Regulatory elements and immune cells
Engineered regulatory sequences with enhancers and promoters address persistence and toxicity issues in CAR-NK cells, enabling controlled and effective cancer treatment by ensuring specific expression of CARs in NK cells.
Patent Information
- Application Number
- PCT/US2025/055624
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-04
- Filing Date
- 2025-11-14
- Publication Date
- 2026-06-11
AI Technical Summary
Existing cell-based immunotherapies, such as CAR-NK cells and HSC gene-engineering, face challenges with persistence and regulatory hurdles, leading to potential toxicity and non-specific gene expression, limiting their effectiveness in cancer treatment.
Development of engineered regulatory sequences comprising enhancers and promoters derived from specific gene regions, linked to heterologous nucleic acids, for targeted expression of chimeric antigen receptors in NK cells, using vectors like retroviral and lentiviral vectors, and CRISPR-mediated insertion into genomic safe harbors for controlled gene delivery.
Enables persistent and specific expression of CARs in NK cells, overcoming persistence and toxicity issues, facilitating robust and long-term cancer treatment by generating self-renewing anti-tumor cells.
Smart Images

Figure US2025055624_11062026_PF_FP_ABST
Abstract
Description
DFCI IP No. 3423.W01WOZ Atty Ref.: 91016-431595REGULATORY ELEMENTS AND IMMUNE CELLSRELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No. 63 / 728,059 filed on December 4, 2024, which is incorporated by reference in its entirety herein.BACKGROUND
[0002] Cell-based immunotherapy has transformed the approach to cancer treatment by using the body’s immune system to attack cancer. Different immune cell types (e.g., natural killer (NK) cells offer an alternative to traditional cell-based immunotherapies (e.g., chimeric antigen receptor (CAR)-T cells); for example, CAR-NK cells have an advantage of being part of the innate immune system but suffer from limitations of persistence. Further, hematopoietic stem cells (HSCs) may be exploited for their self-renewal capacity and lifelong generation of immune cells. HSC gene-engineering and ubiquitous expression of heterologous genes (e.g., CARs) has been reported (See, De Oliveira et al., 2013), but this pan-hematopoietic CAR expression approach has a high risk of toxicity and regulatory hurdles. Moreover, non-specific heterologous gene (e.g., CAR) expression in suppressive immune cells could lead to detrimental pro-tumorigenic effects. Thus, a need exists for robust and persistent cell therapy treatments. Regulatory elements may offer the ability to exploit the self-renewal capacity of HSCs by their selective expression in NK cells for the expression of CARs. Although the regulatory elements described herein are used for the expression of CARs, other payloads are also contemplated herein, including but not limited to, biologically active proteins and peptides for multiple uses.STATEMENT REGARDING SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated by reference in its entirety. Said XML copy, created on October 28, 2024 is named 91016-415452_SeqLising.xml and is 59,000 bytes in size.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595SUMMARY
[0004] In one embodiment described herein is an engineered regulatory sequence, comprising a heterologous nucleic acid sequence of the formula:R1 - R2 or R2 - R1 (Formula I), wherein R1 comprises one or more enhancers derived from: (a) the KIR3DX1 , NCR1 , or KIRDS4 gene intronic region; or (b) the NCR1 and NLRP7 intergenic region; and R2 is a promoter derived from the KIR3DX1 or KIR2DL1 gene; wherein, optionally: (a) (i) R1 and R2 are not linked by a spacer; or (ii) R1 and R2 are linked by a spacer that is 1 -10 base pairs, 1-25 base pairs, 1-50 base pairs, or 1-100 base pairs; and (b) R2 is linked to a minimal promoter sequence.
[0005] In one aspect of the engineered regulatory sequence described herein R1 and R2 are operably linked to a heterologous nucleic acid sequence encoding a chimeric antigen receptor. In another aspect of the engineered regulatory sequence, the orientation of Formula I is R1 - R2. In another aspect (a) R1 comprises SEQ ID NO: 8; and (b) R2 is SEQ ID NO: 7. In another aspect, (a) R1 comprises (i) SEQ ID NO: 11 or SEQ ID NO: 10; or (ii) SEQ ID: 11 ; and (b) R2 is SEQ ID NO: 9. In yet another aspect, (a) R1 comprises SEQ ID NO: 2; and (b) R2 is SEQ ID NO: 1 . In another aspect, (a) R1 comprises SEQ ID NO: 4; and (b) R2 is SEQ ID NO: 3. In another aspect, (a) R1 comprises SEQ ID NO: 5 or SEQ ID NO: 12; and (b) R2 is SEQ ID NO: 6. In one aspect, (a) R1 comprises SEQ ID NO: 5 or SEQ ID NO: 12; and (b) R2 is SEQ ID NO: 7. In another aspect R1 comprises SEQ ID NO: 12. In one aspect, (a) R1 comprises (i) SEQ ID NO: 5 or SEQ ID NO: 12; and (ii) SEQ ID NO: 8; and (b) R2 is SEQ ID NO: 7. In another aspect, (a) R1 comprises (ii) SEQ ID NO: 12; and (i) SEQ ID NO: 8; and (b) R2 is SEQ ID NO: 7.
[0006] In another aspect of the engineered regulatory sequence described herein, Formula I comprises the nucleic acid sequence described herein .
[0007] Another aspect described herein is a vector for delivering the engineered regulatory sequence of described herein, comprising a viral vector. In some aspects, the vector is a viral vector, where the viral vector is a retroviral vector or an adeno-associated virus (AAV) vector. In another aspect, the vector is a lentiviral vector. In another aspect, the lentiviral vector is a self-inactivating (SIN) lentiviral vector.
[0008] Another aspect described herein is a vector for delivering the engineered regulatory sequence described herein, comprising a nonviral vector. In one aspect, the nonviralDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 vector is a Sleeping Beauty (SB) targetable transposon vector. In another aspect, the vector is configured for CRISPR-mediated insertion of the engineered regulatory sequence into a genomic safe harbor (GSH) site. In another aspect, the CRISPR-mediated insertion comprises double-stranded or single-stranded homology directed repair (HDR).
[0009] Another aspect described herein is an autologous hematopoietic stem cell (HSC) transduced with any of the vectors described herein.
[0010] Another aspect described herein is an engineered cell comprising the regulatory elements described herein.
[0011] Another aspect described herein is an engineered NK cell comprising the regulatory elements described herein.
[0012] Another aspect described herein is a pharmaceutical composition comprising the autologous hematopoietic stem cell (HSC) or the engineered cells described herein.
[0013] Another aspect described herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the autologous hematopoietic stem cell (HSC) the engineered cells, or the pharmaceutical composition, described herein.
[0014] Another aspect described herein is the use of the autologous hematopoietic stem cell (HSC) transduced with any of the vectors, or the engineered cells, as described herein, in the manufacture of a medicament for treating a cancer.
[0015] Another aspect described herein a method of generating persistent NK cells in a subject, comprising administering to the subject a therapeutically effective amount of the autologous hematopoietic stem cells described herein.BRIEF DESCRIPTION OF THE FIGURES
[0015] Figure 1A is a schematic of distant regulatory elements in the genome (enhancers and promoter) driving specific gene transcription. Figure 1B is a schematic of a compact assembly of regulatory elements in a 3rd generation lentiviral vector to drive specific expression of a CAR. Figure 1C is a plot describing the size of 231 selected NK-specific elements selected from published ATAC-seq data and the size of 117 assemblies (success of production 117 / 118 assemblies; 99%). Figure 1 D is a diagram of the different assembly types with 1 , 2 or 3 elements associated with a 25-bp minimal promoter Y (YB_TATA). The annotations A, B and C describe the relative position of each element from the minimalDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 promoter Y. Figure 1 E is a plot of the detailed size of each assembly compared to constitutive promoters (EF1 a and CMV) and control scrambled CMV sequences (Pos, position A, B, or C in the assembly as depicted in Figure 1 D). Figure 1F is a plot of the screening results from four independent experiments comparing the activity (GFP expression) of each assembly in NK cells and HSCs. Data were normalized to EF1 a for each cell type. Five assemblies showing the highest expression in NK cells (Y-axis) and highest fold-change compared to HSCs (X-axis) were selected (highlighted in the graph: assemblies #NK014, NK022, NK023, NK052 and NK026).
[0016] Figure 2 describes representative flow cytometry analysis of in vitro NK-specific regulatory element activity in NK cells and HSCs. Human primary NK cells and peripherally mobilized and isolated CD34+cells were transduced with lentiviruses encoding GFP under the control of either no promoter, the constitutive promoters EF1 a or CMV, or the selected regulatory element combinations from the library: NK005, NK022, NK026, or NK080 assemblies. GFP expression, as indicated by the relative geometric MFI of GFP+cells is enumerated. NK005 and NK080, show expression in NK cells but also a similar expression in HSCs with comparable expression are representative of a majority of tested elements or assemblies. Whereas a minority of elements or assemblies, including NK022 and NK026, exhibited preferential expression specific for NK cells. Of note, background HSC expression of GFP for control and NK regulatory assembly candidates is likely to be artificially increased in this in vitro assay by the short-term nature of this approach, proximity to LV transduction, and differences in HSCs in cell culture with required cytokine support vs in vivo results. This difference in vitro is noted vs post-HSC engraftment and hematopoietic differentiation where lower “leakiness” was observed in non-NK cells in vivo (Figure 3).
[0017] Figure 3A is a schematic of the experimental procedure for the testing of in vivo NK-specific promoter activity of the NK022 assembly. Human HSCs were lentivirally transduced with CMV-GFP or NK022-GFP constructs and injected into irradiated (200 Rad) NOG-hlL15 (Taconic Biosciences®, supra-physiologic IL-15) mice (n=3 per group). After five weeks, mice were euthanized, and the bone marrow was harvested for flow cytometry analysis. Figure 3B is a plot of the percentage of GFP+cells in injected HSCs compared to in vivo differentiated NK (CD3- NKp46+), B (CD19+), monocytes (CD14+), T cells (CD3+NKp46-), lineage-negative (Lin-) cells. Quantification in individual mice is shown on the right for CMV and NK022.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595
[0018] Figure 4A is a schematic of the experimental procedure for the testing of in vivo long-term NK-specific promoter activity of the NK022 assembly. Human HSCs were lentivirally transduced with CMV-GFP or NK022-GFP constructs and injected into irradiated (200 Rad) NSG-FLT3-IL15 (The Jackson Laboratory, Strain #:037322, murine Flt3 KO, human FLT3L, physiologic IL-15) mice. After 17 weeks, mice were euthanized, and the bone marrow was harvested for flow cytometry analysis. Figure 4B shows GFP expression in 10 cell types including NK (CD3- CD56+), monocytes (Mono, CD14+), B cells (CD19+), T cells (CD3+CD56- CD8+[T8] or CD4+[T4]), conventional (eDC, Lin" CD34“ c-Kit" HLA-DR+CD16“ CD11c+CD123") and plasmacytoid (pDC, Lin" CD34- CD117" HLA-DR+CD16" CD11c- CD123+) dendritic cells, basophils (Baso, Lin- CD34- CD117- HLA-DR- CD16" CD123+), HSC (Lin- CD34+c-Kit+), granulocytes (neutrophils-eosinophils [Neu-Eos], SSChigh, CD66b+). Representative mice for CMV-GFP (top) and NK022-GFP (bottom) show NK-specific activity of NK022 assembly compared to the ubiquitous activity of CMV.
[0019] Figure 5A describes the NK-specific promoters driving anti-BCMA CAR expression and function in NK cells in vitro with the flow cytometry analysis of BCMA CAR Ciltacabtagene autoleucel (Cilta-cel) / Carvykti® expression in primary NK cells detected using an Alexa Fluor™ 647-conjugated recombinant BCMA protein (R&D Systems / Biotechne, AFR193-020). NK cells were lentivirally transduced using CMV, NK022 or NK026 promoters to drive CAR expression. Figure 5B is a plot of the cytotoxicity assay using the BCMA- expressing multiple myeloma cell line OPM-2 modified to express GFP. Mock or transduced NK cells were combined in a 1 :1 ratio with OPM-2-GFP cells and the relative number of tumor cells (GFP+) was measured every 3 hours over 48 hours using the Incucyte® system.
[0020] Figure 6 describes the NK-specific promoter optimization through element combination. Five single elements (presumably, two promoter regions [26A and 23B] and three enhancer regions) selected from the NK-specific promoter assay were rearranged in 25 combinations (NK119-NK143) including one, two or three elements, cloned upstream the minimal promoter YB_TATA. Figure 6A shows assay results from one representative experiment comparing the activity (GFP expression) of each assembly in NK, HSCs, CD8+(T8) and CD4+(T4) T cells. Data were normalized to EF1a for each cell type. Figure 6B are plots of the expression measured in NK cells (Y-axis) and fold-change expression (X-axis) comparing NK to HSCs, T8 or T4 (left, middle and right panels, respectively). The dashedDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 lines indicate the position of the NK026 assembly assessed in the same experiment for each comparison.
[0021] Figure 7A is a schematic of the experimental procedure for the testing of in vivo long-term NK-specific promoter activity of the NK132 assembly. Human HSCs were lentivirally transduced with NK132-CAR (NK132 assembly driving expression of the BCMA- specific CAR from Ciltacabtagene autoleucel (Cilta-cel) Carvykti®) or CMV-GFP (control for ubiquitous GFP expression from CMV) constructs. Cells were then mixed at a 1 :1 ratio and co-injected into irradiated (200 Rad) NSG-FLT3-IL15 (The Jackson Laboratory, Strain #:037322, murine Flt3 KO, human FLT3L, physiologic IL-15) mice. Figure 7B shows flow cytometry analysis of GFP and CAR expression (detected using an Alexa Fluor™ 647- conjugated recombinant BCMA protein (R&D Systems / Biotechne, AFR193-020)) in the blood harvested 12 weeks post-HSC injection (representing concatenated data from 9 individual mice), demonstrating strong NK-specific CAR expression driven by NK132 (compared to monocytes [Mono], B cells, CD8+[T8] or CD4+[T4] T cells) and contrasting with ubiquitous GFP expression driven from CMV.
[0022] Figure 8A describes the NK-specific promoters driving anti-BCMA CAR expression and function in NK cells in vitro with the flow cytometry analysis of BCMA CAR Ciltacabtagene autoleucel (Cilta-cel) Carvykti® expression in primary NK cells detected using an Alexa Fluor™ 647 -conjugated recombinant BCMA protein (R&D Systems / Biotechne, AFR193-020). NK cells were lentivirally transduced using CMV, NK022 or NK132 promoters to drive CAR expression. Figure 8B is a plot of the cytotoxicity assay using the BCMA-expressing multiple myeloma cell line OPM-2 modified to express GFP. Untransduced (Mock) or transduced NK cells were combined in a 1 :1 ratio with OPM-2-GFP cells and the relative number of tumor cells (GFP+) was measured every 3 hours over 48 hours using the Incucyte® system.
[0023] Figure 9A is a schematic of the experimental procedure for the testing of in vivo long-term anti-tumor efficacy of HSCs modified with NK022 or the optimized NK132 assembly controlling anti-BCMA CAR expression from Ciltacabtagene autoleucel (Cilta-cel) Carvykti®, upon NK cell differentiation. Human HSCs were either untransduced or lentivirally transduced with NK022-CAR or NK132-CAR constructs and injected into irradiated (200 Rad) NSG-FLT3-IL15 (The Jackson Laboratory, Strain #:037322, murine Flt3 KO, human FLT3L, physiologic IL-15) mice (5-9 mice per group). After 56 days (8 weeks), the mice wereDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 injected (i.v.) with the BCMA-expressing multiple myeloma cell line OPM-2 modified to express GFP fused to red italics firefly luciferase (GFP-FLuc). Figure 9B is a representative flow cytometry analysis of the blood of a NK132-CAR mouse at the time of tumor injection confirming strong CAR expression in NK compared to other subsets. Note that T cells are absent at this time and usually only appear from 12 weeks post-HSC in this model. Figure 9C is a quantification of human cell engraftment (left, similar across groups) and the percentage of CAR+in NK cells (right, highest percentage observed in NK132 mice). Figure 9D is a quantification of tumor growth measured by total body bioluminescence (top, upon injection of D-Luciferin) 100 days (14 weeks) post-HSC (6 weeks post-tumor) and mouse survival (bottom).
[0024] Figure 10 is Table A, describing sequences for the elements described herein.
[0025] Figure 11 is Table B, describing sequences for the assemblies described herein.
[0026] Figure 12 is Table C, describing sequences for the new combined assemblies described herein.DETAILED DESCRIPTION
[0027] NK cell populations require extensive cellular expansion to provide meaningful clinical impact for use as CAR-NK cell therapies. The ability of hematopoietic stem cells (HSCs) to self-renew and differentiate into multiple cell types makes them an attractive source for such therapies. The present disclosure thus describes engineered regulatory elements for use in HSCs that lead to cell type-specific expression in differentiated NK cells. This cell type-specific control of transgene expression achieves self-renewing HSC-based cellular immunotherapy, enabled to renew constantly, generating anti-tumor CAR-NK cells, and overcoming the challenges of persistence in cell therapy.
[0028] As used herein, the articles "a," "an," and "the" are used herein to refer to one or to more than one (i.e. , to at least one) of the grammatical object of the article. By way of example, "an element" can mean one element or more than one element.
[0029] As used herein, the term "about" or "approximately" refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 % to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In some embodiments,DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 the terms "about" or "approximately" when preceding a numerical value indicates the value plus or minus a range of 10%, 5%, or 1 %.
[0030] “Administering” is referred to herein as providing one or more compositions described herein to a patient or a subject. By way of example and not limitation, composition administration, e.g., injection, may be performed by intravenous (i.v.) injection, subcutaneous (s.c.) injection, intradermal (i.d.) injection, intraperitoneal (i.p.) injection, or intramuscular (i.m.) injection. One or more such routes may be employed. Parenteral administration may be, for example, by bolus injection or by gradual perfusion over time. Alternatively, or concurrently, administration may be by the oral route. Additionally, administration may also be by surgical deposition of a bolus or pellet of cells, or positioning of a medical device. In an embodiment, a composition of the present disclosure may comprise engineered cells or host cells expressing nucleic acid sequences described herein, or a vector comprising at least one nucleic acid sequence described herein, in an amount that is effective to treat or prevent inflammatory or autoimmune disease. A pharmaceutical composition may comprise a target cell population as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
[0031] As used herein, “nucleic acid” refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double and single stranded DNA, triplex DNA, as well as double and single stranded RNA. It also includes modified forms, for example, by methylation and / or by capping, and unmodified forms of the polynucleotide. The term is also meant to include molecules that include non-naturally occurring or synthetic nucleotides as well as nucleotide analogs. Thus, while all sequences described herein are shown as DNA sequences, the corresponding RNA sequence is contemplated by the same sequence.
[0032] Unless otherwise stated, nucleic acid sequences in the text of this specification are given, when read from left to right, in the 5' to 3' direction.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595
[0033] As used herein, the term “sequence identity” in the context of two nucleic acid sequences or amino acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math., 2:482 (1981 ); by the alignment algorithm of Needleman and Wunsch, J Mai. Biol., 48:443 (1970); by the search for similarity method of Pearson and Lipman, Proc. Nat. Acad Sci US. A., 85:2444 (1988); by computerized implementations of these algorithms (including, but not limited to CLUSTAL in the PC / Gene program by Intelligentics, Mountain View Calif, GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., U.S.A.); the CLUSTAL program is well described by Higgins and Sharp, Gene, 73:237-244 (1988) and Higgins and Sharp, CABIOS, 5:151 -153 (1989); Corpet et al., Nucleic Acids Res., 16:10881-10890 (1988); Huang et al., Computer Applications in the Biosciences, 8:155-165 (1992); and Pearson et al., Methods in Molecular Biology, 24:307-331 (1994). Alignment is also often performed by inspection and manual alignment.
[0034] The terms “identical” and its grammatical equivalents as used herein or “sequence identity” in the context of two nucleic acid sequences or amino acid sequences of polypeptides refer to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window. A “comparison window”, as used herein, refers to a segment of at least about 20 contiguous positions, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are aligned optimally. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math., 2:482 (1981 ); by the alignment algorithm of Needleman and Wunsch, J. Mol. Biol., 48:443 (1970); by the search for similarity method of Pearson and Lipman, Proc. Nat. Acad. Sci U.S.A., 85:2444 (1988); by computerized implementations of these algorithms (including, but not limited to CLUSTAL in the PC / Gene program by Intelligentics, Mountain View Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics ComputerDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595Group (GCG), 575 Science Dr., Madison, Wis., U.S.A.); the CLUSTAL program is well described by Higgins and Sharp, Gene, 73:237-244 (1988) and Higgins and Sharp, CABIOS, 5:151-153 (1989); Corpet et al., Nucleic Acids Res., 16:10881 -10890 (1988); Huang et al., Computer Applications in the Biosciences, 8:155-165 (1992); and Pearson et al., Methods in Molecular Biology, 24:307-331 (1994). Alignment may also be performed by inspection and manual alignment. In one class of embodiments, the polypeptides herein are at least 80%, 85%, 90%, 98% 99% or 100% identical to a reference polypeptide, or a fragment thereof, e.g., as measured by BLASTP (or CLUSTAL, or any other available alignment software) using default parameters. Similarly, nucleic acids may also be described with reference to a starting nucleic acid, e.g., they may be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100% identical to a reference nucleic acid or a fragment thereof, e.g., as measured by BLASTN (or CLUSTAL, or any other available alignment software) using default parameters. When one molecule is said to have certain percentage of sequence identity with a larger molecule, it means that when the two molecules are optimally aligned, the percentage of residues in the smaller molecule finds a match residue in the larger molecule in accordance with the order by which the two molecules are optimally aligned.
[0035] The term “substantially identical” and its grammatical equivalents as applied to nucleic acid or amino acid sequences mean that a nucleic acid or amino acid sequence comprises a sequence that has at least 95% sequence identity with a reference sequence using the programs described above, e.g., BLAST, using standard parameters. For example, the BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11 , an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1992)). Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions ( / .e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparisonDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 and multiplying the result by 100 to yield the percentage of sequence identity. In some embodiments, the substantial identity exists over a region of the sequences that is at least about 50 residues in length, over a region of at least about 100 residues, and in some embodiments, the sequences are substantially identical over at least about 150 residues. In some embodiments, the sequences are substantially identical over the entire length of the coding regions.
[0036] “Homology” is generally inferred from sequence identity between two or more nucleic acids or proteins (or sequences thereof). The precise percentage of identity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence identity is routinely used to establish homology. Higher levels of sequence identity, e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more may also be used to establish homology. Methods for determining sequence identity percentages (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available. Nucleic acids and / or nucleic acid sequences are “homologous” when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Proteins and / or protein sequences are “homologous” when their encoding DNAs are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. The homologous molecules may be termed “homologs.” For example, any naturally occurring proteins may be modified by any available mutagenesis method. When expressed, this mutagenized nucleic acid encodes a polypeptide that is homologous to the protein encoded by the original nucleic acid.
[0037] As will be appreciated by the skilled practitioner, slight changes in nucleic acid sequence do not necessarily alter the amino acid sequence of the encoded polypeptide. This disclosure embraces the degeneracy of codon usage as would be understood by one of ordinary skill in the art. For example, as known in the art, different codons will code for the same amino acid.
[0038] Additionally, it will be appreciated by persons skilled in the art that partial sequences often work as effectively as full-length versions. The ways in which the nucleotide sequence may be varied or shortened are well known to persons skilled in the art, as are ways of testing the suitability or effectiveness of the altered genes. In certain embodiments, suitability and / or effectiveness of the altered gene may easily be tested by, for example,DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 conventional gas chromatography. All such variations of the genes are therefore included as part of the present disclosure.
[0039] The term “isolated” and its grammatical equivalents as used herein refer to the removal of a nucleic acid from its natural environment. The term “purified” and its grammatical equivalents as used herein refer to a molecule or composition, whether removed from nature (including genomic DNA and mRNA) or synthesized (including cDNA) and / or amplified under laboratory conditions, that has been increased in purity, wherein “purity” is a relative term, not “absolute purity.” It is to be understood, however, that nucleic acids and proteins may be formulated with diluents or adjuvants and still for practical purposes be isolated. For example, nucleic acids typically are mixed with an acceptable carrier or diluent when used for introduction into cells. The term “substantially purified” and its grammatical equivalents as used herein refer to a nucleic acid sequence, polypeptide, protein or other compound which is essentially free, i.e., is more than about 50% free of, more than about 70% free of, more than about 90% free of, the polynucleotides, proteins, polypeptides and other molecules that the nucleic acid, polypeptide, protein or other compound is naturally associated with.
[0040] An “expression vector” or “vector” is any genetic element, e.g., a plasmid, a minicircle, a nanoplasmid, chromosome, virus, transposon, behaving either as an autonomous unit of polynucleotide replication within a cell. (i.e. capable of replication under its own control) or being rendered capable of replication by insertion into a host cell chromosome, having attached to it another polynucleotide segment, so as to bring about the replication and / or expression of the attached segment. Suitable vectors include, but are not limited to, plasmids, transposons, bacteriophages and cosmids. Vectors may contain polynucleotide sequences which are necessary to effect ligation or insertion of the vector into a desired host cell and to effect the expression of the attached segment. Such sequences differ depending on the host organism; they include promoter sequences to effect transcription, enhancer sequences to increase transcription, ribosomal binding site sequences and transcription and translation termination sequences. Alternatively, expression vectors may be capable of directly expressing nucleic acid sequence products encoded therein without ligation or integration of the vector into host cell DNA sequences. In some embodiments, the vector is an “episomal expression vector” or “episome,” which is able to replicate in a host cell, and persists as an extrachromosomal segment of DNA within the host cell in the presence of appropriate selective pressure (see, e.g., Conese et al., Gene Therapy, 11 :1735-1742 (2004)).DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595Representative commercially available episomal expression vectors include, but are not limited to, episomal plasmids that utilize Epstein Barr Nuclear Antigen 1 (EBNA1 ) and the Epstein Barr Virus (EBV) origin of replication (oriP). The vectors pREP4, pCEP4, pREP7, and pcDNA3.1 from Invitrogen (Carlsbad, Calif.) and pBK-CMV from Stratagene (La Jolla, Calif.) represent non-limiting examples of an episomal vector that uses T-antigen and the SV40 origin of replication in lieu of EBNA1 and oriP. Vector also may comprise a selectable marker gene.
[0041] The term “coding sequence” as used herein refers to a segment of a polynucleotide that encodes for protein or polypeptide. The region or sequence is bounded nearer the 5’ end by a start codon and nearer the 3’ end with a stop codon. Coding sequences may also be referred to as open reading frames.
[0042] The term “operably linked” as used herein refers to refers to the physical and / or functional linkage of a DNA segment to another DNA segment in such a way as to allow the segments to function in their intended manners. A DNA sequence encoding a gene product is operably linked to a regulatory sequence when it is linked to the regulatory sequence, such as, for example, promoters, enhancers and / or silencers, in a manner, which allows modulation of transcription of the DNA sequence, directly or indirectly. For example, a DNA sequence is operably linked to a promoter when it is ligated to the promoter downstream with respect to the transcription initiation site of the promoter, in the correct reading frame with respect to the transcription initiation site and allows transcription elongation to proceed through the DNA sequence. An enhancer or silencer is operably linked to a DNA sequence coding for a gene product when it is ligated to the DNA sequence in such a manner as to increase or decrease, respectively, the transcription of the DNA sequence. Enhancers and silencers may be located upstream, downstream or embedded within the coding regions of the DNA sequence. A DNA for a signal sequence is operably linked to DNA coding for a polypeptide if the signal sequence is expressed as a pre-protein that participates in the secretion of the polypeptide. Linkage of DNA sequences to regulatory sequences is typically accomplished by ligation at suitable restriction sites or via adapters or linkers inserted in the sequence using restriction endonucleases known to one of skill in the art.
[0043] The term “induce”, “induction” and its grammatical equivalents as used herein refer to an increase in nucleic acid sequence transcription, promoter activity and / or expression brought about by a transcriptional regulator, relative to some basal level of transcription.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595
[0044] The term “ regulatory element” refers to a biochemical element that acts to prevent or inhibit the transcription of a promoter-driven DNA sequence under certain environmental conditions (e.g., a repressor or nuclear inhibitory protein), or to permit or stimulate the transcription of the promoter-driven DNA sequence under certain environmental conditions (e.g., an inducer or an enhancer). In one aspect, the regulatory element may be a promoter sequence. In other aspects, the regulatory sequence may be an enhancer sequence.
[0045] The term “enhancer” as used herein, refers to a DNA sequence that increases transcription of, for example, a nucleic acid sequence to which it is operably linked. Enhancers may be located many kilobases away from the coding region of the nucleic acid sequence or close to the coding region, and may mediate the binding of regulatory factors, patterns of DNA methylation, or changes in DNA structure.
[0046] A large number of enhancers from a variety of different sources are well known in the art and are available as or within cloned polynucleotides. For example, enhancers may be derived from a variety of suitable genes, and from within any areas of the genes including exons, introns or intergenic regions. Exemplary genes / pseudogenes include, but are not limited to, KIR3DX1 , NCR1 , KIR2DS4, NCR1-NLRP7. A number of polynucleotides comprising promoters (such as the commonly-used CMV promoter) also comprise enhancer sequences. Enhancers may be located upstream, within, or downstream of coding sequences.
[0047] The term “promoter” refers to a region of a polynucleotide that initiates transcription of a coding sequence. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 5’ region of the sense strand). Some promoters are constitutive as they are active in all circumstances in the cell, while others are regulated becoming active in response to specific stimuli, e.g., an inducible promoter. The term “promoter activity” and its grammatical equivalents as used herein refer to the extent of expression of nucleotide sequence that is operably linked to the promoter whose activity is being measured. Promoter activity may be measured directly by determining the amount of RNA transcript produced, for example by Northern blot analysis or indirectly by determining the amount of product coded for by the linked nucleic acid sequence, such as a reporter nucleic acid sequence linked to the promoter. As used herein “minimal promoter sequence” refers to a short DNA sequence from a promoter that may form the initiation complex forDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 transcription when combined with additional regulatory elements. Promoters may be derived from a variety of any suitable genes, including but not limited to: KIR3DX1 or KIR2DL1.
[0048] In some aspects, the regulatory sequence described herein may comprise one or more promoter sequence and / or one or more enhancer sequence. In other aspects, the promoter may be a minimal promoter. Any combination of promoter and / or enhancer sequences described herein is contemplated.
[0049] The term “assemblies” refers to various structures or combinations of one or more enhancer and / or promoter regulatory elements in a given construct. In some aspects, spacers may be used to link the one or more enhancer sequence with one or more promoter sequences. Spacers may be comprised of non-coding nucleotide base pairs having a length of between about 1 to 500 base pairs; about 1 to 250 base pairs; about 1 to 100 base pairs; about 1 to 50 base pairs; about 1 to 25 base pairs; or about 1 to 10 base pairs. In some aspects, spacers may be positioned after the assembly within the nucleic acid sequence, but before the start codon part of the 5’ UTR. In other aspects, no spacers are used to link the enhancer or promoter. Exemplary elements and assembly sequences are described in Figures 6 - 8, Tables A - C.
[0050] As used herein the term “persistence” refers to the ability of a chimeric antigen receptor (CAR) cell to remain in the body after being infused.
[0051] The terms “transfection,” “transformation,” “nucleofection,” or “transduction” as used herein refer to the introduction of one or more exogenous polynucleotides into a host cell or organism by using physical, chemical, and / or electrical methods. The nucleic acid sequences and vectors disclosed herein may be introduced into a cell or organism by any such methods, including, for example, by electroporation, calcium phosphate coprecipitation, strontium phosphate DNA co-precipitation, liposome mediated-transfection, DEAE dextran mediated-transfection, polycationic mediated-transfection, tungsten particle- facilitated microparticle bombardment, viral, and / or non-viral mediated transfection. In some cases, the method of introducing nucleic acids into the cell or organism involve the use of viral, retroviral, lentiviral, or transposon, or transposable element-mediated (e.g., Sleeping Beauty) vectors.
[0052] As used herein, "an effective amount" refers to an amount that causes relief of symptoms of a disorder or disease as noted through clinical testing and evaluation, patient observation, and / or the like. An "effective amount" may further designate a dose that causesDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 a detectable change in biological or chemical activity. The detectable changes may be detected and / or further quantified by one skilled in the art for the relevant mechanism or process. Moreover, an "effective amount" may designate an amount that maintains a desired physiological state, i.e., reduces or prevents significant decline and / or promotes improvement in the condition of interest. An "effective amount" may further refer to a “therapeutically effective amount”.
[0053] As used herein, the term "individual" and "subject" are often used interchangeably and refer to any human or domestic animal that may be treated with the methods disclosed herein. Suitable subjects (e.g., patients) include humans and domestic animals or pets (such as a cat or dog). Non-human primates and human patients are included. In one embodiment, subjects may include human patients that have been diagnosed with cancer, such as a hematological cancer, including but not limited to: leukemia or multiple myeloma, or solid tumor cancers such as breast, lung or colorectal cancer. As used herein, the term "patient" refers to a subject that may receive a treatment of a disease or condition.
[0054] As used herein, "treatment", "treat", and "treating" refer to reversing, alleviating, mitigating, or slowing the progression of, or inhibiting the progress of, a disorder or disease or symptoms associated with such disorder or disease, and as described in more detail herein.
[0055] The term “viral vector” as used herein may refer either to a virus or viral particle capable of transferring a nucleic acid into a cell or to the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements that are primarily derived from a virus. The term “retroviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, that are primarily derived from a retrovirus. The term “lentiviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, including LTRs that are primarily derived from a lentivirus. The term “hybrid vector” refers to a vector, LTR or other nucleic acid containing both retroviral, e.g., lentiviral, sequences and non-retroviral viral sequences. In one embodiment, a hybrid vector refers to a vector or transfer plasmid comprising retroviral e.g., lentiviral, sequences for reverse transcription, replication, integration and / or packaging.
[0056] Viral vectors may be used as delivery vehicles for nucleic acids encoding therapeutic molecules, while also avoiding immune-surveillance by host cells, and thusDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 provide a suitable delivery and expression vehicle for proteins, including chimeric antigen receptors. Retrovirus, adenovirus, adeno-associated virus (AAV) and lentivirus have all been adapted for viral vector applications (Robbins et al., 1998 and Milone et al., 2018). In particular, self-inactivating lentiviral vectors may be used to introduce genes in HSCs and T cells. Introduction of deletions into the 3’ LTR of the viral genome creates self-inactivating (SIN) lentiviral vectors to further enhance the safety profile of these vectors. Thus, viral vectors may be replication-defective from the deletion of essential viral genes that are replaced with expressions cassettes comprising a foreign therapeutic gene. As used herein the term “expression cassette” means a distinct component of vector DNA consisting of a gene and regulatory sequence to be expressed by a transfected cell. Such vectors have been demonstrated to be safe and have therapeutic activity, and may be used for gene therapy, vaccines, and cancer therapy applications (Wold et al., 2013). Thus, in one aspect described herein is a vector for delivering an engineered regulatory sequence, comprising a viral vector. The viral vector may be a retroviral vector or an adeno-associated vector. In one aspect, the retroviral vector is a lentiviral vector. In another aspect, the lentiviral vector is a selfinactivating (SIN) lentiviral vector comprising the engineered regulatory sequences described herein.
[0057] In other aspects, the vector may be a “non-viral vector” that delivers genetic material to target cells without the use of a virus and instead use a physical or chemical means for delivery of genetic material. Exemplary non-viral vectors include electroporation lipid nanoparticles, or sleeping beauty transposons. Sleeping Beauty transposon systems use a DNA transposon to perform gene transfers. In some embodiments, the regulatory sequences described herein may be delivered with a non-viral vector. In some aspects the non-viral vector is Sleeping Beauty (SB) targetable transposon vector.
[0058] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1 , 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
[0059] Hematopoietic stem cells (HSCs) may be exploited for their self-renewal capacity and life-long generation of immune cells. HSC gene-engineering and ubiquitous NK-CAR expression may address the need for continued persistence of NK-CAR expression whileDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 providing a cell-type specific control of transgene expression. Thus, described herein are unique DNA regulatory elements engineered into HSCs and that lead to cell-type specific expression in differentiated NK cells. Thus, one embodiment described herein is an engineered regulatory sequence comprising a heterologous nucleic acid, HSCs transduced with such regulatory sequences and NK cells generated from such HSCs and methods of use comprising such engineered regulatory sequences, HSCs and NK cells.
[0060] Another embodiment described herein is an engineered regulatory sequence, comprising a heterologous nucleic acid of Formula (I):R1 - R2 or R2 - R1 (Formula I) wherein R1 comprises one or more enhancers derived from:(a) the KIR3DX1 , NCR1 , or KIR2DS4 gene intronic region; or(b) the NCR1 and NLRP7 intergenic region; andR2 is a promoter derived from KIR3DX2 or KIR2DL1 gene; and wherein, optionally(a) (i) R1 and R2 are not linked by a spacer; or(ii) R1 and R2 are linked by a spacer that is 1 - 10 base pairs, 1 - 25 base pairs, 1 - 50 base pairs, or 1 - 100 base pairs; andR2 is linked to a minimal promoter sequence.
[0061] R1 and R2 may be oriented before or after each from left to right in any given construct, including R1 - R2 or R2 - R1. In some aspects of the engineered regulatory sequences described herein, the orientation of Formula I is R1 - R2. In other aspects, the orientation of Formula I is R2 - R1 .
[0062] In one aspect of the engineered regulatory sequences described herein, R1 and R2 are operably linked to a heterologous nucleic acid encoding a therapeutic protein. Any suitable therapeutic protein of interest is contemplated herein. In other aspects of the engineered regulatory sequences described herein, R1 and R2 are operably linked to a heterologous nucleic acid encoding a chimeric antigen receptor (CAR). The CAR may be specific for any suitable target, including cancer antigens.
[0063] In another aspect of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 8. In other aspects of the engineered regulatory sequences described herein R2 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595ID NO: 7. In yet another aspect of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 8 and R2 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 7.
[0064] In another aspect of the engineered regulatory sequences described herein R1 comprises one or more enhancer sequences where any orientation of the enhancer sequences with respect to each other may be contemplated herein. Thus, if there are two enhancer sequences, a 1stenhancer and a 2ndenhancer, the left to right orientation of the enhancers in the construct may be 1stenhancer - 2ndenhancer or 2ndenhancer - 1stenhancer.
[0065] In other aspects of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 11. In some aspects of the engineered regulatory sequences described herein R1 comprises a first nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 11 or a second nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 10, where the orientation of the enhancers left to right in any construct is SEQ ID NO: 11 - SEQ ID NO: 10, or SEQ ID NO: 10 - SEQ ID NO: 11 . In yet another aspect of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 11 , or R1 comprises a first nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 11 and a second nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 10, and R2 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 9.
[0066] In another aspect of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 2, and R2 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 1.
[0067] In other aspects of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 4, and R2 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 3.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595
[0068] In some aspects of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 5. In other aspects, R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID No: 12. In other aspects, R1 comprises a first nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID No: 5 and a second nucleic acid sequence of SEQ ID NO: 12, where the orientation of the enhancers left to right in any construct is SEQ ID NO: 5 - SEQ ID NO: 12, or SEQ ID NO: 12 - SEQ ID NO: 5.
[0069] In yet another aspect of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 5, or R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 12, and R2 comprises a nucleic acid sequence of SEQ ID NO: 6.
[0070] In other aspects of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 5, or R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 12, and R2 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 7.
[0071] In other aspects of the engineered regulatory sequences described herein R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 12, or R1 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 12, and R2 comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to SEQ ID NO: 8.
[0072] In another aspect of the engineered regulatory sequences of Formula I comprises a nucleic acid sequence having at least about 90%, 95%, or 100% identity to any one of SEQ ID Nos: 13 - 42.
[0073] Other aspects described herein are vectors for delivering the engineered regulatory sequences of the present disclosure, wherein the vector comprises a viral vector. In some aspects, the viral vector is a retroviral vector or an adenovirus associated (AAV) vector. In other aspects the retroviral vector is a lentivirus vector. In some aspects, the lentivirus vector is a self-inactivating (SIN) lentiviral vector comprising any of the engineered regulatory sequences described herein.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595
[0074] In other aspects the vectors are non-viral vectors for delivering the engineered regulatory sequences described herein. In some aspects the non-viral vector is a Sleeping Beauty (SB) targetable transposon.
[0075] The vectors described herein may be used for delivery of genetic material. In other aspects, the vectors may also be used for delivery by “gene editing agents”, including but not limited to CRISPR / Cas9, zinc-finger nucleases (SFNs), transcription activator-like effector nucleases (TALENs), base editors (BEs) and prime editors (PEs), but any gene editing agents are contemplated for use herein. Such gene editing agents may mediate the insertion of the engineered regulatory sequences described herein into any genomic safe harbor (GSH sites). Thus, in another aspect, the vector may be configured for CRISPR-mediated insertion of the engineered regulatory sequences described herein into GSH sites. In some aspects, the CRISPR-mediated insertion comprises double stranded or single-stranded homology directed repair (HDR).
[0076] Any of the engineered regulatory elements described herein and a CAR may be used to achieve the desired pharmacological effect by administration to a patient in need thereof in an appropriately formulated pharmaceutical composition. A patient, for the purpose of this disclosure, is a domestic animal or a human, in need of treatment for a particular condition or disease. Therefore, also disclosed herein are pharmaceutical compositions comprising any of the nucleic acids encoding any of the engineered regulatory elements described herein and a pharmaceutically acceptable carrier, diluent, or excipient.
[0077] By “pharmaceutically acceptable” it is meant the carrier, diluent or excipient must be compatible with the other ingredients of the formulation, including nucleic acids encoding immune cell engagers, and not deleterious to the recipient thereof. A “pharmaceutically acceptable carrier” is any carrier which is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient (e.g., a nucleic acid encoding the engineered regulatory elements and a CAR) so that any side effects ascribable to the carrier do not impair the beneficial effects of the active ingredient.
[0078] Appropriate pharmaceutical compositions comprising the nucleic acids encoding the engineered regulatory elements and a CAR are contemplated herein, and are based partly on the specific tissues, and cell types involved. Pharmaceutical compositions appropriate for nucleic acids encoding the engineered regulatory elements and a CAR of the instant disclosure may be thus be formulated according to any means known in the art. (SeeDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 for example: Remington's Pharmaceutical Sciences, 15th Edition, chapter 33; Gagliardi et al., 2021 ; or Hammond et al., 2021 ).
[0079] Another aspect of the present disclosure includes autologous hematopoietic stem cells (HSCs) transduced with the vectors described herein. In other aspects described herein are the use of autologous hematopoietic stem cells (HSCs) transduced with the vectors described herein in the manufacture of a medicament for treatment of a disease. Thus, pharmaceutical compositions may comprise autologous HSCs transduced with the vectors described herein. In some aspects the engineered autologous HSCs are administered intravenously, intra-arterially, intra-tumorally, subcutaneously, via intraperitoneal administration, or continual administration via infusion.
[0080] Another aspect described herein is an engineered cell comprising the regulatory elements described herein. Engineered cells may include any suitable cell, including immune cells, such as for example, T cells or NK cells. In another aspect is an engineered NK cell comprising the regulatory elements described herein.
[0081] The pharmaceutical compositions of the present disclosure may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the active ingredient (e.g., nucleic acids encoding the engineered regulatory elements and a CAR) into association with an HSC via transduction or gene editing of the vector carrying the nucleic acid construct.
[0082] In the pharmaceutical composition, the engineered HSCs are sufficient to produce the desired effect upon the process or condition of diseases, i.e., differentiation into a NK cell expressing the CAR construct. Thus, another aspect of the present disclosure is a method of generating persistent NK cells in a subject in need thereof, comprising transducing autologous hematopoietic stem cells (HSCs) with a vector encoding the engineered regulatory elements and a CAR, administering the HSCs to the subject, wherein the HSCs differentiate into an NK cell expressing the CAR.
[0083] Also described herein is a method of treating a cancer in a patient in need thereof. Another aspect described herein is a method of treating cancer in a patient in need thereof comprises administering to the patient an effective amount of HSCs transfected with the vectors described herein, encoding the engineered regulatory elements and a CAR as described herein. Another aspect described herein is a method of treating cancer in a patientDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 in need thereof comprises administering to the patient an effective amount of NK cells expressing the CARs as described herein.
[0084] The present disclosure provides an engineered HSC, an engineered NK cell, as described herein, or a pharmaceutical composition thereof, for use in therapy. The present disclosure provides an engineered HSC, an engineered NK cell, as described herein, or a pharmaceutically composition thereof, for use in the treatment of cancer. The present disclosure also provides an engineered HSC, an engineered NK cell, as described herein, or a pharmaceutical composition thereof, for use in therapy, and in particular for treating cancer. In other aspects, the present disclosure provides the use of an engineered HSC, an engineered NK cell, as described herein, or a pharmaceutical composition thereof in the manufacture of a medicament for treating cancer. In some aspects, the engineered HSC cell is transduced with the vectors described herein, wherein the vector encodes the engineered regulatory elements. In other aspects the vector further encodes a CAR. In some aspects the engineered NK cell comprises the regulatory elements described herein. In other aspects, the NK cell further comprises a CAR.
[0085] In some aspects, the present disclosure provides a pharmaceutical composition for use in the treatment of cancer, comprising an engineered HSC as or an engineered NK cell as described herein. The present disclosure provides a pharmaceutical composition for use in the treatment of a cancer, comprising a compound an engineered HSC as or an engineered NK cell as described herein.
[0086] The compositions, methods and uses provided herein may be used in treating a variety of cancers, including blood cancers and solid tumor cancers. Exemplary solid tumor cancers include but are not limited to, hepatocellular carcinoma (HCC), colorectal carcinoma (CRC), breast cancer, prostate cancer or lung cancer. Exemplary hematological cancers include, but are not limited to myeloma, leukemia, and lymphoma. All three types affect the growth and function of white blood cells. Leukemia affects immature white blood cells, lymphoma affects lymphocytes, and myeloma affects plasma cells. Various cancers that may be targeted by a CAR may be treated using the methods and compositions described herein.
[0087] In one aspect, the compositions, and methods described herein are used as a first- line therapy (sometimes called primary therapy). In another aspect, the compositions and methods described herein are used as a second- line therapy. In some aspects the compositions and methods described herein are used as third or more advanced line therapy.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595In some aspects the compositions and methods described herein are used as a salvage therapy. The term “salvage therapy” means a therapeutic agent that can be taken with any regimen after a subject’s initial treatment regimen has failed or after the subject’s condition has not responded to an initial treatment. In another aspect, the compositions and methods described herein are used as a rescue therapy. In one embodiment, the compositions are used as a rescue agent to counteract the action of an initial treatment. In one embodiment, the compositions are used as rescue agent that is administered to a subject who has developed resistance to a standard or an initial treatment.
[0088] Common first line treatments cancer include, but are not limited to, treatment with chemotherapy drugs such as vincristine, doxorubicinlenalidomide (or other IMiDs such as Pomalidomide), and bortezomib (or other proteosome inhibitors such as carfilzomib), Daratumumab (or other antibody therapies such as Isatuximab or Elotuzumab) treatment with corticosteroids such as prednisone and or dexamethasone, targeted therapy with proteasome inhibitors such as carfilzomib, bone marrow transplantation, and radiation . In another aspect, the compositions and methods described herein may be used as an adjuvant therapy. In some aspects, an adjuvant therapy comprises administration of one or more therapeutic agents described herein to a subject, wherein the one or more therapeutic agent that modify the effect of other therapeutic agents that are already administered to the subject or are concurrently administered to the subject or subsequently administered to the subject. In one aspect, the patient has received at least one prior therapeutic agent. In one aspect the patient has received at least two, at least three, or at least four or more prior therapeutic agents.
[0089] In one aspect, the methods described herein include administration of a second therapeutic agent including an anti-cancer agent, bone marrow transplantation, or radiation. In aspect, the second therapeutic agent is a chemotherapy agent and / or radiation, transplantation or surgery.
[0090] In any of the methods of treatment described herein the pharmaceutical composition or nucleic acids encoding the engineered regulatory elements and a CAR described herein may be administered to a subject according to an infrequent dosing regimen (e.g., administered once per week or less frequently). In another aspect, the composition is administered to a subject once weekly. In another aspect, the composition is administered to a subject once every two weeks. In one aspect, the composition is administered to a subjectDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 once every four weeks. In one aspect, the composition is administered to a subject twice a week. In one aspect, the composition is administered to a subject once every three weeks. In one aspect, the composition is administered to a subject according to a frequent dosing regimen (e.g., administered more than once per day or more than once per week). In one aspect, the composition is administered to a subject in a repeated cycle of once daily, twice daily, once weekly, once every two weeks, once every three weeks, once every four weeks or combinations thereof. Any appropriate dosing regimen is contemplated herein.
[0091] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Methods and materials are described below, although methods and materials similar or equivalent to those described herein may be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.
[0092] Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this disclosure that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. The following examples are provided by way of illustration only and not by way of limitation. Those skilled in the art will readily recognize a variety of noncritical parameters that could be changed or modified to yield essentially similar results.EXAMPLES
[0093] Example 1 - Creation of ConstructsLentiviral transfer plasmids
[0094] A modified version of a third-generation self-inactivating (SIN) lentiviral CMV-GFP- WPRE transfer plasmid was used as an acceptor vector to clone candidate DNA sequence elements in place of CMV (Figure 1 B). NK-specific elements (average size of 334 bp) were deduced from published ATAC-seq data of human immune subsets and cloned in assemblies of three, two or one element per construct, depending on element size, upstream of the minimal promoter (mP) YB_TATA (TCTAGAGGGTATATAATGGGGGCCA) (Figure 1C-DFCI IP No. 3423.W01WO / Atty Ref.: 91016-4315951 E)). Control transfer plasmids included the constitutive promoters EF1a and CMV as well as scrambled CMV (Scr.CMV) sequence with or without mP.
[0095] Additional combinations using selected elements from assemblies (Figure 11 (Table B)) identified from the initial screening were generated using the same system as described above (Figure 6A and Figure 12 (Table C)). These combinations were generated using NK-specific promoter optimization through element combination. Five single elements (Figure 10(Table A)) (presumably, 2 promoter regions [26A and 23B] and 3 enhancer regions) selected from the NK-specific promoter screening were rearranged in 25 combinations (NK119-NK143) including 1 , 2 or 3 elements, cloned upstream the minimal promoter YB_TATA.
[0096] Selected assemblies and the CMV vector were also modified to replace GFP by the anti-BCMA CAR from Ciltacabtagene autoleucel (Cilta-cel) Carvykti®.Lentiviral production
[0097] Lenti-X 293T cells (Takara Bio) were seeded at 50,000 cells / cm2the day before transfection using TranslT-293 Transfection Reagent (Mirus). The relative amounts of plasmids for a 15-cm plate (145 cm2) were as follow: Packaging psPAX2 (Gag-Pol-Rev-Tat, Addgene 12260): 3 pmol, envelop pMD2.G (VSVg, Addgene 12259): 1.6 pmol, PKR inhibitor (pAdv, Promega #E1711 ): 0.9 pmol, transfer: 3.7 pmol. For other types of plates, the amounts of plasmids were adjusted proportionally to the surface. The media was changed with fresh media 24 hours post-transfection. The viral supernatant was harvested 48 hours posttransfection. Viral supernatants were cleared from debris after centrifugation (500g, 5 min, 4°C) followed by 0.45um filtration. Viral supernatants were used fresh directly for transduction or frozen (-80°C). To transduce HSCs for in vivo experiments, larger batches of lentivirus were prepared and concentrated by ultracentrifugation (110,000g, 1 hr, 4°C) and aliquoted at -80°C.
[0098] Example 2: Cell CultureHuman T cell culture
[0099] Peripheral blood mononuclear cells (PBMCs, isolated by Ficoll density centrifugation) or purified T cells (RosetteSep™ Human T Cell Enrichment Cocktail, StemCell™ #15061 ) were stimulated with TransAct™ (Miltenyi Biotec), 10uL for 5e6DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595PBMCs / mL or for 1 e6 T / mL, in complete RPMI medium: RPMI (Gibco #118750-093) supplemented with 10% heat inactivated Fetal Bovine Serum (FB) (Life Technologies #10438026), Penicillin-Streptomycin (P / S) (Life Technologies #15140122), Glutamax™ (GX) (Life Technologies #35050061 ). The human recombinant cytokines IL-2 (200 U / mL final), IL- 7 (5 ng / mL final) and IL-15 (10 ng / mL final) were added freshly from frozen (-80°C) 1000X aliquots. After 1-2 days in (2 days recommended for thawed cells) in culture (37°C, 5% CO2 incubator), the cells were used for lentiviral transduction. Cells were monitored every day and adjusted to 0.5-1 e6 cells / mL if needed using media supplemented with cytokines.Human NK cell culture
[0100] NK cells were purified from peripheral blood (RosetteSep™ Human NK Cell Enrichment Cocktail, StemCell™ #15065) and cultured in NK MACs Medium (Miltenyi Biotech #130-114-429), 5% human AB serum (Millipore-Sigma #H3667-20ML). The human recombinant cytokines IL-2 (500 U / mL final) and IL-15 (10 ng / mL final) were added freshly from frozen (-80°C) 1000X aliquots. After 5-7 days in culture (37°C, 5% CO2 incubator), the cells were used for lentiviral transduction. Cells were monitored every other day and adjusted to 0.5-1 e6 cells / mL if needed using media supplemented with cytokines.Human mobilized CD34+(HSC) cell culture and transduction
[0101] Purified CD34+cells from G-CSF-mobilized patients were obtained from the Fred Hutchinson Cancer Center. Cells were thawed in GMP Stem Cell Growth Medium (SCGM) medium (CellGenix®-Sartorius #20806-0500) freshly supplemented with human SCF (CellGenix®-Sartorius #1418-050), Flt3-L (CellGenix®-Sartorius #1415-050), and TPO (CellGenix®-Sartorius #1417-0501 ), at 100 mg / mL final for each. After one day in culture (37°C, 5% CO2 incubator), the cells were used for lentiviral transduction. Cells were monitored every other day and adjusted to 0.5-1 e6 cells / mL if needed using media supplemented with growth factors.Lentiviral transduction
[0102] Cells were washed and resuspended at 1e6 cells / mL before addition of the lentivirus (LV) according to prior titration experiments. Transduction efficiency could beDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 enhanced using 1 mg / mL Poloxamer 338 (P338) (Sigma Aldrich #P2164021 ) and spinoculation (2000g, 1 hr, 30°C).
[0103] Example 3: Expression and Construct TestingIn vitro flow cytometry analysis of GFP expression
[0104] GFP expression was measured in each cell type 5-6 days after transduction by flow cytometry analysis using the 3-laser (V-B-R) Northern Lights™ or 5-laser Aurora flow cytometer and SpectroFlo® software (Cytek®) (Figure 1F, Figure 2, and (Figure 6B). The expected phenotypes were verified: CD3-CD56+ (NK), CD3+CD56 CD8+(CD8+T cells, T8), CD3+CD56-CD4+(CD4+T cells, T4), CD3-CD56-CD34* (HSCs). Cells were treated with human Trustain FcX (Fc Block, BioLegend® #422302) before staining with anti CD3 PE-Cy7 (clone SK7, BioLegend® #344815), CD56 BV711 (clone HCD56, BioLegend® #318336), CD4 BV605 (clone OKT4, BioLegend® #317438), CD8a Alexa Fluor 647 (clone RPA-T8, BioLegend® #301022), CD34 PE (clone 561 , BioLegend® #343606), and the viability dye SYTOX Blue (Invitrogen, #S34857). Brilliant Stain Buffer Plus (BD Biosciences, BioLegend® #566385) was used to mitigate staining artifact.
[0105] Assemblies showing the highest expression in NK cells (Y-axis) and highest foldchange compared to HSCs (X-axis) were selected (highlighted in the graphs of Figure 1F: #14, 22, 23, 52 and 26) Sequences of the individual elements of these candidates are shown in Figure 10(Table A) and the sequences of the assemblies can be found in Figure 11 (Table B).Mouse HSC-humanization
[0106] hlL-15 NOG female mice (5-7 weeks of age, Taconic Bio) were treated with total body irradiation (200 Rad) and injected intravenously four hours later with 0.5-1 e6 lentivirally-transduced (or Mock-treated) HSCs. After 5 weeks, mice were euthanized and the bone marrow was harvested for flow cytometry analysis (Figure 3A). In this accelerated NK development model (supraphysiological human IL-15), mostly monocytes (CD14+), B (CD19+) and NK (CD3'CD56+) cells were observed but emergent T cells (CD3+) could also be detected in some experiments.In vivo flow cytometry analysis of GFP expressionDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595
[0107] GFP expression was measured in different in vivo differentiated subsets by flow cytometry analysis using the 5-laser Aurora cytometer and SpectroFlo® software (Cytek®) (Figure 3B). Bone-marrow cells were treated with ACK Lysing Buffer (Gibco-ThermoFisher #A1049201 ) to remove red blood cells and stained with Zombie NIR™ viability dye (BioLegend® #423105). Cells were then treated with anti-human Trustain FcX™ (Fc Block, BioLegend® #422302) and mouse CD16 / 32 (Fc Block, BioLegend® #101302) before staining with anti-mouse CD45 PE-Dazzle™ 594 (clone 30-F11 , BioLegend® #103146), anti-human CD45 BV605 (clone HI30, BioLegend® #304043), CD3 PE-Cy7 (clone SK7, BioLegend® #344815), CD56 BV711 (clone HCD56, BioLegend® #318336), CD19 BV785 (clone HIB19, BioLegend® #302240), CD14 BV480 (clone Mq>P9, BD Biosciences #566141 ). Brilliant Stain Buffer Plus (BD Biosciences #566385) and CellBlox™ Monocyte and Macrophage Blocking Buffer (Invitrogen™ #B001T03F01 ) were used to mitigate staining artifact.In vitro NK cytotoxicity assay
[0108] In vitro expanded human NK cells were lentivirally transduced to express the anti- BCMA CAR from Ciltacabtagene autoleucel (Cilta-cel) Carvykti® under the control of the CMV promoter or the indicated NK promoter. CAR expression was verified 5-6 days posttransduction by flow cytometry (Figure 5A). Cells were treated with human Trustain FcX™ (Fc Block, BioLegend® #422302) before staining with recombinant human BCMA / TNFRSF17 Fc Alexa Fluor™ 647 protein (R&D Systems-Biotechne, #AFR193-020) combined with anti CD3 PE-Cy7 (clone SK7, BioLegend® #344815), CD56 BV711 (clone HCD56, BioLegend® #318336), and the viability dye SYTOX™ Blue (Invitrogen™, #S34857). Mock or transduced NK cells were mixed in a 1 : 1 ratio with the BCMA-expressing multiple myeloma cell line OPM- 2 modified to express GFP. OPM-2 cells were plated first in a 96-well plate (flat bottom, 10,000 cells per well) pre-coated with 0.01 % Poly-L-Omithine (Millipore-Sigma #A-004-C). Medium or NK cells (10,000 cells per well) were added and tumor cell growth (GFP signal) was monitored every three hours over 48 hours using the Incucyte® system (Sartorius) (Figure 5B). RPMI medium without phenol red (Gibco #11835055) was used.In vivo NK-specific promoter activity
[0109] The in vivo long-term NK-specific promoter activity of the NK022 assembly was tested using human HSCs that were lentivirally transduced with CMV-GFP or NK022-GFPDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 constructs and injected into irradiated (200 Rad) NSG-FLT3-IL15 (The Jackson Laboratory, Strain #:037322, murine Flt3 KO, human FLT3L, physiologic IL-15) mice (Figure 4A). After 17 weeks, mice were euthanized, and the bone marrow was harvested for flow cytometry analysis. GFP expression was shown in 10 cell types including NK (CD3- CD56+), monocytes (Mono, CD14+), B cells (CD19+), T cells (CD3+CD56- CD8+[T8] or CD4+[T4]), conventional (eDC, Lin- CD34- c-Kit- HLA-DR+CD16- CD11 c+CD123-) and plasmacytoid (pDC, Lin- CD34- CD117- HLA-DR+CD16- CD11c- CD123+) dendritic cells, basophils (Baso, Lin- CD34- CD117" HLA-DR- CD16- CD123+), HSC (Lin- CD34+c-Kit+), granulocytes (neutrophils-eosinophils [Neu-Eos], SSChigh, CD66b+) (Figure 4B).
[0110] The in vivo long-term NK-specific promoter activity of the NK132 assembly was tested using human HSCs that were lentivirally transduced with NK132-CAR (NK132 assembly driving expression of the BCMA-specific CAR from Ciltacabtagene autoleucel (Cilta-cel) Carvykti®) or CMV-GFP (control for ubiquitous GFP expression from CMV) constructs (Figure 7A). Cells were then mixed at a 1 :1 ratio and co-injected into irradiated (200 Rad) NSG-FLT3-IL15 (The Jackson Laboratory, Strain #:037322, murine Flt3 KO, human FLT3L, physiologic IL-15) mice. A flow cytometry analysis of GFP and CAR expression (detected using an Alexa Fluor™ 647-conjugated recombinant BCMA protein (R&D Systems / Biotechne, AFR193-020)) was done using the blood harvested at 12 weeks post-HSC injection (representing concatenated data from nine individual mice) and demonstrating strong NK-specific CAR expression driven by NK132 (compared to monocytes [Mono], B cells, CD8+[T8] or CD4+[T4] T cells) and contrasting with ubiquitous GFP expression driven from CMV (Figure 7B).
[0111] The NK-specific promoters driving anti-BCMA CAR expression and function in NK cells in vitro was shown using flow cytometry analysis of BCMA CAR Ciltacabtagene autoleucel (Cilta-cel) Carvykti® expression in primary NK cells which were detected using an Alexa Fluor™ 647-conjugated recombinant BCMA protein (R&D Systems / Biotechne, AFR193-020) (Figure 8A). NK cells were lentivirally transduced using CMV, NK022 or NK132 promoters to drive CAR expression. A cytotoxicity assay using the BCMA-expressing multiple myeloma cell line OPM-2 modified to express GFP was done (Figure 8B). Untransduced (Mock) or transduced NK cells were combined in a 1 :1 ratio with OPM-2-GFP cells and the relative number of tumor cells (GFP+) was measured every three hours over 48 hours using the Incucyte® system.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595
[0112] The in vivo long-term anti-tumor efficacy of HSCs modified with NK022 or the optimized NK132 assembly controlling anti-BCMA CAR expression from Ciltacabtagene autoleucel (Cilta-cel) Carvykti® was tested, upon NK cell differentiation (Figure 9A). Human HSCs were either untransduced or lentivirally transduced with NK022-CAR or NK132-CAR constructs and injected into irradiated (200 Rad) NSG-FLT3-IL15 (The Jackson Laboratory, Strain #:037322, murine Flt3 KO, human FLT3L, physiologic IL-15) mice (5-9 mice per group). After 56 days (8 weeks), the mice were injected (i.v.) with the BCMA-expressing multiple myeloma cell line OPM-2 modified to express GFP fused to red italica firefly luciferase (GFP-FLuc). Flow cytometry analysis of the blood of a NK132-CAR mouse at the time of tumor injection was used to confirm strong CAR expression in NK compared to other subsets (Figure 9B). Note that T cells are absent at this time and usually only appear from 12 weeks post-HSC in this model. A human cell engraftment was quantified (Figure 9C left, similar across groups) along with the percentage of CAR+in NK cells (Figure 9C right, highest percentage observed in NK132 mice). The quantification of tumor growth measured by total body bioluminescence (Figure 9D top, upon injection of D-Luciferin) 100 days (14 weeks) post-HSC (6 weeks post-tumor) and mouse survival (Figure 9D bottom).EQUIVALENTS
[0113] Various aspects of the present disclosure may be used alone, in combination, or in a variety of arrangements not specifically discussed in the embodiments described in the foregoing and is, therefore, not limited in its application to the details and arrangement of components set forth in the foregoing description or illustrated in the drawings. For example, aspects described in one embodiment may be combined in any manner with aspects described in other embodiments.
Claims
DFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595What is claimed:
1. An engineered regulatory sequence, comprising a heterologous nucleic acid sequence of the formula:R1 - R2 or R2 - R1 (Formula I), wherein:R1 comprises one or more enhancers derived from(a) the KIR3DX1 , NCR1 , or KIRDS4 gene intronic region; or(b) the NCR1 and NLRP7 intergenic region; andR2 is a promoter derived from the KIR3DX1 or KIR2DL1 gene; wherein, optionally:(a) (i) R1 and R2 are not linked by a spacer; or(ii) R1 and R2 are linked by a spacer that is 1 -10 base pairs, 1 -25 base pairs, 1 -50 base pairs, or 1 -100 base pairs; and(b) R2 is linked to a minimal promoter sequence.
2. The engineered regulatory sequence of claim 1 , wherein R1 and R2 are operably linked to a heterologous nucleic acid sequence encoding a chimeric antigen receptor.
3. The engineered regulatory sequence of claims 1 - 2, wherein the orientation of Formula I is R1 - R2.
4. The engineered regulatory sequence of claims 1 - 3, wherein: a. R1 comprises SEQ ID NO: 8; and b. R2 is SEQ ID NO: 7.
5. The engineered regulatory sequence of any one of claims 1 - 3, wherein: a. R1 comprises: i. SEQ ID NO: 11 or SEQ ID NO: 10; or ii. SEQ ID: 11 ; andDFCI IP No. 3423.W01WO / Atty Ref.: 91016-431595 b. R2 is SEQ ID NO: 9.
6. The engineered regulatory sequence of any one of claims 1 - 3, wherein: a. R1 comprises SEQ ID NO: 2; and b. R2 is SEQ ID NO: 1.
7. The engineered regulatory sequence of any one of claims 1 - 3, wherein: a. R1 comprises SEQ ID NO: 4; and b. R2 is SEQ ID NO: 3.
8. The engineered regulatory sequence of any one of claims 1 - 3, wherein: a. R1 comprises SEQ ID NO: 5 or SEQ ID NO: 12; and b. R2 is SEQ ID NO: 6.
9. The engineered regulatory sequence of any one of claims 1 - 3, wherein: a. R1 comprises SEQ ID NO: 5 or SEQ ID NO: 12; and b. R2 is SEQ ID NO: 7.
10. The engineered regulatory sequence of claim 9, wherein R1 comprises SEQ ID NO: 12.11 . The engineered regulatory sequence of any one of claims 1 - 3, wherein: a. R1 comprises: i. SEQ ID NO: 5 or SEQ ID NO: 12; and ii. SEQ ID NO: 8; and b. R2 is SEQ ID NO: 7.
12. The engineered regulatory sequence of any one of claims 1 - 3, wherein: a. R1 comprises: i. SEQ ID NO: 12 ; and ii. SEQ ID NO: 8; and b. R2 is SEQ ID NO: 7.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-43159513. The engineered regulatory sequence of any one of claims 1 or 2, wherein Formula I comprises the nucleic acid sequence of any one of SEQ ID NOS: 13 - 42 .
14. A vector for delivering the engineered regulatory sequence of any one of claims 1 - 13, comprising a viral vector.
15. The vector of claim 14, wherein the viral vector is a retroviral vector or an adeno- associated virus (AAV) vector.
16. The vector of claim 15, wherein the retroviral vector is a lentiviral vector.
17. The vector of claim 16, wherein the lentiviral vector is a self-inactivating (SIN) lentiviral vector.
18. A vector for delivering the engineered regulatory sequence of any one of claims 1 - 13, comprising a nonviral vector.
19. The vector of claim 18, wherein the nonviral vector is a Sleeping Beauty (SB) targetable transposon vector.
20. The vector of any one of claims 14 - 19, wherein the vector is configured for CRISPR-mediated insertion of the engineered regulatory sequence into a genomic safe harbor (GSH) site.21 . The vector of claim 20, wherein the CRISPR-mediated insertion comprises doublestranded or single-stranded homology directed repair (HDR).
22. An autologous hematopoietic stem cell (HSC) transduced with any of the vectors of claims 14 - 21.
23. An engineered cell comprising the regulatory elements of claims 1 - 13.DFCI IP No. 3423.W01WO / Atty Ref.: 91016-43159524. An engineered NK cell comprising the regulatory elements of claims 1 - 13.
25. A pharmaceutical composition comprising the autologous hematopoietic stem cell (HSC) of claim 22 or the engineered cells of claims 23 - 24.
26. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the autologous hematopoietic stem cell (HSC) of claim 22, the engineered cells of claims 22 - 23, or the pharmaceutical composition of claim 25.
27. Use of an autologous hematopoietic stem cell (HSC) transduced with any of the vectors of claims 14 - 21 or the engineered cells of claims 22 - 23, in the manufacture of a medicament for treating a cancer.
28. A method of generating persistent NK cells in a subject, comprising administering to the subject a therapeutically effective amount of the autologous hematopoietic stem cells (HSCs) of claim 22.
Citation Information
Patent Citations
Expression vectors and methods for obtaining NK cell specific expression
WO2006103569A2
Compositions and methods for treating proliferative disorders
WO2007042573A2
Cell-specific transcriptional regulatory sequences and uses thereof
WO2020150832A1
Compositions and methods for in VIVO expression of chimeric antigen receptors
WO2024050551A2