Composition for regulating hepatic lipid metabolism, comprising lactiplantibacillus plantarum opt-a1 strain

The Lactiplantibacillus plantarum OPT-A1 strain composition addresses fatty liver by activating AMPK and GLP-1, reducing liver lipid accumulation and enhancing muscle mass, providing a promising treatment for fatty liver and metabolic disorders.

WO2026095764A1PCT designated stage Publication Date: 2026-05-07OPTBIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/095626
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-30
Filing Date
2025-10-02
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

The rapid increase in obesity and related metabolic diseases, particularly non-alcoholic fatty liver disease, is exacerbated by high-fat diets, leading to excessive lipid accumulation in the liver, which can progress to hepatitis and cirrhosis, with existing treatments lacking effective solutions.

Method used

A composition comprising the Lactiplantibacillus plantarum OPT-A1 strain, its culture medium, or lysate, which activates AMPK and GLP-1, inhibiting lipid synthesis and promoting oxidation, thereby reducing triglyceride accumulation and enhancing muscle mass, while also having antibacterial activity against pathogens like Escherichia coli and Klebsiella pneumoniae.

Benefits of technology

The composition effectively inhibits liver lipid accumulation, reduces triglycerides and cholesterol levels, activates GLP-1 secretion, and enhances muscle mass, offering a potential treatment for fatty liver and related metabolic disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025095626_07052026_PF_FP_ABST
    Figure KR2025095626_07052026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for regulating hepatic lipid metabolism, comprising Lactiplantibacillus plantarum OPT-A1 strain deposited under accession number KCTC 15555BP, a culture liquid thereof, a cultured product thereof, or a culture lysate thereof. The composition suppresses lipid accumulation and expression of genes related to lipogenesis in hepatocytes, and enhances expression of genes related to lipid oxidation. In addition, the composition inhibits accumulation of triglycerides in hepatocytes and reduces blood triglyceride levels, total cholesterol levels, and liver injury indices. Furthermore, the composition promotes rapid consumption of lipids in hepatocytes and somatic cells through enhancement of muscle mass, and thus can be advantageously used as a raw material for foods, pharmaceuticals, and the like related to alleviation and treatment of various metabolic diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for regulating liver lipid metabolism comprising the Lactiplantibacillus plantarum OPT-A1 strain

[0001] The present invention relates to a composition for regulating liver lipid metabolism comprising the Lactiplantibacillus plantarum OPT-A1 strain deposited at KCTC15555BP, which has AMPK (AMP-activated protein kinase) and GLP-1 (glucagon-like peptide-1) activating efficacy, the culture medium thereof, the culture thereof, or the culture lysate thereof.

[0002]

[0003] The World Health Organization (WHO) defines obesity as 'a condition in which abnormal or excessive fat is accumulated in adipose tissue to the extent that it is detrimental to health.' Recently, it has been reported that the proportion of the world's overweight population will steadily increase from 38% in 2020 to 42% in 2025, 46% in 2030, and 51% in 2035, while the proportion of the obese population will steadily increase from 14% in 2020 to 17% in 2025, 20% in 2030, and 24% in 2035. With industrialization, modern people have increasingly adopted high-fat, high-salt, high-sugar, and high-calorie diets resulting from the consumption of meat-centered saturated and unsaturated fatty acids, sodium, and sugars. Consequently, metabolic diseases caused by overweight are on the rise, including Type 2 diabetes, dyslipidemia, hypertension, fatty liver, gallbladder disease, coronary artery disease (angina, myocardial infarction), stroke, sleep apnea, gout, osteoarthritis, menstrual irregularities, colorectal cancer, and breast cancer. Furthermore, irregular eating habits not only lead to poor nutritional status but can also cause psychological and physiological unhealthiness and variability. Therefore, it is advisable to prevent obesity in advance; if obesity occurs, regulating metabolism through body fat reduction to ensure smooth functioning is crucial for preventing various diseases and maintaining health.

[0004] AMPK (adenosine monophosphate-activated protein kinase) is a kinase that regulates energy status sensing and metabolic homeostasis in tissues such as fat, liver, pancreas, and muscle. AMPK activation is an important target substance for preventing and treating metabolic diseases because it reduces triglyceride accumulation in adipose tissue by increasing fatty acid oxidation—specifically mitochondrial beta-oxidation—and inhibiting fat synthesis. Under conditions of overnutrition, adipocytes store triglycerides in the form of fatty acids, which consist of three fatty acids linked to a glycerol core; the continuous accumulation of triglycerides leads to hypertrophy of these cells. Hypertrophied adipocytes are associated with metabolic disorders, including insulin resistance, circulatory disorders, and inflammation. Sterol regulatory element binding proteins-1c (SREBP-1c) increases the synthesis of fatty acids and triglycerides within adipocytes, leading to their accumulation, by regulating the expression of C / EBP-α (CCAAT / enhancer binding protein-α), peroxidase proliferator-activated receptor-γ (PPAR-γ), and fatty acid synthase (FAS). During the early stages of adipocyte differentiation, the expression of C / EBP-α increases, as does the expression of PPAR-γ, a late-stage transcription factor and differentiation regulatory transcription factor. This leads to the activation of lipid synthesis genes and the regulation and promotion of differentiation, thereby completing the process of adipocyte formation and differentiation. To regulate lipid synthesis, AMPK is activated to suppress the expression of lipid synthesis genes. Additionally, it oxidizes lipids by increasing mitochondrial beta-oxidation through the activation of peroxidase proliferator-activated receptor-α (PPAR-α) and carnitine palmitoyltransferase 1 (CPT1).Uncoupling protein 1 (UCP1) is expressed during the oxidation of fatty acids, as it consumes energy in the mitochondria of adipocytes to generate heat as a byproduct. Accordingly, regulating various such factors, including AMPK, is becoming a target for suppressing obesity, and various studies are currently underway.

[0005] GLP-1 (glucagon-like peptide-1), another obesity regulatory factor, is an incretin hormone that plays a role in lowering blood sugar by promoting insulin secretion and inhibiting glucagon secretion in a glucose concentration-dependent manner. Recently, GLP-1 has been approved as an obesity treatment and is one of the substances gaining attention as an obesity treatment. GLP-1 secreted from the intestines exerts efficacy on various metabolic diseases through the blood, including weight loss, blood sugar control, blood pressure reduction, lipid improvement, and fatty liver improvement.

[0006] Meanwhile, among these obesity-related metabolic syndromes, the symptom that can appear most rapidly is non-alcoholic fatty liver disease; when excessive calories are continuously consumed, fat accumulates in the liver just as it accumulates in fat cells in the body.

[0007] Fatty liver is diagnosed when excessive fat (primarily triglycerides) accumulates within the liver, generally exceeding 5% of the liver's weight. It is known that harmful cytokines are secreted from this increased fat, leading to the progression of fatty liver hepatitis and cirrhosis. Adult-onset diabetes, caused by resistance to insulin secreted in the body, is also known to be a cause of fatty liver. The increased insulin levels resulting from insulin resistance not only lower blood sugar but also cause fat to be stored in the liver, thereby inducing fatty liver. Additionally, hyperlipidemia, characterized by elevated levels of total cholesterol or triglycerides in the blood vessels, is known to impair the liver's detoxification and fat-degrading functions, leading to fatty liver. Enzymes present within liver cells are primarily released into the bloodstream when the cells are damaged, causing their blood levels to rise. When liver cells are damaged, the concentrations of AST (aspartate aminotransferase) and ALT (alanine aminotransferase) change, so the blood levels of enzymes such as AST (aspartate aminotransferase), ALT (alanine aminotransferase), ALP (Alkaline phosphatase), and GGT (Gamma-Glutamyl Transferase) are mainly tested to check for abnormalities in liver function.

[0008] Recently, various technologies are being researched to apply various probiotics to improve these lipid-related diseases.

[0009] 'Metabiotics' is a term referring to fifth-generation lactic acid bacteria and includes 'parabiotics,' which are dead cells obtained by heat-treating probiotics, which are live lactic acid bacteria, and 'postbiotics,' which are metabolites obtained by heat-treating probiotics, which are culture solutions.

[0010] Metabiotics containing these metabolites possess all the various functionalities of live bacteria, yet are not subject to limitations such as the guarantee of the number of bacteria reaching the intestines compared to the intake of probiotic supplements, nor are they problematic regarding safety issues that live bacteria may have. Furthermore, they are attracting attention as next-generation probiotic products because they are stable against heat and pH, allowing for various formulations.

[0011] The inventors completed the present invention by confirming that metabiotics, parabiotics, and postbiotics derived from Lactibactibacillus plantarum OPT-A1 have lipid synthesis inhibitory activities, such as enhancing the activation, or phosphorylation, of AMPK in animals with fatty liver induced by a high-fat diet.

[0012]

[0013] [Prior Art Literature]

[0014] [Patent Literature]

[0015] Republic of Korea Registered Patent No. 10-2639561 (Title of Invention: Composition for the prevention, treatment, or improvement of metabolic diseases including obesity, diabetes, or fatty liver using Lactobacillus plantarum NCHBL-004 strain or culture medium thereof, Applicant: Industry-Academic Cooperation Foundation of Chonnam National University, Registration Date: February 19, 2024)

[0016] Republic of Korea Registered Patent No. 10-1407980 (Title of Invention: Product containing Lactobacillus curvatus HY7601 and Lactobacillus plantarum KY1032 as active ingredients having efficacy in improving hyperinsulinemia, hyperglycemia, and hypertriglyceridemia, Applicant: Korea Yakult Co., Ltd., Registration Date: June 10, 2014)

[0017]

[0018] [Non-patent literature]

[0019] Guanhua Xue et al. ThreeKlebsiellaspecies as potential pathobionts generating endogenous ethanol in a clinical cohort of patients with auto-brewery syndrome: a case control study. EBioMedicine. 2023, 91, 104560.

[0020] Yoshihisa Takahashi et al. Histopathology of nonalcoholic fatty liver disease / nonalcoholic steatohepatitis. World J Gastroenterol. 2014, 20(42), 15539-15548.

[0021]

[0022] The objective of the present invention is to provide a composition for regulating liver lipid metabolism comprising the Lactibacillus plantarum OPT-A1 strain having AMPK (AMP-activated protein kinase) and GLP-1 (glucagon-like peptide-1) activating efficacy.

[0023]

[0024] The present invention relates to a composition for regulating liver lipid metabolism, characterized by comprising the Lactiplantibacillus plantarum OPT-A1 strain deposited at KCTC15555BP, the culture medium thereof, the culture thereof, or the culture lysate thereof.

[0025] The above composition regulates liver lipid metabolism by inhibiting lipid accumulation within liver cells.

[0026] More preferably, the above composition may have the efficacy to activate AMPK (AMP-activated protein kinase) in liver cells.

[0027] In addition, the above composition inhibits the accumulation of triglycerides in liver cells and reduces the production of blood triglycerides, total cholesterol, AST (Aspartate aminotransferase), and ALT (Alanine aminotransferase). In contrast, due to the above composition, the production of adiponectin, a lipolytic hormone, increases.

[0028] The above composition inhibits the expression of fat synthesis-related genes FAT / CD36 (Fatty acid translocase), PPARγ (Peroxisome proliferator-activated receptor-γ), and FAS (Fatty acid synthase), and enhances the expression of fat oxidation-related genes PPAR-α (Peroxidase proliferator-activated receptor-α) and CPT1 (Carnitine palmitoyltransferase 1).

[0029] The above composition is characterized by having antibacterial activity against Escherichiacoli or Klebsiella pneumoniae, which induce fatty liver formation.

[0030] The above composition activates GLP-1 (glucagon-like peptide-1).

[0031] The above composition may have an efficacy for increasing muscle mass. That is, it may promote lipid metabolism due to increased muscle mass. Preferably, it has an efficacy for promoting myoblast proliferation, an efficacy for promoting differentiation from myoblasts into myotubes, an efficacy for inhibiting muscle atrophy, and an efficacy for restoring damaged muscle cells or myotubes. In this case, the above composition activates mTOR (mammalian target of rapamycin) or Akt.

[0032] The 16S rRNA gene sequence of the above strain is characterized by containing the polynucleotide of SEQ ID NO. 1.

[0033] The above composition may include probiotics.

[0034] The above culture may be a postbiotic composition or a parabiotic composition, and the above culture lysate may be a metabiotic composition in which the bacterial cells in the culture medium are dissolved by Tyndallization, that is, by intermittent sterilization.

[0035] Accordingly, the present invention provides a pharmaceutical composition for the prevention or treatment of fatty liver, characterized by comprising the above composition.

[0036] In addition, the present invention may relate to a food composition for the prevention or improvement of fatty liver, characterized by comprising the above composition.

[0037] The above fatty liver may be non-alcoholic fatty liver. Additionally, the above fatty liver may be alcoholic fatty liver.

[0038] The bacterial cells in the above culture medium are preferably 10 6 to 10 12 CFU / mL or 10 6 to 10 12 It is characterized by being cell / mL.

[0039] In another aspect, the present invention may relate to a method for controlling liver lipid metabolism using the above-mentioned Lactibacillus plantarum OPT-A1 strain, the culture medium thereof, the culture thereof, or the culture lysate thereof.

[0040] Likewise, the present invention may relate to a method for treating fatty liver using the above-mentioned Lactibacillus plantarum OPT-A1 strain, the culture medium thereof, the culture thereof, or the culture lysate thereof.

[0041] In addition, the present invention may relate to a method for manufacturing a food for the prevention or improvement of fatty liver using the above-mentioned Lactibacillus plantarum OPT-A1 strain, the culture medium thereof, the culture thereof, or the culture lysate thereof.

[0042]

[0043] The present invention will be described in detail below.

[0044] In the present invention, 'metabiotics' is defined as obtained by Tyndallizing the culture medium, culture, or metabolite of the OPT-A1 strain. That is, metabiotics may refer to a composition comprising all of: dead cells in the culture medium obtained by Tyndallizing the OPT-A1 strain culture medium; and the culture medium remaining after Tyndallization.

[0045] The present invention relates to a composition for regulating liver lipid metabolism, characterized by comprising a composition derived from the Lactiplantibacillus plantarum OPT-A1 strain deposited at KCTC15555BP, preferably a raw material selected from metabiotics, parabiotics, and postbiotics of said strain.

[0046] The above composition, preferably, the metabiotic may be obtained by Tyndallizing the culture solution of each strain.

[0047] The above Tyndallization can be performed by heating at 90 to 100°C for 30 to 60 minutes.

[0048] The above composition, preferably, the metabiotic is characterized by having AMPK (AMP-activated protein kinase) activating efficacy; GLP-1 (glucagon-like peptide-1) activating efficacy.

[0049] The above composition is selected from raw materials selected from metabiotics, parabiotics, and postbiotics, and preferably, the metabiotic has muscle-enhancing efficacy, characterized by having efficacy in promoting myoblast proliferation, efficacy in promoting differentiation from myoblasts into myotubes, efficacy in inhibiting muscle atrophy, and efficacy in restoring damaged muscle cells or myotubes. The muscle damage may be a symptom of muscle damage selected from the group consisting of muscle strain, muscle rupture, muscle tearing, contusion, distortion, and rotator cuff syndrome, and the cause of the muscle damage may be induced by various drug side effects, sequelae of accidents, sequelae of injuries, sequelae of diseases, sequelae of improper exercise, etc.

[0050] The above muscle disease may be a disease selected from atony, muscular atrophy, myasthenia gravis, muscular dystrophy (muscle degenerative atrophy, muscle degeneration), cachexia, rigid spine syndrome, amyotrophic lateral sclerosis (Lou Gehrig's disease), rigid spinsesyndrome, Charcot-Marie-Tooth disease, and sarcopenia.

[0051] Accordingly, the present invention provides a pharmaceutical composition for the prevention or treatment of muscle diseases characterized by comprising the above composition.

[0052] In addition, the present invention may relate to a food composition for the prevention or improvement of muscle diseases characterized by comprising the above composition.

[0053] The metabiotic derived from the OPT-A1 strain of the present invention can be obtained by culturing the strain in a liquid medium for lactic acid bacteria culture at 30 to 40°C for 18 to 36 hours and then Tyndallizing the strain culture solution. The metabiotic can be used by concentrating or drying it.

[0054] The above Tyndallization can be performed by heating at 90 to 100°C for 30 to 60 minutes, but the temperature or time is not significantly limited as long as the conditions for the inactivation of the strain are met.

[0055] The above liquid medium for culturing lactic acid bacteria may be an MRS liquid medium, but preferably, any form of liquid medium in which lactic acid bacteria are cultured is possible.

[0056] In the present invention, phosphorylation of AMPK (AMP-activated protein kinase) increases by 150–200% based on normal liver cells without induced fatty liver, and by about 120–130% based on liver cells of the lipid synthesis-induced group, i.e., fatty liver-induced group cells, due to treatment with 200 μg / mL of the composition derived from the OPT-A1 strain.

[0057] In the present invention, the secretion of GLP-1 (glucagon-like peptide-1) is increased by 140–450% due to treatment with 200 μg / mL of the composition derived from the OPT-A1 strain, and is preferably increased by 400–450% due to treatment with 200 μg / mL of metabiotics.

[0058] In the present invention, treatment with 200 μg / mL of the composition derived from the OPT-A1 strain, preferably metabiotics, inhibits the accumulation of triglycerides in liver cells by 18-26% compared to liver cells of the lipid synthesis-induced group.

[0059] In addition, the gene expression of PPAR-α (Peroxidase proliferator-activated receptor-α) and CPT1 (Carnitine palmitoyltransferase 1) is increased to 150–170% compared to liver cells of the lipid synthesis-induced group due to treatment with 200 μg / mL of an OPT-A1-derived composition, preferably a metabiotic.

[0060] On the other hand, due to treatment with the above composition, preferably 200 μg / mL of metabiotics, PPAR-γ (Peroxidase proliferator-activated receptor-γ) is reduced by 45-55% compared to liver cells of the lipid synthesis-induced group, FAS (Fatty acid synthase) is reduced by 35-40%, and FAT / CD36 (Fatty acid translocase) is reduced by 40-50%.

[0061] In the present invention, when myoblasts proliferate due to treatment with 200 μg / mL of the composition derived from the OPT-A1 strain, preferably metabiotics, the activation of Akt increases to 110-120% and the activation of mTOR increases to 130-140%, and when myotubes differentiate, the activation of Akt increases to 120-130% and the activation of mTOR increases to 110-120%. At this time, the expression or activity of cell groups among each adipogenesis-induced group is measured based on 100%.

[0062] When treated with the above OPT-A1 strain-derived composition, preferably 20 mg / head / day or 1 mg / kg / day to 1000 mg of metabiotics, total cholesterol is reduced by 8-12% compared to the fatty liver-induced group, the production of AST (Aspartate aminotransferase) is reduced by 10-13% compared to the fatty liver-induced group, and the production of ALT (Alanine aminotransferase) is reduced by 30-40%.

[0063] When treated with the above-mentioned composition derived from the OPT-A1 strain, preferably at a dose of 20 mg / head / day or 1 mg / kg / day to 1000 mg of metabiotics, lipid accumulation in liver tissue is inhibited by 10–20% compared to a group with fatty liver induced by a high-fat diet, and phosphorylation of AMPK (AMP-activated protein kinase) is also increased by 110–120% compared to the group with fatty liver induced. In addition, it has the effect of reducing the weight of the liver with induced fatty liver by 15–30%. At this time, the size of adipocytes decreases by about 10–15%, and histopathologically, it is confirmed that the hepatocellular steatosis state recovers to a normal state as if the high-fat diet had not been induced, that is, as if fatty liver had not been induced. Furthermore, the lipolytic hormone adiponectin is increased by 105–110% compared to the group with fatty liver induced.

[0064] It is preferable to culture the OPT-A1 strain of the present invention at 30 to 37°C for 16 to 48 hours, with the optimal temperature for culture being 37°C, the minimum temperature being 15°C, and the maximum temperature being 45°C, and the optimal pH being 6.5, the minimum pH for culture being 3.5, and the maximum pH being 7.8. The optimal culture time is 24 hours, the minimum culture time is 8 hours, and the maximum culture time is 120 hours.

[0065] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of fatty liver containing a metabiotic derived from the OPT-A1 strain. The metabiotic may be added to the pharmaceutical composition of the present invention in an amount of 0.001 to 30 weight%.

[0066] The above pharmaceutical composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as external preparations, suppositories, and sterile injectable solutions, according to conventional methods. Carriers, excipients, and diluents that may be included in the above pharmaceutical composition may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulating, the product is prepared using diluents or excipients such as commonly used fillers, volume expanders, binders, humectants, disintegrants, and surfactants. Solid dosage forms for oral administration include tablets, pills, powders, granules, and capsules; these solid dosage forms are prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, or gelatin, with the extract of the present invention. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid dosage forms for oral administration include suspensions, liquids, emulsions, and syrups; in addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as humectants, sweeteners, flavorings, and preservatives, may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As non-aqueous solvents and suspending agents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, Witepsol, Macrogol, Tween 61, cocoa paste, laurin paste, glycerogelatin, etc. may be used.

[0067] The dosage of the pharmaceutical composition of the present invention will vary depending on the age, gender, and weight of the subject to treatment, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the judgment of the prescriber. The determination of the dosage based on these factors is within the level of a person skilled in the art, and generally, the dosage ranges from 0.01 mg / kg / day to approximately 2000 mg / kg / day. A more preferred dosage is from 1 mg / kg / day to 1000 mg / kg / day. Administration may be performed once a day or divided into several doses. The above dosage does not limit the scope of the present invention in any way.

[0068] The pharmaceutical composition of the present invention can be administered to mammals, such as rats, livestock, and humans, via various routes. Any mode of administration is expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine, dura mater, or intracerebrovascular injection. Since the composition of the present invention has minimal toxicity and side effects, it is a drug that can be safely used for long-term preventive purposes.

[0069] In addition, the present invention provides a food composition for the prevention or improvement of obesity comprising metabiotics derived from the OPT-A1 strain and a food-grade dietary additive that is acceptable. The metabiotics may be added to the food composition of the present invention in an amount of 0.001 to 30 weight%. The food composition of the present invention includes forms such as general food compositions, tablets, capsules, pills, or liquids, and foods to which the extract of the present invention may be added include, for example, energy bars, nutritional formulas, meat, sausages, bread, candies, jellies, snacks, noodles, ice cream, yogurt, dairy products, soups, functional beverages, energy drinks, isotonic drinks, beverages, alcoholic beverages, various drinks, chewing gum, tea, and vitamin complexes.

[0070]

[0071] The present invention relates to a composition for regulating liver lipid metabolism comprising the Lactiplantibacillus plantarum OPT-A1 strain deposited at KCTC15555BP, the culture medium thereof, the culture product thereof, or the culture lysate thereof. The composition inhibits lipid accumulation in liver cells, has AMPK and GLP-1 activating efficacy, inhibits the expression of lipid synthesis-related genes FAT / CD36, PPARγ, and FAS, and enhances the expression of fatty acid oxidation-related genes PPAR-α and CPT1. Furthermore, it inhibits the accumulation of triglycerides in liver cells and reduces the production of blood triglycerides, total cholesterol, AST (Aspartate aminotransferase), and ALT (Alanine aminotransferase). In addition, by promoting the rapid consumption of lipids within liver cells and somatic cells through muscle enhancement, it can be usefully utilized as a raw material for food, medicine, etc., for the improvement or treatment of various metabolic diseases as well as fatty liver.

[0072]

[0073] Figure 1 shows the results of the sugar fermentation characteristics of the Lactibacillus plantarum OPT-A1 strain.

[0074] Figure 2 shows the results of confirming the secretion level of GLP-1 in STC-1 cells following treatment with Lactibactibacillus plantarum OPT-A1.

[0075] Figure 3 shows the results of confirming the degree of triglyceride formation in HepG2 cells following treatment with Lactibactibacillus plantarum OPT-A1.

[0076] Figure 4 shows the results of confirming the triglyceride content in HepG2 cells following treatment with Lactibacillus plantarum OPT-A1.

[0077] Figure 5 shows the results of confirming the degree of myoblast proliferation promotion following treatment with Lactibactibacillus plantarum OPT-A1 in C2C12 cells.

[0078] Figure 6 shows the results of comparing the degree of myotube differentiation promotion following treatment with Lactiplantibacillus plantarum OPT-A1 in C2C12 cells - Jenner's-Giemsa staining (Figure 6A), Immunofluorescence (Figure 6B).

[0079] Figure 7 shows the results of confirming the change in body weight of animals administered a high-fat diet and Lactibacillus plantarum OPT-A1.

[0080] Figure 8 shows the results of confirming the body fat mass of animals administered a high-fat diet and Lactibacillus plantarum OPT-A1 using DEXA.

[0081] Figure 9 shows the results of checking the tissue weight of animals administered a high-fat diet and Lactibacillus plantarum OPT-A1.

[0082] Figure 10 shows the results of confirming the degree of fatty liver formation in the liver tissue and the size of adipocytes in the adipose tissue of animals administered a high-fat diet and Lactibacillus plantarum OPT-A1 through H&E staining.

[0083] Figure 11 is a photograph showing the antibacterial activity against intestinal pathogenic microorganisms.

[0084]

[0085] Preferred embodiments of the present invention will be described in detail below. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, the content introduced herein is provided to fully convey the concept of the present invention to those skilled in the art, so that it may be thorough and complete.

[0086]

[0087] <Example 1. Isolation and Identification of Probiotics>

[0088] Example 1-1. Isolation of probiotics and

[0089] Probiotics were isolated from various sources, including fermented foods that do not use probiotics as starters, such as kimchi, soy sauce, makgeolli, colostrum, fermented liquids, fruits, and flowers, and the isolation method is as follows. Each sample was serially diluted in sterile water and plated on MRS Broth (Difco, USA) agar medium containing 0.004% Bromophenol blue (Sigma, Korea), and incubated in a 37°C incubator for 48 hours. After 48 hours of incubation, probiotic colonies that exhibited acidity by displaying a yellow halo around the colony were distinguished by shape and color.

[0090]

[0091] Example 1-2. 16SrRNA gene sequencing analysis of probiotics

[0092] A 16S rRNA amplification product was obtained from the probiotics distinguished as described above by PCR using primers 27F (Sequence No. 2) and 1492R (Sequence No. 3), and the amplified nucleotides were submitted to Cosmogenetec for sequencing analysis to obtain a polynucleotide consisting of the nucleotide sequence of Sequence No. 1. Through NCBI phylogenetic analysis of the polynucleotide, the probiotic obtained in the present invention was named Lactiplantibacillusplantarum OPT-A1, and it was deposited with the Korean Collection for Type Cultures (KCTC) of the Korea Research Institute of Biotechnology and Bioengineering on August 18, 2023, under accession number KCTC15555BP.

[0093] 서열번호 1 :LactiplantibacillusplantarumOPT-A1,KCTC15555BPtgcttgcatc atgatttaca tttgattgag tggcgaactg gtgagtaaca cgtgggaaacctgcccagaa gcgggggata acacctggaa acagatgcta ataccgcata acaacttggaccgcatggtc cgagtttgaa agatggcttc ggctatcact tttggatggt cccgcggcgtattagctaga tggtggggta acggctcacc atggcaatga tacgtagccg acctgagagggtaatcggcc acattgggac tgagacacgg cccaaactcc tacgggaggc agcagtagggaatcttccac aatggacgaa agtctgatgg agcaacgccg cgtgagtgaa gaagggtttcggctcgtaaa actctgttgt taaagaagaa catatctgag agtaactgtt caggtattgacggtatttaa ccagaaagcc acggctaact acgtgccagc agccgcggta atacgtaggtggcaagcgtt gtccggattt attgggcgta aagcgagcgc aggcggtttt ttaagtctgatgtgaaagcc ttcggctcaa ccgaagaagt gcatcggaaa ctgggaaact tgagtgcagaagaggacagt ggaactccat gtgtagcggt gaaatgcgta gatatatgga agaacaccagtggcgaaggc ggctgtctgg tctgtaactg acgctgaggc tcgaaagtat gggtagcaaacaggattaga taccctggta gtccataccg taaacgatga atgctaagtg ttggagggtttccgcccttc agtgctgcag ctaacgcatt aagcattccg cctggggagt acggccgcaaggctgaaact caaaggaatt gacgggggcccgcacaagcg gtggagcatg tggtttaattcgaagctacg cgaagaacct taccaggtct tgacatacta tgcaaatcta agagattagacgttcccttc ggggacatgg atacaggtgg tgcatggttg tcgtcagctc gtgtcgtgagatgttgggtt aagtcccgca acgagcgcaa cccttattat cagttgccag cattaagttgggcactctgg tgagactgcc ggtgacaaac cggaggaagg tggggatgac gtcaaatcatcatgcccctt atgacctggg ctacacacgt gctacaatgg atggtacaac gagttgcgaactcgcgagag taagctaatc tcttaaagcc attctcagtt cggattgtag gctgcaactcgcctacatga agtcggaatc gctagtaatc gcggatcagc atgccgcggt gaatacgttcccgggccttg tacacaccgc ccgtcacacc atgagagttt gtaacacccca aagtcggtggggtaaccttt taggaa

[0094] PrimerNo.Sequence (5'-3')27F Sequence No. 2agagtttgat ctggctcag1492R Sequence No. 3ggttaccttg ttacgacttc

[0095]

[0096] Examples 1-3. Investigation of Sugar Fermentation Characteristics of Probiotics

[0097] The sugar fermentation characteristics were investigated using the API 50 CHL kit (Biomerieux, France) to determine whether each probiotic could utilize 49 sugars as a carbon source. The API 50 CHL kit allows for verification of sugar availability by changing color from purple to yellow due to Bromcresol purple contained in the medium as lactic acid bacteria produce acid while growing. First, each lactic acid bacterium was plated onto MRS agar and incubated in a 37°C incubator for 24 hours. Subsequently, the bacterium was suspended in Suspension medium (Biomerieux, France) with a turbidity of 2 McFarland, inoculated at 1% in API 50 CHL medium (Biomerieux, France), and dispensed into API strips at a volume of 110 μL. After incubation in a 37°C incubator for 24 and 48 hours, the fermentation characteristics were read as positive (++) at 24 hours, positive (+) at 48 hours, and negative (-) at 48 hours, and are shown in Figure 1 and Table 3.

[0098] 번호종류OPT-A1번호종류OPT-A10Control-25Esculin++1Glycerol-26Salicin++2Erythritol-27D-Cellobiose++3D-Arabinose-28D-Maltose++4L-Arabinose++29D-Lactose++5D-Ribose++30D-Melibiose++6D-Xylose-31D-Saccharose++7L-Xylose-32D-Trehalose++8D-Adonitol-33Inulin-9Methyl-β D-Xylopyranoside-34D-Melezitose++10D-Galactose++35D-Raffinose-11D-Glucose++36Amidon-12D-Fructose++37Glycogen-13D-Mannose++38Xylitol-14L-Sorbose-39Gentiobiose++15L-Rhamnose-40D-Turanose++16Dulcitol-41D-Lyxose-17Inositol-42D-Tagatose-18Mannitol++43D-Fucose-19D-Sorbitol++44L-Fucose-20Methyl α D-mannopyranoside++45D-Arabitol-21Methyl αD-glucopyranoside+46L-Arabitol-22N-Acetylglucosamine++47Potassium Gluconate++23Amygdalin++48Potassium 2-Ketogluconate-24Arbutin++49Potassium 5-Ketogluconate-

[0099] As confirmed by Figure 1 and Table 3, it was confirmed that Lactiplantibacillus plantarum OPT-A1 utilizes a total of 25 sugars and has the characteristic of producing acid as it metabolizes monosaccharides L-Arabinose, D-Ribose, D-Galactose, D-Glucose, D-Fructose, D-Mannose; sugar alcohols Mannitol and D-Sorbitol; polysaccharides Methyl α D-mannopyranoside, Methyl α D-glucopyranoside, N-Acetylglucosamine; glycosides Amygdalin, Arbutin, Esculin, Salicin; disaccharides D-Cellobiose, D-Maltose, D-Lactose, D-Melibiose, D-Saccharose, D-Trehalose, Gentiobiose, D-Turanose; trisaccharides D-Melezitose; and the sugar compound Potassium Gluconate.

[0100]

[0101] Example 2. Preparation of a sample using a probiotic strain

[0102] Example 2-1. Preparation of Samples for Cell Experiments

[0103] To prepare the sample, 1(v / v)% of the culture of Lactiplantibacillus plantarum OPT-A1 strain was inoculated into MRS broth medium (Difco, USA) (total bacterial count approximately 1 x 10⁶ 8 CFU to 1x10 12 The CFU were cultured in a 37°C incubator for 24 hours. After 24 hours, the liquid probiotic culture was diluted 10-fold, and the OD 600 As a result of measuring, OD 600 It was confirmed to be approximately 8.0 to 10.0, and the probiotic culture was 10 through viable cell count analysis. 9It was confirmed that it contains CFU / mL of live bacteria. The OPT-A1 probiotic culture obtained in this way was prepared into a metabiotic by Tyndallizing at 100°C for 30 minutes. That is, the metabiotic contains dead cells and a culture medium.

[0104] In addition, for comparative experiments, dead cells and culture medium were separated and used as parabiotics, while the culture medium from which the cells were removed was used as postbiotics.

[0105] Meanwhile, it was confirmed that each of these metabiotics had a solid content of approximately 2% by weight after partial concentration and drying. In the experiment, the metabiotics were used in liquid form as is, but the concentration was calculated equally for each sample treatment group.

[0106]

[0107] Example 2-2. Preparation of samples for animal experiments

[0108] Lactiplantibacillus plantarum OPT-A1 isolated in Example 1 above was inoculated into MRS liquid medium at a concentration of 1 (v / v)% (total bacterial count approximately 1 x 10⁶ 8 CFU to 1x10 12Seeds for the main inoculation were prepared by culturing in a 37°C incubator for 19 hours. The main culture was carried out for 18–24 hours in a 37°C fermenter while maintaining a pH of 5.0–6.0. ​​Metabiotics containing Tyndallized dead cells and culture medium were prepared by heat-treating the cultured strains at 121°C for 20 minutes at 50 rpm. Subsequently, the Tyndallized dead cells and culture medium were recovered from the heat-treated metabiotics via centrifugation. The recovered Tyndallized dead cells were dried using a freeze-dryer to obtain a dried powder, while the culture medium was dried using a spray dryer to obtain a dried powder. Finally, based on the dry content of the Tyndallized dead cells and culture medium produced in the fermenter, the final mass cultured culture medium was determined to have a weight ratio of (Tyndallized dead cells : culture medium, 1 : 20), resulting in 1 x 10⁶ cells based on the number of dead cells. 11 Metabiotics were prepared in cell / g and used in the experiment.

[0109]

[0110] Example 3. Confirmation of GLP-1 secretion in intestinal cells stimulated by Lactiplantibacillus plantarum OPT-A1

[0111] Example 3-1. STC-1 cell culture

[0112] To confirm the secretion of GLP-1 from intestinal cells, mouse intestinal tumor cell line STC-1 cells were purchased from the American Type Culture Collection (ATCC), and subcultures were performed every 3 to 4 days in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin at 37°C in a 5% CO2 incubator while maintaining 70 to 80% confluency.

[0113]

[0114] Example 3-2. Confirmation of GLP-1 secretion induced by Lactiplantibacillus plantarum OPT-A1 stimulation

[0115] GLP-1 is an incretin hormone that plays a role in lowering blood sugar by promoting insulin secretion and inhibiting glucagon secretion in a glucose-concentration-dependent manner. Recently, GLP-1 has been approved as an obesity treatment and is currently one of the substances receiving significant attention. GLP-1 secreted from the intestines is transmitted through the bloodstream and demonstrates efficacy in treating various metabolic disorders, including weight loss, blood sugar control, blood pressure reduction, lipid improvement, and fatty liver improvement. Therefore, to confirm GLP-1 secretion following treatment with Lactiplantibacillus plantarum OPT-A1, 2×10 STC-1 cells were cultured in a 24-well plate using DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. 5 After dispensing into cells / well, the cells were cultured for 24 hours in a 37°C, 5% CO2 incubator. After 24 hours, the cells were washed with DPBS, and 500 μL of Krebs-Ringer bicarbonate buffer (Biosolution, Korea) containing 0.1% BSA was added to each well. Then, the Lactiplantibacillus plantarum OPT-A1 metabiotics, dead cells, and culture medium prepared in Example 2 were each added to the cell medium at 1% (v / v) (calculated based on solid content, with the bacterial count and culture medium powder concentration converted to 200 μg / mL), and the cells were cultured for 2 hours. At this time, to confirm the degree of GLP-1 secretion, the supernatant was collected for GLP-1 analysis after culturing in 10 mM Acetate, which is a positive control for GLP-1 production. The supernatant was analyzed using a GLP-1 ELISA kit (Abcam, UK) according to the manufacturer's manual, and the results are shown in Figure 2.

[0116] Referring to Figure 2, when GLP-1 secretion was examined in STC-1 cells upon treatment with Lactiplantibacillus plantarum OPT-A1 metabiotics, parabiotics, and postbiotics, it was confirmed that Lactiplantibacillus plantarum OPT-A1 metabiotics increased GLP-1 by 430.6% compared to the normal group, parabiotics increased it by 331.3% compared to the normal group, and postbiotics increased it by 151.2% compared to the normal group.

[0117] Therefore, it is proven that the Lactibacillus plantarum OPT-A1 metabiotic, parabiotic, and postbiotic can be used as a raw material for foods and medicines that regulate lipid metabolism, blood sugar control, as well as metabolic diseases.

[0118] In addition, based on the results of the metabiotics, subsequent experiments were conducted using metabiotics.

[0119]

[0120] Example 4. Confirmation of increased lipid oxidation and inhibition of lipid synthesis by Lactiplantibacillus plantarum OPT-A1 in liver cells

[0121] Example 4-1. HepG2 cell culture

[0122] To confirm the activation of AMPK (AMP-activated protein kinase) in liver cells, human-derived liver cancer cells, specifically HepG2 cells, were purchased from the American Type Culture Collection (ATCC). Subculture was performed every two days in a 37°C, 5% CO2 incubator using Dulbecco's modified eagle's medium (DMEM: Welgene, Korea) supplemented with 10% fetal bovine serum (FBS: gibco, USA) and 1% penicillin / streptomycin (Gibco, USA).

[0123]

[0124] Example 4-2. Induction of lipolysis in HepG2 cells

[0125] To induce lipid synthesis in HepG2 cells, 5×10⁶ HepG2 cells were placed in a 6-well plate. 4 After seeding into cells / well, the cells were cultured in a 37°C, 5% CO2 incubator. When HepG2 cells reached 80% capacity on the plate, the media was removed. Then, FFAs (Free Fatty Acids) consisting of oleic acid (Sigma, USA) and palmitic acid (Sigma, USA) mixed in a 2:1 ratio were conjugated with 2% bovine serum albumin (BSA, GenDEPOT, USA). The BSA-conjugated FFAs were added to the media to a final concentration of 1 mM to induce lipid synthesis. Through this lipid synthesis induction, the necessary results were obtained at each induction time.

[0126]

[0127] Example 4-3. Confirmation of AMPK activation in lipid synthesis-induced HepG2 cells

[0128] AMPK is a phosphorylation enzyme that regulates energy status sensing and metabolic homeostasis in tissues such as fat, liver, pancreas, and muscle. AMPK activation is an important target substance for the prevention and treatment of metabolic diseases because it reduces triglyceride accumulation in adipose tissue by increasing lipid oxidation—specifically mitochondrial beta-oxidation—and inhibiting lipid synthesis. Therefore, to confirm initial AMPK activation in HepG2 cells, 5×10⁶ HepG2 cells were placed in a 6-well plate using DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. 4After seeding into cells / well, the cells were cultured for 48 hours in a 37°C, 5% CO2 incubator. After 48 hours, lipid synthesis was induced according to the lipid synthesis induction method of Example 4-2, and to measure the AMPK activity of Lactiplantibacillus plantarum OPT-A1, the Lactiplantibacillus plantarum OPT-A1 metabiotic sample prepared in Example 2-1 was used at a final concentration of 200 µg / mL (1% (v / v), based on the number of dead cells: 10 7 HepG2 cells were cultured by adding cells.

[0129] After 2 hours of culture, HepG2 cells were washed with Dulbecco's Phosphate-Buffered Saline (DPBS, Gibco, USA), and proteins were obtained by reacting the cells with the protein extraction solutions Pro-prep solution (Intron, Korea) and Xpert phosphatase inhibitor cocktail solution (Gendepot, USA) at -20 ℃ for 20 minutes. After quantifying the extracted proteins, they were reacted with LDS Sample Buffer (Invitrogen, USA) at 95 ℃ to isolate the proteins using Protein Gels (Invitrogen, USA), and the gel from which the proteins were isolated was transferred to a PVDF membrane (Invitrogen, Israel). After the transfer was complete, the PVDF membrane was blocked with TBS with tween-20 containing 5% BSA (Biosesang, Korea) at room temperature for 2 hours. After 2 hours, the primary antibodies pAMPK and AMPK (Cell signaling, USA) were diluted 1:1,000 and incubated overnight at 4°C. After the reaction, the PVDF membrane was washed with TBS with tween-20, and then incubated with Anti-rabbit IgG HRP-linked Antibody (Cell signaling, USA) diluted 1:2,000 at room temperature for 1 hour. Subsequently, the membrane was reacted with West pico plus chemiluminescent substrate (Thermo, USA), and protein expression levels were analyzed using an iBrightFL1000 (Invitrogen, USA) western blot imaging instrument. The results are shown in Table 4.

[0130] Group AMPK Phosphorylation Expression Level (fold) Normal 1.00 FF As treatment Control 1.32 FF As treatment OPT-A 11.61

[0131] Referring to Table 4, the AMPK activation resulting from the treatment of Lactiplantibacillus plantarum OPT-A1 in lipid-synthesized HepG2 cells was examined. It was confirmed that AMPK activation occurred in the group treated with Lactiplantibacillus plantarum OPT-A1, increasing by approximately 1.61 times compared to normal cells without induced fatty liver, and by 122.3% compared to the 100% control group with induced fatty liver. Therefore, it was determined that the intake of Lactiplantibacillus plantarum OPT-A1 would be beneficial for the treatment of alcoholic and non-alcoholic fatty liver disease by increasing the oxidation of lipids within liver tissue.

[0132]

[0133] Example 4-4. Inhibitory effect on adipogenesis in HepG2 cells induced by lipid synthesis

[0134] Oil Red O staining is a reagent used to specifically stain lipid globules, allowing for the visualization of the degree of adipogenesis based on the intensity of the cell's red color. Therefore, to compare the degree of adipogenesis following treatment with Lactiplantibacillus plantarum OPT-A1, the Oil Red O staining method was used. First, to confirm the degree of adipogenesis within HepG2 cells, HepG2 cells were placed in 5×10⁶ wells of DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. 4After seeding into cells / well, the cells were cultured for 48 hours in a 37°C, 5% CO2 incubator. After 48 hours, adipogenesis was induced according to the adipogenesis induction method of Example 4-2, and 200 μg / mL of the Lactiplantibacillus plantarum OPT-A1 metabiotic prepared in Example 2 was added to the cells for culture. After 24 hours of culture, HepG2 cells were washed with DPBS and fixed with 10% formalin (Biosesang, Korea) for 10 minutes; after removing the 10% formalin, the cells were washed with 60% isopropanol for 30 seconds. After completely drying the cells at room temperature, intracellular lipids were stained with Oil Red O (Sigma, USA) solution for 30 minutes. When the fat was stained red, the Oil Red O solution was removed and washed with water, and then observed under a microscope. The stained Oil Red O was dissolved in 100% Iso-propanol (Samchun, Korea), and the absorbance was measured at 540 nm, and the results are shown in Figure 3.

[0135] Referring to Figure 3, the degree of lipid formation upon treatment with Lactiplantibacillus plantarum OPT-A1 in lipid-synthesized HepG2 cells, i.e., fatty liver-induced cells, was examined. It was confirmed that Lactiplantibacillus plantarum OPT-A1 reduced lipid formation by 12.4% compared to the fatty liver-induced cell control group. Therefore, when correlating this with the results of Figure 2, it was confirmed that lipid accumulation is inhibited by regulating lipids through increased AMPK activation within the actual lipid-synthesized liver cells.

[0136]

[0137] Examples 4-5. Confirmation of triglyceride content in lipid-synthesized HepG2 cells

[0138] Fatty liver is a disease characterized by the excessive production of fat within the liver. It is broadly classified into alcoholic fatty liver, caused by alcohol consumption, and non-alcoholic fatty liver, caused by a high-fat diet. Fatty liver is defined as a condition where the weight of accumulated fat within the liver constitutes 5% or more of the liver's total body weight. While fatty liver is merely a matter of slightly increased fat in the liver and does not typically cause specific problems, long-term persistence or continuous fat accumulation carries a very high risk of progressing to hepatitis, cirrhosis, and liver cancer. Therefore, to verify how effectively it inhibits triglyceride content in HepG2 cells with induced fat synthesis, 5×10⁶ HepG2 cells were placed in a 6-well plate using DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. 4 After seeding into cells / wells, the cells were cultured for 48 hours in a 37°C, 5% CO2 incubator. After 48 hours, adipogenesis was induced according to the adipogenesis induction method, and 200 μg / mL of the Lactibacillus plantarum OPT-A1 metabiotic prepared in Example 2 was added to the cells for culture. After 24 hours of culture, HepG2 cells were washed with DPBS, and the cells were lysed using 5% NP-40 solution (Thermo, USA). The supernatant was then collected by centrifugation, and the triglyceride content was analyzed using a Triglyceride Assay Kit (BioAssay Systems, USA) according to the manufacturer's instructions. Finally, the absorbance of each sample was measured at 570 nm using a Microplate Reader (Agilent, USA), and the results are shown in Figure 4.

[0139] As shown in Figure 4, the triglyceride content of lipid-synthesized HepG2 cells treated with Lactiplantibacillus plantarum OPT-A1 was found to be reduced by 24.8% compared to the lipid-synthesized control group (Control).

[0140] Therefore, it is confirmed that Lactibacillus plantarum OPT-A1 is a substance that lowers the lipid content in the liver of patients with alcoholic and non-alcoholic fatty liver disease.

[0141]

[0142] Examples 4-6. Confirmation of lipid oxidation and lipid synthesis gene expression patterns in lipid synthesis-induced HepG2 cells

[0143] Fatty acid translocase (FAT / CD36), located on the cell membrane, facilitates the influx of fatty acids into the cell, and Peroxisome proliferator-activated receptor-γ (PPAR-γ) is known as a transcription factor that regulates the expression of FAT / CD36. In this process, to regulate lipid synthesis, AMPK is activated to suppress the expression of lipid synthesis genes; additionally, lipids are oxidized by increasing mitochondrial beta-oxidation through the activation of Peroxidase proliferator-activated receptor-α (PPAR-α) and Carnitine palmitoyltransferase 1 (CPT1). Therefore, to confirm the gene expression patterns of Lactiplantibacillus plantarum OPT-A1 within HepG2 cells, HepG2 cells were plated in 6-well plates containing 5×10⁶ cells in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. 4After seeding into cells / wells, the cells were cultured for 48 hours in a 37°C, 5% CO2 incubator. After 48 hours, adipogenesis was induced according to the induction method, and the cells were cultured after adding 200 µg / mL of the Lactiplantibacillus plantarum OPT-A1 metabiotic prepared in Example 2. After 2 or 24 hours of culture, HepG2 cells were washed with DPBS, and RNA was extracted using the AccuPrep Universal RNA Extraction Kit (Bioneer, Korea) to isolate total RNA, followed by AccuPower ® cDNA complementary to RNA was obtained using RocketScript™ Cycle RT PreMix (Bioneer, Korea). Subsequently, the expression patterns of lipid oxidation and lipid synthesis genes were confirmed using the CFX connect Real-Time PCR detection system (Bio-rad, USA) with each primer shown in Table 5 below and TB Green® Premix Ex Taq™ II (Takara, Japan), and the results are shown in Table 6.

[0144] PrimerNo.Sequence (5'-3')PPAR-α Forward Sequence No. 4acgattcgac tcaagctggtPPAR-α Reverse Sequence No. 5gttgtgtgac atcccgacagCPT1 Forward Sequence No. 6ggaatgaaat tcccactgtc tgtcCPT1 Reverse Sequence No. 7cagttcagcc atcgctgttg taFAT / CD36 Forward Sequence No. 8aatgtaaccc aggacgctgaFAT / CD36 Reverse Sequence No. 9agccagattg agaactgtga agPPAR-γ Forward Sequence No. 10accaaagtgc aatcaaagtg gaPPAR-γ Reverse Sequence No. 11atgagggagt tggaaggctc tFAS Forward Sequence No. 12ttctacggct ccacgctctt ccFAS Reverse sequence number 13gaagagtctt cgtcagccag gaβ-actin Forward sequence number 14catgtacgtt gctatccagg cβ-actin Reverse sequence number 15ctccttaatg tcacgcacga t

[0145] Relative amount of groupmRNA (fold)PPAR-αCPT-1FAT / CD36PPAR-γFASNormal1.091.160.470.400.75FFAs treatementControl1.001.001.181.001.00FFAs treatementOPT-A11.591.620.570.580.64

[0146] As shown in Table 6, analysis of lipid oxidation and lipid synthesis gene patterns in lipid-synthesized HepG2 cells treated with Lactiplantibacillus plantarum OPT-A1 revealed that Lactiplantibacillus plantarum OPT-A1 increased lipid oxidation-related genes, specifically PPAR-α and CPT1. Additionally, as lipid synthesis-related genes, such as FAT / CD36, PPARγ, and FAS, decreased, it is possible to regulate and inhibit lipid synthesis by activating a continuous lipid oxidation system during the actual adipogenesis process. Therefore, Lactiplantibacillus plantarum OPT-A1 can be developed as a therapeutic agent and a lipid-reducing ingredient by inhibiting and treating lipid accumulation in patients with alcoholic and non-alcoholic fatty liver disease.

[0147]

[0148] Example 5. Muscle cell growth efficacy of Lactibacillus plantarum OPT-A1

[0149] Example 5-1. C2C12 cell culture

[0150] The number of patients with sarcopenic obesity, characterized by a decline in muscle mass and function while fat mass increases due to factors such as aging and reduced physical activity, is increasing rapidly. Sarcopenia accompanied by obesity can lead to higher levels of metabolic disorders and an increased risk of death compared to cases where obesity or sarcopenia is present alone. Furthermore, to prevent and manage sarcopenia associated with dieting, balanced nutrition, consistent exercise, and an appropriate internal environment are essential. In particular, probiotics aid muscle growth by promoting the expression of proteins involved in cell growth, and their metabolites play a role in reducing blood glucose levels by assisting in glucose absorption. Therefore, to confirm the promotion of muscle cell growth and myotube differentiation from Lactiplantibacillus plantarum OPT-A1, mouse-derived myoblasts, C2C12 cells, were purchased from the American Type Culture Collection (ATCC), and subcultures were performed every 2-3 days in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin at 37°C in a 5% CO2 incubator while maintaining a confluence of 50-60%.

[0151]

[0152] Example 5-2. Confirmation of the proliferation-promoting effect of C2C12 cells

[0153] To confirm the cell proliferation-promoting ability of Lactiplantibacillus plantarum OPT-A1, an MTT (3-(4,5-dimethlthiazol-2-yl)-2,5-diphenyltetrazolium bromide, Sigma, USA) assay was performed. First, C2C12 cells were placed in a 96-well plate at a ratio of 1×10⁶ in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. 5After dispensing into cells / well, the cells were cultured for 24 hours in a 37°C, 5% CO2 incubator. After 24 hours, 200 μg / mL of the Lactibacillus plantarum OPT-A1 metabiotic prepared in Example 2 was added to serum-free media and cultured. After 24 hours, the supernatant was removed, and MTT (5 mg / mL) reagent was added and cultured for 4 hours in a 37°C, 5% CO2 incubator. After 4 hours, the media was removed, and the formazan produced by lysing the cells with dimethyl sulfoxide (DMSO, Sigma, USA) was measured at 590 nm using a microplate reader (BioTek, Korea), and the results are shown in Figure 5.

[0154] Referring to Figure 5, the C2C12 cell proliferation-promoting ability of Lactiplantibacillus plantarum OPT-A1 metabiotic treatment was confirmed, and it was found that the group treated with Lactiplantibacillus plantarum OPT-A1 increased by 53.8% compared to the normal group. Therefore, it was determined that Lactiplantibacillus plantarum OPT-A1 promotes the growth of muscle cells in the body, which helps strengthen muscles and improve exercise function.

[0155]

[0156] Example 5-3. Muscle cell differentiation-promoting efficacy of Lactibacillus plantarum OPT-A1

[0157] Example 5-3-1. Differentiation of C2C12 myocytes into myotubes

[0158] When the C2C12 cells cultured in Example 5-1 reached 90% confluency, the media was removed, and differentiation into myotubes was induced by culturing them in DMEM supplemented with 2% horse serum (gibco, USA) and 1% penicillin / streptomycin at 37°C in a 5% CO2 incubator.

[0159]

[0160] Example 5-3-2. Jenner's-Giemsa staining

[0161] Myotubes differentiated from myocytes were washed with phosphate buffer saline (PBS, Sigma, USA) and fixed with 100% methanol (Duksan, Korea) for 10 minutes. After 10 minutes, the fixative was removed, and the myotubes were stained with Jenner staining solution (1:3, 1 mM sodium phosphate buffer) and Giemsa staining solution (1:20, 1 mM sodium phosphate buffer) for 10 minutes and 5 minutes, respectively. The stained myotubes and cell nuclei were photographed at x20 magnification using a microscope (EVOS M5000, Thermo, USA) and analyzed using Image J software.

[0162]

[0163] Example 5-3-3. Immunofluorescence

[0164] Myotubes differentiated from myocytes were washed with PBS and fixed with 10% formalin (Biosesang, Korea) for 10 minutes. After 10 minutes, the fixative was removed, and the tubes were permeabilized with PBS containing 0.5% Triton-X100 (Daejung, Korea) for 10 minutes. After blocking with 1% BSA for 30 minutes, the tubes were incubated with an anti-MHC (myosin heavy chain) antibody (Abcam, UK) overnight at 4°C and then washed with PBS. Subsequently, the tubes were treated with the secondary antibody Alexa Fluor 488 Goat anti-Rabbit IgG (Abcam, UK) for 1 hour at room temperature, and then treated with DAPI (4', 6-diamidino-2-phenylindole) as a counterstain for 30 minutes. Stained myotubes and cell nuclei were imaged at x20 magnification using a fluorescence microscope (EVOS M5000, Thermo, USA) and analyzed using Image J software.

[0165]

[0166] Example 5-3-4. Confirmation of differentiation-promoting effect of C2C12 cells

[0167] To confirm the cell differentiation-promoting ability of Lactiplantibacillus plantarum OPT-A1, the fusion index was measured and utilized in the results. First, C2C12 myocytes were placed in 8×10⁶ 35 mm dishes using DMEM supplemented with 10% FBS and 1% P / S. 4After dispensing into cells / well, the cells were cultured in a 37°C, 5% CO2 incubator until 80% confluency was reached in the dish. Subsequently, 200 μg / mL of the Lactibacillus plantarum OPT-A1 metabiotic prepared in Example 2 was added to DMEM supplemented with 2% horse serum and 1% penicillin / streptomycin, and differentiation was induced for 6 days. After differentiation was complete, Jenner's-Giemsa staining and immunofluorescence were performed, and the results are shown in Figure 6.

[0168] When the C2C12 cell differentiation-promoting ability of Lactiplantibacillus plantarum OPT-A1 metabiotic was confirmed, Jenner's-Giemsa staining results (Fig. 6A) and Immunofluorescence results (Fig. 6B) showed that the fusion index of the group treated with Lactiplantibacillus plantarum OPT-A1 metabiotic increased to 103.5% (Fig. 6A) and 106.6% (Fig. 6B), respectively, compared to the normal group (Normal) at 100.0%.

[0169] Fusion index (%) = {(Number of differentiated nuclei in the root canal) / (Total number of nuclei)} x 100

[0170] Therefore, it was determined that the Lactibactibacillus plantarum OPT-A1 metabiotic would be helpful in strengthening muscle strength and improving exercise function by promoting the differentiation of muscle cells in the body and participating in the maturation process of muscle fibers.

[0171]

[0172] Example 5-3-5. Confirmation of the effect of IGF-1 on mTOR and Akt expression, signaling pathways

[0173] Protein analysis was performed using Western blot to determine the effects of Lactiplantibacillus plantarum OPT-A1 on the expression of mTOR (mammalian target of rapamycin) and Akt (also known as Protein Kinase B / PKB), proteins involved in muscle synthesis and the IGF-1 (Insulin-like growth factor 1) signaling pathway. To confirm protein expression levels in the myocyte proliferation model and myotube differentiation model described in the above example, cells were washed with DPBS, and proteins were obtained by centrifuging at 4°C for 20 minutes using RIPA lysis buffer (Thermo, USA) and protease & phosphatase inhibitor cocktail (Thermo, USA), which are protein extraction solutions. After quantification, the extracted proteins were reacted with LDS Sample buffer at 95°C to isolate the proteins using protein gels, and the gel from which the proteins were isolated was transferred to a PVDF membrane. After the transfer was complete, the PVDF membrane was blocked with TBS with tween-20 containing 5% BSA at room temperature for 2 hours. After 2 hours, the primary antibodies p-mTOR, mTOR, p-Akt, and Akt (Cell Signaling, USA) were diluted 1:1,000 and incubated overnight at 4°C. After the reaction, the PVDF membrane was washed with TBS with tween-20, and the anti-rabbit IgG HRP-linked antibody (Cell Signaling, USA) was diluted 1:2,000 and incubated at room temperature for 1 hour. Subsequently, the membrane was reacted with West pico plus chemiluminescent substrate, and protein expression levels were analyzed using an iBrightFL1000 western blot imaging instrument. The results are shown in Table 7.

[0174] Group Protein Phosphorylation Expression Level (fold) Myocyte Proliferation Model Myotube Differentiation Model p-mTOR / mTOR p-Akt / Akt p-mTOR / mTOR p-Akt / AktNormal 1.001.001.001.00 OPT-A 11.33 1.14 1.14 1.27

[0175] As shown in Table 7 above, protein expression levels were examined in a myocyte proliferation model and a myotube differentiation model in response to treatment with Lactiplantibacillus plantarum OPT-A1 metabiotics. In the myocyte proliferation model, the p-mTOR / mTOR ratio in the Lactiplantibacillus plantarum OPT-A1 metabiotics treatment group increased to 133.1% and the p-Akt / Akt ratio increased to 113.7% compared to the normal group (Normal) at 100%. In addition, in a myotube differentiation model, the p-mTOR / mTOR ratio increased to 114.1% and the p-Akt / Akt ratio increased to 127.3% in the group treated with Lactiplantibacillus plantarum OPT-A1 metabiotics compared to 100% in the normal group, suggesting that Lactiplantibacillus plantarum OPT-A1 can help improve sarcopenia associated with obesity and diet-related sarcopenia by promoting muscle development.

[0176]

[0177] Example 6. Confirmation of fatty liver-related metabolic responses of Lactiplantibacillus plantarum OPT-A1

[0178] Example 6-1. Experimental animals

[0179] 7-week-old male C57BL / 6 mice were purchased from Orient Bio and used as experimental animals, and all animal experiments were performed at the non-clinical research institute, CoaStemChemOn. The animals were acclimatized for one week, and rearing conditions were maintained in a sterile environment with a temperature of 22 ± 3 ℃, humidity of 55 ± 15%, and a 12-hr light / 12-hr dark cycle (from 08:00 to 20:00). Subsequently, the experimental animals were allowed to freely consume either the 10% Kcal normal diet group (NCD, Normal Chow Diet, D12492, Research Diet) or the 60% Kcal high-fat diet group (HFD, High Fat Diet, D12492, Research Diet) for eight weeks. After 8 weeks, a group was separated from the high-fat diet group to administer the test substance Lactiplantibacillus plantarum OPT-A1, and the Lactiplantibacillus plantarum OPT-A1 metabiotic produced in Example 2-2 was administered to the separated group at a dose of 20 mg / head / day.

[0180]

[0181] Example 6-2. Weight measurement

[0182] To determine the effect of administering Lactibactibacillus plantarum OPT-A1 on body weight in a high-fat diet-induced mouse model, the body weight of the experimental animals was measured twice a week during the experiment period, and the changes in body weight over 112 days, or 8 weeks, were checked and the results are shown in Figure 7.

[0183] When checking the body weight of the group administered Lactiplantibacillus plantarum OPT-A1 metabiotic, it was confirmed that the body weight of the group treated with Lactiplantibacillus plantarum OPT-A1 metabiotic decreased by 12.3% compared to 100% of the high-fat diet control group (HFD), and when comparing the body weight gain from the time of metabiotic administration, it was confirmed that the group administered Lactiplantibacillus plantarum OPT-A1 decreased by 58.6% compared to 100% of the high-fat diet control group (HFD).

[0184]

[0185] Example 6-3. Body fat mass analysis

[0186] Body fat mass from each individual mouse was measured using DEXA (Dual Energy X-Ray Absorptiometry; Hologic Discovry A) to image the body fat mass, and the results are shown in Fig. 8.

[0187] As a result of examining the body fat mass of the group administered Lactiplantibacillus plantarum OPT-A1 metabiotic, it was confirmed that the body fat mass of the group treated with Lactiplantibacillus plantarum OPT-A1 metabiotic decreased by 15.1% compared to 100.0% of the high-fat diet control group (HFD). Therefore, since the administration of Lactiplantibacillus plantarum OPT-A1 metabiotic reduces body fat mass even when combined with a high-fat diet, it can be developed as a therapeutic agent and raw material suitable for the prevention and treatment of obesity or metabolic diseases.

[0188]

[0189] Example 6-4. Measurement of tissue weight

[0190] To measure the degree of fat formation in each tissue from each individual mouse, each tissue was extracted, photographed, and weighed, and the results are shown in Fig. 9.

[0191] As a result of examining the tissue weights of the group administered Lactiplantibacillus plantarum OPT-A1 metabiotic, it was confirmed that the group treated with Lactiplantibacillus plantarum OPT-A1 metabiotic showed a reduction in visceral fat by 30.0%, subcutaneous fat by 18.3%, and liver by 20.2% compared to the high-fat diet control group (HFD) at 100.0%. Since the weight of the liver increases as fat is produced, the inhibitory effect on non-alcoholic fatty liver disease was confirmed by suppressing fat accumulation in non-alcoholic fatty liver disease induced by a high-fat diet. Therefore, it can be developed as a therapeutic agent and raw material suitable for the treatment of non-alcoholic fatty liver disease as well as obesity.

[0192]

[0193] Example 6-5. Histopathological analysis

[0194] For the histopathological analysis of liver and visceral fat from each mouse, each tissue was fixed in a 10% formalin solution and embedded in paraffin to create a paraffin block. The tissues were then sectioned and stained with Hematoxylin & Eosin (H&E). The tissue sections were observed using a light microscope (BX61, Olympus, Japan) and photographs were taken (DP80, Olympus, Japan). For the quantitative histopathological analysis of hepatocytes, hepatocellular steatosis and adipocyte size were analyzed using Image-Pro software (Media Cybernetics, USA). The hepatocellular steatosis score was quantified as a score of 0 to 3 as shown in Table 6 (World J Gastroenterol. 2014, 20(42), 15539-15548), and the results are shown in Fig. 10.

[0195] CategoryScore < 5% of liver parenchyma Normal liver cells 05~33% Mild fatty liver cells 133~66% Moderate fatty liver cells 2 >66% Severe fatty liver cells 3

[0196] As a result of examining the degree of fatty liver formation and the size of adipocytes in visceral adipose tissue in the group administered Lactiplantibacillus plantarum OPT-A1 metabiotic, the steatosis score of the group treated with Lactiplantibacillus plantarum OPT-A1 metabiotic decreased by 63.3% compared to 100% of the high-fat diet control group (HFD) (Fig. 10a). This result was lower than that of normal mice not fed a high-fat diet, indicating that the liver condition was in a recovered state, and it was confirmed that the size of adipocytes also decreased by 12.5% ​​(Fig. 10b).

[0197]

[0198] Example 6-6. Confirmation of AMPK activation within the tissue

[0199] To perform protein analysis from each mouse, proteins were extracted by homogenizing each tissue with a RIPA solution containing a protease inhibitor and a phosphate inhibitor. Proteins were isolated using protein gels, and the gel containing the isolated proteins was transferred to a PVDF membrane. After the transfer, the PVDF membrane was blocked with skim milk, and pAMPK and AMPK were incubated overnight at 4°C. After washing the PVDF membrane, the secondary antibodies were incubated at room temperature for 1 hour. Subsequently, the reaction was performed using Super Signal West Femto Maximum Sensitivity Substrate (Thermo, USA), and protein expression levels were analyzed using an image analysis device; the results are shown in Table 9.

[0200] Group pAMPK / AMPK Protein Phosphorylation Expression Level (%) Visceral Fat Subcutaneous Fat Liver NCD : Normal Group 25 5.9 23 4.5 35 6.0 HFD : High-fat diet administration Control Group 10 0.0 10 0.0 10 0.0 HFD + OPT-A1 : High-fat diet and metabiotic administration 16 7.0 11 8.9 11 5.0

[0201] When the expression levels of AMPK protein in the group administered Lactiplantibacillus plantarum OPT-A1 metabiotic were examined, the Lactiplantibacillus plantarum OPT-A1 metabiotic treatment group showed increases of 167.0% in visceral fat, 118.9% in subcutaneous fat, and 115.0% in the liver compared to 100% in the high-fat diet group (HFD). By inhibiting fat synthesis through the promotion of fatty acid oxidation, it can be developed as a therapeutic agent and raw material suitable for treating not only obesity but also non-alcoholic fatty liver disease.

[0202]

[0203] Examples 6-7. Blood Biochemical Analysis

[0204] Blood collected from each mouse was coagulated by reacting in a tube containing a thromboactivator at room temperature for 30 minutes, and then centrifuged using a centrifuge at 3000 rpm for 10 minutes. The collected serum was used to analyze Aspartate aminotransferase (AST), Alanine aminotransferase (ALT), and Total cholesterol (TCHO). Intrahepatic triglycerides (TG) were analyzed using the Picosens Triglyceride Assay Kit (Biomax, Korea) according to the manufacturer's instructions. Adiponectin was analyzed using the Mouse Adiponectin / Acrp30 Quantikine ELISA Kit (R&D system, USA) according to the manufacturer's instructions, and the measured results are shown in Table 10.

[0205] Group Blood Biochemical Analysis Tissue Analysis TCHO (mg / dL) AST (U / L) ALT (U / L) Adiponectin (μg / mL) TG (mg / dL) NCD : Normal Group 135.67 66.4 24.4 37.2 43.40 HFD : High-fat diet administration Control Group 159.00 78.25 0.8 46.17 5.19 HFD + OPT-A1 : High-fat diet and metabiotic administration 144.38 69.5 26.3 36.5 74.20

[0206] Analysis of blood biomarkers in the group administered Lactiplantibacillus plantarum OPT-A1 metabiotics revealed that, when the values ​​were set to 100% of the high-fat diet control group (HFD), TCHO decreased by 9.2%, AST by 11.1%, and ALT by 34.3%. Conversely, Adiponectin increased by 106.4%, and liver tissue TG decreased by 19.0%. Therefore, it can be seen that Lactiplantibacillus plantarum OPT-A1 metabiotics regulates lipid synthesis by inhibiting endogenous cholesterol and hepatic triglycerides, and also maintains lower AST and ALT levels associated with fatty liver disease. Notably, AST and ALT results largely recovered to levels comparable to the normal group not induced by a high-fat diet. In addition, the simultaneous increase in the lipolytic hormone Adiponectin allows OPT-A1 to inhibit fat synthesis by promoting fat oxidation, making it suitable for use as a therapeutic agent and raw material for the treatment of not only obesity but also non-alcoholic fatty liver disease.

[0207]

[0208] Example 7. Confirmation of antimicrobial activity against microorganisms involved in lipid synthesis

[0209] Lipopolysaccharide (LPS), produced by Escherichia coli, a type of intestinal microorganism, travels systemically to induce inflammation through inflammatory signaling and affects lipid synthesis metabolism. Additionally, it has been reported that alcohol produced within the patient's body during the metabolic process by Klebsiella pneumoniae travels to the liver via the portal vein, causing lipid synthesis and cytotoxicity, thereby inducing fatty liver (EBioMedicine. Guanhua Xue et al).

[0210] Therefore, to determine whether Lactiplantibacillus plantarum OPT-A1 inhibits the growth of Escherichia coli and Klebsiella pneumoniae, which are involved in lipid synthesis metabolism, Escherichia coli KCTC2441 T and Klebsiella pneumonia KCTC12385 T It was obtained from the Korea Research Institute of Bioscience and Biotechnology's Biological Resource Center and used in experiments.

[0211] First, each strain was cultured using Nutrient broth, and to confirm antimicrobial activity, Escherichia coli KCTC2441 was cultured on Mueller Hinton (MB cell, Korea) agar medium. T and Klebsiella pneumonia KCTC12385 T 1x10 each on the agar 5 Agar media containing each strain were prepared by incorporating them at a concentration of CFU / mL. On the prepared agar media, 100 μL of the Lactibacillus plantarum OPT-A1 metabiotic prepared in Example 2-1 was dispensed onto 10 mm paper discs to achieve a final concentration of 20 μg / mL, and the mixture was incubated in a 37°C incubator for 12 hours. After 12 hours of incubation, the presence or absence of a clear zone, which indicates inhibited growth of E. coli, was checked. The results are shown in Figure 11.

[0212] Referring to Fig. 11, the results of measuring the antimicrobial activity of Lactibacillus plantarum OPT-A1 showed that the intestinal microorganism Escherichia coli KCTC2441 associated with fatty liver formation T and Klebsiella pneumonia KCTC12385 T It can be seen that they exhibit excellent antibacterial activity with antibacterial zones of 14.93 mm and 14.87 mm, respectively.

[0213] This is the above-mentioned standard strain Escherichia coli KCTC2441 T and Klebsiella pneumonia KCTC12385 T It was confirmed through additional experiments that at least three other strains of the same species, including Escherichia coli and Klebsiella pneumoniae, each exhibited similar activity.

[0214] Therefore, Lactiplantibacillus plantarum OPT-A1 can regulate fat in fatty liver while simultaneously establishing a beneficial intestinal microbiome environment.

[0215]

[0216] [Consignment Number]

[0217] Depository: Korea Research Institute of Bioscience and Biotechnology

[0218] Trustee Number: KCTC15555BP

[0219] Date of Trust: 20230818

[0220]

Claims

1. A composition for regulating liver lipid metabolism characterized by comprising the Lactiplantibacillus plantarum OPT-A1 strain deposited at KCTC15555BP, the culture medium thereof, the culture thereof, or the culture lysate thereof.

2. In Paragraph 1, The above composition is a composition for regulating liver lipid metabolism, characterized by inhibiting lipid accumulation within liver cells.

3. In Paragraph 1, The above composition is a composition for regulating liver lipid metabolism characterized by having the efficacy of activating AMPK (AMP-activated protein kinase) in liver cells.

4. In Paragraph 1, The above composition is a composition for regulating liver fat metabolism characterized by inhibiting the accumulation of triglycerides in liver cells.

5. In Paragraph 1, The above composition is a composition for regulating liver fat metabolism characterized by reducing the production of blood triglycerides, total cholesterol, AST (Aspartate aminotransferase), and ALT (Alanine aminotransferase).

6. In Paragraph 1, The above composition is a composition for regulating liver fat metabolism characterized by increasing the production of adiponectin, a fat-degrading hormone.

7. In Paragraph 1, The above composition is a composition for regulating liver lipid metabolism characterized by inhibiting the expression of fat synthesis-related genes, such as FAT / CD36 (Fatty acid translocase), PPARγ (Peroxisome proliferator-activated receptor-γ), or FAS (Fatty acid synthase).

8. In Paragraph 1, The above composition is a composition for regulating liver lipid metabolism characterized by enhancing the expression of fatty acid oxidation-related genes, PPAR-α (Peroxidase proliferator-activated receptor-α) and CPT1 (Carnitine palmitoyltransferase 1).

9. In Paragraph 1, The above composition is a composition for regulating liver fat metabolism, characterized by having antibacterial activity against Escherichiacoli or Klebsiella pneumoniae, which induce fatty liver formation.

10. In Paragraph 1, A composition for regulating liver lipid metabolism characterized by activating GLP-1 (glucagon-like peptide-1).

11. In Paragraph 1, The above composition is a composition for regulating liver fat metabolism characterized by having muscle-increasing efficacy.

12. A pharmaceutical composition for the prevention or treatment of fatty liver, characterized by comprising the composition of claim 1.

13. A food composition for the prevention or improvement of fatty liver, characterized by comprising the composition of claim 1.

14. A method for treating fatty liver using the Lactiplantibacillus plantarum OPT-A1 strain deposited at KCTC15555BP, its culture medium, its culture or its lysate.