Use of inverted terminal repeats (ITRS) and ITR-proximal region (IPRS) in gene therapy vectors
Incorporating IPR sequences into rAAV vectors addresses the safety concerns of high vector doses by enhancing transgene expression in target tissues, improving gene therapy safety and efficacy.
Patent Information
- Application Number
- PCT/US2025/051657
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-04-11
- Filing Date
- 2025-10-20
- Publication Date
- 2026-04-30
AI Technical Summary
High doses of recombinant adeno-associated virus (rAAV) vectors required for efficacious gene therapy elicit an immune response and pose safety risks due to high vector genomes in transduced cells, necessitating improved transgene expression strategies.
Incorporation of inverted terminal repeat proximal region (IPR) sequences from AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, and AAVrh.39 into rAAV vectors to enhance promoter and enhancer activities, facilitating tissue-specific transgene expression.
Enhances transgene expression in target tissues such as muscle and liver, reducing the required vector dose and minimizing immune response, thereby improving the safety and efficacy of gene therapy.
Smart Images

Figure US2025051657_30042026_PF_FP_ABST
Abstract
Description
[0001] USE OF INVERTED TERMINAL REPEATS (ITRS) AND ITR-PROXIMAL REGION (IPRS) IN GENE THERAPY VECTORS
[0002] RELATED APPLICATIONS
[0003] This Application claims the benefit under 35 U.S.C. 119(e) of the filing date of U.S. provisional application serial numbers 63 / 710,000, filed October 21, 2024, entitled “USE OF INVERTED TERMINAL REPEATS (ITRS) AND ITR-PROXIMAL REGION (IPRS) FROM ADENO-ASSOCIATED VIRUS SEROTYPES 8 AND RH.39 IN GENE THERAPY VECTORS”, and 63 / 787,146, filed April 11, 2025, entitled “USE OF INVERTED TERMINAL REPEATS (ITRS) AND ITR-PROXIMAL REGION (IPRS) IN GENE THERAPY VECTORS”. The entire contents of each referenced application are incorporated by reference herein.
[0004] FEDERALLY SPONSORED RESEARCH
[0005] This invention was made with government support under W81XWH-17-1-0212 awarded by the Defense Health Agency, Medical Research and Development Branch, and HL 131471, AH21135, HL147367, HD080642, and NS076991 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0006] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0007] The contents of the electronic sequence listing (U012070209WO00-SEQ-KZM.xml; Size: 27,523 bytes; and Date of Creation: October 20, 2025) are herein incorporated by reference in their entirety.
[0008] BACKGROUND
[0009] Recombinant adeno-associated virus (rAAV) vectors are used in seven FDA-approved gene therapies and over 250 clinical trials. While many clinical trials have been successful, the high rAAV doses required for efficacious treatments still pose risks to patients. Specifically, high amounts of vector genomes in transduced cells are known to elicit an immune response. Therefore, increasing transgene expression is paramount to increasing the safety profile of rAAVs used in gene therapy platforms.
[0010] In wildtype AAVs and in their recombinant counterparts, the genomes are flanked by inverted terminal repeat (ITR) sequences at both ends. The ITRs are essential for rAAV genome replication and serve as the packaging signal into pre-assembled capsids. The ITR structure forms a T-shaped hairpin. Engineering of the ITR structure through the introduction of mutations has enhanced the function of vectors. For example, removal of the terminal resolution site (TRS) has been used to generate self-complementary AAV vectors (scAAVs). Additionally, sequence alterations to the D sequence and the RBS’ ITR regions can impact the packaging process. ITRs are directly linked with AAV genome integration. There is also compelling evidence that ITRs interact with host proteins and trigger anti-viral and DNA damage-response pathways. Finally, the ITRs are essential for the stability of AAV, because they determine postentry processing and persistence of the vector as circular episomes. Consequently, different ITRs may display distinct patterns of vector stability, persistence, and safety.
[0011] SUMMARY
[0012] Aspects of the disclosure relate to methods and compositions for delivering transgenes to a target tissue. The disclosure is based, in part, on compositions (e.g., isolated nucleic acids, recombinant adeno-associated virus (rAAV) vectors and viral particles, etc.) comprising one or more inverted terminal repeat (ITR) proximal region (IPR) sequences. In some embodiments, the IPR sequences are AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, and AAVrh.39 IPR sequences. In some embodiments, the IPR sequences provide robust promoter activity as well as enhancer activity when used alone or in conjunction with its native ITRs. In some embodiments, compositions described by the disclosure display enhanced tissue-specific transgene expression, for example expression in muscle tissue or liver tissue. Thus, aspects of the disclosure relate to methods of delivering a transgene to a target tissue (e.g., muscle tissue, liver tissue, etc.) of a subject comprising administering a composition comprising one or more IPR sequences.
[0013] Accordingly, in some aspects, the disclosure provides a recombinant adeno-associated viral (rAAV) vector comprising a transgene flanked by non-AAV2 inverted terminal repeats (ITRs), wherein the non-AAV2 ITRs comprise a 5 ’-ITR and a 3 ’-ITR with respect to the transgene, and further comprising an AAV ITR proximal region (IPR) sequence selected from an AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, and AAVrh.39 IPR sequence.
[0014] In some embodiments, an IPR sequence is positioned between the transgene and the 3’- ITR. In some embodiments, an IPR sequence is positioned between the 5’-ITR and the transgene.
[0015] In some embodiments, a transgene comprises a promoter sequence. In some embodiments, the promoter sequence is a constitutive promoter sequence, inducible promoter sequence, and / or a tissue-specific promoter sequence.
[0016] In some embodiments, a transgene does not comprise a promoter sequence. In some embodiments, the IPR sequence replaces the promoter sequence (e.g., is operably linked to a protein-coding sequence of the transgene).
[0017] In some embodiments, a transgene comprises a nucleotide sequence encoding a protein. In some embodiments, an AAV8 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the AAV8 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 1.
[0018] In some embodiments, an AAV.rh39 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments, the AAV.rh39 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 2.
[0019] In some embodiments, an AAV 1 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 11. In some embodiments, the AAV1 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 11.
[0020] In some embodiments, an AAV3 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 12. In some embodiments, the AAV3 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 12.
[0021] In some embodiments, an AAV3b IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 13. In some embodiments, the AAV3b IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 13.
[0022] In some embodiments, an AAV4 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 14. In some embodiments, the AAV4 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 14.
[0023] In some embodiments, an AAV5 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 15. In some embodiments, the AAV5 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 15.
[0024] In some embodiments, an AAV6 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 16. In some embodiments, the AAV6 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 16.
[0025] In some aspects, the disclosure provides a recombinant adeno-associated virus (rAAV) comprising a recombinant adeno-associated viral (rAAV) vector comprising a transgene flanked by non-AAV2 inverted terminal repeats (ITRs), wherein the non-AAV2 ITRs comprise a 5’-ITR and a 3’-ITR with respect to the transgene, and further comprising an AAV8 ITR proximal region (IPR) sequence or an AAV.rh39 IPR sequence; and at least one AAV capsid protein. In some embodiments, a capsid protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, and AAVrh.39 capsid proteins.
[0026] In some aspects, the disclosure provides a host cell comprising an rAAV vector or rAAV as described herein. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human cell.
[0027] In some aspects, the disclosure provides a method for delivering a transgene to a target tissue, the method comprising administering an rAAV vector or rAAV as described herein to a subject.
[0028] In some embodiments, administration comprises systemic administration or local administration. In some embodiments, systemic administration comprises intravenous injection. In some embodiments, local administration comprises intramuscular injection. In some embodiments, a subject is a mammal. In some embodiments, a subject is a human.
[0029] BRIEF DESCRIPTION OF DRAWINGS FIG. 1 shows a representative sequence alignment of the IPR8 (SEQ ID NO: 1) and IPR.rh39 (SEQ ID NO: 2) sequences to previously described AAV2 IPR (“IPR2”; SEQ ID NO: 3). A consensus sequence is shown as SEQ ID NO: 4 at the top of the alignment. FIGs. 2A-2C show representative data indicating the AAV8 and AAVrh.39 IPRs and ITRs exhibit enhancer / promoter-like activities. FIG. 2 A shows an illustration of ITR and / or IPRs cloned into a 5’ position within a promoter- less luciferase construct. Orientation of the elements are indicated by arrowheads. FIGs. 2B-2C show representative data for constructs that were transfected into HEK293 (FIG. 2B) or Huh7 cells (FIG. 2C). Luciferase activities were measured. Values represent means +SD and normalized to the promoter-less construct scaled to 1 (n=3). ns, not significant; **, p<0.01; ***, p<0.001; ****, p<0.0001.
[0030] FIGs. 3A-3C show representative data indicating IPRrh.39 exhibits robust promoter-like activity. FIG. 3 A shows an illustration of ITR and / or IPRs cloned into a 5’ position within a promoter-less luciferase construct. Constructs were also compared against the ubiquitously active human (h)PGK promoter. Orientation of the elements is indicated by arrowheads. FIGs.
[0031] 3B-3C show representative data for constructs that were transfected into HEK293 (FIG. 3B) or Huh7 cells (FIG. 3C). Luciferase activities were measured. Values represent means +SD and normalized to the hPGK promoter construct scaled to 1 (n=6).
[0032] FIG. 4 shows representative data for AAV2, AAV8, and AAVrh.39 IPRs exhibiting orientation- and position-dependent enhancer activities. Test constructs harboring IPR elements placed upstream of the hPGK promoter or downstream of the FLuc reporter cassette were transfected into HEK293 (left graph) or Huh7 cells (right graph) and luciferase activities were measured. Values represent means +SD and normalized to the hPGK promoter construct scaled to 1 (n=6). The top box represents IPRs placed at 5’ of hPGK-lucif erase in forward orientation, second from top box represents IPRs placed at 5’ of hPGK- luciferase in reverse orientation, third from top box represents IPRs placed at 3’ of hPGK-lucif erase in forward orientation, and bottom box represents IPRs placed at 3’ of hPGK- luciferase in reverse orientation.
[0033] FIGs. 5A-5C show representative data for comparisons of EGFP expression in mouse livers treated with vectors carrying different IPR and ITR elements. FIG. 5A shows select eGFP fluorescence images of liver sections from C57BL / 6 mice transduced with vectors harboring IPR and ITR elements from AAV2, AAV8, and AAVrh.39. FIGs. 5B-5C show representative data for ddPCR detection of eGFP message expression in the liver tissues per vector genome (FIG. 5B), and vector genomes per diploid cell (FIG. 5C).
[0034] FIGs. 6A-6B show representative data indicating IPRs confer tissue-dependent enhancement of transgene expression. FIG. 6A shows representative data for IVIS imaging of tibialis anterior (TA) muscles treated with vector constructs harboring ITRs from AAV2, AAV8, and AAVrh.39 and with or without their cognate IPR elements. Construct diagrams are shown on the to the left of the images. FIG. 6B shows representative fluorescence imaging data of muscle cryosections of TAs shown in FIG. 6A.
[0035] FIGs. 7A-7C show representative data indicating that IPR regions from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 regulate transgene expression in cells. FIG. 7A shows positioning of IPRs from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 immediately 3’ relative to the 5’ITR and 5’ relative to the promoter (e.g., hPGK) of an rAAV vector encoding firefly luciferase (Flue). FIG. 7B shows positioning of IPRs from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 after the Flue coding sequence polyA tail and 5’ relative to the 3’ITR of an rAAV vector. FIG. 7C shows positioning of IPRs from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 immediately 5’ relative to the 5’ITR of an rAAV vector encoding firefly luciferase (Flue) that does not comprise a promoter.
[0036] FIG. 8 shows representative data indicating that IPR regions from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 regulate transgene expression in cells when positioned alongside the 3TTR of an rAAV vector.
[0037] FIGs. 9A-9C show representative data indicating IPRs can upregulate transgene expression in mice. FIG. 9A is a schematic showing an experimental protocol. FIG. 9B shows representative microscopy data indicating IPR2-containing AAV8 vectors exhibit 2x higher GFP expression when compared to control AAV8-GFP mice that do not have the IPRs. FIG. 9C shows representative data for transcript expression analysis indicating that rAAV vectors containing IPR2 exhibit 2x higher GFP expression when compared to control AAV8-GFP mice that do not have the IPRs.
[0038] FIG. 10 is a schematic showing an experimental protocol for analysis of IPR activity in vivo.
[0039] FIG. 11 shows a representative sequence alignment of nucleotide sequences of IPR regions from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6.
[0040] FIGs. 12A-12B show representative data indicating IPRrh.39 exhibits robust promoterlike activity. FIGs. 12A-12B shows an illustration of ITR and / or IPRs cloned into a 5’ position within a promoter-less luciferase construct. Constructs were also compared against the ubiquitously active human (h)PGK promoter. Orientation of the elements is indicated by arrowheads. FIGs. 12A-12B show representative data for constructs that were transfected into HEK293 (FIG. 12A) or Huh7 cells (FIG. 12B). Fuciferase activities were measured. Values represent means +SD and normalized to the hPGK promoter construct scaled to 1 (n=3).
[0041] FIG. 13 shows representative data for AAV2, AAV8, and AAVrh.39 IPRs exhibiting orientation- and position-dependent enhancer activities. Test constructs harboring IPR elements placed upstream of the hPGK promoter or downstream of the FLuc reporter cassette were transfected into HEK293 (left graph) or Huh7 cells (right graph) and luciferase activities were measured. AAV2, AAV8, and AAVrh.39 IPRs are placed at 5’ of hPGK-luciferase in forward orientation, 5’ of hPGK- luciferase in reverse orientation, 3’ of hPGK- luciferase in forward orientation, and 3’ of hPGK- luciferase in reverse orientation. Values represent means +SD and normalized to the hPGK promoter construct scaled to 1 (n=9).
[0042] FIGs. 14A-14B show representative data indicating IPRs confer tissue-dependent enhancement of transgene expression. FIG. 14A shows representative fluorescence imaging data of muscle cryosections of tibialis anterior (TA) muscles treated with vector constructs harboring ITRs from AAV2, AAV8, and AAVrh.39 and with or without their cognate IPR elements. FIG.
[0043] 14B shows representative data for ddPCR detection of eGFP message expression in the liver tissues per vector genome.
[0044] DETAILED DESCRIPTION
[0045] Aspects of the disclosure relate to compositions and methods for improving rAAV transgene expression in a cell or subject. The disclosure is based, in part, on isolated nucleic acids (e.g., rAAV vectors) which include AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, and AAVrh.39 inverted terminal repeat (ITR) proximal region (IPR) sequences. In some embodiments, rAAV vectors which include such IPR sequences mediate more efficient gene transfer and / or transgene expression than rAAV vectors which do not include such IPR sequences. In some embodiments, IPR sequences function in addition to, or as a replacement to, certain regulatory sequences, such as promoter and enhancer sequences.
[0046] Accordingly, in some aspects, the disclosure provides a recombinant adeno-associated viral (rAAV) vector comprising a transgene flanked by non-AAV2 inverted terminal repeats (ITRs), wherein the non-AAV2 ITRs comprise a 5 ’-ITR and a 3 ’-ITR with respect to the transgene, and further comprising an AAV ITR proximal region (IPR) sequence selected from an AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, and AAVrh.39 IPR sequence. The disclosure also provides rAAV particles comprising such rAAV vectors, and methods of expressing a transgene in a cell or subject.
[0047] Isolated Nucleic Acids
[0048] In some aspects, the disclosure relates to isolated nucleic acids comprising one or more AAV IPR sequences. A "nucleic acid" sequence refers to a DNA or RNA sequence. In some embodiments, proteins and nucleic acids of the disclosure are isolated. As used herein, the term “isolated” means artificially produced. As used herein with respect to nucleic acids, the term “isolated” means: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated; however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art. As used herein with respect to proteins or peptides, the term “isolated” refers to a protein or peptide that has been isolated from its natural environment or artificially produced (e.g., by chemical synthesis, by recombinant DNA technology, etc.).
[0049] In some embodiments, the isolated nucleic acids typically comprise a first region that encodes one or more IPR sequences (e.g., IPR sequences from AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, or AAVrh.39). The isolated nucleic acids also typically include a second region encoding a transgene, which may comprise a protein coding nucleotide sequence, and in some embodiments, a promoter. For example, the first region may be positioned at any suitable location. The first region may be positioned within an untranslated portion of the second region. The first region may be positioned in any untranslated portion of the nucleic acid, including, for example, an intron, a 5’ or 3’ untranslated region, etc. In some cases, it may be desirable to position an IPR region (e.g., the first region) upstream of the first codon of a nucleic acid sequence encoding a protein. For example, the IPR region may be positioned between the first codon of a protein coding sequence and 2000 nucleotides upstream of the first codon. The region may be positioned between the first codon of a protein coding sequence and 1000 nucleotides upstream of the first codon. The region may be positioned between the first codon of a protein coding sequence and 500 nucleotides upstream of the first codon. The region may be positioned between the first codon of a protein coding sequence and 250 nucleotides upstream of the first codon. The region may be positioned between the first codon of a protein coding sequence and 150 nucleotides upstream of the first codon.
[0050] In some embodiments, the first region (e.g., IPR sequence) is positioned between the first codon of a protein coding sequence and a 5’-ITR of an rAAV vector. The IPR region may be positioned between the first codon of a protein coding sequence and 2000 nucleotides downstream of the 5’-ITR. The IPR region may be positioned between the first codon of a protein coding sequence and 1000 nucleotides downstream of the 5’-ITR. The IPR region may be positioned between the first codon of a protein coding sequence and 500 nucleotides downstream of the 5’-ITR. The IPR region may be positioned between the first codon of a protein coding sequence and 250 nucleotides downstream of the 5’-ITR. The IPR region may be positioned between the first codon of a protein coding sequence and 150 nucleotides downstream of the 5’-ITR. The IPR region may be positioned between the first codon of a protein coding sequence and 50 nucleotides downstream of the 5’-ITR. The IPR region may be positioned between the first codon of a protein coding sequence and 25 nucleotides downstream of the 5’-ITR. The IPR region may be positioned between the first codon of a protein coding sequence and directly downstream of (e.g., adjacent to) the 5’-ITR.
[0051] In some cases, an IPR region may be positioned downstream of the last base of the poly-A tail of a region encoding a transgene. The IPR region may be between the last base of the poly-A tail and a position 2000 nucleotides downstream of the last base. The IPR region may be between the last base of the poly-A tail and a position 1000 nucleotides downstream of the last base. The IPR region may be between the last base of the poly-A tail and a position 500 nucleotides downstream of the last base. The IPR region may be between the last base of the poly-A tail and a position 250 nucleotides downstream of the last base. The IPR region may be between the last base of the poly-A tail and a position 150 nucleotides downstream of the last base.
[0052] In some embodiments, an isolated nucleic acid further comprises a nucleic acid sequence encoding one or more expression control sequences (e.g., a promoter, etc.). Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters which are native, constitutive, inducible and / or tissuespecific, are known in the art and may be utilized.
[0053] A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrases "operatively positioned," "under control" or "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.
[0054] For nucleic acids encoding proteins, a poly adenylation sequence generally is inserted following the transgene sequences and before the 3' AAV ITR sequence. A rAAV construct useful in the present disclosure may also contain an intron, desirably located between the promoter / enhancer sequence and the transgene. One possible intron sequence is derived from SV-40 and is referred to as the SV-40 T intron sequence. Another vector element that may be used is an internal ribosome entry site (IRES). An IRES sequence is used to produce more than one polypeptide from a single gene transcript. An IRES sequence would be used to produce a protein that contains more than one polypeptide chain. Selection of these and other common vector elements are conventional, and many such sequences are available [see, e.g., Sambrook et al., and references cited therein at, for example, pages 3.183.26 and 16.17 16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989]. In some embodiments, a Foot and Mouth Disease Virus 2A sequence is included in polyprotein; this is a small peptide (approximately 18 amino acids in length) that has been shown to mediate the cleavage of polyproteins (Ryan, M D et al., EMBO, 1994; 4: 928-933; Mattion, N M et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4: 453-459). The cleavage activity of the 2A sequence has previously been demonstrated in artificial systems including plasmids and gene therapy vectors (AAV and retroviruses) (Ryan, M D et al., EMBO, 1994; 4: 928-933; Mattion, N M et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4: 453-459; de Felipe, P et al., Gene Therapy, 1999; 6: 198-208; de Felipe, P et al., Human Gene Therapy, 2000; 11: 1921-1931.; and Klump, H et al., Gene Therapy, 2001; 8: 811-817).
[0055] Examples of constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) ETR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the P-actin promoter (e.g., CBA promoter), the phosphoglycerol kinase (PGK) promoter, and the EFla promoter [Invitrogen], In some embodiments, a promoter is an enhanced chicken P-actin promoter (CAG promoter). In some embodiments, a promoter is a Hl promoter or a U6 promoter.
[0056] Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex) -inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline -repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only. In some embodiments, the regulatory sequences impart tissue- specific gene expression capabilities. In some cases, the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc..) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to the following tissue specific promoters: a liver-specific thyroxin binding globulin (TBG) promoter, an insulin promoter, a glucagon promoter, a somatostatin promoter, a pancreatic polypeptide (PPY) promoter, a synapsin-1 (Syn) promoter, a creatine kinase (MCK) promoter, a mammalian desmin (DES) promoter, a a-myosin heavy chain (a-MHC) promoter, or a cardiac Troponin T (cTnT) promoter. Other exemplary promoters include Beta-actin promoter, hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP) promoter, (Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998)); immunoglobulin heavy chain promoter; T cell receptor a-chain promoter, neuronal such as neuron- specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light-chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron- specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)), among others which will be apparent to the skilled artisan.
[0057] As described further below, the isolated nucleic acids may comprise inverted terminal repeats (ITR) of an AAV serotypes selected from the group consisting of: AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrh.39, and variants thereof.
[0058] The term “orientation” as used herein in connection with expression cassettes, refers to the directional characteristic of a given cassette or structure. In some embodiments, an expression cassette harbors a promoter 5’ of the encoding nucleic acid sequence, and transcription of the encoding nucleic acid sequence runs from the 5’ terminus to the 3’ terminus of the sense strand, making it a directional cassette (e.g., 5’-promoter / (intron) / encoding sequence-3’). Since virtually all expression cassettes are directional in this sense, those of skill in the art can easily determine the orientation of a given expression cassette in relation to a second nucleic acid structure, for example, a second expression cassette, a viral genome, or, if the cassette is comprised in an AAV construct, in relation to an AAV ITR. For example, if a given nucleic acid construct comprises two expression cassettes in the configuration 5’-promoter 1 / encoding sequence 1— promoter2 / encoding sequence 2-3’,
[0059] »»»»»»»»»»»> »»»»»»»»»»»> the expression cassettes are in the same orientation; the arrows indicate the direction of transcription of each of the cassettes. For another example, if a given nucleic acid construct comprises a sense strand comprising two expression cassettes in the configuration
[0060] 5’-promoter 1 / encoding sequence 1— encoding sequence 2 / promoter 2-3’,
[0061] »»»»»»»»»»»> <<<<<<<<<<<<<<<<<<<<< the expression cassettes are in opposite orientation to each other and, as indicated by the arrows, the direction of transcription of the expression cassettes, are opposed. In this example, the strand shown comprises the antisense strand of promoter 2 and encoding sequence 2.
[0062] For another example, if an expression cassette is comprised in an AAV construct, the cassette can either be in the same orientation as an AAV ITR, or in opposite orientation. AAV ITRs are directional.
[0063] rAAV Vectors
[0064] The isolated nucleic acids of the invention may be recombinant adeno-associated virus (AAV) vectors (rAAV vectors). In some embodiments, an isolated nucleic acid as described by the disclosure comprises a region (e.g., a first region) comprising a first adeno-associated virus (AAV) IPR sequence, or a variant thereof, and AAV inverted terminal repeats (ITRs). The isolated nucleic acid (e.g., the recombinant AAV vector) may be packaged into a capsid protein and administered to a subject and / or delivered to a selected target cell. “Recombinant AAV (rAAV) vectors” are typically composed of, at a minimum, a transgene and its regulatory sequences, and 5' and 3' AAV inverted terminal repeats (ITRs). The transgene may comprise, as disclosed elsewhere herein, one or more regions that encode one or more inhibitory RNAs (e.g., miRNAs) and / or protein(s). The transgene may also comprise a region encoding, for example, an expression control sequence (e.g., a poly-A tail), as described elsewhere in the disclosure.
[0065] Generally, ITR sequences are about 145 base pairs (bp) in length. Preferably, substantially the entire sequences encoding the ITRs are used in the molecule, although some degree of minor modification of these sequences is permissible. The ability to modify these ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al., "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520532 (1996)). An example of such a molecule employed in the present invention is a "cis-acting" plasmid containing the transgene, in which the selected transgene sequence and associated regulatory elements are flanked by the 5' and 3' AAV ITR sequences. The AAV ITR sequences may be obtained from any known AAV, including presently identified mammalian AAV types. In some embodiments, the isolated nucleic acid (e.g., the rAAV vector) comprises at least one ITR having a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the isolated nucleic acid comprises a region (e.g., a first region) encoding an AAV2 ITR.
[0066] In some embodiments, the isolated nucleic acid further comprises a region (e.g., a second region, a third region, a fourth region, etc.) comprising a second AAV ITR. In some embodiments, the second AAV ITR has a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the second ITR is a mutant ITR that lacks a functional terminal resolution site (TRS). The term “lacking a terminal resolution site” can refer to an AAV ITR that comprises a mutation (e.g., a sense mutation such as a non- synonymous mutation, or missense mutation) that abrogates the function of the terminal resolution site (TRS) of the ITR, or to a truncated AAV ITR that lacks a nucleic acid sequence encoding a functional TRS (e.g., a ATRS ITR). Without wishing to be bound by any particular theory, an rAAV vector comprising an ITR lacking a functional TRS produces a self-complementary rAAV vector, for example as described by McCarthy (2008) Molecular Therapy 16(10): 1648-1656.
[0067] Aspects of the disclosure relate to rAAV vectors comprising AAV IPR sequences. In some embodiments, the IPR sequences function as enhancer or promoters in the rAAV vector and assist with improving expression of a transgene. In some embodiments, an rAAV vector comprises an AAV8 IPR. In some embodiments, an AAV8 IPR sequence comprises a nucleotide sequence at least 70%, 80%, 90%, 95%, 99% or more identical to the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the AAV8 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 1.
[0068] In some embodiments, an rAAV vector comprises an AAVrh.39 IPR. In some embodiments, an AAV.rh39 IPR sequence comprises a nucleotide sequence at least 70%, 80%, 90%, 95%, 99% or more identical to the nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments, the AAV.rh39 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 2.
[0069] In some embodiments, an rAAV vector comprises an AAV1 IPR. In some embodiments, an AAV1 IPR sequence comprises a nucleotide sequence at least 70%, 80%, 90%, 95%, 99% or more identical to the nucleotide sequence set forth in SEQ ID NO: 11. In some embodiments, the AAV 1 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 11.
[0070] In some embodiments, an rAAV vector comprises an AAV3 IPR. In some embodiments, an AAV3 IPR sequence comprises a nucleotide sequence at least 70%, 80%, 90%, 95%, 99% or more identical to the nucleotide sequence set forth in SEQ ID NO: 12. In some embodiments, the AAV3 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 12.
[0071] In some embodiments, an rAAV vector comprises an AAV3b IPR. In some embodiments, an AAV3b IPR sequence comprises a nucleotide sequence at least 70%, 80%, 90%, 95%, 99% or more identical to the nucleotide sequence set forth in SEQ ID NO: 13. In some embodiments, the AAV3b IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 13.
[0072] In some embodiments, an rAAV vector comprises an AAV4 IPR. In some embodiments, an AAV4 IPR sequence comprises a nucleotide sequence at least 70%, 80%, 90%, 95%, 99% or more identical to the nucleotide sequence set forth in SEQ ID NO: 14. In some embodiments, the AAV4 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 14.
[0073] In some embodiments, an rAAV vector comprises an AAV5 IPR. In some embodiments, an AAV5 IPR sequence comprises a nucleotide sequence at least 70%, 80%, 90%, 95%, 99% or more identical to the nucleotide sequence set forth in SEQ ID NO: 15. In some embodiments, the AAV5 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 15.
[0074] In some embodiments, an rAAV vector comprises an AAV6 IPR. In some embodiments, an AAV6 IPR sequence comprises a nucleotide sequence at least 70%, 80%, 90%, 95%, 99% or more identical to the nucleotide sequence set forth in SEQ ID NO: 16. In some embodiments, the AAV6 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID In addition to the major elements identified above for the recombinant AAV vector, the vector also includes conventional control elements which are operably linked with elements of the transgene in a manner that permits its transcription, translation and / or expression in a cell transfected with the vector or infected with the virus produced by the invention. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (z.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A number of expression control sequences, including promoters which are native, constitutive, inducible and / or tissue-specific, are known in the art and may be utilized.
[0075] As used herein, a nucleic acid sequence (e.g., coding sequence) and regulatory sequences are said to be operably linked when they are covalently linked in such a way as to place the expression or transcription of the nucleic acid sequence under the influence or control of the regulatory sequences. If it is desired that the nucleic acid sequences be translated into a functional protein, two DNA sequences are said to be operably linked if induction of a promoter in the 5’ regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region would be operably linked to a nucleic acid sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide. Similarly, two or more coding regions are operably linked when they are linked in such a way that their transcription, from a common promoter, results in the expression of two or more proteins having been translated in frame. In some embodiments, operably linked coding sequences yield a fusion protein. Recombinant adeno-associated viruses (rAAVs)
[0076] In some aspects, the disclosure provides isolated AAVs. As used herein with respect to AAVs, the term “isolated” refers to an AAV that has been artificially produced or obtained. Isolated AAVs may be produced using recombinant methods. Such AAVs are referred to herein as “recombinant AAVs”. Recombinant AAVs (rAAVs) preferably have tissue- specific targeting capabilities, such that a nuclease and / or transgene of the rAAV will be delivered specifically to one or more predetermined tissue(s). The AAV capsid is an important element in determining these tissue- specific targeting capabilities. Thus, an rAAV having a capsid appropriate for the tissue being targeted can be selected.
[0077] Methods for obtaining recombinant AAVs having a desired capsid protein are well known in the art. (See, for example, US 2003 / 0138772), the contents of which are incorporated herein by reference in their entirety). Typically, the methods involve culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; a recombinant AAV vector composed of, AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to permit packaging of the recombinant AAV vector into the AAV capsid proteins. In some embodiments, capsid proteins are structural proteins encoded by the cap gene of an AAV. AAVs comprise three capsid proteins, virion proteins 1 to 3 (named VP1, VP2 and VP3), all of which are transcribed from a single cap gene via alternative splicing. In some embodiments, the molecular weights of VP1, VP2 and VP3 are respectively about 87 kDa, about 72 kDa, and about 62 kDa. In some embodiments, upon translation, capsid proteins form a spherical 60-mer protein shell around the viral genome. In some embodiments, the functions of the capsid proteins are to protect the viral genome, deliver the genome and interact with the host. In some aspects, capsid proteins deliver the viral genome to a host in a tissue specific manner.
[0078] In some embodiments, an AAV capsid protein is of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, AAVrh8, AAV9, AAV10, AAVrh.10, AAVrh.39, AAV AAV.PHB, and variants of any of the foregoing. In some embodiments, an AAV capsid protein is of a serotype derived from a non-human primate, for example AAVrhlO serotype. In some embodiments, an AAV capsid protein is of an AAV9 serotype.
[0079] The components to be cultured in the host cell to package an rAAV vector in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., recombinant AAV vector, rep sequences, cap sequences, and / or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art. Most suitably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion of regulatory elements suitable for use with the transgene. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contain the rep and / or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.
[0080] The recombinant AAV vector, rep sequences, cap sequences, and helper functions required for producing the rAAV of the disclosure may be delivered to the packaging host cell using any appropriate genetic element (vector). The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present disclosure. See, e.g., K. Fisher et al., J. Virol., 70:520-532 (1993) and U.S. Pat. No. 5,478,745.
[0081] In some embodiments, recombinant AAVs may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650). Typically, the recombinant AAVs are produced by transfecting a host cell with an recombinant AAV vector (comprising a transgene) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector. An AAV helper function vector encodes the "AAV helper function" sequences (z.e., rep and cap), which function in trans for productive AAV replication and encapsidation. Preferably, the AAV helper function vector supports efficient AAV vector production without generating any detectable wild- type AAV virions (z.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use with the present disclosure include pHLP19, described in U.S. Pat. No. 6,001,650 and pRep6cap6 vector, described in U.S. Pat. No.
[0082] 6,156,303, the entirety of both incorporated by reference herein. The accessory function vector encodes nucleotide sequences for non- AAV derived viral and / or cellular functions upon which AAV is dependent for replication (z.e., "accessory functions"). The accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus.
[0083] In some aspects, the disclosure provides transfected host cells. The term "transfection" is used to refer to the uptake of foreign DNA by a cell, and a cell has been "transfected" when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more exogenous nucleic acids, such as a nucleotide integration vector and other nucleic acid molecules, into suitable host cells.
[0084] A “host cell” refers to any cell that harbors, or is capable of harboring, a substance of interest. Often a host cell is a mammalian cell. A host cell may be used as a recipient of an AAV helper construct, an AAV minigene plasmid, an accessory function vector, or other transfer DNA associated with the production of recombinant AAVs. The term includes the progeny of the original cell which has been transfected. Thus, a “host cell” as used herein may refer to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.
[0085] As used herein, the term "cell line" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.
[0086] As used herein, the terms “recombinant cell” refers to a cell into which an exogenous DNA segment, such as DNA segment that leads to the transcription of a biologically-active polypeptide or production of a biologically active nucleic acid such as an RNA, has been introduced.
[0087] As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. In some embodiments, useful vectors are contemplated to be those vectors in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrases "operatively positioned," "under control" or "under transcriptional control" mean that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. The term "expression vector or construct" means any type of genetic construct containing a nucleic acid in which part or all of the nucleic acid encoding sequence is capable of being transcribed. In some embodiments, expression includes transcription of the nucleic acid, for example, to generate a biologically-active polypeptide product or functional RNA (e.g., guide RNA) from a transcribed gene.
[0088] The foregoing methods for packaging recombinant vectors in desired AAV capsids to produce the rAAVs of the disclosure are not meant to be limiting and other suitable methods will be apparent to the skilled artisan.
[0089] Modes of Administration
[0090] Isolated nucleic acids and rAAVs of the disclosure may be delivered to a cell or subject in compositions according to any appropriate methods known in the art. For example, an rAAV, preferably suspended in a physiologically compatible carrier (z.e., in a composition), may be administered to a subject, i.e. host animal, such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or a non-human primate (e.g., Macaque). In some embodiments a host animal does not include a human. Delivery of the rAAVs to a mammalian subject may be by, for example, intramuscular injection or by administration into the bloodstream of the mammalian subject. Administration into the bloodstream may be by injection into a vein, an artery, or any other vascular conduit. In some embodiments, the rAAVs are administered into the bloodstream by way of isolated limb perfusion, a technique well known in the surgical arts, the method essentially enabling the artisan to isolate a limb from the systemic circulation prior to administration of the rAAV virions. A variant of the isolated limb perfusion technique, described in U.S. Pat. No. 6,177,403, can also be employed by the skilled artisan to administer the virions into the vasculature of an isolated limb to potentially enhance transduction into muscle cells or tissue. Moreover, in certain instances, it may be desirable to deliver the virions to the CNS of a subject. The term “CNS” refers to all cells and tissue of the brain and spinal cord of a vertebrate. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage and the like. Recombinant AAVs may be delivered directly to the CNS or brain by injection into, e.g., the ventricular region, as well as to the striatum (e.g., the caudate nucleus or putamen of the striatum), spinal cord and neuromuscular junction, or cerebellar lobule, with a needle, catheter or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000). In some embodiments, rAAV as described in the disclosure, are administered by intravenous injection. In some embodiments, the rAAV are administered by intracerebral injection. In some embodiments, the rAAV are administered by intrathecal injection. In some embodiments, the rAAV are administered by intrastriatal injection. In some embodiments, the rAAV are delivered by intracranial injection. In some embodiments, the rAAV are delivered by cistema magna injection. In some embodiments, the rAAV are delivered by cerebral lateral ventricle injection.
[0091] The compositions of the disclosure may comprise an rAAV alone, or in combination with one or more other viruses (e.g., a second rAAV encoding having one or more different transgenes). In some embodiments, a composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs each having one or more different transgenes.
[0092] Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the rAAV is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present disclosure.
[0093] Optionally, the compositions of the disclosure may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.
[0094] The rAAVs are administered in sufficient amounts to transfect the cells of a desired tissue and to provide sufficient levels of gene transfer and expression without undue adverse effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the selected organ (e.g., intraportal delivery to the liver), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parental routes of administration. Routes of administration may be combined, if desired.
[0095] The dose of rAAV virions required to achieve a particular "therapeutic effect," e.g., the units of dose in genome copies / per kilogram of body weight (GC / kg), will vary based on several factors including, but not limited to: the route of rAAV virion administration, the level of gene or RNA expression required to achieve a therapeutic effect, the specific disease or disorder being treated, and the stability of the gene or RNA product. One of skill in the art can readily determine a rAAV virion dose range to treat a patient having a particular disease or disorder based on the aforementioned factors, as well as other factors that are well known in the art.
[0096] An effective amount of an rAAV is an amount sufficient to infect an animal and target a desired tissue. In some embodiments, an effective amount of an rAAV is an amount sufficient to produce a stable somatic transgenic animal model. The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. For example, an effective amount of the rAAV is generally in the range of from about 1 ml to about 100 ml of solution containing from about 109to 1016genome copies. In some cases, a dosage between about 1011to 1013rAAV genome copies is appropriate. In certain embodiments, 1012or 1013rAAV genome copies is effective to target CNS tissue. In some cases, stable transgenic animals are produced by multiple doses of an rAAV. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar day (e.g., a 24-hour period). In some embodiments, a dose of rAAV is administered to a subject no more than once per 2, 3, 4, 5, 6, or 7 calendar days. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar week (e.g., 7 calendar days). In some embodiments, a dose of rAAV is administered to a subject no more than biweekly (e.g., once in a two-calendar week period). In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar month (e.g., once in 30 calendar days). In some embodiments, a dose of rAAV is administered to a subject no more than once per six calendar months. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar year (e.g., 365 days or 366 days in a leap year).
[0097] In some embodiments, rAAV compositions are formulated to reduce aggregation of AAV particles in the composition, particularly where high rAAV concentrations are present (e.g., ~1013GC / ml or more). Methods for reducing aggregation of rAAVs are well known in the art and include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference.)
[0098] Formulation of pharmaceutically-acceptable excipients and carrier solutions is well-known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens.
[0099] Typically, these formulations may contain at least about 0.1% of the active compound or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of active compound in each therapeutically-useful composition may be prepared in such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
[0100] In certain circumstances it will be desirable to deliver the rAAV-based therapeutic constructs in suitably formulated pharmaceutical compositions disclosed herein either subcutaneously, intraopancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, the administration modalities as described in U.S. Pat. Nos. 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety) may be used to deliver rAAVs. In some embodiments, a preferred mode of administration is by portal vein injection.
[0101] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0102] For administration of an injectable aqueous solution, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, a sterile aqueous medium that can be employed will be known to those of skill in the art. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.
[0103] Sterile injectable solutions are prepared by incorporating the active rAAV in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0104] The rAAV compositions disclosed herein may also be formulated in a neutral or salt form. Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the protein) which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.
[0105] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase "pharmaceutically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.
[0106] Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, the rAAV vector delivered transgenes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like. Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids or the rAAV constructs disclosed herein. The formation and use of liposomes is generally known to those of skill in the art. Recently, liposomes were developed with improved serum stability and circulation half-times (U.S. Pat. No. 5,741,516). Further, various methods of liposome and liposome like preparations as potential drug carriers have been described (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).
[0107] Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of the DNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials examining the effectiveness of liposome-mediated drug delivery have been completed.
[0108] Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs). MLVs generally have diameters that range from 25 nm to 4 pm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 A, containing an aqueous solution in the core.
[0109] Alternatively, nanocapsule formulations of the rAAV may be used. Nanocapsules can generally entrap substances in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 pm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.
[0110] In addition to the methods of delivery described above, the following techniques are also contemplated as alternative methods of delivering the rAAV compositions to a host.
[0111] Sonophoresis (z.e., ultrasound) has been used and described in U.S. Pat. No. 5,656,016 as a device for enhancing the rate and efficacy of drug permeation into and through the circulatory system. Other drug delivery alternatives contemplated are intraosseous injection (U.S. Pat. No.
[0112] 5,779,708), microchip devices (U.S. Pat. No. 5,797,898), ophthalmic formulations (Bourlais et al., 1998), transdermal matrices (U.S. Pat. Nos. 5,770,219 and 5,783,208) and feedback-controlled delivery (U.S. Pat. No. 5,697,899). Kits and Related Compositions
[0113] The recombinant nucleic acids, compositions, rAAV vectors, rAAVs, etc. described herein may, in some embodiments, be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. A kit may include one or more containers housing the components of the invention and instructions for use.
[0114] Specifically, such kits may include one or more agents described herein, along with instructions describing the intended application and the proper use of these agents. In certain embodiments agents in a kit may be in a pharmaceutical formulation and dosage suitable for a particular application and for a method of administration of the agents. Kits for research purposes may contain the components in appropriate concentrations or quantities for running various experiments.
[0115] The kit may be designed to facilitate use of the methods described herein by researchers and can take many forms. Each of the compositions of the kit, where applicable, may be provided in liquid form (e.g., in solution), or in solid form, (e.g., a dry powder). In certain cases, some of the compositions may be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit. As used herein, “instructions” can define a component of instruction and / or promotion and typically involve written instructions on or associated with packaging of the invention. Instructions also can include any oral or electronic instructions provided in any manner such that a user will clearly recognize that the instructions are to be associated with the kit, for example, audiovisual (e.g., videotape, DVD, etc.), Internet, and / or web-based communications, etc. The written instructions may be in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions can also reflect approval by the agency of manufacture, use or sale for animal administration.
[0116] The kit may contain any one or more of the components described herein in one or more containers. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and / or isolating and mixing a sample and applying to a subject. The kit may include a container housing agents described herein. The agents may be in the form of a liquid, gel or solid (powder). The agents may be prepared sterilely, packaged in syringe and shipped refrigerated. Alternatively, it may be housed in a vial or other container for storage. A second container may have other agents prepared sterilely. Alternatively, the kit may include the active agents premixed and shipped in a syringe, vial, tube, or other container. The kit may have one or more or all of the components required to administer the agents to a subject, such as a syringe, topical application devices, or IV needle tubing and bag.
[0117] Exemplary embodiments of the invention will be described in more detail by the following examples. These embodiments are exemplary of the invention, which one skilled in the art will recognize is not limited to the exemplary embodiments.
[0118] EXAMPLES
[0119] Example 1
[0120] This example describes identification of -120 nucleotide sequences present at the 3’ ends of the AAV8 and AAV.rh39 genomes called ITR-proximal regions (IPRs) that show tissuedependent, enhancer-like activities. The full IPR8 and IPR.rh39 sequences boost transduction in skeletal muscle following intramuscular injections, but do not significantly alter transduction in liver after intravenous delivery. Data indicates that the increase in transduction conferred by full-length ITR8 and ITR.rh39, when compared to ITR2 (e.g., AAV2 ITR), are only in part due to enhanced transcription.
[0121] Example 2
[0122] This example describes nucleotide sequences adjacent to the 3’ inverted terminal repeat (ITR) of wild-type AAVs, which are referred to herein as ITR-proximal regions (IPR). Data indicates that IPRs identified in AAV8 and AAV.rh39 serotype viruses harbor enhancer / promoter activities.
[0123] The full-length wild- type pro viral genomes for AAV8 and AAVrh.39 from macaque liver tissues were isolated. The isolates encompassed the rep and cap ORFs, the IPR sequences, and the ITRs (referred to herein as ITR8 and ITRrh.39; SEQ ID NOs: 5-8). The entire AAV8 and AAV.rh39 genome sequences are shown in SEQ ID NOs: 9-10. Sequence alignment of the IPR8 (SEQ ID NO: 1) and IPR.rh39 (SEQ ID NO: 2) sequences to previously described AAV2 IPR (“IPR2”; SEQ ID NO: 3) was performed. Data is shown in FIG. 1. A consensus sequence is shown as SEQ ID NO: 4.
[0124] FIGs. 2A-2C show representative data indicating the AAV8 and AAVrh.39 IPRs and ITRs exhibit enhancer / promoter- like activities. FIG. 2 A shows an illustration of ITR and / or IPRs cloned into a 5’ position within a promoter- less luciferase construct. Orientation of the elements are indicated by arrowheads. FIGs. 2B-2C show representative data for constructs that were transfected into HEK293 (FIG. 2B) or Huh7 cells (FIG. 2C). Luciferase activities were measured. Values represent means +SD and normalized to the promoter-less construct scaled to 1 (n=3). ns, not significant; **, p<0.01; ***, p<0.001; ****, p<0.0001.
[0125] FIGs. 3A-3C show representative data indicating IPRrh.39 exhibits robust promoter-like activity. FIG. 3 A shows an illustration of ITR and / or IPRs cloned into a 5’ position within a promoter-less luciferase construct. Constructs were also compared against the ubiquitously active human (h)PGK promoter. Orientation of the elements are indicated by arrowheads. FIGs.
[0126] 3B-3C show representative data for constructs that were transfected into HEK293 (FIG. 3B) or Huh7 cells (FIG. 3C). Luciferase activities were measured. Values represent means +SD and normalized to the hPGK promoter construct scaled to 1 (n=6).
[0127] FIG. 4 shows representative data for AAV2, AAV8, and AAVrh.39 IPRs exhibiting orientation- and position-dependent enhancer activities. Test constructs harboring IPR elements placed upstream of the hPGK promoter or downstream of the FLuc reporter cassette were transfected into HEK293 (left graph) or Huh7 cells (right graph) and luciferase activities were measured. Values represent means +SD and normalized to the hPGK promoter construct scaled to 1 (n=6). The top box represents IPRs placed at 5’ of hPGK-lucif erase in forward orientation, second from top box represents IPRs placed at 5’ of hPGK- luciferase in reverse orientation, third from top box represents IPRs placed at 3’ of hPGK-lucif erase in forward orientation, and bottom box represents IPRs placed at 3’ of hPGK- luciferase in reverse orientation.
[0128] FIGs. 5A-5C show representative data for comparisons of eGFP expression in mouse livers treated with vectors carrying different IPR and ITR elements. FIG. 5A shows select eGFP fluorescence images of liver sections from C57BL / 6 mice transduced with vectors harboring IPR and ITR elements from AAV2, AAV8, and AAVrh.39. FIGs. 5B-5C show representative data for ddPCR detection of eGFP message expression in the liver tissues per vector genome (FIG. 5B), and vector genomes per diploid cell (FIG. 5C).
[0129] FIGs. 6A-6B show representative data indicating IPRs confer tissue-dependent enhancement of transgene expression. FIG. 6A shows representative data for IVIS imaging of tibialis anterior (TA) muscles treated with vector constructs harboring ITRs from AAV2, AAV8, and AAVrh.39 and with or without their cognate IPR elements. Construct diagrams are shown on the to the left of the images. FIG. 6B shows representative fluorescence imaging data of muscle cryosections of TAs shown in FIG. 6A. FIGs. 12A-12B show representative data indicating IPRrh.39 exhibits robust promoterlike activity. FIGs. 12A-12B shows an illustration of ITR and / or IPRs cloned into a 5’ position within a promoter-less luciferase construct. Constructs were also compared against the ubiquitously active human (h)PGK promoter. Orientation of the elements are indicated by arrowheads. FIGs. 12A-12B show representative data for constructs that were transfected into HEK293 (FIG. 12A) or Huh7 cells (FIG. 12B). Luciferase activities were measured. Values represent means +SD and normalized to the hPGK promoter construct scaled to 1 (n=3).
[0130] FIG. 13 shows representative data for AAV2, AAV8, and AAVrh.39 IPRs exhibiting orientation- and position-dependent enhancer activities. Test constructs harboring IPR elements placed upstream of the hPGK promoter or downstream of the FLuc reporter cassette were transfected into HEK293 (left graph) or Huh7 cells (right graph) and luciferase activities were measured. AAV2, AAV8, and AAVrh.39 IPRs are placed at 5’ of hPGK-luciferase in forward orientation, 5’ of hPGK- luciferase in reverse orientation, 3’ of hPGK- luciferase in forward orientation, and 3’ of hPGK- luciferase in reverse orientation. Values represent means +SD and normalized to the hPGK promoter construct scaled to 1 (n=9).
[0131] FIGs. 14A-14B show representative data indicating IPRs confer tissue-dependent enhancement of transgene expression. FIG. 14A shows representative fluorescence imaging data of muscle cryosections of tibialis anterior (TA) muscles treated with vector constructs harboring ITRs from AAV2, AAV8, and AAVrh.39 and with or without their cognate IPR elements. FIG.
[0132] 14B shows representative data for ddPCR detection of eGFP message expression in the liver tissues per vector genome.
[0133] In summary, the data indicate that (i) novel AAV8 and AAV.rh39 IPR sequences have shown robust promoter activity as well as enhancer activity in vitro when used alone or in conjunction with its native ITRs; inclusion of the novel AAV8 and AAV.rh39 IPR sequences in conjunction with their cognate ITRs in AAV vectors have shown robust enhancer activity in liver and in muscle tissues; and, novel AAV8 and AAV.rh39 IPR sequences packaged with their native ITRs as a vector have shown tissue specific activities in muscle tissues.
[0134] Example 3
[0135] This example describes identification and cloning of IPR sequences (IPR1, IPR2, IPR3, IPR3b, IPR4, IPR5, and IPR6) into three distinct configurations: (1) at the 5’ end upstream of the human phosphoglycerate kinase (hPGK) promoter, (2) at the 3’ end downstream of the polyA signal in hPGK-driven luciferase expression cassettes, and (3) at the 5’ end in promoterless luciferase expression cassette. This design allowed for systemic evaluation of the enhancer and promoter activities of these IPRs in regulating transgene expression.
[0136] Representative data are shown in FIGs. 7A-7C. FIGs. 7A-7C show representative data indicating that IPR regions from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 regulate transgene expression in cells. FIG. 7A shows positioning of IPRs from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 immediately 3’ relative to the 5TTR and 5’ relative to the promoter (e.g., hPGK) of an rAAV vector encoding firefly luciferase (Flue). FIG. 7B shows positioning of IPRs from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 after the Flue coding sequence polyA tail and 5’ relative to the 3TTR of an rAAV vector. FIG. 7C shows positioning of IPRs from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 immediately 5’ relative to the 5TTR of an rAAV vector encoding firefly luciferase (Flue) that does not comprise a promoter.
[0137] FIG. 8 shows representative data indicating that IPR regions from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6 regulate transgene expression in cells when positioned alongside the 3TTR of an rAAV vector.
[0138] FIGs. 9A-9C show representative data indicating IPRs can upregulate transgene expression in mice. FIG. 9A is a schematic showing an experimental protocol. FIG. 9B shows representative microscopy data indicating IPR2-containing AAV8 vectors exhibit 2x higher GFP expression when compared to control AAV8-GFP mice that do not have the IPRs. FIG. 9C shows representative data for transcript expression analysis indicating that rAAV vectors containing IPR2 exhibit 2x higher GFP expression when compared to control AAV8-GFP mice that do not have the IPRs.
[0139] FIG. 10 is a schematic showing an experimental protocol for analysis of IPR activity in vivo.
[0140] FIG. 11 shows a representative sequence alignment of nucleotide sequences of IPR regions from AAV2, AAV8, AAVrh.39, AAV1, AAV3, AAV3b, AAV4, AAV5, and AAV6.
[0141] REPRESENTATIVE SEQUENCES
[0142] >AAV8 inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 1) CCGGTTGATTCGTTTCAGTTGAACTTTGGCCTACTGTCCTTCTTATCTTATCTCGTCT CCATGGCAACTGGTTAAACATTAACTGCTTGGGTGCGCTTCGCGATAAGGGACTGA CGTCATCG
[0143] >AAV.rh39 inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 2) CCGTTTGATTCGTTTCAGTTGAACTTTGGTCTCCGTGTGCTTCTTATCTTATCTCGTCT CCATGGCAACTGGTTACACATTAACTGCTTGGTGCGCTTCGCGATCATAAATGACTT ACGTCATCG
[0144] >AAV2 inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 3) CCGTTTAATTCGTTTCAGTTGAACTTTGGTCTCTGCGTATTTCTTTCTTATCTAGTTTC CATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACA
[0145] > IPR consensus nucleotide sequence 1 (SEQ ID NO: 4)
[0146] See FIG. 1
[0147] >AAV83’ ITR (SEQ ID NO: 5) ggttacccctagtgatggagttggccactccctctatgcgcgctcgctcgctcggtggggccggcagagcagagctctgccgtctgcgga cctttggtccgcaggccccaccgagcgagcgagcgcgcatagagggagtggccaa
[0148] >AAV85’ ITR (SEQ ID NO: 6) ttggccactccctctatgcgcgctcgctcgctcggtggggcctgcggaccaaaggtccgcagacggcagagctctgctctgccggcccc accgagcgagcgagcgcgcatagagggagtggccaactccatcactaggggtaacc
[0149] >AAVrh.393’ ITR (SEQ ID NO: 7) ggttacccctagtgatggagttggccactccctctatgcgcgctcgctcgctcggtggggccggctgagcagagctcagccgtctgcgga cctttggtccgcaggccccaccgagcgagcgagcgcgcatagagggagtggccaa
[0150] >AAVrh.395’ ITR (SEQ ID NO: 8) ttggccactccctctatgcgcgctcgctcgctcggtggggcctgcggaccaaaggtccgcagacggctgagctctgctcagccggcccc accgagcgagcgagcgcgcatagagggagtggccaactccatcactaggggtaacc
[0151] >AAV8 genome (SEQ ID NO: 9) ttggccactccctctatgcgcgctcgctcgctcggtggggcctgcggaccaaaggtccgcagacggcagagctctgctctgccggcccc accgagcgagcgagcgcgcatagagggagtggccaactccatcactaggggtaacctcccacgctgccgcgtcagcgctgacgtaaat tacgtcataggggagtggtcctgtattagctgtcacgtgagtgcttttgcggcattttgcgacaccacgtggccatttgaggtatatatggccg agtgagcgagcaggatctccattttgaccgcgaaatttgaacgagcagcagccatgccgggcttctacgagatcgtgatcaaggtgccga gcgacctggacgagcacctgccgggcatttctgactcgtttgtgaactgggtggccgagaaggaatgggagctgcccccggattctgaca tggatcggaatctgatcgagcaggcacccctgaccgtggccgagaagctgcagcgcgacttcctggtccaatggcgccgcgtgagtaag gccccggaggccctcttctttgttcagttcgagaagggcgagagctactttcacctgcacgttctggtcgagaccacgggggtcaagtccat ggtgctaggccgcttcctgagtcagattcgggagaagctggtccagaccatctaccgcggggtcgagcccacgctgcccaactggttcgc ggtgaccaagacgcgtaatggcgccggcggggggaacaaggtggtggacgagtgctacatccccaactacctcctgcccaagactcag cccgagctgcagtgggcgtggactaacatggaggagtatataagcgcgtgcttgaacctggccgagcgcaaacggctcgtggcgcagc acctgacccacgtcagccagacgcaggagcagaacaaggagaatctgaaccccaattctgacgcgcccgtgatcaggtcaaaaacctcc gcgcgctatatggagctggtcgggtggctggtggaccggggcatcacctccgagaagcagtggatccaggaggaccaggcctcgtaca tctccttcaacgccgcctccaactcgcggtcccagatcaaggccgcgctggacaatgccggcaagatcatggcgctgaccaaatccgcg cccgactacctggtggggccctcgctgcccgcggacattacccagaaccgcatctaccgcatcctcgctctcaacggctacgaccctgcc tacgccggctccgtctttctcggctgggctcagaaaaagttcgggaaacgcaacaccatctggctgtttggacccgccaccaccggcaag accaacattgcggaagccatcgcccacgccgtgcccttctacggctgcgtcaactggaccaatgagaactttcccttcaatgattgcgtcga caagatggtgatctggtgggaggagggcaagatgacggccaaggtcgtggagtccgccaaggccattctcggcggcagcaaggtgcg cgtggaccaaaagtgcaagtcgtccgcccagatcgaccccacccccgtgatcgtcacctccaacaccaacatgtgcgccgtgattgacgg gaacagcaccaccttcgagcaccagcagcctctccaggaccggatgtttaagttcgaactcacccgccgtctggagcacgactttggcaa ggtgacaaagcaggaagtcaaagagttcttccgctgggccagtgatcacgtgaccgaggtggcgcatgagttttacgtcagaaagggcg gagccagcaaaagacccgcccccgatgacgcggataaaagcgagcccaagcgggcctgcccctcagtcgcggatccatcgacgtcag acgcggaaggagctccggtggactttgccgacaggtaccaaaacaaatgttctcgtcacgcgggcatgcttcagatgctgtttccctgcaa aacgtgcgagagaatgaatcagaatttcaacatttgcttcacacacggggtcagagactgctcagagtgtttccccggcgtgtcagaatctc aaccggtcgtcagaaagaggacgtatcggaaactctgtgcgattcatcatctgctggggcgggctcccgagattgcttgctcggcctgcga tctggtcaacgtggacctggatgactgtgtttctgagcaataaatgacttaaaccaggtatggctgccgatggttatcttccagattggctcga ggacaacctctctgagggcattcgcgagtggtgggcgctgaaacctggagccccgaagcccaaagccaaccagcaaaagcaggacga cggccggggtctggtgcttcctggctacaagtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggacgca gcggccctcgagcacgacaaggcctacgaccagcagctgcaggcgggtgacaatccgtacctgcggtataaccacgccgacgccgag tttcaggagcgtctgcaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaagaagcgggttctcgaacctctcg gtctggttgaggaaggcgctaagacggctcctggaaagaagagaccggtagagccatcaccccagcgttctccagactcctctacgggc atcggcaagaaaggccaacagcccgccagaaaaagactcaattttggtcagactggcgactcagagtcagttccagaccctcaacctctc ggagaacctccagcagcgccctctggtgtgggacctaatacaatggctgcaggcggtggcgcaccaatggcagacaataacgaaggcg ccgacggagtgggtagttcctcgggaaattggcattgcgattccacatggctgggcgacagagtcatcaccaccagcacccgaacctgg gccctgcccacctacaacaaccacctctacaagcaaatctccaacgggacatcgggaggagccaccaacgacaacacctacttcggcta cagcaccccctgggggtattttgactttaacagattccactgccacttttcaccacgtgactggcagcgactcatcaacaacaactggggatt ccggcccaagagactcagcttcaagctcttcaacatccaggtcaaggaggtcacgcagaatgaaggcaccaagaccatcgccaataacc tcaccagcaccatccaggtgtttacggactcggagtaccagctgccgtacgttctcggctctgcccaccagggctgcctgcctccgttcccg gcggacgtgttcatgattccccagtacggctacctaacactcaacaacggtagtcaggccgtgggacgctcctccttctactgcctggaata ctttccttcgcagatgctgagaaccggcaacaacttccagtttacttacaccttcgaggacgtgcctttccacagcagctacgcccacagcca gagcttggaccggctgatgaatcctctgattgaccagtacctgtactacttgtctcggactcaaacaacaggaggcacggcaaatacgcag actctgggcttcagccaaggtgggcctaatacaatggccaatcaggcaaagaactggctgccaggaccctgttaccgccaacaacgcgtc tcaacgacaaccgggcaaaacaacaatagcaactttgcctggactgctgggaccaaataccatctgaatggaagaaattcattggctaatc ctggcatcgctatggcaacacacaaagacgacaaggagcgtttttttcccagtaacgggatcctgatttttggcaaacaaaatgctgccaga gacaatgcggattacagcgatgtcatgctcaccagcgaggaagaaatcaaaaccactaaccctgtggctacagaggaatacggtatcgtg gcagataacttgcagcagcaaaacacggctcctcaaattggaactgtcaacagccagggggccttacccggtatggtctggcagaaccg ggacgtgtacctgcagggtcccatctgggccaagattcctcacacggacggcaacttccacccgtctccgctgatgggcggctttggcctg aaacatcctccgcctcagatcctgatcaagaacacgcctgtacctgcggatcctccgaccaccttcaaccagtcaaagctgaactctttcatc acgcaatacagcaccggacaggtcagcgtggaaattgaatgggagctgcagaaggaaaacagcaagcgctggaaccccgagatccag tacacctccaactactacaaatctacaagtgtggactttgctgttaatacagaaggcgtgtactctgaaccccgccccattggcacccgttacc tcacccgtaatctgtaattgcctgttaatcaataaaccggttgattcgtttcagttgaactttggcctactgtccttcttatcttatctcgtctccatgg caactggttaaacattaactGCTTGGGTGCGCTTCGCGATAAGGGACTGACGTCATCgggttacccctag tgatggagttggccactccctctatgcgcgctcgctcgctcggtggggccggcagagcagagctctgccgtctgcggacctttggtccgca ggccccaccgagcgagcgagcgcgcatagagggagtggccaa >AAVrh.39 genome (SEQ ID NO: 10) ttggccactccctctatgcgcgctcgctcgctcggtggggcctgcggaccaaaggtccgcagacggctgagctctgctcagccggcccc accgagcgagcgagcgcgcatagagggagtggccaactccatcactaggggtaaccGCGAAGCGCCTCCCACGCTG CCGCGTcagcgctgacgtaaatcacgtcataggggagtggtcctgtattagctgtcacgtgagtgcttttgcgacagtttgcgacacca cgtggtcacagggggtatatatggccgagtgagcacgcaggatctccattttgagcgcggaatttgaacgagcagcagccatgccgggct tctacgagatcgtgatcaaggtgccgagcgacctggacgagcacctgccgggcatttctgactcgttcgtgaactgggtggccgagaagg aatgggagctgcccccggattctgacatggatcggaatctgatcgagcaggcacccctgaccgtggccgagaagctgcagcgcgacttc ctggtcgaatggcgccgcgtgagtaaggccccggaggccctcttctttgttcagttcgagaagggggaaagctactttcacctgcacgttct ggtcgagaccacgggggtcaagtccatggtgctgggccgcttcctgagccagattcgcgaaaagctcgtgcaacgcatctaccgcgggg tcgagcccacgctgcccaactggttcgcggtgaccaagacgcgaaatggcgccggcggggggaacaaggtggtggacgagtgctaca tccccaactacctcctgcccaagacgcagcccgagctgcagtgggcgtggactaacatggaggagtatataagcgcgtgtctgaacctcg cggagcgtaaacggctcgtggcgcagcacctgacccacgtcagccagacgcaggagcagaacaaggagaatctgaacccgaattctg acgcgcccgtgatcaggtcaaaaacctccgcgcgctacatggagctggtcgggtggctggtggaccggggcatcacctccgagaagca gtggatccaggaggaccaggcctcgtacatctccttcaacgccgcctccaactcgcggtcccagatcaaggccgcgctggacaatgccg gaaagatcatggcgctgaccaaatccgcgcccgactacctggtgggcccgtccttacccgcggacattaaggccaaccgcatctaccgc atcctggagctcaacggctacgaccccgcctacgccggctccgtcttcctgggctgggcgcagaaaaagttcggtaaacgcaacaccatc tggctcttcgggcccgccaccaccggcaagaccaacatcgcggaagccatcgcccacgccgtgcccttctacggctgcgtcaactggac caatgagaactttcccttcaacgattgcgtcgacaagatggtgatctggtgggaggagggcaagatgaccgccaaggtcgtggagtccgc caaggccattctgggtggaagcaaggtgcgcgtggaccaaaagtgcaagtcatcggcccagatcgaccccacgcccgtgatcgtcacct ccaacaccaacatgtgcgccgtgatcgacgggaacagcaccaccttcgagcaccagcagcccctgcaggaccgcatgttcaagttcgag ctcacccgccgtctggagcacgactttggcaaggtgaccaagcaggaagtcaaagagttcttccgctgggctcaggatcacgtgactgag gtggcgcatgagttctacgtcagaaagggcggagccaccaaaagacccgcccccagtgacgcggatataagcgagcccaagcgggcc tgcccctcagttgcggagccatcgacgtcagacgcggaagcaccggtggactttgcggacaggtaccaaaacaaatgttctcgtcacgcg ggcatgcttcagatgctgtttccctgcaagacatgcgagagaatgaatcagaatttcaacgtctgcttcacgcacggggtcagagactgctc agagtgcttccccggcgcgtcagaatctcaacccgtcgtcagaaaaaagacgtatcagaaactgtgcgcgattcatcatctgctggggcgg gcacccgagattgcgtgttcggcctgcgatctcgtcaacgtggacttggatgactgtgtttctgagcaataaatgacttaaaccaggtatggc tgctgacggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggacctgaaacctggagcccccaagccc aaggccaaccagcagaagcaggacgacggccggggtctggtgcttcctggctacaagtacctcggacccttcaacggactcgacaagg gggagcccgtcaacgcggcggacgcagcggccctcgagcacgacaaggcctacgaccagcagctcaaagcgggtgacaatccgtac ctgcggtataaccacgccgacgccgagtttcaggagcgtctgcaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccag gccaagaagcgggttctcgaacctctcggtctggttgaggaagctgctaagacggctcctggaaagaagagaccggtagaaccgtcacc tcagcgttcccccgactcctccacgggcatcggcaagaaaggccagcagcccgctaaaaagagactgaactttggtcagactggcgact cagagtcagtccccgaccctcaaccaatcggagaaccaccagcaggcccctctggtctgggatctggtacaatggctgcaggcggtggc gctccaatggcagacaataacgaaggcgccgacggagtgggtagttcctcaggaaattggcattgcgattccacatggctgggcgacag agtcatcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaagcaaatatccAATGGGACATCG GGAGGAAGCACCAACGACAACACCTACTTCGGCTACAGCACCCCCTGGGGGTATTT TGACTTCAACAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAA CAACAACTGGGGATTCCGGCCAAAAAGACTCAGCTTCAAGCTCTTCAACATCCAGG TCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTTACCAGC ACGATTCAGGTATTTACGGACTCGGAATACCAGCTGCCGTACGTCCTCGGCTCCGCG CACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTCTTCATGattccccagtacggctaccttacac tgaacaatggaagtcaagccgtaggccgttcctccttctactgcctggaatattttccatctcaaatgctgcgaactggaaacaattttgaattc agctacaccttcgaggacgtgcctttccacagcagctacgcacacagccagagcttggaccgactgatgaatcctctcatcgaccagtacc tgtactacttatccagaactcagtccacaggaggaactcaaggtacccagcaattgttattttctcaagctgggcctgcaaacatgtcggctca ggctaagaactggctacctggaccttgctaccggcagcagcgagtctctacgacactgtcgcaaaacaacaacagcaactttgcttggact ggtgccaccaaatatcacctgaacggaagagactctttggtaaatcccggtgtcgccatggcaacccacaaggacgacgaggaacgcttc ttcccgtcgagtggagtcctgatgtttggaaaacagggtgctggaagagacaatgtggactacagcagcgttatgctaaccagcgaagaa gaaattaaaaccactaaccctgtagccacagaacaatacggtgtggtggctgacaacttgcagcaaaccaatacagggcctattgtgggaa atgtcaacagccaaggagccttacctggcatggtctggcagaaccgagacgtgtacctgcagggtcccatctgggccaagattcctcaca cggacggcaacttccacccttcaccgctaatgggaggatttggactgaagcacccacctcctcagatcctgatcaagaacacgccggtac ctgcggatcctccaacaacgttcagccaggcgaaattggcttccttcattacgcagtacagcaccggacaggtcagcgtggaaatcgagtg ggagctgcagaaggagaacagcaaacgctggaacccagagattcagtacacttcaaactactacaaatctacaaatgtggactttgctgtc aatacagagggaacttattctgagcctcgccccattggtactcgttacctcacccgtaatctgtaattgctggttaatcaataaaccgtttgattc gtttcagttgaactttggtctccgtgtgcttcttatcttatctcgtctccatggcaactggttacacattaactgcttggtgcgcttcgcGATCA TAAATGACTTACGTCATCGggttacccctagtgatggagttggccactccctctatgcgcgctcgctcgctcggtggggc cggctgagcagagctcagccgtctgcggacctttggtccgcaggccccaccgagcgagcgagcgcgcatagagggagtggccaa > AAV 1 inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 11) ccggttgattcgtttcagttgaactttggtctcctgtccttcttatcttatcggttaccatggttatagcttacacattaactgcttggttgcgcttcgc gataaaagacttacgtcatcggg
[0152] > AAV3 inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 12) ccgtttaattcgtttcagttgaactttggctcttgtgcacttctttatctttatcttgtttccatggctactgcgtagataagcagcggcctgcggcg cttgcgcttcgcggtttacaactgctggttaatatttaactctc
[0153] > AAV3b inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 13) ccgtttaattcgtttcagttgaactttggctcttgtgcacttcttatcttatcttgtttccatggctactgcgtagataagcagcggcctgcggcgct tgcgcttcgcggtttacaactgctggttaatatttaactctc
[0154] > AAV4 inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 14) ccggtttattcgtttcagttgaactttggtctccgtgtccttcttatcttatctcgtttccatggctactgcgtacataagcagcggcctgcggcgct tgcgcttcgcggtttacaactgccggttaatcagtaacttct
[0155] > AAV5 inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 15)
[0156] ccgtgtattcgtgtcagtaaaatactgcctcttgtggtcattcaatgaataacagcttacaacatc
[0157] > AAV6 inverted terminal repeat (ITR) proximal region (IPR) nucleotide sequence (SEQ ID NO: 16) Ccggttaattcgtgtcagttgaactttggtctcatgtcgttattatcttatctggtcaccatagcaaccggttacacattaactgcttagttgcgctt cgcga
[0158] > IPR consensus nucleotide sequence 2 (SEQ ID NO: 17)
[0159] See FIG. 11
Claims
CLAIMSWhat is claimed is:
1. A recombinant adeno-associated viral (rAAV) vector comprising a transgene flanked by non-AAV2 inverted terminal repeats (ITRs), wherein the non-AAV2 ITRs comprise a 5’-ITR and a 3’-ITR with respect to the transgene, and further comprising an AAV ITR proximal region (IPR) sequence selected from an AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, and AAVrh.39 IPR sequence.
2. The rAAV vector of claim 1, wherein the IPR sequence is positioned between the transgene and the 3 ’-ITR.
3. The rAAV vector of claim 1, wherein the IPR sequence is positioned between the 5’-ITR and the transgene.
4. The rAAV vector of claim 2, wherein the transgene comprises a promoter sequence.
5. The rAAV vector of claim 4, wherein the promoter sequence is a constitutive promoter sequence, inducible promoter sequence, and / or a tissue-specific promoter sequence.
6. The rAAV vector of claim 3, wherein the transgene does not comprise a promoter sequence.
7. The rAAV vector of any one of claims 1 to 6, wherein the transgene comprises a nucleotide sequence encoding a protein.
8. The rAAV vector of any one of claims 1 to 7, wherein the AAV8 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 1.
9. The rAAV vector of any one of claims 1 to 7, wherein the AAV8 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 1.
10. The rAAV vector of any one of claims 1 to 7, wherein the AAV.rh39 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 2.
11. The rAAV vector of any one of claims 1 to 7, wherein the AAV.rh39 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 1.
12. The rAAV vector of any one of claims 1 to 7, wherein the AAV1 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 11.
13. The rAAV vector of any one of claims 1 to 7, wherein the AAV1 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 11.
14. The rAAV vector of any one of claims 1 to 7, wherein the AAV3 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 12.
15. The rAAV vector of any one of claims 1 to 7, wherein the AAV3 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 12.
16. The rAAV vector of any one of claims 1 to 7, wherein the AAV3b IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 13.
17. The rAAV vector of any one of claims 1 to 7, wherein the AAV3b IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 13.
18. The rAAV vector of any one of claims 1 to 7, wherein the AAV4 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 14.
19. The rAAV vector of any one of claims 1 to 7, wherein the AAV4 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 14.
20. The rAAV vector of any one of claims 1 to 7, wherein the AAV5 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 15.
21. The rAAV vector of any one of claims 1 to 7, wherein the AAV5 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 15.
22. The rAAV vector of any one of claims 1 to 7, wherein the AAV6 IPR sequence comprises a nucleotide sequence at least 70% identical to the nucleotide sequence set forth in SEQ ID NO: 16.
23. The rAAV vector of any one of claims 1 to 7, wherein the AAV6 IPR sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 16.
24. A recombinant adeno-associated virus (rAAV) comprising:(i) the rAAV vector of any one of claims 1 to 23; and(ii) at least one AAV capsid protein.
25. The rAAV of claim 24, wherein the capsid protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV8, and AAVrh.39 capsid proteins.
26. A host cell comprising the rAAV vector or rAAV of any one of claims 1 to 25.
27. The host cell of claim 26, wherein the host cell is a mammalian cell, optionally a human cell.
28. A method for delivering a transgene to a target tissue, the method comprising administering the rAAV vector of any one of claims 1 to 23 or the rAAV of claim 24 or 25 to a subject.
29. The method of claim 28, wherein the administration comprises systemic administration or local administration.
30. The method of claim 29, wherein the systemic administration is intravenous injection.
31. The method of any one of claims 28 to 30, wherein the local administration is intramuscular injection.
32. The method of any one of claims 28 to 31, wherein the subject is a mammal, optionally a human.