AAV vector and use thereof in treatment of brain glioma

Abstract

Provided in the present invention are an AAV vector and use thereof in the treatment of brain glioma. The AAV vector comprises a pyroptosis effector protein-N-terminal fragment (GSDMD NTD) coding gene, and a promoter operably linked to the GSDMD NTD coding gene.

Description

AAV vectors and their use in the treatment of glioma Technical Field

[0001] This application belongs to the field of gene therapy technology, specifically relating to AAV vectors and their use in the treatment of glioma. Background Technology

[0002] Gliomas are tumors originating from glial cells in the central nervous system and are the most common primary intracranial tumors. Gliomas are characterized by high rates of disability and recurrence, seriously threatening patients' lives, impacting their quality of life, and imposing a heavy burden on individuals, families, and society. Clinical treatments for gliomas mainly include surgery, radiotherapy, chemotherapy, and VEGF antibody therapy. Clinical trial results show that the median overall survival (OS) for patients undergoing surgery and radiotherapy is approximately 12.1 months (11.2-13 months), and the median progression-free survival (PFS) is approximately 5 months (4.2-5.5 months). For patients undergoing surgery, radiotherapy, and temozolomide chemotherapy, the median OS is approximately 14.6 months (13.2-16.8 months), and the median PFS is approximately 6.9 months (5.8-8.2 months). In clinical trials, VEGF antibody bevacizumab treatment did not prolong the median OS of patients undergoing surgery, radiotherapy, and temozolomide chemotherapy, but it improved the median PFS by approximately 3 months. The PD-1 antibody nivolumab, an immune checkpoint inhibitor, has also failed to achieve success in clinical trials for glioblastoma. Furthermore, due to the blood-brain barrier, most small molecule drugs and antibody drugs struggle to penetrate it and reach effective concentrations in the brain to exert their effects. Therefore, developing targeted small molecule drugs and antibody drugs for glioblastoma is extremely challenging. Consequently, there is a significant unmet clinical need for treatment in glioblastoma patients. With the development of gene therapy and precise local brain drug delivery technologies, the development of targeted gene therapies for gliomas is becoming increasingly mature, offering patients more treatment options.

[0003] GSDMD stands for Gasdermin D, a protein that plays a crucial role in pyroptosis and inflammatory responses, and belongs to the gasdermin protein family. Gasdermin D (GSDMD) is encoded by the GSDMD gene and is cleaved upon activation of the NLRP3 inflammasome, forming an N-terminal fragment with membrane-perforating activity, triggering pyroptosis and the release of inflammatory factors. Its alternative names include GSDMDC1, DFNA5L, or FKSG10.

[0004] Pyroptosis is a highly inflammatory form of lytic programmed cell death. It is mediated by the GSDMD protein. When cells are infected by pathogens, intracellular cysteine ​​proteases Caspase-1, Caspase-4, Caspase-5, and Caspase-11 are activated, further cleaving GSDMD to produce the GSDMD N-terminal domain (GSDMD NTD). GSDMD NTD oligomerizes to form a pore-drilling complex, which punches holes in the cell membrane, leading to the release of intracellular lysates and a strong inflammatory response. Recent studies have shown that pyroptosis can directly kill tumor cells and also trigger a strong anti-tumor immune response, recruiting a large number of lymphocytes to the tumor microenvironment to eliminate tumor cells. Combining pyroptosis with immune checkpoint inhibitors such as anti-PD-1 antibodies can significantly improve the therapeutic effect on tumors.

[0005] Developing gene therapy strategies that specifically induce pyroptosis in tumor cells is a potential approach to cancer treatment. Recombinant adeno-associated virus (rAAV) is a commonly used gene therapy vector in clinical practice, possessing advantages such as physicochemical stability, low immunogenicity, and long-term expression. However, the strong cytotoxicity of GSDMD NTD poses a significant challenge to packaging high-titer rAAV in mammalian cells. Furthermore, the specific expression of GSDMD NTD in tumor cells while simultaneously reducing its expression in normal tissues remains a key difficulty in developing gene therapy strategies. Summary of the Invention

[0006] In view of the problems existing in the prior art, the purpose of this application is to provide an AAV carrier and its use in the treatment of glioma.

[0007] Specifically, this application relates to the following aspects:

[0008] 1. An AAV vector comprising a gene encoding a pyroptosis executive protein-N-terminal fragment (GSDMD NTD) and a promoter operatively linked to the GSDMD NTD gene.

[0009] 2. The AAV vector according to claim 1, wherein the promoter is a glioma-specific promoter.

[0010] 3. The AAV vector according to item 2, wherein the promoter is selected from one or more of the group consisting of: GfaABC1D, GFAP, ALDH1L1, BLBP / FABP7, Nestin, Survivin, hTERT and EGFRvIII.

[0011] 4. The AAV carrier according to any one of items 1-3, wherein the AAV is AAV DJ, AAV 1, AAV 2, AAV 5, AAV 6, AAV 8, AAV 9, AAV PHP.B, AAV PHP.eB, AAV PHP.S, AAV Retro, AAV B10, AAV rh10 or a variant thereof.

[0012] 5. The AAV carrier according to any one of items 1-4, wherein the AAV is a self-complementary AAV.

[0013] 6. The AAV carrier according to item 5, wherein the AAV is a self-complementary AAV DJ.

[0014] 7. The AAV vector according to any one of items 1-6, wherein the GSDMD NTD is derived from a mammal, optionally from a mouse or a human.

[0015] 8. The AAV vector according to claim 7, wherein the GSDMD NTD comprises or is composed of the following protein fragments:

[0016] A protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with at least 1-150, 1-200, 1-230, 1-250, or 1-276 amino acids at the N-terminus of the mouse GSDMD protein.

[0017] 9. The AAV vector according to item 8, wherein the nucleotide sequence of the GSDMD NTD encoding gene is shown in SEQ ID NO:2.

[0018] 10. The AAV vector according to claim 7, wherein the GSDMD NTD comprises or is composed of the following protein fragments:

[0019] A protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with at least 1-150, 1-200, 1-230, 1-250, or 1-275 amino acids at the N-terminus of the human GSDMD protein.

[0020] 11. The AAV vector according to any one of claims 1-10, wherein the AAV vector further comprises a miRNA target sequence operatively linked to the GSDMD NTD encoding gene to reduce the expression of the GSDMD NTD encoding gene in a non-target tissue, wherein the miRNA target sequence is a sequence that binds to a miRNA highly expressed in a target tissue.

[0021] 12. A pharmaceutical composition comprising the AAV carrier described in any one of items 1-11, and a pharmaceutically acceptable carrier.

[0022] 13. A method of treating glioma, comprising administering to a subject a therapeutically effective amount of any one of items 1-11, or the pharmaceutical composition described in item 12.

[0023] 14. The method of claim 13, wherein the method further comprises administering one or more additional therapeutic agents to the subject.

[0024] 15. The method according to item 14, wherein the additional therapeutic agent is temozolomide.

[0025] 16. The method according to any one of items 13-15, wherein the additional therapeutic agent is administered before, after, or simultaneously with the AAV carrier.

[0026] 17. The method according to any one of claims 13-16, wherein the glioma is a GFAP-positive glioma.

[0027] 18. The method according to any one of items 13-17, wherein the subject is a human.

[0028] 19. Use of the AAV carrier described in any one of items 1-11 in the preparation of a medicament for treating glioma.

[0029] 20. The use according to item 19, wherein the glioma is a GFAP-positive glioma.

[0030] 21. The use according to item 19 or 20, wherein the drug is used in humans.

[0031] 22. Use of the AAV carrier and one or more other therapeutic agents as described in any one of items 1-11 in the preparation of a medicament for treating glioma.

[0032] 23. The use according to item 22, wherein the additional therapeutic agent is temozolomide.

[0033] 24. Use of the AAV carrier according to any one of items 1-11 in the preparation of a medicament for treating glioma, wherein the medicament is a medicament for use of the AAV carrier in combination with one or more other therapeutic agents, optionally, the other therapeutic agent being temozolomide.

[0034] 25. The use according to any one of items 22-24, wherein the glioma is a GFAP-positive glioma.

[0035] 26. The use according to any one of items 22-25, wherein the drug is used in humans.

[0036] This application provides a targeted gene therapy strategy for GFAP-positive gliomas. Using the scAAV-DJ serotype as an expression vector, the GfaABC1D promoter is used to express GSDMD NTD in GFAP-positive glioma cells, inducing pyroptosis and thus treating GFAP-positive gliomas. This application has potential clinical translational value, providing more treatment options for glioma patients. Attached Figure Description

[0037] Figure 1 shows the detection results of GFAP expression in GL261 cells; protein immunoblotting was used to detect GFAP in GL261 cells (top of Figure 1) and the internal control tubulin (bottom of Figure 1).

[0038] Figure 2 shows the results of infecting GL261 cells with different AAV serotypes; pAAV-CMV-mScarlet was packaged with different AAV serotypes AAV6, AAV8, AAV9, AAV.Cap-B10, AAV-PHP.eB and AAV-DJ, and GL261 cells were infected with the virus at MOI 1e4. After 48 hours of infection, the expression of mScarlet fluorescent protein was detected by fluorescence microscopy.

[0039] Figure 3 shows the activity of the GfaABC1D promoter in GL261 cells; GL261 cells were infected with AAV virus (scAAV-DJ-GfaABC1D-mScarlet) with different MOIs (0, 1e4, 1e5), and the expression of mScarlet was detected by fluorescence microscopy 48 hours after infection.

[0040] Figure 4 shows the efficiency of different ssAAV and scAAV in expressing the target gene in tumor cells; GL261 cells were infected with MOI 1e4 AAV virus (ssAAV-DJ-GfaABC1D-mScarlets and cAAV-DJ-GfaABC1D-mScarlets), and the expression of mScarlets was detected by fluorescence microscopy 48 hours after infection.

[0041] Figure 5 shows the results of GSDMD NTD expression in GL261 cells by different titers of scAAV-DJ-GfaABC1D-GSDMD NTD virus. GL261 cells were infected with AAV virus (scAAV-DJ-GfaABC1D-GSDMD NTD) with different MOIs (0, 1e3, 1e4, 1e5). After 48 hours of infection, GSDMD NTD and the internal control tubulin were detected by Western blotting (top of Figure 5).

[0042] Figure 6 shows the effect of scAAV-DJ-GfaABC1D-GSDMD NTD virus on killing GL261 cells in vitro. GL261 cells were infected with AAV virus at MOI 1e4 (control: scAAV-DJ-GfaABC1D-mScarlet, GSDMD NTD: scAAV-DJ-GfaABC1D-GSDMD NTD). Cell counts were performed at 48 and 96 hours post-infection to reflect GL261 cell death. Each group had three biological replicates. All data were standardized using the mean of the three biological replicates in the control group, and statistical differences were analyzed using Student's T test.

[0043] Figure 7 shows the efficacy of scAAV-DJ-GfaABC1D-GSDMD NTD virus in treating GL261 glioma in vivo; Figure 7. Top: Schematic diagram of the experimental protocol, vg represents vector genome; Figure 7. Bottom: Mouse survival curve, n represents number (representing the number of mice), mOS represents median overall survival (representing the median survival time), and statistical difference analysis was performed using the log-rank (Mantel-Cox) test.

[0044] Figure 8 shows the efficacy of in vivo treatment of GL261 glioma with scAAV-DJ-GfaABC1D-GSDMD NTD virus combined with the chemotherapy drug temozolomide; upper part of Figure 8: schematic diagram of the experimental protocol, vg represents vector genome, ip represents intraraperitoneal; lower part of Figure 8: mouse survival curve, n represents number (representing the number of mice), mOS represents median overall survival (representing the median survival time), and statistical difference analysis was performed using the log-rank (Mantel-Cox) test. Detailed Implementation

[0045] The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.

[0046] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.

[0047] definition

[0048] As used herein, the term "gene" or "coding gene" refers to the deoxyribonucleotide sequence containing the coding region of a structural gene. A "gene" may also include untranslated sequences located near the 5' and 3' ends of the coding region, such that the gene corresponds to the length of full-length mRNA. A sequence located at the 5' end of the coding region and present on the mRNA is called a 5' untranslated sequence. A sequence located at or downstream of the 3' end of the coding region and present on the mRNA is called a 3' untranslated sequence. The term "gene" includes both the cDNA and genomic forms of a gene. mRNA plays a role in translation to specify the sequence or order of amino acids in a nascent polypeptide.

[0049] As used herein, the term "operably linked" refers to a functional relationship between two or more DNA segments, particularly the functional relationship between a gene sequence to be expressed and those sequences that control its expression. For example, a promoter (including any combination of cis-acting transcriptional control elements) is operably linked to a coding sequence if it stimulates or regulates transcription of the coding sequence in a suitable expression system. A promoter regulatory sequence operably linked to the transcribed gene sequence is physically adjacent to the transcribed sequence.

[0050] As used herein, the term "transduction" refers to the transfer of nucleic acids (e.g., vector genome) into cells via a viral vector (e.g., transfer of an rAAV vector into target cells, or transfer of heterologous nucleotides from a recombinant baculovirus into insect cells). Cells in which transgenes are introduced via a virus or viral vector are referred to as "transduced cells." In some embodiments, transduced cells are isolated cells, and transduction occurs in vitro. In some embodiments, transduced cells are cells within an organism (e.g., a subject), and transduction occurs in vivo. Transduced cells may be target cells of an organism that have been transduced with a recombinant AAV vector, such that the target cells of that organism express polynucleotides.

[0051] As used herein, the term "vector" refers to a construct capable of delivering and optionally expressing one or more target polynucleotides into a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, granules or phage vectors, DNA or RNA expression vectors associated with cationic condensers, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as production cells.

[0052] As used in this article, the term "adeno-associated virus (AAV)" is a small, non-enveloped virus belonging to the Parvoviridae family. It is commonly used as a gene delivery vector and is widely applied in gene therapy and gene editing. The AAV genome is a single-stranded linear DNA molecule, approximately 4700 bp, containing two open reading frames (ORFs): Rep and Cap, located between two T-shaped inverted terminal repeats (ITRs), each consisting of 145 nucleotides. The ITRs act as the origin of viral replication and packaging signals. The Rep gene participates in viral replication and integration, encoding viral replication proteins, while the Cap gene encodes three viral capsid proteins. Compared to other commonly used viral vectors, such as lentiviruses, adenoviruses, and retroviruses, AAV has low immunogenicity and a long duration of action in vivo, making it clinically used as a gene therapy drug.

[0053] As used herein, the term "recombination adeno-associated virus (rAAV)" refers to a gene vector derived from a non-pathogenic wild-type AAV. The rep and / or cap genes of the wild-type AAV virus genome have been removed and replaced with polynucleotide sequences that do not belong to or are not entirely derived from AAV (e.g., polynucleotides heterologous to AAV).

[0054] As used in this article, the term "single-stranded AAV (ssAAV)" refers to AAV whose genome is single-stranded. After AAV enters the cell, the single-stranded genome needs to be replicated and synthesized to form a double-stranded genome in order to express genes. "Self-complementary AAV (scAAV)" refers to AAV whose ITR sequence has been specially modified so that the AAV genome is a double-stranded genome. After AAV enters the cell, the double-stranded genome can directly express genes.

[0055] As used herein, the term "promoter" refers to a DNA sequence operatively linked to a nucleic acid sequence to be transcribed (such as a nucleic acid sequence encoding a desired molecule). Promoters are generally located upstream of the nucleic acid sequence to be transcribed and provide sites for the specific binding of RNA polymerases and other transcription factors. In particular embodiments, promoters are typically located upstream of the DNA sequence to be transcribed, serving as sites of specific recognition and binding for RNA polymerases. They control the initiation of transcription and help generate the desired RNA molecule. Furthermore, promoters may interact with other transcription factors to jointly regulate the efficiency and specificity of transcription.

[0056] As used in this article, the term "glioma-specific promoter" refers to a class of promoters that are specifically activated in glioma cells but are silenced or expressed at low levels in normal cells, and can drive the efficient and specific expression of target genes in tumor cells.

[0057] As used herein, the term "AAV serotype" refers to different variants of adeno-associated virus (AAV), which are primarily distinguished by differences in the capsid proteins of their viral particles. Different AAV serotypes possess unique capsid protein spatial structures, sequences, and tissue specificities. These characteristics determine their ability to recognize and bind to receptors on the surface of host cells, thereby affecting viral infection efficiency, tissue distribution, and immunogenicity. Currently, dozens of AAV serotypes with different capsid proteins have been identified, and they have broad application potential in gene therapy, gene delivery, and other biomedical research.

[0058] As used in this article, the term "glial fibrillary acidic protein (GFAP) positive glioma" refers to a glioma that expresses glial fibrillary acidic protein (GFAP).

[0059] The "homology" or "identity" between two amino acid or nucleotide sequences refers to the percentage of amino acid or nucleotide residues that are completely identical between the two sequences. If the two sequences to be compared differ in length, the sequence "homology" or "identity" preferably refers to the percentage of nucleotide residues in the shorter sequence that are completely identical to the amino acid or nucleotide residues in the longer sequence. Sequence identity can be routinely determined using sequence analysis software commonly used in the art, such as the Wisconsin sequence analysis package.

[0060] As used herein, the term "pharmaceutical composition" means an article which is presented in a form that allows the biological activity of the active ingredient contained therein to exert its effect, and which does not contain any additional components that would have unacceptable toxicity to the subject to whom the formulation is to be administered.

[0061] As used herein, the term "subject" means any individual or patient undergoing the methods of this application. Typically, a subject is a human being, but as those skilled in the art will understand, a subject can be an animal. Therefore, the definition of a subject also includes other animals, including mammals such as rodents (including mice, rats, hamsters, and guinea pigs), cats, dogs, and rabbits; farm animals including cattle, horses, goats, sheep, pigs, etc.; and primates (including monkeys, chimpanzees, orangutans, and gorillas).

[0062] As used herein, the term "effective amount" refers to an amount sufficient to achieve a beneficial or desired outcome. For example, a therapeutic amount is an amount sufficient to achieve a desired therapeutic effect. This amount may be the same as or different from a preventative effective amount, which is the amount necessary to prevent the onset of disease or disease symptoms. An effective amount may be administered in a single or multiple dose, application, or dosage. Those skilled in the art will understand that certain factors may affect the dose and duration required to effectively treat a subject, including, but not limited to, the severity of the subject's disease or condition, prior treatment, overall health and / or age, and any other pre-existing conditions.

[0063] As used herein, the term "treatment" aims to prevent or slow undesirable physiological changes or disturbances. For the purposes of this application, beneficial or desired clinical outcomes include, but are not limited to, detectable or undetectable: relief of symptoms, reduction of disease severity, stabilization (i.e., non-exacerbation) of the disease state, delay or slowing of disease progression, improvement or mitigation of the disease state, and relief (partial or complete), such as relief of inflammation, increase of pain threshold, etc. "Treatment" may also refer to extended survival compared to expected survival without treatment.

[0064] As used herein, the term "pharmaceutically acceptable" means a compound, material, composition, and / or dosage form suitable for contact with human or animal tissues without causing excessive toxicity, irritation, allergic reactions, other problems, or complications, and with a reasonable benefit / risk ratio. In some embodiments, pharmaceutically acceptable compounds, materials, compositions, and / or dosage forms refer to those compounds, materials, compositions, and / or dosage forms approved by regulatory agencies (such as the U.S. Food and Drug Administration, the China National Medical Products Administration, and the European Medicines Agency) or listed in recognized pharmacopoeias (such as the United States Pharmacopeia, the Chinese Pharmacopoeia, and the European Pharmacopoeia) for use in animals, particularly humans.

[0065] As used herein, the term "pharmaceutically acceptable carrier" refers to any pharmaceutically acceptable material, composition, or delivery vehicle, such as liquid or solid fillers, diluents, excipients, solvents, or encapsulating materials, used to carry or transport the AAV carrier of this application from one location, body fluid, tissue, organ (internal or external), or body part to another location, body fluid, tissue, organ, or body part. A pharmaceutically acceptable carrier may be a delivery vehicle, diluent, excipient, or other material that can be used in contact with animal tissues without excessive toxicity or adverse reactions. Exemplary pharmaceutically acceptable carriers include, but are not limited to, sugars, starches, cellulose, malt, astragalus gum, gelatin, Ringer's solution, alginate, isotonic saline, buffers, etc.

[0066] As used herein, the term "subject" refers to an animal, human, or non-human to whom the treatment described in this application is given consideration for both veterinary and non-veterinary applications. This term includes, but is not limited to: mammals such as humans, other primates, pigs, rodents such as mice and rats, rabbits, guinea pigs, hamsters, cattle, horses, cats, dogs, sheep, and goats. Typical subjects include humans, farm animals, and domestic pets such as cats and dogs.

[0067] AAV carrier

[0068] This application provides an AAV vector, including a gene encoding the N-terminal fragment of a pyroptosis executive protein (GSDMD NTD) and a promoter operatively linked to the GSDMD NTD gene.

[0069] The promoter can be any glioma-specific promoter known in the art, i.e., a promoter that is specifically activated in glioma cells but silenced or expressed at low levels in normal cells. In some specific embodiments, the promoter is selected from one or more of GfaABC1D, GFAP, ALDH1L1, BLBP / FABP7, Nestin, Survivin, hTERT, and EGFRvIII.

[0070] In some specific embodiments, the promoter is the GfaABC1D promoter. The nucleotide sequence of the GfaABC1D promoter is shown in SEQ ID NO:1.

[0071] The AAV can be any of the various serotypes of AAV known in the art, such as AAV DJ, AAV 1, AAV 2, AAV 5, AAV 6, AAV 8, AAV 9, AAV PHP.B, AAV PHP.eB, AAV PHP.S, AAV Retro, AAV B10, AAV rh10 or variants thereof.

[0072] The AAV can be a single-chain AAV (ssAAV), such as single-chain AAV DJ, AAV 1, AAV 2, AAV 5, AAV 6, AAV 8, AAV 9, AAV PHP.B, AAV PHP.eB, AAV PHP.S, AAV Retro, AAV B10, or AAV rh10. The AAV can also be a self-complementary AAV (scAAV), such as self-complementary AAV DJ, AAV 1, AAV 2, AAV 5, AAV 6, AAV 8, AAV 9, AAV PHP.B, AAV PHP.eB, AAV PHP.S, AAV Retro, AAV B10, or AAV rh10.

[0073] In some specific embodiments, the AAV is a self-complementary AAV. In some specific embodiments, the AAV is a self-complementary AAV DJ.

[0074] The GSDMD NTD encoding gene is a gene that encodes GSDMD NTD. The GSDMD NTD is a fragment of the GSDMD protein that induces pyroptosis, or a functional equivalent thereof.

[0075] The GSDMD NTD can be derived from mammals, optionally from mice or humans. In some specific embodiments, the GSDMD NTD comprises amino acids 1-150 from the N-terminus of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD comprises amino acids 1-200 from the N-terminus of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD comprises amino acids 1-230 from the N-terminus of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD comprises amino acids 1-250 from the N-terminus of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD comprises amino acids 1-276 from the N-terminus of the mouse GSDMD protein.

[0076] In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the N-terminal amino acids 1-150 of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the N-terminal amino acids 1-200 of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the N-terminal amino acids 1-230 of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the N-terminal amino acids 1-250 of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first to second 276th amino acids of the N-terminus of the mouse GSDMD protein.

[0077] In some specific embodiments, the GSDMD NTD is amino acids 1-150 from the N-terminus of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD is amino acids 1-200 from the N-terminus of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD is amino acids 1-230 from the N-terminus of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD is amino acids 1-250 from the N-terminus of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD is amino acids 1-276 from the N-terminus of the mouse GSDMD protein.

[0078] In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the N-terminal amino acids 1-150 of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the N-terminal amino acids 1-200 of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the N-terminal amino acids 1-230 of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the N-terminal amino acids 1-250 of the mouse GSDMD protein. In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first to second 276th amino acids at the N-terminus of the mouse GSDMD protein.

[0079] In some specific embodiments, the GSDMD NTD comprises amino acids 1-150 from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD comprises amino acids 1-200 from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD comprises amino acids 1-230 from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD comprises amino acids 1-250 from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD comprises amino acids 1-275 from the N-terminus of the human GSDMD protein.

[0080] In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 150 amino acids from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 200 amino acids from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 1-230 amino acids of the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 1-250 amino acids of the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD comprises a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 1-275 amino acids of the N-terminus of the human GSDMD protein.

[0081] In some specific embodiments, the GSDMD NTD is amino acids 1-150 from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD is amino acids 1-200 from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD is amino acids 1-230 from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD is amino acids 1-250 from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD is amino acids 1-275 from the N-terminus of the human GSDMD protein.

[0082] In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 150 amino acids from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 200 amino acids from the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 1-230 amino acids at the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 1-250 amino acids at the N-terminus of the human GSDMD protein. In some specific embodiments, the GSDMD NTD is a protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the first 1-275 amino acids at the N-terminus of the human GSDMD protein.

[0083] In some specific embodiments, the sequence of the GSDMD NTD encoding gene is shown in SEQ ID NO:2.

[0084] In some specific embodiments, the AAV vector includes a gene encoding the pyroptosis executive protein-N-terminal fragment (GSDMD NTD) and a GfaABC1D promoter operatively linked to the GSDMD NTD gene, wherein the GSDMD NTD gene contains a gene encoding amino acids 1-150, 1-200, 1-230, 1-250, or 1-276 of the N-terminus of the mouse GSDMD protein. The AAV is a self-complementary AAV DJ.

[0085] In some specific embodiments, the AAV vector includes a gene encoding the pyroptosis executive protein-N-terminal fragment (GSDMD NTD) and a GfaABC1D promoter operatively linked to the GSDMD NTD gene, wherein the GSDMD NTD gene encodes amino acids 1-150, 1-200, 1-230, 1-250, or 1-276 of the N-terminus of the mouse GSDMD protein. The AAV is a self-complementary AAV DJ.

[0086] In some specific embodiments, the AAV vector includes a gene encoding the pyroptosis executive protein-N-terminal fragment (GSDMD NTD) and a GfaABC1D promoter operatively linked to the GSDMD NTD gene, wherein the GSDMD NTD gene contains a gene encoding amino acids 1-150, 1-200, 1-230, 1-250, or 1-275 of the N-terminus of the human GSDMD protein. The AAV is a self-complementary AAV DJ.

[0087] In some specific embodiments, the AAV vector includes a gene encoding the pyroptosis executive protein-N-terminal fragment (GSDMD NTD) and a GfaABC1D promoter operatively linked to the GSDMD NTD gene, wherein the GSDMD NTD gene encodes amino acids 1-150, 1-200, 1-230, 1-250, or 1-275 of the N-terminus of the human GSDMD protein. The AAV is a self-complementary AAV DJ.

[0088] Furthermore, the AAV vector may also include a miRNA target sequence operatively linked to the GSDMD NTD encoding gene to reduce the expression of the GSDMD NTD encoding gene in non-target tissues, wherein the miRNA target sequence is a sequence that binds to a miRNA that is highly expressed in the target tissue.

[0089] The miRNAs highly expressed in the target tissue can be those known in the art, such as miR-137, miR-219a, miR-124, miR-9, miR-487b, miR-128, etc.

[0090] The AAV vector of this application can specifically express GSDMD NTD in glioma cells, thereby inducing pyroptosis, and can be used to treat gliomas, especially GFAP-positive gliomas.

[0091] Pharmaceutical Composition

[0092] This application provides a pharmaceutical composition comprising any of the above-described AAV carriers, as well as a pharmaceutically acceptable carrier.

[0093] The pharmaceutically acceptable carrier is known in the art.

[0094] The form of a pharmaceutical composition depends on several criteria, including, for example, route of administration, disease severity, or dosage.

[0095] In some embodiments, the pharmaceutical composition is an injectable formulation. Injectable formulations include sterile aqueous solutions or dispersions, suspensions, or emulsions. In all cases, the injectable formulation should be sterile and should be a liquid for ease of injection. It should remain stable under manufacturing and storage conditions and should be resistant to microbial (e.g., bacterial and fungal) contamination. The carrier can be a solvent or dispersion medium comprising, for example, water, ethanol, polyhydroxy compounds (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.) and suitable mixtures thereof, and / or vegetable oils. The injectable formulation should maintain appropriate fluidity, which can be maintained in various ways, for example, by using a coating such as lecithin, using surfactants, etc. Antimicrobial contamination can be achieved by adding various antimicrobial and antifungal agents (e.g., parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc.).

[0096] Treatment methods and therapeutic uses

[0097] This application provides a method for treating glioma, comprising administering to a subject a therapeutically effective amount of the above-mentioned AAV carrier, or a pharmaceutical composition.

[0098] In some specific embodiments, the glioma is a GFAP-positive glioma.

[0099] In some specific implementations, the subject is a human.

[0100] In this application, no restrictions are placed on the method or route of administration. For example, it can be administered by injection, specifically by intravenous injection, intratumoral injection, intraoperative cavity wall perfusion, convection-enhanced infusion (CED), intraventricular / intrathecal injection, etc.

[0101] Furthermore, the method further includes administering one or more additional therapeutic agents to the subject. These additional therapeutic agents are known in the art, including those known to be used to treat brain tumors, i.e., agents that have a therapeutic effect on brain tumors, alleviate one or more symptoms of brain tumors, alter the progression of brain tumors, eradicate brain tumors, reduce the size of brain tumors, slow or inhibit the growth of brain tumors, delay or minimize one or more symptoms associated with brain tumors, reduce the malignancy of brain tumors, or induce the cessation of brain tumor activity, or alleviate or minimize one or more side effects associated with another therapy administered or applied to treat brain tumors.

[0102] In some specific embodiments, the additional therapeutic agents include one or more of DNA reactive agents, PARP inhibitors, antiemetics, anticonvulsants or antiepileptics, checkpoint inhibitors, PVC chemotherapy, bevacizumab, and gemcitabine.

[0103] In some specific embodiments, additional therapeutic agents are DNA-reactive agents. As used herein, “DNA-reactive agents” are those agents that covalently or non-covalently interact with cellular DNA, such as alkylating agents, cross-linking agents, and DNA intercalating agents. Examples of DNA-reactive agents include adorexin, hexamethylmelamine, bifenexin, busulfan, carboplatin, carboquinone, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, estradiol, formustine, hepsulfam, ifosfamide, inprofen, iroflavone, lomustine, nitrogen mustard, melphalan, mitozolamide, nedaplatin, oxaliplatin, piperazine, procarbazine, semustine, streptozotocin, temozolomide, thiotepa, triamcinolone, diethylnitrosamine, benzo(a)pyrene, doxorubicin, mitomycin C, and so on. Many of these DNA reactive agents can be used as DNA reactive chemotherapeutic agents in cancer treatment.

[0104] In some specific implementations, the additional therapeutic agent is temozolomide.

[0105] One or more additional therapeutic agents may be administered together with the AAV carrier, either as a single dosage form (e.g., a pharmaceutical composition) or as separate dosage forms. If administered as separate dosage forms, one or more additional therapeutic agents may be administered simultaneously with or sequentially (before or after) the administration of the AAV carrier.

[0106] In some specific implementations, the AAV carrier is administered after one or more additional therapeutic agents.

[0107] In some specific implementations, the AAV carrier is administered prior to one or more additional therapeutic agents.

[0108] In some specific implementations, the AAV carrier is administered simultaneously with one or more other therapeutic agents.

[0109] In some specific implementations, the AAV vector is administered one week after temozolomide administration.

[0110] Those skilled in the art will understand that the dosage and frequency of administration of AAV carriers and other therapeutic agents can be adjusted according to the severity of the disease.

[0111] This application also provides the use of the above-mentioned AAV carrier in the preparation of a medicament for treating glioma.

[0112] In some specific embodiments, the glioma is a GFAP-positive glioma.

[0113] In some specific implementations, the drug is used in humans.

[0114] This application also provides the use of the above-mentioned AAV carrier and one or more other therapeutic agents in the preparation of a medicament for treating glioma.

[0115] This application also provides the use of the above-mentioned AAV carrier in the preparation of a medicament for treating glioma, wherein the medicament is a medicament for use of the AAV carrier in combination with one or more other therapeutic agents, optionally, the other therapeutic agent being temozolomide.

[0116] Other types of therapeutic agents are as described above. In some specific embodiments, the AAV carrier is used in combination with temozolomide to treat gliomas, such as GFAP-positive gliomas.

[0117] Example

[0118] Materials and methods:

[0119] 1. Cell lines and mice

[0120] 2. Antibodies and reagents

[0121] 3. Carrier

[0122] 4. Sequence Information

[0123] GfaABC1D promoter:

[0124] Mouse GSDMD NTD encoding gene:

[0125] 5. Experimental Methods:

[0126] Western blot of proteins:

[0127] Cell pellets were collected and lysed with 1xRIPA lysis buffer (25mM Tris-HCl, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, pH 7.6). Proteins were then separated using a 10% SDS-PAEG protein gel and transferred to a PVDF membrane. The PVDF membrane was blocked in PBST solution containing 5% skim milk for 30 minutes. The PVDF membrane was then incubated overnight at 4°C on a shaker in PBST containing primary antibodies (Rabbit anti-GFAP antibody for GFAP, Rabbit anti-GSDMD antibody for GSDMD, and Mouse anti-α-tubulin antibody for tubulin). The membrane was then washed three times with PBST and finally placed in a PVDF membrane containing HRP-conjugated secondary antibodies (Goat Anti-Rabbit antibody for Rabbit anti-GFAP and Rabbit anti-GSDMD). The secondary antibody for detecting mouse anti-α-tubulin antibody was Goat Anti-Mouse IgG Antibody, Fc, HRP conjugate. The antibody was incubated in 5% skim milk PBST at room temperature for 60 minutes on a shaker. The PVDF membrane was then washed three times with PBST and developed with ECL developing solution.

[0128] AAV virus packaging and purification:

[0129] AAV virus packaging was performed using a three-plasmid system for transient co-transferring suspension in Viral Production Cells 2.0 cells. The specific procedure was as follows: The three plasmids pAdDeltaF6:RepCap:target plasmid were added to an appropriate amount of opti-MEM at a ratio of 2:1:1 and mixed thoroughly. Then, PEI was added at a 2:1 mass ratio. The PEI and plasmid were mixed and incubated at room temperature for 15 minutes. Then, the plasmid was added to suspension 293T at a ratio of 1 μg plasmid / 1 e6 cells. After transfection for 72 hours, cells were collected by low-speed centrifugation into centrifuge tubes, and the supernatant was discarded. After collection, the cells were washed once with DPBS (Gibco, 14190-144). The supernatant was discarded after centrifugation. 8 mL of Lysis buffer (composition: 144 mM NaCl, 20 mM Tris-HCl, 0.1% Trion-X100, pH = 8.0) was added to each sample, vortexed to mix, and then flash-frozen in liquid nitrogen. Complete freezing takes approximately 5 minutes. After complete freezing, place the sample in a 37°C water bath to thaw for approximately 15 minutes, shaking occasionally to accelerate thawing. After thawing, vortex to mix the sample thoroughly. Repeat the freeze-thaw cycle three times, then add 8 μL of totipotent nuclease (Yisheng Biotechnology, 20156ES60), vortex to mix, and incubate at 37°C for 1 hour. After incubation, add 3 ml of chloroform to each sample and vortex for 30 seconds. Centrifuge at 2000g, 4°C for 20 minutes. At this point, AAV will be in the upper aqueous phase. Use a pipette to aspirate the supernatant and transfer it to a new centrifuge tube. Store at 4°C for later use.Place the ultracentrifuge tube (Beckman, 361625) on the centrifuge rack. Using a 10ml syringe with a flat-tipped syringe needle, draw 6ml of 17% iodixanol gradient solution (12.5ml iodixanol stock solution (Sigma, D1556-250ML), 10ml 5M NaCl, 5ml 10xPBS, 125uL 1M KCl, and 50uL 1M MgCl2 added to ddH2O, then bring the volume to 50ml with ddH2O). Hold the syringe tip against the bottom of the tube and slowly and evenly add the solution to the bottom of the centrifuge tube. Then draw 6ml of 25% iodixanol gradient solution (20ml iodixanol stock solution (Sigma, D1556-250ML), 5ml 10xPBS, 125uL 1M KCl, and 50uL 1M MgCl2 added to ddH2O, then bring the volume to 50ml). Add MgCl2 and 200 μL of phenol red (Gibco, PO290-100 mL) to ddH2O, and bring the volume to 50 mL with ddH2O. Continue to hold the needle against the bottom of the tube and slowly and evenly add the gradient solution, using the gradient difference to flush the lower concentration gradient solution to the upper layer. Repeat this process, adding 5 mL of 40% iodixanol gradient solution (33.3 mL of iodixanol stock solution (Sigma, D1556-250 mL), 5 mL of 10xPBS, 125 μL of 1M KCl, and 50 μL of 1M MgCl2 added to ddH2O, and bringing the volume to 50 mL with ddH2O) and 4 mL of 60% iodixanol gradient solution (125 μL of 1M KCl, 50 μL of 1M MgCl2, 100 μL of 1M MgCl2, and 100 μL of 1M MgCl2 added to ddH2O, and bringing the volume to 50 mL) and 4 mL of 60% iodixanol gradient solution (125 μL of 1M KCl, 50 μL of 1M MgCl2, 100 μL of 1M MgCl2, and 100 μL of 1M MgCl2 added to ddH2O). Add MgCl2 and 50 μL of phenol red (Gibco, PO290-100 mL) to the iodixanol stock solution, then bring the volume to 50 mL with iodixanol stock solution. After spreading the gradient solution, use a sterile pipette to slowly add the crude AAV solution, holding it against the centrifuge tube wall and the surface of the gradient solution, being careful not to disrupt the gradient. After adding the crude virus solution, seal the tube with Lysis buffer and cap it accordingly. To ensure accurate virus collection after centrifugation, streak lines can be drawn at 40% and 60% before centrifugation.

[0130] Place the centrifuge in an ultracentrifuge (Beckman, XPN90) and set the rotor to 70Ti, speed to 53,000 rpm, time to 2 hours and 40 minutes, and temperature to 14°C. After setting, click "Start Vacuum." Wait for the vacuum to drop below 200°C before clicking "Start." After the centrifuge has completely stopped, click "Release Vacuum." When the pressure equals the ambient pressure, open the centrifuge compartment door and remove the rotor. Use needle forceps to remove the centrifuge tube, and use a 5mL syringe to puncture the tube and draw liquid from the 40% gradient liquid level. Be careful to keep the needle pointing upwards and parallel to the scribe line, and avoid drawing liquid from the upper or lower layers. Approximately 3-3.5mL of solution should be obtained. Next, perform ultrafiltration and medium replacement. Rinse a 100kd ultrafiltration tube (Millipore, UFC910096) with virus preservation solution (0.1% Poloxamer 188 (Sigma, 24040032) in PBS). Transfer the ultrafiltration sample to the ultrafiltration tube, add an appropriate amount of virus preservation solution, mix well by aspiration and centrifugation (4℃, 3500rpm, 10min). Adjust the centrifugation time as needed based on the sample. Repeat this operation at least 3 times until the solvent in the sample is completely replaced by the virus preservation solution. Transfer the sample to a centrifuge tube. The purified AAV can be temporarily stored at 4℃ or aliquoted and frozen at -80℃ for long-term storage.

[0131] AAV titer determination

[0132] First, AAV samples were digested with DNase I (Sigma, 10104159001) to remove residual DNA contamination in the AAV solution. Then, AAV was lysed with 0.2% SDS solution to release the AAV genome. Simultaneously, the target plasmid digested with a single enzyme was used as a standard, and the AAV titer was determined by qPCR. The primers used were as follows: For AAV containing GSDMD NTD, the primers were: forward primer: gtgctgcagacaaaggaggaag (SEQ ID NO:3), reverse primer: ccactcggaatgccaggatg (SEQ ID NO:4); For AAV containing mScarlet, the primers were: forward primer: ccttctcctgggacatcctgtc (SEQ ID NO:5), reverse primer: tcctccagggaggtgtcctg (SEQ ID NO:6).

[0133] Preparation of temozolomide stock solution (10 mg / mL):

[0134] After thoroughly mixing 1g temozolomide, 10mL DMSO, 40mL PEG3000, and 50mL PBS, dissolve the drug by sonication (42℃, 40kHz) under light-protected conditions, observing every 10 minutes until the solution becomes clear and transparent. For drug dispensing: Attach a syringe to a nitrogen balloon and seal the connection with sealing film. First, fill an empty centrifuge tube with nitrogen, add the drug, and then repeat the nitrogen filling process. Immediately after nitrogen filling, tighten the cap and store at -80℃ protected from light. If precipitation occurs before use, heating or sonication can be used to aid dissolution.

[0135] Example 1. Screening for glial fibrillary acidic protein (GFAP)-positive mouse glioma cell line GL261

[0136] Many gliomas express GFAP, a marker protein specific to astrocytes. GFAP is also one of the common immunohistochemical tests for gliomas in clinical practice. In order to develop targeted gene therapy for GFAP-positive gliomas, the first important thing is to find a GFAP-positive mouse cell line in an animal model for early drug development testing. To verify whether the mouse glioma cell line GL261 expresses GFAP, we performed a protein immunoblotting experiment to detect GFAP expression.

[0137] The results are shown in Figure 1: The results indicate that GL261 cells express GFAP protein.

[0138] Example 2. Screening for AAV serotypes that efficiently infect GL261 cells

[0139] AAV vectors possess stable physicochemical properties, low immunogenicity, and long-term stable expression, making them commonly used gene delivery vectors in clinical practice. Several AAV gene therapies have already been approved. Different AAV serotypes exhibit different tissue tropisms. To identify AAV serotypes that can efficiently infect GL261 cells, we tested the infection efficiency of various AAV serotypes in GL261 cells. These serotypes included AAV6, AAV8, AAV9, AAV.Cap-B10, AAV-PHP.eB, and AAV-DJ. We then packaged a DNA element (i.e., pAAV-CMV-mScarlet) with mScarlet fluorescent protein expression driven by a broad-spectrum CMV promoter using these serotypes.

[0140] GL261 was infected with different AAV serotypes of MOI 1e4, and the expression of mScarlet fluorescent protein was detected by fluorescence microscopy 48 hours after viral infection.

[0141] The results are shown in Figure 2: As can be seen, compared with other AAV serotypes tested, the AAV-DJ serotype can infect GL261 cells very efficiently.

[0142] Example 3. Verification of the activity of the GfaABC1D promoter in GL261 cells.

[0143] The GfaABC1D promoter is an astrocyte-specific promoter derived from the human GFAP promoter, but it has been widely used in mice. To verify whether the GfaABC1D promoter is active in GFAP-expressing GL261 cells and can drive the expression of the target gene, we packaged a self-complementary scAAV of the DJ serum type (scAAV-DJ-GfaABC1D-mScarlet) driven by the GfaABC1D promoter to express the fluorescent protein mScarlet, and then infected GL261 cells to detect mScarlet expression. We infected GL261 cells with AAV at different MOIs (0, 1e4, 1e5), and after 48 hours of infection, we used fluorescence microscopy to detect mScarlet expression.

[0144] The results are shown in Figure 3. The results show that, compared with the control group without AAV, the AAV-added group expressed mScarlet, and the expression level of mScarlet increased with the increase of AAV MOI titer, indicating that the GfaABC1D promoter is active in GL261 cells and can drive the expression of the target gene in the cells.

[0145] Self-complementary scAAV is a double-stranded AAV virus produced by modifying wild-type ITR. Compared to single-stranded ssAAV, scAAV does not require second-strand DNA synthesis after its genome enters the cell nucleus, resulting in faster expression of the target gene. Because AAV does not integrate into the cellular genome, after entering tumor cells, the AAV DNA copy number decreases as the tumor cells divide, leading to a decline in target gene expression. Therefore, to express more of the target gene as early as possible in tumor cells, we compared the expression efficiency of ssAAV (corresponding to ssAAV-DJ-GfaABC1D-mScarlet) and scAAV in tumor cells.

[0146] The results are shown in Figure 4: It can be seen that, compared with ssAAV, scAAV delivers a higher expression level of mScarlet.

[0147] Example 4. In vitro test of the effect of scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus on killing GL261

[0148] Next, we wanted to test whether delivering mouse GSDMD NTD using the scAAV-DJ serotype could induce GL261 cell death. First, we packaged a DJ serotype scAAV virus (scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus) with GfaABC1D promoter-driven mouse GSDMD NTD expression, and then infected GL261 cells to detect GSDMD NTD expression. GL261 cells were infected with AAV at different MOIs (0, 1e3, 1e4, 1e5), and GSDMD NTD expression was detected by Western blotting 48 hours after infection. The results are shown in Figure 5: The results indicate that compared to the MOI 0 AAV group, the MOI 1e3 AAV group showed weak GSDMD NTD expression, while the MOI 1e4 and 1e5 AAV groups showed high GSDMD NTD expression.

[0149] Next, we examined the effect of scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus on killing GL261 cells in vitro. We infected GL261 cells with AAV at MOI 1e4 and counted the number of cells at 48 and 96 hours after viral infection to reflect the death of GL261 cells.

[0150] The results are shown in Figure 6: Compared with the control group infected with AAV expressing mScarlet, the number of GL261 cells in the experimental group infected with AAV expressing GSDMD NTD was significantly reduced, and the number of surviving GL261 cells decreased with the increase of viral infection time, indicating that AAV expressing GSDMD NTD can promote GL261 cell death.

[0151] Example 5. In vivo testing of the efficacy of scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus in treating GL261 glioma.

[0152] Next, we want to test the efficacy of scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus in treating GL261 glioma in wild-type mice with intact immune systems (C57BL / 6N Mice). 1 μL of GL261 cells (5e4 cells, injection coordinates: AP: -2, ML: 0.5, DZ: 3) were injected intracranially into wild-type mice using a stereotaxic instrument. On day 7 after cell inoculation, control AAV virus expressing mScarlet and AAV virus expressing GSDMD NTD were injected intratumorally using the stereotaxic instrument (AAV administration volume per tumor: 1.5 μL, dosage: 5e9 vg, injection coordinates: AP: -2, ML: 0.5, DZ: 3). On day 14 after cell inoculation, AAV virus expressing GSDMD NTD was injected intratumorally again using the stereotaxic instrument (AAV administration volume per tumor: 1.5 μL, dosage: 5e9 vg, injection coordinates: AP: -2, ML: 0.5, DZ: 3). The mice were then observed and weighed. The mice were considered to have reached the experimental endpoint when they exhibited neurological symptoms such as slowed movement or a 20% weight loss.

[0153] The results are shown in Figure 7: The results indicate that, compared with the single administration group of scAAV-DJ-GfaABC1D-mScarlet virus, a single administration of scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus can significantly prolong the survival of mice. Two administrations of scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus can better prolong the survival of mice and improve the cure rate. 30% of the mice had complete tumor disappearance and long-term survival.

[0154] Example 6. In vivo testing of the efficacy of scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus combined with the chemotherapy drug temozolomide in the treatment of GL261 glioma.

[0155] Temozolomide is a DNA alkylation chemotherapy drug that can cross the blood-brain barrier and is a commonly used chemotherapy drug in the clinical treatment of gliomas, especially in patients with MGMT (6-methylguanine DNA methyltransferase) gene promoter methylation, where temozolomide can better prolong patient survival. MGMT gene promoter methylation leads to a decrease in MGMT gene expression, making it impossible to promptly remove the DNA alkylation modification induced by temozolomide, thus resulting in DNA damage and cell death.

[0156] In GL261 RNA seq, we found very low expression levels of the MGMT gene (data not shown), suggesting that temozolomide may have some therapeutic effect on GL261 tumors. However, considering that the number of AAV genes decreases with tumor cell division after AAV infection, leading to a decline in the therapeutic effect of AAV gene therapy, we attempted to combine temozolomide chemotherapy with AAV gene therapy for GL261 tumors. Temozolomide inhibits tumor growth, keeping tumor cells in a non-dividing or low-dividing phase, allowing sufficient expression time and an effective window for the AAV gene-mediated GSDMD NTD gene, thus achieving a better combined therapeutic effect.

[0157] Specifically, we tested the efficacy of scAAV-DJ-GfaABC1D-mouse GSDMD NTD virus combined with the chemotherapy drug temozolomide in treating GL261 gliomas in immune-intelligent wild-type mice (C57BL / 6N mice). Wild-type mice were injected intracranially with 1 μL of GL261 cells (cell count 2e4, injection coordinates AP: -2, ML: 0.5, DZ: 3) using a stereotaxic instrument. On day 7 after cell inoculation, intraperitoneal injection of temozolomide (25 mg / kg) or a solvent (PBS solution containing 10% DMSO and 40% PEG3000) was initiated. The temozolomide or solvent dosing regimen lasted for 4 weeks, administered 5 days a week, once a day, followed by a two-day break. One week after administration of temozolomide or solvent (day 14 after cell seeding), control AAV virus expressing mScarlet and AAV virus expressing GSDMD NTD were injected using a stereotaxic instrument (AAV administration volume per tumor was 1.5 uL, dosage was 5e9 vg, injection coordinates were AP: -2, ML: 0.5, DZ: 3). The mice were then observed and weighed. The mice were considered to have reached the experimental endpoint when they showed neurological symptoms such as slowed movement or a 20% decrease in body weight.

[0158] The results are shown in Figure 8: The results indicate that, compared with the solvent treatment group, temozolomide alone significantly prolonged the survival of mice. More importantly, compared with the temozolomide alone treatment group, the scAAV-DJ-GfaABC1D-mGSDMD NTD virus combined with temozolomide treatment group better prolonged the survival of mice and improved the cure rate, with 50% of mice showing complete tumor disappearance and long-term survival.

Claims

1. An AAV vector comprising a gene encoding a pyroptosis executive protein-N-terminal fragment (GSDMD NTD) and a promoter operatively linked to the GSDMD NTD gene.

2. The AAV vector according to claim 1, wherein the promoter is a glioma-specific promoter.

3. The AAV vector according to claim 2, wherein the promoter is selected from one or more of the group consisting of: GfaABC1D, GFAP, ALDH1L1, BLBP / FABP7, Nestin, Survivin, hTERT and EGFRvIII.

4. The AAV carrier according to any one of claims 1-3, wherein the AAV is AAV DJ, AAV 1, AAV 2, AAV 5, AAV 6, AAV 8, AAV 9, AAV PHP.B, AAV PHP.eB, AAV PHP.S, AAV Retro, AAV B10, AAV rh10 or a variant thereof.

5. The AAV carrier according to any one of claims 1-4, wherein the AAV is a self-complementary AAV.

6. The AAV carrier according to claim 5, wherein the AAV is a self-complementary AAV DJ.

7. The AAV vector according to any one of claims 1-6, wherein the GSDMD NTD is derived from a mammal, optionally from a mouse or a human.

8. The AAV vector of claim 7, wherein the GSDMD NTD comprises or is composed of the following protein fragments: A protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with at least 1-150, 1-200, 1-230, 1-250, or 1-276 amino acids at the N-terminus of the mouse GSDMD protein.

9. The AAV vector according to claim 8, wherein the nucleotide sequence of the GSDMD NTD encoding gene is shown in SEQ ID NO:

2.

10. The AAV vector of claim 7, wherein the GSDMD NTD comprises or is composed of the following protein fragments: A protein fragment having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with at least 1-150, 1-200, 1-230, 1-250, or 1-275 amino acids at the N-terminus of the human GSDMD protein.

11. The AAV vector according to any one of claims 1-10, wherein the AAV vector further comprises a miRNA target sequence operatively linked to the GSDMD NTD encoding gene to reduce the expression of the GSDMD NTD encoding gene in a non-target tissue, wherein the miRNA target sequence is a sequence that binds to a miRNA highly expressed in a target tissue.

12. A pharmaceutical composition comprising the AAV carrier of any one of claims 1-11, and a pharmaceutically acceptable carrier.

13. A method of treating glioma, comprising administering to a subject a therapeutically effective amount of the AAV carrier according to any one of claims 1-11, or the pharmaceutical composition according to claim 12.

14. The method of claim 13, wherein the method further comprises administering one or more additional therapeutic agents to the subject.

15. The method of claim 14, wherein the additional therapeutic agent is temozolomide.

16. The method according to any one of claims 13-15, wherein the additional therapeutic agent is administered before, after, or simultaneously with the AAV carrier.

17. The method according to any one of claims 13-16, wherein the glioma is a GFAP-positive glioma.

18. The method according to any one of claims 13-17, wherein the subject is a human.

19. Use of the AAV carrier according to any one of claims 1-11 in the preparation of a medicament for treating glioma.

20. The use according to claim 19, wherein the glioma is a GFAP-positive glioma.

21. The use according to claim 19 or 20, wherein the drug is used in humans.

22. Use of the AAV carrier and one or more other therapeutic agents according to any one of claims 1-11 in the preparation of a medicament for treating glioma.

23. The use according to claim 22, wherein the additional therapeutic agent is temozolomide.

24. Use of the AAV carrier according to any one of claims 1-11 in the preparation of a medicament for treating glioma, wherein the medicament is a medicament for use of the AAV carrier in combination with one or more other therapeutic agents, optionally, the other therapeutic agent being temozolomide.

25. The use according to any one of claims 22-24, wherein the glioma is a GFAP-positive glioma.

26. The use according to any one of claims 22-25, wherein the drug is used in humans.

Images