Novel korean velvet grass variety 'KVX' of genus zoysia and specific marker for identifying 'KVX'

The 'KVX' turfgrass variety, developed through crossbreeding and DNA markers, addresses adaptation challenges in Zoysia grasses, offering resistance to high temperature and humidity, extended green period, and low mowing tolerance, suitable for golf courses and ornamentals.

WO2026116504A1PCT designated stage Publication Date: 2026-06-04HANUL CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
HANUL CO LTD
Filing Date
2024-11-26
Publication Date
2026-06-04

AI Technical Summary

Technical Problem

Existing turfgrass varieties face challenges in adapting to high temperature and humidity stress, climate change, and maintaining putting quality, while conventional Zoysia grasses are limited in commercial application and genetic diversity, leading to inefficiencies in breeding and commercialization.

Method used

Development of a new Zoysia genus turfgrass variety 'KVX' through crossbreeding Zoysia matrella var. pacifica and Zoysia pacifica, utilizing DNA molecular markers for selection and identification, ensuring resistance to high temperature and humidity, extended green period, and low mowing tolerance, with a unique morphological profile.

Benefits of technology

The 'KVX' variety exhibits excellent resistance to high temperature and humidity, extended green period, and low mowing tolerance, suitable for golf course greens and ornamental purposes, with stable genetic traits and efficient propagation methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024018813_04062026_PF_FP_ABST
    Figure KR2024018813_04062026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a novel Korean velvet grass variety 'KVX' of the genus Zoysia, and a specific marker for identifying 'KVX', and more specifically, relates to 'KVX' (Accession No: KCTC16100BP), which is a novel Korean velvet grass variety having resistance to high temperature-high humidity stress, low-mowing and shade tolerance, longer green color retention, and ultra-fine leaves.
Need to check novelty before this filing date? Find Prior Art

Description

New Zoysia genus turfgrass variety 'KVX' and specific markers for identifying 'KVX'

[0001] The present invention relates to a new variety of Zoysia genus velvet grass of Korean Korean origin, 'KVX', which is a variety developed by crossbreeding Zoysia matrella var. pacifica × Zoysia pacifica, and is a Korean velvet grass with ultrafine leaves that has resistance to high temperature and humidity stress and adaptability to climate change, and has a green period of 50 to 55 days longer than that of the cultivated grass (Zoysia japonica), has resistance to low mowing, and is distinguished by having different morphological characteristics from Zoysia pacifica inhabiting the Mascarene Islands in the Indian Ocean and the Ryukyu Islands in Japan, which is maintained without mowing, and by having a northern growth type with low temperature resistance.

[0002] According to the report "History, Uses, and Breeding Methods of Zoysiagrass (Zoysiaspp.)," an official document of the U.S. Department of Agriculture (USDA), Korean grass (Zoysia japonica) was identified as seeds sent to the USDA in 1894 by John M. B. Sill, who served as the Consul General of the Republic of Korea in Seoul from 1894 to 1897. Although there were no official records of the introduction of the plant to the United States prior to 1898, when the USDA established a section on seed and plant introduction, it is said that shortly after being introduced from Korea in 1894, the performance of Zoysiagrass was reported in the press from the Carolinas to Washington D.C., and it began to attract public attention.

[0003] Zoysia grass is a type of turfgrass widely distributed globally across temperate and subtropical zones, including the Korean Peninsula and East Asia, comprising 11 species. Currently in Korea, it is classified into five species: Zoysia japonica, Zoysia matrella, Zoysia pacifica, Zoysia macrostachya, and Zoysia sinica. The size of the domestic and international turfgrass seed market is increasing annually, and many new varieties are being developed. The International Union for the Protection of New Varieties of Plants (UPOV) has introduced a plant variety protection system to safeguard the rights of breeders who develop new varieties, which is operated by member countries.

[0004] If general breeding methods are followed to develop new turf varieties, it takes approximately 5 to 10 years from the selection of breeding candidates to breeding, cultivation trials, and the completion of variety development. Since breeding new varieties requires a significant amount of labor, there is not only an economic burden but also a long time required, which causes variety development to fail to keep up with industry trends. Furthermore, there are limitations in establishing a mass production system and distributing varieties after propagation, so there are not many cases that lead to commercialization.

[0005] Due to the impact of global climate change and warming, large-scale grasslands such as sports fields and golf courses are also experiencing changes in the environment to be hot and humid. Consequently, damage from pests and diseases and the emergence of heterogeneous grasses are increasing in cool-season grasses like Kentucky bluegrass and Bentgrass, and the resulting economic burden is also increasing. Due to these high temperatures, the use of grasses that grow vigorously in warm seasons, such as Zoysia grass and Bermuda grass, is increasing; however, the number of Zoysia genus grass varieties applied to greens in warm climate zones that provide putting quality, such as creeping Bentgrass, remains very small.

[0006] In some tropical regions, including Southeast Asia, greens composed of Zoysia grass, Bermuda grass, and seashore paspalum grass are used; however, ball speed and putting quality, which are directly linked to performance, do not reach the level of creeping bentgrass. Furthermore, due to high water consumption and environmental burden, there is an increasing demand for new varieties of the Zoysia genus that offer significant climatic and environmental advantages, and active development is currently underway worldwide.

[0007] Compared to bentgrass, which is generally the most commonly used grass on golf course greens, Bermuda grass and Paspalum grass have larger leaf surfaces and medium-protruding growth characteristics. As a result, the ball roll is relatively slower, and the obliquely lying leaf stems hinder ball direction and make precise putting difficult. Consequently, performance varies depending on the grass type, affecting fair play. During the peak growth period, the excessive growth of Bermuda grass and Paspalum grass contributes to increased maintenance costs for maintaining turf quality.

[0008] In addition, greens composed of Paspalum grass have the disadvantage of being prone to becoming spongy due to the accumulation of thatch caused by their very rapid growth, and the excessive density of the stems leads to the easy depletion of water resources and soil fertility.

[0009] Multinational seed companies worldwide are commonly utilizing genomic information to develop molecular markers across various crop fields, and rapid advancements in the field of biotechnology are being made in enhancing crop breeding efficiency and conducting comparative genomic studies through plant genomic research, bioinformatics, and variety development based on DNA markers.

[0010] In this invention, to pioneer the resolution of the distinctiveness, uniformity, and stability "DUS evaluation" of new turfgrass varieties, variety development was carried out by applying DNA molecular marker technology to the selection line, and an SSR molecular marker for variety identification was developed.

[0011] Meanwhile, Korean Registered Patent No. 1581281 discloses a 'new variety of turf having herbicide resistance and dwarfism and a method for producing the same,' obtained by crossing a herbicide-resistant wild turf (Zoysia japonica) as the paternal parent and a golden turf (Zoysia matrella) as the maternal parent; Korean Registered Patent No. 1337246 discloses a 'new variety of turf with induced narrow-leaf mutation,' obtained by inducing a mutant by irradiating wild turf (Zoysia japonica) seeds with a dose of 230–280 Gy, characterized by a leaf width that is 0.5–1.5 mm narrower compared to wild turf not irradiated with a proton beam; and Korean Registered Patent No. 2540868 discloses a variety of Korean wild turf (Zoysia japonica Steud.) and a green stolon turf with a high chlorophyll content. Disclosed is 'The Green,' a new variety of Korean turfgrass, characterized by a long green period, rapid growth rate, and excellent coverage rate, selected by crossbreeding in which green stolon individuals are selected from F2 individuals obtained by self-pollination of F1 individuals produced by crossing Chinese turfgrass. Additionally, Korean Registered Patent No. 0716569 discloses 'Millok,' a new variety of turfgrass, which is produced by collecting turfgrass from domestic and foreign sources, performing artificial self-pollination on turfgrass with superior growth among the collected turfgrass, selecting seeds, and cultivating; this variety features medium-length leaves, a low plant height, and a wide stance angle, resulting in high photosynthetic efficiency, as well as yellowish-green stolons that distinguish it from existing turfgrass, and is capable of repetitive asexual reproduction. However, the present invention is a hybrid variety cultivated by crossbreeding from Korean wild turfgrass genetic resources, possessing resistance to high temperature and humidity stress and adaptability to climate change, tolerance to low mowing, and a Korean variety of ultra-fine leaves with a northern-type growth pattern and an extended green period. There is no mention of the new variety of Zoysia Willd. 'KVX', a type of silk grass.

[0012] The present invention was derived from the above-mentioned requirements. To develop a fine-leaved Zoysia grass variety, the inventors newly bred 'KVX' based on the S1 offspring of a cross between Zoysia matrella var. pacifica and Zoysia pacifica, which possesses resistance to high temperature and humidity stress and adaptability to climate change, extends the green period until late autumn, and ensures stability of the F5 generation, which is particularly resistant to low mowing.

[0013] To solve the above problem, the present invention provides a new variety of ultra-fine-leaved silk grass 'KVX' with accession number KCTC16100BP, having the morphological characteristics of (a) to (h) below, resistance to high temperature and humidity stress, low mowing and shade tolerance, and vegetative propagation by above-ground stolons or rhizomes:

[0014] (a) The width of the leaf blade is 0.2 to 0.3 mm.

[0015] (b) The length of the plant body is 36–37 mm.

[0016] (c) The stem length of young plants is 9–14 mm.

[0017] (d) The leaf blade length is 31–32 mm.

[0018] (e) The leaf blade is dull light green.

[0019] (f) The length of the leaf is 21~22 mm.

[0020] (g) The width of the leaf is 0.2~0.3 mm.

[0021] (h) The leaf sheath length is 7~8 mm.

[0022] In addition, the present invention provides seeds of the new silk grass variety 'KVX'.

[0023] In addition, the present invention provides the rhizomes and above-ground stolons of the new silk grass variety 'KVX'.

[0024] In addition, the present invention provides a method for propagating the new variety of silk grass 'KVX', comprising the steps of: transplanting the rhizome or stolon of the new silk grass variety 'KVX' into soil; and propagating the rhizome or stolon transplanted into soil.

[0025] In addition, the present invention provides a marker composition for identifying a new variety of silk grass 'KVX', comprising a set of SSR (simple sequence repeat) primers consisting of the nucleotide sequences of SEQ ID NOs. 1 and 2.

[0026] In addition, the present invention provides a method for identifying the new variety of silk grass 'KVX' using the marker composition.

[0027] The new variety of ultra-fine-leaved silk grass 'KVX' of the present invention is a delicate grass with resistance to low mowing and excellent resistance to trampling, so it can be applied to golf course greens. In addition, due to its northern growth type, it offers broad climate adaptability and exhibits excellent growth even in shade, so it can be used for ornamental purposes. Furthermore, since the genotype is fixed through asexual reproduction, ensuring the permanence of genetic traits, it can be beneficially utilized in related fields.

[0028] Figure 1 shows the growth of the applied variety, the ultra-fine-leaved silk grass 'KVX'.

[0029] Figure 2 is a photograph showing the rhizome of the applied variety 'KVX'.

[0030] Figure 3 is a schematic diagram of the development of a specific molecular marker for the applied variety 'KVX'.

[0031] Figure 4 shows a phylogenetic tree constructed using the size values ​​of 120 SSR marker products from 96 individuals of Zoysia grass.

[0032] Figure 5 shows the adjacent sequence of the 'KXV' specific SSR marker (Zoysia-081), where the [_] marked part is the SSR motif and the underlined part indicates the location of the primer.

[0033] Figure 6 shows the analysis results using the 'KVX' variety-specific SSR primer set.

[0034] To achieve the objective of the present invention, the present invention provides a new variety of ultra-fine-leaved silk grass 'KVX' with accession number KCTC16100BP, having the morphological characteristics of (a) to (h) below, resistance to high temperature and humidity stress, low mowing and shade tolerance, and vegetative propagation by above-ground stolons or rhizomes:

[0035] (a) The width of the leaf blade is 0.2 to 0.3 mm.

[0036] (b) The length of the plant body is 36–37 mm.

[0037] (c) The stem length of young plants is 9–14 mm.

[0038] (d) The leaf blade length is 31–32 mm.

[0039] (e) The leaf blade is dull light green.

[0040] (f) The length of the leaf is 21~22 mm.

[0041] (g) The width of the leaf is 0.2~0.3 mm.

[0042] (h) The leaf sheath length is 7~8 mm.

[0043] However, anyone in the industry can infer that the morphological characteristics of (a) to (h) above may vary slightly depending on unusual climatic conditions, soil, fertilization management, nutrition, moisture, and light intensity.

[0044] The new turf variety 'KVX' of the present invention is classified as *Zoysia pacifica* (scientific name: Zoysia pacifica (Goudswaard) M. Hotta; synonym: Zoysia matrellavar. tennifolia Willd. ex Thiele), which originated on the Korean Peninsula and thrives in warm seasons. It is a grass with weak cold tolerance but excellent shade tolerance. It is a unique species of grass for which there have been no instances of commercial use, such as on golf course greens or fairways, through commercially bred varieties. It is a creeping type distinguished by the International Society of Plant Taxonomy (Taxonomy Species ID 460412; Zoysia matrellavar. tennifolia) (synonym). It is a perennial herbaceous plant of the Poaceae family possessing two root systems—primary and secondary roots—and is still used internationally under the English name 'Korean velvet grass.' However, genomic information regarding specimens derived from Korean genetic resources has never been developed, and it consists of rhizomes or above-ground It reproduces and grows via stolons.

[0045] The new turf variety 'KVX' according to the present invention is a new turf variety of the Zoysia genus that fixes the genotype over the F5 generation through crossbreeding, line separation, generational advancement (verification using DNA molecular markers), and productivity verification. It was developed to improve the characteristics of the well-known conventional Zoysia pacifica, which has the finest stems and delicate leaves among Zoysia genus grasses and can be mowed low, but cannot spread out widely due to short internode lengths and swells up in a hemispherical shape, and has a high internode length of 1 to 3 leaves from the ground, which exposes the ground when the grass is mowed. It is based on S1 offspring that possess superior traits of the paternal parent, such as low and uniform creeping growth and resistance to low mowing, through crossbreeding, line separation, generational advancement (verification using DNA molecular markers), and productivity verification.

[0046] The inventors deposited the vegetative body of the new turf variety 'KVX' having the above characteristics with the Korea Research Institute of Bioscience and Biotechnology on October 22, 2024 (Accession number: KCTC16100BP). In the Seed Industry Act, "seed" refers to a seed used for propagation or cultivation, mushroom spawn, seedling, spore, or leaves, stems, roots, etc. that are vegetative bodies.

[0047] In the present invention, leaf explants of 'KVX' were prepared under light culture conditions at 25°C at 2.0 mg·L -1 BA (6-Benzylaminopurine) and 0.1 mg·L -1 After inducing a callus by culturing in MS medium (pH 5.7) containing NAA (1-Naphthaleneacetic acid), it was transferred to subculture medium and cultured statically for 92 days, after which it was deposited.

[0048] The new turf variety 'KVX' according to the present invention was developed using the Woljeong-ri resource (Zoysia matrella var. pacifica), a variety of Zoysia matrella collected in the Jeju Island region, as the paternal parent, and the Beophwan-dong resource (Zoysia pacifica), a variety of Zoysia matrella collected in Seogwipo N 33° 55' E126° 79', as the maternal parent.

[0049] The Woljeong-ri resource, which is the parent of the new turf variety 'KVX' according to the present invention, showed winterkill damage and survivability (LT) due to abnormal low-temperature stress during winter at the K-Testbed of the National Sejong Arboretum in Sejong Special Self-Governing City. 50 It has been verified and showed results with a 53-day increase in the green period compared to Zoysia japonica. In the subtropical and tropical climate zones, which are the target markets for the industrialization of the applied variety, it is characterized not only by maintaining a green color year-round, but also by a C4 type photosynthetic mechanism initiating photosynthesis at temperatures above 10°C and exhibiting the best growth at 35°C, with health reaching its peak especially during the summer.

[0050] The present invention also provides seeds, rhizomes, and above-ground stolons of the new variety of ultra-fine-leaved silk grass 'KVX', with the deposit number KCTC16100BP.

[0051] The new variety 'KVX' according to the present invention can be easily propagated by rhizomes or above-ground stolons and can also be propagated by seeds; however, while 'KVX' exhibits a basic vegetative growth form in warm temperate, subtropical, and tropical climates, it heads in response to low temperature conditions in temperate climates. Since the plant body is dwarf, seed collection is not easy, and it may not be beneficial due to low economic viability and a high rate of immature embryo emergence.

[0052] The present invention also provides a method for propagating a new turf variety 'KVX', comprising the steps of: transplanting a rhizome or a stolon of the new ultra-fine-leaved silk turf variety 'KVX', whose deposit number is KCTC16100BP, into soil; and propagating the rhizome or stolon transplanted into soil.

[0053] The propagation method of the new silk grass variety 'KVX' according to the present invention can be repeatedly reproduced asexually by tissue culture, etc., which is well known in the art, in addition to the method using rhizomes or above-ground stolons.

[0054] The present invention also provides a marker composition for identifying a new variety of silk grass 'KVX', comprising a set of SSR (simple sequence repeat) primers consisting of the nucleotide sequences of SEQ ID NOs. 1 and 2.

[0055] In the marker composition according to the present invention, the primer may comprise an oligonucleotide consisting of a fragment of 13 or more, 14 or more, 15 or more, 16 or more, or 17 or more consecutive nucleotides within the sequences of SEQ ID NOs. 1 and 2, depending on the sequence length of each primer. For example, the primer of SEQ ID NO. 1 (20 oligonucleotides) may comprise an oligonucleotide consisting of a fragment of 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, or 19 or more consecutive nucleotides within the sequence of SEQ ID NO. 1. Additionally, the primer may also comprise a sequence that is added, deleted, or substituted from the nucleotide sequences of SEQ ID NOs. 1 and 2 and can bind to an amplification site.

[0056] In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of said primer must allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength.

[0057] In this specification, the oligonucleotide used as a primer may also include a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or an intercalating agent.

[0058] The present invention also provides a method for identifying the new variety of silk grass 'KVX' using the marker composition. More specifically, the identification method according to the present invention is as follows:

[0059] Step of isolating genomic DNA from Zoysia sp. grass samples;

[0060] A step of amplifying a target sequence by performing an amplification reaction using the above-described isolated genomic DNA as a template and a marker composition according to the present invention; and

[0061] A step of detecting the product of the amplification step above may be included, but is not limited thereto.

[0062] The identification method of the present invention includes the step of isolating genomic DNA from a sample of Zoysia grass. The method for isolating genomic DNA from the sample of Zoysia grass may utilize methods known in the art, for example, the CTAB (Cetrimonium bromide) method may be used, or the Wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, an amplification reaction may be performed using a primer set according to one embodiment of the present invention to amplify a target sequence. The method for amplifying the target nucleic acid may be selected from a polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification, or amplification via Qβ replicase, or any various methods known in the art for amplifying nucleic acid molecules. Among these, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. These PCR methods are well known in the industry, and commercially available kits can also be used.

[0063] In an identification method according to one embodiment of the present invention, the Zoysia genus grass sample may be a leaf, stem, root, or seed of a grass plant, but is not limited thereto.

[0064] In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance may be a fluorescent, phosphorescent, or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 (Cyanine-5) or Cy-3. When performing PCR by labeling the 5'-terminus of a primer with Cy-5 or Cy-3 during the amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling substance. Additionally, labeling using a radioactive substance when performing PCR 32 P or 35 When radioisotopes such as S are added to the PCR reaction mixture, radioactivity is incorporated into the amplification product during synthesis, so that the amplification product can be radiolabeled. One or more oligonucleotide primer combinations used to amplify the target sequence are as described above.

[0065] The identification method according to the present invention includes a step of detecting the amplification product, and the detection of the amplification product may be performed through gel electrophoresis, capillary electrophoresis, DNA chips, fluorescence measurement, phosphorescence measurement, or radioactivity measurement, but is not limited thereto. As one of the methods for detecting the amplification product, capillary electrophoresis may be performed. For example, an ABi Sequencer may be used for capillary electrophoresis. In addition, gel electrophoresis may be performed, and depending on the size of the amplification product, agarose gel electrophoresis or acrylamide gel electrophoresis may be used. In addition, for the fluorescence measurement method, when PCR is performed by labeling the 5'-terminus of a primer with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling substance, and the fluorescence thus labeled can be measured using a fluorescence detector. In addition, for the radioactivity measurement method, when performing PCR 32 P or 35 After labeling the amplification product by adding a radioactive isotope such as S to the PCR reaction solution, radioactivity can be measured using a radioactivity measuring instrument, for example, a Geiger counter or a liquid scintillation counter.

[0066]

[0067] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0068]

[0069] Example 1. Breeding process of the new turfgrass variety 'KVX'

[0070] The applied variety 'KVX' of the present invention is a turf plant derived from a selection line of 957 Korean wild grass genetic resources with morphologically distinct low mowing and resistance to low temperatures. It was created by artificial crossbreeding at the Hanul Turf Science Research Institute located at N 35° 01' E 128° 08', Hapcheon, Gyeongsangnam-do, using the Woljeong-ri resource of Zoysia matrella var. pacifica, collected in 2008 at N 33° 14' E 126° 30', Jeju Island at an elevation of 26 m, as the paternal parent, and the Beophwan-dong resource of Zoysia pacifica, collected in the following year at N 33° 55' E 126° 79', Seogwipo as the maternal parent. Since the Woljeong-ri and Beophwan-dong resources did not flower under normal conditions, flower buds were induced using the vernalization technique; however, while the Woljeong-ri resources showed stable stamen expression and pollen development, the Beophwan-dong resources exhibited minimal stamen expression, raising the need to incorporate the superior traits of the Woljeong-ri resources into the new variety.

[0071] Seeds harvested 65 days after crossbreeding were ripened for 30 days and selected using the sorting method to select 100 healthy seeds. As a means to increase the germination rate of turf seeds, which inherently have a low germination rate, the chitin on the surface of the seeds was removed with fine sandpaper (sandpaper # 220) as part of the primary priming process. After softening, the seeds were immersed in distilled water containing 24-Epibrassinolide (MB-E6208-10 mg) at room temperature for 24 hours to prevent mold growth and decay and to promote seed activity. After moisture absorption, dormancy was forcibly broken by a secondary low-temperature treatment at 2.5°C for 30 days while the seeds were sown one seed at a time in trays. When the seeds were placed in a plant growth bed under fluctuating temperature conditions of 24°C to 32°C, humidity of 65%, and light conditions, 86 individuals germinated within 5 to 6 days of sowing.

[0072] S1, which was produced by crossing two resources, underwent morphological characterization to verify genetic segregation and to shorten the intergenerational time range for target trait selection. To this end, Chungnam National University was commissioned to screen repetitive sequences based on the genome sequences of Zoysia japonica, Zoysia macrophylla, Zoysia japonica, and Zoysia japonica, which are based on domestic and international Zoysia species. Subsequently, the SciRoKo program was used to search for and discover repetitive motifs (dimers, trimers, tetramers, etc.) of genome-based SSR markers. SSR information specific to the genetic resource was obtained from the corresponding genome information according to species classification. Primers were designed using the Primer3 program based on information from conserved regions within the flanking regions adjacent to areas with differences in SSR repetitive sequence lengths. After performing amplification reactions using DNA extracted from Korean turfgrass genetic resources to confirm and verify the results for each resource, allele distribution by locus was evaluated through High Resolution Melting (HRM) analysis. We conducted an assessment of the genetic diversity of Korean turfgrass genetic resources to obtain information on genetic resource-specific Single Nucleotide Polymorphisms (SNPs) from the Internal Transcribed Spacer (ITS) regions of each resource. We then searched for SNPs using an SNP detection tool, selected candidates to be used as SNP markers through comparative analysis of the selected SNPs with the wild turfgrass genome, and performed genotyping analysis by converting them into SNP-specific identification PCR markers for verification. By utilizing these digital breeding techniques, we shortened the time interval between generations for target trait selection. Finally, we selected individuals from verified F5 lines that had overcome fundamental genotypic segregation through F4 generation progression close to the target trait, thereby ensuring trait stability.A new turf variety with adaptability to high temperature and high humidity stress climates, selected from a selection line with water-repellent and drainage properties of an isoploid (2n=4X=40) that was propagated from the vegetative body (rhizome) of the finally selected F5 line and subjected to 20 replicate morphological characteristic investigations, was named 'KVX'.

[0073] The Beophwan-dong resource used as the maternal parent and the Woljeong-ri resource used as the paternal parent are among 957 individuals observed at the Hanul Grass Science Research Institute Gene Conservation Center, which have been collected from major wild grass habitats on the Korean Peninsula since 1995.

[0074]

[0075] Example 2. Analysis of Morphological Characteristics of New Turfgrass Variety 'KVX'

[0076] The morphological characteristics of the new Korean turf variety 'KVX' selected in Example 1 above and the control variety, Golden Grass (M45), were tested and observed in the field, and the results are shown in Table 1 below.

[0077]

[0078] In the characteristic survey of 'KVX', it was found that although heading, flowering, and fruiting did not occur in natural conditions, flower bud differentiation occurred in response to a temporary low temperature of about 10℃. This allowed for the induction of heading and flowering through simple artificial vernalization in addition to vegetative propagation, making it possible to harvest seeds through crossbreeding and confirming that propagation by seeds is also possible.

[0079] As can be seen from the table above, the new turf variety 'KVX' has no hairs on the leaf blade and underside, a sparse hair density at the leaf sheath opening, and a low height. In addition, although the new turf variety 'KVX' grows slowly, it has a very soft texture and dense density. It has a root depth similar to bentgrass, which is a golf course green grass species mainly used in temperate to polar climates worldwide. On the other hand, 'KVX' is a variety proven to be climate change-adapting from tropical to temperate climates, with low water requirements and resistance to high temperature and humidity stress. Furthermore, 'KVX' has been tested to be resistant to low mowing, allowing it to provide excellent quality even at low mowing heights comparable to golf course greens.

[0080] In addition to the characteristics mentioned above, the new turf variety 'KVX' is suitable for ornamental or landscaping purposes due to its delicate leaves, ability to grow well even in shade, and excellent texture that does not irritate human skin. Furthermore, by simply adjusting the mowing height appropriately, it can be widely used on golf course greens, tees, and fairways, as well as on sports fields such as soccer, leading to the realization of environmental and economic benefits.

[0081]

[0082] Example 3. Development of a Molecular Marker Specific to the New Turfgrass Variety 'KVX'

[0083] The inventors developed a variety-specific molecular marker to distinguish the new turf variety 'KVX' from other Zoysia grasses. The selection of the molecular marker was carried out through the process shown in Fig. 3, and samples of 'KVX' and Zoysia grass resources were commissioned to Cedars Co., Ltd. for analysis.

[0084] Specifically, genomic DNA was extracted from 'KVX' and Zoysia grass resource samples using the Aprep Total DNA kit (APBIO, Korea), quantified using the nanodrop and qubit quantification methods, and then loaded onto an agarose gel to verify the quality of the genomic DNA. Subsequently, the concentration of genomic DNA was measured using PicoGreen, and a PacBio HiFi library was constructed using samples that passed the QC criteria, followed by NGS analysis.

[0085] As a result of verifying the size distribution for all size QCs using the Femto Pulse System (Aglient) with genomic DNA for PacBio Revio sequencing, it was confirmed that all library insert sizes fell within the optimal range. Megaruptor ® Genomic DNA was sheared using 3 (Diagenode), and a library of at least 10 kb was selected using Blue Pippin (Saga Science). A total of 10 µl of library was prepared using the PacBio SMRTbell prep kit 3.0, and the SMRTbell template was the Revio polymerase kit. Revio sequencing plates and Revio SMRT Cee trays were used for sequencing, and subsequent analysis was performed based on the PacBio sample Net-shared protocol.

[0086] A draft genome was constructed by performing assembly according to the official protocol of the HiFiasm program using Pacbio ling reads, and SSRs were detected in the assembled contig sequences using the MISA (v1.0) program. Reference genome information used was Zoysia japonica (version r1.1), Zoysia matrella (version r1.0), and Zoysia pacifica (version r1.0) (http: / zoysia.kazusa.or.jp).

[0087] Standard genome information used in the present inventionZoysia japonica (version r1.1) Scaffold No.Total length (bp)Min. length(bp)Max. length(bp)Avg. length(bp)N50 length(bp)11,786334,384,4275008,501,89528,3712,370,062Zoysia matrella(version r1.0)Scaffold No.Total length(bp)Min. length(bp)Max. length(bp)Avg. length(bp)N50 length(bp)13,609563,438,5955001,041,50641,401108,897Zoysia pacifica(version r1.0)Scaffold No.Total length(bp)Min. length(bp)Max. length(bp)Avg. length(bp)N50 length(bp)11,428397,009,9575001,506,65234,740111,449

[0088] Sequencing raw data results using Pacbio Revio SampleNo. of readsAvg. length(bp)Total length(bp)N50Avg. read quality'KVX'1,985,07314,15328,096,360,53714,478Q301) N50: 50% of all basescom from HiFi reads linger than this value.2) Avg. read quality: The mean quality of HiFi reads.

[0089] HiFiasm de novo assembly result - draft genomeSampleNo. ofcontigLength (bp) of contigsTotalMin.Max.Avg.N50'KVX'219333,195,51811,30322,711,5271,521,44015,931,937

[0090] To perform a comparative analysis of SSRs between analysis samples, an SSR size matrix was constructed between the comparison samples and the reference sequence based on the 'KVX' draft genome. Based on the SSR regions found in the 'KVX' draft genome sequence, flanking sequences of 20 bp before and after were extracted, and the flanking sequences were subjected to in silico PCR on the comparison sample's draft genome sequence and the reference genome sequence to calculate the size of the preventive SSR. An SSR size matrix between samples was constructed by integrating the predicted SSR sizes for each reference sequence based on the SSR regions found in the 'KVX' draft genome sequence. Multiple SSR regions observed as a result of in silico PCR on the 'KVX' draft genome sequence were excluded from the matrix construction, and cases that did not map to each reference sequence during in silico PCR were indicated as '-' on the matrix.

[0091] Primers were designed targeting SSRs found in the 'KVX' draft genome sequence. Primers satisfying the specified conditions (product size: 250–500 bp, primer size: 18–24 bp, melting temperature: 58–62°C) were designed using the Primer3 (v2.3.5) program, and in silico PCR was performed on the assembled contig sequences of comparison samples to develop common SSR markers between the reference sequence and the 'KVX' samples. For the selection of common SSRs, only cases with identical SSR sizes were selected from the SSR size matrix loci. SSRs with less than 30% missing data in the total samples of the corresponding loci were selected.

[0092] Statistics by reference sequence and sample SSR motif type Motif type Zoysia japonica Zoysia matrella Zoysia pacifica 'KVX' mono-nucleotide 2,905 3,328 2,103 2,660 di-nucleotide 1 2,298 21,412 15,084 12,689 tri-nucleotide 7,453 12,555 8,643 7,390 tetra-nucleotide 2,682 4,608 3,119 2,700 penta-nucleotide 6,150 10,315 7,165 6,041 hexa-nucleotide 2 00,548343,852242,466204,146hepta-nucleotide53,21391,80965,28054,790octa-nucleotide18,70831,92322,47018,97 5nona-nucleotide8,05513,6459,5558,013deca-nucleotide2,6674,5403,2242,652Total314,679537,987379,109320,056

[0093] Table 5 above shows the results by type of SSR motifs (based on the number of repeat bases) identified in the sample genomes and reference genomes, and it was found that the 6 (hexa-) base motif repeat was the most common in most Zoysia genus resources.

[0094] A phylogenetic tree was constructed using the size values ​​of 120 SSR marker products from 96 individuals of Zoysia genus grass. As a result, as disclosed in Figure 5, it was confirmed that the domestically bred new grass variety Senok (an interspecific artificial hybrid of Zoysia sinica and Zoysia matrella) is genetically close to the KM series (Zoysia matrella), the overseas introduced variety Emerald is genetically close to the Semil variety, and the JP-series introduced from the Ryukyu Islands in Japan forms a separate category. Furthermore, it was found that the new variety 'KVX' of the present invention is genetically close to the 'KV1' resource previously filed for plant variety protection by the same inventor. This indicates that the variety 'KVX' of the present invention is a resource bred through crossbreeding and possesses the Zoysia pacifica genotype.

[0095] Among the above Zoysia genus resources, an SSR marker capable of distinguishing the application variety 'KVX' was selected (Table 6). Figure 5 shows the adjacent sequence of the 'KVX' specific SSR marker (Zoysia-081), where the [_] marked part is the SSR motif and the underlined part indicates the position of the primer.

[0096] 'KVX' Breed-Specific SSR Primer Set Marker IDSSR Motif Primer Sequence (5'-3') Sequence Number Zoysia-081(AACAT)4F: GGCGAAGATGAGGATGGTGT1R: ACCCGAAGAGACATGGTGGA2

[0097] As a result of performing PCR using the above 'KVX' specific SSR primer set, as disclosed in Figure 6, a single amplification product of 351 bp was produced for 'KVX', and single amplification products of 346 bp were confirmed for KH (hybrid), KL (Zoysia japonica), KLN (Yalu River collected resource), KLS (Zoysia japonica), KM (Zoysia matrella), KMC (Zoysia matrella), KSS (Zoysia japonica), and Senok, while amplification products of 346 / 351 bp were confirmed for KM45, KM68, C4GREEN (Zoysia matrella var.), Jinji, KM-J, M68, and ZOYGREEN resources, and amplification products of 351 / 356 bp were confirmed for JP (Ryukyu Islands, Japan). Through this, it was found that resources KM45, KM68, C4GREEN, Jinji, KM-J, M68, ZOYGREEN, and JP (Ryukyu Islands, Japan), which contain amplification products of the same size as the applied variety 'KVX' of the present invention, are genetically partially related to 'KVX', and this was considered to reflect that interspecies hybridization of the Zoysia genus occurs frequently in the natural state.

[0098] Based on the above results, it was found that 'KVX' of the present invention is a novel turf resource distinct from existing Zoysia genus resources.

[0099] [Consignment Number]

[0100] Depository Name: Korea Research Institute of Biotechnology and Bioengineering Biological Resource Center (KCTC)

[0101] Trustee Number: KCTC16100BP

[0102] Date of Trust: 20241022

[0103]

Claims

1. A new variety of ultra-fine-leaved silk grass 'KVX' with accession number KCTC16100BP, having the morphological characteristics of (a) to (h) below, resistance to high temperature and humidity stress, low mowing and shade tolerance, and propagating vegetatively by above-ground stolons or rhizomes: (a) The width of the leaf blade is 0.2 to 0.3 mm. (b) The length of the plant body is 36–37 mm. (c) The stem length of young plants is 9–14 mm. (d) The leaf blade length is 31–32 mm. (e) The leaf blade is dull light green. (f) The length of the leaf is 21~22 mm. (g) The width of the leaf is 0.2~0.3 mm. (h) The leaf sheath length is 7~8 mm.

2. Seeds of the new silk grass variety 'KVX' of Paragraph 1.

3. The rhizome of the new silk grass variety 'KVX' of Paragraph 1.

4. Ground stolons of the new silk grass variety 'KVX' of Paragraph 1.

5. A step of transplanting the rhizomes of the new silk grass variety 'KVX' of Paragraph 3 or the above-ground stolons of the new silk grass variety 'KVX' of Paragraph 4 into the soil; and A method for propagating the new variety of silk grass 'KVX', comprising the step of propagating rhizomes or stolons transplanted into the soil.

6. A marker composition for identifying a new variety of Zoysia pacifica 'KVX', comprising a set of SSR (simple sequence repeat) primers consisting of the nucleotide sequences of SEQ ID NOs 1 and 2.

7. Step of isolating genomic DNA from Zoysia sp. grass samples; A step of amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA above as a template and a marker composition according to claim 6; and A method for identifying a new variety of silk grass 'KVX', comprising a step of detecting the product of the amplification step.