151 to 159, a vector according to any of claims 160 to 168, a pseudotyped virus particle according to claim 171, a pharmaceutical composition according to any of claims 172 to 180, or a combined preparation according to any of claims 181 to 185, for use in immunising a subject against an influenza virus.
190. A method of inducing an immune response to an influenza virus in a subject, which comprises administering to the subject an effective amount of: a polynucleotide according to any of claims 151 to 159; a vector according to any of claims 160 to 168; a pseudotyped virus particle according to claim 171; a pharmaceutical composition according to any of claims 172 to 180; or a combined preparation according to any of claims 181 to 185.
191. A method of immunising a subject against an influenza virus, which comprises administering to the subject an effective amount of: a polynucleotide according to any of claims 151 to 159; a vector according to any of claims 160 to 168; a pseudotyped virus particle according to claim 171; a pharmaceutical composition according to any of claims 172 to 180; or a combined preparation according to any of claims 181 to 185.
Citation Information
Patent Citations
Betacoronavirus mRNA vaccine
US10702600B1
Vaccines and methods
WO2020065349A2
Multivalent influenza vaccines
CN117580568A
Influenza virus reassortment
WO2014115104A1
A polygene influenza vaccine
WO2019081750A1