Development and production of a synthetic antibacterial drone
Modified bacterial DNA islands packaged in phage-like particles (ABDs) address antibiotic-resistant bacteria by delivering cargo sequences to kill or inhibit growth, offering efficient and safe treatment options.
Patent Information
- Application Number
- PCT/US2025/052201
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-23
- Filing Date
- 2025-10-23
- Publication Date
- 2026-04-30
AI Technical Summary
Antibiotic resistance in bacteria, particularly Staphylococcus aureus, has rendered many infections untreatable, necessitating the development of alternative compositions and methods to inhibit bacterial growth or kill bacteria effectively.
Engineering modified bacterial DNA islands (B-INS) into phage-like particles (ABDs) that infect bacteria, delivering cargo sequences to kill or inhibit bacterial growth, utilizing a holin-lysin defective helper phage system for production and avoiding antibiotic resistance.
ABDs demonstrate broad host range, efficient production, and one-hit kinetics, effectively killing or inhibiting antibiotic-resistant bacteria, including biofilm infections, with reduced side effects and resistance development.
Smart Images

Figure IMGF000028_0001_TABLE 
Figure IMGF000029_0001_TABLE 
Figure IMGF000030_0001_TABLE
Abstract
Description
[0001] DEVELOPMENT AND PRODUCTION OF A SYNTHETIC ANTIBACTERIAL DRONE CROSS-REFERENCE TO RELATED APPLICATION
[0002] This application claims priority to U.S. provisional patent application no. 63 / 711,024, filed October 23, 2024, the entire disclosure of which is hereby incorporated by reference. FIELD
[0003] The present disclosure relates generally to approaches for inhibiting growth of and / or killing bacteria, and more particularly to engineered particles comprising improved modified bacterial DNA islands.
[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0005] This invention was made with government support under R01 Al 139613 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0006] SEQUENCE LISTING
[0007] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy was created on October 13, 2025, is named “058636.00836.xml” and is 39,594 bytes in size.
[0008] BACKGROUND
[0009] Antibiotic resistance is one of the world’s most pressing public health problems. Illnesses that were once easily treatable with antibiotics are becoming more difficult to cure and more expensive to treat. Each year in the United States alone, at least 2 million people become infected with bacteria that are resistant to antibiotics. Genotypic as well as phenotypic antibiotic resistance can arise in a wide variety of bacteria. Of particular concern is that Staphylococcus aureus and other staphylococci continue to cause life-threatening infections affecting any bodily organ and, during the past 15 years have become a major cause of community-acquired infections, as well as continuing to be the scourge of the hospital environment. Staphylococci have become increasingly resistant to antibiotics, especially to 0-lactams and glycopeptides, and their infections are now, in many cases, totally untreatable. Thus, there is an ongoing need for improved compositions and methods for treating bacterial infections and otherwise limiting growth or killing bacteria. The present disclosure is pertinent to these needs.
[0010] BRIEF SUMMARY
[0011] This disclosure provides polynucleotides which comprise a mobile bacterial island nucleotide sequence (B-INS). The B-INS contains or more modifications to thereby provide a modified B-INS. The modifications include deletion or modification of restriction enzyme recognition sites to inhibit restriction enzyme cleavage of the B-INS. The B-INS includes an insertion of at least one cargo sequence. The B-INS is packaged within a bacterium into a phage-like particle that contains a bacteriophage capsid, tail and tail fiber proteins. The phage-like particle functions as an antibacterial drone “ABD” and infects bacteria. The cargo sequence is introduced into bacteria infected by the ABD and kills the infected bacteria or inhibits their growth.
[0012] BRIEF DESCRIPTION OF THE FIGURES FIG. 1. ABD2047 with restriction sites identified and modified. Each vertical line represents a RE site; “x” means site was modified; Roman numeral signifies enzyme type (I, II, and III); Arabic numeral is the specific RE of that type signifies the number of that site in a master list. For example, XII 7 represents a restriction site of the type II restriction enzyme #7 has been modified so that it is no longer recognized by this enzyme. Numbers without an X are sites that will have corresponding methylase in the particle-producing strain.
[0013] FIG 2. Plasmid U88OLPUPGO-1 containing a ~13 kb insert of the synthetic ABD2047, to which have been added the pI258 replicon, and a chloramphenicol resistance gene. The plasmid map shows a lack of restriction sites.
[0014] FIG. 3. Electron microscope image showing the effect of holin-lysin mutant of phage 80a on ABD particle production. A holin-lysin mutant of phage 80a was constructed by allelic replacement in the 80a / c / ;S'-defective prophage resident in the particle-producing strain. ABD2001 was introduced into this strain and the mutant prophage induced with mitomycin C and incubated for 9 hours. Bacteria were recovered, embedded, and sectioned for electron microscope examination. A single cell is shown.
[0015] FIG. 4. Related to FIG. 3, with a graphical flowchart showing steps to produce ABD particles.
[0016] FIG. 5. provides Table 1, summarizing percent killing data obtained using ABDs as indicated. DETAILED DESCRIPTION
[0017] Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
[0018] Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein.
[0019] The disclosure includes all polynucleotide and amino acid sequences described herein. Each RNA sequence includes its DNA equivalent, and each DNA sequence includes its RNA equivalent. Complementary and anti-parallel polynucleotide sequences are included. Every DNA and RNA sequence encoding polypeptides disclosed herein is encompassed by this disclosure. Amino acids of all protein sequences and all polynucleotide sequences encoding them are also included. Sequences of from 80-99.99% identical to any sequence (amino acids and nucleotide sequences) of this disclosure are included. In some examples a cargo module may be referred to herein as a module.
[0020] The present disclosure provides compositions and methods for converting bacterial DNA islands into what is referred to herein from time to time herein as “Anti-bacterial Drones” (ABDs), and includes the ABDs themselves, compositions comprising them, and methods of using them. In examples, the disclosure provides non-antibiotic compositions, and methods of treating bacterial infections using them, and wherein the presently described ABDs, methods of producing the ABDs, and methods of using the ABDs are improved relative to prior ABD examples.
[0021] In examples, the disclosure provides: a polynucleotide comprising a mobile bacterial island nucleotide sequence (referred to herein as a “B-INS”) comprising one or more modifications (referred to herein as a “modified B-INS”), the one or more modifications including but not necessarily limited to a B-INS comprising: i) a deletion of restriction sites; and ii) an insertion of at least one cargo sequence into the B-INS. In examples, the polynucleotide comprising the modified B-INS is capable of being packaged within a bacterium into a phage-like particle that comprises or consists of bacteriophage capsid, tail and tail fiber proteins that is referred to herein an ABD. The ABD is capable of infecting bacteria such that at least one cargo sequence is introduced into bacteria infected by the ABD. In non-limiting examples, a native B-INS may or may not contain one or more virulence determinants. In examples, modifications of a virulence determinant in a B-INS comprises a deletion of all or substantially all of the virulence determinants in the B-INS. In examples, at least one cargo sequence comprises a polynucleotide sequence encoding an anti-bacterial agent that is functional against a target in at least some bacteria in a bacterial population. In examples, between 80-100% of the bacteria are killed.
[0022] The disclosure includes improvements relative to previously described ABDs, such as those described in PCT Publication No. WO / 2018 / 213301, in which in certain examples, the particles were produced by mitomycin C induction of a helper prophage resident in the particle producing bacteria, and were concentrated by PEG precipitation. Yields of particles were only from lOel 1 - 10el2 / liter of culture, and one example was effective with <25% of clinical isolates because most target strains possessed restriction endonucleases that destroyed it. The present disclosure provides at least the following improvements relative to the disclosure in in PCT Publication No. WO / 2018 / 213301, which include but are not necessarily limited to the following three qualitative and novel modifications that are different from the previously described process: i) synthesis and testing of an ABD DNA molecule lacking restriction endonuclease recognition sites, ii) helper phage induction by elevated temperature instead of mitomycin C, and iii) ABD particle production and concentration using a holin-ly sin-defective helper phage. These improvements allow preparation of 10el3-10el4 ABD particles / liter, sufficient for use in humans, that are fully effective with >90% of clinical S. aureus isolates and can be adapted for use against any other type of unwanted bacteria. As such, in various and non-limiting examples, the present disclosure provides for modifying any naturally occurring phage-packageable and mobilizable bacterial chromosomal island using the described improvements. In examples, the ABD particles are thus produced in a manner wherein induction of a helper phage is performed without adding any compound to the media to induce the helper phage. In an example a holin-lysin defective helper phage is used. In an example, a holin-lysin defective helper phage is a bacteriophage that has been genetically modified such that it lacks genes for its own holin and endolysin proteins. This configuration impedes its ability to lyse or otherwise kill its bacterial host.
[0023] In examples, some or all of Type I, Type II, and / or Type III restriction cites are removed from or altered within a described polynucleotide. The arrangement and sequences of Type I, Type II, Type III restriction sites are known in the art. They are recognized by Type I, Type II, and Type III restriction enzymes, respectively. Such restriction enzymes are known in the art.
[0024] In examples, a Type I restriction site comprises a bipartite sequence with two specific half-sites separated by a non-specific spacer of 5-8 nucleotides. Either or both of half-sites may be deleted or modified. In examples, a Type II restriction site comprises 4 to 8 base pairs which may be palindromic. In examples, a Type III restriction site comprises two non-palindromic sequences arranged in an inverted repeat format. In examples, 10-100% of the restriction sites in the described polynucleotide are eliminated or modified such that they cannot be cleaved by their respective restriction enzymes. In examples, 10-100% of Type I sites are eliminated or modified to resist cleavage. In examples, 10-100% of Type II sites are eliminated or modified to resist cleavage. In examples, 10-100% of Type III sites are eliminated or modified to resist cleavage. The stated percentages are inclusive and include all integers and ranges of integers between the upper and lower percentages.
[0025] ABDs are indifferent to antibiotic resistance, and do not, themselves, induce resistance, are effective in several animal models, kill with one-hit kinetics, and are often curative by a single dose. The described improved ABDs have a broader host range than previously available, and are produced by methods that are safer and more efficient than the previously described production methods. The ABD platform is also distinct from bacteriophage therapy, as follows: i) the bactericidal genes of the ABD are expressed immediately following entry of the ABD DNA, requiring only the protein-synthesizing machinery of the target cell, mutation of which would be lethal to the cell, whereas a therapeutic phage must execute its complex multistage life cycle to kill a host cell, and this cycle is vulnerable to a wide variety of mutations that are not lethal to the host cell but interrupt the phage's life cycle at any stage; ii) the ABD is designed to have space within its particles for at least 30 kb of added DNA - which may include a wide variety of bactericidal and ancillary genes to provide antibacterial versatility, for example, disruption of host cell metabolism or structure, penetration of abscesses, disruption of biofilms, and other advantages, whereas a bacteriophage has little or no extra space for the addition of ancillary genes; iii) and production of high-titer preparations is greatly facilitated by the use of holin-lysin-defective helper phages, which cannot readily be used for phage production.
[0026] With respect to antibiotics, ABDs can be used with antibiotic-resistant infecting bacteria but are also useful for patients allergic to antibiotics and will have far fewer side effects. It is expected that the presently describes ABDs will be competitive with antibiotics for sensitive as well as resistant bacteria: with one-hit kinetics, and may cure a bacterial infection with a single dose, which has never been shown for an antibiotic. In examples, are useful for infections involving bacterial biofilms, against which antibiotics perform very poorly if at all. It is expected the ABDs will outperform antibiotics with infections involving biofilms, such as periprosthetic joint infections. The disclosure includes designing and constructing DNA cargo modules which encode antibacterial agent(s) and / or other agents that facilitate and / or improve and / or alter the function of the ABDs, and affect cells into which they are introduced. The disclosure includes inserting one or more anti-bacterial cargo modules into the modified island to create improved DNA islands (ABD-islands) that have the ability to kill or attenuate or otherwise modify any bacterial cell that is infected by an ABD. The disclosure thus provides for exploiting the packaging system and high frequency transfer mechanism of the islands to package and disseminate the re-purposed island DNA (ABD-DNA). The ABD-DNA may be packaged in infectious phage-like particles (ABD-particles), which may be released from the ABD-producing cell upon phage-induced lysis, as further described herein. The disclosure includes customizing and optimizing ABD-particle producing bacterial strains, and includes such strains themselves.
[0027] In certain aspects the invention includes introducing by any suitable approach the ABDs into bacterial cells such that the cargo is expressed or otherwise affects function of the bacterial host. Depending on the cargo, ABD may alter, kill, weaken or disarm the targeted bacteria or the surrounding bacteria, or may deliver a drug or other substance to a particular locale as further described herein. An ABD may contain a plasmid replicon and can then proliferate throughout the bacterial population, or may be designed to prevent proliferation
[0028] The disclosure includes all modifications that are described herein, and those that are depicted in the figures and any nucleotide and amino acid sequences provided by the disclosure, directly, or by reference to any other source, including but not necessarily limited to plasmid maps.
[0029] In non-limiting examples, the disclosure provides a representative lysostaphin-encoding ABD2047 sequence, referred to as ABD2047s. This construct was modified such that most of the recognition sites for restriction enzymes were eliminated by sequence modification. See Fig. 1. The modified ABD was provided attached to a shuttle plasmid and was introduced by DNA transformation into E. coli strain DH5alpha, and then electroporated into S. aureus strain RN4220, where the sequence was confirmed (Fig. 2), and from there into S. aureus strain RN12064, the ABD particle-producing strain (PPS), containing the gene encoding the repressor of the tetracycline resistance gene, to prevent expression of the lysostaphin gene. This strain was used for the production of ABD2047s particles by induction with mitomycin C, which were tested for killing of 30 S. aureus strains that were resistant to the original ABD2047 owing to degradation of the ABD DNA by restriction enzymes. Twenty-six of these strains were fully sensitive to killing by ABD2047s, and 4 were partially sensitive (Table 1 in FIG. 5).
[0030] The disclosure also includes two changes in the ABD particle production system. First, we deleted the holin-lysin genes of the helper prophage in the PPS, to enable the accumulation of ABD particles intracellularly (FIG. 3). The cells were incubated for 3.5 h, to allow accumulation of ABD particles, and concentrated 20-fold by centrifugation. Treatment of these cells with anhydrotetracycline enabled expression of lysostaphin, which caused lysis of the cells, releasing the ABD particles. Treatment with NP40 and DNase I disrupted cell debris and removed free DNA, enabling filter-sterilization of the particles, which had a final concentration of lOel l-10el2 / ml. The second major change was to eliminate the use of the toxic and carcinogenic mitomycin C (MC) for helper phage induction, by introducing a point mutation, T52A, into the helper phage repressor gene. This mutation imparted the capability for thermal induction of coliphage lambda cl 857, which is located in a region of the lambda cl repressor that is homologous to the corresponding region of the staphylococcal helper phage 80alpha repressor. Thermal induction of the PPS containing this mutation resulted in particle yields that were only slightly lower than those obtained with MC.
[0031] The disclosure includes the following examples: 1) further demonstration of the killing efficacy of the described synthetic ABD, using a panel of 150 clinical S. aureus isolates representing important clonal complexes; 2) testing the described synthetic ABDs in various animal infection models of an ABD with three representative bactericidal modules and a fourth expressing streptokinase, which will enable the ABD to invade abscesses, cardiac valve vegetations, and other fibrin-containing lesions; scaling manufacturing to amounts and properties suitable for clinical trial levels, and demonstrating safety, preservation, and shelflife.
[0032] In examples, the described ABDs are expected to be useful in combatting bacterial pathogens on the Center for Disease Control (CDC) ESKAPE list (Enterococci, Staphylococci, Klebsiella, Acinetobacter, Pseudomonas, and Enterobacter sp.), which are responsible for a major proportion of antibiotic-multi-resistant infections in humans and in domestic animals. In examples, the described ABDs are expected to be useful in combatting the ABD system to the enterococcal pathogens, E. faecalis and E. faecium, which together cause about 400,000 deaths, worldwide. Regarding resistance, most clinical staph isolates, including MRSA, are multi-resistant and the enterococci are mostly pan-resistant. Adaptation to this and other Gram-positive pathogens, such as streptococci, are encompassed by the disclosure. In examples, the described ABDs have their virulence and other accessory genes replaced by bactericidal genes that, in present examples, are lethal for staphylococci and listeria. Although listeria is not on the ESKAPE list, it is a serious pathogen and its cell wall teichoic acid is so similar to that of S. aureus that many strains can adsorb staphylococcal phage particles, including the ABD which, appropriately armed, can kill listeria. Enterococci are additionally sufficiently similar to staphylococci that the two genera naturally participate in genetic exchange. As such, the disclosure included ABDs that can combat enterococci.
[0033] In an example, a described ABD DNA is synthesized within engineered staphylococcal cells under control of a helper phage, packaged in phage-like ABD particles which are released upon cellular lysis, then concentrated and purified for in vivo use. The ABD particles are administered using any suitable route, on example being parenterally, to an infected individual, adsorb to the infecting bacteria, inject their DNA and immediately express their lethal cargo, thus eradicating these bacteria with one-hit kinetics. The ABD can target dormant (persister) or stationary-phase cells and small-colony variants as well as normally growing bacteria. The ABDs can target cardiac vegetations and other biofilm-related infections such as infected surgical implants, as well as organisms colonizing the nasal mucosa or skin. Thus, the ABD system is amenable to both systemic and topical uses. Adaptations will furthermore be developed enabling the ABD to target intracellular bacteria. Prophylactic applications are also encompassed by the disclosure for high-risk situations such as prosthetic joint surgery. The disclosure includes protection of the ABD DNA from bacterial defenses and prevention of unwanted transfer of DNA among bystander bacteria. The disclosure contemplates demonstration of ABD superiority to therapeutic phages and other non-antibiotic initiatives in the face of burgeoning antibiotic resistance.
[0034] Some advantages of the described ABD system is in its potential to solve the problem of staphylococcal (including MRSA) antibiotic resistance by replacing antibiotics with particles that deliver several distinct bactericidal genes to the interior of a staphylococcal cell that is causing an infection. The products of these bactericidal genes destroy the organism's DNA, RNA or cell envelope. They function even if the cell is not biologically active, since a dormant cell can still be infected by the ABD and will be killed when it becomes sufficiently active to express the ABD cargo genes. ABD can treat staph infections of different types, including skin infections, pneumonia, nasal colonization, sepsis, endocarditis, foreign body infections, bone infections, and deep abscesses. It is expected that the multiplicity of functions will preclude the development of resistance. The disclosure includes flanking bactericidal by chi sites so that in case the backbone is cleaved by an unknown endonuclease - such as a CRISPR - the modules will be protected from exonucleases and will express their bactericidal genes. Given the concern over possible dissemination of virulence or resistance genes either contained in the ABD particles or mobilized during ABD infection, all ABDs may carry a self-destruct system whose expression will be specifically delayed until after the cargo genes have been fully expressed. The ABD, among other uses, is expected to be useful for staphylococcal infections and for enterococcal infections and, and for Streptococcus uberis for bovine mastitis and listeria. In examples, the ABD is species-specific and therefore is expected to not significantly impact the microbiome. The ABDs are expected to be nontoxic and not exhibit deleterious side effects that would prevent their use. They may, however, induce immunity to proteins of the carrier bacteriophage.
[0035] The disclosure demonstrates prophylactic and therapeutic utility for specific examples of the invention, which can be readily extended to the other examples that are described herein by the skilled artisan when given the benefit of the present description.
[0036] In examples, the disclosure provides polynucleotides, and ABDs containing them, that include a DNA sequence or encode an RNA that comprises specificity for a target that is an essential gene, or an RNA encoded by an essential gene, or a variable gene, or an RNA encoded by a variable gene. In examples, the ABDs include a sequence encoding a protein that has specificity for a target and can participate in and / or cause its cleavage and / or inactivation. In examples, the ABCs include a sequence encoding a toxin, which may or may not be an excreted toxin, that is bactericidal or cytostatic against bacteria, or a non-toxin protein that inhibits growth of bacteria in a bacterial population, or inhibits formation of and / or kills persister bacteria and / or dormant viable but non-culturable (VBNC) bacteria, such toxin capable of killing bacteria that have not been infected by the ABD, and / or can kill bacteria that do harbor or are otherwise infected by the ABD. In examples, the toxin is lysostaphin. In examples, the ABDs comprise a sequence encoding an anti-sense RNA, or a Clustered Regularly Interspaced Short Palindromic repeats (CRISPR) guide RNA targeted to a sequence in a bacterium in a bacterial population. In examples, the ABDs comprise a sequence encoding a CRISPR-associated nuclease including a Cas9 nuclease, a Cpfl nuclease, or a dCas9. In examples, a target of a component of the CRISPR system is a bacterial chromosome or a bacterial plasmid. Pharmaceutical compositions comprising ABDs of this disclosure, including mixtures of distinct types of ABDs that are differentiated from one another at least by the polynucleotide they include, are provided. Methods of killing bacteria or otherwise limiting the growth of bacteria, or changing a phenotype of bacteria, are provided by introducing ABDs into bacteria. The bacteria may be in an individual, or present on or impregnated in a surface, such as a surface of an inanimate object, which may be any of a variety of objects, devices and the like, including but not limited to medical devices, surgical implants, and the like. Methods of producing ABDs by engineering bacteria to produce them are included in the disclosure, as are methods of separating ABDs from the bacteria, the engineered and infected bacteria, and the cell culture media comprising the bacteria and / or secreted ABDs. Isolated and / or purified ABDs are also included.
[0037] In examples, the disclosure includes the following aspects: enabling the ABD backbone and its cargos to effectively kill at least 95% of clinical S. aureus strains, including the major clonal complexes; demonstrating functionality of the synthetic ABD2001; cloning restriction methylase genes to the PPS chromosome; protecting the cargo modules from exonuclease degradation in cases where the synthetic ABD DNA backbone is still cleaved by endonucleases; to minimize the possibility of inadvertent transfer of PPS or target strain DNA to target cells during treatment the ABD may include a self-destruction circuit; replacing the existing pac system with a cos packaging system; deletion of all variable genes that are present in the PPS and absent from clinical S. aureus strains, plus all important pseudo pac sites; preventing ABD integration into the target cell genome and / or transduction of host genes to other bacteria; and protecting the ABD particles from clearance in the bloodstream.
[0038] The disclosure includes polynucleotides comprising ABDs of this disclosure. In certain approaches of this disclosure expression vectors, such as plasmids, are used to produce one or more than one construct and / or component of the ABDs, and any of their cloning steps or intermediates. A variety of suitable expression vectors known in the art can be adapted to produce the ABDs of this disclosure.
[0039] In one aspect the disclosure includes a kit comprising one or more expression vector(s) that encode one or more ABD components. The expression vector in certain approaches includes a cloning site, such as a poly-cloning site, such that any desirable cargo gene can be cloned into the cloning site to be expressed in any target cell into which the ABD is introduced. The kit can further comprise one or more containers, printed material providing instructions as to how to use make and / or use the expression vector to produce ABDs, and reagents for introducing the expression vector into cells. The kits may further comprise one or more bacterial strains for use in producing the ABDs. The bacterial strains may be provided in a composition wherein growth of the bacteria is restricted, such as a frozen culture with one or more cryoprotectants, such as glycerol.
[0040] Methods of making ABDs are included and generally comprise introducing one or more polynucleotide encoding at least some portion of an ABD into suitable cells that comprise resident phages or prophages and / or other suitable genetic elements and / or proteins, allowing replication of the polynucleotides such that ABDs are formed, harvesting the ABDs from the cells, the cell cultures, or the culture supernatants, and optionally separating the ABDs from the cells, cell culture, cell culture supernatant, etc. Cells and cell cultures that harbor polynucleotides comprising the ABDs are included, as are isolated and / or purified ABDs. The ABDs can be purified to any desired degree of purity using standard approaches, such as density gradient separation or commercially available kits used to purify infectious particles made by bacteria.
[0041] In certain aspects the disclosure includes a pharmaceutical formulation comprising ABDs as described herein. The form of pharmaceutical preparation is not particularly limited, but generally comprises ABDs and at least one inactive ingredient. In certain examples suitable pharmaceutical compositions can be prepared by mixing any one type of ABD, or combination of distinct ABDs, with a pharmaceutically-acceptable carrier, diluent or excipient, and suitable such components are well known in the art. Some examples of such carriers, diluents and excipients can be found in: Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, PA. Lippincott Williams & Wilkins.
[0042] In another aspect the disclosure comprises delivering to bacteria a cargo via ABDs of this disclosure. The method generally comprises adding a preparation of ABDs of this disclosure to one or more bacterial cells, allowing attachment of ABDs to the cells, such as via a surface receptor, whereby the nucleic acids contained by the ABDs enter the cells.
[0043] Subsequent to ABD nucleic acid entry the expression of the cargo occurs.
[0044] The compositions can be administered to humans, and are also suitable for use in a veterinary context and accordingly can be given to non-human animals, including but not limited to non-human mammals, and avian animals, and / or to any eukaryotic organism, including plants, wherein targeting of bacteria would be desirable.
[0045] In examples the ABDs are introduced into a subject as a component of a pharmaceutical composition. In certain aspects, the ABDs can be administered using any suitable route and method which may in part be dictated by the type of cargo that is encoded in the ABD, and the subject to which the ABDs are administered, the type and severity of the bacterial infection, its location, and other factors that will be apparent to those skilled in the art. In examples, the amount of ABDs is an effective amount such that the cargo achieves a desired result. The desired result can comprise a prophylactic effect or a therapeutic effect. In this regard, the type of cargo that the ABDs encode is not particularly limited and nonlimiting illustrations are described further below. This disclosure is considered to be suitable for targeting any microorganism that is susceptible to infection by any ABD described herein. In present examples the bacteria that are targeted by ABDs of this disclosure are Gram -positive. In alternative examples the bacteria that are targeted by ABDs of this disclosure may be Gram-negative. In examples the bacteria are resistant to one or more antibiotics and the ABDs kill or reduce the growth of the antibiotic-resistant bacteria, and / or the ABDs sensitize the bacteria to an antibiotic by, for example, use of cargo that targets an antibiotic resistance gene, which may be present on a chromosome or a plasmid. The disclosure is thus suitable for targeting bacterial chromosomes or episomal elements. In certain approaches the present disclosure can comprise use of a composition comprising ABDs as the only antimicrobial agent in the composition, or the composition can also comprise other antimicrobial agents. In examples, the disclosure encompasses using ABDs in the same composition as at least one other antimicrobial compound, or in concurrent or sequential, distinct administrations wherein ABDs are administered separately from at least one other antimicrobial compound, examples of which include but are not limited to any known antimicrobial compound and / or compounds that interfere with, for example, bacterial quorum sensing. In various examples, the ABDs can be used with antibiotics that are members of classes such as aminoglycosides, beta lactams (with or without beta lactamase inhibitor such as clavulanic acid), macrolides, glycopeptides, polypeptides, cephalosporins, lincosamides, ketolides, rifampicin, polyketides, carbapenem, pleuromutilin, quinolones, streptogranins, oxazolidinones, lipopeptides, etc.
[0046] In examples, the method of this disclosure is used to reduce or eradicate bacterial cells. A reduction can be determined by comparing bacteria treated with ABDs to any suitable control. Eradication can comprise killing all bacterial cells as determined using any suitable measurement of bacteria. The bacteria can be present in an infection, which may be systemic, or localized to any particular system, organ or tissue, including but not limited to a wound. The bacteria may also be present in a biological or non-biologic liquid, or on an inanimate surface, or a food product. In non-limiting examples the surface can be a non-porous surface, a surface in a hospital, or a surface that is used for food processing or preparation.
[0047] Examples of this disclosure may be used to reduce or eradicate persister bacteria and / or dormant viable but non-culturable (VBNC) bacteria, and / or small-colony variant (SCV) bacteria. Such cells include but are not necessarily limited to mid-stationary phase or late- stationary phase cells. Such cells include pathogenic bacteria that neither grow nor die in the presence of conventional microbicidal antibiotics. In examples, persister cells and SCVs contribute to the recalcitrance of clinical infections. In examples, the bacteria are present in a biofilm. In examples, the disclosure inhibits formation of a biofilm, and may promote biofilm dispersal.
[0048] In certain examples, the method of the disclosure results in eradication of a bacterial population from an infection, such as from an infection of an organ, tissue, skin, or biological fluid from an individual, or from the surface of an inanimate object, including but not necessarily limited to medical devices, such as implantable or implanted medical devices, and / or any medical device that may stay in contact with the skin or be fully or partially present within the body of an individual for a period of time during which the surface of the device may be susceptible to biofilm formation. In examples, the method of this disclosure is used to reduce or eradicate bacteria that are present in anaerobic conditions. Thus, the disclosure in various implementations provides flexible approaches for a) killing b) attenuating virulence and c) inhibiting growth of a wide variety of bacteria in diverse environments, as well as for modifying non-pathogenic bacteria so that they have at least one intended characteristic / comprise / express a cargo as described herein.
[0049] In examples, disarming means reducing the capability of bacteria to cause damage to a host, such as by reducing or eliminating the capacity to produce toxins. In examples, attenuating means weakening the organism, such as by slowing or blocking its growth, or its ability to penetrate cells.
[0050] The disclosure includes designing and constructing DNA cargo modules. These cargo modules comprise DNA sequences encoding antibacterial agent(s). These cargo modules may also encode any other agents that facilitate and / or improve and / or alter the function of the ABDs. Numerous specific examples of DNA cargo modules are discussed below, and others will be apparent to those skilled in the art when given the benefit of the present description. The disclosure includes inserting one or more anti-bacterial cargo modules into the modified island to create a novel DNA island (ABD-island) that has the ability to kill or attenuate any bacterial cell that is infected by it.
[0051] In certain aspects the invention includes introducing by any suitable approach the ABDs into bacterial cells such that the cargo is expressed or otherwise affects function of the bacterial host. In examples, ABDs are introduced into bacteria and affect one or more properties of the bacteria. In examples, such effects are realized without integration of the ABD or any segment of its DNA content into the host chromosome; in other examples, the effects are realized subsequent to integration into the host chromosome.
[0052] Depending on the cargo, ABD may kill, weaken or disarm the targeted bacteria or the surrounding bacteria (or may deliver a drug or other substance to a particular locale). ABD can then spread throughout the bacterial population either spontaneously or by design. ABDs have been constructed to treat staphylococcal infections and can be considered alternatives or adjuncts to conventional antibiotics. Implicit in their design and construction is applicability to a wide variety of other pathogenic bacteria.
[0053] With respect to designing and constructing the genetic content of ABDs of this disclosure, the invention includes all modifications that are described herein, and those that are depicted in the figures.
[0054] In an example, a plasmid of Figure 2 comprises the sequence (with the described identity thresholds) or consists of the sequence:
[0055] Plasmid of Fig. 2 sequence tttcttctatcattatataatttttaataatggtaaccatgttttctctttgttttggatcgtcttcgcaaatgaaaattttcatacattcacatccttat ggctagttgttaataatttcaactttttgaataaagaaaccattttcgataattgtatctaataagacattgtctgcattatcagcaatttcttttaa agttgatagacctaaaccacgaccttcacctttagtagaaaaactttcttggaacaattcatgaatgcgtggtatatcatcagcgcatttatt cataacaataaacgttactgaattttcactttcaataaatgcaacgcgaatgatagggtcatcaatttcagttgatgcctcaattgcattatca agaataataccaatactgcgacttaaatcgatcatattcaagttaatgctacttacttcatcgggtatttcgatactaatcggaatattcatttc ttgtgcacgtaaaattttcgcagtaattaagcctttaatttcacgtactttaagattctcgataccatttaattttatagcattcatttgtaaattgt ctttcataggtacaatatttttattgaaataatcacgtaggccaggcatgtcatcttctcgaatgtattctgaaagtgtcgttaagatattgaca taatcatgacggaacttgcgcatttcgttgttgatagcttcaatcttcaatgtatattcataataggtttcaatttcttcttgattacgtttatatttc atctctttaaggagaaattgagaaataacaaatgttaatatacttaaaaatatagtgataccaataaaaataaaagaatactgccttattactt tagcttcatccgagtttatttgtgaataaaagaaaaataatgaaaaagtaagcagtaagatagtcgaaataactattaaaaatcctttgttta gtattagatatggtgtgctaatttttttgagaactctatttattatatatgagaatagtatactaatagtcacataaactacaaaaaagctaggg aatattacaaatatactatcagaaattttggtgatatatgcatatataactatatacatgtagttagcacagtatagaataatctgcgaagtcat aatcaacaaaatagaataccatttgattttgacaaaatacattataataataaatgaagttaatatgattaaggacgcgctatcaaacatttta aatagaaataacgataatgtcgaaattactatgatgaaaaaataatcaagtttactgtacttaataccactaattatagctggtattgtaaaca ttaatatcatttgagttaatacgaataaaacaaaattataactatttaataattccacctactatcacactctctatttaaattattcgtgtaattgt gttaattcttttggtacttcaacttcatccattatgaagtcacaagtactataagctgcgatgttaccaatgttttttaaaatcccagtaataaaa tcaaaaaataagttaaataatgtattcattttaagtcctccttaataaagaaaataggtaataatgtaatagcttctattatgatgcctaattgaa tgaattgggcaaatggctctttgatgataagtgtgataatgaaaagggttaaactaacaataatcgcataatatttttttcgtttaataagtcg cacaggaatgggcttctttttagttgctgcaggagcatatactgagattacacctaaagaaataactgttaaaataatcataattaaaaagtt aatatgaaaatttactattactaaaggtaaaagtataaatagtataatactttctacataacaccaaaaagaagaaggtgcatgtgcaccat gtgcatgtcttcttattaaataaaatgttaaattcgtaattaacgtaaacagaaaaatgtttaaaatataggcaatagtatacataacaattaat ttacctatatttttagctaagacctgcatccctaatcgtacttgcaaaaattgaatatgatctaagttatttctcttttgaagatacgtggcaaac tggtcaattttattatcaaaataattcaattttacaccactctcctcactgtcattatacgatttagtacaatcttttatcattatattgcctaactgt aggaaataaatacttaactgttaaatgtaatttgtatttaatattttaacataaaaaaatttacagttaagaataaaaaacgactagttaagaaa aattggaaaataaatgcttttagcatgttttaatataactagatcacagagatgtgatggaaaatagttgatgagttgtttaattttaagaatttt tatcttaattaaggaaggagtgatttcaatggcacaagatatcatttcaacaatcggtgacttagtaaaatggattatcgacacagtgaaca aattcactaaaaaataagatgaataattaattactttcattgtaaatttgttatcttcgtatagtactaaaagtatgagttattaagccatcccaa cttaataaccatgtaaaattagcaagtgagtaacatttgctagtagagttagtttccttggactcagtgctatgtatttttcttaattatcattaca gataattatttctagcatgtaagctatcgtaaacaacatcgatttatcattatttgataaataaaatttttttcataattaataacatccccaaaaa tagattgaaaaaataactgtaaaacattcccttaataataagtatggtcgtgagcccctcccaagctcgcggccttttttgtaatgaagaag ggatgagttaatcatcattatgagacccgccgttaaaatatatgaataagtctaatgttggaaaaggtcaaaaaattaatcaatttaattaag aaaatcattcatttgcaaagggcgaaatgggttcttactgagttatctattataaaaaaataaacatagacttatgaaaaatctctcataaatc tatgtttagtcatgacatgtgttaaatattatttcgggcgcttcttatttatacaaatctaatttaatacttttaaatacaggtatattttcgcgttgc tgttctacttcatttaagtttaaatctacagtcaaaatatctgcggattcatttaattctccaactaaatctccatttgggtttataactatcgaat gaccagcatattctgtgttaccatcgaatccagtgctattagttccaatgacaaacatattattttcaattgcacgtgcctttagtaatgaatg ccaatgttgaagacgtgacataggccattgcgccacataaaatgcaattttagcaccactacgagcaggatatcttaataattctggaaa acgtaaatcataacagataagttgggtcacataagtaccgtcagacaattgaaagggttcagctacgtattcgccagcggttaaaaattc atgctctcttaacataggaactaaatgaactttgtcgtattcattaatcagctggccacttttattcacactaaaagctgtattaaatatttgatt gtttctaatgttagaaactgacccagctacgatatcgactttatatttttcagctaaatgtttaataaatgaaaaactttgtcctagattattatct gctttttcatttaaatgctctaaatcatagccattattccacatttcaggtaaaacgactacatctacttcagcattcatatttttttcgaaccatt gcgttatttgagtttcatttttagaactatctccaaaaacaatcggtaattgataaatttggactttcataacatcacatccttgatagatcttata tataacttactaaaagttatgttgaaacgcaaaaaacgagcacaagacataaaatcaaagtcctaggctctacaaagttatattgacagta gttgatggggccccaacatagagaaattggaacaccaatttctacagacaatgcaagttggggtgggctctaacataaagaaatactttt tctttagaaattagtatttcttatacatgagttttactcatgtattcctattcttaagtgcacattagcagcggctaatgtgtaagaactactacat aatgaataactaatgattctttatcatttctgtcccattcctaacaatatattgattatttttttattacgaaacgatcttccactggattaaatgtttt ttcgccagcagcttcacgaatatcaccaaatggcatttgagcaataagtttccaacttttaggaatattaaattcatttgaagtcatctcatca acaagtggattatagtgttgtaatgaagcacctatgcctttagtagctaatgcagtccaaattgcaaattgatgcatggcatttgtttgagtt gaccatattgcaaaattatcatagtagtttggcatttgttcttgtaaaccacttacaacatcttgatcttcataaaacaaaattgtaccgtatga atgtttgaagttatcaattttttgttcagttggctcgaaatcacgattctctcccatgacttcttttaaaattgcttttgtgttatcccaaaatttatt attgttgtcatttaacaagagaacaattctagttgattgagaattaaatgatgaaggaacatgtttaactgcatgtgcaatcattgattctaatt cgtcatcgctaattgatatcgaatctttcaaattatatattgaacgtctttcttccattgcattgtcaaaagtcattgcttttttatcttttttaaataa gcccataattattgctccttctttagtaaagaatacttaatagactaagtataaaatttatactcgtacttgtaaagcaatatttacgaaaatttc aagaatattaatattcattttcaaattccaaatataaatgcattttcaacgcatatttattatacttagattaatacttacatgaaaaagggaggt gtctcgtgaaatgtcatatcattggtttaagaaaatgttactttcaacaagtattttaattttaagtagtagtagtttagggcttgcaacgcaca cagttgaagcaaaggataacttaaatggagaaaaaccaactactaatttgaatcataatataacttcaccatcagtaaatagtgaaatgaa taataatgagactgggacacctcacgaatcaaatcaaacgggtaatgaaggaacaggttcgaatagtcgtgatgctaatcctgattcga ataatgtgaagccagactcaaacaaccaaaacccaagtacagattcaaaaccagacccaaataaccaaaactcaagtccgaatcctaa accagatccagataacccgaaaccaaaaccggatccaaaaccagacccagataaaccaaagccaaatccggatccaaaaccagat ccagataacccgaaaccaaatccagatccaaaaccagacccagataaaccaaagccaaatccggatccaaaaccagatccagataa accaaagccaaatccgaatccaaaaccagaccctaataagccaaatcctaacccgtcaccagatcccgatcaacctggggattccaat cattctggtggctcgaaaaatggggggacatggaacccaaatgcttcagatggatctaatcaaggtcaatggcaaccaaatgggaatc aaggaaactcacaaaatcctactggtaatgattttgtatcccaacgatttttagccttggcaaatggggcttacaagtataatccgtatatttt aaatcaaattaataagttgggcaaagattatggagaagttactgatgaagacatttataatattattcgaaaacaaaatttcagcggaaatg catatttaaatggattacaacagcaatcgaattactttagattccaatatttcaatccattgaaatcagaaaggtactatcgtaatttagatga acaagtactcgcattaattactggtgaaattggatcaatgccagatttgaaaaagcccgaagataagccggattcaaaacaacgctcatt tgaaccgcatgaaaaagacgattttacagtagttaaaaaacaagaagataataagaaaagtgcgtcaactgcatatagtaaaagttggc tagcaattgtatgttctatgatggtggtattttcaatcatgctattcttatttgtaaagcgaaataaaaagaaaaataaaaacgaatcacagc gacgataatccgtgtgtgattcgttttttttattatggaataaaaatgtgatatataaaattcgcttgttccgtggcttttttcaaagcctcagga ttaagtaattggaatataacgacaaatccgttttgtaacatatggataataattggaacagcaagccgttttgtccaaacatatgctaatgaa aaaatgacacccataccaaaataaactggaataaatttgaaatcattatgtgctaatgcaaatattaatgaacttactgttgtagcaataata aatgccacgatacgattacctttaatcgcattaaataattctccaaagattacttttctgaatacatattcttctaataaaggaccaataataga tacaaagaagataaatataggtatttttcgagcaataataattagcttttctgtattaggacttacttgttgtccaccataaatttgcgttaatac aatgctcactaccatttgataaatcattaccaatgcaaatccaagcaatgcccatggaatgatatattttttaggttctttaacttctaattctaa ttttgttggatttttaatttttaaattaattaaaataatcgtcgtggcggcgattaaaaatagaacaagttgtatgtaaatgactgctttagtcagt tctatgccactatattgtacaaatggtaatttttttacaatgagaagcggtaaaaattgagacaatatataaataataacagttagcaatgatg cccataatcttgtcataattttcctccaaatatttgtttataatttattttatcgtaaataacttgaagttacaaaacttaattaaaaggttatgactt gaaattttgaccaaatttgattattataaatgtatgttagcactctttaatgttaagtgctaaactttaggttttttaaggaggaacaatcatgct aaaaccaattggaaatcgtgtgattattgagaaaaaagaacaagaacaaacaactaaaagtggtattgttttaactgatagtgctaaaga aaaatcaaacgaaggcgttatcgttgcagtaggaactggacgcctattaaatgatggtacaagagtgactcctgaagtgaaagaaggg gaccgtgtcgtgttccaacaatatgctggtacagaagttaaacgagataatgaaacatatctggtattaaatgaagaagatattttagcag ttattgaataatacagaacttaattcataaataaattaaatagaacgaaaatgaaacacaactaaacaaatggaggtttatcatttatggtta aacaattgaaattctctgaagatgcacgtcaagcaatgttacgtggtgttgaccaacttgcaaatgcagttaaagtaacgattggtcctaa aggacgtaatgttgtattagataaagagtttacagcacctttaattacgaatgatggtgtgacgattgctaaagaaatcgaattagaagatc catatgaaaatatgggggctaaactagttcaagaagtcgcaaataagacaaatgaaattgctggtgacggtacgacaactgcaacagt attagctcaagcaatgattcaagaaggcttgaaaaatgttacaagtggtgcgaacccagttggtttacgacaaggtatcgacaaagcag ttaaagttgctgttgaagcgttacatgaaaattctcaaaaagttgaaaataaaaatgaaattgcgcaagtaggtgcgatttcagcagcaga tgaagaaattggacgttatatttctgaagctatggaaaaagtaggtaacgatggtgtcattacaattgaagaatcaaatggactaaacact gaactagaagtggttgaaggtatgcaatttgatcgtggttatcaatcaccgtatatggttactgattcagataaaatggttgctgaattagaa cgcccatactttttagtaacagataagaaaatctcgtctttccaagatatcttacctttattagaacaagtggttcaatctaatcgtccaatctt aattgtagctgatgaagttgaaggcgatgcattaacaaatatcgtgctaaaccgtatgcgtggcacatttacagctgttgcagtaaaagc acctggttttggtgatcgtagaaaagcgatgcttgaagatttagctattttaactggtgcgcaagtgattactgatgatttaggcttagattta aaagatgcatcaattgatatgttaggtactgcaagtaaagtagaagtaactaaagataataccactgttgttgatggtgacggtgacgaa aacagcattgatgcacgtgttagccaattgaaatctcaaattgaagaaactgaatctgactttgatcgtgaaaaattacaagagcgcttag ctaaattagcaggtggtgttgcagttatcaaagtaggtgcagcaagtgaaacagagcttaaagaacgtaaattacgtattgaagatgcat taaattctacacgtgcagcagttgaagaaggtattgttgcaggtggtggtactgcattagtaaatgtttaccaaaaagtaagtgaaattga agctgaaggtgacattgaaacaggtgtaaatattgtacttaaagcattaactgcaccagttcgtcaaattgctgaaaatgcaggattagaa ggttctgttattgtagaacgtttgaaaaacgcagagccgggtgttggttttaacgctgctacaaacgagtgggttaatatgttagaagaag gtatcgttgatccaactaaagtaacacgctcagcattacaacatgctgcaagtgttgcagcaatgttcttaacgactgaagcggttgtagc atcaattccagaaaaaaataatgaccaacctaacatgggtggcatgccaggaatgatgtaaaacGACTGTTAAACGCCG ATTTTATAACGTTTGTAATATTGGGTGGTCATAATTTGGTCATAGAAATTTTAAAA TAAATCTTTTGAGACGTTTTCCATGAGTTTACTAAACTTTTGAGAAGCGTCTTTTT TGTATGAGTTCGTAATCTTAGCGTAGATGTTCATAGTGGTATTTATATCTTTATGG CGCAAGCGTTCTTGTATTTCCTTAATATGCACACCAGCCTCTATAAGTAACGCAC AATGAGTATGACGAAATGAATGAGTGCTTATTTGTTTATTAGTTATGTCAGTCTTT TTAAGTATAGCTTTTATCCATAATTGTAGTTTTTTAATTACAAGAGGGTAGCCGTT AACATCAGTAAAAACGAAATTATTATCTACATACAATTCGTTTTTCCATGTGTCCT GCACGTCGGTTTTATAATTTTTAAGTAATTTAATCACATGAGGATCCACTGAAAT TTTTCCGATTGAGCTTTCAGTTTTTGGTGTAAGTATTTGAAATTGCTTTTTATTGTT ATTCGGATTGTAATAAGTCTTTGTAATATTGATTGTGTTATTCTCAAAGTCTATAT CAGACCATTTCAATGCCAATAATTCACCTGCACGCATGCCTGTATATGCTAATGT ACAAAACACCTCAAAGCTGTTTTGGGGTGAATGGTGATTTTTAGCAACCTCCAGG AATTGAAATAATTCATCTTTTTCAAGAAACTTTTTATGTATCTCAGTATCTTCTAA TTCTTCCACACTAATTTTCTTTTTAGGTCGTTTAATACCCTCGCTAGGCATTATTCT TATTAATTTCATATCGTATGCGTACTTAAATATCATATTTGTAGAGGCTATAATGC TATCAACATAATTCTTGCTATACTGTGCGCTTATATCGTTTACAAAACGTTGATAT TCATGTTTATTGATAGTTTGTATTGGTTTATTGTTAAAGCGTTCTATGGCGTGGTT TATGGCTTTCTCGCGTGCTCTGACACTACTTACTTTTACTTCGTTAGCATATTGTG ATATCCAATCGTCAGCAACCTGTTTAAATGTAGATGTGGACGGTGCGATATAATC GCCATTTCTTAACTGACGCTCAACCATTTCAGCGTGATGTTTAGCGTCTGATTTGC GTTTAAAACCTGAGTTTGAAATATATTTATATTTGCCCGTTTCTGCGTCTTTTCCT AGTGATATACGATAGCGCCATGTATTTCCGCGTTTTTCATAACTTGCCATTTGATC ACCTCGATTAATATTCTTTAAAAATATCACTAGATAAACGGCTATCAGTTTGTAA AATTTCTTTATGTAGAGTCGTACTTTTTTCGCCTTTATTTGGAAAAAGCTCTTCAA TATCGTCTATATTTTTTACTATTATTTCAGAAACATACCCACTTAACTTTTGGTTAATTTTTTTAAATAACAAGTTTTTAAGGCCTGCAGATAAACTATCAACGTATTTTTTTAATCCGATATTTTCATCTTCATTTTTAATCGTGAAAATAAATCTATGTTGTGAAT TAGTTATCTTTTCAGTTTCTTTATATGAGACGTCTAAGTCAAAATTTAATTTTTGC CTATTATCTAATTCGACGTCTACTAAAATTTCAAAGTCAAAATTTTCAATCGAAA AAGCGTGAGTAATGTTTGCAGTTACTTCAAATCCCTCGAAAACATCATTAATTTT ATAATTCGGTTCTTCATCAAAAGTAAAGTCAAAATTGATCGGATTATGTTCAAAA AATTCTGAAGGAGATATGTGCAGATAACTACATAATTTATCTATAGCATCATATC TTATCATTTCAGAATCATTTTGTGCCATTGAAGTAAGTGAACTTCTTGCTATTTTT ACATCTTTTGCAACACGAGATATTTTTAGTCCTCTTTCTGACAGTAGTTCAGACAA TCTATTTCTAATCATTACAAACCTCCTAATTATGTTAATAATAGCATTTTTTTGGA CGTTTATGTACAAAAAAATAAAAAATGATTGAGAAGTCAGTCGAAAAACTATTG CAAAAGAAAAACGATTATGTATAATAAAGTTATAAATTGATTGAGAAGTCAGTC AAAAACGAAGGAGGATTTTAATTATGACTATTTTAGCGAATACTAGAAAGTTTAA AGAAGCCATGTTCTTAAAAGGCTTTAATTTATCTGATTTATCACGTGAAACAGGT GTTGGAATTTCTTATTTAAGCCAAATTATTAATGGTAAAAAGATTCCAAGCCCTA AATTAGCTAAGAAAATGGCAGAAGTTTTACAAGTTGAGGTAAATGAATTATTTG AATTTGAAGTAAAGGAGGCATAAACCAATGTTCAACATTAATATTGATGAAGAT GAAGCACGTGAGTTACTTGAGCAGGCTATCAATGCACGTGTGGACGAATTAGCG AAAGAGAAATATTTTATGACTTACAAAGAGTTGTCTAACTATCTGAATTTAAGTA AGCCTACTATTGAAGAATTACTTATTAATAATGGCATGAAATATTATATGGTCGG ATCTACGTACAGATTCAAAAAGTCTGATGTAGATGAATTCATGGAACAGCTTACT GCTCATATGAATATCCAGAATAACGACTTTAAACAAGTCAATATCAAAAAGTTAT TGGAGGCAAGGCAATGAAAATCTACTTAACTTATATCTGCTTAGTTTCATTGTTA ACAATATTATTACTAGCAATATCTAACATGTATGTTGCTTTTAGCGTTTATGCTTG GCTAATAACTTTAGGATGTAATTTAACAGGAGAGATTACAACGTGCGAAAACAA GTGATTATTACAAAAACAGTAGTTGGCTGGTACAACATTAAAGATACTCAACATA ATTTAATGTTAAATATACCGCCAAAAGTATTTGAACAGTACTTTCCTGATGTTAG TAAAGATGTTCAAGTTGTGTGTTTAGAAATGGATTTATCAAAAATTACAGAAATT AAAAATAAGAAAAAAGTAGGTAGTTAAGATGGGAATCAAACAAAAATATCAATT ATCAAAAGTGGTTAAAATATTAGAAGTAGTATTATACGAGGAAGATAAGTTTCA ATCCGATAAGGACTATCATTATCAGGATAAAGCATTATATGAATATGCTTTAAAG TTAGTTCATAATGGATTGTTCAATATTCTTGCTGAATTAGATTTTGAAGATGAAGC ATTTTTAATTCTTGATGAAGTAACAATGACGCTAAGTGATGTCATGAAAGAAACA CAACACGTTTACCGTTATAGTGTCATAGATGAAAAAGGTGAACACAAACATACA ACAGATCGCAAAGGACACGTGATTGGAATGTTAGAGTGGGCATTAGATTACATT GCGGGAAATATTGAAGTGGAGGAATTATAAATGAATTGGGAAATTAAAGATTTA ATGTGTGATATTGAAGCGGTAAAAGAAAAAATCAATGATGTAGCTATCAAACAT GCTTGGTTTGTTGAAGATAGATTTGTAAAAAATGAATTAGAAACAAAACGGGAA CATATTAATTTTTCTGCTAGCTATTTAGAACATCGTATACAAAATGAACATACAG TTGAGTTATTACATGTGTACTTAAAAGAATTCGGTGAACTTATACAAAAATTTCA TGAAATAGAAAAAGCATCATCTGAGAACTTTGGCGAGGTATCAGATGACGCACA AAAATTAAAAATCACAGAGTAATTTAGAAATTACACATGTTTATTATAACATTTT TTACTCTGTGAATCACTAGAGGTGCAAAAAATGAATGAAATTAAATTAGAATAT GACACACATGTTTCAGTGGTACATTATGAAAGTTTAGACTCACGTTCATTTAATA GCTTTTCAAAAATTAATTGGAGTAAGTTGGTTAATAAACTGTCTGTACCTATAGA AGCAAATTATAAGTATGCACGTGGTGTTGCTGTTTACGGTGATATTAAAAACGGT GCAAATGATCAAGGTGAAATTATCAAAAAGCATCGAAACGATAAAAATGTCATA TACAGAGATGTGATTGTACTTGATTATGATGAAATAAATGATTTAAAGCAATTAC ATGAAGCAATCAGCTCAGCTTTAAGCAATGTTGCATGGTTTTGGCACACAAGTTA CTCGCACAGAACTGAACAAGCTAGAATACGCCTGTATATCCCTCTAAATGAGCG AATAAGTGCAGATGATTATCGTAAATATACAAAAGTATTAGCAAATAAAATTGG CCATAAAGTGGATGAAGGTTCATATCAGCCAAGTAGATGTTTTGCGTTACCAGTT ATTCAAAAAGGACACATATTTATTAAGCGAGTGAATGACTGTCCAATTATGAATG TTGATATGCTCGAACAGTGGTCGAAGGAGTTTGAACAATCAAATGCTAGTCCTAA TGTCATAGGATACACTCGACGCGATAGTGAGTACTGGCGCGAGCTATGCTTTGGA ACAACCGAAGGCAATCGTAACAATGCACTAGCTAGCTTAATTGGGCATTTATTAA GATGTCACGTTAATGATTATATTGTTTATTCATTTGCTTTACTATGGGGGCAATTC GCATGTAAACCACCTATGAAAGAACAAGAAATCAACGCCACTTTTCAATCGATA TTAAATAAACACTATAACAATTAGAAAGGGGCTTTGTATGGAAACAGGTAAAAG TGATGTACTTGATAAAATTGAAAAAATTAATAAAAAAGATAGTGCCTTACAAGA AATTATACCAAAAGGTTATGAAATTGAACATCATCAATGCGGTATTGCCTTAAAT CAACTTATACCAAGTAAAAAAGAAGGCGAGCCAGATAAAAAGGTTTTTATCACA AGTACAATCCCTCAAATCACTGAACGCTTTGAAGATATTGAGAGTAACGAAGTC AGCTTTAATATGCTTTTCTATGACAATAAAACGCCAGTAAATATAGCTGTGAGTG CCGAAGAAATTTCAGATAGTCGTCAACTCTTGAAATTGGTTAATAAAAAGCTGGA TGTAACATCGTCGACATCTACTAAACTTGTTGATTATATTAATGCATCTAAACGG TATAATCCACCATTGAATGTTAAAGTTGCAACGCGTTTGGGGCATGTGAAAGGTT ATTTTATTTATCCTTATCAAGAAGTGATGAAAGACAGCAATATCAAGTTGTTTAG TAATGATAAAGGATTTCAAAAGTTAATAGACTCTTTTCAAAGCAAAGGAACATTA GAAGGTTACTCTAAAAAAGTGTTCGGTCAAATAAAAGATCTACCAATGGTAATG GTTATGTTATATGCCTCTTTAGGTTCGGTTTTATTAAGAGAATTTGGATTACAGCC CTTTATTGTAGAAATATCAGGTAGTACATCTACAGGTAAAACATTCACACTCAAC TTAGTATCAAGTGTTTGGGGAACGAGCGACCTTATCACGACATGGAGTTCTACTC AAAATAGTATTGAATCGATGGCATCATTTTTGAACTCATTTCCAATGTTTAAAGA TGATACACGTAATACACATCCTAAGTTTGTTACCAGTGCCACATATAACTTTTCTA GTGGTGAAAGTAAATCAAGAAGTAATATTAATTTAACACTAAACGCTAAAAAAG AATGGCGAAATATTTTAATTTCTACTGGTGAATCATCTATCGCAAATATGGCTGA TGAAAAAGCGGGTGTATCAGCACGTGTAGTTACACTACAAGATCCACCATATCC AGATAATTTTGATTTTACCACATTAGACAAATCGTTTAGGGAGAACTATGGAACG TTAGGGTTGGCATTTATTAAACAATATGAGTCTAAAAAAGACGTGTATAAGAAC GCTTTTGAGAGCTATCAACGGTATTTTAATCAAAAAGGTAGTAATGAAATCATGC AACGTTTAGGACGTGCCTTTGCGTTACTACAAGTTACCGGTGAGGTTTTGAATGA TATTGATGGGTTTGAACATGACCATTTTAAAATTATCGAACAAGCCTATGACAGC ATGGTTAAAAACAATAAGACGATTGATAAACCTAAGCAACTGTTAGAGGAACTA TTACAATATTTAGATGCAAATAGAAATAATATCGCTGGTGATGGCTATAGTTCAG TCAAAAATGGTGACATCAAAGCTATATATAAACGTGATTATTTATGTATATTAGG TCAAACTGTACACGATAAATTAGGTCATGAAATGCAGACTATAACAGGTCAATG GGGCAAAAAAGGATATTTAATTAAAGGTGAAAAAGATCGCTTGCAAAAAAAGGT GAGTCACAAAAACATTAAGTATAGAGGATTTGCTATAAACAAAGAAATGCTTGA AGAATTAGGATTTGATTTCTCGAATTCTCATAATCCTTATTCAGATTATTAAATAG TTCCCAAAGTTCCCGATAAGTTCCCGCGAAAAACATACAAACGGGAACTATAAG ACTACTTTAACCACAAGCAATTAAAGTTAATAGTTCCCGAAGTTCCCAATAAATA ATATTATTATTTATTATTTGAAAACGAACAAATGTTGTTAGCTTTATACCATATAT GATAGAAAATTTTTAACGGGTACAACGGGAACTAAGTTTATTTAAAGTTTATATA TCAATGGTTTGACTAGTTCCCGATAAGTATTTTAAGTCGGGAATTCAACGGGGAC TAGTTCCCATTTAAAAATATTGGAGGTAACACATGGATAAAGAGCAACTTAAAA AGTATATATACGATTATGTAAAAGAATATAAGGAGATACCGATATATCAGTTAG AAGATTTGTTTAAAGAAATGAATCACGACTATATAGGGAGAACCAGTGTCACAC ACGATAAGGATGAGAATATTGTGTTTTGGAGTGGATGGAACAAAATTACAATGT TTGCGCTGATTGAATTAGTTAAAAGTGAACAACTTGATTTAGTGTATAGAGGTAG TTTTGTAATGCGTTATTTGTTGGATGGTAGAGTTCCTAACTTACCATTAGCAATTT GTTATCCAGAAGATGGACAACAAACGGACGTGCCCTCATGGGTGCCTATGGTATT AAGAATAAATAAAGAGGAGAAAATCAAATGAACATAGAAACTATCGTAAACCA ATTTGAAACACGAGCAGGCACGTTACTAAGGTACTACACAGGATTATTAGAACA TAGTAAAGTGCAACCATGTTGCTTTAAGTTATACAATGATCCATTTGATATGGCA TACGTGATGATGAATGGGAAGTTATTCGGTCATGTATATATTAAAGATTGTAAAG TAAGGCAATCATTTGAATTAGCGTCACCTAAGCACACTGAGGGGCTTATAAGAA GTATAGAAGGTCATTATGTAGGTTATGAATTACATGACGGTAAACAGCTTTCTAT TAGTGATATGATGGCCAGTCAATTATTTGAAGATGAGTATTTTATGTATGGATTA CAAACATATGCAGAATCAAATAATAGTGATGTGTTTGAGTACCTAGAAAATGGA TTTGATACCGATACACTTGAGGGCATTCAATCGAGTAATACTGATGTGATAGCGA ATATTGAAATGTTGTATCAGTTAGCTACAGGAATCAATGAACCAGCACCAGAGTT AGTTGAGGGGTTGAGATTAGTAACTGAGTTTGTACAAGATGAGAATGCGACACA AGAGGATTACAAGGCTTTAGAGCATAAGTTAACTGAGTTGAAGTCATCTTATTAC AGTTTGAATAAGTAATTAAATATGGAGTCTCACGTGGTGTGTGGCTCCTAATATA AAAGTATAAGGTATAGAAGTTTTAAAATGTAAAGGTTGCAACAATAGTGAGTTA ATAGATAGGTAGGCGAAATTCAAAAAAGTGTGAAATGTTGATATTGAGCTGTTTT ATGGCTTTGAAAATAATAAGGTTATATAAAGGTGTTAGCTTTTAACATCGGAAGG TATACAGTCTTTGAGAATTGAAAAAATGGCAAGATTTGTGCAAGGTGTGAGAAC TTTGTTAACGCTAATACAAGCTAAAGTTTGTGTTTTTGGCATAGGCCTAAAAGTT AAGTTTGTTCGCTGTTTGTTCGTGTTATTTTATCGAACTTAAGTTCTATATTAGGTT AATGTGAAAAGCCTAACGTTAAGTTTATAACATGATTTTATAAGTGTTATATATG ATAAGCTAAACAATTGATAAAACGCGCTATAAAGCGAACGTAAGTTTGTTTTAG ACCTGTAAAAATGGTATAATTTAGGTATGAAATAATTAAAAGAAAGAGGTGTAG AAATGCAAAGTATCAATTTAGCTAAGCAAAACAGGATTATTAAATAGCAATGAT TGCCTATCCAATTCGGGTAGGCTCTGTTTATAGGGGTGAATAAATGAAACTGCTT AAAACGAAGAATTGTTTATATTATCGTAATGGCGACAATAAACTATCTGAGTATC AACTATTAACGCAATTTAACCCAGCATTTATTAATAAAAAAATTAAGATGTGTGA ATTCCAAATTGAAAGTATGTACCATATGAGTGCGTCGACCACAACATGTGATGAA ATAATGGGGGTCGTGTCTGTCTCATATCCGATTGAAAAATTAGTTATCAAAATTA TTGAAACAAAAGCAGGGTTACAAAACTATAAAAATAGATCTATAAATAATATGG CGTTGTTGAAAAAGGTACTAAATCATTATACAGAAAAAGAGCAGAAGCAAGTTG TAAAATATATGCGTTCAAATGGACGATATAAGCCTTACAACGTCATTGAACGCTT ACAAGTTGATTTGTATCAAGCAAGTATTAAACAACGTTCAGAACGTCAAAAACA AAGAAATACAGCAATTGAAAACAGTAAGATTGCACGAGTAAATGCATATCACCA ATCTTCATATGTAAAAGTGGTGTAACAATGGATAAAAAGCAAATAAAAGACTTC GTTTGTGATTATCATAAGCGAACTAGAAGTGATGTGTTGATAGATGATGAAATAA ATACCGATGAATTCTTTTCAATAGGTGATGAAAATTCTAATGAATGGATGGCAGA CGATAACATTGATGATCATATTGTAAAGAATCACTTAGAAATGATTGTTGACCAA GTAGCTAATGACAAAGAGTTTTATATTTTCGATTCTTTAATACAAGGACGTAGTT TTAAAGATATTAGCAATGTCTTAGAGTGTTCAGAACAATCTGTAAGATTATGGTA TGAAACCTTATTAGATAAAATTGTGGAGGTGATAGAATGAGTGAGTTAACGGCA AAACAAGCGCGTTTTGTGAATGAGTATATAAGAACACTTAATGTAACACAAAGT GCCATAAAAGCAGGCTATAGCGCAAATAGTGCACATGTGACAGGATGTAGGTTA TTAAAGAAGCCACACATCAAGCAATATATACAAGAACAAAAAGATAAGATTATA GATGAGAATGTATTAACCGCAAAAGAGTTACTACATGTGCTTACGAATGCGGCA GTCGGTGATGAGACAGAAACGAAAGAAGTTGTAGTCAAGCGAGGGGAATATAA AGAGAATCCACAAAGTGGCAAAGTACAGCTAGTCTATAACGAACATGTTGAACT GATAGAGGTACCAATAAAACCTAGTGATCGTTTAAAAGCTCGTGATATGTTGGGT AAATACCATAAGTTATTTACAGATAAGCATGATATTAACGGGAATGTGCCTATAT TCATTAATATTGGTGAATGGGATGGCGATGATGAAGATTTAGATAAGACGGTAC AAGAGGTATCTAACGCTAATCCTAATCATACTGTGATTGTGGATGATATACCGTT AGAGGATTGATTACAGTAAAAACGATTATCATATTGAGTTAGTGAGGATTAGTTT ACTAATTCACCCTAGCTTTATATTAAAGCGTTATAAAGATAAAAGGGAGAACGCT TATTATAATTAACGGACTCCCTTTATTAATAATTATTACAGAAAAAGTGGTAAAG CACTTATTCAAGTGTATTTTTTAATAAATTATTTTACTTATTGAAATGTATTATTTT CTAATGTCATACCCTGGTCAAAACCGTTCGTTTTTGAGACTAGAATTTTATGCCCT ACTTACTTCTTTTATTTTCATTCAAATATTTGCTTGCATGATGAGTCGAAAATGGT TATAATACACTCAAATAAATATTTGAATGAAGATGGGATGATAATATGAAAAAG AAAGATACTTGTGAAATTTTTTGTTATGACGAAGAAAAGGTTAATCGAATACAAG GGGATTTACAAACAGTTGATATTTCTGGTGTTAGCCAAATTTTAAAGGCTATTGC CGATGAAAATAGAGCAAAAATTACTTACGCTCTGTGTCAGGATGAAGAGTTGTG TGTTTGTGATATAGCAAATATCTTAGGTGTTACGATAGCAAATGCATCTCATCAT TTACGTACGCTTTATAAGCAAGGGGTGGTCAACTTTAGAAAAGAAGGAAAACTA GCTTTATATTCTTTAGGTGATGAACATATCAGGCAGATAATGATGATCGCCCTAG CACATAAGAAAGAAGTGAAGGTCAATGTCTGAACAAAAGGTTAAACTAATGGAA GAAGAAATGAACGTCTATCGGGTCCAAGGATTTACATGTGCAAATTGTGCAGGA AAGTTTGAGAAAAATGTTAAAAAGATTCCAGGCGTTCAGGACGCAAAAGTAAAC TTTGGCGCTTCTAAAATTGATGTATATGGAAATGCATCGGTTGAAGAACTTGAAA AAGCAGGTGCTTTTGAGAATCTAAAAGTATCTCCTGAAAAACTAGCGAATCAAA CGATACAAAGGGTTAAAGATGACACTAAGGCTCATAAAGAAGAGAAAACACCAT TTTATAAAAAACATAGTACATTGCTGTTTGCCACACTACTAATTGCTTTTGGTTAC CTTTCTCACTTTGTAAATGGAGAAGATAACCTCGTAACTTCCATGTTATTTGTAGG TTCTATTGTAATTGGCGGATATTCATTATTTAAAGTCGGTTTTCAAAATTTGATAC GCTTTGATTTCGACATGAAAACCCTGATGACCGTTGCCGTTATTGGAGCTACCAT TATTGGTAAATGGGCAGAGGCATCTATTGTTGTTATTCTCTTTGCAATCAGTGAA GCACTTGAACGCTTCTCTATGGACAGATCAAGACAATCCATACGTTCATTGATGG ATATCGCCCCAAAAGAAGCACTAGTTAGACGAAATGGTCAGGAAATAATAATCC ATGTGGACGATATCGCTGTGGGTGATATCATGATTGTCAAACCAGGGGAGAAAA TTGCCATGGATGGAATCATTGTGAATGGCTTGTCGGCTGTCAATCAGGCAGCTAT AACAGGAGAATCTGTTCCCGTCTCCAAAGCGGTAGATGACGAAGTATTTGCAGG TACGCTTAACGAAGAGGGACTAATTGAAGTAAAAATCACCAAATACGTAGAAGA TACAACCATTACCAAGATTATTCATCTTGTTGAAGAAGCACAAGGGGAGCGTGCT CCAGCCCAAGCATTCGTTGATAAATTTGCGAAATACTACACTCCGATCATTATGG TTATTGCAGCCTTGGTTGCAGTCGTTCCACCCCTATTCTTTGGTGGCAGTTGGGAT ACATGGGTTTATCAAGGATTAGCAGTTCTTGTAGTTGGATGTCCTTGTGCATTAGT TATTTCTACTCCAATCTCGATTGTCTCGGCAATTGGAAATGCAGCGAAAAAAGGT GTGTTGGTTAAAGGTGGTGTCTATCTCGAGAAATTAGGAGCCATTAAGACAGTCG CATTTGATAAAACAGGAACACTGACAAAAGGTGTACCAGTGGTAACAGATTTTG AAGTATTAAATGACCAAGTGGAAGAAAAAGAGCTATTCTCTATCATTACAGCTTT AGAATATCGTTCACAACATCCACTTGCTTCAGCAATAATGAAAAAGGCAGAGCA AGATAATATCCCTTATTCTAATGTACAAGTGGAAGAATTCACTTCGATTACTGGG CGAGGTATAAAAGGGATTGTAAACGGAACTACTTACTATATTGGAAGCCCAAAA CTTTTCAAGGAATTAAATGTTTCCGATTTTAGCCTTGGGTTTGAAAACAATGTGA AAATCCTACAAAACCAAGGAAAAACAGCCATGATTATTGGAACGGAAAAAACA ATTCTCGGCGTAATTGCCGTTGCAGATGAGGTTCGTGAAACAAGTAAAAATGTGA TTCAAAAACTTCATCAGTTAGGTATCAAGCAAACAATTATGCTGACAGGTGATAA TCAAGGTACTGCAAATGCAATCGGTACACATGTAGGCGTTTCTGATATTCAGTCT GAATTGATGCCACAGGATAAATTAGATTATATTAAAAAAATGCAATCGGAGTAT GATAATGTAGCTATGATTGGCGATGGCGTTAATGATGCTCCAGCACTTGCTGCAT CTACTGTTGGAATTGCAATGGGCGGTGCTGGAACGGATACTGCAATTGAAACAG CTGATATTGCATTAATGGGAGATGATTTAAGTAAGCTTCCATTTGCAGTAAGACT CAGTCGAAAAACTTTAAATATCATTAAAGCTAACATCACTTTTGCTATCGGAATT AAAATAATTGCCTTACTATTAGTTATCCCGGGATGGTTAACCCTTTGGATAGCGA TTCTTTCCGATATGGGAGCTACTATTTTGGTAGCATTAAATAGTTTACGACTGATG AGAGTGAAGGATAAATAGGTAGAAAACAGAATAGTAAGGTCACGCTGTGCGCA ATTCAAGGGGGGCTTTTCAATTTGAAGAAAAGTCCTACCCCTAAAATATAAAATA TTGGAGATGGAAAAATGATCGCAACGATACTTACAGCAGCTGCGGTGCGTTTTAT GTTGTTATATAAATATGGTTTCTTATTAAATAAGATGAAATATTCTTTAATATAGA TTTGAATTAAAGTGGAAAGGAGGAGATTGTTATTATAAACTACAAGTGGATATTG TGTCCTATTTGTGGAAATAAAACAAGACTACGAATACGAGTGGATACTATACTTA AAAATTTCCCTTTATACTGCCCCAAATGTAAGAACGAAACTTTAATTAATGTTCA AAAAATGAATATAATAACAATCAAAGAGCCAGACGCCAAGACGCAGAGCCGAT AATTTGAGAAATGAAACTCTCATCTTATCGGCTCTTTTTGTTTATCTGAATTTTAC TGACTAGCCTTCAATATTTCTTGCTTCATTGATACCTTTTGCTAGTGCTTCCATTA AGGATAGTTCTTTGTCTGTAAAGCTATCCATGTATTTTTCTACCTGTAACCTTCGA GTGCTTTTAATCAAATTATCTGTAGGTAAGAAAAATTCATCAATAGATACATGGA GTAATGATACAAGATCCCCTAAGAAGCTTCAACTTTAGGAATGAGAAAAAATTTT TATTTGCTCTAATTATCATATAAGTTTATAAAAAGCGCGCaaagatctattgtgtgactcaacatc attcaaatcattgaacgcctcaatagcttctaatacatctttgtcatcatcttggtattgaattggattgcctaagaaataaccgttaataaaat cgctaatataagatgcgtaatcatgagctacacggttgtctgccatgtactcttctttgcgtcgtgttaactcaactaaattcttagttttacctt cgtaataatcacttaacactttcaatctaggtcgttggtaatccatgtgatgttcaatgtatttacttacttcattaacgttttgtaataaatcgga ttccgtcccgtcatatgtgtaaacaacattggcttcatcattaaataagtaatttatgtttccccgtagatctgtatctgtttcaaattcgtttactt ttaacatttgttccctcctataatcctagagattttattgtgtcaactttcgaactgacatttgtgcgttttctaaccggtctgtagaatcgttcca ctgaataacgcaacgaatcgatacaatgattgtatgtatctactggttcattggtatattcacctgtatctttgtccttttgccatgtgtagttgt caaactcttcaatagtcttgaaacaacgttcatcaacaatgatttcaaattgcattaagaattgtaacccttgtacaaccgagcccttcccttt tttggttggtaaaatccttttaagccctagattccttaattcagctatacttttttgttctgcactatctgctgtaatttcttctttagcataaccaag ttgctttatgacattagctatttcatcattcagcataccttgtttaacatactcttcaatgatgtataacttctttttctttacatctattttagaatgta taaaagcactaggatcattaacgtagccaaagtccaatccaaaataagaaggtaaatgtcttaactcatctttatttattaaacgtttttcata cttagggaaaaccaatttgtctagtgtagaaaattcacctaacgcataaattttgtaatatgctggattacgatttgctaacaactctaagtttt gtcgtgtcatttcatcaagaaacttattatctcgataactagattgtctaatcatgacattttccattggttcaccatgttcaaagaaatacttat aaacccaattcagtttagatactgggttaaacatcaaaaatatttgcttattcacgtgtttacgctccctcaaacgcaacgttaattgcgtgta atcatttagtgtgaattcagacgcttcttccatgactatgtctgatatgccttttatcgactttattttctctgggttatctaatcctttaaacaaaa aaactgcgccgtttggcaattcaactttgttatcagtcttattccaaaggcacatgtcccaaataccgaagtttatcaaacaatctttgacat cttcgaataaactatctttaattgttgattggacttttctaagccatagtatacgcctaggatatttccagtcttgcaatgctttaagtacaacttt ttgtataacgccgtgagacttaccactcgaacctccaccgtaatgtacttcagtgaagttatcgtaattggttagtatttcgaatatgtttctgt tgaaaacattagatggtttgttaaagtttaatttaactttcgtcatcgtactcaccaatattaatctcaatattcttctgagtaatttcttttttgtcg atatacgcaccatgaacttttagtatgtggtcaatagatctctgacgctcttcaaaagttggtgtgattgtgtaagtaacctctttttccacttc atcgtttaaatggtcatatttcttactgtaagcctcttgaggttctcctctagcaatagaagcagataacgctaaagcttctgtaatgctcatta aacgctcttcttgtatctgttctaatcgttctttaatatattccgaaacattaacatttcttaacaatcgacttgctaaagactctgctgttttctta ctataacctgctgaaattgctgcttttttaccattacatccattcattatatattcatctgcgaatctcttttgtttttcgttcatttcatttaccacca actctcgcgctatacgctttttaaaattaaaaaaggattggctataatcagccaacccacatagatcctttattcctaattgcgataagggaa acgcagtaagatagtcaatatcctacactatcataatatctcattttaggtatcaaaaactgccactttactgccaatttcactcttcccctaa ctcttccgccaatctagatatgattttccttttgattctatgagcagttctatcagaaatgtgtaCCTTAATACCTCCTtattttaatt atactctatcaatgatagagtgtcaatattttttttagtttttcatgaactcgaATAAGCATTATATTGCAATGAAAAA GCATTATATGGATAATCATATCTATCATTGCAAATATACTTATAGAGATTTATGT GTGTGATAATTGGTGGTCATAAATTGGTCATAATGAAATAAAAAAACTAAAAAA ATTGAATGCATAAAGAATACACGATGCTGATTTAATAGGATTTTTGTATATGATT T AT ATCT ATTT CAT ACTGCCCTTtgtttatagttttgactaactagaaaattacattatgcacgagtatgattcattctaa gtataaattagaatgcacgcaaatatattttaattacgagacgtcttccatttggtgactaaacttatgggaggcgtcttttttgtatgaatttgt gattttagcatagatattcatagtggtattgatatctttatgccgtaatcgttcttgtatttctttaatgtgtacacctgattctatgagcaatgcg caatgtgtgtatctgaatgagtgcgtagagatatttttgagtatgctggtacgtgacataatggtttgtatccacattgatagttttttcattaca atggttatcattatataattcgtttttccaattattttgaacgtttatcttataatcacgcaacacctttattacatttgggtcaacggaaatcttac cgatagaactttcagttttagggggaagtatctgatatttcttcttgttattatttggattgtaatatgttttagtaatactaatcgtgttgttttcaa aatcaatatcagaccacttcaatgctagtatctcgccagcacgacagccggtatatgcaagtgtgctaaagacttcaaagctagttaacg gggcgatgatgaaataaatactgatgatttctttttaataggtgatgaagattctgacgaattgatgacagacgataatgtcaatgatcatat tataaagaatcacatagaaatgattgttgacagattagcgaccgataaagagttttatatttttgactcccttatacaaggacttagttatcaa gatattagtagtgccttagattgttcagaacaatctgtaatattatggtatgaaaccatattagataaaattgtgggggtgataaaatgagtg agttaactgcaaagcaagcacgttttgtgaatgagtatattagaacactgaatgtaacacaaagtgccataaaagcaggatataacgca aatagcgcacatgtgacagcgtgtaggttattgaaaaagccgcacatcaagcaatatatacaagaacaaaaagataagattatagatga gaatgtattaaccgcaaaagagttattacatgtgctaacgaatgcggcagtcggtgatgaaacagaaacgaaagaagttgtagtcaag cgtggagaatataaagaaaatccacaaagtggcaaagtacaattagtctataatgaacatgttgaactgatagaggtaccaataaaacct agtgatcgtttaaaagctcgtgatatgttgggtaaatatcataaattatttacagataagcatgatataaacggtaatgtacctatattcattaa tattggtgaatgggacggaggtgatgaggggttagataaggcagtgaaagatgtatctaacgataatcctaatcatactgtgattgtgga tgatataccgttagaagattatgagtcaattaggtttttataaattgggtatatattttatggtgttgccagtatttattgatagtatcggttaaga cgatgagaagaatgagtgagatttaaaagagttgtaaacgcaatatcctaatactgattttcatattgatgatttagggaggttttcaggagt aaaagtatgatatttttttcaaattacatcaacatttcagattgattattgtaatatataataaaatgatttaagaaaaagggagaaaaatggat aatataaataaaaatgaaaaatttcgtgttttgtaaacaattgctattactatatcatttattttaaattttgggttgtttatttctctagctatttggt caataaattcgatgggtaataaacaatgcattagtttgaatttattgctttcggatgatactttcgcagtaatttcagtaatgacaactttggga actgctattttaggaggtatagcaccttcaatatatggtatttttacatcgcctatagataaaaaaagtagttttagggctattagcgattggg agcaagaacaaagaaataatgttaaagatctgatgatgctattaccatttacattacttagtattttaattgtgatttttatttttcagtttgcatat tctaaactatttaatacgatagctattataatatttattataatacttgttgttatgttttttttaattttattaatctgttataaaattactgtgaagatat gcagatatttttcaaaagaatagaaatgatttgtttacgctgagaaacgtcctgatttgcagtgagaaatgattttgcgtatctattgtatgta acaataggtacataatatttttagggtgggttatatgagcataattacaagattgtttaataacagtgattttgaaaaattaaatcaactatgta aattatatgatgatctaggttatccaacaaatgagaatgatttaaaaaagagactaaagaaaataacgaatcatgatgattacttcctactg cttttgataaaagaaaataaaataattggtttaagtggtatgtgtaaaatgatgttttacgaaaaaaatgcagagtatatgagaatccttgcg tttgttatacattctgaatttaggaaaaaaggttatggaaagagattattagctgattctgaagaattttctaaacggttgaattgtaaagcaat aacactaaatagtggtaatagaaatgaaagactatctgcacataaactatatagtgataatgggtatgttagcaatacatctgggtttacta aacaactataagtgtgagcattcgtataatacgatgtaggaacatattttattgtaaatgttgcatgtatgcctcgtattatgacttatttaaag ggagaaaaaagggcataattcttcgattgttggagaaatagactagattttcgagattttccaacaataaatcaatgttggaaaacagttttt gagtgacataattatgacataatagaattgaaaaactaaaaataatagcgttgtctaaaaattaaaacgctgatttaataatctttaaagcgt gtattaaagtaagtttttattagtgcattgtatatagttttgactaattagaaaattacattatgaacgagtatgatgtattctaagtacaaattag aatgcacgcaaatatattttaattacgagacgttttccatttggtgactagacttatgggaggcgtcttttttatgtgctaatttgtaattgagat tcataatggtatttaaatcattatggtgcgggagttatggtattgccataatatgagagtgcatccacttctataagtaatgcatattgcgagt gcaggaatgaatgagtgcttgattaaaatccttatgggtggttgacataattaaaagaaaccacatttaaaatttcttaatcacaagcggtt aactaggtatagtttagttttgagtaaatctttttaaaggtgtacttgtgcattttacttaattaaagacataagacatttaatcggcctaaaata aataaaaaactacctgtttaggtagtttttttaatgtaatagattaaaacactagttcatttcttattaaagatggatagttattttatagataaatt tgtcctttagtgtagcggtaatttttaggactttttggtggtataaatgttcttaataaagttaatagtcctactttaccgcaaagcataacgaat ataataattattttagtaataccatgatattctgtggtaaggttcatacttaaccctactgttccgaatgcagaaaccacttcgaataataactt gattaatgatatgttcggattaattatcgataatataaaagtaatgatgctgataaatagaaatgagatattaatggtaacaatagatagtttt atatgtttgtcagatatttctttattgaatactgaaacattattttctttacgtatataatttagtacaaaaataaacgcaactgcaaaagtagtta ttttaattcctccagctgcactgagaggggcaccaccaataaacataagtagcattaacattaatgcggtagatttgttaatgcttgctatat ctatactgttaaaacccgctgttcgtgttgttactgattggaaaaaagaatttccgattttttcaactagtcccatatgttgcatagtattaaact gttctaataaaaagaatgtaatagctcctataattattaggatactagttgtagttaagactaatttagaatgtaaagataatttactcaatttttt acaattaataaagtctatcacgacaaaatgtccaatacctccaaatattatgagtattgagattgtaataatgacaattggatcactagaata atctattaagttattcttaaaaagggcaaatccagcattattaaaagctgatactgatgtgaataagcttaaaaataaacctttgcctatacca aattttggtataaaagataaacacaaacaaatcataccaattaattcagtgactaaactataaatagccaagtgtttaattagcttaataaca ccaccaggttcgtcaatattccatgtaaccataatcaagaatctatttttcattgatatctttctatttaaaaatactagtgtcaatagggttacg gtcacgatacccagaccacctatttgaattaataatagtattactatctcaccaagtatattaaactgtgatcctatatcaactggggacaag ccagtaactgtaaatgcacttgaagctataaatagggcatctaaaaaagatattggctttttaccagtaaaaggtaaatacaataaaagtg cacctatgatagttgtagagaagaaaagcattaaataaaaatataaaggtttgtggactttgttcattttaatttcatactcctttatattataaa ttaataattagataatatcataaatgaaaatagaaatgttactgatgtgtattactaacaggcgttgactaattcttttaatattttataattgaaa atgaatatcaattgaaaaacaaaaggatgatattatgaaaagattaattggaattttattatgtaatttatttattttgactgcgtgttcagcatct gtcgataaaacaagtaactcgacaaagactacagactataaaattgaaaatggtgaaacactgaaagtaccagagaaacctaaaaga gttgctgtattaactggattttatgttggtgattttataaagttaggaatcaaaccaattgctgtttcagatataactaaagattcttcaattttaa aaccttatttaaaaggggttgattatattggagaaaatgatgttgaaagagttgctaaagcaaaaccagatttaattgttgtagatgctatgg ataaaaatataaaaaaataccaaaaaatagcgccaacaatcccatatacatacaataaatacaatcataaagaaatattaaaagaaatag gcaagttgactaataatgaagataaagctaaaaaatggattgaagagtgggacgataaaactagaaaagataaaaaagaaattcaaag taaaattggtcaagcaacagcatctgtgtttgaaccagatgaaaagcaaatatacatatataactctacatggggtcgtggtttggatattg ttcatgatgcattcggtatgccaatgacaaagcaatataaagataaattacaagaagataaaaaaggctatgcttccatttcaaaagaaaa tattagtaaatatgctggtgattatatatttttaagtaaaccttcgtacggaaaatttgattttgaaaaaacacatacatggcagaatattgaag ctgtaaaaaaaggacatgtaatttcatataaagcagaagattattggttcacagatcctattacattagaacatttgagaagtaaattaaaaa aagaaattttaaataaaaaataatagaaataagttgtaaaaattttcttatgcattggtactaatgtttttaaggagtgattaaatgaagcaact ggttggaattcccgaatcaatgttaattcctttgatagctcgagcaaaagagtacgaaaacgaaaaaccaataataaaagacgcactatc aaaaaaaatatttgatggtttagatgatatgtacaaaaatgttacatgtgatgacatgtctcaaattggaattagtatacgtactgtgataata gattgtgttactaagaggcttatcaaggataataaagatttaatcgtggtcaatataggttgtggcttagatacaaggtttcaaagatttaata aagaaaaaatatcatggatagatttagatgtaccagaatcaatagaaatacgaaaaacattttttaaagaaagtaatagttataagatgata tctaaatctatgctagattacagttggattgatgatgtcaaaaattataaattttttaatagtaagtcagatatattgtttattattgaaggtgtatt gatgtattttgatgagagtgtaatgactcaattattggacactattatcaaaaagatgggagatcataatttgacatttgcgattgaattttgct caaaaacaattgcgaataatacaaagagacatcaatcggtatcaaagttatcctcacaacctgtttttaaatatggttacaatgatttaaaaa aattgaatgaaattttaccaaatacaataagagtaatacatgaatataattattttgactattataagaatcgatggggcttatttggatattgt agatttataccttatttaaaaaaaaggttaaacaataaaatagtacttatgaaatataaagttccaaagagacagagacattaagttcttaga caatgtaaaaaagctgatttctataaattatttgatagaaatcagcttttttcaaatgtatttgataatttacagctcgttgagctgctgttttcta gggatttatgtcccattccttttacgagaaggtttttacgagttttatgtaactattagaagctatctttttatatgaccattagtcaatatatgtat gacaaatcagcacaataatttcagttttacatcacttaatcaatgaaaatgtgcttgttgatatttgaatatttacattcaaacaatattcatcgc tatttctatcaacttaaaattcgcaataaaaaactgccagcacgcgaatagggcagctgacagcatcgttcttatttttcttttaaatattgaat ggaagcctctttaaaaatatcaatatatttcagatacatatctttttcaatatattcatcgatttgatgtgccattaatggattacctggtccaaa aatggctaaatcaacattgtccttattatctcctaagaaactagaggcatctgttgcgcctacaagcgctgaaacaaatatttcgtcttgttct acataactagaagctacatctttaatcgtagtaattaatttgctatttttatcgcttgttacaggtcggtgattgcttggaatatcgagtgaaag cttattgctatccacatcattaatgatattttggaaaaacgattctataaagtcgttatcatactcaggaactggtcttacgttaaattcaagtg aagcttcatctggtacagagttaaattgtttgccgccatttataatcgaacatacagctgtaagaccagatgcataatttgcatcctcttcag aaatttcttttccaatcaatgatttgaacataggcgcaacatctaattcatgtttagtatcttgttgtttaagctctgaatatttttctttaaatagat tataaaattcaagcagtgtatcaattgcattgtcaccaataaatggaactgagctatggacagctttaccagttgcagttactttacatgaca tagaccccttatgtgcataataaattccagatccagttggttcagcaataattaagccatcgacatcgtctaaatagcctttatcagctaata atttggcaccttcttgttctttctcttcgccagcagtagccagtaatctaatcgttccatgaggcaattcattttgttcttttaattcgattagaga tacgaccaaagccattaaaccgcctttcatatctgtagtgcctcggccatataatttgccatctttttctgtcagttgaaaagggggatatga ccaattatcttgatttcctgcatcaacaacatccatatgaccactcaatgcgagtataggtgagccgttaccgatttctgcaacgatattgg cgcggtgttcattaactttcaaaatttcagatttaatatcgtacttgtcgaataaatctgttaaataattacaaacgtctatttcattattattttca gtttgtagttcaacaatatctgctagtaattgaattttttctttttcactaaaagttgtcattaagctcacacctttcaaagtagtatatatatttata taaacataatttttattcttaaacataatttaaaatgcagaaagtagtgtgttatttgatttcgttctatgaaattaactgtctagtatcaacgatct tattaacgctgatatcggatatgcttaattttatagtaaattgtatgagaaagatgcaggatattatttagctaataattatatataaatttcaaat cgatggttattaactactaaataaaaatatttgctaaattaatgactttgtacacacattatttttaaagaggataaagtatttaataatattaac aaaatcatttaataaatagttaaatatatattctctgtttttgtgatattattcacatgtcgatacatatcaacaaatatcaatcatacgaaagaa ggttataacaatgaaaaataaaaaacgtgttttaatagcgtcatcattatcatgtgcaattttattgttatcagcagcaacgactcaagcaaa ttcagctcataaagactctcaagaccaaaataagaaagaacatgttgataagtctcaacaaaaagacaaacgtaatgttactaataaaga taaaaattcaacagcaccggatgatattgggaaaaacggtaaaatcacaaaacgaactgaaacagtatatgatgagaaaacaaatata ctccaaaatttacaattcgactttatcgatgatccaacttatgacaagaatgtattacttgttaaaaaacaaggctcaattcattcaaatttaaa gtttgaatctcataaagaagaaaaaaattcaaattggttaaagtatccaagtgagtaccatgtagattttcaagtaaaaagaaatcgtaaaa ctgaaatattagaccaattgccgaaaaataaaatttcaactgcaaaagtagacagtacattttcatatagctcaggtggtaaattcgattca acaaaaggtattggacgaacttcatcaaatagctactccaaaacgattagttataatcagcaaaattatgacacaattgccagcggtaaa aataataactggcatgtacactggtcagttattgcgaatgacttgaagtatggtggagaagtgaaaaatagaaatgatgaattattattcta tagaaatacgagaattgctactgtagaaaaccctgaactaagctttgcttcaaaatatagatacccagcattagtaagaagtggctttaatc cagaatttttaacttatttatctaatgaaaagtcaaatgagaaaacgcaatttgaagtaacatacacacgaaatcaagatattttgaaaaaca gacctggaatacattatgcacctccaattttagaaaaaaataaagatggtcaaagattaattgtcacttatgaagttgattggaaaaataaa acagttaaagtcgttgataaatattctgatgacaataaaccttataaagaaggataatattgaaagggcggattactaatgattaaacaact atgtaaaaatatcacaatttgtacgttagcactatcgactactttcactgtattaccagctacttcatttgcaaagattaattctgaaatcaaac aagtttctgagaagaatcttgatggtgatactaaaatgtatacacgtacagctacaacaagtgatagtcaaaaaaatattactcaaagctta caatttaatttcttaactgaacctaattatgataaagaaacagtatttattaaagcaaaaggtacaattggtagtggtttgagaattttagacc caaatggttattggaatagtacattaagatggcctggatcttattcagtttcaattcaaaatgttgatgacaacaacaatacaaatgtgactg actttgcaccaaaaaatcaggatgaatcaagagaagttaaatatacgtatggttataaaacaggtggagatttttcgattaatcgtggagg cttaactggaaatattacaaaagagagtaattattcagagacgattagttatcaacaaccatcatatcgtacattacttgatcaatctacgtc acataaaggtgtaggttggaaagtagaagcacatttgataaataatatgggacatgaccatacgagacaattaactaatgatagtgataa tagaactaaaagtgaaattttttctttaacacgaaatggaaatttatg (SEQ ID NO:1)
[0056] In an example, the disclosure includes the following, using ABD2023 as an example, wherein numbering does not necessarily specify the order of the steps:
[0057] I. Identify all known Restriction Sites of the Type I, II and III varieties found in S. aureus.
[0058] II. Identify all relevant sites in the ABD.
[0059] III. Modification to eliminate some of all of the identified ABD restriction sites. IV. Delete all unnecessary regions of the ABD backbone - i.e. make the minimum ABD backbone to avoid sites, which could not be altered without compromising the ABD function.
[0060] VI. Streamline the lysostaphin module.
[0061] VII. For restriction sites that cannot be deleted or mutated, they can be designed to be methylated.
[0062] The disclosure includes making the following mutations:
[0063] 1. Sites within coding sequences:
[0064] a. In examples, the coding sequence modifications may comprise only synonymous substitutions. b. Substitutions can be designed based on the optimum codon usage for S.
[0065] aureus (strain NCTC 8325) when a choice was feasible.
[0066] c. For the few restriction sites where no synonymous substitution is available, they may be methylated.
[0067] 2. Sites in non-coding sequences: All substitutions were consistent with a low GC content.
[0068] a. attS 1 site
[0069] This sequence of ABD2023 has identical att sites (similar to the groEL site), although SaPI2 has different att sites, at least in 8325:
[0070] SaPI att sites:
[0071] groEL: ATGCC4GGAATGATGTAAAAC (SEQ ID NO:2) trkH (downstream): ATGCCGGGAATGATGTAAAAC (SEQ ID NO:3)
[0072] To avoid restriction, both sites have been changed to the trkH site.
[0073] b. stl - intergenic - str no sites
[0074] c. ori iterons - no sites within iterons, however, there are sites among them; substitutions may made consistent with low GC content
[0075] d. pac site - no site
[0076] e. Cheo boxes - 1 site was found within the upstream box. To remove the site, the SaPIbovl upstream box, which has no site, it was substituted for the SaPI2 / ABD box.
[0077] f. RBS - 1 site in RBS of terS - the site was not change, but could be by deleting ptiM / A.
[0078] g. Untranslated leader - changes are modeled through Mfold to limit alteration in RNA secondary structure.
[0079] h. Terminator - no sites in inverted repeats, but downstream of CDS before IRs - changes consistent with Mfold.
[0080] i. Sequences between backbone and module arbitrary changes.
[0081] Summary
[0082] 1. Of the 112 Type I sites, all but 5 were eliminated. 4 of the 5 were I #22 sites, 2 in ptiM / A, which may also be deleted, and 1 in ORF4 and 1 in rep. These sites can be methylated. The fifth site is in ORF6 and may be modified by conservative substitution before methylation. 2. Of the 78 Type II sites, all but 4 could be eliminated. 2 are in tetM, which can be replaced and 2 are in the lysostaphin coding region. These are Sau961 (II #10) sites, which can be methylated.
[0083] 3. Of the 15 Type III sites, all could be eliminated.
[0084] Summary of nucleotide changes in the described polynucleotides:
[0085] nucleotide 2047S 2047
[0086] 6 G A
[0087] 77 A T
[0088] 123-5 TGA ACT
[0089] 285-7 TGA GCT
[0090] 342 A
[0091] 462 T
[0092] 468 T
[0093] 471 G
[0094] 474 A
[0095] 598-9 CT
[0096] 702-4 TAA
[0097] 729-31 TAA
[0098] 744 A
[0099] 1051 G
[0100] 1056 T
[0101] 1059 T
[0102] 1111 T
[0103] 1128 T
[0104] 1264 T
[0105] 1342-4 TGA
[0106] 1351 A
[0107] 1417-9 AGA
[0108] 1600 T
[0109] 1738 A
[0110] 1750 T
[0111] 1783 A
[0112] 1855-7 CAA
[0113] 2239 C
[0114] 2391 A
[0115] 2500-2 TTA
[0116] 2505 A
[0117] 2536-7 AG
[0118]
[0119] 2633 TTA 2668 TTA 2836 A 3169 AG 3211 G 3224 T 3235 T 3309 A 3311 a 3316 T 3319 T 3592 T 3673 C 3711 T 3718 T 3913 A 3963 C 4075 T 4081 T 4096 A 4138 G 4255 A 4586 G 4598 A 4808 T 4883 T 4989-91 TTA 4R997 T 5058 T 5075 A 5211 T 5214 G 5253-4 CT 5304-6 CGT 5353-5 AGT 5399 T 5405 T 5414 T 5531 T 5652 A 5667 A 5671-3 AGT
[0120]
[0121] 5697 C 5702 T 5862 C 5875-7 AGA 5970 G 6186 A 6238-40 AGA 6303-5 TTG 6393 T 6597 A 6640 A 6786-8 CGT 6955 T 7000 A 7013 A 7099-7101 TTA 7137 T 7178 C 7207 G 7471-3 TAA 7765 A 7768 A 7779 T 7788 T 8044 T 8056 T 8066 T 8463 T 8470-1 TC 8482 A 8487-9 CGT 8898 T 9003 C 9141 C 9307 C 9535 A 9538 T 9544 T 9558-60 AGA 9583 C 9958 T 10012-4 ACT
[0122]
[0123] 10084 T 10094 T 10186 T 10213 T 10239-41 TGA 10369 A 10401-3 ACT 10631 T 10717 T 10997 A 11063 A 11098 G 11411 A 11420 C 11477 G 11603 T 11605 A 11655-7 CGT 11663-5 TTG 11875 A 11903 T 11986 C 12077 T 12094 C 12137 A 12203 A 12332 G 12410 T 12448 G 12522-4 TTA 12592 A 12607 T 12877 T 12880 T 12937 A 13048 T 13156 A 13168 A 13311 T 13321 A 13327-8 TA 13335 A
[0124]
[0125] 13459 T 13478 A
[0126] 13502-4 TGA
[0127] 13519 A
[0128] 13532 G
[0129] 13657-9 GTC
[0130] 13771-3 GTC
[0131] 13814 A
[0132] 13826 A
[0133] 13961 A
[0134] 14086 C
[0135] 14089 A
[0136] 14095 T
[0137] 14104 T
[0138] 14140 A
[0139] 14158 T
[0140] 14230 A
[0141] 14287 T
[0142] 14433-3 AA
[0143] 14585 A
[0144] 14695 A
[0145] 14756 T
[0146] 14901 T
[0147] 14964 A
[0148] 15002 A
[0149]
[0150] 15021 G
[0151] The disclosure includes ABD particle production and addressing host range limitations.
[0152] Particle production. The disclosure includes a particle production protocol using a holin-lysin-defective mutant of the helper prophage (Fig. 4). The bacteria are mitomycin-induced, incubated in growth medium for 3.5h, at 32°C, concentrated 20x by centrifugation, and the Iss gene, carried by the ABD, induced with anhydro tetracycline in a buffer containing 20% sucrose and 10 mM MgC12. Overnight incubation at room temperature converts the bacteria to protoplasts which are lysed with NP40 and clarified by centrifugation. The resulting 50 ml cleared lysate from a IL starting culture generally contains 3xl0n-1012particles / ml, which are purified by ultracentrifugation through a CsCl step gradient, then dialyzed. It is considered this yield is sufficient for scale-up. Because mitomycin C (MC) is not only toxic but also expensive and is not suitable for scale-up to manufacturing levels, we have incorporated the lambda cl 857 (temperature sensitivity) mutation into the 80a cl repressor and demonstrated temperature induction of the resulting prophage.
[0153] Host range limitation. Bacteria are well equipped with the means to protect themselves from the potential dangers of incoming foreign DNA, including previously available ABD DNA. Consequently, although those ABDs are highly effective against the standard laboratory strains that were used in their development, they are fully active against only about 1 / 3- 1 / 2 of clinical S. aureus isolates. To the other 1 / 2 -2 / 3, they can be transferred at frequencies of only 10'7-l O'4compared with the sensitive lab strains. We have shown that this low transfer efficiency is largely or perhaps entirely due to the restriction enzyme degradation of incoming ABD DNA, and that the successful low frequency ABD transfers to these strains are due to classical epigenetic modifications. Accordingly, we have had a modified ABD2047 sequence in which as many of the known restriction sites as presently biologically feasible have been eliminated, leaving out non-essential regions of the ABD that contain restriction sites. Fig- 2 is a diagram showing all of the identifiable restriction sites for enzymes produced by S. aureus. Restriction sites within essential ORFs were modified using synonymous codons. Restriction sites not within ORFs were replaced with nucleotides that retain the structure of a potential transcript or a regulatory sequence. S. aureus codon usage was maintained as far as feasible. The synthetic molecule was cloned to a shuttle plasmid. Following transfer of this plasmid to RN4220, the ABD particles were induced by 80a at the usual high frequency, and killed >90% of each of two unrelated ABD-resistant strains, confirming its functionality and the present demonstration of restriction enzyme basis of ABD resistance. Additionally, we cloned a type I methylase gene to MRSA strain MW2, and found that the ABD transfer frequency to this strain was increased by 100-fold, further confirming the role of restriction enzymes in ABD resistance.
[0154] While the disclosure has been particularly shown and described with reference to specific examples, it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present disclosure as disclosed herein.
Claims
What is claimed is:
1. A polynucleotide comprising a mobile bacterial island nucleotide sequence (B-INS) comprising one or more modifications (a modified B-INS),wherein the one or more modifications comprise:i) a deletion or modification of restriction enzyme recognition sites to inhibit restriction enzyme cleavage of the B-INS; andii) an insertion of at least one cargo sequence into the B-INS;wherein the polynucleotide comprising the modified B-INS is capable of being packaged within a bacterium into a phage-like particle that comprises or consists of bacteriophage capsid, tail and tail fiber proteins, and wherein the phage-like particle (an antibacterial drone “ABD”) is capable of infecting bacteria such that the at least one cargo sequence is introduced into bacteria infected by the ABD.
2. The polynucleotide of claim 1, wherein the ABDs are capable of being produced by an ABD particle-producing strain (PPS), and wherein optionally holin-lysin genes of a helper prophage in the PPS are disrupted or deleted.
3. The polynucleotide of claim 2, wherein a helper phage repressor gene is modified such that thermal induction of production of the ABDs can be performed.
4. The polynucleotide of any one of claims 1-3, wherein the at least one cargo sequence comprises a polynucleotide sequence encoding an anti-bacterial agent that is functional against a target in at least some bacteria in a bacterial population.
5. The polynucleotide of claim 4, wherein the anti-bacterial agent comprises one or a combination of:a) a sequence encoding an RNA or DNA polynucleotide that comprises specificity for the target, wherein the target comprises an essential gene or an RNA encoded by an essential gene or a variable gene or an RNA encoded by a variable gene;b) a sequence encoding a protein that has specificity for the target and can participate in and / or cause its cleavage and / or inactivation; orc) a sequence encoding a toxin that is cytostatic against bacteria, or a non-toxin protein that inhibits growth of bacteria in the bacterial population or inhibits formation ofand / or kills persister bacteria and / or dormant viable but non-culturable (VBNC) bacteria.
6. The polynucleotide of claim 5, wherein a) comprises an anti-sense RNA.
7. The polynucleotide of claim 5, wherein b) comprises a Clustered Regularly Interspaced Short Palindromic repeats (CRISPR) guide RNA targeted to a sequence in the bacteria in the bacterial population.
8. The polynucleotide of claim 5, wherein the encoded protein of b) comprises a CRISPR-associated nuclease that is optionally a Cas9 nuclease or a Cpfl nuclease or a dCas9.
9. The polynucleotide of claim 5, wherein the toxin of c) comprises a toxin that kills bacteria that have been infected by the ABD.
10. The polynucleotide of claim 9, wherein the toxin comprises lysostaphin.
11. The polynucleotide of claim 5, wherein the toxin of c) comprises a toxin that is secreted by the bacteria and which is bactericidal against bacteria that are uninfected by the ADB.
12. The polynucleotide of claim 5, wherein the target is comprised by a bacterial chromosome or a bacterial plasmid.
13. The polynucleotide of claim 12, wherein the target confers antibiotic resistance.
14. An ABD of any one of claims 1-3.
15. A pharmaceutical composition comprising an ABD of claim 14.
16. A method comprising administering a pharmaceutical composition of claim 14 to an individual in need thereof, wherein subsequent to the administration bacteria infected by the ABDs in the individual are killed or exhibit reduced virulence.
17. A method for producing ABDs of claim 14 comprising growing bacterial cells comprising a polynucleotide comprising a bacterial island nucleotide sequence (B-INS) comprising one or more modifications (a modified B-INS)wherein the polynucleotide comprising the modified B-INS is packaged within the bacteria to thereby produce the ABD.