Adeno associated viral (AAV) vectors for treatment of propionic acidemia (PA) caused by mutations in propionyl-COA carboxylase beta (PCCB)

Abstract

The invention provides a genetic expression cassette comprising, in order from 5'-3':an 5' adenoassociated viral (AAV) inverted terminal repeat (ITR), the elongation factor 1 long promoter, a chimeric intron, a 5' UT translational enhancer element containing a Kozak sequence, a polynucleotide comprising a nucleic acid sequence with at least 80% identity to the nucleic acid sequence of either wild-type of propionyl-CoA carboxylase beta (PCCB or synPCCB1), the hepatitis B virus derived post-translational response element, the bovine growth hormone poly-adenylation sequence, and an 3' AAV inverted ITR. The invention also provides expression vectors comprising the inventive cassette, compositions comprising the same, and methods for treating a disease or condition mediated by propionyl-CoA carboxylase.

Description

ADENO ASSOCIATED VIRAL (AAV) VECTORS FOR TREATMENT OF PROPIONIC ACIDEMIA (PA) CAUSED BY MUTATIONS IN PROPIONYL-COA CARBOXYLASE BETA (PCCB) CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 63 / 706,441, filed October 11, 2024, which is incorporated by reference. STATEMENT OF GOVERNMENT INTEREST

[0002] This invention was made with Government support under project number Z01HG200318-14 by the National Institutes of Health, National Human Genome Research Institute. The Government has certain rights in the invention. INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0003] Incorporated by reference in its entirety herein is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: One 176,802 Byte XML file named “774031.XML,” dated October 10, 2025. FIELD OF THE INVENTION

[0004] The subject invention relates to engineering genetic expression cassettes for enhancing the expression of the human propionyl-CoA carboxylase beta gene (PCCB) in eukaryotic cells. BACKGROUND

[0005] Propionic acidemia (PA) is an autosomal recessive metabolic disorder caused by mutations in either of propionyl-CoA carboxylase (PCC) alpha or beta (PCCA or PCCB) genes. The products of these genes form the alpha and beta subunits of PCC, a critically important mitochondrial enzyme involved in the catabolism of branched chain amino acids. Specifically, propionyl-CoA carboxylase catalyzes the carboxylation of propionyl-CoA to D- methylmalonyl-CoA.

[0006] The results from an ongoing PA natural history study have revealed that in a large and diverse cohort of patients, approximately 50% have PA caused by PCCB mutations. Many PA patients present within the first few days to weeks of life with symptoms, and lethality canensue if clinical recognition and treatment is delayed. Laboratory investigations show characteristic elevations of propionylcarnitine (C3), 3-hydroxypropionate (3-OHP), and 2- methylcitrate (2-MC). Milder patients can escape from early presentations but remain at risk for metabolic decompensation and late complications, especially cardiomyopathy. All individuals with PA can experience high mortality and disease related morbidity despite nutritional therapy. The failure of conventional medical and dietary management to treat PA has led to the use of elective liver transplantation as an alternative approach to stabilize metabolism and mitigate the risk of lethal metabolic decompensations.

[0007] The amino acid sequence of PCCB has been modified to generate novel DNA sequences encoding synthetic PCCB genes (synPCCB) (see U.S. Patent Application Publication US 2022-0325266 A1, the contents of which are incorporated herein in their entirety). These synPCCB sequences have been engineered into AAV-vectors and used to rescue Pccb- / -knock-out mice from neonatal lethality, with improvement in the clinical and metabolic phenotypes of the treated mutant mice. However, despite the success of these codon- optimized synPCCB variants, potential toxicity of AAV through innate immune activation remains a concern. Hence, a need exists for yet further improved safer and potent reagents for enhancing the expression of the human PCCB in eukaryotic cells. SUMMARY

[0008] The present invention addresses this need by providing a genetic expression cassette comprising, in order from 5’-3’: an 5’ adenoassociated viral (AAV) inverted terminal repeat (ITR) SEQ ID NO:1, the elongation factor 1 long promoter SEQ ID NO:2, a chimeric intron SEQ ID NO:3, a 5’ UT translational enhancer element containing a Kozak sequence SEQ ID NO:4, a polynucleotide comprising a nucleic acid sequence with at least 80% identity to the nucleic acid sequence of SEQ ID NOs:5 or 6 (either WT PCCB or synPCCB1), the hepatitis B virus derived post-translational response element SEQ ID NO:7, and the bovine growth hormone poly-adenylation sequence SEQ ID NO:8, and an 3’ adenoassociated viral (AAV) inverted terminal repeat (ITR) SEQ ID NO:9. The invention also provides expression vectors comprising the inventive cassette, compositions comprising the same, and methods for treating a disease or condition mediated by propionyl-CoA carboxylase.

[0009] The expression cassettes and vectors described herein can be used as a drug, via viral- or non-viral mediated gene delivery, to restore PCC function in some PA patients, prevent metabolic instability, and ameliorate disease progression. Because this enzyme may also beimportant in other disorders of branched chain amino acid oxidation, gene delivery of a synthetic PCCB gene could be used to treat conditions other than PA.

[0010] Additionally, expression cassettes and vectors described herein can be used for the in vitro production of PA for use in enzyme replacement therapy for PA. Enzyme replacement therapy is accomplished by administration of the synthetic PCC protein orally, subcutaneously, intramuscularly, intravenously, or by other therapeutic delivery routes. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 presents a CpG analysis of PCCB vs. synPCCB1.

[0012] Figure 2 presents information concerning the PCCB HEPG2 knock-out cell line. Panel A provides information for clones C06 and D10. Panel B presents an image of a Western blot.

[0013] Figure 3 presents a graphic overview of PCCB AAV transgenes.

[0014] Figure 4 presents an image of Western blot data concerning the expression of PCCB AAV transgenes in PCCB HepG2 (hepatocellular carcinoma) knockout cells. To generate the data, human PCCB (PCCB WT) or codon optimized human PCCB (synPCCB1) was cloned into 2 different vector backbones, one with a 5’UTR and one without to determine which configuration had the highest transgene expression. HepG2 cells were seeded into 6-well plates at a density of 1.5x106cells per well. Each well was transiently transfected with 18 µg of plasmid DNA with lipofectamine™ 2000 reagent (Invitrogen) and Opti-MEM™ (ThermoFisher Scientific) using the manufacturer’s instructions. Each transfection was performed in triplicate. Cells were harvested 72 hours post transfection and lysed in M-Per™ buffer (ThermoFisher Scientific) supplemented with fresh protease inhibitors (cOmpleteTM Protease Inhibitor Cocktail, Sigma). Homogenates were centrifuged at 16,000 RCF for 15 minutes. Supernatant was collected and measured for protein content by Bradford assay. Samples were then denatured in 5x SDS loading buffer and run on SDS-PAGE gels (50 µg of protein per lane). Resulting blots were immunoblotted (IB) with one or more of the indicated antibodies: PCCB Polyclonal antibody (Proteintech, catalog number 11139-1-AP) and Beta Actin Monoclonal antibody (Proteintech, catalog number 66009-1-Ig). Imaging used an Odyssey system (LI-COR). The PCCB signal was normalized to beta actin and the fold change compared to PCCB WT is listed below each lane.

[0015] Figure 5 presents an extended exposure image of Western blot data concerning the expression of PCCB AAV transgenes in PCCB HepG2 knockout cells. These are the samesamples presented in Figure 4. PCCB expression was detected in the transfected samples, and present in the parental HEPG2 cells, but not in the PCCB KO D10 clone. The extended exposure prevented quantitation.

[0016] Figure 6 presents Western blot data concerning AAV9-hPCCB in vitro infection studies in human liver (HepG2) PCCB knockout (KO) cell line. To generate the data, a deletion mutation in PCCB was engineered in a human hepatocyte derived cell line (HEPG2) to create the PCCB KO cell line and used to test the in vitro potency of AAV9-hPCCB applied at varying multiplicity of infection (MOI) ranging from 5x104to 1x106. After 48 hours, the infected PCCB KO cells were harvested and lysed, and 25 µg of total cellular protein was subjected to Western analysis using a PCCB polyclonal antibody. Beta-actin was used as a loading control. A dose- response with increasing PCCB protein after exposure to varying doses of AAV9-hPCCB is apparent.

[0017] Figure 7 presents survival data for AAV9-hPCCB treated and untreated PCCB8 bpdel8 / 8 bp delmice. To generate the data, mice were treated AAV9-hPCCB at P0-1. The dose was 1x1014vg / kg. No treatment (untreated) PCCB8 bp del8 / 8 bp delmice were used as a control. The graph depicts the percent survival of different cohorts of animals. AAV9=AAV9-hPCCB; ** P<0.01 compared to survival of untreated vs treated PCCB8 bp del8 / 8 bp delmice. P values were calculated with GraphPad Prism 10 software using a Log-rank (Mantel-Cox) test.

[0018] Figure 8 graphically presents data concerning plasma (A) 3-OHP and (B) 2-MC levels in AAV9-hPCCB treated Pccb8 bp del8 / 8 bp delmice. 3-OHP and 2-MC levels in the plasma were measured by GC-MS in AAV9-hPCCB Pccb8 bp del8 / 8 bp delmice 30 days posttreatment, age matched untreated wildtype mice and untreated Pccb8 bp del8 / 8 bp delone-day old pups. WT=wildtype, NS=not significant, AAV9=AAV9-hPCCB, *** P<0.001 **** P<0.0001. P values were calculated with GraphPad Prism software using one-way ANOVA.

[0019] Figure 9 presents a Western blot to examine expression of PCCB after AAV9-hPCCB gene delivery. To generate the data, Pccb8 bp del8 / 8 bp delmice (PA) were treated with 1x1014vg / kg of AAV9-hPCCB delivered by retroorbital injection in the immediate neonatal period on DOL1. Untreated age matched mice served as wild type controls and treated Pccb8 bp del8 / 8 bp delmice were collected 35 days after birth. The AAV9-hPCCB treated Pccb8 bp del8 / 8 bp delmice demonstrated robust PCCB expression. Untreated Pccb8 bp del8 / 8 bp delmice did not produce any PCCB in their livers.

[0020] Figure 10 presents survival data for AAV9-hPCCB treated and untreated PccbX / X; TgMck-PCCBmice.mice were treated AAV9-hPCCB at weaning as indicated by the black arrow. The doses were 1x1014vg / kg, 2.5e1013vg / kg, and 5e1012vg / kg. Notreatment (untreated) and PBS treatment (vehicle) were used as a control. The graph depicts the percent survival of different cohorts of animals. AAV9=AAV9-hPCCB, PA= PccbX / X; TgMck-Pccb. ** P<0.01 and *** P<0.001 compared to survival of untreated vs treated PccbX / X; TgMck-Pccbmice. P values were calculated with GraphPad Prism using a Log-rank (Mantel-Cox) test.

[0021] Figure 11 presents data concerning (A) weight gain, (B) 3-OHP and (C) plasma 2- MC levels in AAV9-hPCCB treated and untreated PccbX / X; TgMck-Pccbmice. Panel A presents data concerning weight gain. Panel B presents data concerning plasma 3-OHP levels. Panel C presents data concerning plasma 2-MC levels. To generate the data, PccbX / X; TgMck-Pccbmice (PA) were treated AAV9-hPCCB or phosphate buffered saline (PBS) at weaning. The doses were 1x1014vg / kg and 2.5e1013vg / kg. Weight gain (Panel A), 3-OHP (Panel B), and 2-MC (Panel C) levels in the plasma were measured by GC-MS. No treatment (untreated) and PBS treatment were used as controls. AAV9=AAV9-hPCCB, ** P<0.01 *** P<0.001. P values were calculated with GraphPad Prism software using one-way ANOVA. To generate the growth data, weight gain in the PccbX / X; TgMck-Pccbmice treated AAV9-hPCCB with either 1e14vg / kg compared to 2.5e13vg / kg on D10 and 1M after treatment was measured and compared to historical controls. D=days, M=month.

[0022] Figure 12 presents a Western blot to examine expression of PCCB after AAV9- hPCCB gene delivery. To generate the data, PccbX / X; TgMck-Pccbmice (PA) were treated AAV9- hPCCB or phosphate buffered saline (PBS) at weaning. The doses were 1x1014vg / kg and 2.5e1013vg / kg. Untreated age matched mice served as wild type controls. All mice were sacrificed 30 days after receiving AAV9 or near the time of death for the PBS injected mice. As presented in Panel A, the AAV9-hPCCB treated PccbX / X; TgMck-Pccbmice demonstrated robust PCCB expression which was at or above the levels present in WT untreated mice (Panel B). Untreated PccbX / X; TgMck-Pccbmice did not produce any PCCB in their livers.

[0023] Figure 13 presents biodistribution of the AAV9– hPCCB vector as detected by digital droplet PCR. AAV9-hPCCB treated PccbX / X; TgMck-Pccbmice were treated with 1x1014vg / kg of AAV9– hPCCB and sacrificed at 3 months. DNA from multiple tissues was extracted and the number the PCCB vector transgene was compared to the cellular gene GAPDH. Robust transduction of the liver and heart are noted.

[0024] Figures 14-19 present images reflecting the expression of AAV9-hPCCB in various tissues as assayed via RNA in situ hybridization with two color RNAscope. To generate the images, a series of probes designed to recognize the expression of PCCB mRNA and the AAV DNA genomes was generated. A PccbX / X; TgMck-Pccbmouse was treated with AAV9-hPCCBusing systemic delivery via intravenous retroorbital injection at weaning at a dose of 1x1014vg / kg. Three months later, the mouse was harvested to study AAV9-hPCCB transgene expression in various tissues.

[0025] In Figure 14, Panel A depicts an RNAScope image from the liver stained to detect PCCB mRNA. Panel B is a magnification showing staining, which represents PCCB mRNA, and puncta, which represent AAV DNA genomes.

[0026] In Figure 15, Panel A depicts an RNAScope image from the kidney stained to detect PCCB mRNA. Panel B is a magnification showing staining, which represents PCCB mRNA, and puncta, which represent AAV DNA genomes.

[0027] In Figure 16, Panel A depicts an RNAScope image from the heart stained to detect PCCB mRNA. Panel B is a magnification showing staining, which represents PCCB mRNA, and puncta, which represent AAV DNA genomes.

[0028] In Figure 17, Panel A depicts an RNAScope image from the skeletal muscle stained to detect PCCB mRNA. Panel B is a magnification showing staining, which represents PCCB mRNA, and puncta, which represent AAV DNA genomes.

[0029] In Figure 18, Panel A depicts an RNAScope image from the spleen stained to detect PCCB mRNA. Panel B is a magnification showing staining, which represents PCCB mRNA, and puncta, which represent AAV DNA genomes. In Figure 19, Panel A depicts an RNAScope image from the brain stained to detect PCCB mRNA. Panel B is a magnification showing staining, which represents PCCB mRNA, and puncta, which represent AAV DNA genomes.

[0030] Figure 20 presents data concerning growth and plasma 2-MC and 3-OHP levels in AAV9-hPCCB treated PccbP230L / 8bpmice followed by high protein dietary challenge. To generate the data, mice were treated AAV9-hPCCB at 2 months of age at a dose of 1x1014vg / kg. Protein challenge (Panel A) shows mouse weights just prior to being placed on a high protein diet and after 10 days on a high protein diet. 3-OHP (Panel B), and 2-MC (Panel C) levels in the plasma were measured by GC-MS in AAV9 treated and age matched controls 10 days post AAV9 treatment and 10 days after being place on a high protein diet. No treatment (untreated) was used as a control. AAV9=AAV9-hPCCB, ns=not significant * P<0.05, *** P<0.001, **** P<0.0001. P values were calculated with GraphPad Prism software using one- way ANOVA.

[0031] Figures 21-25 present images reflecting the expression of AAV9-hPCCB in various tissues as assayed via RNA in situ hybridization with two color RNAscope. To generate the images, a series of probes designed to recognize the expression of PCCB mRNA and the AAVDNA genomes was generated. A PccbP230L / 8bp delmouse was treated with AAV9-hPCCB using systemic delivery via intravenous retroorbital injection at 2 months of age at a dose of 1x1014vg / kg. Two weeks later, the mouse was harvested to study AAV9-hPCCB transgene expression in various tissues.

[0032] In Figure 21, Panel A presents images reflecting H and E of the liver. Panel B depicts an RNAScope image stained to detect PCCB mRNA. Panel C is a magnification of a cluster of cells (circled in Panel B) showing staining, which represents PCCB mRNA, and puncta, which represent AAV DNA genomes.

[0033] In Figure 22, Panel A presents images reflecting H and E of the kidney. Panel B depicts an RNAScope image stained to detect PCCB mRNA. Panel C is a magnification of a cluster of cells (circled in Panel B) showing staining, which represents PCCB mRNA, and puncta, which represent AAV DNA genomes.

[0034] In Figure 23, Panel A presents images reflecting H and E of the heart. Panel B depicts an RNAScope image stained to detect PCCB mRNA.

[0035] In Figure 24, Panel A presents images reflecting H and E of skeletal muscle. Panel B depicts an RNAScope image stained to detect PCCB mRNA.

[0036] In Figure 25, Panel A presents images reflecting H and E of the spleen. Panel B depicts an RNAScope image stained to detect PCCB mRNA. Panel C is a magnification of a cluster of cells (circled in Panel B) showing very little staining, which represents PCCB mRNA, and many puncta, which represent AAV DNA genomes. DETAILED DESCRIPTION

[0037] Reference will now be made in detail to representative embodiments of the invention. While the invention will be described in conjunction with the enumerated embodiments, it will be understood that the invention is not intended to be limited to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the scope of the present invention as defined by the claims.

[0038] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in and are within the scope of the practice of the present invention. The present invention is in no way limited to the methods and materials described.

[0039] All publications, published patent documents, and patent applications cited in this application are indicative of the level of skill in the art(s) to which the application pertains. Allpublications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference. Definitions

[0040] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods, devices, and materials are now described.

[0041] As used in this application, including the appended claims, the singular forms “a,” “an,” and “the” include plural references, unless the content clearly dictates otherwise, and are used interchangeably with “at least one” and “one or more.” Thus, reference to “a polynucleotide” includes a plurality of polynucleotides or genes, and the like.

[0042] As used herein, the term “about” represents an insignificant modification or variation of the numerical value such that the basic function of the item to which the numerical value relates is unchanged.

[0043] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “contains,” “containing,” and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, product-by-process, or composition of matter that comprises, includes, or contains an element or list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, product-by-process, or composition of matter.

[0044] In the context of PCCB or synPCCB, the terms “gene” and “transgene” are used interchangeably. A “transgene” is a gene that has been transferred from one organism to another.

[0045] The term “subject,” as used herein, refers to a domesticated animal, a farm animal, a primate, a mammal, for example, a human.

[0046] The phrase “substantially identical,” as used herein, refers to an amino acid sequence exhibiting high identity with a reference amino acid sequence (for example, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity) and retaining the biological activity of interest (the enzyme activity).

[0047] As used herein, “PCCB” refers to the beta subunit of human propionyl-CoA carboxylase, and “Pccb” refers to the beta subunit of mouse propionyl-CoA carboxylase. Propionyl-CoA carboxylase (PCC) catalyzes the carboxylation of propionyl-CoA to D- methylmalonyl-CoA which is a metabolic precursor to succinyl-CoA, a component of the citric acid cycle or tricarboxylic acid cycle (TCA). The genes encoding the alpha and beta subunits of naturally occurring human propionyl-CoA carboxylase gene are referred to as PCCA or PCCB, respectively. The synthetic polynucleotide encoding the beta subunit of PCC is known as synPCCB.

[0048] Naturally occurring human propionyl-CoA carboxylase is referred to as PCC, while synthetic PCC is designated as synPCC, even though the two are identical at the amino acid level. For further details, reference is made to U.S. Patent Application Publication US 2022- 0325266 A1, the entirety of which is incorporated herein.

[0049] As used herein, “determining”, “determination”, “detecting”, or the like are used interchangeably herein and refer to the detecting or quantitation (measurement) of a molecule using any suitable method, including immunohistochemistry, fluorescence, chemiluminescence, radioactive labeling, surface plasmon resonance, surface acoustic waves, mass spectrometry, infrared spectroscopy, Raman spectroscopy, atomic force microscopy, scanning tunneling microscopy, electrochemical detection methods, nuclear magnetic resonance, quantum dots, and the like. “Detecting” and its variations refer to the identification or observation of the presence of a molecule in a biological sample, and / or to the measurement of the molecule’s value.

[0050] As used herein, a “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. In certain embodiments, it may be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.

[0051] A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount of a vector comprising the synthetic polynucleotide of the invention may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the vector to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the vector are outweighed bythe therapeutically beneficial effects. A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.

[0052] Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of the synthetic polynucleotide or a fragment thereof according to the invention calculated to produce the desired therapeutic effect in association with a pharmaceutical carrier. Genetic expression cassette

[0053] In accordance with one embodiment the invention comprises a genetic expression cassette comprising, in order from 5’-3’: an 5’ adenoassociated viral (AAV) inverted terminal repeat (ITR), such as SEQ ID NO:1, the elongation factor 1 long promoter, such as SEQ ID NO:2, a chimeric intron, such as SEQ ID NO:3, a 5’ UT translational enhancer element containing a Kozak sequence, such as SEQ ID NO:4, a polynucleotide comprising a nucleic acid sequence with at least 80% identity to the nucleic acid sequence of SEQ ID NOs:5 or 6 (either WT PCCB or synPCCB1), the hepatitis B virus derived post-translational response element, such as SEQ ID NO:7, and the bovine growth hormone poly-adenylation sequence, such as SEQ ID NO:8, and an 3’ adenoassociated viral (AAV) inverted terminal repeat (ITR) SEQ ID NO:9. For those polynucleotides having at least about 80% identity to SEQ ID NOs:5 or 6, in additional embodiments, they can comprise at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs:5 or 6. Of course, such can have 100% identity to SEQ ID NOs:5 or 6, in certain embodiments. In other embodiments, in place of SEQ ID NOs:5 or 6, the coding sequence within the inventive expression vector can comprise any of the synPCCB polynucleotides identified in U.S. Patent Application Publication US 2022-0325266 A1 (which is incorporated herein in its entirety).

[0054] In an aspect, the inventive genetic expression cassette encodes a PCC beta subunit that has 100% identity with the naturally occurring human PCC beta subunit protein, or that has at least 90% amino acid identity to the naturally occurring human PCC beta subunit protein. In a preferred embodiment, the polynucleotide encodes a PCC beta subunit protein that has at least 95% amino acid identity to naturally occurring human PCC beta subunit protein. Thus, it will be observed that, in some embodiments, polynucleotides of the present invention do not share 100% identity with SEQ ID NOs:5 or 6. In other words, in some embodiments, polynucleotides having 100% identity with SEQ ID NOs:5 or 6 are excluded from such embodiments of the present invention.

[0055] In one embodiment, the inventive genetic expression cassette encodes a polypeptide that retains at least 90% of the naturally occurring human PCC protein function, i.e., the capacity to catalyze the carboxylation of propionyl-CoA to D-methylmalonyl-CoA. In another embodiment, the encoded polypeptide retains at least 95% of the naturally occurring human PCC protein function. This protein function can be measured, for example, via the efficacy to rescue a neonatal lethal phenotype in Pccb knock-out mice the lowering of circulating metabolites including methylcitrate in a disease model of PA (U.S. Patent Application Publication US 2022-0325266 A1).

[0056] While the inventive expression cassettes have heretofore been described in broad terms, specific examples of the inventive expression cassettes containing AAV ITRs are presented herein as SEQ ID NOs: 10-13. It will be observed, however, that the inventive expression cassette is not limited to one of these sequences but can contain sequence variations as is typical in the field of genetic engineering. Thus, an expression cassette according to the present invention can comprise at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity to one of SEQ ID NOs:10-13. Of course, such can have 100% identity to one of SEQ ID NOs:10-13, in certain embodiments.

[0057] In the context of the present invention, the genetic expression cassette can be composed of DNA and / or RNA or a modified nucleic acid, such as a peptide nucleic acid, and could be conjugated for improved biological properties. Synthesis of such cassettes can be achieved by methods known to those of ordinary skill in the art, such as using standard recombinant DNA technology or direct, solid-state synthesis, among other common manufacturing methods pertinent to polynucleotides.Vector

[0058] In another embodiment, the invention provides a vector, such as an expression vector or a cloning vector, comprising the inventive genetic expression cassette. For example, the inventive vector can be in the form of a recombinant plasmid or viral vector. In accordance with an aspect of the invention, a suitable plasmid vector can be devoid of bacterial DNA and include forms of closed end DNA generated by AAV replication in a baculoviral system.

[0059] Examples of viral vectors according to the present invention (i.e., comprising the inventive genetic expression cassette) include, but are not limited to, adeno-associated viral vectors (AAV), adenoviral vectors, retroviral vectors, lentiviral vectors, and herpes viral vectors.

[0060] When the inventive vector comprises an rAAV vector, such can be any suitable AAV vector known to persons of ordinary skill in the art. Examples of AAV serotypes include, but are not limited to AAV1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 44.9, rh8, rh10, ANC80L65, LK03, NP59, KP1, and others well known to practitioners of the art. Thus, an rAAV according to the present invention can comprise an AAV capsid and a vector genome packaged therein, the vector genome comprising the inventive genetic expression cassette. Within such rAAV, the capsid can comprise, consist essentially of, or consist of that of any desired serotype of AAV (e.g., serotype AAV1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 44.9, rh8, rh10, ANC80L65, LK03, NP59, KP1, and mutants thereof), with serotypes 8 and 9 being somewhat preferred.

[0061] The inventive vector can comprise the inventive genetic expression cassette and other desired genetic elements. Such an inventive vector can be generated by methods known to persons of ordinary skill in the art, such as using recombinant DNA technology, packaging cell lines, and the like.

[0062] In an aspect, the inventive vector can be a hybrid vector, such as those that use a combination of rAAV vectors and vectors, including non-viral vectors such as lipid nanoparticles (LNPs), designed to deliver and express Piggy Bac (PB) or Sleeping Beauty (SB) transposons (i.e., a “hybrid AAV-PB or hybrid AAV-SB transposon system”) or other DNA transposons that use a cut and paste mechanism to accomplish insertion of the target sequence. Hybrid vectors can include an rAAV comprising the inventive genetic expression cassette, either alone or in combination with a polynucleotide encoding the propionyl-CoA carboxylase beta and flanked by Piggy Bac (PB) or Sleeping Beauty (SB) transposon specific terminal repeats, when administered with a source of Piggy Bac (PB) or Sleeping Beauty (SB) transpose mRNA. Such embodiments can enable transposition of the viral transgene into the genome, with permanent correction of transduced cells resulting. Such cells include hepatocytes, themain cell of the liver, which is targeted by many AAV serotypes, or by selecting a preferred AAV capsid and LNP to target other cells.

[0063] In another aspect, the inventive vector can be produced as an RNA containing the inventive transgenes, in entirety, from the promoter to the end of the polyadenylation signal (SEQ ID NOs: 14 and 15), without an intron (SEQ ID NOs: 16 and 17), or with a liver specific promoter, such as the ApoE-human alpha one antitrypsin promoter (SEQ ID NOs:18 and 19) are preferred. The inventive transgene RNA can then be modified to serve as a template for a type 2 retrotransposon and co-packaged in a lipid nanoparticle with the mRNA encoding a retrotransposon reverse transcriptase to allow site specific integration into the ribosomal RNA locus as is known to practitioners of the art. Such embodiments can enable retrotransposition of RNA containing the sequences of the inventive transgene into the genome, with permanent correction of transduced cells resulting. Cell types include hepatocytes, the main cell of the liver, which is preferentially targeted by many LNPs.

[0064] In certain aspects, the inventive therapeutic transgene can be incorporated into a recombinant packaging vector, such as a retro- or lentiviral vector and then serve as an integrating vector for permanently correcting any cell type from a patient with PCC deficiency, as discussed herein. In such embodiments, the inventive retro- or lentiviral vector can comprise vector elements well known to practitioners, such as self-inactivating LTRs, and varied envelopes, but contain elements of the inventive expression cassettes. In one embodiment, the inventive lentiviral vectors can be produced using an RSV promoter drive the expression of lentiviral transgenes that contain the elongation factor 1 long promoter (SEQ ID NOs: 20 and 21) or the ApoE enhancer linked to the human alpha 1 antitrypsin promoter (SEQ ID NOs:22 and 23) of PCCB or synPCCB1 respectively. In another embodiment, the CMV promoter is preferred to assist with the production of similar transgenes that contain the elongation factor 1 long promoter (SEQ ID NOs: 24 and 25) or the ApoE enhancer linked to the human alpha 1 antitrypsin promoter (SEQ ID NOs:26 and 27) of PCCB or synPCCB1 respectively. Prophylaxis and Therapy

[0065] In another aspect, the invention comprises a method of treating a disease or condition mediated by propionyl-CoA carboxylase. The disease or condition can, in one embodiment, be propionic acidemia (PA). This method comprises administering to a subject in need thereof the inventive genetic expression cassette or vector, such as within a pharmaceutical composition, as described herein. The PCC enzyme is processed after translation and translocation into the mitochondrial inner space.

[0066] In another aspect, the invention is directed to the preclinical amelioration or rescue from the disease state, for example, propionic acidemia, that the afflicted subject exhibits. This may include symptoms such as lethargy, lethality, metabolic acidosis, and biochemical perturbations, such as increased levels of 2-MC and 3-OHP in blood, urine, and body fluids.

[0067] Enzyme replacement therapy consists of administration of the functional enzyme (propionyl-CoA carboxylase) to a subject in a manner so that the enzyme administered will catalyze the reactions in the body that the subject’s own defective or deleted enzyme cannot. In enzyme therapy, the defective enzyme can be replaced in vivo or repaired in vitro using the synthetic polynucleotide according to the invention. The functional enzyme molecule can be isolated or produced in vitro, for example. Methods for producing recombinant enzymes in vitro are known in the art. In vitro enzyme expression systems include, without limitation, cell-based systems (bacterial (for example, Escherichia coli, Corynebacterium, Pseudomonas fluorescens), yeast (for example, Saccharomyces cerevisiae, Pichia Pastoris), insect cell (for example, Baculovirus-infected insect cells, non-lytic insect cell expression), and eukaryotic systems (for example, Leishmania) and cell-free systems (using purified RNA polymerase, ribosomes, tRNA, ribonucleotides). Viral in vitro expression systems are likewise known in the art. The enzyme isolated or produced according to the above-iterated methods exhibits, in specific embodiments, 80%, 85%, 90%, 95%, 98%, 99%, or 100% homology to the naturally occurring (for example, human) propionyl-CoA carboxylase.

[0068] Gene therapy can involve in vivo gene therapy (direct introduction of the genetic material into the cell or body) or ex vivo gene transfer, which usually involves genetically altering cells prior to administration. In one aspect, genome editing, or genome editing with engineered nucleases (GEEN) may be performed with the genetic expression cassette and / or vector of the present invention allowing synPCCB or PCCB DNA to be inserted, replaced, or removed from a genome using artificially engineered nucleases. Any known engineered nuclease may be used such as Zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), the CRISPR / Cas system, and engineered meganuclease re- engineered homing endonucleases. Alternately, the nucleotides of the present invention including synPCCB, in combination with a CRISPR / Cas, ZFN, or TALEN can be used to engineer correction at the locus in a patient’s cell either in vivo or ex vivo, then, in one embodiment, use that corrected cell, such as a fibroblast or lymphoblast, to create an induced pluripotent stem cell (iPS) or other stem cell for use in cellular therapy.Administration / delivery and dosage forms

[0069] Routes of delivery of a genetic expression cassette and / or vector according to the invention may include, without limitation, injection (systemic or at target site), for example, intradermal, subcutaneous, intravenous, intraperitoneal, intraocular, subretinal, renal artery, hepatic vein, intramuscular injection; physical, including ultrasound(-mediated transfection), electric field-induced molecular vibration, electroporation, transfection using laser irradiation, photochemical transfection, gene gun (particle bombardment); parenteral and oral (including inhalation aerosols and the like). Thus, dosage forms contemplated include injectables, aerosolized particles, capsules, and other oral dosage forms. Related methods include using genetically modified cells, antisense therapy, and RNA interference.

[0070] Vehicles for delivery of a genetic expression cassette and / or vector according to the invention may include, without limitation, viral vectors (for example, AAV, adenovirus, baculovirus, retrovirus, lentivirus, foamy virus, herpes virus, Moloney murine leukemia virus, Vaccinia virus, and hepatitis virus) and non-viral vectors (for example, naked DNA, mini- circules, plasmids, liposomes, ligand-polylysine-DNA complexes, nanoparticles, cationic polymers, including polycationic polymers such as dendrimers, synthetic peptide complexes, artificial chromosomes, and polydispersed polymers).

[0071] The genetic expression cassette and / or vector, such as when formulated into a pharmaceutical composition, can be delivered by various means into the systemic circulation, portal vein, or directly injected into a tissue or organ, such as the liver or kidney. In addition to the liver or kidney, the brain, pancreas, eye, heart, lungs, bone marrow, and muscle constitute targets for therapy. Other tissues or organs may be additionally contemplated as targets for therapy.

[0072] In another embodiment, the inventive genetic expression cassette and / or vector can be used in ex vivo applications via packaging into a retro- or lentiviral vector to create an integrating vector that can be used to permanently correct any cell type from a patient with PCC deficiency. The synPCCB- or PCCB-transduced and corrected cells then can be used as a cellular therapy. Examples include CD34+ stem cells, primary hepatocytes, or fibroblasts derived from patients with PCC deficiency. Fibroblasts are reprogrammed to other cell types using iPS methods well known to practitioners of the art.

[0073] In yet another embodiment, the inventive genetic expression cassette is recombined using genomic engineering techniques that are well known to practitioners of the art, such as ZFNs and TALENS, into the PCCB locus, a genomic safe harbor site, such as AAVS1, or intoanother advantageous location, such as into rDNA, the albumin locus, GAPDH, or a suitable expressed pseudogene.

[0074] To facilitate administration of the inventive genetic expression cassette to a patient or animal subject, the invention provides a composition (pharmaceutical composition) comprising a therapeutically effective amount of a composition comprising the inventive genetic expression cassette or an inventive vector as described herein. The pharmaceutical composition may be for human or animal usage.

[0075] Typically, a physician or veterinarian will determine the actual dosage which will be most suitable for an individual subject, and it will vary with the age, weight, and response of the particular individual; however, the composition can be formulated for administration via common drug-delivery routes, such as subcutaneously, intramuscularly, intradermally, intraperitoneally, and intravenously. Moreover, while an appropriate dosage will be determined by the treating physician or veterinarian, in embodiments in which the inventive vector is administered as a medicament, a general range of dosage typically will fall within about 1 x 1011to about 1 x 1014genome copies (GC) / kg. Furthermore, the composition (e.g., containing the inventive genetic expression cassette or vector) can be administered in a single dose or in multiple doses, as determined by the treating physician or veterinarian.

[0076] The composition may, in specific embodiments, comprise a pharmaceutically acceptable carrier, diluent, excipient, or adjuvant. Such materials should be non-toxic and should not interfere with the efficacy of the transgene. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, sugars and ethanol. Pharmaceutically acceptable salts can also be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles. A thorough discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences (Mack Pub. Co., 18th Edition, Easton, Pa. (1990)). The choice of pharmaceutical carrier, excipient, or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as, or in addition to, the carrier, excipient, or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilizing agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system). For oral administration, excipients such as starch or lactose may be used. Flavoring or coloring agents may be included, as well. For parenteraladministration, a sterile aqueous solution may be used, optionally containing other substances, such as salts or monosaccharides to make the solution isotonic with blood.

[0077] A composition according to the invention may be administered alone or in combination with at least one other agent, such as a stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions may be administered to a patient alone, or in combination with other agents, modulators, or drugs (e.g., antibiotics).

[0078] The composition may be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories. Additional dosage forms contemplated include: in the form of a suppository or pessary; in the form of a lotion, solution, cream, ointment or dusting powder; by use of a skin patch; in capsules or ovules; in the form of elixirs, solutions, or suspensions ; in the form of tablets or lozenges. Additional embodiments of the invention

[0079] In another aspect, the invention is directed to a transgenic animal whose genome comprises the inventive genetic expression cassette. In still another aspect, the invention is directed to a method for producing such a transgenic animal, comprising: providing an exogenous expression vector comprising the inventive genetic expression cassette; introducing the vector into a fertilized oöcyte; and transplanting the oöcyte into a female animal. Transgenic animals according to the invention include, without limitation, rodent (mouse, rat, squirrel, guinea pig, hamster, beaver, porcupine), frog, ferret, rabbit, chicken, pig, sheep, goat, cow primate, and the like.

[0080] Methods for producing transgenic animals are known in the art and include, without limitation, transforming embryonic stem cells in tissue culture, injecting the transgene into the pronucleus of a fertilized animal egg (DNA microinjection), genetic / genome engineering, viral delivery (for example, retrovirus-mediated gene transfer).

[0081] In still another aspect, the invention is directed to a method for producing a genetically engineered animal as a source of recombinant synPCCB. In another aspect, genome editing, or genome editing with engineered nucleases (GEEN) may be performed with the synPCCB nucleotides of the present invention allowing synPCCB DNA to be inserted, replaced, or removed from a genome using artificially engineered nucleases. Any known engineered nuclease may be used such as Zinc finger nucleases (ZFNs), Transcription Activator-LikeEffector Nucleases (TALENs), the CRISPR / Cas system, and engineered meganuclease re- engineered homing endonucleases. Alternately, the nucleotides of the present invention including synPCCB, in combination with a CASP / CRISPR, ZFN, or TALEN can be used to engineer correction at the locus in a patient’s cell either in vivo or ex vivo, then, in one embodiment, use that corrected cell, such as a fibroblast or lymphoblast, to create an iPS or other stem cell for use in cellular therapy.

[0082] In yet another embodiment, the invention is directed at the production of lipid nanoparticles designed to express the PCCB polynucleotide(s).

[0083] In yet another embodiment, the invention is directed at the production of DNA plasmids designed to express the PCCB polynucleotide(s). Such plasmids may be devoid of bacterial DNA and include forms of closed end DNA generated by AAV replication in a baculoviral system. EXAMPLE

[0084] This Example reports the results of work developing a series of highly optimized transgenes designed to express PCCB. These new AAV9-PCCB cassettes contain optimized 5’ regulatory sequences combined with the wild type PCCB cDNA. Each rescues lethal Pccb knock-out and PccbX / X;mice and prevents hypomorphic Pccb mice from dying under metabolic stress.

[0085] These were tested for expression in HEPG2 PCCB knock out cells and then used to produce single stranded vectors that were packaged using an AAV9 capsid. The lead vector, AAV9 EF1L 5’UT PCCB HPRE, was selected for robust PCCB expression and reduced CpG content. AAV9 EF1L 5’UT PCCB HPRE was further studied for efficacy in a range of newly developed Pccb mouse models. Systemic delivery via intravenous retroorbital injection of AAV9 EF1L 5’UT PCCB HPRE to neonatal lethal, juvenile lethal and hypomorphic PCCB PA mice, representing a spectrum of genetic mutations and disease phenotypes reported in PA patients, resulted in significantly increased survival, reduced disease related metabolites, improved growth, and protection against metabolic stress in comparison to the respective untreated mutant mice. Based on disease severity, murine models of PA were treated as neonates, juveniles, or adults, which is reflective of the age range of the PA patient population.

[0086] A PCCB knock out cell line was generated to enable the testing of new PCCB transgenes. A guide sequence targeting the second exon of PCCB, 5’- CAAGAGACTGATCCTCTCCC-3’ (SEQ ID NO:32), was co-delivered with CAS9 / CRISPRto HepG2 cells, and two single cell clones, C6 and D10, were further studied by Sanger sequencing. Clone C06 was homozygous for the PCCBc.201-202delnucleotide change, corresponding to a predicted mutation of PCCBp.Arg67fs*12. Clone D10 was homozygous for the PCCBc.203delnucleotide change, corresponding to a predicted mutation of PCCBp.Glu68Glyfs*80(Figure 2, Panel A). A western blot was performed to demonstrate that the cells lines did not produce immunoreactive PCCB, hence were cross reactive material (CRM) negative (Figure 2, Panel B).

[0087] To optimize expression of the PCCB cDNA, a series of therapeutic transgene vectors were constructed. Two classes of cassettes for PCCB and synPCCB1 were generated (Figure 3, Panel A). Both were flanked by WT AAV2 ITRs that were 130 base pairs and used a kanamycin resistance marker for antibiotic selection. The respective plasmid sequences are presented in SEQ ID NOs:28-31 below (see Table 2). The therapeutic transgenes contained, 5’-3’, the elongation factor 1 long promoter, a chimeric intron, a 5’ UT translational enhancer element, either the WT or synPCCB1 cDNA (SEQ ID NO:s 10 and 11), the hepatitis B virus derived post-translational response element, and the bovine growth hormone poly-adenylation sequence. Additional transgenes were identical but did not contain the 5’ UT translational enhancer element (SEQ ID NO:s 12 and 13).

[0088] To test the relative expression potential of each transgene, PCCB knock out cells (clone D10) were transiently transfected with 18 ^g of plasmid DNA with lipofectamine™ 2000 reagent (Invitrogen) and Opti-MEM™ (ThermoFisher Scientific) using the manufacturer’s instructions. Each transfection was performed in triplicate. Cells were harvested 72 hours post transfection and lysed in M-Per™ buffer (ThermoFisher Scientific) supplemented with fresh protease inhibitors (cOmpleteTM Protease Inhibitor Cocktail, Sigma). Homogenates were centrifuged at 16,000 RCF for 15 minutes. Supernatant was collected and measured for protein content by Bradford assay. Samples were then denatured in 5x SDS loading buffer and run on SDS-PAGE gels (50 ug of protein per lane). Resulting blots were immunoblotted (IB) with one or more of the indicated antibodies: PCCB Polyclonal antibody (Proteintech, catalog number 11139-1-AP) and Beta Actin Monoclonal antibody (Proteintech, catalog number 66009-1-Ig). Background as measured on HepG2 PCCB KO D10 lane was subtracted out followed by normalization to beta actin levels for each lane. Band intensity was measured using Image Studio™ software from LICORbio. The lanes were compared to the WT PCCB. As can be seen in Figure 4, 5'UTR_synPCCB1 had the highest expression of PCCB (1.44x WT PCCB) followed by synPCCB (1.43 X WT PCCB), then 5'UTR_PCCB WT (1.29xWT PCCB) and lastly PCCB WT (set at 1.0). Thus, the inclusion of a translational enhancer in the 5’UT increased the expression of PCCB to levels comparable to those produced when the construct contained the synPCCB1 gene, which is CpG enriched. Figure 5 presents an extended exposure of the western blot presented in Figure 4, revealing a robust increase over the relatively low basal levels of PCCB present in the parental HepG2 cell line.

[0089] Prior to testing in mice, the EF1L 5’UT PCCB HPRE transgene contained within plasmid pAAV EF1L 5UT PCCB HPRE kana (SEQ ID NO:24) was packaged into an AAV9 capsid using triple transfection, purified, and further studied. The resulting vector, designated AAV9-hPCCB was used to infect PCCB knock out cells (clone D10). Varying concentrations (5x104, 5x105, 1x106vg) of AAV9-hPCCB showed increasing expression of PCC enzyme by Western Blotting after probing with a PCCB specific antibody that was not seen in the control (uninfected PCCB KO cells) (Figure 6). These studies show the vector grows well, can package the transgene, infect a human liver PCCB knock out cell line and demonstrate transgene expression.

[0090] A series of in vivo studies in Pccb mutant mice were next performed. Because there are no murine models of PA caused by PCCB deficiency, we used CRISPR / Cas9 genome editing to engineer 3 different mutations that are analogous to mutations seen in patients, such as frameshift-stop changes, in exon 7 and 14 of the murine Pccb gene as well as a murine Pccbp.P230Lmissense mutation in Exon 7, which is orthologous to the human PCCBp.P228Lmissense mutation which causes a milder form of PA in the homozygous state. Another severe Pccb mutation, caused by an 8 bp deletion in exon 7, is null at the level of PCCB protein expression (cross reactive material (CRM)-). Pccb8 bp del / 8 bp delmice recapitulate the neonatal lethal form of PA in humans, and these mice perish in the first 7 days of life, and hence, are particularly useful to assay the efficacy of AAV9-hPCCB gene therapy for the treatment of severe PA. Data from the in vivo studies demonstrate that administration of AAV9-hPCCB vector rescues Pccb8 bp del / 8 bp delneonatal mice by increasing animal survival and reducing levels of pathological metabolites.

[0091] A hypomorphic model of PA caused by PCCB deficiency was also generated using an approach previously adopted to study the related disorder, methylmalonic acidemia (MMA). In brief, a rescue transgene designed to express PCCB from the murine creatine kinase promoter (Mck) was introduced as a germline transgene (TgMck-Pccb) and bred with mice carrying a severe Pccb mutation, c.1495_1499, designated PccbX, which causes a predicted frameshift stop mutation p.Ala498Profs*2. PccbX / X; TgMck-Pccbmice are rescued from lethality due to transgene expression in the muscle but manifest growth retardation, lethality afterweaning, and pronounced elevations of 3-OHP and 2-MC caused by lack of PCC in the liver. AAV9-hPCCB treatment of PccbX / X; TgMck-Pccbmice at weaning results in weight gain, increased survival, and reduced metabolites.

[0092] In mouse models of methylmalonic and propionic acidemia, early lethality is a uniform characteristic of the homozygous mutant phenotype. Accordingly, these studies were initiated to determine the therapeutic efficacy of AAV9-hPCCB delivered by intravenous retroorbital plexus injection in newborn Pccb8 bp del8 / 8 bp delmice. Because the untreated Pccb8bp del / 8 bp delmice experience 100% lethality in the newborn period (Figure 7), we injected AAV9-hPCCB via retro-orbital plexus to the systemic circulation to recapitulate IV delivery, the anticipated route of administration in humans. Heterozygous Pccb8 bp del8 / +breeding units yielded litters and all the pups obtained in the litter were treated with AAV9-hPCCB within a few hours after birth (at P1). For the survival study in the Pccb8 bp del8 / 8 bp delmice, we used a dose of 1x1014vg / kg administered via a retro-orbital injection. To minimize stress on the newborns and mothers, the pups were not weighed before AAV9-hPCCB administration.

[0093] The survival of the AAV9-hPCCB treated Pccb8 bp del / 8 bp delmice is presented in Figure 7. A dose of 1x1014vg / kg provided rescue from neonatal lethality. In the same mice, the disease related metabolites, 3-OHP and 2-MC, which serve as metabolic biomarkers reflective of PCC activity restored in the liver from AAV9-hPCCB expression, were measured and compared to the levels in untreated Pccb8 bp del / 8 bp delmice (n=6). The AAV9-hPCCB treated Pccb8 bp del / 8 bp delmice (n=2) had a substantial reduction in 3-OHP (****P<0.001) and 2-MC (****P<0.001) at D30 post injection. The results are presented in Figure 8.

[0094] Figure 9 presents a Western blot to examine expression of PCCB after AAV9-hPCCB gene delivery. To generate the data, Pccb8 bp del8 / 8 bp delmice (PA) were treated with 1x1014vg / kg of AAV9-hPCCB delivered by retroorbital injection on P1. Livers from two wild type mice, two untreated Pccb8 bp del8 / 8 bp delmice, and three treated Pccb8 bp del8 / 8 bp delmice were collected 35 days after birth. The livers were lysed in T-Per™ buffer (ThermoFisher Scientific) supplemented with fresh protease inhibitors (Halt Protease Inhibitor Cocktail, ThermoFisher Scientific). Homogenates were centrifuged at 10,000 RCF for 5 minutes. The supernatant was collected and measured for protein content by BCA assay. Samples were then denatured in 5x SDS loading buffer and electrophoresed on SDS-PAGE gels (100 mg of protein per lane). The resulting membranes were immunoblotted (IB) with the following antibodies: PCCB Polyclonal antibody (Proteintech, catalog number 11139-1-AP) and DJ-1 Recombinant Monoclonal Antibody (ThermoFisher Scientific, catalog number SN07-21) (both diluted 1:2000 in TBS-T). Imaging used an Odyssey system (LI-COR). PCCB expression wasdetected in the WT and Pccb8 bp del8 / 8 bp delAAV9-hPCCB treated mice, but not in the untreated Pccb8 bp del8 / 8 bp delmice

[0095] PccbX / X; TgMck-Pccbmice represent an early childhood model of PCCB deficiency and can be treated at weaning. In a proof-of-concept and exploratory dosing study, 7 PccbX / X; TgMck-Pccbmice received AAV9-hPCCB at a dose of 1x1014vg / kg delivered via retroorbital injection on D25, 7 PccbX / X; TgMck-Pccbmice received AAV9-hPCCB at a dose of 2.5x1013vg / kg delivered via retroorbital injection on D25, and 4 PccbX / X; TgMck-Pccbmice received AAV9- hPCCB at a dose of 5x1012vg / kg delivered via retroorbital injection on D25. Survival, growth, and the levels of 2-MC and 3-OHP were measured in the treated mice on D10 and D30 and compared to historic untreated controls sampled on D25. The survival of the AAV9-hPCCB treated PccbX / X; TgMck-Pccbmice are presented in Figure 10 and compared to 19 untreated PccbX / X; TgMck-Pccbmice and 3 PccbX / X; TgMck-Pccbtreated with phosphate buffered saline (vehicle) which served as controls for the study. Doses of 1x1014vg / kg and 2.5x1013vg / kg significantly increased survival compared to untreated PccbX / X; TgMck-Pccbcontrols. The 4 PccbX / X; TgMck-Pccbmice treated with a dose of 2.5x1013vg / kg are not included because they have not yet reached D10 after treatment. Animals were weighed on D25 and again on D35 after AAV9-hPCCB treatment alongside wild type controls (n=10) and compared to untreated PccbX / X; TgMck-Pccbmice weighed on D25 (n=10). Figure 11 Panel A shows that at 10 and 30 days, the PccbX / X; TgMck-Pccbmice treated with AAV9-hPCCB at doses of 1x1014vg / kg and 2.5x1013vg / kg achieved the same weight as wild type untreated controls (P= not significant, ns). Measurements of disease related metabolites, 3-OHP and 2-MC, which serve as metabolic biomarkers reflective of PCC activity restored in the liver from AAV9-hPCCB expression, were measured in AAV9-hPCCB compared to the levels in untreated PccbX / X; TgMck-Pccbmice (n=7) and PccbX / X; TgMck-Pccbmice injected with PBS (n=3). The AAV9-hPCCB PccbX / X; TgMck-Pccbmice treated with 1x1014vg / kg and 2.5x1013vg / kg had a substantial reduction in 3-OHP (P<0.05) (Figure 11 Panel B) and 2-MC (P<0.001) (Figure 11 Panel C) at both D10 and D30 post injection in comparison to untreated PccbX / X; TgMck-Pccband PccbX / X; TgMck-Pccbtreated with PBS.

[0096] To examine whether AAV9-hPCCB treatment resulted in hepatic PCCB expression, PccbX / X; TgMck-Pccbmice treated with AAV9-hPCCB at doses of 1x1014vg / kg and 2.5e1013vg / kg were sacrificed 30 days after injection. Livers were lysed in T-Per™ buffer (ThermoFisher Scientific) supplemented with fresh protease inhibitors (Halt Protease Inhibitor Cocktail, ThermoFisher Scientific). Homogenates were centrifuged at 10,000 RCF for 5 minutes. The supernatant was collected and measured for protein content by BCA assay.Samples were then denatured in 5x SDS loading buffer and electrophoresed on SDS-PAGE gels (100 ^g of protein per lane). The resulting membranes were immunoblotted (IB) with the following antibodies: PCCB Polyclonal antibody (Proteintech, catalog number 11139-1-AP) and DJ-1 Recombinant Monoclonal Antibody (ThermoFisher Scientific, catalog number SN07-21) (both diluted 1:2000 in TBS-T). Imaging used an Odyssey system (LI-COR). PCCB expression was detected in the WT and PccbX / X; TgMck-PccbAAV9-hPCCB treated mice, but not in the untreated PccbX / X; TgMck-Pccbmice (Figure 12 Panel A). A dose response between the degree of hepatic PCCB expression was noted with the 1x1014vg / kg treated mice showing 300% PCCB expression compared the WT controls, and the 2.5e1013vg / kg treated animal showing the same level of hepatic PCCB as untreated WT controls (Figure 12 Panel B).

[0097] An examination of the vector biodistribution was conducted in two PccbX / X; TgMck-Pccbmice treated with AAV9-hPCCB at a dose of 1x1014vg / kg that were then sacrificed 30 days after injection. Genomic DNA from tissue samples was extracted using the DNeasy Blood & Tissue Kit (catalog number 69506; QIAGEN). ddPCR was performed according to the manufacturer’s recommendations using a Bio-Rad (Hercules, CA, USA) QX200 AutoDG ddPCR system with the following probes: Bio-Rad ddPCR copy number variation (CNV) assay Gapdh (assay ID dMumCNS300520369) and PCCB (assay ID dHsaCPE5056812). Figure 13 presents the average of the number of vector genomes containing PCCB in various tissues, normalized to the genomic locus Gapdh. The liver and heart, the target tissues for gene therapy in PA, have the highest number of transgenes which were variably detected in other tissues studied.

[0098] The expression of the AAV9-hPCCB was detected using RNA in situ hybridization with two color RNAscope. A series of probes designed to recognize the expression of PCCB mRNA and the AAV DNA genomes was generated. A PccbX / X; TgMck-Pccbmouse was treated with AAV9-hPCCB using systemic delivery via intravenous retroorbital injection at weaning age at a dose of 1x1014vg / kg. Three months later, the mouse was harvested to study AAV9- hPCCB transgene expression in various tissues. Figure 14, Panel A demonstrates widespread expression of PCCB mRNA in the liver (stained) and Figure 14, Panel B vector genomes showing transduction of the liver (bright puncta). Figure 15, Panel A demonstrates expression of PCCB mRNA in the outer renal cortical tubules (stained) and Figure 15, Panel B transduction of the tubules (bright puncta). Figures 16 and 17 likewise show widespread transgene expression in the heart (Figure 16, Panel A and B) and skeletal muscle (Figure 17, Panel and B) respectively. Figure 18, Panel A shows the spleen, and rare cells within thegerminal center that expressed PCCB and are transduced (Figure 18, Panel B). Figure 19, Panel A shows the brain, and cells that are expressing PCCB (Figure 19, Panel B).

[0099] The PccbP230L / 8bp delmurine model is a compound heterozygote, harboring a missense mutation and a frameshift stop allele, a genotype combination frequently noted in PA patients. PccbP230L / 8bp delmice were treated with AAV9-hPCCB using systemic delivery via intravenous retroorbital injection at 2 months of age at a dose of 1x1014vg / kg. Untreated and AAV9- hPCCB treated PccbP230l / 8bp delmice were then placed on a high protein diet to induce metabolic stress. The AAV9-hPCCB treated PccbP230l / 8bp delmice maintained their weight and appeared healthy during the 10-day exposure to high protein while the untreated PccbP230l / 8bp delmice became lethargic and lost a significant amount of weight from a baseline that was equal to unaffected controls (not presented) (Figure 20, Panel A). The high protein diet was discontinued after 10 days of feeding because of the weight loss and poor health of the untreated PccbP230l / 8bp delanimals. The unaffected PccbWT / P230Lmice did not lose weight while on the high protein diet, indicating that the stress caused by the diet was disease related. The disease related metabolites, 3-OH and 2-MC, were significantly reduced 10 days post AAV9-hPCCB treatment and are presented in Figure 20, Panels B-C.

[0100] The expression of the AAV9-hPCCB was detected using RNA in situ hybridization with two color RNAscope. A series of probes designed to recognize the expression of PCCB mRNA and the AAV DNA genomes was generated. A PccbP230L / 8bp delmouse was treated with AAV9-hPCCB using systemic delivery via intravenous retroorbital injection at 2 months of age at a dose of 1x1014vg / kg. Two weeks later, the mouse was harvested to study AAV9- hPCCB transgene expression in various tissues. Figure 21, Panel A shows representative H and E stained liver, Figure 21, Panel B demonstrates widespread expression of PCCB mRNA in the liver (stained) and Figure 21, Panel C transduction of the liver (bright puncta). Figure 22, Panel A shows representative H and E stained kidney, Figure 22, Panel B demonstrates expression of PCCB mRNA in the outer renal cortical tubules (stained) and Figure 22, Panel C transduction of the tubules (bright puncta). Figures 23 and 24 likewise show histology (Figure 23, Panel A, Figure 24, Panel A) and widespread transgene expression in the heart (Figure 23, Panel B) and skeletal muscle (Figure 24, Panel B) respectively. Figure 25, Panel A shows the spleen, and cells within the germinal center that are transduced (Figure 25, Panel B) but appear to only contain AAV genomes (Figure 25, Panel C).

[0101] In summary, the results of these experiments demonstrate the delivery via intravenous retroorbital injection of AAV9-hPCCB to neonatal lethal, juvenile lethal and hypomorphic PCCB PA mice, representative of the spectrum of genetic mutations and disease phenotypesreported in PA patients, resulted in significantly increased survival, reduced disease related metabolites, improved growth, and protection against metabolic stress in comparison to the respective untreated mutant mice. Based on disease severity, murine models of PA were treated as neonates, juveniles, or adults, which is reflective of the age range of the PA patient population. PA patients experience early mortality, therefore the significant improvement in survival strongly supports the efficacy of AAV9-hPCCB therapy. A reduction in disease related metabolites observed after AAV9-hPCCB treatment provides evidence of increased PCC enzymatic activity and may be clinically beneficial because these metabolites are thought to be toxic. Lastly, the resistance to metabolic stress in a murine model of PA is clinically relevant because patients are known to experience potentially lethal metabolic decompensation in response to stressors. After systemic delivery of AAV9-hPCCB, widespread transduction and transgene expression in the liver, heart, skeletal muscle, and to a less extent, the kidney, was demonstrated using two color RNAscope to detect mRNA and AAV viral genomes after treatment of PCCB with AAV9-hPCCB in 2 mouse models of PCCB deficiency.

[0102] Thus, the work reported in this Example demonstrates the successful engineering of several novel PCCB gene therapy vectors including a safer and potent AAV9 PCCB vector that displays efficacy in murine models of PA over a dose range between 2.5e13vg / kg and 1e14vg / kg. AAV9 EF1L 5’UT PCCB HPRE and other optimized PCCB transgenes, therefore, represent a promising new gene therapy approach that may be used to treat patients with PA caused by PCCB deficiency, a genetic disorder that has no known effective therapy. The PCCB transgenes could be used for the in vitro production of PCC and PCCB for use in enzyme replacement therapy, mRNA therapeutics, DNA and RNA based non-viral gene therapies, ex vivo genome editing of cells, and viral gene therapy with AAV, lentiviral and editing vectors.

[0103] For CpG islands (*), see Madeira F, Madhusoodanan N, Lee J, et al. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Research.2024 Apr:gkae241. DOI: 10.1093 / nar / gkae241. PMID: 38597606 (incorporated herein in its entirety). Table 2 Biological Sequences SEQ ID NO: 1: 5’ Adenoassociated viral (AAV) inverted terminal repeat (ITR)AG TA AG GC CG CT AA CC CTA CT GC GAGCGCGGCC CCG G CGG CGGGGG G C C GC GGCCGGCC GC CTGSEQ ID NO:6: Nucleotide sequence of synPCCB1:SEQ ID NO:8: Nucleotide sequence of the bovine growth hormone poly-adenylation sequenceG G C A T A GCCAACCTTCTTCCACACGTGCCCGAATCTGCTGTGACCTGGATGTCTTGGCCAGCCCTTCATGGTCAAGGATACCTCGTACCTCTTCATTACTGGCCCAGACGTGGTCAACAAGACCCTGCACCTGTGCGGGAATGCCACGACCCAAGCGACAGGCTGGTGCCGSEQ ID NO:16: Nucleotide sequence EF1L 5UT PCCB HPRE without intronGTCGACGCCCTGTGCAATCTGCGGGATTTCTTTAACTACCTCCCGCTGTCCAGCCGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGACTAGAAG AG GT AG AC CT TA CC ATT GG TA GG CG CG GA CT AT AC TT CA CG AT TG AC AT TG CTT AT CA TTG G C GCCC GCC G C C G GG GC G G AT GGGAGGACTGTTGGAATTGTTGGCAACCAACCTAAGGTGGCCTCAGGATGCTTG GATATTAATTCATCTGTGAAAGGGGCTCGTTTTGTCAGATTCTGTGATGCATTCA ATATTCCACTCATCACTTTTGTTGATGTCCCTGGCTTTCTACCTGGCACAGCACAGCAA CCT GC GCG TAG GA AA GTT CTA TAG CTT GCG TGA AA CTT GAC AA GGC CAA TGC GAC CTT ATT TAT TTG CA AG GAC GGA AC GGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGA GGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAA AGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATAA A G G T T C GTCTCTGATCATGGGCCCATGTGCTGGTGGGGCCGTCTACTCCCCAGCCCTAACAG ACTTCACGTTCATGGTAAAGGACACCTCCTACCTGTTCATCACTGGCCCTGATGTT GTGAAGTCTGTCACCAATGAGGATGTTACCCAGGAGGAGCTCGGTGGTGCCAAGG T A T A A C C G C G G T G G A CCTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGG AAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCCCCA GTC GAA GCAA GTTA GCAT AGCT ATTC TCG ACGT TTA GCAC CTTC CATT CGC GCTT TTAC CATC AGTG TGAT AAC CACT CAAA AAAA CGGC GCTGGT AAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTA AAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACT CGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACA GAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATA ACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCG AAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATC GTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGASEQ ID NO:21: Nucleotide sequence of the RSV EF1L synPCCB1 HPRE lentiviral transgeneC CCC G C GGGGCCC G GC GG GG GCCG G C C CCGGCCC G CCSEQ ID NO:22: Nucleotide sequence of the RSV ApoE HAAT PCCB HPRE lentiviral transgeneAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGAC GGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGA AAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAAC AAATTACAAAAATTCAAAATTTTACTAGTAGGCTCAGAGGCACACAGGAGTTTCT GGGCTCACCCTGCCCCCTTCCAACCCCTCAGTTCCCATCCTCCAGCAGCTGTTTGT GTGCTGCCTCTGAAGTCCACACTGAACAAACTTCAGCCTACTCATGTCCCTAAAA TGGGCAAACATTGCAAGCAGCAAACAGCAAACACACAGCCCTCCCTGCCTGCTG ACCTTGGAGCTGGGGCAGAGGTCAGAGACCTCTCTGGGCCCATGCCACCTCCAA CATCCACTCGACCCCTTGGAATTTCGGTGGAGAGGAGCAGAGGTTGTCCTGGCGT GGTTTAGGTAGTGTGAGATGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGT GAGAGCAGAGGGCCAGCTAAGTGGTACTCTCCCAGAGACTGTCTGACTCACGCC ACCCCCTCCACCTTGGACACAGGACGCTGTGGTTTCTGAGCCAGGTACAATGACT CCTTTCGGTAAGTGCAGTGGAAGCTGTACACTGCCCAGGCAAAGCGTCCGGGCA GCGTAGGCGGGCGACTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGCTCCTC CGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCT CTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGCTTCAG GCACCACCACTGACCTGGGACAGTGAATGAATTCAGGCTGGGAGTATATTAGTG CTAATTTCCCTCCGTTTGTCCTAGCTTTTCTCTTCTGTCAACCCCACAGCCACCAT GGCGGCGGCATTACGGGTGGCGGCGGTCGGGGCAAGGCTCAGCGTTCTGGCGAG CGGTCTCCGCGCCGCGGTCCGCAGCCTTTGCAGCCAGGCCACCTCTGTTAACGAA CGCATCGAAAACAAGCGCCGGACCGCGCTGCTGGGAGGGGGCCAACGCCGTATT GACGCGCAGCACAAGCGAGGAAAGCTAACAGCCAGGGAGAGGATCAGTCTCTTG CTGGACCCTGGCAGCTTTGTTGAGAGCGACATGTTTGTGGAACACAGATGTGCAG ATTTTGGAATGGCTGCTGATAAGAATAAGTTTCCTGGAGACAGCGTGGTCACTGG ACGAGGCCGAATCAATGGAAGATTGGTTTATGTCTTCAGTCAGGATTTTACAGTT TTTGGAGGCAGTCTGTCAGGAGCACATGCCCAAAAGATCTGCAAAATCATGGAC CAGGCCATAACGGTGGGGGCTCCAGTGATTGGGCTGAATGACTCTGGGGGAGCA CGGATCCAAGAAGGAGTGGAGTCTTTGGCTGGCTATGCAGACATCTTTCTGAGGA ATGTTACGGCATCCGGAGTCATCCCTCAGATTTCTCTGATCATGGGCCCATGTGC TGGTGGGGCCGTCTACTCCCCAGCCCTAACAGACTTCACGTTCATGGTAAAGGAC ACCTCCTACCTGTTCATCACTGGCCCTGATGTTGTGAAGTCTGTCACCAATGAGG ATGTTACCCAGGAGGAGCTCGGTGGTGCCAAGACCCACACCACCATGTCAGGTG TGGCCCACAGAGCTTTTGAAAATGATGTTGATGCCTTGTGTAATCTCCGGGATTT CTTCAACTACCTGCCCCTGAGCAGTCAGGACCCGGCTCCCGTCCGTGAGTGCCACCSEQ ID NO:23: Nucleotide sequence of the RSV ApoE HATT synPCCB1 HPRE lentiviral transgeneGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATCATGTTTGTGGAACACAGATGTGCAGATTTTGGAATGGCTGCTGATAAGAATAAGT C G C C G T G GCGACAATTCTGTCGTACTCTCCCGCAAGTATACATCGTTTCCATGGCTGCTAGGCT GTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCT GAATCCCGCGGACGACCCCTCCCGGGGCCGCTTGGGGCTCTACCGCCCGCTTCTCATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCT CACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT SEQ ID NO:27: Nucleotide sequence of the CMV ApoE HATT synPCCB1 HPRE lentiviral transgene TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAG TTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACC CCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGAC TTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTA CATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAAT GGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCA GTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTAC ATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCA TTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATG TCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGA GGTCTATATAAGCAGAGCTGGTTTAGTGAACCGGGTCTCTCTGGTTAGACCAGAT CTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAA AGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAA CTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCC CGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGG ACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGT ACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAG CGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGG AGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTA GACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTA GATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGAT AAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTA AGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATG AGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCA TTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAG AGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCAC TATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGT ATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGCGGCGCTGAATCCCGCGGACGACCCCTCCCGGGGCCGCTTGGGGCTCTACCGCCCGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGG CACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCSEQ ID NO:28: Nucleotide sequence pAAV EF1L 5’UT PCCB HPRE kanaACAGTATATGACCCTTTACCCCGTTGCTCGGCAACGGCCTGGTCTGTGCCAAGTGSEQ ID NO:29: Nucleotide sequence pAAV EF1L 5’UT synPCCB1 HPRE kanaTTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAAT GT GC G TG AG T TG AC GG CG GC AT GC A AT TT GT AG A T AT A G A TC CT GG TC CC CGA TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAG CCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTASEQ ID NO:31: Nucleotide sequence pAAV EF1L synPCCB1 HPRE kanaGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTAGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGSEQ ID NO:32: guide sequence targeting the second exon of PCCB

Claims

CLAIMS 1. A genetic expression cassette comprising, in order from 5’-3’: an 5’ adenoassociated viral (AAV) inverted terminal repeat (ITR), the elongation factor 1 long promoter, a chimeric intron, a 5’ UT translational enhancer element containing a Kozak sequence, a polynucleotide comprising a nucleic acid sequence with at least 80% identity to the nucleic acid sequence of SEQ ID NOs:5 or 6 (either WT PCCB or synPCCB1), the hepatitis B virus derived post- translational response element, the bovine growth hormone poly-adenylation sequence, and an 3’ AAV inverted ITR.

2. The genetic expression cassette of claim 1, wherein, a. the 5’ AAV ITR comprises SEQ ID NO:1, b. the elongation factor 1 long promoter comprises SEQ ID NO:2, c. the chimeric intron comprises SEQ ID NO:3, d. the 5’ UT translational enhancer element containing a Kozak sequence comprises SEQ ID NO:4, e. the hepatitis B virus derived post-translational response element comprises SEQ ID NO:7, f. the bovine growth hormone poly-adenylation sequence comprises SEQ ID NO:8, g. the 3’ AAV ITR comprises SEQ ID NO:9, or h. a combination of one or more of (a) through (g).

3. The genetic expression cassette according to claim 1 or 2, comprising a polynucleotide comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of any one of SEQ ID NOs: 10-13.

4. The genetic expression cassette according to claim 1 or 2, comprising a polynucleotide consisting essentially of the nucleic acid sequence of any one of SEQ ID NOs: 10-13.

5. The genetic expression cassette according to any one of claims 1-4, comprising a polynucleotide consisting of the nucleic acid sequence of SEQ ID NO:10.

6. The genetic expression cassette according to any one of claims 1-4, comprising a polynucleotide consisting of the nucleic acid sequence of SEQ ID NO:

11.

7. The genetic expression cassette according to any one of claims 1-4, comprising a polynucleotide consisting of the nucleic acid sequence of SEQ ID NO:

12.

8. The genetic expression cassette according to any one of claims 1-4, comprising a polynucleotide consisting of the nucleic acid sequence of SEQ ID NO:

13.

9. The genetic expression cassette according to any one of claims 1-8, configured to integrate into the genome after delivery using a lentiviral vector.

10. The genetic expression cassette according to claim 9, wherein lentiviral vector further comprises a human alpha 1 antitrypsin promoter.

11. The genetic expression cassette according to claim 9, wherein the lentiviral vector further comprises the elongation factor 1 long promoter.

12. The genetic expression cassette according to claim 9, wherein the lentiviral vector further uses the cytomegalovirus (CMV) promoter to assist with viral transgene production.

13. A recombinant expression vector comprising the genetic expression cassette according to any one of claims 1-8.

14. The recombinant expression vector according to claim 13, wherein the vector is a recombinant adeno-associated virus (rAAV), said rAAV comprising an AAV capsid, and a vector genome packaged therein, said vector genome comprising the genetic expression cassette.

15. The recombinant expression vector according to claim 14, wherein the AAV capsid is from an AAV of serotype AAV1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 44.9, rh8, rh10, ANC80L65, LK03, NP59, KP1, and mutants thereof.

16. The recombinant expression vector according to claim 14 or 15, wherein the AAV capsid is from an AAV of serotype 8.

17. The recombinant expression vector according to claim 14 or 15, wherein the AAV capsid is from an AAV of serotype 9.

18. The recombinant expression vector according to any one of claims 14-17, wherein the vector genome comprises RNA comprising a sequence selected from SEQ ID NOs: 14, 15, 16, 17, 18, or 19, or a sequence having at least 80% identity to the nucleic acid sequence of any one of SEQ ID NOs: 14, 15, 16, 17, 18, or 19.

19. A composition comprising the genetic expression cassette according to any one of claims 1-12 and a pharmaceutically acceptable carrier.

20. A composition comprising the expression vector according to any one of claims 13- 18 and a pharmaceutically acceptable carrier.

21. The composition according to claim 20, further comprising a hybrid AAV-Piggy Bac (PB) or hybrid AAV-Sleeping Beauty (SB) transposon system.

22. A method of treating a disease or condition mediated by propionyl-CoA carboxylase, comprising administering to a subject in need thereof a therapeutic amount of a composition comprising the genetic expression cassette according to any one of claims 1-12.

23. The method according to claim 22, comprising administering to a cell of a subject in need thereof the genetic expression cassette, wherein the genetic expression cassette is inserted into the cell of the subject via genome editing on the cell of the subject using a nuclease selected from the group of zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), the clustered regularly interspaced short palindromic repeats (CRISPER / cas system) and meganuclease re-engineered homing endonucleases on a cell from the subject; and administering a composition comprising the cell to the subject.

24. A method of treating a disease or condition mediated by propionyl-CoA carboxylase, comprising administering to a subject a composition comprising propionyl-CoA carboxylase produced using the genetic expression cassette according to any one of claims 1- 12 or the expression vector according to any one of claims 13-18.

25. A method of treating a disease or condition mediated by propionyl-CoA carboxylase, comprising administering to a subject a composition comprising the expression vector according to any one of claims 13-18.

26. A method of treating a disease or condition mediated by propionyl-CoA carboxylase, comprising administering to a subject in need thereof a therapeutic amount of a composition comprising the expression vector according to any one of claims 13-18.

27. The genetic expression cassette according to any one of claims 1-12, propionyl-CoA carboxylase produced using the genetic expression cassette according to any one of claims 1- 12 or the expression vector according to any one of claims 13-18, or the expression vector according to any one of claims 13-18 for use or when used in the treatment a disease or condition mediated by propionyl-CoA carboxylase.

28. Use of the genetic expression cassette according to any one of claims 1-12, propionyl-CoA carboxylase produced using the genetic expression cassette according to any one of claims 1-12 or the expression vector according to any one of claims 13-18, or the expression vector according to any one of claims 13-18 in the manufacture of a medicament for the treatment of a disease or condition mediated by propionyl-CoA carboxylase.

29. The method according to any one of claims 22-26 or the use according to claim 27 or 28, wherein the disease or condition is propionic acidemia (PA).

30. The method or use according to any one of claims 22-29, wherein the composition is administered through a route consisting of subcutaneously, intramuscularly, intradermally, intraperitoneally, and intravenously.

31. The method or use according to claim 30, wherein the genetic expression cassette is within an rAAV and is administered at a dose of about 1 x 1011to about 1 x 1014genome copies (GC) / kg.

32. The method or use according to any one of claims 25-31, wherein administering the vector comprises administration of a single dose of vector.

33. The method or use according to any one of claims 25-31, wherein administering the vector comprises administration of multiple doses of vector.

Images