Cell line for vector production

CRISPR-Cas9 editing of producer cell lines removes unwanted nucleic acid sequences, addressing purity and genotoxicity issues in lentiviral vectors, resulting in safer and purer gene therapy vectors.

WO2026132806A1PCT designated stage Publication Date: 2026-06-25BRUNEL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/GB2025/060029
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-19
Filing Date
2025-12-17
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

The large-scale production of highly pure gene therapy vectors, particularly lentiviral vectors, is challenging due to issues with vector purity, target cell specificity, tropism, and potential genotoxicity from contaminating nucleic acids, including human endogenous retrovirus sequences, which can cause insertional mutagenesis and other side effects.

Method used

A method involving CRISPR-Cas9 gene editing is used to modify the genome of producer cell lines, such as HEK293, to remove unwanted nucleic acid sequences, including human endogenous retrovirus sequences, ensuring that these sequences are not packaged into the gene therapy vectors, thereby enhancing vector purity and reducing genotoxic risks.

Benefits of technology

The modified cell lines produce gene therapy vectors that are free from contaminating nucleic acids, improving vector purity and safety for clinical use by minimizing the risk of genotoxicity and other side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GB2025060029_25062026_PF_FP_ABST
    Figure GB2025060029_25062026_PF_FP_ABST
Patent Text Reader

Abstract

A method of producing a cell line for production of a gene therapy vector includes providing a cell line (10) suitable for production of a gene therapy vector (20); editing the genome (12) of the cell line (10), for example using CRISPR gene editing, to remove at least one region of nucleic acid sequence, wherein the region of nucleic acid sequence is unwanted in the gene therapy vector (20) to be produced thereby; and confirming deletion of the region of nucleic acid sequence from the genome (12') of the modified cell line (10'). The region of unwanted nucleic acid sequence may be derived from a virus. The modified cell line (10) can be used to make a viral gene therapy vector (20) that does not contain unwanted nucleic acid sequences.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] CELL LINE FOR VECTOR PRODUCTION

[0002] Technical Field

[0003] The present invention relates to a method of producing a cell line for production of a gene therapy vector, a cell line for production of a gene therapy vector, a method of making a gene therapy vector, and a gene therapy vector.

[0004] To date over 3000 clinical trials have been initiated in the field of gene therapy (Ginn et al. (2018); https: / / www.abedia.com / wiley). Many of these involve the use of adeno-associated virus (AAV) and lentiviral (LV) based vectors due to their ubiquitous gene transfer to dividing and non-dividing cells (Lundstrom et al. (2018)) and long term and persistent therapeutic gene expression (Qiao et al. (2006)). Lentivirus vectors (LV) offer permanent delivery of therapeutic genes to a host through an RIMA intermediate genome. They are the most commonly used vectors for clinical gene therapy of inherited disorders such as immune-deficiencies and cancer including haematological malignancies and solid tumours. The viruses are generally made by specialised cell lines, known as producer cell lines, which contain plasmids with the instructions for making and packaging the viruses.

[0005] Significant modifications to retroviruses and the lentivirus genus have resulted in their use in non-clinical and clinical settings, which are considered essential to meet safety requirements. Recombinant LV, based on the HIV-1 genome, is routinely produced using human embryonic kidney cells (HEK293). First generation LV use three discrete plasmids (called cis and trans plasmids) for split genome packaging. To ensure only the recombinant genome is transferred, the first plasmid (cis plasmid) carries the vector genome expression cassette with the therapeutic gene of interest under the control of an internal promoter, the genome packaging signal, the wild-type LTR and a rev response element. The second plasmid carries the trans genes of the HIV genome required to package virus particles that bud from the producer cell surface. The third plasmid (also a trans plasmid) carries the envelope gene that enables a ligand glycoprotein to be positioned on the cell surface providing infectivity to particles leaving the cell. The most commonly used envelope is from the vesicular stomatitis virus (VSV-G) that provides effective and widespread gene transfer and renders the recombinant particles more robust than with other pseudotypes (Burns et al. (1993)). Second and third plasmids do not carry packaging signals.

[0006] To reduce the potential for replication competent virus production, second generation vectors contain further sequential removal of accessory genes identified as disposable for vector production (i.e. Vif, Vpu, Vpr and Nef) (Zufferey et al. (1997); Fouchier et al. (1996); Dull et al. (1998)). Third generation vectors, like the second, have genes coding for the non-essential accessory proteins removed, however, further modifications include removal of Tat and the addition of Rev on a separate plasmid to facilitate improved vector genome nuclear export. Third generation vectors also have self-inactivating design with a deletion in the 3' long terminal repeat (LTR) containing the TATA box to abolish LTR promoter activity. Thus the likelihood of replication- competent retroviruses is reduced along with removal of LTR sequences that can activate oncogenes located near to site of vector integration (Cornetta et al. (2011); Zufferey et al. (1998)).

[0007] One of the most difficult challenges facing the widespread use of LV in patients is the large-scale production of highly pure vector stocks. To improve vector production and downstream purification there has been recent investment in the UK to establish GMP licensed centres for manufacture and quality control. Other concerns regarding these vectors include their target cell specificity and tropism, how to regulate gene expression of the therapeutic payload and their potential side effects.

[0008] Any therapeutic entity such as a drug, including gene therapy vectors, must meet exacting standards before use in patients. Therefore, vector purification is essential before application. Downstream purification of LV after transfection of HEK293T cells involves removal of impurities such as producer cell debris, which is critical to prevent a host immune response to vector delivery (Baekelandt et al. (2003); McNally et al. (2014)). In large scale production, the method of ultra-centrifugation is replaced with tangential flow filtration or chromatography and benzoate treatment and gradient purification or chromatography to remove cellular genomic DNA (Milone et al. (2018); Bandeira et al. (2012)) followed by elution and further filtration.

[0009] Whilst enormous steps have been taken to improve LV purity, the need to understand the potential of LV to cause genotoxicity in the host is still of utmost importance. Genotoxicity is known to involve the vector genome and as mentioned steps have been taken to engineer the LV genome to reduce its potential to influence host gene expression after integration. To ensure the fidelity of genome transfer, the nucleocapsid part of HIV-1 Gag binds full length vector genomes at the Psi packaging signal, located near the 5'-end of the viral RIMA vector genome to preferentially enrich these nucleic acids in assembling virions, whilst discriminating against single genomes, spliced viral mRNAs and cellular mRNA. Gag ribonucleoprotein complexed with vector genomes reach the plasma membrane and meet several more Gag molecules that form immature particles that become mature after budding. However, Gag proteins have been shown to also package some cellular RNA (Lu et al. (2012)).

[0010] The human genome contains approximately 8% of sequences that are of endogenous retrovirus (ERV) origin. An example being a member of the HERV-K family that contain HERV-K113 that has full coding capacity (Beimforde et al. (2008); van der Kuyl (2008)). HERV structure includes gag, pol and env that are bordered by LTR regions on both sides. HERV integration can be influential to the host since their LTRs can also inhibit or activate nearby promoter / enhancer activity (Jern & Coffin (2008)). HERV can also create novel splice sequence locations and activity (Cohen et al. (2009)). Under specific conditions, including cancer and auto-immune disease, these elements have also been known to become active (Rasmussen et al. (1997); Li et al. (2019)). Although HERV can be transcribed and translated, alone they are believed not able to transfer between cells. During HIV-1 infection, HERV-K113 expression has been shown to increase to the point where its RNA can be detected in patient plasma (Contreras-Galindo et al. (2006); Contreras-Galindo et al. (2007)). Although little complementation activity exists between HIV and HERVs (van der Kuyl (2012); Ogata et al. (1999)), it has been shown that HIV-1 derived packaging cells can package HERV transcripts (Zeilfelder et al. (2007); Sakai et al. (1990); Rulli et a / . (2007)). The presence of HERV in LV preparations may, therefore, be regarded as a contaminant with the potential to cause insertional mutagenesis.

[0011] Gene therapy vectors are products for use in the therapy of humans. It is therefore important to know exactly what is present in such a product, and to be sure they are free of unwanted contaminants.

[0012] The present invention seeks to provide an improved method of producing cells for production of a gene therapy vector, an improved cell line for vector production, and an improved gene therapy vector.

[0013] According to an aspect of the present invention, there is provided a method of producing a cell line for production of a gene therapy vector including: a) providing a cell line suitable for production of a gene therapy vector, the cell line having a genome; b) editing the genome of the cell line to remove at least one region of nucleic acid sequence, wherein the region of nucleic acid sequence is unwanted in the gene therapy vector to be produced thereby; and c) confirming deletion of the region of nucleic acid sequence from the genome of the modified cell line.

[0014] According to another aspect of the present invention, there is provided a method of producing a cell line for production of a gene therapy vector including: a) providing a cell line suitable for production of a gene therapy vector, the cell line having a genome; al) manipulating the cell line to render it capable of producing a gene therapy vector; a2) producing a gene therapy vector from the cell line; a3) analysing the gene therapy vector to identify unwanted nucleic acid sequence; b) editing the genome of the cell line to remove at least one region of nucleic acid sequence identified in Step a3); and c) confirming deletion of the region of nucleic acid sequence from the genome of the modified cell line.

[0015] The method may include removing a plurality of regions of unwanted nucleic acid sequence.

[0016] Step b) may include removing a plurality of regions of unwanted nucleic acid sequence prior to carrying out Step c). Steps b) may include removing a single region of unwanted nucleic acid sequence prior to carrying out Step c), wherein Steps b) and c) are repeated until all regions of unwanted nucleic acid sequence have been removed from the genome of the cell line.

[0017] The region of unwanted nucleic acid sequence is derived from a virus.

[0018] Step b) may include removing a region of unwanted nucleic acid derived from at least one of the following: Human endogenous retrovirus, BeAn 58058 virus, Chrysochromulina ericina virus, Friend murine leukemia virus, Macaca mulatta polyomavirus, Salmonella virus, Human betaherpesvirus, Abelson murine leukemia virus, Pandoravirus dulcis, Finkel-Biskis-Jinkins murine sarcoma virus, Dishui lake phycodnavirus, Melbournevirus, Cotesia congregata bracovirus, Penguinpox virus, Micromonas pusilia virus, Harvey murine sarcoma virus, Human mastadenovirus, Marseillevirus marseillevirus, Pandoravirus salinus, Pandoravirus quercus, Escherichia virus, Molluscum contagiosum virus, Ectropis obliqua nucleopolyhedrovirus, Sarcoma virus, Avian leukosis virus, Pestivirus giraffe-1, Moloney murine sarcoma virus, Shigella phage, Macropodid alphaherpesvirus, Yokapox virus, Camelpox virus, Monkeypox virus , Canarypox virus, Brazilian marseillevirus, Only Syngen Nebraska virus, Pandoravirus neocaledonia, Bovine viral diarrhea virus, Cafeteria roenbergensis virus.

[0019] In embodiments, the human endogenous retrovirus is human endogenous retrovirus K113, the macaca mulatta polyomavirus is macaca mulatta polyomavirus 1, the salmonella virus is salmonella virus SP6, the human betaherpesvirus is human betaherpesvirus 5, the Dishui lake phycodnavirus is Dishui lake phycodnavirus 1, the Micromonas pusilia virus is Micromonas pusilia virus 12T, the human mastadenovirus is human mastadenovirus C, the Escherichia virus is Escherichia virus Pl, the Molluscum contagiosum virus is Molluscum contagiosum virus subtype 1, the sarcoma virus is Y73 sarcoma virus, the avian leukosis virus is avian leukosis virus - R.SA, the pestivirus giraffe-1 is pestivirus giraffe-1 H138, the shigella phage is shigella phage SflV, the macropodid alphaherpesvirus is macropodid alphaherpesvirus 1, the monkeypox virus is monkeypox virus Zaire-96- 1-16, the only syngen Nebraska virus is only syngen Nebraska virus 5, the bovine viral diarrhea virus is bovine viral diarrhea virus 3 Th / 04_KhonKaen, and / or the cafeteria roenbergensis virus is cafeteria roenbergensis virus BV-PW1.

[0020] Step b) may include removing a region of unwanted nucleic acid derived from at least one of the following: Human endogenous retrovirus BeAn 58058 virus, Chrysochromulina ericina virus, Friend murine leukemia virus, Macaca mulatta polyomavirus, Salmonella virus. The method may include removing all regions of unwanted nucleic acid present in the cell line that are derived from human endogenous retrovirus K113, BeAn 58058 virus, chrysochromulina ericina virus, friend murine leukemia virus, macaca mulatta polyomavirus 1, and salmonella virus SP6.

[0021] In an embodiment, the method includes removing at least one region of unwanted nucleic acid derived from human endogenous retrovirus. For example, the method may include removing the following sequences: m54118_181207_113652 / 15794380 / ccs m54118_181207_113652 / 5832778 / ccs m54118_181207_113652 / 63308073 / ccs m54118_181207_113652 / 46530831 / ccs m54118_181207_113652 / 63505012 / ccs m54118_181207_113652 / 12779821 / ccs m54118_181207_113652 / 47579377 / ccs m54118_181208_080006 / 23855664 / ccs m54118_181208_080006 / 32702952 / ccs m54118_181208_080006 / 42599406 / ccs m54118_181208_080006 / 22610651 / ccs

[0022] The cell line may be HEK293 or PER.6.

[0023] Step c) may include isolating a clone from the modified cell line and confirming deletion of regions of unwanted nucleic acid using PCR.

[0024] The genome editing is carried out using CR.ISPR. gene editing. The viability of the modified cell line may be checked after removal of each region of unwanted nucleic acid.

[0025] The transfection efficiency of the modified cell line obtained from Step c) may be validated after all regions of unwanted nucleic acid have been removed. This may be done by validating the transfection efficiency after removal of each region of unwanted nucleic acid.

[0026] The transfection efficiency may validated using a reporter plasmid.

[0027] The method may include using the modified cell line to make vector and confirming that the vector does not include any unwanted nucleic acid. This may be done, for example, by using the methods, such as the sequencing methods disclosed herein.

[0028] The vector may be a viral vector such as a retroviral vector. In some embodiments, the vector is a lentiviral vector.

[0029] According to another aspect of the present invention, there is provided a modified cell line obtainable by a method as specified above.

[0030] According to another aspect of the present invention, there is provided a method of making a gene therapy vector including: a) providing a modified cell line as specified above or made by a method as specified above; and b) using the modified cell line to make a gene therapy vector. The method may include transfecting the modified cell line with plasmids for viral vector production and a transgene, wherein the gene therapy vector is a viral vector.

[0031] According to another aspect of the present invention, there is provided a gene therapy vector obtainable by a method as specified above.

[0032] In an embodiment, the gene therapy vector does not contain nucleic acid sequences derived from at least one of the following: Human endogenous retrovirus (optionally human endogenous retrovirus K113), BeAn 58058 virus, Chrysochromulina ericina virus, Friend murine leukemia virus, Macaca mulatta polyomavirus (optionally macaca mulatta polyomavirus 1), or Salmonella virus (optionally salmonella virus SP6).

[0033] In an embodiment, the gene therapy vector does not contain nucleic acid sequences derived from any of the following: Human endogenous retrovirus (optionally human endogenous retrovirus K113), BeAn 58058 virus, Chrysochromulina ericina virus, Friend murine leukemia virus, Macaca mulatta polyomavirus (optionally macaca mulatta polyomavirus 1), or Salmonella virus (optionally salmonella virus SP6).

[0034] In an embodiment, the gene therapy vector does not contain nucleic acid sequences derived from: Human betaherpesvirus (optionally human betaherpesvirus 5), Abelson murine leukemia virus, Pandoravirus dulcis, Finkel-Biskis-Jinkins murine sarcoma virus, Dishui lake phycodnavirus (optionally Dishui lake phycodnavirus 1), Melbournevirus, Cotesia congregata bracovirus, Penguinpox virus, Micromonas pusilia virus (optionally Micromonas pusilia virus 12T), Harvey murine sarcoma virus, Human mastadenovirus (optionally Human mastadenovirus C), Marseillevirus marseillevirus, Pandoravirus salinus, Pandoravirus quercus, Escherichia virus (optionally Escherichia virus Pl), Molluscum contagiosum virus (optionally molluscum contagiosum virus subtype 1), Ectropis obliqua nucleopolyhedrovirus, Sarcoma virus (optionally Y73 sarcoma virus), Avian leukosis virus (optionally Avian leukosis virus - R.SA), Pestivirus giraffe-1 (optionally pestivirus giraffe-1 H138, Moloney murine sarcoma virus, Shigella phage (optionally shigella phage SflV), Macropodid alphaherpesvirus (optionally macropodid alphaherpesvirus 1), Yokapox virus, Camelpox virus, Monkeypox virus (optionally monkeypox virus Zaire-96-1-16), Canarypox virus, Brazilian marseillevirus, Only syngen Nebraska virus (optionally Only syngen Nebraska virus 5), Pandoravirus neocaledonia, Bovine viral diarrhea virus (optionally bovine viral diarrhea virus 3 Th / 04_KhonKaen), Cafeteria roenbergensis virus (optionally Cafeteria roenbergensis virus BV-PW1).

[0035] List of Figures

[0036] Embodiments of the present invention are described below, by way of example only, with reference to the accompanying drawings, in which:

[0037] Figure 1 is a schematic overview of a method of making a gene therapy vector using cis and trans plasmids as shown in (II-III), using a modified cell line produced according to an embodiment (I);

[0038] Figure 2 is a flow chart illustrating steps of an embodiment of a method of producing a cell line for production of a gene therapy vector;

[0039] Figure 3 shows linear representations of plasmids used in lentivirus production; Figure 4 is an image of an agarose gel showing the results of a contamination analysis of viral RIMA samples;

[0040] Figures 5 and 6 are graphs showing read length (bp) distribution for pHR LV RNA;

[0041] Figures 7 and 8 illustrate PacBio sequence reads of aligned construct plasmids (pHR and pCMVR8.74 respectively); and

[0042] Figures 9 and 10 show the results of in vitro pHR LV infection of hamster cells.

[0043] Detailed Description

[0044] Retrovirus (RV) and lentiviral vectors (LV) offer efficient and permanent delivery of therapeutic genes for gene therapy of hereditary diseases. Several improvements to vector production and particle purity along with better safety design using SIN configuration have resulted in successful clinical applications (Montini et al. (2009)). Most efforts to generate LV for gene therapy have involved creating cell lines or transient transfection protocols that yield pseudotyped particles that can be concentrated by ultracentrifugation to remove contaminants that may cause cell toxicity, such as producer cell debris (Baekelandt et al. (2003); McNally et al. (2014)). More recently, downstream purification of RV or LV uses tangential flow filtration and chromatography with benzoate treatment and gradient purification or further chromatography to remove cellular genomic DNA (Milone et al. (2018); Bandeira et al. (2012)). Although these technologies provide vector batches that have external impurities removed for gene therapy, little was known about the exact LV nucleic acid content of these particles intended for the clinic. R.V and to a lesser extent LV genotoxicity are known to be associated with the vector genome following integration as highlighted by a number of in vitro and in vivo non-clinical applications, and in clinical trials to correct genetic disorders (Cavazzana-Calvo et al. (2010)). Hence, it is of the utmost importance to understand the effects of these particles on a host. For this purpose, models have been developed to assess and understand vector genome / host interactions (Nowrouzi et al. (2013); Chandler et al (2015); Themis et al. (2015)). Currently, adverse effects concern insertional mutagenesis where the vector genome influences specific cancer gene expression directly. However, other indirect mechanisms of genotoxicity have been determined such as gene activation via vector splicing with a host gene, and epigenetic changes that occur following infection and gene inactivation. However, no previous investigation has been carried out to determine clearly the nucleic acid composition of these particles to make inferences on the potential for genotoxicity to be cause by contaminating aberrantly packaged nucleic acids in these particles.

[0045] Surprisingly, little is known about the full nucleic acid content of LV even though they have been used in several clinical trials. With the potential for side effects in mind, it is important to identify the exact contents packaged within these particles.

[0046] The applicant has investigated the presence of contaminating nucleic acids within gene therapy vectors arising from producer cell lines. The applicant used highly sensitive PacBio long distance, next generation sequencing of reverse transcribed vector component RIMA to investigate in detail recombinant HIV-1 particle components generated by human 293T packaging cells. Nucleic acids that may be delivered during gene transfer other than the recombinant vector genome were found.

[0047] In view of the limited investigation of the exact nucleic content of recombinant HIV-1 particles, and since both HERV and cellular mRNA may be packaged in LV particles in addition to the vector genome, the applicant profiled the nucleic acids packaged within replication defective LV in more detail. To do this, LV particles were generated from 293T cells for highly sensitive long range PacBio RNA sequencing. The findings show the existence of a range of unexpected nucleic acids in addition to the virus genome that are not of HIV-1 origin suggesting that further investigation of the fate of these unwanted nucleic acids and their potential side effects should be performed.

[0048] In view of concerns over the sensitivity of previous reported studies to identify nucleic material packaged in LV particles and given LV has generally superseded RV in gene therapy, mainly due to safety concerns, the applicant chose to investigate LV particle composition by PacBio RNA sequencing as a more sensitive approach to nucleic acid identification. Alongside reverse transcribed sequences from transcribed RNA and DNA sequences packaged within LV, to ensure removal of DNA external to virus particles, vector supernatants were treated by DNasel and PCR, and q-RT PCR was used to show that no contaminating DNA remained externally to LV particle batches prior to investigating their contents.

[0049] It is generally considered that the vector packaging i site ensures only the recombinant vector genome is present within the particles used for therapy. However, previously, human endogenous virus sequences devoid of this sequence when expressed have been shown to be packaged by human producer cells albeit at far lower levels than by murine cells (Patience et al. (1998)). Interestingly, interactions between HIV-1 and human HERV also include induction on HERV transcription by HIV-1 LV (Grandi et al. (2020); Srinivasachar Badarinarayan et al. (2020)). HERV have been identified in HIV infected patient blood (van der Kuyl (2012)). The applicant has identified incomplete HERV-K113 sequences in both empty and full LV particles at relative quantities of 1.33xl0'3and 4.51X10'5, however, competition between HERV-K113 and HR'SIN-cPPT-SEW-eGFP-W (abbreviated to pHR herein) integration for the target genome would expect pHR to be favoured by the HIV-1 integrase and exclude HERV sequences, which do not have homology with the HIV-1 LTR. In a clinical application, with an increased viral load of greater than lxlO10, HERV-K113 sequences may become more common especially when delivered by empty LV particles. Importantly though, the HERV-K113 sequences found were present at values greater than background human reads with values at 36.4 times more prevalence than human genome reads in empty virus and 19.9 for full virus samples. This difference in relative quantity and RPKM (Reads per Kilobase of genome per Million reads) in empty viruses is worth investigating to identify the differences as either a result of sequencing bias or less competition for HERV-K113 sequences to be packaged into the vectors.

[0050] As to the origin of the HERV sequences packaged in the LV particles, upon further investigation, it was found that the HERV-K113 sequences identified aligned better to the human genome than virus database suggesting the origins of these sequences to be from the packaging cell genome rather than HERV transcripts. To what extent HERV-K113 gene transfer presents a potential genotoxic hazard is unknown, however, these HER.V are known to be associated with disease and cancer (Yu et al. (2013)). Importantly, HERV K113 gene transfer to non-human cells was not found even though highly efficient gene transfer of pHR in these cells was achievable. This may have been due to the low sensitivity of the nested PCR method used to identify HERV-K113 transfer and warrants a more sensitive q-RT PCR being used to identify for these sequences in the infected V79 cells. Further techniques that could be applied to identify integrated sequences include whole genome NGS analysis, TES, inverse PCR or LAM PCR and may be useful to study the potential for HERV-K113 to cause mutagenesis.

[0051] From this study, clearly empty LV is produced carrying unwanted nucleic acids. By investigating both species several unexpected virus sequences at low levels in both pHR and the 'empty' LV were identified. Aberrantly packaged nucleic acid sequences represented by the alignment of PacBio sequences to the virus database appeared with more frequent reads in the full virus compared to empty particles suggesting transgene packaging may also increase transfer of contaminating sequences that would effectively reduce viable vector titre. Further methodologies to remove empty particles from virus preparations would be welcome.

[0052] Multiple aberrantly packaged nucleic acid species in full genome carrying and empty LV particles have been identified. However, it is important for any therapeutic agent such as a gene therapy vector that may be administered to a patient to be highly pure, and for all of its contents to be known. Having identified certain contaminants in LV vectors produced by HEK293 cells, the applicant proposes a method of modifying the cell genome of cell lines used to produce gene therapy vectors to ensure that these contaminants are not present in the genome of the vector produced thereby.

[0053] To prevent packaging of adventitious agents other than the vector genome, it is proposed to modify the 293 cell line by gene editing to remove the unwanted sequences, such as those identified in this study, to prevent their packaging. Thus a cell line specifically tailored for LV production can be created.

[0054] To mitigate the problems associated with the contaminating nucleic acids identified by the applicant, a method of producing cell lines for producing purified vector is proposed. The method takes advantage of known gene editing techniques such as the CRISPR-Cas9 system to modify the genome of the vector-producing cells to remove contaminating genetic material from the cells so that this cannot end up in the resulting gene therapy vector.

[0055] Virus vectors can be generated using HEK293 (human) cells. These will be titred for comparison with virus generated at the end of the gene deletion (editing) protocol. To modify the HEK 293 cell genome, each of these sequences can be subjected to genome deletion. For each deletion, cell clones can be isolated and subjected to PCR. to show both alleles of the locus have been removed (biallelic). Clones can then be chosen for the next region of DNA to be deleted to generate 293 cells that are still viable but devoid of the unwanted contaminating sequences. The cell line will be subjected to transfection with a reporter plasmid (containing a reporter gene such as that for GFP or ampicillin resistance) to show high frequency transfection is maintained for the cell. Cells will then be used to generate virus vectors at high titre using several cis and trans plasmids.

[0056] An embodiment of a method of producing a cell line for production of a gene therapy vector includes: a) providing a cell line 10 suitable for production of a gene therapy vector 20, the cell line having a genome 12; b) editing the genome 12 of the cell line 10 to remove at least one region of nucleic acid sequence, wherein the region of nucleic acid sequence is unwanted in the gene therapy vector 20 to be produced thereby; and c) confirming deletion of the region of nucleic acid sequence from the genome 12' of the modified cell line 10'.

[0057] In an embodiment of a method of producing a cell line for production of a gene therapy vector, the method includes: a) providing a cell line 10 suitable for production of a gene therapy vector, the cell line having a genome 12; al) manipulating the cell line 10 to render it capable of producing a gene therapy vector 20; a2) producing a gene therapy vector 20 from the cell line 10; a3) analysing the gene therapy vector 20 to identify unwanted nucleic acid sequence; b) editing the genome 12 of the cell line 10 to remove at least one region of nucleic acid sequence identified in Step a3); and c) confirming deletion of the region of nucleic acid sequence from the genome 12' of the modified cell line 10'. With reference to Figure 1, an embodiment of the method includes the following steps: a) Providing a cell line 10 suitable for production of a gene therapy vector 20. Suitable cell lines 10 are specialised cells amenable to high efficiency uptake of nucleic acids to enable them to produce vectors, such as viral vectors. Well known cell lines 10 suitable for this purpose include HEK293 and PER6. b) Editing the genome 12 of the cell line 10 (Figure 1(1)) to remove at least one region of nucleic acid sequence, wherein the region of nucleic acid sequence is unwanted in the gene therapy vector to be produced thereby. Suitable gene editing procedures include the CRISPR / Cas9 system, which enables very precise targeted modification of nucleic acid sequences. In this instance, the gene editing involves excision of regions of unwanted nucleic acid sequence. The resultant modified cell line 10' thus has a modified genome 12'. c) After removal of each region of unwanted nucleic acid sequence, or after removal of all regions of unwanted nucleic acid sequence, confirmation of deletion of the region of nucleic acid sequence in question from the genome 12' of the modified cell line 10' can be carried out, for example, using PCR. This can be done by isolating a clone from the modified cell line 10', then confirming deletion of regions of unwanted nucleic acid using PCR. In embodiments, after removal of each region of unwanted nucleic acid sequence, or after removal of all regions of unwanted nucleic acid sequence, a check is carried out to ensure that the cells are still viable and amenable for making high titre viruses. d) Once modification of the genome 12 of the cell line 10 is complete, the transfection efficiency of the modified cell line 10' can be validated, for example, using a reporter plasmid. e) The modified cell line 10' can then be used to produce vector 20, for example viral vector Figure 1 (III and IV). In an embodiment, the vector is a lentiviral vector 20. This can be done using standard procedures in which the modified cell line 10' is transfected with three plasmids (a packaging vector 14, an envelope vector 16 and a transgene vector 18; Figure 1(11))), which together allow the modified cell line 10' to produce the vector, which is then harvested for use Figure 1 (III).

[0058] Figure 2 sets out the steps of an embodiment of a method.

[0059] A cell line, such as HEK293, amenable to production of a gene therapy vector is provided. This is subjected to gene editing to remove at least a first region of unwanted nucleic acid, for example, one of the contaminating sequences identified by the present inventors (see Examples below). After removal of each region of nucleic acid, PCR. may be used to check successful deletion.

[0060] The method may include removing a plurality of regions of unwanted nucleic acid sequence prior to confirming deletion of the region(s) of nucleic acid from the genome of the modified cell line. In an embodiment, the method includes removing a single region of unwanted nucleic acid sequence prior to confirming deletion of the region of nucleic acid from the genome of the modified cell line, and repeating the editing and confirming steps until all regions of unwanted nucleic acid sequence have been removed from the genome of the cell line.

[0061] Transfection efficiency of the modified cell line can be checked after removal of each region of unwanted nucleic acid and / or after removal of all regions of unwanted nucleic acid. This can be done using a reporter plasmid carrying a reporter gene such as a GFP reporter gene or ampicillin reporter gene. As an additional check, the modified cell line can then be used to generate vector, which itself can then be tested for contaminating nucleic acid. If any remains, the process of editing the genome of the cell line to remove regions of unwanted nucleic acid can be repeated.

[0062] Once the modified cell line has been confirmed not to introduce contaminating nucleic acid into the vector, the modified cell line can be used to produce gene therapy vector with a desired transgene.

[0063] In embodiments, the method takes advantage of CRISPR / Cas9 gene editing amongst other gene editing methods to remove regions of unwanted nucleic acid from the cell line. In other embodiments, other genome editing methods could be used such as zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and meganucleases.

[0064] Established approaches to gene therapy have been based on prior laboratory research, enabling the addition, deletion, or modification of genes in living organisms. CRISPR / Cas9 for genome editing is based on RNA-guided targeting.

[0065] The development of the CRISPR / Cas9-based genome-editing in 2012 came from Doudna and Charpentier who showed that the CRISPR- associated protein Cas9 complexed with CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA), provides a specific endonuclease with a defined cleavage site after base pairing of the crRNA to the target. Following this Cas9 as a endonuclease was shown capable of being programmed with a single "guide RNA" designed to cleave specific DNA (Jinek et al. (2012)). Gasiunas et al. (2012) then showed that purified complexes containing Cas9 and a crRNA could cleave doublestranded DNA at sites complementary to the crRNA. Jinek et al. (2012) made the breakthrough of using single chimeric guide RNA (sgRNA) to fulfil the role of both the crRNA and tracrRNA. Since that time there has been an explosion in the application and refinement of Cas9-mediated cleavage, as well as the discovery of novel CRISPR systems that can be adapted for genome editing.

[0066] The region(s) of unwanted nucleic acid sequence removed from the genome 12 of the cell line 10 may be derived from a virus.

[0067] For example, a region of unwanted nucleic acid derived from at least one of the following may be removed: Human endogenous retrovirus (for example, human endogenous retrovirus K113), BeAn 58058 virus, Chrysochromulina ericina virus, Friend murine leukemia virus, Macaca mulatta polyomavirus (for example, macaca mulatta polyomavirus 1), Salmonella virus (for example, salmonella virus SP6), Human betaherpesvirus (for example, human betaherpesvirus 5), Abelson murine leukemia virus, Pandoravirus dulcis, Finkel-Biskis-Jinkins murine sarcoma virus, Dishui lake phycodnavirus (for example, Dishui lake phycodnavirus 1), Melbournevirus, Cotesia congregata bracovirus, Penguinpox virus, Micromonas pusilia virus (for example, Micromonas pusilia virus 12T), Harvey murine sarcoma virus, Human mastadenovirus (for example, human mastadenovirus C), Marseillevirus marseillevirus, Pandoravirus salinus, Pandoravirus quercus, Escherichia virus (for example, Escherichia virus Pl), Molluscum contagiosum virus (for example, Molluscum contagiosum virus subtype 1), Ectropis obliqua nucleopolyhedrovirus, Sarcoma virus (for example, Y73 sarcoma virus), Avian leukosis virus (for example, avian leukosis virus - R.SA), Pestivirus giraffe-1 (for example, pestivirus giraffe-1 H138), Moloney murine sarcoma virus, Shigella phage (for example, shigella phage SflV), Macropodid alphaherpesvirus (for example, macropodid alphaherpesvirus 1), Yokapox virus, Camelpox virus, Monkeypox virus (for example, monkeypox virus Zaire-96-1-16), Canarypox virus, Brazilian marseillevirus, Only Syngen Nebraska virus (for example, only syngen Nebraska virus 5), Pandoravirus neocaledonia, Bovine viral diarrhea virus (for example, bovine viral diarrhea virus 3 Th / 04_KhonKaen), Cafeteria roenbergensis virus (for example, cafeteria roenbergensis virus BV-PW1).

[0068] In a preferred embodiment, the method includes removing a region of unwanted nucleic acid derived from at least one of, any combination of, or all of the following : Human endogenous retrovirus, BeAn 58058 virus, Chrysochromulina ericina virus, Friend murine leukemia virus, Macaca mulatta polyomavirus, Salmonella virus. The method may include removing at least one of, any combination of, or all regions of unwanted nucleic acid present in the cell line that are derived from human endogenous retrovirus K113, BeAn 58058 virus, chrysochromulina ericina virus, friend murine leukemia virus, macaca mulatta polyomavirus 1, and salmonella virus SP6.

[0069] In an embodiment, the method includes removing at least the following human endogenous retrovirus sequences: m54118_181207_113652 / 15794380 / ccs m54118_181207_113652 / 5832778 / ccs m54118_181207_113652 / 63308073 / ccs m54118_181207_113652 / 46530831 / ccs m54118_181207_113652 / 63505012 / ccs m54118_181207_113652 / 12779821 / ccs m54118_181207_113652 / 47579377 / ccs m54118_181208_080006 / 23855664 / ccs m54118_181208_080006 / 32702952 / ccs m54118_181208_080006 / 42599406 / ccs m54118_181208_080006 / 22610651 / ccs

[0070] EXAMPLES 1 - Production of HIV-1 LV vectors

[0071] Replication defective SIN configuration HIV-l-based particles, HR'SIN- cPPT-SEW-eGFP-W (abbreviated to pHR), carrying either the vector backbone or no vector genome (Figure 3) were generated by three plasmid transient transfection of HEK293T cells. Figure 3 shows each plasmid construct in a linear form. Plasmid "a" (pMD2.G) carried a CMV enhancer, CMV promoter, beta-globin intron 1, VSV-glycoprotein gene, beta-globin poly(A) and components for growth and selection in bacteria. Plasmid "b" (pHR'SIN-cPPT-SFFV-eGFP-WPRE) contained the cPPT region of HIV-1, an SSFV promoter, the eGFP reporter gene, WPR.E, 3'HIV SIN LTR, the promoter / enhancer from SV40 and the 5' SIN HIV LTR. Plasmid "c" (pCMV-dR8.74) contained a CMV promoter to drive the expression of the HIV-1 gag and pol genes, RRE, tet, ampicillin gene and the SV40 early promoter.

[0072] Transient transfection of producer cells with the two packaging plasmids (a and c) used in identical concentrations as transfections that included the third plasmid carrying the vector backbone (b). Viruses were harvested at 48 and 72 hours post transfection for RNA extraction. The GFP reporter gene allows vector genome containing particles to be titrated via FLOW for GFP expression using infected HEK293T cells. Vector titre for both pHR and empty LV, non-genome carrying particles was also determined using a p24 gag ELISA alongside the FLOW titred genome carrying pHR vector batches. Each was diluted to 2.42x10“ TU / ml to ensure that equal LV titres were used for investigation.

[0073] Virus particles in cell supernatants from culture were treated with DNAse I to remove external contaminants then washed in PBS before being lysed and subjected to reverse transcription of the contents of the virus. Agarose gel electrophoresis of the viral vector RNA converted to DNA was followed by PCR amplification to identify the virus genome in virus preps. The results are shown in Figure 4. PCR primers identifying b-actin as a negative control for residual 293 genomic DNA were used. Absence of b-actin in viral samples and presence in cellular nucleic acid indicates the vector to be free of gDNA (293 genomic DNA) contamination. Primers designed for the vector LTR were used to identify positive bands representing reverse transcribed LTRs. Weak LTR bands for non-reverse transcribed samples suggests reverse transcription within particles by HIV-1 RT during maturation. Positive LTR bands in the empty virus particles suggests the presence of contaminating trans plasmid used to generate virus particles. Samples were run on a 2% agarose-TBE gel at 70V for 35 minutes to separate bands in the DNA marker. The absence of bands for B-actin in viral samples but their presence in control cellular nucleic acid demonstrated the vector to be free of gDNA contamination at this level of detection.

[0074] Batches of vectors were also subjected to more sensitive q-RT PCR that also showed no contaminating HEK293T gDNA present (data not shown). PCR of the HIV-1 LTR in samples without reverse transcription identified weak bands suggesting these could have arisen from reverse transcription within HIV-1 particles that is known to occur during maturation. Positive LTR bands in the empty virus particles suggests that the plasmid DNA carrying the HIV-1 trans acting components used to generate virus particles is present. This corresponds with the data analysed from PacBio sequencing of vector RNA. particle contents distance

[0075] Extracted DNAse-1 treated viral RNA samples were examined for RNA integrity using an Agilent 6000 Pico Bioanalyser and RNA pico chips. RNA (lpg) was depleted for rRNA then cleaned and then re-analysed for diminished rRNA profiles. cDNA libraries were synthesised and repeat purified before examination with a DNA HS Bioanalyser chip. PacBio sequencing of the extracted samples identified various reads and the sequence metrics of each prep.

[0076] The vector carrying full particles had a greater number of subreads (3,956,793 reads derived from sequencing) than the empty LV, nongenome carrying LV preparation ((6,617,371 v 2,660,578). The sequence data was processed using the IsoSeq pipeline within the SMRT Link software suite (v5.1.0.26412). As the primary aim of this experiment was to sensitively detect transcripts, the final IsoSeq output files were not used, as these involved iterative clustering of sequences resulting in reduced sensitivity. Instead, the intermediate Circular Consensus Reads (CCS) generated as part of the IsoSeq pipeline were used. These reads were generated by creating a consensus sequence from multiple sequencing passes of the same template molecule that improved sequence quality and reduced errors. As the sensitivity was critical, no lower limit to the minimum number of sequencing passes was specified.

[0077] When processed, a similar number of CCS reads was identified between the vector particles. 657,675 CCS were identified in full viral prep and 691,011 CCS reads in empty particle prep (see Table 1, which gives read metrics for PacBio sequenced viral RNA samples - metrics for pHR and empty LV RNA samples are shown). Table 1 - Read metrics for PacBio sequenced viral RNA samples

[0078] The mean CCS length was similar between full (1,272 bp) and empty (1823 bp) LV vectors. The distribution of CCS read length in both pHR and empty LV particles followed a double exponential curve with the slope flatter for empty LV preps (Figures 5 and 6, which show read length (bp) distribution for pHR and empty LV RNA, respectively; both show a double exponential curve though pHR LV carrying the vector genome shows greater numbers of large read lengths and reads between 0-2000bp).

[0079] Example 3 - Taxonomic assignment based on filtered BLAST analysis shows sequences present of multiple viral origins

[0080] To determine whether library DNA sequences were from RNA contained in virus and not packaged from the HEK293T cell transcriptome, BLAST was used to determine highest probable matches. To confirm this, BLAST searches were made against the pHR viral backbone, human genome and virus RefSeq genome library. These sequences were found to align with HIV-1 abundantly as well as other viruses. To investigate coverage of sequences for full genomic sequences, viral sequences were separated by species and mapped and CCS reads for each sample were taxonomically assigned by using them as a query for nucleotide BLAST (Altschul et al. (1990)) against the viral RefSeq database (https: / / www.ncbi.nlm.nih.gov / genome / viruses / ). Alignments were filtered to retain the single best hit for each CCS read, hits of 80 bp or longer, hits derived from reads that are 100 bp or longer and hits where the alignment matched over at least 10% of the CCS read length. Post-filtering, 23.6% of reads from pHR were taxonomically assigned. However, a much smaller proportion of empty reads were taxonomically assigned (4.3%) due to the alignment lengths generally being extremely short and there is much lower content in this sample. The top 11 species identified based on filtered reads alone are shown (see Table 2).

[0081] Table 2 - PacBio reads of pHR LV and empty LV Table 2 is a taxonomic assignment based on filtered BLAST hits for empty LV and pHR. Hits show the number of reads aligned to pHR and empty virus samples. The taxonomical ID and calculated relative abundances are shown. These abundances are not normalised based on the hit genome's lengths, but simply represent the proportion of reads mapping to each species.

[0082] A full representation of the alignments is provided in Table 3. Table 3 - Taxonomic assignment based on filtered BLAST hits

[0083] Hits show the number of reads aligned to each of the pHR virus and empty virus samples. Calculated relative abundances are also shown. Abundances represent the proportion of reads mapping to each species.

[0084] Note that the Woodchuck hepatitis virus and SFFV reads represent the presence of these elements in the pHR vector and may also represent the presence of the transfected cloning vector (HR'SIN-cPPT-SEW-eGFP- W). As this was not used in the production of empty particles, this sequence was not identified in the empty particle preparation. Furthermore, two aligned taxonomical classes identified in empty viruses (Bovine viral diarrhea virus 3 Th / 04 KhonKaen and Cafeteria roenbergensis virus BV-PW1) were not identified in the pHR LV prep. Conversely, 23 taxonomical classes were identified in full viral particles but not in empty virus suggesting increased aberrant packaging of sequences may be triggered by transgene production.

[0085] In summary, of the sequences set out in Tables 2 and 3 above, those derived from woodchuck hepatitis virus, HIV1, vesicular stomatitis Indiana virus, human adenovirus 5, spleen focus-forming virus, Moloney murine leukaemia virus and human adenovirus 1 are expected to be found in the vectors and do not represent nucleic acid that is considered to be contaminating or otherwise problematic.

[0086] Example 4 - Screening for packaging seguences and cloning vectors

[0087] No sequences carrying the HIV-1 psi (ip) packaging sequence were identified in empty LV particles. In full HIV-1 virions, however, 3,370 CCS reads contained significant hits to the HIV packaging sequence. Of these 3,347 / 3,370 (99.32%) identified with pHR, HIV and human reference databases. 3,289 (98.27%) sequences align with pHR, however, only 26 (0.78%) associated with HIV and 32 (0.96%) with the human reference databases suggesting that with the ip packaging sequences were derived from pHR and the RNA used in this analysis did not derive from a human source. As only 0.51% of all CCS reads (657,675) were identified carrying the ip packaging sequence, this suggests the majority of sequences packaged both in full and empty particles were aberrantly selected. When mapping the sequences identified in full and empty viral preps to the pHR plasmid or the trans acting gag / pol carrying plasmid pCMVR.8.74, this identified numerous sequence alignments suggesting the plasmid vectors used in vector production are packaged at low level (Figures 7 and 8). Figures 7 and 8 illustrate PacBio sequence reads of aligned construct plasmids. Reads identified in viral preps were aligned to the pHR plasmid construct (Figure 7) or pCMVR8.74 (Figure 8). These identify differences in sequence identity between viral preps.

[0088] Example 5 - Detection of HERV contamination of virus preparations

[0089] We noticed that HERV-K113 were detected at low levels in both pHR; (7 hits with relative abundance of 4.15xl0exp-5); and empty particles (4 hits with relative abundance of 1.33xl0exp-3) suggesting these are packaged upon virus production. The identities of these reads are provided in Table 4.

[0090] Table 4 - HERV sequence identity in pHR and Empty LV samples

[0091] HERVK113 reads identified in viral samples were mapped to the

[0092] 5 HERVK113 and human genomes respectively to identify percentage identity. Higher percentage identity is found in the human genome determining this as the source of the transcripts.

[0093] By identifying the relative abundance of human and HERV sequences, it 0 was sought to determine whether there is a disproportionately high amount of HERV, or equivalent amounts, as the latter would suggest that the HERV identified could be from 293T human genomic DNA contamination. 5 To address this, all CCS reads were aligned to the human reference genome, filtered in the same way as described earlier, and counts were calculated. Following this, the counts to human and HERV-K113 sequences were normalised based on the size of the respective genomes, and as a frequency per million reads, i.e. RPKM. In pHR LV 0 prep, the relative abundance of human sequences was calculated as 37.0 RPKM compared to HERV-K113 as 739.2 RPKM. In empty LV preps, human and HERV sequence relative abundance was calculated as 11.6 and 422.4 RPKM, respectively. This identifies significantly greater reads for HERV-K113 in proportion to genome size and suggests HERV-K113 sequences are not derived from human genomic contamination.

[0094] However, it is important to note that the number of HERV-K113 reads is very low for each sample. In addition, the HERV associated reads aligned to HERV-K113 with only moderately high percentage identity, and not across the whole read, excepting for the polyA tail region present in each CCS read. This could mean that the sequences are not, in fact, HERV-K113 derived: For viral classification, reads were aligned to viral RefSeq database, and it may not fully represent all biological diversity, i.e. the sequences may be from different HERV-related genomes.

[0095] Additionally, in all cases, the HERV-associated reads aligned better to the human reference sequence than to the viral database sequences, specifically, the length and BLAST alignment score of matches was better in all cases, and the percentage identity was better in most cases. This suggests the reads could be derived from the human genome, which would be a good indication that there are no nonintegrated HERV sequences. A summary of the key alignment metric differences between HERV and human alignments is shown (Table 5). Table 5 - HER.VK113 sequence read metrics

[0096] pHR and empty LV RNA were identified to contain HERVK113 reads. HERV-associated BLAST hits identified in pHR and empty LV preps were matched against metrics from the same reads aligned against the human reference genome. Metrics of sequences including percentage identity and match rate are shown in Table 5. Seven and 4 sequences were identified in pHR and Empty LV RNA respectively. In general alignments were higher against the human genome rather than the viral RefSeq database.

[0097] Example 6 - HERV-K113 qene transfer in non-human V79 hamster cells

[0098] As the PacBio analysis showed the potential presence of HERV-K113 that were not full-length sequences, whether gene transfer of these genomes occurs following LV infection was next determined. The V79 hamster cell line was chosen for this investigation because these cells are highly permissive to LV infection and being of non-human origin do not carry HERV. To achieve high level infection and transfer of the GFP reporter gene, V79 cells were infected at an MOI of 100 with pHR, titred against HEK293T cells by FLOW cytometry for GFP reporter gene expression and p24 gag assay ELISA. Cells were sampled at 3 days and 6 weeks post infection for FLOW cytometry of GFP expression.

[0099] 100% of cells appeared positive for GFP expression without measurable cytotoxicity (Figure 9). Figure 9 demonstrates infection of V79 hamster cells by pHR LV showing high level of gene transfer to cells. These were cultured for 6 weeks to show persistence of GFP.

[0100] After 7 days V79 DNA was harvested and used for nested PCR analysis for the presence of the pHR LTR and HERV-K113 (Figure 10). The nested PCR results of gDNA from infected pHR LV cells show successful gene transfer. Nested PCR. for HERV fragments however showed no gene transfer in hamster cells. PCR of HEK293T cells are shown in comparison as a positive control. Positive bands were clearly visible for the GFP reporter gene, however, no bands originating from HERV-K113 could be detected in the infected V79 cells as opposed to bands for HERV-K113 in the 293T human genomic DNA.

[0101] Methods for Examples 1 to 6

[0102] Vector production and titration

[0103] The production of HR'SIN-cPPT-SEW-eGFP-W (pHR, full) and no transgene equivalent (empty) LV was carried out as previously described (Khonsari et al. (2016)). pHR LV vector express eGFP under the internal promoter of SFFV. Infectious LV titre was calculated as previously reported (Khonsari et al. (2016)). Briefly, 2 x 105HEK293T cells were seeded and incubated at 37°C, 5% CO2 overnight to adhere. Serial dilutions of virus were prepared and incubated in complete cell culture medium with 5pg / ml polybrene (Sigma Aldrich, Dorset, England), for 20 minutes at room temperature before addition to cells. 72 hours post transfection, cells were harvested for GFP expression analysis via flow cytometry using ACEA Novocyte flow cytometer and NovoExpress software vl.2.5 (Agilent Technologies, Didcot, England).

[0104] Dilutions expressing 1-30% GFP expression were analysed as accurate representations of viral titre, calculated as shown below: Titre (TU / ml) = ((Cell count * (Percentage GFP expression / 100)) / Volume) * DF SIN'LTR LV titre was calculated as 1.18 x 109 TU / ml and pHV was titrated as 3.8 x 109 TU / ml.

[0105] Empty LV, carrying no reporter transgene, were titrated using Lenti-X™ p24 Rapid Titer Kit (Takara Bio), according to manufacturer's instructions. Absorbance was read on Elx808 absorbance reader at 450nm and analysed using Gen5 software (x2.06.10).

[0106] Nucleic acid harvesting

[0107] Cellular DNA and RNA were harvested using DNEasy and RNeasy mini kits (Qiagen) respectively, according to manufacturer's instructions. Viral RNA was harvested via QIAamp® viral RNA mini kit (Qiagen) according to manufacturer's instructions. Nucleic acid concentration was determined using Nanodrop 2000C UV-Vis (vl.2.1) (Fisher Scientific). RNA samples were treated to remove gDNA contamination using RNase free DNase set (Qiagen) according to manufacturer's instructions.

[0108] PacBio DNA sequencing

[0109] RNA samples were sequenced by Centre for Genomic Research, University of Liverpool. Sample preparation of involved RNA integrity using the Agilent 6000 Pico Bioanalyser and RNA pico chips, lpg of RNA per sample was depleted of rRNA using a Ribozero kit followed using RNA clean AMPure beads and re-peated Bioanalyser testing for diminished rRNA profiles. Treated with Cell Script plus poly-A polymerase tailing kit, undergoing 15 cycles of cDNA synthesis being once again purified with the AMPure beads and re-analysed this with a DNA HS Bioanalyser chip.

[0110] The library was produced using the Pac Bio DNA template kit 1.0 followed by a final AMPure bead cleaning and bioanalyser control step, sample were mixed with polymerase and diffusion loaded into LR cells and into a PacBio Sequel 2.1 chemistry Sequencing machine. Settings were 1200 minutes movie times and 240 minutes of pre-extension with a on plate load of 8pM. The data were processed using the Iso-Seq workflow to retrieve CCS.

[0111] DNA contaminants identification

[0112] Prior to sequencing, RNA samples were analysed for gDNA contamination prior to and subsequent to conversion to cDNA using GoScript™ reverse transcriptase (Promega) according to manufacturer's instructions. Samples were amplified via polymerase chain reaction (PCR) against 0- actin and the viral LTR, shown below.

[0113] LTR-F GAGCTCTCTGGCTAACTAGG (SEQ ID NO: 1)

[0114] LTR-R GCTAGAGATTTTCCACACTG (SEQ ID NO: 2)

[0115] SY100216195-080 AAGAGAGGCATCCTCACCCT (SEQ ID NO: 3)

[0116] SY100216195-081 TACATGGCTGGGGTGTTGAA (SEQ ID NO: 4)

[0117] Screening for HERVS, cloning vectors and packaging sequences

[0118] For all searches the same search keys were used to enable comparison, sequence coverage had to be greater or equal to 80 bp, had to be derived from CCS of 100 bp or greater, alignment had to be 10% or greater of the CCS length. The single best result was determined for each CCS where applicable.

[0119] To identify the relative presence of HERV-K113 in the samples, the prevalence of human genomic reads was calculated by aligning all CCS to the human reference genome (GRCh38) and HERV-K113 genome and normalised per kilobase of genome per million reads.

[0120] 7 - Gene editing HEK 293 cells to avoid contaminants and a safer cell line

[0121] Having identified nucleic acid sequences present in lentiviral vectors produced from HEK293T cells that are undesirable, the applicant proposes a method of removing these from the producer cell genome prior to production of viral vector.

[0122] In this Example, sequences derived from human endogenous retrovirus K113, BeAn 58058 virus, chrysochromulina ericina virus, friend murine leukemia virus, macaca mulatta polyomavirus 1, and salmonella virus SP6 are removed from HEK293T cells.

[0123] After confirming that these sequences are present in the HEK293 genome, they are removed using CRISPR excision technology. Checks for viability, transfection efficiency and nucleic acid content of viral vectors produced by the cell line are also carried out.

[0124] An example method is as follows: 1. Identify sequences adjacent to each locus sequence to be removed to generate guide RNAs for excision of each unwanted sequence

[0125] 2. Apply excision technology to the HEK 293 cell line.

[0126] 3. Isolate a set of up to 5 HEK clones that present negative for the excised nucleic acids versus control untreated HEK 293 cells

[0127] 4. Screen each clone for cell viability

[0128] 5. Apply vector plasmid transfection to each modified clone to generate recombinant virus

[0129] 6. Apply exosome removal to the vector batches generated to isolate recombinant virus only carrying only the transgene

[0130] 7. Titre recombinant virus as near to or identical to the virus titre obtained prior to gene sequencing to accept the cells as efficient producer cells

[0131] 8. Apply PacBio long distance DNA sequencing to the recombinant vector from each clone (up to 3) that provides high vector titre

[0132] 9. Align vector sequences to the human and virus genome databases to show only vector genome is packaged and not the excised nucleic acid contaminants

[0133] Sample nucleic acid fragment deletion

[0134] CRISPR Design

[0135] 1. sgRNAs can be designed manually or using freely available online tools (Ran et al. (2013)) using the sequences of the human genome that may be considered to be contaminating vector particles batches or any other identified sequences that are not required. This design will identify guide sequences to minimise genomic matches or near-matches to reduce risk of off-site targeting. Guide sequences will consist of a 20- mer ("protospacer sequence") upstream of an "NGG" sequence ("protospacer adjacent motif" or PAM) at the genomic recognition site.

[0136] 2. The reverse complement of each guide sequence will also be designed.

[0137] 3. 24- or 25-mer oligos for each guide and its associated reverse complement including additional nucleotides for cloning and expression purposes will be obtained. The plasmid pX458 (Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), will allow for the simultaneous expression of sgRNA and SpCas9 and includes GFP and puromycin as selectable markers, respectively, or constructs in which multiple sgRNAs may be expressed from a single plasmid. Cloning can use a "CACC" before the 20-mer guide sequence and "AAAC" before the guide's reverse complement for cloning. A G nucleotide will be added after the CACC sequence and before the 20-mer if the first position of the 20-mer is not G. sgRNA expression from vector is enhanced by the inclusion of a G nucleotide after the CACC sequence. By adding a C at the 3' end of the reverse complement oligo, the resultant oligos would be 25-mer oligos.

[0138] Screening primers to identify deletions

[0139] 1. Primers will be designed internal to the sequence to be deleted ("non-deletion band") and another set of primers upstream and downstream of the sgRNA cleavage sites. In the absence of deletion, the "deletion band" is often too large to efficiently amplify. Typically use primers at least 100 bp from the predicted cleavage site to ensure detection would not be impacted by a small indel at the sgRNA target site.

[0140] 2. Additional primers will be designed to analyse for scarring (small indels produced at the sgRNA cleavage site without the intended deletion). A pair of forward and reverse primers flanking each sgRNA target site (within 150-350 bp) will be used to amplify the sgRNA target site to examine for scarring. This may be useful to characterise the nondeleted allele in monoallelic deletion clones.

[0141] CRISPR Cloning

[0142] 1. Anneal and phosphorylate oligos. i. Resuspend oligos at a concentration of 100 pM in ddhhO. ii. Prepare a 10 pl reaction mix for each guide and its reverse complement: 1.0 pl sgRNA 24- or 25-mer oligo (100 pM), 1.0 pl sgRNA 24- or 25-mer reverse complement oligo (100 pM), 1.0 pl lOx T4 Ligation Buffer, 6.5 pl ddhhO, and 0.5 pl T4 Polynucleotide Kinase (PNK) (10,000 U / ml).

[0143] NOTE: Phosphorylated oligos may be ordered instead. For this approach, the use of T4 PNK is omitted. iii. Anneal in a thermocycler using the following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C / min. iv. Dilute oligos 1 : 10 in ddhhO (e.g., 1.0 pl annealed oligos + 9.0 pl ddFhO to yield a concentration of 1 pM). a. Ligate annealed oligos into pX330 using a Golden Gate assembly cloning strategy (Wu et al. (2013)). b. Prepare a 50 pl reaction mix: 100 ng circular pX330 vector, 1.0 pl annealed oligos (1 pM), 5.0 pl restriction enzyme buffer (lOx), 4.0 pl (20 U) BbsI restriction enzyme (5,000 U / ml), 5.0 pl ATP (10 mM), 0.25 pl (5 pg) BSA (20 mg / ml), 0.375 pl (750 U) T4 DNA ligase(2,000,000 U / ml), and H2O to final volume of 50 pl. This reaction may be scaled down to a smaller final volume if necessary. c. Run samples in a thermocycler using the following parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling conditions allow for digestion and ligation to occur in one reaction. d. Transform 10 pl of DH5o E. coli cells with 1 l of reaction. e. Plate onto a lysogeny broth (LB) agar plate with 100 pg / ml ampicillin and incubate O / N at 37 °C. f. Pick 2-3 colonies and inoculate into a mini-prep culture. g. Perform mini-prep for each sample and sequence each colony using a U6 promoter forward primer:

[0144] CGTAACTTGAAAGTATTTCGATTTCTTGGC (SEQ ID NO: 5). This is a representative sequencing primer; other flanking primers may be utilised. h. Choose a sequence-verified colony and inoculate into a maxi-prep culture. Prep size may be scaled based on the required DNA yield. i. Perform maxi-prep for each CRISPR / Cas9 construct.

[0145] Transfecting CRISPRs into Cells of Interest

[0146] NOTE: This protocol involves the delivery of CRISPR / Cas9 plasmids using electroporation (Gehl (2003)). The culture is DMEM supplemented with 2% penicillin / streptomycin and 1% L-glutamine.

[0147] However, transient transfection of CRISPR / Cas9 plasmids may be successfully adapted to numerous cell types using preferred culture conditions and transfection strategies for each cell type. j. Ensure there are 2 x 106cells per CRISPR pair. Resuspend 2 x 106cells in 100 pl of electroporation solution and add to electroporation cuvette. k. Add 5 pg of each CRISPR / Cas9 construct (10 pg total). Add 0.5 pg of GFP expression construct. l. Electroporate cells with 250 volts for 5 msec in a 2 mm cuvette using an electroporation system or use another transfection method such as cationic liposome-based transfection. m. Immediately transfer solution from cuvette into 1 ml of culture media after electroporation. Minimize the time between electroporation and transferring the solution into media to enhance cell viability. n. Incubate at 30-37 °C for 24-72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable.

[0148] Fluorescence Activated Cell Sorting (FACS) of Transfected Cells o. Prepare cells for FACS by filtering them through a 50 pm filter into a FACS tube. p. FACS sort the top ~3% of GFP positive cells in order to enrich for cells that received high levels of the CRISPR / Cas9 constructs. q. Plate sorted cells individually into 96-well round-bottom plates using sorter or by using limiting dilution at 30 cells per 96-well roundbottom plate. Optimize plating the cell type used at limiting dilution prior to performing this step to reliably obtain approximately 30 cells per 96-well plate. r. Include 100 pl per well of cell culture media. s. For the remaining sorted cells ("bulk") that were not plated, freeze half of the cells for future plating. Plate the other half for screening and primer validation.

[0149] NOTE: This protocol is for suspension cells. Adherent cells can either grow as individual cells in 96-well flat bottom plate or in a 10 cm dish at low concentration so that individual single-cell derived clones can be picked and moved to a flat bottom 96-well plate. t. Allow the bulk cells to incubate at 37 °C for 3 - 7 days and allow the clones to incubate at 37 °C for 7 - 14 days. Vary these times depending on the doubling time of the cell line used.

[0150] NOTE: This incubation time allows for sufficient cell proliferation for screening genomic DNA (gDNA) for the intended deletion by PCR. The bulk cells have sufficiently proliferated when the concentration exceeds ~100,000 cells / ml or for adherent cells, the cells have reached ~80% confluence. The clones have sufficiently proliferated once macroscopically visible with ~2 mm diameter.

[0151] Primer Validation and Screening for CRISPR / Cas9-Mediated Deletion u. Isolate gDNA from parental and bulk sorted cells by resuspending parental and bulk cell pellets in 50 pl of DNA extraction solution.

[0152] NOTE: Generally ~100,000 cells are used for DNA extraction, although a wide range of cell numbers is acceptable. The bulk sorted cells are composed of a polyclonal population exposed to sgRNA-A and sgRNA-B. The purpose of the following PCR is to validate primers and verify the presence of intended genomic deletion. v. Run sample in thermocycler and run the following program: 65 °C for 6 min, 98 °C for 2 min to extract gDNA. Measure the DNA concentration.

[0153] NOTE: Any method for genomic DNA isolation may be utilised to be able to perform PCR. w. Assemble a 20 pl PCR with the following components: 10 pl 2x PCR mix, 0.5 pl forward primer (10 pM), 0.5 pl reverse primer (10 pM), 50-100 ng gDNA, and H2O up to 20 pl. Use the primers designed above. Conduct PCR for "non-deletion band" and "deletion band" in separate reactions. NOTE: Numerous polymerases may be used. x. Run samples in a thermocycler using the following parameters: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10 min. Optimize PCR conditions for each primer pair designed based on testing the bulk sorted cells. y. Run samples on 2% agarose gel at 10 V / cm using lx Tris- acetate-EDTA (TAE) buffer. z. Examine samples for the presence / absence of non-deletion and deletion bands. Consider multiplexing the "deletion" and "non-deletion" PCR primer pairs in a single reaction. Optimise multiplexing in a polyclonal population (i.e., bulk sorted cells) before screening individual clones. It is critical that the deletion and non-deletion amplicons be easily resolved on an agarose gel for multiplexing.

[0154] Screening CRISPR / Cas9 Clones for Deletions and Clone Selection

[0155] I. For suspension cells, transfer all clones to a single 96-well plate that already contains 50 pl cell culture media per well for a final volume of 150 pl. This facilitates screening by allowing a multichannel pipette to be used for the remainder of the steps.

[0156] II. Transfer 50 pl from each well (leaving 100 pl in each well) to a 96-well PCR plate using a multichannel pipette.

[0157] III. Centrifuge PCR plate at 400 x g for 5 min and remove supernatant by flicking the PCR plate over a sink. Add 50 pl of DNA extraction solution per well and resuspend.

[0158] IV. For adherent cells, aspirate media. Add 20 pl of 0.05% trypsin- EDTA to each well with a clone present.

[0159] V. Resuspend cells in 200 pl of media. Pipette mix to detach cells. VI. Plate 100 pl each into two separate 96-well flat-bottom plates. Keep one plate to allow for clones to grow and use the other plate to screen each clone for deletions.

[0160] VII. Add an additional 100 pl to each well for a total volume of 200 pl. Wait 24 - 72 hr to allow cells to grow.

[0161] VIII. Aspirate media. Add 50 pl DNA extraction solution per well, resuspend and transfer to 96-well PCR plate.

[0162] IX. Extract the gDNA from clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract gDNA

[0163] X. Screen each clone using the same PCR primers and reaction conditions optimized on the bulk cells

[0164] XI. Select the clones identified with the desired deletion and move to larger plate or flask for growth.

[0165] Validation of Biallelic Deletion Clones

[0166] 1. In order to characterise obtained clones and validate a successful knockout, evaluate clones at the DNA as well as RNA and / or protein levels.

[0167] 2. To evaluate the DNA, amplify deletion bands from biallelic deletion clones with a proofreading polymerase and clone the amplicons (e.g., with a PCR cloning kit) into a plasmid vector. Transform the plasmid into DH5o E. coll cells and plate onto LB agar plates with the relevant antibiotic. Select multiple colonies, mini-prep each one, and subject each clone to Sanger sequencing to characterise each deletion allele (Zhang & Cahalan (2007); Froger & Hall (2007); Finney et al. (2001)). Repeating the PCR test for deletion after the initial screen ensures that the correct clone was selected and reproducibility of results. i. To evaluate the RIMA, perform RT-qPCR for gene expression of the relevant gene (Finney et al. (2001); Gordanpour et al. (2012). ii. To evaluate the protein, perform an immunoblot using an antibody against the relevant protein (Eslami & Lujan (2010)).

[0168] Production of lentivirus particles

[0169] Self-inactivating (SIN) HIV-l-based lentiviral vectors (LV) are produced using a three-plasmid or 4 transient transfection system, as previously described by Ding & Kilpatrick (2013).

[0170] Plasmids used for transfection in a typical transfection reagent such as PEI or Genejuice® are shown in Table 6.

[0171] Table 6 - Plasmid and transfection reagents used for gene transfer to HEK 293T cells

[0172] Transfection of HEK 293 cells

[0173] 1.5 x 107HEK 293T cells are seeded in a complete medium in a T175cm2flask and incubated overnight at 37°C, 5% CO2. A DNA solution containing the vector backbone construct, envelope plasmid and gag-pol packaging plasmid are prepared at a ratio of 4:3: 1 in 5ml 0.22pm filtered Opti-MEMTM (ThermoFisher). Another solution is prepared by adding transfection reagent in 5ml of 0.22pm filtered Opti- MEMTM. The prepared DNA solution and transfection reagent solution are mixed and kept at room temperature for 20 minutes. The seeded cells are washed with Opti-MEMTM, and DNA complexes are added to the cells and incubated at 37°C, 5% CO2, for 4-24 hours. The media is then replaced with 10ml of complete medium (just enough medium to cover the cells). 24 hours after the medium change, the supernatant should be harvested from the producer cells, filtered through a 0.45pm filter and stored in a centrifuge tube at 4°C. The medium is replaced and harvested again over the next two days.

[0174] Virus Concentration

[0175] Filtered crude viral harvests collected over three days are loaded into sterilised 38.5 mL, Open-Top Thin wall Ultra-Clear Tubes (Beckman Coulter Ltd, Buckinghamshire, UK) and placed into an SW32Ti rotor. The samples are then ultra-centrifuged for 2.5 hours at 4°C, spinning at 23000 R.PM using Optima XPN. Immediately after ultracentrifugation, the supernatant is carefully decanted and the LV pellet is air dried for 10 minutes before resuspension in 200pl of Opti-MEMTM. The tubes are left on ice for an hour before being subjected to pipetting up and down several times. Finally, concentrated LV is stored at -80 °C in aliquots of 20pl. Virus can also be purified using a variety of technologies including affinity chromatography, hollow fibre filtration (2, 3).

[0176] Lentiviral titration by flow cytometry

[0177] Viral titre is determined using a flow cytometry-based gene transfer assay. This method is exclusively used to titre stocks of vectors that carry a transgene, allowing easy monitoring by flow cytometry (such as GFP, other living colours, or any membrane protein detected by flow cytometry). 2xl05HEK 293T cells / well are seeded in a 12-well plate with 1 ml of complete DMEM and incubated at 37°C and 5% CO2. 24 hours after incubation, one well is sacrificed to quantify the number of cells per well before viral exposure. For the non-concentrated vector, the cells are transduced with 500 pl, 100 pl, 50 pl, 20 pl and 10 pl of crude supernatant, and the volume is made up to 500 pl with complete DMEM. One well is kept as a non-transduced control (NI). For concentrated vector, the cells are transduced with: lpl, 10 -1, 10 -2, 10 -3 and 10 -4 pl of vector in 500 pl of fresh complete DMEM (Gibco) and incubated with a cationic Polymer (2-hydroxyethyl methacrylate), Polybrene (Hexadimethrine Bromide Sigma Aldrich) to achieve a final concentration of 5pg / ml for 20 minutes before transducing the cells. 24 hours after the transduction medium is replaced, the transduced cells are incubated for 48 hours before being detached and subjected to flow cytometry analysis using an ACEA Novocyte flow cytometer. 5,000 to 10,000 events are collected, whereby gated data and viral titres are calculated from virus dilutions, whereby 1-30% of the cell population is eGFP-positive. Infectious titre (IllF / ml) is then calculated.

[0178] Dilutions expressing 1-30% GFP expression are analysed as accurate representations of viral titre, calculated as shown below: Titre (TU / ml) = ((Cell count * (Percentage GFP expression / 100)) / Volume) * DF pHR LV titre was calculated as 1.18 x 109TU / ml.

[0179] Empty LV, carrying no reporter transgene, were titrated using Lenti-X™ p24 Rapid Titer Kit (Takara Bio), according to manufacturer's instructions. Absorbance was read on Elx808 absorbance reader at 450nm and analysed using Gen5 software (v2.06.10). Nucleic acid harvesting, sequencing of viral nucleic acids and contaminant identification

[0180] These may be carried out using the methods provided above for Examples 1 to 6.

[0181] Taxonomic assignment based on filtered BLAST analysis shows sequences present of multiple viral origins

[0182] To determine whether library DNA sequences are from RIMA contained in virus and not packaged from the HEK293T cell transcriptome, BLAST can be used to determine highest probable matches. To confirm this, BLAST searches can be made against the pHR viral backbone, human genome and virus RefSeq genome library. These sequences were found to align with HIV-1 abundantly as well as other viruses.

[0183] Screening for HERVS, cloning vectors and packaging sequences For all searches the same search keys can be used to enable comparison, sequence coverage should be greater or equal to 80 bp, should be derived from CCS of 100 bp or greater, alignment should be 10% or greater of the CCS length. The single best result is determined for each CCS where applicable.

[0184] To identify the relative presence of HERV-K113 in the samples, the prevalence of human genomic reads is calculated by aligning all CCS to the human reference genome (GRCh38) and HERV-K113 genome and normalised per kilobase of genome per million reads.

[0185] The present applicant has identified nucleic acid sequences in the genomes of viral vectors that originate from contaminating nucleic acid within the genome of the producer cells. It proposes that improvements to producer cells, and resulting improved gene therapy vectors, can be made by modifying the genome of the producer cells to remove the contaminating nucleic acid prior to vector production.

[0186] All optional and preferred features and modifications of the described embodiments and dependent claims are usable in all aspects of the invention taught herein. Furthermore, the individual features of the dependent claims, as well as all optional and preferred features and modification of the described embodiments are combinable and interchangeable with one another.

[0187] The disclosures in United Kingdom patent application 2418718.9, from which this application claims priority, and in the accompanying Abstract are incorporated herein by reference.

[0188] References

[0189] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990 October 05;215(3):403-410.

[0190] Aslan C, Kiaie SH, Zolbanin NM, Lotfinejad P, Ramezani R, Kashanchi F, et al. Exosomes for mRNA delivery: a novel biotherapeutic strategy with hurdles and hope. BMC Biotechnol 2021 March 10;21(l):20-021.

[0191] Baekelandt V, Eggermont K, Michiels M, Nuttin B, Debyser Z. Optimized lentiviral vector production and purification procedure prevents immune response after transduction of mouse brain. Gene Ther 2003 November 01;10(23): 1933-1940. Bandeira V, Peixoto C, Rodrigues AF, Cruz PE, Alves PM, Coroadinha AS, et al. Downstream processing of lentiviral vectors: releasing bottlenecks. Hum Gene Ther Methods 2012 August 01;23(4):255-263.

[0192] Beimforde N, Hanke K, Ammar I, Kurth R, Bannert N. Molecular cloning and functional characterization of the human endogenous retrovirus K113. Virology 2008 February 05;371(l):216-225.

[0193] Burns JC, Friedmann T, Driever W, Burrascano M, Yee JK. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc. Natl. Acad. Sci. U.S. A. 1993;90(17):8033-8037.

[0194] Cavazzana-Calvo M, Payen E, Negre 0, Wang G, Hehir K, Fusil F, et al. Transfusion independence and HMGA2 activation after gene therapy of human beta-thalassaemia. Nature 2010 September 16;467(7313):318- 322.

[0195] Chandler RJ, LaFave MC, Varshney GK, Trivedi NS, Carrillo-Carrasco N, Senac JS, et al. Vector design influences hepatic genotoxicity after adeno-associated virus gene therapy. J Clin Invest 2015 February 01;125(2):870-880.

[0196] Cohen CJ, Lock WM, Mager DL. Endogenous retroviral LTRs as promoters for human genes: a critical assessment. Gene 2009 December 15;448(2): 105-114. Contreras-Galindo R, Kaplan MH, Markovitz DM, Lorenzo E, Yamamura Y. Detection of HERV-K(HML-2) viral RNA in plasma of HIV type 1- infected individuals. AIDS Res Hum Retroviruses 2006 October 01;22(10):979-984.

[0197] Contreras-Galindo R, Lopez P, Velez R, Yamamura Y. HIV-1 infection increases the expression of human endogenous retroviruses type K (HERV-K) in vitro. AIDS Res Hum Retroviruses 2007 January 01;23(l): 116-122.

[0198] Cornetta K, Yao J, Jasti A, Koop S, Douglas M, Hsu D, et al. Replication- competent lentivirus analysis of clinical grade vector products. Mol Ther 2011 March 01;19(3):557-566.

[0199] Ding & Kilpatrick Methods Mol Biol. 2013 Lentiviral vector production, titration, and transduction of primary neurons.

[0200] 1018: 119-31.

[0201] Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol 1998 November 01;72(ll):8463-8471.

[0202] Eslami A, Lujan J. Western blotting: sample preparation to detection. J. Vis. Exp. 14, 2359 2010.

[0203] Finney M, Nisson PE, Rashtchian A. Molecular cloning of PCR products.

[0204] Current Protocols in Molecular Biology Chapter 15, Unit 15.4 2001. Fouchier RA, Simon JH, Jaffe AB, Malim MH. Human immunodeficiency virus type 1 Vif does not influence expression or virion incorporation of gag-, pol-, and env-encoded proteins. J Virol 1996 December 01;70(12):8263-8269.

[0205] Froger A, Hall JE. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. 2007, 253 2007.

[0206] Gasiunas G, Barrangou R, Horvath P, Siksnys V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America. 2012;109(39):E2579-E2586.

[0207] Gehl J. Electroporation: theory and methods, perspectives for drug delivery, gene therapy and research. Acta Physiologica Scandinavica 177, 437-447 2003. PubMed.

[0208] Ginn SL, Amaya AK, Alexander IE, Edelstein M, Abedi MR. Gene therapy clinical trials worldwide to 2017: An update. J Gene Med 2018 May 01;20(5):e3015.

[0209] Gordanpour A, Nam RK, Sugar L, Bacopulos S, Seth A. MicroRNA detection in prostate tumors by quantitative real-time PCR (qPCR). J. Vis. Exp. 16, e3874 2012.

[0210] Grandi N, Pisano MP, Scognamiglio S, Pessiu E, Tramontano E.

[0211] Comprehensive Analysis of HERV Transcriptome in HIV+ Cells: Absence of HML2 Activation and General Downregulation of Individual HERV Loci. Viruses 2020 April 23;12(4): 10.3390 / vl2040481. Jern P, Coffin JM. Effects of retroviruses on host genome function. Annu Rev Genet 2008;42:709-732.

[0212] Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337(6096):816-821.

[0213] Khonsari H, Schneider M, Al-Mahdawi S, Chianea YG, Themis M, Parris C, et al. Lentivirus-meditated frataxin gene delivery reverses genome instability in Friedreich ataxia patient and mouse model fibroblasts. Gene Ther 2016 December 01;23(12):846-856.

[0214] Li M, Radvanyi L, Yin B, Rycaj U - Li, Jia, Li J, Chivukula R, et al. Correction: Downregulation of Human Endogenous Retrovirus Type K (HERV-K) Viral env RNA in Pancreatic Cancer Cells Decreases Cell Proliferation and Tumor Growth. Clin Cancer Res 2019 May 01;25(9):2936-0432.CCR.

[0215] Lu K, Heng X, Summers MF. Structural determinants and mechanism of HIV-1 genome packaging. J Mol Biol 2011 July 22;410(4):609-633.

[0216] (3) Lundstrom K. Viral Vectors in Gene Therapy. Diseases 2018 May 21; 6(2): 10.3390 / diseases6020042.

[0217] McNally DJ, Darling D, Farzaneh F, Levison PR, Slater NK. Optimised concentration and purification of retroviruses using membrane chromatography. J Chromatogr A 2014 May 02;1340:24-32. Milone MC, O'Doherty U. Clinical use of lentiviral vectors. Leukemia 2018 July 01;32(7): 1529-1541.

[0218] Montini E, Cesana D, Schmidt M, Sanvito F, Bartholomae CC, Ranzani M, et al. Genotoxic potential of retroviral vectors is strongly modulated by vector design and integration site selection in a mouse model of HSC gene therapy. Journal of Clinical Investigation 2009;119(4):964-975.

[0219] Nowrouzi A, Cheung WT, Li T, Zhang X, Arens A, Paruzynski A, et al. The fetal mouse is a sensitive genotoxicity model that exposes lentiviral-associated mutagenesis resulting in liver oncogenesis. Mol Ther 2013 February 01;21(2):324-337.

[0220] Ogata T, Okui N, Sakuma R, Kobayashi N, Kitamura Y. Integrase of human endogenous retrovirus K-10 supports the replication of replication-incompetent Int- human immunodeficiency virus type 1 mutant. Jpn J Infect Dis 1999 December 01;52(6):251-252.

[0221] Patience C, Takeuchi Y, Cosset FL, Weiss RA. Packaging of endogenous retroviral sequences in retroviral vectors produced by murine and human packaging cells. J Virol 1998 April 01;72(4):2671-2676.

[0222] Qiao J, Moreno J, Sanchez-Perez L, Kottke T, Thompson J, Caruso M, et al. VSV-G pseudotyped, MuLV-based, semi-replication-competent retrovirus for cancer treatment. Gene Ther 2006 October 01;13(20): 1457-1470. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8, 2281- 2308. 2013.

[0223] Rasmussen HB, Geny C, Deforges L, Perron H, Tourtelotte W, Heltberg A, et al. Expression of endogenous retroviruses in blood mononuclear cells and brain tissue from multiple sclerosis patients. Acta Neurol Scand Suppl 1997;169:38-44.

[0224] Rulli SJ, Hibbert CS, Mirro J, Pederson T, Biswal S, Rein A. Selective and nonselective packaging of cellular RNAs in retrovirus particles. J Virol 2007 June 01;81(12):6623-6631.

[0225] Sakai H, Siomi H, Shida H, Shibata R, Kiyomasu T, Adachi A. Functional comparison of transactivation by human retrovirus rev and rex genes. J Virol 1990 December 01;64(12): 5833-5839.

[0226] Srinivasachar Badarinarayan S, Shcherbakova I, Langer S, Koepke L, Preising A, Hotter D, et al. HIV-1 infection activates endogenous retroviral promoters regulating antiviral gene expression. Nucleic Acids Res 2020 November 04;48(19): 10890-10908.

[0227] Themis M, Waddington SN, Schmidt M, von Kalle C, Wang Y, Al-Allaf F, et al. Oncogenesis following delivery of a nonprimate lentiviral gene therapy vector to fetal and neonatal mice. Mol Ther 2005 October 01;12(4):763-771. van der Kuyl, A C. HIV infection and HERV expression: a review. Retrovirology 2012 January 16;9:6-4690. Wu Y, Liang D, Wang Y, Bai M, Tang W, Bao S, Yan Z, Li D, Li J. Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell 13, 659-662 2013.

[0228] Yu HL, Zhao ZK, Zhu F. The role of human endogenous retroviral long terminal repeat sequences in human cancer (Review). Int J Mol Med 2013 October 01;32(4):755-762.

[0229] Zeilfelder U, Frank 0, Sparacio S, Schon U, Bosch V, Seifarth W, et al. The potential of retroviral vectors to cotransfer human endogenous retroviruses (HERVs) from human packaging cell lines. Gene 2007 April 01;390(l-2):175-179.

[0230] Zhang S, Cahalan MD. Purifying plasmid DNA from bacterial colonies using the Qiagen Miniprep Kit. J. Vis. Exp. 2007, 247 2007.

[0231] Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 1997 September 01;15(9):871-875.

[0232] Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, et al. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 1998 December 01;72(12):9873-9880.

Claims

1. CLAIMS1. A method of producing a cell line for production of a gene therapy vector including : a) providing a cell line suitable for production of a gene therapy vector, the cell line having a genome; b) editing the genome of the cell line to remove at least one region of nucleic acid sequence, wherein the region of nucleic acid sequence is unwanted in the gene therapy vector to be produced thereby; and c) confirming deletion of the region of nucleic acid sequence from the genome of the modified cell line.

2. A method of producing a cell line for production of a gene therapy vector including : a) providing a cell line suitable for production of a gene therapy vector, the cell line having a genome; al) manipulating the cell line to render it capable of producing a gene therapy vector; a2) producing a gene therapy vector from the cell line; a3) analysing the gene therapy vector to identify unwanted nucleic acid sequence; b) editing the genome of the cell line to remove at least one region of nucleic acid sequence identified in Step a3); and c) confirming deletion of the region of nucleic acid sequence from the genome of the modified cell line.

3. A method as claimed in claim 1 or 2, including removing a plurality of regions of unwanted nucleic acid sequence.

4. A method as claimed in claim 3, wherein Step b) includes removing a plurality of regions of unwanted nucleic acid sequence prior to carrying out Step c).

5. A method as claimed in claim 3, wherein Steps b) includes removing a single region of unwanted nucleic acid sequence prior to carrying out Step c), and wherein Steps b) and c) are repeated until all regions of unwanted nucleic acid sequence have been removed from the genome of the cell line.

6. A method as claimed in any preceding claim, wherein the region of unwanted nucleic acid sequence is derived from a virus.

7. A method as claimed in any preceding claim, wherein Step b) includes removing a region of unwanted nucleic acid derived from at least one of the following :Human endogenous retrovirusBeAn 58058 virusChrysochromulina ericina virusFriend murine leukemia virusMacaca mulatta polyomavirusSalmonella virusHuman betaherpesvirusAbelson murine leukemia virusPandoravirus dulcisFinkel-Biskis-Jinkins murine sarcoma virusDishui lake phycodnavirus MelbournevirusCotesia congregata bracovirusPenguinpox virusMicromonas pusilia virusHarvey murine sarcoma virusHuman mastadenovirusMarseillevirus marseillevirusPandoravirus salinusPandoravirus quercusEscherichia virusMolluscum contagiosum virusEctropis obliqua nucleopolyhedrovirusSarcoma virusAvian leukosis virusPestivirus giraffe-1Moloney murine sarcoma virusShigella phageMacropodid alphaherpesvirusYokapox virusCamelpox virusMonkeypox virusCanarypox virusBrazilian marseillevirusOnly Syngen Nebraska virusPandoravirus neocaledoniaBovine viral diarrhea virusCafeteria roenbergensis virus.

8. A method as claimed in claim 7, wherein the human endogenous retrovirus is human endogenous retrovirus K113, wherein the macaca mulatta polyomavirus is macaca mulatta polyomavirus 1, wherein thesalmonella virus is salmonella virus SP6, wherein the human betaherpesvirus is human betaherpesvirus 5, wherein the Dishui lake phycodnavirus is Dishui lake phycodnavirus 1, wherein the Micromonas pusilia virus is Micromonas pusilia virus 12T, wherein the human mastadenovirus is human mastadenovirus C, wherein the Escherichia virus is Escherichia virus Pl, wherein the Molluscum contagiosum virus is Molluscum contagiosum virus subtype 1, wherein the sarcoma virus is Y73 sarcoma virus, wherein the avian leukosis virus is avian leukosis virus - R.SA, wherein the pestivirus giraffe-1 is pestivirus giraffe-1 H138, wherein the shigella phage is shigella phage SflV, wherein the macropodid alphaherpesvirus is macropodid alphaherpesvirus 1, wherein the monkeypox virus is monkeypox virus Zaire-96-1-16, wherein the only syngen Nebraska virus is only syngen Nebraska virus 5, wherein the bovine viral diarrhea virus is bovine viral diarrhea virus 3 Th / 04_KhonKaen, and / or wherein the cafeteria roenbergensis virus is cafeteria roenbergensis virus BV-PW1.

9. A method as claimed in any preceding claim, wherein Step b) includes removing a region of unwanted nucleic acid derived from at least one of the following :Human endogenous retrovirus BeAn 58058 virus Chrysochromulina ericina virus Friend murine leukemia virus Macaca mulatta polyomavirus Salmonella virus.

10. A method as claimed in claim 9, including removing all regions of unwanted nucleic acid present in the cell line that are derived fromhuman endogenous retrovirus K113, BeAn 58058 virus, chrysochromulina ericina virus, friend murine leukemia virus, macaca mulatta polyomavirus 1, and salmonella virus SP6.

11. A method as claimed in any of claims 1 to 9, including removing at least one region of unwanted nucleic acid derived from human endogenous retrovirus.

12. A method as claimed in claim 11, including removing the following sequences: m54118_181207_113652 / 15794380 / ccs m54118_181207_113652 / 5832778 / ccs m54118_181207_113652 / 63308073 / ccs m54118_181207_113652 / 46530831 / ccs m54118_181207_113652 / 63505012 / ccs m54118_181207_113652 / 12779821 / ccs m54118_181207_113652 / 47579377 / ccs m54118_181208_080006 / 23855664 / ccs m54118_181208_080006 / 32702952 / ccs m54118_181208_080006 / 42599406 / ccs m54118_181208_080006 / 22610651 / ccs13. A method as claimed in any preceding claim, wherein the cell line is HEK293 or PER.6.

14. A method as claimed in any preceding claim, wherein Step c) includes isolating a clone from the modified cell line and confirming deletion of regions of unwanted nucleic acid using PCR.

15. A method as claimed in any preceding claim, wherein the genome editing is carried out using CR.ISPR. gene editing.

16. A method as claimed in any preceding claim, wherein the viability of the modified cell line is checked after removal of each region of unwanted nucleic acid.

17. A method as claimed in any preceding claim, including validating the transfection efficiency of the modified cell line obtained from Step c) after all regions of unwanted nucleic acid have been removed.

18. A method as claimed in claim 17, including validating the transfection efficiency of the modified cell line obtained from Step c) after removal of each region of unwanted nucleic acid.

19. A method as claimed in claim 17 or 18, wherein the transfection efficiency is validated using a reporter plasmid.

20. A method as claimed in any preceding claim, wherein the method includes using the modified cell line to make vector and confirming that the vector does not include any unwanted nucleic acid.

21. A method as claimed in any preceding claim, wherein the vector is a viral vector.

22. A method as claimed in any preceding claim, wherein the vector is a retroviral vector.

23. A method as claimed in any preceding claim, wherein the vector is a lentiviral vector.

24. A modified cell line obtainable by a method as claimed in any preceding claim.

25. A method of making a gene therapy vector including: a) providing a modified cell line as claimed in claim 24; b) using the modified cell line to make a gene therapy vector.

26. A method as claimed in claim 25, wherein the method includes transfecting the modified cell line with plasmids for viral vector production and a transgene, wherein the gene therapy vector is a viral vector.

27. A gene therapy vector obtainable by a method as claimed in claim 25 or 26.

28. A gene therapy vector as claimed in claim 27, wherein the gene therapy vector does not contain nucleic acid sequences derived from: Human endogenous retrovirus, optionally human endogenous retrovirus K113BeAn 58058 virusChrysochromulina ericina virusFriend murine leukemia virusMacaca mulatta polyomavirus, optionally macaca mulatta polyomavirus 1 and / orSalmonella virus, optionally salmonella virus SP6.

29. A gene therapy vector as claimed in claim 27 or 28, wherein the gene therapy vector does not contain nucleic acid sequences derived from:Human betaherpesvirus, optionally human betaherpesvirus 5Abelson murine leukemia virusPandoravirus dulcisFinkel-Biskis-Jinkins murine sarcoma virusDishui lake phycodnavirus, optionally Dishui lake phycodnavirus 1 MelbournevirusCotesia congregata bracovirusPenguinpox virusMicromonas pusilia virus, optionally Micromonas pusilia virus 12THarvey murine sarcoma virusHuman mastadenovirus, optionally Human mastadenovirus CMarseillevirus marseillevirusPandoravirus salinusPandoravirus quercusEscherichia virus, optionally Escherichia virus PlMolluscum contagiosum virus, optionally molluscum contagiosum virus subtype 1Ectropis obliqua nucleopolyhedrovirusSarcoma virus, optionally Y73 sarcoma virusAvian leukosis virus, optionally Avian leukosis virus - R.SAPestivirus giraffe-1, optionally pestivirus giraffe-1 H138Moloney murine sarcoma virusShigella phage, optionally shigella phage SflVMacropodid alphaherpesvirus, optionally macropodid alphaherpesvirus 1 Yokapox virusCamelpox virusMonkeypox virus, optionally monkeypox virus Zaire-96-1-16Canarypox virusBrazilian marseillevirusOnly syngen Nebraska virus, optionally Only syngen Nebraska virus 5 Pandoravirus neocaledoniaBovine viral diarrhea virus, optionally bovine viral diarrhea virus 3 Th / 04_KhonKaen and / orCafeteria roenbergensis virus, optionally Cafeteria roenbergensis virus BV-PW1.

30. A gene therapy vector as claimed in claim 27, 28 or 29, wherein the gene therapy vector does not contain nucleic acid sequences derived from any of the following:Human endogenous retrovirus, optionally human endogenous retrovirus K113BeAn 58058 virusChrysochromulina ericina virusFriend murine leukemia virusMacaca mulatta polyomavirus, optionally macaca mulatta polyomavirus 1Salmonella virus, optionally salmonella virus SP6.

31. A gene therapy vector as claimed in any of claims 27 to 30, wherein the gene therapy vector does not contain nucleic acid sequences derived from any of the following:Human betaherpesvirus, optionally human betaherpesvirus 5Abelson murine leukemia virusPandoravirus dulcisFinkel-Biskis-Jinkins murine sarcoma virusDishui lake phycodnavirus, optionally Dishui lake phycodnavirus 1MelbournevirusCotesia congregata bracovirusPenguinpox virusMicromonas pusilia virus, optionally Micromonas pusilia virus 12THarvey murine sarcoma virusHuman mastadenovirus, optionally Human mastadenovirus CMarseillevirus marseillevirusPandoravirus salinusPandoravirus quercusEscherichia virus, optionally Escherichia virus PlMolluscum contagiosum virus, optionally molluscum contagiosum virus subtype 1Ectropis obliqua nucleopolyhedrovirusSarcoma virus, optionally Y73 sarcoma virusAvian leukosis virus, optionally Avian leukosis virus - R.SAPestivirus giraffe-1, optionally pestivirus giraffe-1 H138Moloney murine sarcoma virusShigella phage, optionally shigella phage SflVMacropodid alphaherpesvirus, optionally macropodid alphaherpesvirus 1Yokapox virusCamelpox virusMonkeypox virus, optionally monkeypox virus Zaire-96-1-16Canarypox virusBrazilian marseillevirusOnly syngen Nebraska virus, optionally Only syngen Nebraska virus 5Pandoravirus neocaledoniaBovine viral diarrhea virus, optionally bovine viral diarrhea virus 3Th / 04_KhonKaen and / orCafeteria roenbergensis virus, optionally Cafeteria roenbergensis virus BV-PW1.