Compositions and methods for promoting beta cell development and treating and preventing metabolic disease
Administering Candida dubliniensis compositions enhances beta cell development and metabolic health by increasing its abundance, addressing the lack of understanding in neonatal islet resident macrophages and microbiota influence on beta cells, thereby improving glucose clearance and reducing metabolic diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF UTAH RES FOUND
- Filing Date
- 2025-11-25
- Publication Date
- 2026-05-28
AI Technical Summary
The mechanisms by which microbes influence beta cell development and metabolic diseases, particularly in early life, remain elusive, and existing studies primarily focus on adult animals, neglecting the role of neonatal islet resident macrophages and the microbiota.
Compositions comprising Candida dubliniensis and a carrier are administered to subjects to promote beta cell development, increase Candida dubliniensis abundance, and enhance beta cell proliferation, survival, and metabolic health.
The approach increases beta cell mass, improves glucose clearance, and reduces metabolic diseases by leveraging Candida dubliniensis's interaction with macrophages to stimulate postnatal beta cell development and function.
Smart Images

Figure US2025057031_28052026_PF_FP_ABST
Abstract
Description
[0001] Attorney Docket No. 21101.0495P1
[0002] COMPOSITIONS AND METHODS FOR PROMOTING BETA CELL DEVELOPMENT AND TREATING AND PREVENTING METABOLIC DISEASE
[0003] CROSS REFERENCE TO RELATED APPLICATIONS
[0004] This application claims the benefit of U. S. Provisional Application No. 63 / 724,563, filed November 25, 2024. The content of this earlier filed application is hereby incorporated by reference herein in their entirety.
[0005] INCORPORATION OF THE SEQUENCE LISTING
[0006] The present application contains a sequence listing that is submitted concurrent with the filing of this application, containing the file name “21101_0495Pl_SL.xml” which is 225,280 bytes in size, created on November 24, 2025. and is herein incorporated by reference in its entirety.
[0007] BACKGROUND
[0008] Loss of early -life microbial diversity' is correlated with diabetes, yet mechanisms by which microbes influence disease remain elusive. While macrophages are well known to recognize and respond to microbial stimuli (S. T. Ferris el al.. J Exp Med 214, 2369-2385 (2017)), these cells also play integral roles in tissue development and survival (C. Cosentino, R. Regazzi, IntJMol Sci 22, (2021)). Tissue resident macrophages represent the dominant immune cell in healthy islets (B. Calderon et al., J Exp Med 212, 1497-1512 (2015)) and interact with p-cells (K. Mussar et al., JCI Insight 2, (2017)). promoting their survival and ensuring a quality source of insulin production (C. Cosentino, R. Regazzi, IntJMol Sci 22, (2021)). Yet, most of what is known about islet resident macrophages is gleaned from studies in adult animals and thus very little is know n about neonatal islet resident macrophages or whether the microbiota influences these cells in early life (C. Cosentino, R. Regazzi, Int J Mol Sci 22, (2021); and B. H. Zinselmeyer et al., Diabetologia 61, 1374-1383 (2018)).
[0009] SUMMARY
[0010] Disclosed herein are compositions comprising Candida dubliniensis and a carrier. Disclosed herein are compositions comprising a supernatant from Candida dubliniensis.
[0011] Disclosed herein are compositions comprising a supernatant from Candida dubliniensis and a carrier.
[0012] Disclosed herein are compositions comprising a Candida dubliniensis. Attorney Docket No. 21101.0495P1
[0013] Disclosed herein are methods of treating a subject with a metabolic disease, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier.
[0014] Disclosed herein are methods of treating a subject with diabetes, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier.
[0015] Disclosed herein are methods of treating or preventing a metabolic disease in a subject, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier.
[0016] Disclosed herein are methods of promoting or enhancing proliferation of beta cell development or beta cell regeneration in a subject, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier.
[0017] Disclosed herein are methods of treating a subject with a metabolic disease or disorder, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration Disclosed herein are methods of treating a subject with diabetes, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
[0018] Disclosed herein are methods of treating or preventing a metabolic disease in a subject, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
[0019] Disclosed herein are methods of promoting or enhancing proliferation of beta cell development or beta cell regeneration in a subject, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
[0020] Disclosed herein are methods of increasing survival of a subject having diabetes, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration. Attorney Docket No. 21101.0495P1
[0021] Disclosed herein are methods of increasing clearance of blood glucose in a subject, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
[0022] Disclosed herein are method of increasing 0-cell mass in a subject, the methods comprising administering to the subject a composition comprising Candida dubliniensis and a carrier, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
[0023] BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects and together with the description serve to explain the principles of the invention.
[0025] Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or can be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
[0026] FIGS. 1A-K show transient disruptions to the postnatal microbiota have lasting consequences on 0-cell development and function. FIG. 1 A shows 0-cell mass (BCM) in 8-week old adult Swiss Webster mice, SPF and GF. BCM determined by whole pancreatic histology to calculate the average ratio of insulin+ area: whole pancreatic area across multiple sections. This ratio is multiplied by whole pancreas mass to estimate a value for BCM. In instances when pancreas size is significantly different between treatment groups, the ratio of insulin+ area is measured, but within a fixed area for normalization across mice. Student’s T-test ****p<0.0001. FIG. IB shows pancreatic cross sections from adult Swiss Webster mice, SPF (top) and GF (bottom), insulin in gray. Scale bar = 500 um. FIG. 1C shows total pancreas mass in adult Swiss Webster mice, SPF and GF. Student’s T-test p=ns (not significant) or >0.05. FIG. ID shows the experimental timeline for antibiotic (ABX) cocktail dosing of neonatal mice. ABX Pulse 1 from embryonic (E) day 14 to postnatal (P) day 4, Pulse 2 from P3 to P12, and pulse 3 from P10 to P21 or weaning. Pups were sacrificed at the end of each ABX pulse at different ages of postnatal development. FIG. IE shows 0-cell mass of pups at the end of each antibiotic treatment schematized in FIG. ID: P4 red, P12 Attorney Docket No. 21101.0495P1
[0027] yellow, P20 blue, and age matched SPF and GF controls. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different. FIG. IF shows experimental timeline for testing effects of neonatal ABX exposure on adults. Gray bars represent times when mice are SPF or have a normal microbiota. The bars (Pulse 1, Pulse 2, and Pulse 3; and GF) represent same ABX dosing schedule as in FIG. ID, except that mice were reconstituted with SPF microbes at each treatment end point. White bars represent the germ-free state, lasting until either PIO or P20. All pups were analyzed at P56, or 8 weeks of age. FIG. 1G shows P-cell mass of adult mice, aged P56, following each neonatal antibiotic pulse color-coded as described herein, and SPF, GF and lifetime antibiotic controls.
[0028] Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different. FIG. 1H shows p-cell mass of adult mice bom GF and reconstituted according to the timeline in FIG. IF. Lowercase letters denote significantly different groups based on oneway ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different. FIGS. II and 1J show metabolic measurements of adult mice given antibiotics from P10-P20 and then reconstituted with a control microbiota. Measurements taken at 8 weeks of age on a normal diet in blue (neonatal ABX treated) and gray (lifelong SPF). Measurements taken after 12 weeks on a high fat diet (HFD; second line in FIG. II and top line in FIG. 1J) (lifelong SPF) and navy (neonatal ABX treated). FIG. II show glucose tolerance test (GTT), Two-way ANOVA, with significant difference between treatment groups ***p<0.00I, and *p<0.05. FIG. 1J shows insulin secretion in response to glucose during GTT. Two-way ANOVA with significant difference between treatment groups **p<0.0I, and ***p<0.00L FIG. IK shows P-cell mass of P20 pups humanized with human microbiome sample from birth. Donor ages binned on x-axis. Each point represents one humanized mouse pup. The shape of each point denotes a different donor sample. There are three different donor samples in each age group. The dashed line represents approximate mean of germfree mice for comparison. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different.
[0029] FIGS. 2A-K show that early life bacterial and fungal commensals stimulate postnatal P-cell development. FIG. 2A shows genus-level taxonomic bar plots with genera shaded similarly within the top 5 most abundant taxonomic classes. FIG. 2B shows Min-Max Attorney Docket No. 21101.0495P1
[0030] normalized quantity of Candida spp. specific ITS DNA in SPF mice aged P12 and P20. Student's T-test **p<0.01. Read counts for germfree samples were used as the detection cutoff value. FIG. 2C shows beta-cell mass of P20 pups treated with anti-fungal and the antibiotic moxalactam as indicated from P10-P20. Lowercase letters denote significantly' different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different. FIG. 2D shows genus-level taxonomic bar plots with genera colored similarly within the top 5 most abundant taxonomic classes. FIG. 2E shows p-cell mass of pups treated with specific ABX from P10-P20.
[0031] Vertical line denotes that the SPF and GF data were collected separately in the experiment in FIG. IE and are repeated in this plot for comparison purposes. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly' different, while groups that differ in their letter designation are statistically significantly different from one another and represent differences between the indicated group and GF base on ad hoc Dunnets test with one-way ANOVA. FIG. 2F shows Min-Max normalized quantity of Candida spp. specific ITS DNA in specific antibiotic treated pups. ABX cocktail = Gentamycin, Ampicillin, Neomycin, and Erythromycin. Read counts for germfree samples were used as the detection cutoff value. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different. FIG. 2G shows fold changes of the significantly different (ANCOMBC2; q < 0.05) genera from P12 to P20 untreated mice or moxalactam to untreated mice (P20). Stars indicate a member of the Lactobacillaceae family. FIG. 2H shows p-cell mass of P20 pups mono-associated with the indicated microbe from birth. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly' different. FIG. 21 shows Colony Forming Units (CFU) / g of Candida dubliniensis detected in colon contents from mono-associated pups P5-P20. Each dot is one pup. FIG. 2J shows representative individual and merged channel images of EdU and insulin staining on an isolated islet, quantified in FIG. 2K. Insulin / beta-cells in red, EdU / proliferating cells in green, DAPI / nuclei in blue. Scale bar = 40 urn. FIG. 2K shows the number of EdU and insulin positive cells per islet. N = 40-100 islets per group. Lowercase letters denote significantly different groups based on oneway ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are Attorney Docket No. 21101.0495P1
[0032] not significantly different. Whiskers denote std. error of mean of at least 3 replicate experiments.
[0033] FIGS. 3 A-I show that the microbiota regulates seeding, but not phenotype, of macrophages within the neonatal islet. FIG. 3A shows volcano plots showing significantly differentially expressed genes from islets of GF and SPF at PIO and P20. 16,585 total genes tested. Horizontal dotted line shows adjusted p cutoff at 0.05 and vertical dotted lines at log2 fold-change 0.58 (~1.5 fold change). FIG. 3B shows GSEA on P20 islets from cell type signature gene sets (MSigDB set M8 representing cluster markers from scRNA-seq studies), filtered to show pancreas cell type signature gene sets. GeneRatio reflects the proportion of genes in a given gene set (y-axis) that are differentially expressed in GF versus SPF mice at P20. FIG. 3C shows a heat map of differentially expressed genes in SPF vs GF P20 islets from the Descartes Fetal Pancreas Myeloid and Descartes Fetal Pancreas Lymphoid Cell Type gene sets. A negative fold change indicates enrichment in SPF compared to GF samples. Core enriched genes from GSEA analysis (those that contribute most to the enrichment results) are shown. FIGS. 3D-G show normalized read counts from SPF (PIO or P20) and GF islets for the gene indicated above the graph. Each dot represents the counts from pooled islets of a single mouse pup. The genes initially identified as differentially abundant with DESeq2. Lyz2 GF v SPF **p=0.0033, Lyz2 P10 v P20 p= 0.0097, Cd74 GF v SPF *p=0.0016, Cd74 P10 v P20 p= 4.1425E-08, Folr2 *p= 0.0276, Lyve1***p= 0.0003, Lowercase letters denote significantly different groups based on one-way ANOVA and post hoc means testing (Tukey). Groups that share a letter designation are not significantly different. FIG. 3H shows representative islets from SPF and GF pups, aged P15. F4 / 80 or macrophages in white. Islet boundary denoted by white dashed line. Scale bar = 50 um. FIG.
[0034] 31 shows the number of macrophages per islet in SPF (gray) and GF (white) animals aged P10, P15, and P20. Lowercase letters denote significantly different groups based on one-way ANOVA and post hoc means testing (Tukey). Groups that share a letter designation are not significantly different.
[0035] FIGS. 4A-0 show that C. dubliniensis uses macrophages to increase postnatal p-cell mass. FIG. 4A shows a schematic of macrophage depletion experimental timelines. Red bar represents time when postnatal macrophages are significantly knocked down, Gray bars represent times when macrophage population is not manipulated. The mice are SPF. Animals were analyzed at either P20 or P56. Image created with BioRender.com. FIGS. 4B-C show normalized beta-cell area (FIG. 4B) or basal serum insulin (FIG. 4C) in SPF (gray box plots) Attorney Docket No. 21101.0495P1
[0036] or GF (white box plots) pups (P20) treated with PBS (circles) or clodronate (triangles) liposomes. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different. FIGS. 4D-E show normalized read counts from P20 SPF and Clodronate treated islets for the gene indicated above the graph. Each dot represents the counts from pooled islets of a single mouse pup. The genes initially identified as differentially abundant with DESeq2. Folr2 **p=0.0017, Lyve1 *p=0.0216. FIGS. 4F-G show normalized beta-cell area (FIG. 4F) and serum insulin (FIG. 4G) in SPF MaFIA pups (P20), with macrophage activated apoptosis (Dimerizer injected = triangles) or PBS control injected (circles). Student’s two-tailed T-test **p<0.01. FIG. 4H shows the number of cells double positive for EdU and insulin per islet while grown in vitro under standard media conditions. Islets isolated from P15 pups treated with either PBS (circles) or clodronate (triangles) from P12-P15. Student’s two-tailed T-test, ****p<0.0001. FIGS. 4I-J show normalized beta-cell area (FIG. 41) and fasting serum insulin (FIG. 4 J) of adult SPF mice treated with either PBS (circles) or clodronate (triangles) liposomes as neonates. Student’s T-test ns p=0.25. FIGS. 4K-L show GTT (FIG. 4K) and insulin secretion (FIG. 4L) on adult SPF mice treated with either PBS (white circles) or clodronate (red triangles) liposomes as neonates. Two-way ANOVA difference between treatment groups *p<0.05, **p<0.01. FIG.
[0037] 4M shows the number of macrophages per islet in P15 SPF, GF, and mono-associated animals. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different. FIG. 4N shows normalized beta-cell area in C. dubliniensis (C. dub.) mono-associated (silver box plots) or E. galinarum (E.gal) mono-associated (dark gray box plots) pups (P20) treated with PBS (circles) or clodronate (triangles) liposomes. Posthoc means testing (Tukey) *p<0.05. FIG. 40 shows normalized beta-cell area in C. dubliniensis (C. dub.) mono-associated pups (P20) treated with either isotype control (circles) or anti-csfrl macrophage targeting antibody (triangles). Student’s T-test ***p<0.001.
[0038] FIGS. 5A-H show that variations in Candida cell wall drive host beta-cell phenotypes. FIG. 5 A shows beta-cell mass of P20 mice, mono-associated with C. albicans mutant strains. WT = wild type. Aahrl mutant with altered cell wall proteins, YL = yeast locked (via tetracycline driven expression of the nrgl gene). Vertical line indicates that samples were pooled with those collected separately from the current experiment. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Attorney Docket No. 21101.0495P1
[0039] Groups that share a letter designation are not significantly different. FIG. 5B shows beta-cell mass of P20 mice, mono-associated with C. dubliniensis mutant strains. WT = wild type (either CD36 or Wu284),, Wc7? mutant with reduced cell wall mannan in Wii284 background, Anrgl mutant with extra hyphae in Wu284 background. Vertical line indicates that samples were pooled with those collected separately from the current experiment. Lowercase letters denote significantly different groups based on one-way AN OVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different. *Students two-tailed t-test result for comparisons between WT CD36 and WT Wii284 (p=0.019), and WT Wu284 and Aoch mutant (p=0.012). FIGS. 5C-D show Median Fluorescence Intensity (MFI) from wild type C. dubliniensis strains indicated for ConA (mannan), and WGA (chitin) using standard flow cytometry on fungal cultures. Each dot is a replicate culture. ****Students t-test for ConA & WGA, p<0.0001. FIGS. 5E-F show the cell area as measured in bright field via image flow cytometry on single cells of wild-type C. dubliniensis cultures, n=173-479 cells per group. FIG. 5E shows circular yeast-like cells. Students t-test **p =0.0056. FIG. 5F shows cells containing true hyphae, ****Students t-test pO. OOOl. FIGS. 5G-H show MFI values for individual cells for ConA (mannan) and WGA (beta-glucan). Cells were separated into yeast or hyphal morphotypes based on strain. n=173-479 cells per group. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different.
[0040] FIGS. 6A-F show that C. dubliniensis reduces disease in mouse models. FIGS. 6A-B show the diabetes rates in NOD mice mono-associated with the indicated microbe from birth. (FIG. 6A) Log-rank test, p=0.126. (FIG. 6B) Male NOD mice, Log-rank test. p=0.002. FIGS.
[0041] 6C-E show survival curve. Log-rank test p=0.063 (FIG. 6B), GTT, Two-way ANOVA ***p=0.0004 between treatments (FIG. 6C), and beta-cell mass, T-test **p<0.01 of germfree mice treated with streptozotocin (STZ) and then treated + / - C. dubliniensis. For FIGS. 6C-D, a single representative experiment is shown, survival curve (FIG. 6B) is for the combined experiments. FIG. 6F shows beta-cell mass of pups treated with antibiotics (ABX) and C. dubliniensis (C. dub.) Lowercase letters denote significantly different groups based on oneway ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different.
[0042] FIGS. 7A-M show that disruptions to the microbiota by antibiotics (ABX) during the neonatal period (postnatal Day 10-20) but not during adult (8weeks) or a lack of a microbiota (GF) on p-cell development and function. FIGS. 7A-B show p-cell mass (FIG. 7A) and total Attorney Docket No. 21101.0495P1
[0043] pancreas mass (FIG. 7B) in 8-week old adult C57B16 mice, SPF and GF. Student’s T-test **p<0.01. FIG. 7C shows representative pancreatic cross sections from P21 mice, SPF left, GF middle, Pulse 3 right, insulin staining in brown. Scale bar = 500 um. FIG. 7D shows P-cell mass in adult C57B16 mice given ABX cocktail from P35-P45, and analyzed at P56. Student’s T-test p=ns. FIGS. 7E-G show P-cell mass (FIG. 7E). serum insulin (FIG. 7F), and blood glucose (FIG. 7G) in adult Swiss Webster mice given ABX cocktail from P42-P52, and analyzed at P70. FIGS. 7H-I show fasting blood glucose and serum insulin levels in mice at 8 weeks of age on a normal diet (blue, given ABX in neonatal life). Student’s T-test **p<0.01. FIG. 71 shows fasting serum insulin at 8 weeks on a normal diet (blue, given ABX in neonatal life). Student’s T-test ***p<0.001. FIG. 7J shows percent weight change of mice as they were fed an obesogenic diet in adulthood. FIGS. 7K-L show fasting glucose and insulin levels in mice fed a high fat diet for 12 weeks (blue, given ABX in neonatal life). FIG. 7M show serum insulin of P20 pups humanized with human microbiome sample from birth. Donor ages binned on x-axis. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter designation are not significantly different.
[0044] FIGS. 8A-I show variations in bacterial and fungal commensals during treatment with singular antibiotic treatment and how these differences in microbiota communities stimulate postnatal P-cell development. FIG. 8A shows the alpha diversity metrics of antibiotic-treated and untreated mice at different ages. Wilcoxon Rank Sum test. For clarity, statistical tests to untreated SPF animals are shown in panels with multiple groups. FIG. 8B shows fungal-specific ITS sequencing of human donor samples from the TEDDY study, donor ages (weeks) on the x-axis. Each sample is from a different donor, except bar plot of 8-week is average of two donors. Samples without detectable ITS amplification were not included. Cultures alongside represent sequencing from lab prepared purified cultures of each Candida species, indicating the ability to accurately assign species level taxa using this approach. FIG. 8C shows total Illumina 16S reads and 16S copies detected by qPCRfrom input total-DNA normalized samples. Pearson correlation p < 0.0001, R2 = 0.83. FIG. 8D shows NMDS based on Bray-Curtis distances of antibiotic-treated microbial communities. Antibiotic treatment significantly separates communities (Adonis p < 0.001, R2 = 0.63293). FIGS. 8E-F show basal blood glucose (FIG. 8F), and serum insulin (FIG. 8G), of pups treated with specific ABX from P10-P20. Lowercase letters denote significantly different groups based on one-way ANOVA and posthoc means testing (Tukey). Groups that share a letter Attorney Docket No. 21101.0495P1
[0045] designation are not significantly different. In FIG. 8F, asterisks represent difference between the indicated group and GF base on ad hoc Dunnets test with one-way ANOVA. FIG. 8G shows the average P-cell area in moxalactam and neomycin treated mice. Student’s T-test *p<0.05. FIG. 8H shows the estimated -cells per pancreatic cross section based on average P-cell area in moxalactam and neomycin treated mice. Student’s T-test **p<0.01. FIG. 81 show colony forming units (CFU) per mg of feces in adult Swiss Webster mice monoassociated with the indicated Candida species for 72 hours.
[0046] FIG. 9 shows the most enriched GeneOntology (GO) term biological processes at P20 from GF and SPF islet transcripts, with term associated with proliferation processes highlighted in red.
[0047] FIGS. 10A-I show the normalized counts of genes initially identified as differentially abundant with DESeq2. Each dot represents the counts from the isolated islets of a single mouse pup. FIGS. 10A-C show fungal response element genes between SPF and GF mice aged P20. Syk *p= 0.0323, Malt1 **p= 0.0041. Card14 *p= 0.0339. FIGS. 10D-E show islet maturation genes, Arnt2 and Nrld1, from postnatal (P) day 20 SPF and germfree (GF) islets. DESeq2 adjusted p values: Arnt2***p=0.0012, Nrld1****p=7.8803E-15. FIGS. 10F-I show macrophage associated genes from SPF P10 and P20 islets, Cd209a *p= 0.0128, Cd163 *p= 0.0234. H2-Aa ****p= 1.2921E-06. H2-Ab1 ***p= 1.2002E-05.
[0048] FIGS. 11 A-H show how the microbiota influences the cellularity and transcriptional profile of islets. FIG. 11A shows UMAP illustrating SPF and GF sample cell clustering with 14 unique identities. Cells are pooled from 20 mice per treatment resulting in one GF and SPF sample that was sequenced. FIG. 11B depicts bar plots showing proportion of each cluster in FIG. 11A represented in SPF and GF. FIG. 11C depicts a dot plot showing expression patterns of immune and islet macrophage associated genes across clusters. FIG.
[0049] 11D shows UMAP after subsetting and reclustering the confident immune cell populations from FIG. 11 A. FIG. 11E shows macrophage polarization index (MPI) between microbiota conditions for macrophage cluster 0 and 4 after subsetting. Wilcoxon rank sum test. ** p < 0.01. FIG. 11F shows activation-induced macrophage differentiation index (AMDI) between microbiota conditions for macrophage cluster 0 and 4 after subsetting. Wilcoxon rank sum test. ** p < 0.01, *** p < 0.001. FIG. 11G depicts violin plots showing the expression distributions of important islet macrophage-associated genes among the macrophage clusters 0 and 4 from FIG. 1 ID. FIG. 11H shows a volcano plot illustrating 28 differentially expressed genes between GF and SPF in cells from cluster 4. Attorney Docket No. 21101.0495P1
[0050] FIGS. 12A-0 show that macrophages regulate beta cell development during the early life window of postnatal day 10-20 and that the microbiota influences the presence of these macrophages. FIG. 12A shows representative staining of liver resident macrophages in mice treated with either PBS or clodronate liposomes. F4 / 80+ macrophages are green, DAPI / nuclei are blue. Scale bar = 75 pm. FIG. 12B shows representative F4 / 80+ macrophage staining of islets isolated from mice that were treated with clodronate of PBS liposomes. Scale bar = 40 pm. FIG. 12C shows the percentage of CD64+, CD1 lb+ cells of CD45+ cells from spleens following clodronate or PBS treatment at P20 (FIG. 4A). Student’s two-tailed T-test **p<0.01. FIG. 12D shows pancreas mass of P20 SPF mice treated with either PBS (circles) or clodronate (triangles) liposomes. Student’s two-tailed T-test ***p<0.001. FIG. 12E shows representative insulin-stained cross sections of pancreatic from pups treated with either PBS. clodronate, or from dimerizer-induced MaFIA transgenics. Scale bar = 500 pm. FIG. 12F depicts a ridgeplot showing the distribution of fold-changes among genes within Reactome gene sets with significant GSEA results with clodronate treatment at P20. FIG. 12G shows H& E staining of pancreas from PBS or clodronate treated pups. Red arrows indicate regions of inflammation. Scale bar = 500 pm. FIGS. 12H-M show normalized counts of genes initially identified as differentially abundant with DESeq2. Each dot represents the counts from all isolated islets of a single mouse pup. Csflr *p= 0.0408, Cd209a *p=0.0366, Cdl63 ****p=5 345E-12, Insr *p=0.0156, MafA **p=0.0078, Nrldl ****p=6.836E-ll. FIG. 12N shows the number of cells double positive for EdU and insulin per islet. Islets isolated from P15 pups treated with either PBS (circles) or clodronate (triangles) from P12-P15 and with or without BefA added while grown in vitro under standard media conditions. Student’s two-tailed T-test, ns=not significant. FIG. 120 shows representative pancreatic cross sections from 3 different adult mice treated with either PBS (circles) or clodronate (triangles) liposomes as neonates, F4 / 80 or macrophages in green, DAPI / nuclei in blue, scale bar = 75 pm.
[0051] DETAILED DESCRIPTION
[0052] The present disclosure can be understood more readily by reference to the following detailed description of the invention, the figures and the examples included herein.
[0053] Before the present methods and compositions are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology’ used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar Attorney Docket No. 21101.0495P1
[0054] or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.
[0055] Moreover, it is to be understood that unless otherwise expressly stated, it is in no way intended that any method set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not actually recite an order to be followed by its steps or it is not otherwise specifically stated in the claims or descriptions that the steps are to be limited to a specific order, it is in no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, and the number or Wpe of aspects described in the specification.
[0056] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.
[0057] Further, the dates of publication provided herein can be different from the actual publication dates, which can require independent confirmation.
[0058] DEFINITIONS
[0059] As used in the specification and the appended claims, the singular forms “a,” "an" and “the” include plural referents unless the context clearly dictates otherwise.
[0060] The word “or” as used herein means any one member of a particular list and also includes any combination of members of that list.
[0061] Ranges can be expressed herein as from “about” or “approximately” one particular value, and / or to “about” or “approximately” another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” or “approximately,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also Attorney Docket No. 21101.0495P1
[0062] understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0063] As used herein, the terms “optional” or “optionally” mean that the subsequently described event or circumstance may or may not occur and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0064] As used herein, the term “sample” is meant a tissue or organ from a subject; a cell (either within a subject, taken directly from a subject, or a cell maintained in culture or from a cultured cell line); a cell lysate (or lysate fraction) or cell extract; or a solution containing one or more molecules derived from a cell or cellular material (e.g. a polypeptide or nucleic acid), which is assayed as described herein. A sample may also be any body fluid or excretion (for example, but not limited to, blood, urine, stool, saliva, tears, bile, cerebral spinal fluid) that contains cells or cell components.
[0065] As used herein, the term “subject” refers to the target of administration, e.g., a human. Thus, the subject of the disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.). In one aspect, a subject is a mammal. In another aspect, a subject is a human. The term does not denote a particular age or sex. Thus, adult, child, adolescent and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.
[0066] As used herein, the term “patient” refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects. In some aspects of the disclosed methods, the “patient” has been diagnosed with a need for treatment for altering relative abundance of Candida dubliniensis in the subject, such as, for example, prior to the administering step. In some aspects of the disclosed methods, the “patient” has been diagnosed with a need for treatment for metabolic disease, such as, for example, prior to the administering step.
[0067] As used herein, the term “normal” refers to an individual, a sample or a subject that does not have a disease (e.g., metabolic disease) or does not have an increased susceptibility of developing a disease (e.g., metabolic disease).
[0068] As used herein, the term “susceptibility” refers to the likelihood of a subject being clinically diagnosed with a disease. For example, a human subject with an increased susceptibility for metabolic disease can refer to a human subject with an increased likelihood of a subject being clinically diagnosed with metabolic disease. Attorney Docket No. 21101.0495P1
[0069] As used herein, the term “comprising’" can include the aspects “consisting of’ and “consisting essentially of.”
[0070] As used herein, a “control” is a sample from either a normal subject or from tissue from a normal subject that does not have metabolic disease.
[0071] As used herein, “under-expression” means expression less than the expression detected in a normal sample. For example, a nucleic acid that is under-expressed may be expressed about 1 standard deviation below normal, or about 2 standard deviations below normal, or about 3 standard deviations below the normal level of expression. Therefore, a nucleic acid that is expressed about 3 standard deviations below a control level of expression is a nucleic acid that is under-expressed.
[0072] As used herein, “treat” is meant to mean administer a compound or composition of the invention to a subject, such as a human or other mammal (for example, an animal model), that has a metabolic disease, in order to prevent or delay a worsening of the effects of the disease or condition, or to partially or fully reverse the effects or symptoms of the disease.
[0073] As used herein, “prevent” is meant to mean minimize the chance that a subject who has an increased susceptibility for developing a disease (e.g., metabolic disease) of actually developing the disease.
[0074] As used herein, the term “reference,” “reference expression,” “reference sample,” “reference value,” “control,” “control sample” and the like, when used in the context of a sample or expression level of one or more microbes refers to a reference standard wherein the reference is expressed at a constant level among different (i.e., not the same tissue, but multiple tissues) tissues, and is unaffected by the experimental conditions, and is indicative of the level in a sample of a predetermined disease status (e.g., not suffering from metabolic disease). The reference value can be a predetermined standard value or a range of predetermined standard values, representing no illness, or a predetermined type or severity of illness.
[0075] The percentages are by weight unless otherw ise stated. The expressions “weight %” and “wt %"’ are synony mous. They refer to quantities expressed in percent on a dry w eight basis.
[0076] As used herein, the term "‘probiotic” refers to live microorganisms that, when administered in adequate amounts, confer a health benefit on the host. As used herein, the term “probiotic” can also refer to microbial cell preparations or components or metabolites of microbial cells with a beneficial effect on the health or well-being of the host. A probiotic can comprise a unique strain of microorganism, a mix of various strains and / or a mix of various Attorney Docket No. 21101.0495P1
[0077] fungi and / or bacterial species and genera. In case of mixtures, the singular term “probiotic'’ can still be used to designate the probiotic mixture or preparation. In some aspects, “probiotic” refers to live microorganisms, which, when administered in adequate amounts, may confer a health benefit on the host. The probiotics can be available in foods and dietary supplements (for example, but not limited to capsules, tablets, and powders). Non-limiting examples of foods containing probiotics include dairy products such as yogurt, fermented and unfermented milk, smoothies, butter, cream, hummus, kombucha, salad dressing, miso, tempeh, nutrition bars, and some juices and soy beverages. In some aspects, the probiotics can be present naturally.
[0078] As used herein, the term “nutraceutical” refers to a food stuff or a dietary supplement that can provide health benefits.
[0079] Upon birth, mammals are first exposed to microbial organisms that begin the process of establishing the resident microbiota (C. Martino et al., Nat Rev Microbiol 20, 707-720 (2022)). After this initial colonization, microbiota composition develops and diversifies in distinct phases across early life, each new phase dominated by different microbial taxa (C. J. Stewart et al., Nature 562, 583-588 (2018); T. A. Auchtung et al., Nat Commun 13, 3151 (2022); and J. Turunen, et a., Pediatr Res 94, 486-494 (2023)). The presence of microbial cues at the appropriate time is likely an important component of host development, similarly to the precisely timed expression of host genes (T. C. G. Bosch. M. McFall-Ngai, Curr Top Dev Biol 141, 399-427 (2021)). Healthy infants harbor fast-growing facultative Gamma proteobacteria and Bacilli, and fungal species, most abundant of which are from the Candida genus, common members of the vaginal microbiota (C. J. Stewart et al., Nature 562, 583-588 (2018); T. A. Auchtung et al., Nat Commun 13, 3151 (2022); M. Yassour et al., Sci Transl Med 8, 343ra381 (2016): S. Raimondi et al., Front Microbiol 10, 1575 (2019); andN.
[0080] Kondori et al., MedMycol 58, 485-492 (2020)). While the outgrowth of these microbes often correlates with disease in adults, their enrichment in early life suggests they may confer benefits that are yet to be appreciated. Supporting this, infants that are bom via caesarean section have a distinct microbiota from those delivered vaginally, and are also at increased risk for diseases, including diabetes (E. T. Jensen et al.. J Endocr Soc 6, bvac072 (2022)). However, exposure of caesarean infants to vaginal fluids can reduce these odds, such as has been documented for neurodevelopmental disorders (L. Zhou et al.. Cell Host Microbe 31, 1232-1247 el235 (2023)). Several other reports have also shown important roles for infant microbial communities in various aspects of development (L. Zhou et al.. Cell Host Microbe 31, 1232-1247 el235 (2023); X. S. Zhang etal.. Cell Host Microbe 29, 1249-1265 el249 Attorney Docket No. 21101.0495P1
[0081] (2021); Z. Al Nabhani et al., Immunity 50. 1276-1288 el275 (2019); and Laura M. Cox et al., Cell 158. 705-721 (2014)). Thus, acquisition of the appropriate bacterial and fungal species in early life is important for lifelong health. Yet, the impact of the neonatal microbiota, in particular fungi, on pancreatic development and function in mammals has not been studied.
[0082] Metabolic homeostasis relies on insulin-producing p-cells, housed within the pancreatic islets. Loss of insulin production or responsiveness is the basis of diabetes. P-cells differentiate in utero, and undergo a proliferative burst after birth, allowing for the expansion of insulin-producing tissue (S. Georgia, A. Bhushan, J Clin Invest 114, 963-968 (2004); J. J. Meier et al., Diabetes 57, 1584-1594 (2008); and Y. Dor, et al., Nature 429, 41-46 (2004)). This period of P-cell proliferation is early and limited, with estimates from human tissue putting peak levels before one year of age (B. E. Gregg et al., J. Clin. Endocrinol. Metab. 97, 3197-3206 (2012)). Because of the long lifetime of P-cells (M. Cnop et al., Diabetologia 53, 321-330 (2010)). this neonatal proliferation event is important to establish the majority of adult P-cells. The concurrence of microbiota acquisition and diversification with postnatal islet expansion suggests that commensal microbes might influence this process. Supporting this, bacterial species of the zebrafish microbiota are a source of bio-active products that can directly induce P-cell proliferation (J. H. Hill et al.. Cell Metab, (2022); and J. H. Hill, et al., eLife 5, (2016)). However, to what extent this phenomenon is conserved in more metabolically complex mammals, or whether transient disruptions to this community might have life-long impacts, were unexplored questions.
[0083] COMPOSITIONS
[0084] Candida dubliniensis is a fungal opportunistic pathogen originally isolated from AIDS patients. It is also occasionally isolated from immunocompetent individuals. It is of the genus Candida, very' closely related to Candida albicans but forming a
[0085] distinct phylogenetic cluster in DNA fingerprinting.
[0086] Retrospective studies have shown that Candida dubliniensis had been commonly identified as Candida albicans, with which C. dubliniensis is closely related and shares a number of characteristics.
[0087] Disclosed herein are compositions comprising or consisting of Candida dubliniensis. Also disclosed herein are compositions comprising or consisting of Candida dubliniensis and a carrier. In some aspects, the Candida dubliniensis is strain RL0039. In some aspects, the Candida dubliniensis is strain Wu284. Disclosed herein are compositions comprising or Attorney Docket No. 21101.0495P1
[0088] consisting of a supernatant from Candida dubliniensis. Disclosed herein are compositions comprising or consisting of a supernatant from Candida dubliniensis and a carrier.
[0089] Disclosed herein are consortiums (a mixture of two or more distinct strains of fungi) of fungi. In particular, the present disclosure is directed to compositions containing one or more of the Candida dubliniensis strains as disclosed herein. In some aspects, the composition can include two or more Candida dubliniensis strains. In some aspects, the compositions can comprise one or more of the Candida dubliniensis strains provided in Table 1. In some aspects, the compositions can comprise one or more of the Candida dubliniensis strains provided in BioProject: PRJNA983325 (SRA Study: SRP459155). In some aspects, the compositions can comprise one or more of the Candida dubliniensis strains as disclosed in Accession: SRX26196627 or SRX26196626. In some aspects the Candida dubliniensis can have an 18S rRNA sequence set forth in Accession No. NG_062654. In some aspects the Candida dubliniensis can have an 18S rRNA sequence having 80, 85, 90, 95, 96, 97, 98, or 99% identity to the sequence set forth in Accession No. NG_062654.
[0090] Table 1. Candida dubliniensis Sequences.
[0091] Strain ID Microbe Accession Number RL053 Candida dubliniensis 43921810
[0092] JH055
[0093] RL0039 Candida dubliniensis
[0094] CD36 Candida dubliniensis Taxon ID: 573826; ATCC: MYA-646;
[0095] AJ227752
[0096] WU284 Candida dubliniensis
[0097] NGY563 Candida dubliniensis7’u284’Aoch
[0098]
[0099] In some aspects, the compositions disclosed herein are capable of replacing microbiota of a subject with an imbalanced microbiota. In some aspects, the compositions disclosed herein are capable of replacing microbiota of a subject with an imbalanced microbiota to prevent or reduce the likelihood of the development of a disease or disorder. In some aspects, the compositions disclosed herein are capable of replacing microbiota of a subject with a disease or disorder associated with an imbalanced microbiota. In some aspects, the imbalanced microbiota can be a decrease in Candida dubliniensis. In some aspects, the disease or disorder can be a metabolic disease. In some aspects, the metabolic disease can be type 1 diabetes, type 2 diabetes, insulin deficiency, insulin deficiency, insulin-resistance Attorney Docket No. 21101.0495P1
[0100] related disorders, or glucose intolerance. In some aspects, diabetes can be type 1 diabetes. In some aspects, diabetes can be type 2 diabetes.
[0101] In some aspects, the disclosed compositions can include at least one or more Candida dubliniensis strains identifiable by homology of at least 95, 96, 97, 98, 99 or greater percent identity to the ITS or 18S. In some aspects, the 18S sequence is less than about 1.2 kb, 1.1 kb, 1.0 kb, 0.9 kb, 8 kb, 0.7 kb, 0.6 kb, 0.5 kb, 0.4 kb, 0.3 kb, 0.2 kb, or 0.1 kb and greater than about 50 nt, 0.1 kb, 2 kb, 0.3 kb. 0.4 kb. 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1.0 kb. or 1.1 kb. In some aspects, the amount of ITS or 18S sequence homology is between about 150 nt and 500 nt, for example about 250 nt. To determine the percent identity of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first nucleic acid sequence for optimal alignment with a second nucleic acid sequence). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity of identical positions / total # of positions times 100).
[0102] In some aspects, the Candida dubliniensis can be a C. dubliniensis mutant strain. In some aspects, the C. dubliniensis mutant strain can have a defective N-mannosylation. In some aspects, the Candida dubliniensis can be a C. dubliniensis mutant strain that has defective N-mannosylation. In some aspects, the C. dubliniensis mutant strain can be C. dubliniensisAoch. In some aspects, the C. dubliniensisAochcan be on the Wu284 background. In some aspects, the C. dubliniensisAochis the strain NGY563.
[0103] The determination of percent homology between two sequences may be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Nat'l Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Nat'l Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (1990) J. Mol. Biol. 215:403-410. BLAST nucleotide searches can be performed with the NBLAST program, score=100, word length=12 to obtain nucleotide sequences similar or homologous to nucleic acid molecules of the present disclosure. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters Attorney Docket No. 21101.0495P1
[0104] of the respective programs (e.g., XBLAST and NBLAST) can be used. These algorithms may¬ be used to align DNA with RNA, and in some cases may be used to align proteins with translated nucleotide sequences.
[0105] In some aspects, at least two or more microorganisms can be included in the compositions of the present disclosure. It is contemplated that where two or more Candida dubliniensis strains form the composition, the Candida dubliniensis strains can be co-cultured to produce the disclosed composition. In some aspects, the disclosed composition can be formed by combining individual cultures of the two or more strains. The Candida dubliniensis strains can be propagated by methods known in the art. For example, the Candida dubliniensis strains can be propagated in a liquid medium under anaerobic or aerobic conditions. Suitable liquid mediums used for growing microorganism include those known in the art such as Nutrient Broth, Tryptic soy agar (TSA), Schadlers, YCFA, etc. In some aspects, the composition includes the entire listing of the strains listed in Table 1. In some aspects, the compositions can further include one or more strains listed in Table 1. In some aspects, the composition will include one or more fungal or bacterial strains from those listed in Table 1, Table 2, or mixtures thereof.
[0106] Table 2. Sequences.
[0107] Microbe Strain ID Accession Number Enterococcus gallinarum RL0508
[0108] Enterococcus gallinarum JLR. JH044 JAVRDK000000000 (Version JAVRDK000000000.1)
[0109] NCBI: GCF_047445735.1
[0110] (GCF 047445735.1- RS 2025 02 05)
[0111] E. coli Nissle 1917 CP007799; proteome ID:
[0112] UP000011176; GCF 003546975.1 E. coli RL0476
[0113] E. coli JLR. JH012 JAVRDJ000000000 (Version JAVRDJ000000000.1)
[0114] NCBI: GCF_047445705.1
[0115]
[0116] Attorney Docket No. 21101.0495P1
[0117] (GCF_047445705.1- RS 2025 02 05)
[0118]
[0119] As used herein, the term “therapeutically effective amount” or “effective amount” refers to an amount of a therapeutic agent such as Candida dubliniensis, that when administered alone or in combination with an additional therapeutic agent to a cell, tissue, or subject is effective to prevent, delay the onset of, or reduce the progression of a metabolic disease, for example. A therapeutically effective dose further refers to that amount of the therapeutic agent such as Candida dubliniensis, sufficient to result in amelioration of symptoms, e.g., treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient administered alone, a therapeutically effective dose refers to that ingredient alone. When applied to a combination, a therapeutically effective dose refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously. In particular, an effective amount can be an amount that inhibits or reduces one or more signs or symptoms of a metabolic disease.
[0120] In some aspects, the compositions disclosed herein can comprise at least IxlO4cells of each Candida dubliniensis strain. In some aspects, the compositions disclosed herein can comprise at least IxlO3cells of each Candida dubliniensis strain. In some aspects, the compositions disclosed herein can comprise at least IxlO6cells of each Candida dubliniensis strain. In some aspects, the compositions disclosed herein can comprise at least IxlO7cells of each Candida dubliniensis strain. In some aspects, the compositions disclosed herein can comprise at least IxlO8cells of each Candida dubliniensis strain. In some aspects, the compositions disclosed herein can comprise at least IxlO9cells of each Candida dubliniensis strain. In some aspects, the compositions disclosed herein can comprise at least IxlO10cells of each Candida dubliniensis strain. In some aspects, a single dosage of any of the compositions disclosed herein can comprise between IxlO4and IxlO10cells of each microbial strain. In some aspects, the cells of the consortia can be active. In some aspect, Candida dubliniensis present in any of the compositions described herein can be active. Attorney Docket No. 21101.0495P1
[0121] In some aspects, the Candida dubliniensis can be administered at a dose of at least 103CFU. optionally at least 104CFU, optionally at least 105CFU, optionally at least
[0122] 106CFU, optionally at least 107CFU, optionally at least 108CFU, or optionally at least 109CFU. In some aspects, the Candida dubliniensis can be administered at a dose of 103to 1012CFU, optionally at a dose of 104to 1011CFU, optionally at a dose of 105to 1010CFU, optionally at a dose of 106to 1010CFU, or optionally at a dose of 107to 1010CFU. In some aspects, the Candida dubliniensis can be administered at optionally at a dose of 107to 1010CFU. In some aspects, the Candida dubliniensis can be administered at optionally at a dose of 5×109to 7×1010CFU.
[0123] In some aspects, the compositions disclosed herein comprising or consisting of Candida dubliniensis can be administered at a dose of at least 0.01 pg. optionally at least 0.1 pg, optionally at least 1 pg, optionally at least 0.5 pg, optionally at least 1 pg, optionally at least 5 pg, optionally at least 10 pg, optionally at least 50 pg, optionally at least 100 pg, optionally at least 500 pg, or optionally at least 1 mg. In some aspects, the compositions disclosed herein comprising or consisting of Candida dubliniensis can be administered at a dose of 1 pg to 1000 mg. optionally at a dose of 0.005-500 mg, optionally at a dose of 0.01-200 mg, optionally at a dose of 0.05-100 mg, optionally at a dose of 0.1-50 mg, optionally at a dose of 1-20 mg, optionally at a dose of 0.1-5 mg, or optionally at a dose of about 1-5 mg. In some aspects, the compositions disclosed herein comprising or consisting of Candida dubliniensis can be administered at a dose of 1 pg to 10 mg. In some aspects,
[0124] the compositions disclosed herein comprising or consisting of Candida dubliniensis uniformis can be administered at a dose of 25 pg to 1 mg.
[0125] In any of the methods disclosed herein, the amount of Candida dubliniensis administered to a subject in need thereof can be determined according to various parameters such as the age, body weight, response of the subject, condition of the subject to be treated; the type and severity the metabolic disease; the form of the composition in which the Candida dubliniensis is included; the route of administration; and the desired treatment regimen. The severity of the condition can, for example, be evaluated, in part, by standard prognostic evaluation methods. For example, the amount of Candida dubliniensis can be titrated to determine the effective amount for administering to the subject in need of treatment. One of ordinary skill in the art would appreciate that the attending physician would know how to and when to terminate, interrupt or adjust administration of bacteria due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity). Attorney Docket No. 21101.0495P1
[0126] In some aspects, the compositions described herein can be pharmaceutical compositions. Disclosed herein are pharmaceutical compositions comprising Candida dubliniensis. In some aspects, the pharmaceutical compositions can comprise Candida dubliniensis and a carrier. In some aspects, the carrier can be a pharmaceutically acceptable carrier. As used herein, the phrase “pharmaceutically acceptable carrier” can include any solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
[0127] In some aspects, the compositions can also include additives. Suitable additives include substances known in the art that may support grow th, production of specific metabolites by the microorganism, alter pH, enrich for target metabolites, enhance insecticidal effects, and combinations thereof. Exemplary additives include carbon sources, nitrogen sources, phosphorous sources, inorganic salt, organic acid, growth media, vitamins, minerals, acetic acid, amino acids and the like.
[0128] A “pharmaceutically acceptable salt” is intended to mean a salt of a free acid or base of a compound represented herein that is non-toxic, biologically tolerable, or otherwise biologically suitable for administration to the subject. Preferred pharmaceutically acceptable salts are those that are pharmacologically effective and suitable for contact with the tissues of subj ects without undue toxici ty, irritation, or allergic response. A compound described herein may possess a sufficiently acidic group, a sufficiently basic group, both types of functional groups, or more than one of each type, and accordingly react with a number of inorganic or organic bases, and inorganic and organic acids, to form a pharmaceutically acceptable salt.
[0129] Examples of pharmaceutically acceptable salts include but are not limited to sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, monohydrogen-phosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates, butyne- 1,4-dioates, hexyne- 1,6-dioates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, hydroxybenzoates, methoxybenzoates, phthalates, sulfonates, methylsulfonates, propylsulfonates, besylates. xylenesulfonates, naphthalene- 1-sulfonates, naphthalene-2-sulfonates, phenylacetates, phenylpropionates, phenylbutyrates, citrates, lactates, y-hydroxybutyrates, glycolates, tartrates, and mandelates.
[0130] Examples of suitable carbon sources include, without limitation, starch, peptone, yeast extract, amino acids, sugars such as sucrose, glucose, arabinose, mannose, glucosamine, maltose, sugar cane, alfalfa extracts, molasses, rum, and the like; salts of organic acids such Attorney Docket No. 21101.0495P1
[0131] as acetic acid, fumaric acid, adipic acid, propionic acid, citric acid, gluconic acid, malic acid, pyruvic acid, malonic acid, isovaleric acid, valeric acid, butyric acid and the like: alcohols such as ethanol, glycerol, and the like; oil or fat such as soybean oil, rice bran oil, olive oil, com oil, and sesame oil. The amount of the carbon source added varies according to the kind of carbon source and is typically between 1 to 100 grams per liter of medium. The weight fraction of the carbon source in the composition may be about 98% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2%, or about 1% or less of the total weight of the composition. Preferably, alfalfa is contained in the medium as a major carbon source, at a concentration of about 1 to 20% (w / v). More preferably, the alfalfa is at a concentration of about 5 to 12% (w / v).
[0132] Examples of suitable nitrogen sources include, w ithout limitation, amino acids, yeast extract, alfalfa extract, tryptone, beef extract, peptone, potassium nitrate, ammonium nitrate, ammonium chloride, ammonium sulfate, ammonium phosphate, ammonia or combinations thereof. The amount of nitrogen source varies according to the nitrogen source, typically between 0.1 to 30 grams per liter of medium. The weight fraction of the nitrogen source in the composition may be about 98% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2%, or about 1% or less of the total weight of the composition.
[0133] Examples of suitable inorganic salts include, without limitation, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, disodium hydrogen phosphate, magnesium sulfate, magnesium chloride, ferric sulfate, ferrous sulfate, ferric chloride, ferrous chloride, manganous sulfate, manganous chloride, zinc sulfate, zinc chloride, cupric sulfate, calcium chloride, sodium chloride, calcium carbonate, sodium carbonate, and combinations thereof. The weight fraction of the inorganic salt in the composition may be about 98% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less. Attorney Docket No. 21101.0495P1
[0134] about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2%, or about 1% or less of the total weight of the composition.
[0135] In some aspects, the compositions of the present disclosure can further comprise acetic acid or carboxylic acid. Suitable acetic acids include any known in the art including, without limitation, formic acid, acetic acid, propionic acid, butanoic acid, isobutyric acid, 3-methyl butanoic acid, methyl acetate ethyl acetate, propyl acetate, butyl acetate, isobutyl acetate, isovaleric acid, valeric acid, butyric acid, and 2-methyl butyl acetate. In some aspects, the acetic acid is included by using vinegar. The weight fraction of the acetic acid in the composition may be about 98% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2%, or about 1% or less of the total weight of the composition.
[0136] In some aspects, the compositions disclosed herein can be frozen. In some aspects, the bacteria can be frozen in 25% anaerobically reduced PBS+ 0.1% L-Cystine or 5% DMSO. The compositions of the present disclosure can be in liquid or dry form. In some aspects, the compositions disclosed herein can be a solid. In some aspects, the compositions disclosed herein can be a liquid. In some aspects, the liquid can be concentrated liquid. In some aspects, the liquid can be dilute liquid. In some aspects, the composition can comprise an aqueous suspension of components. This aqueous suspension can be provided as a concentrated stock solution which is diluted prior to application or as a diluted solution ready -to-use. Also, the composition can be a powder, granules, dust, pellet or colloidal concentrate. Such dry forms may be formulated to dissolve immediately upon wetting or dissolve in a controlled-release, sustained-release, or other time-dependent manner. Also, the composition may be in a dry form that does not depend upon wetting or dissolving to be effective.
[0137] In some aspects, the composition of the present disclosure can comprise at least one optional excipient. Non-limiting examples of suitable excipients include antioxidants, additives, diluents, binders, fillers, buffering agents, mineral salts, pH modifying agents, disintegrants, dispersing agents, flavoring agents, nutritive agents, oncotic and osmotic agents, stabilizers, preservatives, palatabilify enhancers and coloring agents. The amount and types of excipients utilized to form the combination may be selected according to known principles of science. Attorney Docket No. 21101.0495P1
[0138] In some aspects, the excipient can include at least one diluent. Non-limiting examples of suitable diluents include microcrystalline cellulose (MCC), cellulose derivatives, cellulose powder, cellulose esters (i.e., acetate and butyrate mixed esters), ethyl cellulose, methyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, com starch, phosphated com starch, pregelatinized com starch, rice starch, potato starch, tapioca starch, starch-lactose, starch-calcium carbonate, sodium starch glycolate, glucose, fructose, lactose, lactose monohydrate, sucrose, xylose, lacitol, mannitol, malitol, sorbitol, xylitol, maltodextrin, and trehalose.
[0139] In some aspects, the excipient can comprise a binder. Suitable binders include, but are not limited to, starches, pregelatinized starches, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinyl alcohols, C12-C18 fatty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, polypeptides, oligopeptides, and combinations thereof.
[0140] In some aspects, the excipient can include a filler. Suitable fillers include, but are not limited to, carbohydrates, inorganic compounds, and polyvinylpyrrolidone. By way of nonlimiting example, the filler may be calcium sulfate, both di- and tri-basic, starch, calcium carbonate, magnesium carbonate, microcrystalline cellulose, dibasic calcium phosphate, magnesium carbonate, magnesium oxide, calcium silicate, talc, modified starches, lactose, sucrose, mannitol, or sorbitol.
[0141] In some aspects, the excipient can comprise a buffering agent. Representative examples of suitable buffering agents include, but are not limited to, MOPS, HEPES, TAPS, Bicine, Tricine, TES, PIPES, MES, Tris buffers or buffered saline salts (e.g., Tris buffered saline or phosphate buffered saline).
[0142] In some aspects, the excipient can include a disintegrant. Suitable disintegrants include, but are not limited to, starches such as cornstarch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, microcrystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, locust bean, karaya, pecitin, and tragacanth.
[0143] In some aspects, the excipient can include a dispersion enhancer. Suitable dispersants may include, but are not limited to, starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose. Attorney Docket No. 21101.0495P1
[0144] In some aspects, the excipient can include a lubricant. Non-limiting examples of suitable lubricants include minerals such as talc or silica; and fats such as vegetable stearin, magnesium stearate or stearic acid.
[0145] The weight fraction of the excipient(s) in the combination can be about 98% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2%, or about 1% or less of the total weight of the combination.
[0146] In some aspects, the compositions of the present disclosure are stable at room temperature.
[0147] In some aspects, the consortia or compositions disclosed herein can be kept at a reduced temperature for storage and transportation without significantly compromising the viability of the live fungal and / or bacterial microorganisms. The consortia or compositions comprising the same can be refrigerated, frozen, or lyophilized. The compositions may be refrigerated at between 32°F to 44°F.
[0148] In some aspects, the consortia or compositions comprising the same can be stored and transported in a frozen state. The live beneficial fungal and / or bacterial microorganisms can be reinvigorated quickly once the compositions are thawed and brought to ambient temperature, for example, with aeration and / or agitation.
[0149] In some aspects, the consortia or compositions can be stored and transported in a manner that limits their exposure to oxygen. In some aspects, live beneficial fungal and / or bacterial microorganisms can be reinvigorated quickly once the compositions are thawed and brought to ambient temperature, for example, with aeration and / or agitation in an anaerobic environment. In some aspects, live beneficial fungal and / or bacterial microorganisms can be reinvigorated quickly once the compositions are thawed and brought to ambient temperature, for example, with aeration and / or agitation in an aerobic environment.
[0150] In some aspects, the compositions or consortia can be lyophilized. The compositions or consortia can be first frozen. Water can be then removed amendments under vacuum. This process further reduces the weight of the composition for storage and transportation. The compositions or consortia can be reconstituted and reinvigorated prior to application or administration.
[0151] In some aspects, the concentrated consortia, or compositions comprising the same can be diluted with water before application or administration. Diluted compositions can be Attorney Docket No. 21101.0495P1
[0152] stored for a prolonged period of time, e.g., as long as 30 days, without losing viability. To maintain the live beneficial microorganism in a substantially aerobic state, dissolved oxygen in the diluted compositions of the present disclosure are preferably kept at an optimal level. It is preferable to supply optimal amounts of oxygen to the diluted composition though slow aeration.
[0153] Various pharmaceutical compositions and techniques for their preparation and use will be known to those of skill in the art in light of the present disclosure. For a detailed listing of suitable pharmacological compositions and associated administrative techniques one may refer to the detailed teachings herein, which may be further supplemented by texts such as Remington, The Science and Practice of Pharmacy, 20thed., (Lippincott, Williams & Wilkins 2003). Except insofar as any conventional media or agent is incompatible with the active compound, such use in the compositions is contemplated.
[0154] The disclosed compositions can be administered subcutaneously, transdermally, orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally. via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposally, intraarticularly, or intrathecally. The disclosed compositions comprising Candida dubliniensis can also be administered in slow release dosage forms.
[0155] In some the composition can be administered intermittently, periodically, continuously, or chronically.
[0156] In some aspects, the composition can be administered via oral administration.
[0157] In some aspects, the composition can be a probiotic composition, a nutraceutical composition, a pharmaceutical composition, or a mixture thereof.
[0158] In some aspects, any of the composition disclosed herein can be administered in a form selected from the group consisting of powder, granules, a ready -to-use beverage, food bar, an extruded form, capsules, gel caps, and dispersible tablets.
[0159] In some aspects, the composition can be administered with and one or more additional therapeutic agents. In some aspects, the composition and one or more additional therapeutic agents can be administered simultaneously or consecutively in any order. In some aspects, the composition and one or more additional therapeutic agents can be administered chronically or intermittently. In some aspects, the one or more (additional) therapeutic agents can be one or more microbes, one or more of the cell wall components of Candida dubliniensis, or a combination thereof. In some aspects, the one or more (additional) therapeutic agents can be Attorney Docket No. 21101.0495P1
[0160] one or more microbes listed in Table 2. In some aspects, the one or more microbes can be Enterococcus galinarum, E.coli. or a combination thereof.
[0161] METHODS
[0162] Disclosed herein are methods for treating a subject with a metabolic disease. Also disclosed herein are methods for treating or preventing a metabolic disease in a subject. Further disclosed herein are methods for promoting or enhancing proliferation of beta cell development or beta cell regeneration in a subject in need thereof. Disclosed herein are methods of increasing survival of a subject having diabetes. Also disclosed herein are methods of increasing clearance of blood glucose in a subject. Further disclosed herein are methods of increasing beta-cell mass in a subject. In some aspects, the methods can comprise adjusting the composition of gut microbiota in the subject. In some aspects, the subject can be a human. In some aspects, the subject has or is at risk for developing diabetes. In some aspects, the diabetes can be type 1. In some aspects, the diabetes can be type 2.
[0163] Disclosed herein are methods of treating a subject with a metabolic disease. In some aspects, the methods can comprise: administering to the subject a composition comprising Candida dubliniensis. In some aspects, the composition comprising Candida dubliniensis can be administered in an amount effective to treat the subject with the metabolic disease. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject compared to the relative abundance prior to administration. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis and a carrier.
[0164] Disclosed herein are methods of treating or preventing a metabolic disease in a subject. In some aspects, the methods can comprise: administering to the subject a composition comprising Candida dubliniensis. In some aspects, the composition comprising Candida dubliniensis can be administered in an amount effective to treat or prevent the metabolic disease in the subject. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject compared to the relative abundance prior to administration. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis and a carrier.
[0165] Disclosed herein are methods of treating a subject with diabetes. In some aspects, the methods can comprise: administering to the subject a composition comprising Candida dubliniensis. In some aspects, the composition comprising Candida dubliniensis can be Attorney Docket No. 21101.0495P1
[0166] administered in an amount effective to treat the subject with diabetes. In some aspects, the diabetes can be type 1 diabetes. In some aspects, the diabetes can be type 2 diabetes. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject compared to the relative abundance prior to administration. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis and a carrier.
[0167] Disclosed herein are methods of promoting or enhancing proliferation of beta cell development or beta cell regeneration in a subj ect in need thereof. In some aspects, the methods can comprise: administering to the subject a composition comprising Candida dubliniensis. In some aspects, the composition comprising Candida dubliniensis can be administered in an amount effective to promote or enhance proliferation of beta cell development or beta cell regeneration in the subject in need thereof. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject compared to the relative abundance prior to administration. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis and a carrier.
[0168] Disclosed herein are methods of increasing survival of a subject having or with diabetes. In some aspects, the methods can comprise: administering to the subject a composition comprising Candida dubliniensis. In some aspects, the composition comprising Candida dubliniensis can be administered in an amount effective to treat the subject with diabetes. In some aspects, the diabetes can be type 1 diabetes. In some aspects, the diabetes can be type 2 diabetes. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject compared to the relative abundance prior to administration. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis and a carrier.
[0169] Disclosed herein are methods of increasing clearance of blood glucose in a subject. In some aspects, the methods can comprise: administering to the subject a composition comprising Candida dubliniensis. In some aspects, the composition comprising Candida dubliniensis can be administered in an amount effective to treat the subject with diabetes. In some aspects, the diabetes can be type 1 diabetes. In some aspects, the diabetes can be type 2 diabetes. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject compared to the relative abundance prior to administration. In some aspects, the Attorney Docket No. 21101.0495P1
[0170] composition can comprise or consist of a supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis and a carrier.
[0171] Disclosed herein are methods of increasing beta-cell mass in a subject. In some aspects, the methods can comprise: administering to the subject a composition comprising Candida dubliniensis. In some aspects, the composition comprising Candida dubliniensis can be administered in an amount effective to treat the subject with diabetes. In some aspects, the diabetes can be type 1 diabetes. In some aspects, the diabetes can be type 2 diabetes. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject compared to the relative abundance prior to administration. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis.
[0172] Disclosed herein are methods of replacing microbiota of a subject with a disease or disorder associated with an imbalanced microbiota. In some aspects, the methods can comprise: administering to the subject a composition comprising Candida dubliniensis. In some aspects, the composition comprising Candida dubliniensis can be administered in an amount effective to replacing microbiota of a subject with a disease or disorder associated with an imbalanced microbiota. In some aspects, the disease or disorder associated with the imbalanced microbiota can be a metabolic disease or disorder. In some aspects, the microbiota that can be replaced can be Candida dubliniensis. In some aspects, the methods of replacing microbiota can be accomplished by altering the relative abundance of microbiota. In some aspects, the relative abundance of Candida dubliniensis can be increased by administering to the subject a composition comprising Candida dubliniensis. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject compared to the relative abundance prior to administration. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis.
[0173] The methods of altering microbiota can also include measuring the relative abundance of one or more microbiota in a sample from a subject. As used herein, the term “relative abundance” refers to the commonality or rarity of an organism relative to other organisms in a defined location or community. For example, the relative abundance can be determined by generally measuring the presence of a particular organism compared to the total presence of organisms in a sample. In some aspects, the composition can comprise or consist of a Attorney Docket No. 21101.0495P1
[0174] supernatant from Candida dubliniensis. In some aspects, the composition can comprise or consist of a supernatant from Candida dubliniensis and a carrier.
[0175] The relative abundance of microbiota can be measured directly or indirectly. Direct measurements can include culture based methods. Indirect measurements can include comparing the prevalence of a molecular indicator of identity7, such as ribosomal RNA (rRNA) gene sequences, specific for an organism or group of organisms in relation to the overall sample. For example, a total number of rRNA gene sequences corresponding to one or more Candida dubliniensis strains obtained from a cecal sample can be used to determine the relative abundance of Candida dubliniensis in the cecal sample.
[0176] As used herein, the term “microbiota” is used to refer to one or more microbial communities that can be found or can exist (colonize) wi thin a gastrointestinal tract of an organism. When referring to more than one microbiota, the microbiota can be of the same type (strain) or it can be a mixture of taxa. In some aspects, the methods and compositions disclosed herein that alter the relative abundance of microbiota from genera such as Candida in a gastrointestinal tract of a subject. The relative abundance microbiota can be altered by administering a composition comprising Candida dubliniensis substantially increases the relative abundance of microbiota (e.g., Candida dubliniensis). In some aspects, the methods and compositions disclosed herein that alter the relative abundance of Candida dubliniensis in a gastrointestinal tract of a subj ect.
[0177] In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject by at least about 5%. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject by at least about 10%. In some aspects, the relative abundance of Candida dubliniensis can be increased in the subject by at least about 1%, 2%, 3%, 4%, 5%, 6%. 7%, 8%, 9%, or 10%. In some aspects, the relative abundance of at least one of species of Candida dubliniensis can be increased by 5%.
[0178] In some aspects, the methods disclosed herein can further comprise administering a second therapeutic agent to the subject. In some aspects, the second therapeutic agent can be one or more bacteriophages. In some aspects, the second therapeutic agent can be one or more commercially available therapeutic agents that can be administered to treat type 1 or type 2 diabetes. In some aspects, the second therapeutic agent can be a microbe. In some aspects, the microbe can be Enterococcus galinarum, E.coli, or a combination thereof. In some aspects, the microbe can be one or more of the microbes listed in Table 2.
[0179] In some aspects, in any of the methods disclosed herein, the subject has been identified as being in need of the treatment. In some aspects, the subject has obesity. Attorney Docket No. 21101.0495P1
[0180] metabolic syndrome, insulin deficiency, insulin-resistance related disorders, glucose intolerance, diabetes, or an inflammatory bowel disease. In some aspects, the inflammatory bowel disease can be Crohn’s disease or ulcerative colitis. In some aspects, insulin -resistance related disorder can be diabetes, hypertension, hyperglycemia, dyslipidemia, or cardiovascular disease. In some aspects, diabetes can be Npe I diabetes. In some aspects, diabetes can be type II diabetes. In some aspects, the subject has or is at risk for developing a metabolic disease. In some aspects, the metabolic disease can be type 1 diabetes, type 2 diabetes, insulin deficiency, insulin deficiency, insulin-resistance related disorders, or glucose intolerance. In some aspects, diabetes can be type 1 diabetes. In some aspects, diabetes can be type 2 diabetes.
[0181] As used herein, the term “metabolic disorder” or “metabolic syndrome” refers to disorders, diseases, and conditions that are caused or characterized by abnormal weight gain, energy use or consumption, altered responses to ingested or endogenous nutrients, energy sources, hormones or other signaling molecules within the body or altered metabolism of carbohydrates, lipids, proteins, nucleic acids or a combination thereof. A metabolic disorder is associated with either a deficiency or excess in a metabolic pathway resulting in an imbalance in metabolism of nucleic acids, proteins, lipids, and / or carbohydrates. Factors affecting metabolism include, and are not limited to, the endocrine (hormonal) control system (e.g., the insulin pathway, the enteroendocrine hormones including GLP-1, PYY or the like), the neural control system (e.g., GLP-1 or other neurotransmitters or regulatory proteins in the brain) or the like. Some non-limiting examples can be obesity, diabetes, including type II diabetes, insulin-deficiency, insulin-resistance, insulin-resistance related disorders, glucose intolerance, syndrome X, inflammatory7and immune disorders, osteoarthritis, dyslipidemia, metabolic syndrome, non-alcoholic fatty liver, abnormal lipid metabolism, cancer, neurodegenerative disorders, sleep apnea, hypertension, high cholesterol, atherogenic dyslipidemia, hyperlipidemic conditions such as atherosclerosis, hypercholesterolemia, and other coronary artery7diseases in mammals, and other disorders of metabolism.
[0182] Disorders also included are conditions that occur or cluster together, and increase the risk for heart disease, stroke, diabetes, and obesity. Having just one of these conditions such as increased blood pressure, elevated insulin levels, excess body fat around the waist or abnormal cholesterol levels can increase the risk of the above mentioned diseases. In combination, the risk for coronary heart disease, stroke, insulin-resistance syndrome, and diabetes is even greater. Attorney Docket No. 21101.0495P1
[0183] In some aspects, the step of administering any of the compositions disclosed herein can comprise delivering the composition to at least a stomach, a small intestine, or a large intestine of the subject. In some aspects, the composition can be administered orally.
[0184] In some aspects, the subject can be a human.
[0185] In some aspects, the cells of the composition or consortia are active. In some aspects, the cells of the microbial strains disclosed herein are active.
[0186] In some aspects, in any of the methods disclosed herein, the compositions can comprise or consist of one or more Candida dubliniensis strains (e.g., in Table 1).
[0187] In any of the methods disclosed herein, and, in particular for preventative methods, subjects can be selected that are at an increased risk of a metabolic disease. In some aspects, the subjects can be selected that are at an increased risk of developing type 1 diabetes or type 2 diabetes. In some aspects, known risk factors that increase the likelihood of a metabolic disease can be used to evaluate the suitability of a subject for the preventative methods disclosed herein. These risk factors include, but are not limited to, genetic susceptibility within the human leukocyte antigen (HLA) locus, antibiotic exposure in early life, lack of breast feeding, bom via caesarean section, sequencing of the microbiota during the early life window (e.g., birth through early childhood) that reveals a lack of colonization by these important organisms.
[0188] In some aspects, the risk factor that can increase a subject’s susceptibility to a metabolic disease can be the composition of gut microbiota. Shifts in the intestinal microenvironment can lead to changes in the microbiota known as dysbiosis, which in turn may increase susceptibility to 3-cell dysfunction including but not limited to a reduction in the number of 3-cell in the pancreas. Dysbiosis conditions that can contribute to the development of a metabolic disease.
[0189] In some aspects, a combination of nsk factors, such as genetic risk factors, reduction in or the development of P-cells, and / or gut microbiota, can be combined to evaluate a subject's susceptibility7to a metabolic disease. A subject identified as at an increased risk of a metabolic disease can be treated with the preventative methods disclosed herein. In some aspects, a subject with diabetes, such as type 1 diabetes, can be treated with the preventative methods disclosed herein. In some aspects, a subject with type 2 diabetes can be treated with the preventative methods disclosed herein. In some aspects, a subject with a chronic metabolic disease, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40 or more years, can be treated with the preventative methods disclosed herein. Attorney Docket No. 21101.0495P1
[0190] In some aspects, known molecular biomarkers of a metabolic disease can be used to identify a subject that can be at an increased risk of a metabolic disease to be treated with the preventative methods disclosed herein. Examples of biomarkers that can contribute to a metabolic disease, include but not limited to, blood glucose levels have been showed to occur in diabetes (126 mg / dL or higher), prediabetes (e.g., 100 to 125 mg / dL), and cardiovascular. In some aspects, glycated hemoglobin (HbAlc) or “A1C’ can be used as a biomarker for diagnosing and monitoring diabetes and prediabetes as well as assess the risk for diabetes-related complications. Normal levels of A1C in the blood are less than 5.7%, prediabetes levels are considered to be between 5.7 to 6.4%, and diabetes levels are 6.5% or higher on two separate tests. In some aspects, the molecular biomarkers can be used to monitor the progression (or lack thereof) of a metabolic disease in a subject under treatment.
[0191] As used herein, “preventing a metabolic disease" can include, but not limited to, delaying the onset of dysplasia or diabetes (e.g., type 1 or type 2) (or prediabetes), etc. In some aspects, the presently disclosed methods can be used to prevent or delay the development of prediabetes.
[0192] In some aspects, the preventative effect can be characterized as the disease-free period for the treated subject. In some aspects, the subject treated with the methods disclosed herein can be assessed for the disease-free period. To characterize the preventative effect, a reference value can be established based on one or more control subjects that are not treated with the methods disclosed herein. In some aspects, the treated subject can show an increase of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 200%, about 300%, about 400%, about 500% or more in the disease-free period in comparison to the reference value. In some aspects, the treated subject can show a decrease of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or about 100%, or a range between any two of these values in the total number of tumors in comparison to the reference value. In some aspects, the colonization of one or more Candida dubliniensis strains, blood glucose levels, A1C levels, or a combination thereof can be measured in treated subjects and compared to control subjects that are not treated with the methods disclosed herein.
[0193] In any of the methods disclosed herein, the disease-free period of the subject can be increased by at least 5% in comparison to a subject to which the composition has not been administered. In any of the methods disclosed herein, the disease-free time of the subject can Attorney Docket No. 21101.0495P1
[0194] be increased by at least 20% in comparison to a reference disease-free time in one or more subjects to which the composition has not administered.
[0195] In any of the methods disclosed herein, the P-cell growth or regeneration in the subject can be increased by at least 5% in comparison to a subject to which the composition has not been administered. In any of the methods disclosed herein, the P-cell grow th or regeneration in the subject can be increased by at least 20% in comparison to a reference P-cell growth or regeneration in one or more subjects to which the composition has not been administered.
[0196] In any of the methods disclosed herein, the colonization of one or more Candida dubliniensis strains in the subject can be increased by at least 5% in comparison to a subject to which the composition has not been administered. In any of the methods disclosed herein, the colonization of one or more Candida dubliniensis strains in the subject can be increased by at least 20% in comparison to the colonization of one or more Candida dubliniensis strains in reference sample in one or more subjects to which the composition has not been administered.
[0197] In some aspects, the subject has or has been diagnosed with a metabolic disease. In some aspects, the subject has or has been diagnosed with type 1 diabetes, type 2 diabetes, insulin deficiency, insulin deficiency, insulin-resistance related disorders, or glucose intolerance that can also be prevented, delayed, reduced or treated by the methods disclosed herein.
[0198] In some aspects, a metabolic disease can be prevented, delayed, or reduced through the adjustment of the composition of the gut microbiota in a subject susceptible to developing a metabolic disease by administering the composition disclosed herein. Adjustment of the composition of the gut microbiota refers to changing the composition of the bacteria in the gut. In some aspects, adjustment of the composition of the gut microbiota in the subject can be achieved by, for example, fecal transplantation (also known as fecal microbiota transplantation (FMT), fecal bacteriotherapy or stool transplant). Fecal transplantation can include a process of transplantation of fecal bacteria from a healthy donor, for example a subject without a metabolic disease, to a recipient (e.g., a subject suffering from a metabolic disease). The procedure of fecal transplantation can include single or multiple infusions (e.g., by enema) of microbial fecal flora from the donor to the recipient. In some aspects, methods disclosed herein consist of adjusting the composition of the gut microbiota in a subject susceptible to a metabolic disease. In some aspects, methods disclosed herein consist of adjusting the composition of the gut microbiota in a subject susceptible to a metabolic Attorney Docket No. 21101.0495P1
[0199] disease. In some aspects, methods disclosed herein are not combined with other pharmaceutical(s).
[0200] In some aspects, adjusting the composition of the gut microbiota in the subject can include administering the subject a composition comprising bacteria, for example, a composition comprising Candida dubliniensis. The composition comprising Candida dubliniensis, for example, can be administered to the subject via various routes. For example, the composition can be administered to the subject via oral administration, rectal administration, transdermal administration, intranasal administration or inhalation. In some aspects, the composition can be administered to the subject orally. The composition comprising Candida dubliniensis, can also be in various forms. For example, the composition can be a probiotic composition, a nutraceutical, a pharmaceutical composition, or a mixture thereof.
[0201] In some aspects, the composition can be a probiotic composition, a nutraceutical composition, a pharmaceutical composition, or a mixture thereof. Each dosage for human and animal subjects preferably contains a predetermined quantity of the bacteria calculated in an amount sufficient to produce the desired effect. The actual dosage forms will depend on the particular bacteria employed and the effect to be achieved. The composition comprising a Candida dubliniensis can be administered alone or in combination with one or more additional probiotic, nutraceutical, or therapeutic agents. In some aspects, the one or more therapeutic agents can be one or more microbes. In some aspects, the Candida dubliniensis can be administered in combination with a neonatal strain of Enterococcus galinarum, a neonatal strain of E.coli, or a combination thereof. Table 1 and Table 2 provide strains that can be combined in any of the compositions or methods disclosed herein.
[0202] In some aspects, the composition comprising a Candida dubliniensis can be administered via oral administration.
[0203] Administration “in combination with” one or more further additional probiotic, nutraceutical, or therapeutic agents includes both simultaneous (at the same time) and consecutive administration in any order. In some aspects, the composition comprising Candida dubliniensis and the one or more therapeutic agents can be administered simultaneously or consecutively in any order. In some aspects, the composition comprising Candida dubliniensis and one or more therapeutic agents can be administered chronically or intermittently.
[0204] In some aspects, the composition comprising Candida dubliniensis can be administered intermittently, periodically, continuously, or chronically. Administration can be Attorney Docket No. 21101.0495P1
[0205] chronic or intermittent, as deemed appropriate by the supervising practitioner, particularly in view of any change in the disease state or any undesirable side effects. "‘Chronic” administration refers to administration of the composition in a continuous manner while “intermittent” administration refers to treatment that is done with intermption.
[0206] In any of the methods disclosed herein, the composition comprising Candida dubliniensis can be administered following assessing the risk of a metabolic disease of the subject. In some aspects, the assessing the risk of a metabolic disease of the subject can be performed by looking for a family history of metabolic disease of the subject, identifying a genetic mutation associated with metabolic disease in the subject, testing for dysbiosis in the subj ect, or a combination thereof.
[0207] In some aspects, the dysbiosis can comprise an under-representation of Candida dubliniensis in the subject. In some aspects, the assessing the risk of metabolic disease of the subject can comprise detecting an under-representation of Candida dubliniensis in the subj ect.
[0208] The composition of gut microbiota of the treated subject can be monitored before, during, or after the treatment period. A variety of monitoring techniques are known to one of ordinary skill in the art. For example, sequencing, PCR or microarray analysis can be used to identify the species and amount of a microorganism (e.g., bacteria, fungus, etc.) present in the gut microbiota. ELISA assays using antibodies that specifically bind to microbial antigens may also be used to identify and quantify the microbial species in the gut microbiota. In some aspects, administrating the composition comprising Candida dubliniensis, for example, can also be adjusted according to the results from monitoring the composition of gut microbiota. For example, if the administered composition fully restores the normal colonization state of the microorganism, further administration of the composition can be suspended in view of further monitoring results.
[0209] In some aspects, the subject can be a human. In some aspects, the human can be of any developmental stage including but not limited to infancy, childhood, adolescence, and adulthood. In some aspects, the subject being treated can be anon-human mammal. A program comparable to that discussed above can be used in veterinary medicine.
[0210] In some aspects, the methods can comprise identifying the subject in need of treatment based on the type of metabolic disease, development history of the metabolic disease, presence of dysbiosis, or a combination thereof. In some aspects, the method can comprise subject identified as at risk of metabolic disease has diabetes. In some aspects, the diabetes can be type 1 diabetes or type 2 diabetes. In some aspects, the metabolic disease can Attorney Docket No. 21101.0495P1
[0211] be type 1 diabetes, type 2 diabetes, insulin deficiency, insulin deficiency, insulin-resistance related disorders, or glucose intolerance.
[0212] In some aspects, the subject in need thereof can be an infant. In some aspects, the subj ect in need thereof can be identified by obtaining a stool sample from the subj ect and analyzing the stool sample to confirm the present or absence of Candida dubliniensis. In some aspects, the method can comprise determining the presence, absence, and / or the relative amount of Candida dubliniensis by PCR or sequencing. In some aspects, methods can comprise administering to the subject any of the compositions disclosed herein when the absence of Candida dubliniensis is detected in the stool sample. In some aspects, methods can comprise administering to the subject any of the compositions disclosed herein when the relative amount of Candida dubliniensis that is detected in the stool sample is less than the relative amount of Candida dubliniensis in a reference sample.
[0213] KITS
[0214] In some aspects, kits are disclosed comprising Candida dubliniensis capable of promoting or enhancing proliferation of beta cell development or beta cell regeneration in a subject, treating a subject with diabetes, treating a subject with a metabolic disease, increasing survival in a subject with diabetes, increasing clearance of blood glucose in a subject, increasing beta-cell mass in a subject, or treating or preventing a metabolic disease in a subject.
[0215] In some aspects, any of the disclosed Candida dubliniensis strains or compositions can be packaged in a suitable container labeled, for example, for use as a therapy to promote or enhance proliferation of beta cell development or beta cell regeneration in a subject, treat diabetes, treat a metabolic disease, or treat or prevent a metabolic disease in a subject.
[0216] Accordingly, packaged products (e.g., sterile containers containing the Candida dubliniensis strains or compositions described herein and packaged for storage, shipment, or sale at concentrated or ready -to-use concentrations) and kits, including Candida dubliniensis strains or compositions as described herein and instructions for use, are also within the scope of the disclosure. A product can include a container (e.g., a vial, jar, bottle, bag, or the like) containing the Candida dubliniensis strains or compositions described herein. In addition, the kits further can include, for example, packaging materials, instructions for use, syringes, buffers or other control reagents. The product can also include a legend (e.g., a printed label or insert or other medium describing the product's use (e.g., an audio- or videotape)). The legend can be associated with the container (e.g., affixed to the container) and can describe the manner in which the Candida dubliniensis strains or compositions therein should be Attorney Docket No. 21101.0495P1
[0217] prepared, stored or administered (e.g., the frequency and route of administration), indications therefor, and other uses. In some aspects, the kits can also comprise media, culturing instructions, delivery instructions, as well as instructions for preparing, storing, delivering, etc. of the Candida dubliniensis strains or compositions.
[0218] EXAMPLES
[0219] Example 1: Neonatal fungi promote lifelong metabolic health through macrophage dependent p-cell development
[0220] Lack of exposure to specific fungal or bacterial species during the neonatal period disrupts pancreatic development leading to metabolic disease.
[0221] Loss of early-life microbial diversity is correlated with diabetes, yet mechanisms by which microbes influence disease remain elusive. Described herein are findings that show that an important neonatal window in mice exists when microbiota disruption results in lifelong metabolic consequences stemming from reduced p-cell development. The evidence show for the existence of a similar program in humans and identify specific fungi and bacteria that are sufficient for P-cell growth. The microbiota also plays an important role in seeding islet-resident macrophages, and macrophage depletion during development reduces P-cells. Candida dubliniensis increases P-cells in a macrophage-dependent manner through unique cell wall composition and reduces murine diabetes incidence. Provision of C. dubliniensis after P-cell ablation or antibiotic treatment improves P-cell function. These data identify fungi as important early -life commensals that promote long-term metabolic health.
[0222] Transient disruptions to the postnatal microbiota have lasting consequences on / 3-cell development and function. Postnatal mouse P-cell proliferation peaks between the first and second weeks after birth, and this event contributes to the vast majority of p-cell growth during the animal’s lifetime (M. Teta, et al.. Diabetes 54, 2557-2567 (2005)(26). As mammals grow out of infancy, insulin-producing P-cells enter into a long-lived, quiescent state (M. Cnop et al., Diabetes Obes Metab 13 Suppl 1, 39-46 (2011)). This dormancy makes endogenous restoration of adult p-cells, such as in type 1 diabetes (T1D) or the later stages of type 2 diabetes (T2D), extremely challenging. Neonatal germfree (GF) mice have reduced P-cell mass compared to mice possessing a normal microbiota (SPF mice) (J. H. Hill et al., Cell Metab, (2022)). however, it was unclear whether this defect lasted into adulthood.
[0223] Examination of P-cells in adult GF mice revealed a significant reduction in P-cell mass when compared to SPF mice, despite no difference in overall pancreas size (FIGS. 1A-C). This difference was consistent between males and females and across two different mouse strains: Attorney Docket No. 21101.0495P1
[0224] C57B1 / 6 and Swiss Webster (FIGS. 7A, B), demonstrating that the microbiota is important for determining adult mammalian P-cell mass.
[0225] To distinguish between microbial cues for P-cell development versus long-term p-cell maintenance, the microbiota were transiently disrupted using a broad-spectrum antibiotic cocktail containing Gentamycin. Neomycin. Ampicillin, and Erythromycin during defined windows across neonatal life in Swiss Webster animals (FIG. ID). From birth to weaning, P-cell mass expanded in untreated SPF pups (FIG. IE). However, in GF mice, no significant increase in p-cell mass was observed (FIG. IE), demonstrating that postnatal p-cell expansion is dependent on microbial colonization. Pups that received antibiotics in pulse 1 (embry onic day (E) 14 - postnatal day (P) 4) had no significant difference in P-cell mass compared to either GF or SPF age-matched counterparts, supporting the conclusion that maternal microbes do not play a significant role in pre-natal P-cell development (FIG. IE). During pulse 2 (P3-P12), both antibiotic-treated and GF animals had slight but insignificant decreases in p-cell mass compared to SPF animals (FIG. IE). Strikingly, pups that received antibiotics in pulse 3 (P10-P20) had the greatest reduction in P-cell mass compared to SPF pups of the same age (FIG. IE, FIG. 7C), even though these animals had normal microbial exposures from birth to age PIO (FIG. ID), indicating that bacterial stimuli have the greatest effect on p-cell expansion just prior to weaning.
[0226] Antibiotic perturbation to the neonatal microbiota had lasting consequences, as adult animals that experienced early life antibiotic perturbations (FIG. IF) had persistent defects in P-cell mass (FIG. 1G). Indeed, while adult animals that experienced antibiotics during either the E14-P4 or P3-P12 treatment windows (pulses 1&2) had normal P-cell mass, antibiotic treatment from P10-P20 (pulse 3) resulted in significant reductions in adult P-cell mass, even after the antibiotics had been withdrawn for 5 weeks prior to analysis (FIGS. IF and 1G). Importantly, a 10-day antibiotic treatment during adulthood had no effect on p-cell mass, serum insulin levels, or blood glucose (FIGS. 7D-G), demonstrating the importance of the microbiota during the neonatal period. Furthermore, colonization of GF mice with an SPF microbiota (ex-GF) at day PIO, but not P20, is sufficient to restore p-cell mass in adult ex-GF animals (FIGS. IF and 1H), indicating the microbiota is sufficient for P-cell expansion if colonized during the appropriate neonatal timeframe. Collectively, these results demonstrate that the microbiota is important for promoting postnatal P-cell expansion in mammals during a specific developmental window that dictates adult P-cell mass. Attorney Docket No. 21101.0495P1
[0227] p-cel I s are flexible and dynamic cells that match insulin production to metabolic need and can undergo compensatory hypertrophy or hyperplasia when insulin demand is persistently high (B. B. Boland, et al., Mol Metab 6, 958-973 (2017)). To explore whether the reduction in p-cell mass caused by disrupting the neonatal microbiota has any functional consequences, metabolic testing was performed on adult mice that were exposed to antibiotics from P10-P20. Compared to SPF control mice, mice treated with antibiotics as pups had significantly higher fasted blood glucose (FIG. 7H), reduced glucose tolerance (FIG. II), lower fasting serum insulin (FIG. 71), and reduced insulin secretion in response to glucose (FIG. 1J). To further test the metabolic health of these mice, animals were placed on an obesogenic diet for 12 weeks. Importantly, since antibiotics can induce weight gain, it was confirmed that both treatment groups gained the same amount of weight during the diet (FIG.
[0228] 7J). Mice that received early-life antibiotics had significantly worse glucose tolerance (FIG. II, FIG. 7K) and insulin secretion (FIG. 1 J, FIG. 7L) by the end of the challenge, than their counterparts that never received antibiotics. Importantly, these results show that early life microbiota influences on P-cells set the stage for life-long host metabolic capacity.
[0229] It was then tested whether a similar important window of microbial driven p-cell development could exist in humans. Human fecal samples from children 4 to 30 months of age were obtained as part of an approved ancillary project of the TEDDY (The Environmental Determinants of Diabetes in the Young) study (M. Rewers et al., Curr Diab Rep 18, 136 (2018)). These samples were collected from donors that have genetic risk factors predisposing them to type 1 diabetes (T1D). Importantly, these particular donors did not develop disease, allowing for the identification of potentially protective environmental factors. These samples were used to colonize germfree pups from birth to P20, at which point insulin-expressing tissue was assessed. Mice that were colonized with samples obtained from children betw een 7 and 12 months of age had significantly more insulin-expressing tissue and serum insulin than mice colonized from donors of any other age groups (FIG. IK, FIG. 7M). These results correlate with estimates of peak P-cell proliferation in humans (B. E. Gregg et al., J. Clin. Endocrinol. Metab. 97, 3197-3206 (2012)) and show7that P-cell-promoting microbes are present during 7-12 months of age in humans. Thus, the data demonstrates that in both mouse and humans there exists a developmental window wherein specific microbes are present to promote P-cell expansion and tune life-long metabolic health.
[0230] Early life fungal and bacterial commensals stimulate postnatal [3-cell development. Mammalian microbiota composition, including that of humans, is in constant flux during Attorney Docket No. 21101.0495P1
[0231] early life as diversity steadily increases after initial neonatal colonization (C. Martino et al., Nat Rev Microbiol 20, 707-720 (2022); and C. J. Stewart et al., Nature 562, 583-588 (2018)). A comparison of the 16S rRNA gene sequencing on the large intestinal contents of SPF pups, ages P12 and P20, illustrate the bacterial diversity that accrues across this short time period FIG. 2A, FIG. 8A). Bacterial communities shift rapidly in postnatal life as do resident commensal fungi (T. A. Auchtung et al., Nat Commun 13, 3151 (2022)). Several studies have highlighted the enrichment of fungal commensals within the Candida genus in the microbiota of healthy infants and mice (T. A. Auchtung et al., Nat Commun 13, 3151 (2022); N. Kondori et al., Med Mycol 58, 485-492 (2020); T. L. Ward, et al., BMC Med 15, 30 (2017); and I. D. Iliev et al., Science 336, 1314-1317 (2012)). One of the most important factors dictating the colonization of Candida in the gut at any age is the composition of the resident bacterial community (T. L. Ward, et al., BMC Med 15, 30 (2017)), with Candida growth often enhanced by broad-spectrum antibiotics (R. A. Drummond et al., Cell Host Microbe 30, 1020-1033 el026 (2022); and S. Dollive et al., PLoS ONE 8, e71806 (2013)). Therefore, it was tested whether resident fungi, such as Candida, might be present during the important window of P-cell development. Candida colonization was assessed using a set of pan Candida quantitative PCR primers (J. Zhang et al., Microbiol Insights 9, 21-28 (2016)) and Candida was found in the intestinal contents of P12 aged mice, that was almost completely undetectable just 10 days later at P20 (FIG. 2B). These data indicated the presence of this fungal genera at the beginning of the important window, similarly to early blooms of Candida in human infants prior to diversification of resident bacteria (N. Kondori et al., Med Mycol 58, 485-492 (2020)). Indeed, fungal-specific ITS gene sequencing on the human donor microbiotas used to humanize our mice (FIG. IK), indicated that Candida species comprised the most abundant fungal taxa in donors one year of age or younger, but Saccharomyces and Pencillium species were also detected (FIG. 8B). Candida specific qPCR also indicated that these fungi were able to transfer into and colonize the neonatal humanized mice. The Candida species that were detected in the microbiome samples from human children were C. albicans, C. parapsilosis, C. tropicalis, C. glabrata, and C. dubliniensis (FIG. 8B). Notably, C. dubliniensis, although it comprised about 1.6% of the fungal species, it was the species whose presence was limited to samples that were able to promote P-cell development. To determine whether disruptions to fungal communities could impact P-cell development from P10-P20, pups were treated with the anti-fungal drug, fluconazole. Similarly to mice treated with antibiotics, pups exposed to fluconazole had significantly reduced P-cell mass compared Attorney Docket No. 21101.0495P1
[0232] to untreated control litters (FIG. 2C). Collectively, these data show that early life fungi can also impact P-cell development.
[0233] To identify the microbes responsible for stimulating postnatal P-cell development in mice, a targeted antibiotic screen was performed during the P10-P20 window, with the goal of enriching or depleting different microbial taxa. Each antibiotic had a distinct effect on the fecal bacterial communities detected at the end of the treatment (FIG. 2D and FIGS. 8D, E). The antibiotics reduced the bacterial richness, though some antibiotics resulted in similar total bacterial loads to untreated mice at the end of the treatment regime, as assayed by total 16S reads and 16S copy number detected by qPCR (FIGS. 8 A, D). The beta-lactams had the largest effects overall with moxalactam uniquely enriching Bacilli in the remaining microbiota (FIG. 2D). These treatments also resulted in significant differences in P-cell mass (FIG. 2E), basal blood glucose, and insulin levels (FIGS. 8F, G), together demonstrating distinct taxa are responsible for p-cell expansion from P10-P20. As antibiotic treatments are known to create niches for fungal blooms, fungal organisms were assayed by qPCR in these samples. Interestingly, Candida DNA was also increased in several of the antibiotic treatment conditions (FIG. 2F), implicating Candida as a fungal determinant of host biology in these experiments.
[0234] Insulin producing capacity (as measured by total P-cell mass) did not always correlate with the expected glycemic response, reflecting the complexify of host metabolism and P-cell function, and showing that multiple microbial signals might converge to influence this system. For example, although several antibiotic treatments resulted in significantly reduced P-cell mass and serum insulin (FIG. 2E, FIG. 8G), some were more normoglycemic than GF animals (e.g., chloramphenicol, FIG. 8F). The opposite was also true; mice treated with neomycin had similar P-cell mass to SPF mice (FIG. 2E). but also had increased blood glucose (FIG. 8F). After examining the p-cells in neomycin treated mice more closely, evidence of hypertrophy was observed, which would cause an increase in p-cell mass without an increase in cell numbers (FIGS. 8H, I). Indeed, basal serum insulin levels were slightly elevated in neomycin treated mice (FIG. 8G). This mismatch between total P-cell mass, insulin production and blood glucose, across different microbial communities, shows that several different microbes influence various aspects of metabolic regulation, and that a diverse complement of microbial functions is required to ensure appropriate regulation of this host system. Importantly, pups treated with the antibiotic moxalactam had significantly Attorney Docket No. 21101.0495P1
[0235] increased P-cell mass over GF controls (FIG. 2E), were normoglycemic (FIG. 8F), and had elevated serum insulin levels (FIG. 8G).
[0236] Differential abundance analyses were performed to identify bacterial taxa enriched in moxalactam-treated and SPF animals compared to mice with lower p-cell mass. The genera Enterococcus showed the largest change, both enriched in moxalactam-treated mice and reduced across the P12-P20 period, while 3 genera within the Lactobacillaceae family exhibited differing patterns and a genus of Escherichia exhibited the largest change from Pl 2 to P20 (FIG. 2G). Importantly, these genera are enriched during the first year of human life, and show differential abundance across children with differing diabetes outcomes (N.
[0237] Kondori et al., Med My col 58. 485-492 (2020); and T. Vatanen et al.. Nature 562, 589-594 (2018)). Neonatal gut contents from both SPF and moxalactam-treated pups were used to culture representative isolates from these genera. These isolates, which included Limosilactobacillus reuteri, Esherichia coli, and Enterococcus galinarum, were used to colonize GF breeding pairs and obtain mono-associated pups that received each microbe vertically from their parents. While L. reuteri colonization had no effect on P-cell mass, colonization with E. coli and E. galinarum were each sufficient to rescue the P-cell mass to levels similar to SPF mice (FIG. 2H). These data indicate that a subset of bacteria enriched by moxalactam treatment, and abundant during the p-cell expansion window, are specifically capable of stimulating mammalian p-cell mass.
[0238] Moxalactam-treated animals also had enriched levels of Candida spp. compared to SPF mice FIG. 2F). Importantly, Candida DNA levels varied significantly based on the type of antibiotic but were absent from mice that received the broad-spectrum antibiotic cocktail used in FIG. 1 (FIG. 2F). Therefore, to test whether any of the enriched Candida that were detected in moxalactam-treated pups might also contribute to p-cell development, pups were treated with both moxalactam and fluconazole. While moxalactam treated animals alone have high P-cell mass, co-treatment with fluconazole and moxalactam leads to significantly decreased p-cell mass (FIG. 2E), indicating that much of the p-cell promoting activity in moxalactam treated animals relied on the bloom of fungi (FIG. 2E). Based on this, it was also tested whether specific Candida species were sufficient to promote P-cell development. To this end, GF pups were mono-associated with either C. dubliniensis or C. albicans. Although rare, C. dubliniensis was the only species of Candida detected in the human samples with a presence limited to the time frame in which the highest stimulation of P-cell development was observed. C. albicans was used as it is a highly studied and common member of the Attorney Docket No. 21101.0495P1
[0239] my cobiota (FIG. IK, FIG. 8B). Although these two Candida species are closely related genetically, C. dubliniensis is less virulent in humans (G. P. Moran, et al., Int J Microbiol 2012, 205921 (2012)). Interestingly, by P20, pups mono-associated with C. dubliniensis, but not with the C. albicans type strain, had significantly increased P-cell mass compared to GF animals (FIG. 2H). This difference was not due to differences in colonization as both strains colonized GF mice to similar levels. Analysis of the longitudinal colonization dynamics of C. dubliniensis was also performed in neonatal mice. GF pups and their mother were inoculated with C. dubliniensis at birth and the CFU / g of both fecal and intestinal contents were monitored at P5, PIO, Pl 5, and P20. Despite high C. dubliniensis colonization in the dam, colonization within the pups was not observed in the gastrointestinal tracts until between PIO and P15 (FIG. 21), correlating with the timing of the important window of microbial induced P-cell expansion. Collectively, these data indicate that distinct fungal commensals can promote host p-cell development.
[0240] BefA, a secreted protein from the zebrafish commensal, Aeromonas veronii, can stimulate P-cell proliferation (J. H. Hill et al., Cell Metab, (2022)). To determine whether any mammalian microbes might secrete a factor with similar properties, isolated neonatal islets were cultured with microbial cell-free supernatants (CFS) and assayed for beta-cell proliferation (FIG. 2 J). CFS from E. galinarum and C. dubliniensis had no stimulatory effect on proliferation (FIG. 2L). However, CFS from the E. coli isolate elicited significantly elevated levels of islet proliferation, as did the positive control treatment of glucose (FIG. 2K). Yet, CFS from a separate strain of A’, coli, Nissle 1917, had no stimulatory effect, highlighting functional variation between strains (FIG. 2K). The genomes of each of the isolates were sequences, and none were found that contained predicted befA homologs, showing the E. coli isolate stimulate proliferation via an alternative secreted factor. These discordant effects also show that multiple different cues to islet proliferation exist across members of the postnatal microbiota. Given that C. dubliniensis and E. galinarum can stimulate P-cell expansion in vivo (FIG. 2H), it was tested whether these microbes act through a separate, more indirect signaling mechanism.
[0241] The microbiota regulates seeding, but not phenotype, of macrophages within the neonatal islet. The data show that the microbiota can have both direct and indirect mechanisms dictating P-cell mass. Thus, to characterize host mechanisms dependent upon the microbiota during neonatal development within islets, bulk RNA sequencing was performed on islets isolated from GF and SPF pups aged P10 and P20. The microbiota induced changes Attorney Docket No. 21101.0495P1
[0242] broadly across the islet trans criptome. Biological processes important for responding to microbes, including several fungal associated response elements (Syk, Malt and Cardl4). were increased in SPF islets compared to GF at P20 (FIG. 9, FIGS. 10A-C). Differences in transcription between SPF and GF islets increased substantially from PIO to P20, with 21% of genes differentially expressed by P20 (FIG. 3A), indicating that the host is responsive to the microbiota during this time. As expected, many of these differences w ere attributed to changes in P-cells (FIG. 3B). Consistent with the observations of -cell mass, gene ontology term enrichment revealed biological processes associated with cell cycle and proliferation to be the most significantly different pathways, with enrichment overall in SPF samples (FIG.
[0243] 8). It was also found that circadian clock genes (Arntl2 and Nrldl) were increased in SPF. These play important roles in the rhythmic regulation of glucose stimulated insulin secretion, a function of advanced P-cell maturation (T. Barsby, T. Otonkoski, Diabetologia 65, 917-930 (2022)) (FIGS. 10D, E).
[0244] Surprisingly, given that non-endocrine cells represent a small minority of tissue present within islets, differential expression of transcripts associated with myeloid cells were detected between SPF and GF samples (B. H. Zinselmeyer et al., Diabetologia 61, 1374-1383 (2018)) (FIGS. 3B, C). Specifically, enrichment of macrophage markers w ere found in P20 SPF mice compared to GF (FIGS. 3C-E). While macrophages contribute a small minority of total islet RNA, they are known to constitute the major immune cell type of islets under steady-state conditions (B. Calderon et al., J Exp Med 212, 1497-1512 (2015)). It was also found that additional macrophage associated transcripts similarly increased from P10-P20 (FIGS. 3D-G, FIGS. 10F-I). Previous longitudinal characterization of the islet-resident macrophage population across late neonatal and juvenile life in mice, revealed a progressive increase in the proportion of macrophages that expressed MHC-II (Major Histocompatibility Complex II) over time (S. T. Ferris et al., J Exp Med 214, 2369-2385 (2017)), showing these cells gradually become more activated with age, concurrently with the grow th and maturation of the pancreatic islets. Similarly, it was found that expression of macrophage activation markers, including Lyz2 (38) (FIG. 3D) and MHC-II genes (Cd74, H2-Aa & H2-Ahl), increased from P10-P20 in SPF islets (FIG. 3E, FIG. 10H, I), but were reduced in P20 GF samples (FIGS. 3D, E), demonstrating microbe-dependent differences in immune development that mirror p-cell development across this neonatal window.
[0245] Differences in macrophage transcripts across the window of development also included genes associated with tissue resident macrophage identities (Folr2 andZyveT) (S. A. Attorney Docket No. 21101.0495P1
[0246] Dick et al., Set Immunol 7, eabf7777 (2022)) (FIGS. 3F, G). Neonatal islet resident macrophages are not well characterized, largely because there are so few cells within each islet, making them difficult to isolate. Therefore, neonatal islet macrophage phenotypes were assessed within the microenvironment of whole islets. Islets were isolated from pancreata of SPF and GF neonatal mice between P10-P20, and stained using the macrophage marker, F4 / 80 (Adgrel) (FIG. 3H). No obvious differences in macrophage morphology were seen between SPF and GF samples. However, paralleling the observations on p-cell mass, it was found that the average number of macrophages per islet increased significantly from P10-P20 in SPF animals, while there was no change in average macrophage numbers per islet in GF samples (FIGS. 3H, I). This indicates that islet-associated macrophages expand in number across early life in response to the microbiota.
[0247] To investigate whether macrophage function was microbiota dependent, single cell RNA sequencing (scRNA-seq) of MACS-sorted (Magnetic Activated Cell Sorting) CD45+ cells was performed on dissociated islets isolated from SPF or GF pups, aged P15. Consistent with previous reports, macrophages were the most abundant immune cells of the islet (B. Calderon et al., J Exp Med 212, 1497-1512 (2015); and P. N. Zakharov, et al., J Exp Med 217, (2020)), followed by B and T cells, and small ILC-2 and ILC-3 populations (FIG. 11 A), and had higher proportions in SPF (FIG. 11B). Annotated high-confidence immune cell clusters that expressed higher levels of / 7 / M-C7'CD45 were analyzed (FIGS. 11A-C). The macrophage clusters (0 and 4) had high expression of MHCII genes, Adgrel (F4 / 80), Cd68, Tnfw lllb (fig. S5G) (M. Baron et al., Cell Syst 3, 346-360 e344 (2016)). Cluster 0 had elevated levels of Tnf and Cd68 suggesting these cells are more inflammatory (FIGS. 1 IE, F). Macrophage clusters according to a spectrum of macrophage states (MacSpectrum) were assessed and the islet macrophages had both low polarization indices (MPI) and low activation induced differentiation (AMDI) scores (FIG. 1 IE) (C. Li et al., JCI Insight 5, (2019)). Even though AMDI and MPI was somewhat increased in the GF state in these cells, 28 genes were differentially expressed between microbiota states in cluster 4 with modest fold changes and no significant gene-set enrichments among the differentially expressed genes (FIGS. 1 IE, 1 IF, 11H). No differences in gene expression were detected in cluster 0 between microbiota. Traditional transcripts associated with tolerant macrophages that support tissue repair (Argl, Mgl2, Stat6, and Il4ra) were detected at low' levels in a few cells, and did not differ among clusters, consistent with reports that most neonatal macrophages within the islet possess an inflammatory-skewed phenotype (M. Cnop et al., Diabetologia 53, 321-330 Attorney Docket No. 21101.0495P1
[0248] (2010)). These data demonstrate that although the microbiota promotes macrophage accumulation within juvenile islets, it has a minor impact on macrophage inflammatory’ state.
[0249] C. dubliniensis requires macrophages to increase postnatal P-cell mass. Previous studies have implicated macrophages as positive regulators of P-cell mass. For instance, op / op mice, lacking the cytokine CSF-1. have near-total loss of islet macrophages as well as lifelong reduced P-cell mass (L. Banaei-Bouchareb et al., J Leukoc Biol 76, 359-367 (2004). and a similar phenotype is seen upon ablation of CCR2+ myeloid cells in neonates (K.
[0250] Mussar et al., JCI Insight 2, (2017)). To determine if macrophages are important for the early-life window of P-cell expansion, SPF and GF pups w ere treated w ith clodronate-liposomes to ablate macrophages or PBS-liposomes as controls from P10-P20 (FIG. 4A). Clodronate treatment efficiently depleted systemic tissue resident macrophages, as confirmed by loss of F4 / 80 expression in the livers (FIG. 12A) and islets (FIG. 12B) of treated mice. Circulating macrophages were also reduced significantly, but not eliminated (FIG. 12C). Consistent with the published role of macrophages in tissue development at several sites, systemic loss of macrophages results in overall tissue reduction (J. W. Pollard, Nat Rev Immunol 9, 259-270 (2009); and B. Lee, et al., PLoS ONE 9, e99575 (2014)) including smaller whole pancreas mass (FIG. 12D). Therefore, insulin-producing tissue was measured as a ratio of pancreatic area rather than measuring p-cell mass, to account for overall smaller organ size. At P20. SPF clodronate-treated mice had both reduced insulin-expressing tissue area and basal serum insulin compared to PBS-treated control mice (FIGS. 4B, C, FIG. 12E). However, it was found that clodronate did not further reduce the p-cell mass or insulin levels of GF mice, demonstrating that the effect of macrophages is microbiota dependent (FIGS. 4B. C).
[0251] To further assess the effects of clodronate on neonatal islets, bulk RNA-seq was performed on islets isolated from P20 SPF pups treated with clodronate during the P10-P20 window; Overall, clodronate treatment resulted in the enrichment of transcripts associated with pro-inflammatory signaling (FIG. 12F), consistent with what has previously been reported for systemic macrophage ablation (B. Lee, et al., PLoS ONE 9, e99575 (2014); and C. L. Wu et al., Arthritis Rheumatol 69, 1772-1783 (2017)), demonstrating that macrophages play an important role in balancing inflammatory processes. Indeed, histopathology' of clodronate-treated pancreata also showed evidence of some inflammation, despite overall normal appearance (FIG. 12G). There were significantly reduced transcripts of the macrophage associated genes (Csfr Cd209a, and Cdl63) (FIGS. 12H-J) as well as of tissue Attorney Docket No. 21101.0495P1
[0252] resident macrophage markers (Folr2, and Lyvel) after clodronate treatment (FIGS. 4D, E), consistent with depletion of these subsets. Importantly, clodronate treatment also reduced expression of the insulin receptor gene, Insr, and the p-cell maturation associated genes, Nrldl sn MafA (FIGS. 12K-M) (T. Barsby, T. Otonkoski, Diabetologia 65, 917-930 (2022)), showing reduced p-cell function in islets lacking macrophages. Given the potential off-target effects of clodronate (S. Culemann et al., J Exp Med 220, (2023)), Macrophage F as-induced Apoptosis (MaFIA) mice (S. H. Burnett et al., J Leukoc Biol 75, 612-623 (2004)) were also utilized to genetically induce neonatal macrophage apoptosis in SPF mice. Again, depletion of macrophages resulted in significantly reduced insulin-expressing tissue and serum insulin levels (FIGS. 4F, G, FIG. 12E).
[0253] Islet macrophages secrete growth factors that stimulate P-cell proliferation (C.
[0254] Cosentino, R. Regazzi, Int J Mol Sci 22, (2021); and K. Mussar et al., A CCR2+ myeloid cell niche required for pancreatic beta cell growth. JCI Insight 2, (2017)). Therefore, it was tested whether islet resident macrophages were required for P-cell proliferation during the important neonatal window by isolating islets from P12 neonatal mice previously treated with control or clodronate liposomes, and measured p-cell proliferation in vitro. Islets from mice that were treated with PBS control liposomes had significantly more EdU-labelled insulin-positive cells than islets isolated from mice that were treated with clodronate (FIG. 4H), indicating that macrophages in postnatal developing islets are important for promoting P-cell proliferation. Since the bacterial protein BefA can stimulate islet-cell proliferation (J. H. Hill et al., Cell Metab, (2022)), it was tested whether this phenomenon was also reliant upon macrophages. Islets isolated from neonatal mice were treated with depleted tissue resident macrophages with BefA, and it was found that macrophages were dispensable for BefA-dependent p-cell proliferation (FIG. 12N). further supporting that BefA acts directly on P-cells. Together, these data show macrophages are important for postnatal P-cell development from P10-P20.
[0255] To determine whether perturbation to macrophages during the neonatal period results in lasting consequences to adult p-cell mass and function, macrophages were depleted transiently during the P10-P20 neonatal window and subsequently analyzed at P56 (FIG. 4A). No differences were identified in the number of F4 / 80 positive cells in the adult pancreas between treatment groups (FIG. 120), indicating that the macrophage population is capable of rebounding after clodronate. Nonetheless, adult SPF mice treated with clodronate during the neonatal period had trending reductions in P-cell mass (FIG. 41) as well as significantly reduced fasting serum insulin, glucose tolerance, and insulin secretion (FIGS. 4I-L). Attorney Docket No. 21101.0495P1
[0256] Collectively, these data indicate that neonatal macrophages can impact both p-cell mass and function, with long-lasting effects.
[0257] To determine whether any of the P-cell stimulating microbes that were identified (FIG. 2H) also affected islet macrophages, total macrophages were quantified in islets isolated from pups mono-associated with E. gallinartum, L. reuteri. E. colt, or C. dubliniensis. The microbes tested could increase the number of macrophages within the islet compared to GF (FIG. 4M). However, the most striking effect was observed in pups monoassociated with the fungus C. dubliniensis, in which macrophage numbers were significantly elevated even above islets from SPF animals (FIG. 4M). To determine whether C. dubliniensis requires macrophages to affect P-cell growth, mono-associated pups were treated with clodronate liposomes to eliminate macrophages from P10-P20. Animals that received clodronate had significantly reduced ratios of insulin positive tissue compared to animals that were untreated (FIG. 4N), indicating that without macrophages. C. dubliniensis was unable to promote host P-cell expansion. These results were confirmed using a third macrophage depletion technique, injection of an anti-Csflr antibody to precisely target macrophages. Again, pups that experienced reductions in macrophages had significantly reduced p-cell mass (FIG. 40). Interestingly, clodronate treatment had no effect on the amount of insulinexpressing tissue in mice mono-associated with E. galinarum (FIG. 4N), a bacterial species that was found to be sufficient to promote P-cell expansion and increase macrophage numbers within the islet in GF mice (FIGS. 2H and 4M). These results show that the effect of C. dubliniensis requires the presence of macrophages to induce host P-cell expansion, while other microbes act independently of macrophages, again highlighting the diversity of hostmicrobe interactions that impact insulin-expressing tissue development. Here, a specific fungal commensal has been identified that can influence macrophage seeding of the pancreas to enhance P-cell mass.
[0258] Variations in Candida cell wall drive host beta-cell phenotypes. C. albicans and C dubliniensis are closely related species, and whole genome comparisons have highlighted a small number of differences between them (A. P. Jackson et al., Genome Res 19. 2231-2244 (2009)). Many of these differences are in cell wall composition and the formation and regulation of hyphae (filamentation), with C. dubliniensis forming less extensive hyphae and appearing more yeast-like than C. albicans (A. P. Jackson et al., Genome Res 19, 2231-2244 (2009)). Indeed, host immune recognition of Candida often relies on genes related to, or downstream of, hyphal regulation (S. Oh et al., Cell Rep 38, 110567 (2022); and K. S. Ost et Attorney Docket No. 21101.0495P1
[0259] al., Nature 596, 114-118 (2021)). Therefore, it was tested whether C. albicans ' negative effects on p-cell development could be attributed to increased filamentation by monoassociating germfree mice with a yeast-locked (YL) strain of C. albicans, which is unable to form hyphae (B. R. Braun, et al., EMBO J 20, 4753-4761 (2001)). Mice colonized with this strain showed no increase in P-cell mass, indicating that loss of hyphae is insufficient to rescue host -cell development (FIG. 5A). However, when mice were mono-associated with a mutant of C. albicans that has lost the expression of the transcription factor Ahrl, a significant increase in mouse P-cell mass was observed (FIG. 5A). Importantly, Ahrl is a well-studied transcription factor with many downstream targets that play a prominent role in regulating Candida cell wall composition, and these differences can drive differential immune responses (K. S. Ost, et al.. Nature 596, 114-118 (2021)). Fungal cell walls have an outer mannan layer that shields inner layers of chitin and P-glucan (Y. Zhou, et al., Front Microbiol 12, 652725 (2021)). Different fungal species and strains exhibit wide variability in the composition and structure of these cell wall molecules, often leading to differential immune recognition and responses (B. Yadav et al.. Cell Surf 6, 100042 (2020)). Therefore, it was tested whether distinct strains of C. dublininesis differ in their ability to influence P-cell mass. Strikingly, animals mono-colonized with a different C. dubliniensis wild-type strain, Wu284, exhibited a decrease in P-cell mass compared to the original wild-type isolate, most similar to the CD36 strain, used herein (FIG. 5B). To determine whether this difference might be due to variability in cell wall composition, each strain w as stained for mannan and chitin. Flow cytometry on replicate cultures of each strain revealed that Wii284 had significantly- increased levels of both mannan and chitin as measured by concanavalin A (ConA) and wheat germ agglutinin (WGA) staining, respectively (FIGS. 5C, D). Since significant heterogeneity' in fungal morphology can exist within a single culture, image flow' cytometry' was used to more closely assess the cell walls of these two strains. Image flow allowed for the separation of hundreds of fungal cells based on their phenotypic state from yeast-like to filamented (FIGS. 13A, B). CD36 cells of both yeast and hyphal morphologies were significantly larger than those of Wu284 (FIGS. 5E, F), indicating basic differences in overall structure of these two strains. In both the yeast and hyphal states, Wii284 had significantly higher levels of both ConA and WGA staining than CD36, which w as particularly striking given that the quantifications was normalized to cell size (FIGS. 5G, H). However, there was variability in expression levels of these markers across cells from the same strain, reiterating the fact that there is significant population heterogeneity' even in lab-grown clonal cultures. Attorney Docket No. 21101.0495P1
[0260] The gating strategy for image flow cytometry of CD36 and Wu284 C. dubliniensis wild-type strains was earned out. Unfocused images were eliminated using the gradient RMS of brightfield (BF) objects, singlets were identified using BF aspect ratio and area, and then events with signal in both ConA and WGA channels were retained for analysis of these intensities. Remaining events were then subsetted for circular yeast cells defined as events with aspect ratios above 0.8 (Cl gate), while filamentous / hyphae-containing cells were defined as events with aspect ratios below 0.5 with a large major axis (Fl gate). Intermediate populations (Ml and Bl) exist on a spectrum between true yeast and true hyphal. The filamentous Fl gate was further cleaned using bright detail intensity R3 of BF and the major axis intensity of ConA to remove low aspect ratio aggregates and non-hyphae. Heterogeneity in staining intensity was observed across strains.
[0261] Together, these observations indicate that CD36 has significantly reduced levels of both mannan and chitin compared to Wu284, w hich is independent of whether the cell has undergone filamentation. To directly determine whether mannan levels play a role in host P-cell development, the C. dubliniensisAochmutant strain was utilized on the Wu284 background that has defective N-mannosylation leading to altered cell wall mannan and P-glucan exposure (B. Yadav et al., Cell Surf 6, 100042 (2020)). Pups mono-associated with C. dubliniensisAochexhibited greater P-cell mass than the parent Wu284 strain, similar to original CD36 strain, showing that cell wall mannan is detrimental to P-cell development (FIG. 5B). A second WQ284 mutant, Anrgl (G. P. Moran, et al., Mol Microbiol 66, 915-929 (2007))), that exhibits increased hyphal formation, elicited no change in P-cell mass compared to Wii284 (FIG. 5B), indicating that excessive filamentation is not detrimental to P-cell mass. Collectively, these data show that Candida cell wall composition differs significantly between strains and is an important driver of P-cell mass.
[0262] C. dubliniensis reduces disease in mouse models. Many factors influence the development of T1D, both genetic and environmental (L. M. Quinn and F. S. Wong, P. Front Immunol 12, 737964 (2021)). Recent work has shown that individuals with a genetic predisposition for T1D, but who remain healthy, have significantly more diverse microbial communities than individuals who progress to disease (A. D. Kostic et al., Cell Host Microbe 17, 260-273 (2015)). Moreover, in mouse models of T1D, antibiotic perturbation in early life, results in increased disease incidence (X. S. Zhang et al., Cell Host Microbe 29, 1249-1265 el249 (2021); V. E. Ruiz et al., Nat Commun 8. 518 (2017); and X.-S. Zhang et al., eLife 7, (2018)). Collectively, these data in mice and humans show that the presence of specific Attorney Docket No. 21101.0495P1
[0263] organisms in early life are important for regulating the development of diabetes. T1D arises from the extreme loss of P-cell mass, such that there is no longer sufficient endogenous insulin-production, resulting in hyperglycemia. Given that C. dubliniensis can promote appropriate development of p-cell mass, it was tested whether it could influence development of diabetes. Nonobese diabetic (NOD) animals have a genetic pre-disposition to the development of spontaneous T1D that is influenced by the microbiota. Germ-free NOD mice were mono-associated at birth with either C. dubliniensis or the bacterial isolate, Lactobacillus reuteri, which does not promote p-cell development (FIG. 2E). Diabetes onset was tracked in these mice until 26 weeks of age, when more than half the cohort exhibited chronic hyperglycemia. While NOD mice mono-associated with C. dubliniensis had trending reductions in diabetes incidence compared to mice mono-associated with L. reuteri (FIG. 6A), it was found that male mice in particular had significantly reduced disease (FIG. 6B). Notably, male C. dubliniensis mono-associated mice also exhibited later disease onset time (FIGS. 6A, B). These data show that exposure early in life to specific microbes that regulate appropriate developmental cues can differentially effect diabetes onset in the NOD model, with C. dubliniensis eliciting reduced disease compared to L. reuteri, and the protection afforded by C. dubliniensis can be sex specific.
[0264] Given the length of time that NOD animals take to develop T1D, it is possible that the presence of a specific organism could act through multiple mechanisms to prevent diabetes development in this model. Since mechanisms of development are often overlapping with those of tissue regeneration, it was assessed whether C. dubliniensis could promote p-cell replacement upon injury. Adult germfree mice were given a single dose of streptozotocin (STZ), to induce P-cell death and hyperglycemia. One week following STZ induction of diabetes, one treatment group of germfree animals was mono-associated with C. dubliniensis while the other remained germfree. This timing allows for assessment of C. dubliniesis ’ effect during the repair or regeneration phase. Mice were monitored for 6 weeks, at the end of which, survival, glucose tolerance, and P-cell mass were analyzed. Animals treated with C. dubliniensis had higher rates of survival, were more capable of clearing blood glucose, and had higher p-cell mass than the other treatment groups (FIGS. 6C-E). showing that the commensal fungus, C. dubliniensis, is able to promote P-cell regeneration after injury, even in adult animals of both sexes.
[0265] Finally, infants and children often undergo broad-spectrum antibiotic treatments to combat infections that could impact these important metabolic developmental cues. These Attorney Docket No. 21101.0495P1
[0266] data demonstrated that antibiotic treatment during early life could have lasting consequences on pancreatic P-cell mass. To determine whether C. dubliniensis could counteract the effects of antibiotics on the developing pancreas, SPF pups were simultaneously treated with ablative antibiotics and purified C. dubliniensis from P10-P20. While pups that received the antibiotics alone had significantly reduced p-cell mass compared to untreated SPF controls, mice that also received C. dubliniensis had P-cell levels rescued to the levels of untreated SPF pups (FIG. 6F). These results show that C. dubliniensis can be harnessed as a prophylactic to counteract the losses imposed by antibiotic treatment, especially in individuals predisposed to diabetes.
[0267] High- and middle-income countries are experiencing increasing rates of metabolic diseases for unknown reasons (M. G. Saklayen, Curr Hypertens Rep 20, 12 (2018)). While much of mammalian development occurs in utero. it is clear that early postnatal events such as antibiotic exposure, birth mode, breast feeding, and infection, can have important consequences on the continued development of metabolic health (H. K. Akerblom, et aL, Am. J. Med. Genet. 115, 18-29 (2002); and M. Knip, et al., Diabetes 54 Suppl 2, S125-136 (2005)). Despite the number of studies that have explored the relationship between early development and metabolism, little is known regarding how these early life events impact pancreatic growth and glucose homeostasis in mammals. The data show an important postnatal window for microbial-driven islet development that dictates common metabolic health outcomes. Metabolic homeostasis depends upon complex programs of postnatal P-cell development that involves both tissue expansion and functional maturation (T. Barsby, T. Otonkoski. Diabetologia 65, 917-930 (2022); and S. Bonner-Weir, et al., Ups J Med Sci 121, 155-158 (2016)). These processes are reliant upon the delicate balance of multiple intrinsic regulatory cell networks as well as extrinsic environmental signals (T. Barsby, T. Otonkoski, Diabetologia 65, 917-930 (2022)). This work demonstrates that resident microbes are important instigators of these processes, and show that multiple microbes, spanning widely different taxonomies, influence P-cell expansion in distinctive ways. These mechanisms seem to be limited to a handful of specific microbial representatives from across widely different taxonomies, emphasizing the importance of functional diversity during early life development. Interestingly, work analyzing the longitudinal communities of genetically susceptible children has shown that the genera of Escherichia. Enterococcus, and Candida, are enriched in <1 year-old infants who do not progress to diabetes. This timing mirrors the time when human p-cell proliferation occurs (C. Martino et al., Nat Rev Microbiol 20, 707- Attorney Docket No. 21101.0495P1
[0268] 720 (2022); and C. J. Stewart et al., Nature 562, 583-588 (2018)), and raises the possibility that conserved mechanisms to those identified herein might exist in humans. Indeed, this is supported by the data whereby animals colonized with the microbiota from infants between the ages of 7-12 months old had significantly increased P-cell mass compared to animals colonized with infant stool from any other age group. Thus, precise timing of host-microbiota interactions promotes optimal pancreatic development and metabolic health.
[0269] Important windows of microbial-driven development have also been described recently in the setting of immune and nervous systems (Z. Al Nabhani et al., Immunity 50, 1276-1288 e!275 (2019); and L. W. Yu, et al., Annu Rev Immunol 40, 143-167 (2022)). The timing of these findings in mice coincides closely with that of the recently described weaning reaction (L. W. Yu, et al, Annu Rev Immunol 40, 143-167 (2022)). The weaning reaction is a transient increase in inflammatory signals such as TNF-a and IFN-y, in the ileum, as animals transition to solid food over the P10-P21 window. This spike in inflammatory signals protects against the development of later onset immune driven diseases such as inflammatory bowel disease and cancer and is reliant upon the microbial induction of RORyt+Tregs (Z. Al Nabhani et al., Immunity' 50, 1276-1288 e!275 (2019)). No microbe-dependent differences in TNF-a or IFN-y transcripts were observed from islets in these experiments, demonstrating that the islet microenvironment responds to microbial stimuli differently from the ileum at this time of life. The scarcity of T-cells overall in the healthy postnatal islet further distinguishes the macrophage-dependent mechanism in the pancreas from the described weaning reaction mechanism in the gut. The data using human infant stool is the first to support that the microbiota in humans during the specific window of 7-12 months of age has a composition that better promotes pancreatic development. Incidentally, 7-12 months of age is when many infants begin to introduce solid foods into their diet. Use of the strategy could be employed in other studies to determine whether human infant microbiota composition has distinct effects on other aspects of health in the future.
[0270] Here, a microbiota-mediated mechanism has been identified that influence P-cell development through macrophage seeding of the islet. These data support that increased numbers of islet macrophages, rather than their functional state, drives -cell proliferation, since there were minimal effects of microbiota on the transcriptional state of islet macrophages (K. Mussar et al., JCI Insight 2, (2017); and L. Banaei-Bouchareb et al., J Leukoc Biol 76, 359-367 (2004)). Islet associated macrophages have been shown by others to express more pro-inflammatory markers (S. T. Ferris et al., J Exp Med 214, 2369-2385 Attorney Docket No. 21101.0495P1
[0271] (2017); B. Calderon et al., J Exp Med 212, 1497-1512 (2015); and M. Baron et al., Cell Syst 3, 346-360 e344 (2016)), which were also evident in the data. An intriguing question that remains, is the source of these macrophages. Existing islet macrophages might expand in response to microbial cues. Alternatively, microbes might induce recruitment to the islet of circulating macrophages. While previous studies have indicated that islet macrophages are not normally replenished from circulating precursors in adult animals, it is possible that the microbiota can influence early hematopoietic events in the neonatal period (B. Calderon et al., J Exp Med 212, 1497-1512 (2015); and K. Mussar et al., JCI Insight 2, (2017)). While the candidate microbes, bacterial and fungal, appeared capable of stimulating islet resident macrophage numbers in germfree mice, C. dubliniensis was uniquely reliant upon macrophages to promote P-cell expansion, and most robustly induced macrophage numbers. Importantly, the type strain of Candida albicans, which is the most closely related Candida species to C. dubliniensis, did not promote P-cell development or function. However, the data might argue that strain variation or fungal gene expression is an important driver of P-cell mass. When the fungal mechanism of this host phenotype was probed further, variability in P-cell mass with different strains of C. albicans and C. dubliniensis were found that correlated with differences in cell wall structure, showing that although this phenomenon was initially identified in C. dubliniensis, it may be shared across fungal species or strains with similar cell wall architecture. Importantly, fungal cell wall composition is notoriously difficult to study, as altering one component can have effects on the entire cell wall structure (C. Wang, Front Fungal Biol 1, 602032 (2020); andN. A. R. Gow, et al., Microbiol Spectr 5, (2017)). Therefore. The mannan composition appears to be an important factor involved in cell wall changes responsible for activating islet macrophages. Importantly, cell wall components of fungi are classically recognized by macrophages (B. D. Snarr, et al., J Fungi (Basel) 3, (2017)), and cell wall alterations might drive differences in macrophage detection that somehow make it to the islets. One explanation for the downstream translation of this phenotype is that cell wall mannans on the outside of the cell (and possibly other components), are uniquely arranged to allow host sensing receptors differential access to other signaling molecules such as P-glucan. These findings highlight the importance of fungi for early life health.
[0272] C. dubliniensis is thought to be a rarer member of the microbiota than C. albicans, however, it was detected in the infant samples that were analyzed and has been reported to be found in the infant gut in other studies (G. P. Moran, et al., Int J Microbiol 2012, 205921 Attorney Docket No. 21101.0495P1
[0273] (2012)). It's possible that C. dubliniensis is enriched in specific age-groups for unknown reasons, and that this study was able to identify this otherwise rare fungal commensal because age was considered as an important variable. Additionally, while the infant samples that were analyzed contained some Candida species, C. albicans was present in 50% of the samples and many other species were also present including C. glabrata, C. tropicalis, and C. parapsilosis. Thus. Candida diversity in the infant gut is greater than previously appreciated, and other members might have similar P-cell promoting activity. Perhaps more importantly, is that there is significant variation in C. albicans strains amongst humans.
[0274] Understanding whether these early life events can influence disease onset later in life, and more importantly, whether they can be harnessed to prevent or treat disease during adulthood were also addressed in this work. Previous studies on NOD mice have also highlighted the presence of an early life microbial window that predisposes to diabetes if disrupted with antibiotics. Yet it remains unclear what organisms are associated with protection or exactly how these changes impact autoimmune development (X.-S. Zhang et al., eLife 7, (2018)). It was tested whether P-cell promoting microbes are associated with less development of diabetes in the NOD model. Introduction of C. dubliniensis early in life was associated with significantly less development of diabetes when compared to animals associated with L. reuteri, a common early -life bacterium that did not promote p-cell mass. Thus, perhaps appropriate development of P-cells early in life plays a role in diabetes development. Importantly, that the results disclosed herein also demonstrate that C. dubliniensis can restore p-cell mass. Introduction of C. dubliniensis after ablation of p-cells or during early life antibiotic treatment can enhance P-cell repair and overcome the deficient development associated with antibiotics, respectively. Collectively, these data demonstrate that understanding early life microbe-host associations might identify mechanisms for endogenous beta-cell replacement.
[0275] Finally, a variety of metabolic effects were observed when the mice were treated with targeted antibiotics, indicating that additional members of the infant gut microbiota have yet-to-be discovered roles that influence other islet physiological functions. The results indicate that this axis of mammalian host-microbe communication has elements of highly conserved mechanisms, present in less complex systems, such as zebrafish (J. H. Hill et al.. Cell Metab, (2022); J. H. Hill, et al., eLife 5, (2016); and J. H. Hill, Science 377, 164-165 (2022)), as well as more recently evolved pathways that are more specific to mammalian biology7, such as the role uncovered for tissue resident macrophages (X. Lin, et al., Blood Sci 1, 57-60 (2019)). Attorney Docket No. 21101.0495P1
[0276] Materials and Methods. Mouse Husbandry. In the experiments, males and females were used equally. Mice were housed with a 12-h light-dark cycle per day, a temperature of 22 °C, and 22-30% relative humidity. GF and SPF Swiss Webster mice are maintained as breeding colonies at the University of Utah mouse facility, but were originally obtained from Taconic Labs (SW-F, SW-M). GF and SPF NonObese Diabetic mice (Taconic NOD / MrkTac) are also maintained as breeding colonies at the University of Utah mouse facility, but GF were originally obtained from the University of Michigan Mouse Facility, and SPF C57B1 / 6J (RRID: IMSR_JAX000664) were originally bought from Jackson Labs. Gnotobiotic mice were maintained in a separate room within the same building and facility as SPF mice. GF animals are housed in sterile plastic isolators with designated filtered air supply, and are screened bimonthly for contaminating microbes by both culture and 16s and 18s PCRs to detect bacterial and fungal organisms. Mono-associated mice were established by orally gavaging pure bacterial cultures to GF breeding pairs. Mono-associated breeding pairs were maintained in sterile Techniplast Iso-P cages with designated filtered air supply. Litters from these pairs were colonized vertically from their parents. Any manipulation to mono-associated mice was performed in a pre-sterilized biosafety cabinet using sterile solutions and tools. Integrity of mono-associations was confirmed periodically and at experiment end points by culturing fecal and, upon sacrifice, duodenal contents.
[0277] Multiple types of media and growth conditions were used to identify the growth of any contaminating organisms. Visual inspection of mono-associated and gram-stained fecal smears w as also performed at sac using 40X and 100X magnification. Fecal samples w ere also validated using metagenomic analysis to confirm mono-associated status, using no sample kit controls. GF or antibiotic-treated mice were re-constituted with a normal microbiota using fresh fecal pellet donations from SPF nursing dams, or from age matched SPF mice when appropriate. For direct comparisons between GF and SPF mice, SPF mice were maintained on the same autoclaved diet as their GF counterparts.
[0278] Antibiotic Treatment. For experiments using four-drug ablative antibiotic cocktails, Neomycin (Fisher Scientific, cat #BP266925), Ampicillin (Fisher Bioreagents, cat #1760-25), Erythromycin (Fisher Scientific, cat #BP920-25), and Gentamycin (Goldbio, cat #G-400-100) were dissolved into the drinking water at a final concentration of 0.5 g / L each for the duration indicated in the text. Pups were not directly administered antibiotics. To encourage mice to drink antibiotic water, the sweetener Splenda (Amazon, cat #B000F3N7AC) was added at a final concentration of 4 g / L. When compared to antibiotic-treated mice. SPF control mice were also administered Splenda into their drinking water. Individual antibiotics (Gentamycin, Attorney Docket No. 21101.0495P1
[0279] Neomycin, Ampicillin, Chloramphenicol (Sigma- Aldrich, cat #C0378-25G), Moxalactam (Sigma- Aldrich, cat #M8158-1G) and Cephalothin (Sigma- Aldrich, cat #C452O-1G)) were also administered at a final concentration of 0.5 g / L into the drinking water. Antibiotic water was refreshed every 5 days.
[0280] -cell Mass. Pancreata were dissected at the experiment end point, weighed, and fixed overnight at room temperature (RT) in Z-Fix. Cassettes were washed 3X in PBS for 5 minutes each, before placing in 70% EtOH, paraffin embedding, and sectioning. 6-micron thick, longitudinal sections were taken every 100-200 microns (depending on the age of the mouse). Pancreas sections were deparaffmed and permeabilized before staining with antiinsulin antibody (1:10 guinea-pig, Agilent cat #IR002, RRID: AB_2800361) overnight at 4 °C. Secondary horse radish peroxidase (HRP) conjugated anti-guinea-pig antibody (1:250, Jackson ImmunoResearch Labs, cat #706-036-148, RRID: AB_2340448) was added for 4-6 hours at RT, before applying DAB reaction (Vector Labs, cat #SK-4100), followed by Hematoxylin nuclear stain (Sigma Aldrich, cat #MHS16). Whole sections were imaged using an Axioscan Slide Scanning microscope (Zeiss). Images were randomized and blinded prior to analysis using the opensource software, ImageJ. Total insulin containing tissue area was measured as was total pancreatic area to determine the ratio of insulin positive tissue per section. 3-7 sections per mouse were quantified to obtain the average ratio per animal. This ratio was used to estimate total P-cell mass by multiplying the mass of the wet pancreas at sacrifice. In cases where there were significant differences in overall mouse or pancreas sizes between treatment groups, insulin area ratios were used to prevent artificial skewing based on uncontrolled factors affecting mouse size.
[0281] Glucose Tolerance and Insulin Measurements. Glucose tolerance tests were performed on adult mice that had been fasted overnight. Fasts lasted between 10 and 16 hours. Sterile glucose was injected intraperitoneally at 1.5 g / kg. Blood glucose was read from the tail vein using a Contour Next EZ glucometer at 0, 5-, 15-, 30-, 60-, 90-, and 120-minutes after glucose was administered. Additional blood was collected for measuring serum insulin at 0, 5-, 15-, 30-, and 60-minutes post glucose administration. Insulin was measured using an insulin ELISA kit (Crystal Chem, cat #90082).
[0282] Neonatal Islet Isolation. Neonatal islets were isolated from wild-type Swiss Webster pups, males and females, aged P10-P20 (C. Huang, G. Gu, J Vis Exp, (2017)). and were purified using several rounds of direct hand-picking. Identification of islets was aided using dithizone staining (EMD Millipore, cat #SCR047), which washed out after overnight culture. Attorney Docket No. 21101.0495P1
[0283] Islets were maintained in suspension culture and RPMI1640 complete medium (w / 10%FBS, IXPen / Strep, and 6mM Glucose) at 37°C and 5% CO2.
[0284] Islet Proliferation and Islet Macrophage Quantification. To measure p-cell proliferation, islets were isolated from male and female neonatal Swiss Webster mice, aged P10-P15. For experiments indicated, islets were also isolated at P15, after treating pups with either PBS- or clodronate- containing liposomes from P12-P14. Loss of macrophages was confirmed by staining islets with an anti-F4 / 80 (1:500, BioRad, cat #MCA497PEB, RRID: AB_567117). For experiments using bacterial CFS, concentrated CFS was added to each well, containing 20-40 islets, at a final concentration of 500 mg / mL. Controls included 16mM glucose, purified BefA at a final concentration of 250 ug / mL concentrated bacterial culture (Brain Heart Infusion, also at 500 mg / mL), and basal complete RPMI 1640 islet culture media. EdU was added to each well of islets at a final concentration of 10 uM, for the final 4-6 hours of the treatment period. Islets were fixed and labelled according the Click-it EdU Imaging Kit Protocol (Thermo Fisher, cat #C 10637). Islets were then immediately stained with anti-insulin (1:10 guinea-pig, Agilent cat #IR002, RRID: AB_2800361), and anti-guinea-pig- Alexa488 (1:500, Molecular Probes, cat #A-11073, RRID: AB2534117) and DAPI (1:1000, Biotium, cat #40043). Total double positive EdU and insulin labelled cells per islet were quantified for each treatment via microscopy (Evos m7000, Thermo Fisher).
[0285] To measure total macrophages per islet, islets were isolated at P10, P15, and P20, from either SPF, GF, or mono-associated pups. Islets were immediately fixed and stained using anti-F4 / 80 (1:500, BioRad, cat #MCA497PEB, RRID: AB_567117), anti-rabbit-Alexa488 (1:500, Jackson ImmunoResearch Labs, cat #711-545-152, RRID: AB_2313584), and DAPI (1: 1000. Biotium. cat #40043). Total F4 / 80 positive cells were quantified via microscopy (Evos m7000, Thermo Fisher).
[0286] For each of these cell type analyses, slides were randomized and blinded prior to quantifications.
[0287] Macrophage Depletion. Macrophages were eliminated systemically from neonatal mice using a variety of chemical and genetic approaches. For clodronate elimination, Clodronate- and PBS-filled liposomes from Liposoma (cat #CP-005-005) were intraperitoneally injected into neonatal mice at a volume of 30 uL (for pups P7-P10) and 50 uL (for pups older than P10). Liposomes were injected every other day from P7-P19 in order to deplete tissue resident macrophages between P10 and P20. For this and the methods described herein, macrophage depletion in tissues w as confirmed by the loss of F4 / 80 Attorney Docket No. 21101.0495P1
[0288] staining in the liver when whole pancreas was required to assess p-cell mass, or in the islets directly when isolated away from whole pancreas tissue. Flow cytometry analysis of splenic macrophages also indicated a significant reduction after clodronate treatment. For genetic induction of macrophage apoptosis, MaFIA (Macrophage Fas-induced apoptosis, Jackson Laboratories, IMSR_JAX: 005070) pups were injected intraperitoneally with dimerizing agent, AP20187 (Sigma Aldrich, cat #SML2838). or PBS control, at a dosage of 10 mg / kg, daily from P7-P10 and every third day thereafter until P20. For antibody mediated depletion of macrophages, 600 ug of anti-mouse CSF1R (CD115) (BioXCell, cat #BE0213) antibody or isotype control (BioXCell, cat #BE0213), was injected on P7, P10, and P13.
[0289] Fungal Cell Wall Analysis. Fungal strains were grown overnight at 30 C in 5 ml YPD from single colonies. To induce hyphal growth, overnight cultures were subcultured (1:100) for 5 hours at 37 C the following day in 5 ml RPMI 1640 with L-glutamine (Coming, cat.# 10-040-CM) supplemented with 10% FBS, 1% Na-Pyruvate and IX non-essential amino acids for MEM (Caisson labs, cat# NAL03). 200 ul of this subculture was collected and stained in replicate in 96 well v-bottom plates. Cells were first collected by spinning at 2,200 x g and washing 2x in sterile PBS (without Ca2+ / Mg2+). Cells were stained first with a 100 ug / ml ConA-Rhodamine (Vector Labs, cat. # RL-1002-25) solution for 15 minutes at room temperature in the dark, then washed 2x and stained in a 100 ug / ml WGA-AlexaFluor 488 (ThermoFisher, cat. # W11261) solution for 15 minutes at room temperature in the dark. Finally, cells were washed 3x in PBS and then fixed in a 1:1 solution of 4% paraformaldehyde (ThemoFisher, cat.# J19943. K2) and column buffer (HBSS without Ca / Mg, 0.5% FBS, 2 mM EDTA, 10 mM HEPES) prior to running samples on a BD Fortessa flow cytometer or a Cytek (Amnis) ImageStream.
[0290] Image Stream: Data was collected on an Amnis Imagestream mk II imaging cytometer (488 and 561 nm lasers both set at 25 mW) at 60x magnification and analyzed with IDEAS application version 6.2.187.0. Unfocused images were eliminated using the gradient RMS of brightfield objects to determine image contrast or focus quality; gradient RMS values of 42.7-72 identified in-focus images. Singlets were identified using brightfield (BF) aspect ratio and area; circular yeast had aspect ratios above 0.8, and filamentous yeast had aspect ratios below 0.5. WGA+ / ConA+ yeast phenotypes were further sub-categorized based on aspect ratio and major axis of the yeast BF image. Filamentous, or hyphal, yeast underwent an additional gate cleanup using bright detail intensity R3 of BF and major axis intensity of ConA to remove low aspect ratio aggregates and non-hyphae. Attorney Docket No. 21101.0495P1
[0291] High Fat Diet. Mice were put on a high fat diet comprised of 10 kcal% fat (D12450Hi, Open Source Research Diets, cat #D12450Ji) starting at 8 weeks of age. The diet was continued for 12 weeks before assessing metabolic function.
[0292] Murine Diabetes Models. Germfree Nonobese Diabetic (NOD) mice (originally from University of Michigan colony) mono-associated at birth with either C. dubliniensis or L. reuteri isolates. Starting at 11 weeks of age mice were monitored for diabetes via presence of hyperglycemia, which was established by measuring blood glucose from the tail vein with a handheld glucometer (Freestyle). Mice were considered diabetic if they read a blood glucose level of greater than 250 mg / dL for two consecutive weeks in a row. Mono-associated status was determined throughout the experiment and at the end point by plating colon contents on a variety of medias and culture conditions. Mice were also housed in isolator caging and handled aseptically in a BSC throughout the duration of the experiment.
[0293] For STZ (Streptozotocin, Selleck Chemicals, cat #S 1312) treated animals, 6-7 week old germ-free C57B1 / 6 mice were given a single injection (intraperitoneally) of 200 mg / kg of STZ in sodium-citrate buffer aseptically prepared and delivered in a BSC. Animals were then housed in isolator caging and monitored for 6 weeks. Advanced signs of disease were grounds for humane end point removal from the experiment and are represented in the survival curve data. 7 days following STZ animals were either kept germfree or given an inoculum of C. dubliniensis. Mono-associated status was confirmed at the end point - 6 weeks post STZ - by culturing. A glucose tolerance test was performed on the surviving mice after 6 weeks.
[0294] 16SrRNA Gene Sequencing of Neonatal Microbiotas. Total colon contents of P12 or P20 pups was collected from different gnotobiotic groups as indicated in the text. DNA was extracted using the Power Fecal DNA Isolation Kit (Mo Bio Laboratories, cat #12830-50). per kit instructions and included 2 cycles of 1 minute of bead beating at 4°C on a Mini-Bead-Beater 16 (BioSpec Products). The V3 and V4 regions of the 16S rRNA gene was amplified with a single round of PCR using primers that contained (described 3’ to 5’) the V3 / 4 region 16S rRNA gene targeting sequence, a 2-nucleotide pad followed by the Illumina primer sequences, an 8-nucleotide index sequence and the remaining Illumina adapter sequence. The V3 / 4 16S-targeting sequences were taken from Takahashi (S. Takahashi, et al., PLoS One 9, el05592 (2014)) and the Indices were taken from Kozich (J. J. Kozich, et al., Appl Environ Microbiol 79, 5112-5120 (2013)). The full oligonucleotide sequences used were (indices denoted by Xs): Prokl6SV34_For:
[0295] AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACAC Attorney Docket No. 21101.0495P1
[0296] GACGCTC TTCCGATCTTGCCTACGGGNBGCASCAG (SEQ ID NO: 1);
[0297] Prokl6SV34 Rev:
[0298] CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGT GCTCTTCCGATCTGCGACTACNVGGGTATCTAATCC (SEQ ID NO: 2). PCR cycling conditions were as follows: 98°C initial denaturation for 2 minutes; 26 cycles of 20 sec 98°C denaturation, 20 sec 51.5°C anneal, 20 sec 72°C extension, and a single final 72°C extension for 2 minutes. Each PCR (performed in triplicate for each sample) was done in a 25 µl volume using Q5 High-Fidelity 2X Master Mix (NEB, cat# M0492L). 5 pmol of each primer and 50 ng template DNA. After amplification, triplicate PCRs from each sample were pooled, 5 µl was run on an agarose gel to confirm amplification and the remaining volume was cleaned up using Axygen AxyPrep MAG PCR cleanup beads (Coming, cat# MAG-PCR-CL-50) diluted to 62.5% in water to efficiently remove any primer dimer that would be preferentially sequenced. Diluted beads were added at 1.8X volume of the PCR reactions, cleaned per manufacturer guidelines and the cleaned amplicons eluted with 25 µl 10 mM Tris-Cl, pH 8.0. Amplicons were then quantified with a picogreen dsDNA assay (ThermoFisher, cat #P11495) on a microplate reader, then the cleaned and indexed individual sequencing libraries were evenly multiplexed (by ng DNA) and sequenced on an Illumina MiSeq instrument in paired-end 300 cycle mode at the Huntsman Cancer Institute’s High- Throughput Genomics shared resource facility.
[0299] Fungal ITS Sequencing. Human fecal samples were obtained as part of an approved ancillary study within the TEDDY (The Environmental Determinants of Diabetes in the Young) study. DNA from human fecal samples and Candida cultures was extracted using the Zymobiomics 96 MagBead DNA Kit (Zymo Research, cat# D4302-E) per kit instructions and included 2 cycles of bead-beating for 1 minute each with a 5 minute dwell time between cycles on a Bead Ruptor Elite (Omni International). Barcoded Illumina sequence libraries were prepared from 2 µl template of each sample and the Quick-ITS Plus NGS Library’ Prep Kit (Zymo Research; cat# D6424-PS2) as per manufacturer’s protocol. No template control reactions with water alone were included to assess contamination. PCR amplification was performed on a QuantStudio6 Real-Time PCR System (ThermoFisher, cat# 4485691) as follows: 95°C initial denaturation for 10 minutes; 42 cycles of 30 sec 95°C denaturation, 30 sec 55°C anneal, 3 minutes 72°C extension. Cleaned PCR products were equally pooled and sequenced on an Illumina MiSeq instrument in paired-end 300 cycle mode at the Huntsman Cancer Institute's High-Throughput Genomics shared resource facility. Attorney Docket No. 21101.0495P1
[0300] RNA Sequencing on Islet Tissues. For bulk RNA sequencing, islets were isolated from GF and SPF mice aged P10 and P20. Purification from acinar tissue was achieved by several rounds of hand picking. Both male and female mice were used in each group and islets from one mouse constitute one sample. Islets were immersed in TRIzol (Ambion LifeTechnologies) to lyse cells and preserve RNA. RNA extraction was performed using, Direct-zol RNA miniprep kit (Zymo Research cat# R2070) according to manufacturer instructions and sequencing libraries were prepared by the Huntsman Cancer Institute High-throughput Genomics core facility. Total RNA was first hybridized with the NEBNext rRNA Depletion kit v2 (NEB, cat# E7400) to diminish rRNA from the samples. Stranded RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, cat# E7760L). Purified libraries were qualified on an Agilent Technologies 4150 TapeStation using a D1000 ScreenTape assay (Agilent, cat# 5067-5582 and 5067-5583). The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant Kit (Roche, cat# 07960140001).
[0301] Individual libraries were normalized to 5 nM in preparation for Illumina sequence analysis and sequenced on a NovaSeq 6000 with a paired-end 150 cycle sequencing run.
[0302] For single cell sequencing of islet immune cells, islets were purified from P15 GF and SPF animals. Purification from acinar tissue was achieved by several rounds of hand picking. Purified islets from 20 animals each of GF and SPF origins were pooled and digested using Gibco Enzyme Free Cell Dissociation Buffer (Fisher Scientific, cat #13151014) at 37 °C for 15 minutes. Samples were vortexed every 5 minutes throughout the incubation. Washed and resuspended cells from the islet dissociation were run through a CD45 positive selection column (Miltenyi Biotec, CD45 MicroBeads mouse, Miltenyi Biotec. cat #130-052-301) followed by a dead cell removal kit (Miltenyi Biotec, cat #130-090-101) to isolate live immune cells, which were immediately submitted to the Huntsman Cancer Institute High-throughput Genomics core facility where libraries were prepared from the GF and SPF pooled samples using the Next GEM Single Cell 3’ Gene Expression Library Prep version 3.1 with UDI (10X Genomics) and sequenced on a NovaSeq (reagent kit version 1.5) with paired-end 150 cycle sequencing.
[0303] Sequencing and Genome Assemblies of Neonatal Microbial Isolates. DNA was extracted from purified cultures of each isolate, using the Zymo Quick DNA Fungal / bacterial microprep kit. Extracted gDNA was sequenced with paired-end 150 cycle reads on an Illumina NovaSeq (kit reagent version 1.5) following library preparation with the NEBNext Attorney Docket No. 21101.0495P1
[0304] Ultra II DNA kit. Genomic DNA was also long read sequenced on an individual ONI’ Flongle flow cell (Oxford Nanopore Technologies) for each isolate. ONT sequence libraries were prepared with the rapid barcoding kit using R9 (SQK-RBK004 kit and FLO-FLG001 flowcells - E. coli and E. gallinarum) or R10 chemistry (SQK-RBK114-24 kit and FLO-FLG114 flowcells - C. dubliniensis). Illumina reads were first quality and adapter trimmed with trim galore and ONT reads were quality trimmed and filtered with NanoFilt, discarding any reads shorter than 200 nucleotides. Hybrid assemblies were then created using Unicycler (R. R. Wick, et al., PLoS Comput Biol 13, e1005595 (2017)) in normal mode (P. A.
[0305] Chaumeil, et al., Bioinformatics 38, 5315-5316 (2022)) for the bacterial genomes. Bacterial taxonomic placements were confirmed using GTDB-Tk (version 2.3.0) on the assembled contigs. Raw reads and assembled contigs from C. dubliniensis isolate sequencing were taxonomically confirmed using Kraken2 (D. E. Wood, et al., Genome Biol 20, 257 (2019)) with the PlusPF pre-built index and indicated similarity to the CD36 strain.
[0306] Bioinformatics processing and analysis of sequence data. 16S rRNA gene raw reads were demultiplexed allowing 0 mismatches in indices then processed and analyzed within the QIIME2 framework (E. Bolyen et al., Nat Biotechnol 37, 852-857 (2019); and W. Z.
[0307] Stephens et al. Cell Rep 37, 109916 (2021)). In brief, demultiplexed and quality-filtered sequences were first trimmed of primer and linker sequences with the Cutadapt plugin, then denoised with DADA2 (B. J. Callahan et al., Nat Methods 13, 581-583 (2016)) (Martin, 2011). Taxonomies were then assigned to ASVs with the classify-skleam method in the feature-classifier plugin, against the Greengenes2 reference set trimmed to the amplified V3 / 4 region and trained with the fit-classifier-naive-bay es method (E. Bolyen et al., Nat Biotechnol 37, 852-857 (2019); and E. R. Gamazon, et al., Front Genet 3, 202 (2012)). ASV representative sequences were inserted into the Greengenes (version 13 8) backbone reference tree using the fragment-insertion plugin (S. Janssen et al., mSystems 3, (2018)). Three samples with less than 500 quality sequences per sample were removed and 22 ASVs that could not be taxonomically placed in any phyla were removed before further analysis. QI1ME2 ASV table, taxonomy and tree artefacts were imported into R as a phyloseq object using the microbiomeMarker package (Y. Cao et al., Bioinformatics 38, 4027-4029 (2022)). Differentia] abundance analysis (performed separately between ages or between antibiotic treatment groups) was performed with ANCOM-BC2 functions in the ANCOM-BC package with a prevalence cutoff of 0.05, structural zero detection set to false and using the global test for the age comparisons and Dunnett's test for the multi-group antibiotic comparisons to the untreated control group (H Lin, S. D. Peddada, Nat Commun 1 1, 3514 (2020)). Beta Attorney Docket No. 21101.0495P1
[0308] diversity group significance was tested with the adonis2 function in the vegan package. Alpha diversity and NMDS plots and calculations were made with the MicrobiotaProcess package (S. Xu et al.. Innovation (Camb) 4, 100388 (2023)). The microshades package was used to make taxonomic barplots with similar colors for genera within the top 5 most abundant taxonomic classes (E. M Dahl, et al., Microbiol Resour Announc 11, e0079522 (2022)).
[0309] For bulk RNA-seq of islets, the raw reads were first quality and adapter-trimmed using trim galore then transcript counts were quantified using Salmon against the transcriptome from assembly GRCm38 (mm10) (R. Patro, et al., Nat Methods 14, 417-419 (2017)). Transcript level quantifications were read into R using the tximeta package and summarized to gene level counts before differential expression analysis with DESeq2 (M. I. Love, et al., Genome Biol 15, 550 (2014); and M. I. Love et al.. PLoS Comput Biol 16, el007664 (2020)). Samples with a relatively low number of mapped reads (< 3 million) were removed resulting in an average of 27 million mapped reads per sample. Differential responses to clodronate treatment, age or microbiota status were tested separately and significantly differentially expressed genes were defined as those with an adjusted p value < 0.05. Shrunken log fold change (LFC) estimates w ere obtained with the ashr function implemented in DESeq2 (M. Stephens, Biostatistics 18, 275-294 (2017)). LFC ranked differentially abundant genes lists w ere used in the clusterProfiler package to implement gene set enrichment analysis (GSEA) and plot results (T. Wu et al., Innovation (Camb) 2, 100141 (2021)).
[0310] Single cell RNA sequencing reads were initially processed with cellranger 7.0.1 (10X Genomics) against the GRCm38 (mm10) mouse genome assembly and the resultant matrix files were read into R and analyzed with Seurat (version 4.3.0) (Y. Hao et al., Cell 184, 3573-3587 e3529 (2021)). As initial QC, cells that contained more than 7.5% mitochondrial reads, less than 200 features detected, or more than 6000 features detected, were filtered out. Counts were then normalized and transformed with the SCTransform function, regressing out percent mitochondrial reads and the two samples were integrated using 3000 features. The optimal clustering resolution of 0.6 was determined using the clustree package and cells were clustered within the integrated dataset (L. Zappia, A. Oshiack, Gigascience 7, (2018)). Four clusters with a small proportion of cells (<2%) were then filtered out for improved doublet prediction which was then performed on each sample individually using the DoubletFinder package (C. S. McGinnis, et al., Cell Syst 8, 329-337 e324 (2019)) after removal of low quality cells and clusters. Following predicted doublet removal on each sample individually, the samples were re-integrated as before. Cell clusters were then annotated with a Attorney Docket No. 21101.0495P1
[0311] combination of 2 annotation packages and manual examination of differentially expressed genes due to the unusual cellular states and paucity of reference cell annotations from developing islets. CIPR (H. A. Ekiz, et al., BMC Bioinformatics 21, 191 (2020)) was first used on both the average expression per cluster (derived from the Seurat function AverageExpression and tested in CIPR with Spearman correlation method) and log fold change of a cluster’s markers (derived from Seurat function FindAllMarkers and tested in CIPR with the logFC dot product method) against the ImmGen mouse reference sets and against the presorted RNAseq mouse reference sets for a total of 4 CIPR results. Clusters with consensus annotations across the results were annotated as determined by CIPR which showed that some clusters appeared to be non-immune despite the CD45+ sorted input. Then, clusters were annotated with scType and the provided pancreas single cell sequencing reference set derived from Baron et al. as well as manual examination of genes listed as sensitive and specific for pancreatic cell types in the PanglaoDB database which represents aggregated data from many scRNAseq studies (A. lanevski, et al., Nat Commun 13, 1246 (2022); and O. Franzen, et al., Database (Oxford) 2019, (2019)). The high-confidence immune clusters were subsetted and they were reclustered for further analysis. MacSpectrum R package was obtained from the original authors and used for analysis of MPI and ADMI scores of each cluster (P. N. Zakharov, et al. J Exp Med 217, (2020)).
[0312] Demultiplexed ITS raw reads were processed with QIIME2 (version amplicon-2024.2) and the ITSxpress plugin (version 2) (S. T. Rivers, et al.). After importing sequences into QIIME2 artefact format, the ‘trim-pair-output-unmerged’ command from ITSxpress was used to trim sequences to the appropriate ITS2 region that is targeted by the primers used in the library prep (parameters: — p-taxa F, -p-region ITS2). The DADA2 denoise-paired plugin was then used to create an ASV table and representative sequences. Taxonomy of sequences was then called using the feature-classifier classify-skleam plugin and a pretrained classifier for UNITE v9.0 (version 18.07.2023) (Abarenkov, et al. (2023): UNITE QIIME release for Fungi. Version 18.07.2023). A single species hypothesis (sh SHI 193376.09FU) was found to account for the majority of the few no-template-control sample reads, but was rare or absent in fecal samples, and was removed prior to further processing. Two samples with unusually low percent of initial reads further identified by ITSx as fungal (3% and 11%) were determined to be of low-quality and removed from subsequent analyses. The QIIME2 artefact objects were then imported into R with the microbiomeMarker package (Y. Cao et al., Bioinformatics 38, 4027-4029 (2022)) Attorney Docket No. 21101.0495P1
[0313] and taxonomic barplots created with MicrobiotaProcess package (S. Xu et al., Innovation (Camb) 4, 100388 (2023)).
[0314] Human fecal samples. Human fecal samples were obtained as part of an approved ancillary study of The Environmental Determinants of Diabetes in the Young (TEDDY) Study. Samples were originally collection by TEDDY from healthy children carrying genetic risk alleles for type 1 diabetes. Twenty samples, from both male and female donors, which ranged in age from 3-30 months, were obtained. These samples were collected from the Denver region in Colorado and deidentified prior to our receipt. Samples were not included from any study participant had been prescribed antibiotics within the last 6 months. Upon receipt, frozen samples were thawed inside an anaerobic chamber, resuspended in sterile, reduced PBS supplemented with cysteine. The samples were normalized in concentration by their weight. Reduced sterile glycerol was added to each sample at a final concentration of 25%. The samples were then aliquoted in 500uL cro-tubes and flash frozen in liquid nitrogen and stored at -80 until used to inoculate germ-free mice.
[0315] Statistics. For mouse experiments, 2-3 replicate experiments were pooled, and are represented in each panel unless otherwise specified in the figure legend. Power calculations were done a priori using a power of 80% and a significance level of 0.05 to estimate the number of mice required for detecting statistical significance. Individual mice are represented as dots over box plots (median, inner and outer quartiles) with whiskers representing either the 95% confidence interval or the min and max of the data set. Definitive outliers were excluded from data sets if detected using a ROUT outlier analysis with a Q of 1%. For quantifications involving islets, at least 20 islets were quantified from 2-3 replicate treatment wells per experiment. And 2-3 replicate experiments were pooled in the represented panels. Islets were collected from several mice on the same day. Individual islets are not represented in these panels because they are too numerous to display in a readable fashion. In histograms, error bars represent the standard deviation. To determine significant differences between treatment groups, either a Students Two-Tailed T-test (for two groups) or a One-Way ANOVA (for 3 or more groups) with comparisons between groups (Tukey test for posthoc comparisons between the groups, or Dunnett's test for adhoc comparisons to a single control) were used. Two-Way ANOVA was used to determine significant differences between treatment groups across experiments with multiple time points, such as glucose tolerance tests and insulin secretion response to glucose. For survival curves and NOD diabetes curves, a log-rank test was performed. Graph Pad Prism was used to calculate statistical values.
Claims
Attorney Docket No. 21101.0495P1CLAIMS WHAT IS CLAIMED IS:
1. A composition comprising Candida dubliniensis and a carrier.
2. A composition comprising a supernatant from Candida dubliniensis.
3. The composition of claims 1 or 2, wherein the Candida dubliniensis is C. dubliniensis wild-type strain, Wii284, RL053. RL00369, CD36, NGY563, or a combination thereof.
4. The composition of claims 1 or 2, wherein the Candida dubliniensis is a C.dubliniensis mutant strain that has defective N-mannosylation.
5. The composition of claim 4, wherein the C. dubliniensis mutant strain is C.dubliniensisAoch.
6. The composition of claims 1 or 2, wherein the composition comprises at least IxlO4cells of Candida dubliniensis.
7. The composition of any of the preceding claims, wherein the composition comprises between IxlO4and IxlO10cells of Candida dubliniensis.
8. The composition of any of the preceding claims, wherein the composition is frozen.
9. The composition of any of the preceding claims, wherein the composition is a solid.
10. The composition of any of the preceding claims, wherein the composition is a liquid.
11. The composition of claim 10, wherein the liquid is concentrated liquid.
12. The composition of claim 10, wherein the liquid is a dilute liquid.
13. The composition of preceding claims, wherein the composition is capable of replacing microbiota of a subject with a disease or disorder associated with an imbalanced microbiota.
14. The composition of claim 13, wherein the imbalanced microbiota is a decrease in Candida dubliniensis.
15. The composition of claim 13, wherein the disease or disorder is a metabolic disease.Attorney Docket No. 21101.0495P116. The composition of any of the preceding claims, wherein the composition is in a form selected from the group consisting of powder, granules, a ready-to-use beverage, food bar, an extruded form, capsules, gel caps, and dispersible tablets.
17. A pharmaceutical composition comprising any of the compositions of claims 1-16, and a pharmaceutically acceptable carrier.
18. The composition of any one of the preceding claims, further comprising Enterococcus galinarum, E. coli, or a combination thereof.
19. A method of treating or preventing a metabolic disease in a subject, the method comprising administering to the subject the composition of any of claims 1-16.
20. A method of treating a subject with diabetes, the method comprising administering to the subject the composition of any of claims 1-16.
21. A method of promoting or enhancing proliferation of beta cell development or beta cell regeneration in a subject, the method comprising administering to the subject the composition of any of claims 1-16.
22. A method of treating a subject with a metabolic disease or disorder, the method comprising administering to the subject the composition of any of claims 1-16, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
23. A method of treating a subject with diabetes, the method comprising administering to the subject the composition of any of claims 1-16, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
24. A method of treating or preventing a metabolic disease in a subject, the method comprising administering to the subject the composition of any of claims 1-16, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.Attorney Docket No. 21101.0495P125. A method of promoting or enhancing proliferation of beta cell development or beta cell regeneration in a subject in need thereof, the method comprising administering to the subject the composition of any of claims 1-16, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
26. A method of increasing survival of a subject having diabetes, the method comprising administering to the subject the composition of any of claims 1-16, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
27. A method of increasing clearance of blood glucose in a subject, the method comprising administering to the subject the composition of any of claims 1-16, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
28. The method of claim 27, wherein the subject has diabetes.
29. The method of claim 28 wherein the diabetes is type I diabetes.
30. A method of increasing p-cell mass in a subject, the method comprising administering to the subject the composition of any of claims 1-16, wherein the relative abundance of Candida dubliniensis is increased in the subject compared to the relative abundance prior to administration.
31. The method of claim 30, wherein the subject has diabetes.
32. The method of claim 31, wherein the diabetes is type I diabetes.
33. The method of any one of claims 19-32, wherein the composition is administered orally.
34. The method of any one of claims 19-33, wherein the relative abundance of Candida dubliniensis is increased by 5%.
35. The method of any one of claims 19-34, wherein the subject is a human.
36. The method of any one of claims 19-34, wherein the Candida dubliniensis is active.Attorney Docket No. 21101.0495P137. The method of any one of claims 19-34, wherein the subject has been identified as being in need of the treatment.
38. The method of any one of claims 19-37, wherein the composition is in a form selected from the group consisting of powder, granules, a ready -to-use beverage, food bar, an extruded form, capsules, gel caps, and dispersible tablets.
39. The method of any one of claims 19-38, wherein the composition is for replacing microbiota of a subject with a disease or disorder associated with an imbalanced microbiota.