Cell production method

The method improves genome editing confirmation by analyzing a targeted region with a nucleic acid modifying enzyme and customized sequencing, addressing accuracy issues in high-throughput cell production.

WO2026134331A1PCT designated stage Publication Date: 2026-06-25CIRA FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/044538
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-20
Filing Date
2025-12-19
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Current genome editing technologies face challenges in accurately confirming editing results, particularly when multiple sites are cut and edited simultaneously, especially in regions with high sequence homology like HLA genes, and existing sequencing methods struggle to distinguish between large structural mutations in one allele versus both alleles, necessitating high-cost and time-consuming whole-genome sequencing.

Method used

A method involving the introduction of a nucleic acid modifying enzyme with a sequence recognition module, followed by analyzing a 0.5 kb to 2.0 kb region containing the target sequence, including an exon and intron, and selecting cells with confirmed modifications in both alleles, using a customized exome panel to capture introns and a reference sequence matching the cell's pre-editing sequence for accurate confirmation.

Benefits of technology

Enables high-throughput, accurate confirmation of genome editing results, reducing the need for costly and time-consuming whole-genome sequencing and immunohistochemical cross-checks, ensuring stable production of cells with desired DNA modifications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

The present invention provides a method for producing cells in which the double-stranded DNA has been modified, the method comprising: (1) a step for introducing a nucleic acid-modifying enzyme having a nucleic acid sequence recognition module into cells; (2) a step for analyzing, in cells into which the nucleic acid-modifying enzyme having a nucleic acid sequence recognition module has been introduced, the sequence of a region of 0.5-2.0 kb including a target sequence in both alleles of each cell, the region including an exon and the intron that is nearest to the target sequence; and (3) a step for selecting cells in which modification has been confirmed in both alleles.
Need to check novelty before this filing date? Find Prior Art

Description

Cell manufacturing methods

[0001] The present invention relates to a method for producing cells in which double-stranded DNA has been modified. More specifically, the production method of the present invention includes the steps of: (1) introducing a nucleic acid modifying enzyme having a nucleic acid sequence recognition module into cells; (2) analyzing the sequence of a predetermined region containing the target sequence in both alleles of each cell in the cells into which the nucleic acid modifying enzyme having the nucleic acid sequence recognition module has been introduced; and (3) selecting cells in which modification has been confirmed in both alleles.

[0002] In recent years, technologies using artificial nucleases such as the CRISPR-Cas system, which mainly consists of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) and CRISPR-associated (Cas) proteins, which are part of the acquired immune mechanism of eubacteria and archaea, or zinc finger nucleases (ZFNs), TALENs (TAL effector nucleases) which link transcription activator-like (TAL) effectors with DNA endonucleases, and proteins which link pentatricopeptide repeat (PPR) proteins with various nucleases, have been developed and are widely used as genome editing technologies, including gene disruption (knockout). Here, the CRISPR-Cas system is broadly classified into Class 1 CRISPR-Cas systems, in which the effector that works in the process of cleaving DNA in a guide RNA-dependent manner forms a complex of multiple proteins and Class 2 CRISPR-Cas systems which function with a single protein.

[0003] As mentioned above, genome editing technology is widely used, but the status of the editing site can be analyzed to some extent by whole-genome sequencing analysis using next-generation sequencers or by pulling down sequences near the target and performing sequence analysis (Non-Patent Literature 1). However, the analysis costs are high, and analyzing large amounts of data requires technology and time.

[0004] International Publication No. 2023-047524

[0005] Morisaka H. et al., Nat Commun. 6;10(1):5302 (2019)Kitano Y et al. (2020) Molecular Therapy - Methods & Clinical Development, 26, 15-25

[0006] The objective is to provide a method for producing cells with modified double-stranded DNA, which includes a step for accurately confirming the editing results when the double-stranded DNA (e.g., genomic DNA) is cut and edited, particularly when multiple sites are cut and edited simultaneously.

[0007] The inventors have found that, through the production of induced pluripotent stem cells in which HLA-A, HLA-B, and CIITA genes are knocked out (Patent Document 1, Non-Patent Document 2), when double-stranded DNA (e.g., genomic DNA) is cut and edited, particularly when multiple sites are cut and edited simultaneously, if the Sanger method (Sanger sequencing) is used as a method for confirming the edited sequence, even if the Sanger method determines it to be "Edit A" (editing efficiency above the standard value), it is not possible to distinguish between a large structural mutation in one allele and "Edit A" in one allele from "Edit A" in both alleles. In contrast, while whole-genome sequencing can accurately confirm this, there were situations where it was difficult to use, for example, in tests that screen many samples in a short time during the manufacturing process of genome-edited induced pluripotent stem cells. Furthermore, while exome sequencing combines throughput and a certain degree of comprehensiveness, it was understood that confirmation is difficult when large structural mutations affecting introns occur because it enriches the exon region.

[0008] Given the circumstances described above, and considering that genome editing occurs probabilistically, and that efficiently producing genome-edited cells as intended requires screening a large number of cells in a short time during the cell manufacturing process, and that while exome sequencing uses capture probes to enrich exons, it is difficult to accurately confirm large-scale structural mutations affecting introns, we designed a probe that also captures introns near the editing target and spiked it into an existing exome panel to obtain the desired intron sequence. When we used this expanded panel to read a wide area with a next-generation sequencer, we found that the editing results could be confirmed much more accurately and quickly compared to confirmation using the Sanger method.

[0009] Furthermore, the inventors have found that in regions with many highly homologous sequences, such as HLA genes, it is difficult to analyze sequences using reference sequences commonly used in next-generation sequencing (for example, hg19, hg38, etc., for HLA genes), and that adding genome editing makes the analysis even more difficult. Therefore, the inventors conceived the idea that it might be possible to confirm the editing results with high accuracy by analyzing using a reference sequence that matches the sequence of the cell before genome editing (specifically, for example, by using a special sequence in which the sequences of the HLA-A, HLA-B, and CIITA genes of hg19 are replaced with the sequence with the highest frequency of HLA in Japanese people as a reference sequence to analyze HLA-edited strains). Based on these findings, further research led to the completion of the present invention.

[0010] In other words, the present invention is as follows: [1] A method for producing cells in which double-stranded DNA has been modified, comprising: (1) introducing a nucleic acid modifying enzyme having a nucleic acid sequence recognition module into cells; (2) analyzing the sequence of a 0.5 kb to 2.0 kb region containing a target sequence in both alleles of each cell in the cells into which the nucleic acid modifying enzyme having the nucleic acid sequence recognition module has been introduced, wherein the region includes an exon and an intron nearest to the target sequence; and (3) selecting cells in which modification has been confirmed in both alleles. [2] The method according to [1], wherein the nucleic acid modifying enzyme having a nucleic acid sequence recognition module is at least one selected from the group consisting of a CRISPR-Cas system containing one or more gRNAs, a zinc finger nuclease, a TAL effector nuclease, and a protein in which a PPR protein and a nuclease are linked. [3] The method according to [1] or [2], wherein the nucleic acid modifying enzyme having a nucleic acid sequence recognition module is a CRISPR-Cas system containing one or more gRNAs. [4] The method according to any one of [1] to [3], wherein the double-stranded DNA is genomic DNA. [5] The method according to any one of [2] to [4], wherein the CRISPR-Cas system comprises two or more gRNAs. [6] The method according to any one of [1] to [5], wherein the duration of step (2) is 11 days or less. [7] The method according to any one of [1] to [6], further comprising the step of (4) expanding the culture of the selected cells. [8] The method according to any one of [1] to [7], wherein the 0.5 kb to 2.0 kb region containing the target sequence in both alleles of each cell is a region of approximately 1.0 kb. [9] The method according to any one of [1] to [8], wherein at least one of the target sequences is a sequence within an HLA gene.

[10] The method according to [9], wherein the sequence within the HLA gene is at least one selected from the group consisting of HLA-A, HLA-B, and CIITA.

[11] The method according to any one of [1] to

[10] , wherein the cells in which the double-stranded DNA has been modified are pluripotent stem cells.

[12] The method according to

[11] , wherein the pluripotent stem cells are induced pluripotent stem cells.

[13] Cells in which double-stranded DNA has been modified by any one of the methods described in [1] to

[12] .

[0011] This invention improves the accuracy of genome editing confirmation in situations requiring high throughput, enabling a stable supply of cells with desired double-stranded DNA (e.g., genomic DNA) modifications. For confirming knockout in the production of cells with desired gene knockouts (e.g., induced pluripotent stem cells), the need for cross-checking with immunohistochemical staining as a primary test is eliminated, allowing confirmation solely through sequence analysis. Furthermore, it becomes possible to confirm gene mutations (including oncogenes) on exons within the production process of cells with modified double-stranded DNA (e.g., genomic DNA) as needed.

[0012] Figure 1 shows a type I CRISPR-Cas system. Figure 2 shows the results of exome sequencing (without using a custom panel capable of capturing introns). Figure 3 shows a schematic of the manufacturing method of the present invention. Figure 4 shows a schematic of an exome sequencing test performed by the manufacturing method of the present invention. Figure 5 shows an example of cells obtained by the manufacturing method of the present invention.

[0013] 1. Method for Producing the Invention The present invention provides a method for producing genome-modified cells, comprising the following steps: (1) introducing a nucleic acid-modifying enzyme having a nucleic acid sequence recognition module into cells; (2) analyzing the sequence of a 0.5 kb to 2.0 kb region containing a target sequence in both alleles of each cell in the cells into which the nucleic acid-modifying enzyme having the nucleic acid sequence recognition module has been introduced, wherein the region includes an exon and an intron nearest to the target sequence; and (3) selecting cells in which modification has been confirmed in both alleles (hereinafter sometimes referred to as "the method of the present invention"). The method of the present invention may further include (4) expanding the culture of the cells selected in step (3). In one aspect of the present invention, the nucleic acid-modifying enzyme having a nucleic acid sequence recognition module is a CRISPR-Cas system containing one or more gRNAs.

[0014] (i) Step (1) In this specification, unless otherwise specified, "cells" includes "cell populations." A cell population may consist of one type of cell or two or more types of cells.

[0015] Examples of cells used in the manufacturing method of the present invention include Escherichia species, Bacillus species, yeast, insect cells, insects, animal cells, and plant cells.

[0016] Examples of animal cells that can be used include cells isolated from living organisms, cells from living organisms, cell lines such as monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary (CHO) cells, mouse L cells, mouse AtT-20 cells, mouse myeloma cells, rat GH3 cells, HeLa cells, and human FL cells, as well as pluripotent stem cells of humans and other mammals (mice, rats, dogs, monkeys, etc.) and primary cultured cells prepared from various tissues. Furthermore, zebrafish embryos and African clawed frog oocytes can also be used. Mammals are preferred as animal cells used in the method of the present invention, and such mammals include rodents such as mice, rats, hamsters, and guinea pigs, primates such as humans, rhesus monkeys, crab-eating macaques, Japanese macaques, and chimpanzees, and cattle, horses, dogs, and cats. In one embodiment, the cells used in the method of the present invention are human pluripotent stem cells.

[0017] In this specification, "pluripotent stem cells" refers to stem cells that can differentiate into various tissues and cells with different forms and functions in the living body, and that have the ability to differentiate into any lineage of cells from the three germ layers (endoderm, mesoderm, and ectoderm). Examples of pluripotent stem cells used in the present invention include induced pluripotent stem cells (iPS cells), embryonic stem cells (ES cells), nuclear transfer embryonic stem cells (ntES cells) derived from cloned embryos obtained by nuclear transfer, multipotent germline stem cells ("mGS cells"), and embryonic germline stem cells (EG cells), but preferably iPS cells (more preferably human iPS cells) and ES cells (more preferably human ES cells). When the above-mentioned pluripotent stem cells are ES cells or any cells derived from a human embryo, the cells may be cells produced by destroying the embryo or cells produced without destroying the embryo, but from an ethical standpoint, cells produced without destroying the embryo are preferred.

[0018] ES cells are stem cells that possess pluripotency and the ability to proliferate through self-renewal, established from the inner cell mass of (early) embryos (e.g., blastocysts) of mammals such as humans and mice. ES cells were discovered in mice in 1981 (MJ Evans and MH Kaufman (1981), Nature 292:154-156), and subsequently, ES cell lines were established in primates such as humans and monkeys (JA Thomson et al. (1998), Science 282:1145-1147; JA Thomson et al. (1995), Proc. Natl. Acad. Sci. USA, 92:7844-7848; JA Thomson et al. (1996), Biol. Reprod., 55:254-259; JA Thomson and VS Marshall (1998), Curr. Top. Dev. Biol., 38:133-165). ES cells can be established by extracting the inner cell mass from the blastocyst of a fertilized egg of a target animal and culturing the inner cell mass on a fibroblast feeder. Alternatively, ES cells can be established using only a single blastomeres from an embryo at the cleavage stage before the blastocyst stage (Chung Y. et al. (2008), Cell Stem Cell 2: 113-117), or using embryos that have stopped developing (Zhang X. et al. (2006), Stem Cells 24: 2669-2676).

[0019] As for the ES cell lines used in this invention, if they are mouse ES cells, various mouse ES cell lines established by, for example, inGenious Targeting Laboratory, RIKEN (the Institute of Physical and Chemical Research), etc., can be used. If they are human ES cell lines, various human ES cell lines established by, for example, the University of Wisconsin, NIH, RIKEN, Kyoto University, the National Center for Child Health and Development, and Cellartis, etc., can be used. Specifically, examples of human ES cell lines include CHB-1 to CHB-12, RUES1, RUES2, HUES1 to HUES28, etc. distributed by ESI Bio, H1, H9, etc. distributed by WiCell Research, and KhES-1, KhES-2, KhES-3, KhES-4, KhES-5, SSES1, SSES2, SSES3, etc. distributed by RIKEN.

[0020] iPS cells are cells obtained by reprogramming mammalian somatic cells or undifferentiated stem cells by introducing specific factors (nuclear reprogramming factors). Currently, there are various types of iPS cells. These include iPSCs established by Yamanaka et al. by introducing four factors—Oct3 / 4, Sox2, Klf4, and c-Myc—into mouse fibroblasts (Takahashi K, Yamanaka S., Cell, (2006) 126: 663-676), human cell-derived iPSCs established by introducing the same four factors into human fibroblasts (Takahashi K, Yamanaka S., et al. Cell, (2007) 131: 861-872), Nanog-iPSCs established by selecting cells based on Nanog expression after introducing the above four factors (Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Nature 448, 313-317), and iPSCs produced using methods that do not include c-Myc (Nakagawa M, Yamanaka S., et al. Nature Biotechnology, (2008) 26, 101-106), iPSCs established by introducing six factors using a virus-free method (Okita K et al. Nat. Methods 2011 May;8(5):409-12, Okita K et al. Stem Cells. 31(3):458-66.) can also be used. In addition, induced pluripotent stem cells established by introducing four factors, OCT3 / 4, SOX2, NANOG, and LIN28, as created by Thomson et al. (Yu J., Thomson JA. et al., Science (2007) 318: 1917-1920.), induced pluripotent stem cells created by Daley et al. (Park IH, Daley GQ. et al., Nature (2007) 451: 141-146), and induced pluripotent stem cells created by Sakurada et al. (Japanese Patent Publication No. 2008-307007) can also be used.

[0021] Various iPSC lines established by Kyoto University, the NIH, RIKEN, and others can be used as induced pluripotent stem cell lines. For example, human iPSC strains include Kyoto University's 253G1, 253G4, 1201C1, 1205D1, 1210B2, 1383D2, 1383D4, 1383D6, 201B7, 409B2, 454E2, 606A1, 610B1, 648A1, 1231A3, Ff-I01s04 (clinical strain: QHJI01s04), Ff-I14s03 (clinical strain: QHJI14s03), Ff-I14s04 (clinical strain: QHJI14s04), RIKEN's HiPS-RIKEN-1A, HiPS-RIKEN-2A, HiPS-RIKEN-12A, Nips-B2, etc.

[0022] Cells into which a nucleic acid-modifying enzyme having a nucleic acid sequence recognition module has been introduced can be cultured according to known methods depending on the type of cell. For example, when culturing Escherichia coli or Bacillus bacteria, a liquid medium is preferred as the culture medium. Furthermore, the medium preferably contains a carbon source, a nitrogen source, and inorganic substances necessary for the growth of the transformants. Here, examples of carbon sources include glucose, dextrin, soluble starch, and sucrose; examples of nitrogen sources include inorganic or organic substances such as ammonium salts, nitrates, corn slush liquor, peptone, casein, meat extract, soybean meal, and potato extract; and examples of inorganic substances include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. Yeast extract, vitamins, and growth-promoting factors may also be added to the medium. The pH of the medium is preferably about 5 to about 8.

[0023] For culturing E. coli, preferred culture media include, for example, M9 medium containing glucose and casamino acids [Journal of Experiments in Molecular Genetics, 431-433, Cold Spring Harbor Laboratory, New York 1972] or LB medium. If necessary, agents such as 3β-indolylic acid may be added to the medium to ensure the promoter functions efficiently. E. coli culture is usually carried out at approximately 15 to 43°C. Aeration and stirring may be performed as needed. Bacillus culture is usually carried out at approximately 30 to 40°C. Aeration and stirring may be performed as needed.

[0024] Suitable culture media for yeast include, for example, Burkholder Minimal Medium [Proc. Natl. Acad. Sci. USA, 77, 4505 (1980)] and SD Medium containing 0.5% casamino acid [Proc. Natl. Acad. Sci. USA, 81, 5330 (1984)]. The pH of the medium is preferably about 5 to about 8. Culturing is usually carried out at about 20°C to about 35°C. Aeration and stirring may be performed as needed.

[0025] For culturing insect cells or insects, a suitable culture medium may be used, for example, Grace's Insect Medium [Nature, 195, 788 (1962)] with appropriate additives such as inactivated 10% bovine serum. The pH of the medium is preferably about 6.2 to about 6.4. Culturing is usually carried out at about 27°C. Aeration and stirring may be performed as needed.

[0026] For culturing animal cells, suitable culture media include, for example, Minimum Essential Medium (MEM) containing approximately 5-20% fetal bovine serum [Science, 122, 501 (1952)], Dulbecco's Modified Eagle Medium (DMEM) [Virology, 8, 396 (1959)], RPMI 1640 medium [The Journal of the American Medical Association, 199, 519 (1967)], and 199 medium [Proceedings of the Society for the Biological Medicine, 73, 1 (1950)]. For culturing pluripotent stem cells such as human iPS cells, suitable media include mTeSR medium, Essential-8 medium, and StemFit AK03N medium. The pH of the medium is preferably approximately 6-8. Culturing is usually carried out at approximately 30°C-40°C. Aeration and stirring may be performed as needed.

[0027] MS medium, LS medium, B5 medium, etc., are used as culture media for plant cells. The pH of the medium is preferably about 5 to about 8. Culture is usually carried out at about 20°C to about 30°C. Aeration and stirring may be performed as needed. Step (4) of the manufacturing method of the present invention may also be carried out under the culture conditions described above.

[0028] In this specification, "nucleic acid sequence recognition module" means a molecule or molecular complex that has the ability to specifically recognize and bind to a specific nucleotide sequence on a DNA strand (i.e., a target nucleotide sequence). The nucleic acid modifying enzyme used in the present invention enables the nucleic acid modifying enzyme to act specifically on a targeted site on double-stranded DNA by binding the nucleic acid sequence recognition module to the target nucleotide sequence. Nucleic acid sequence recognition modules that can be used in the present invention include, but are not limited to, the CRISPR-Cas system (or a part of the CRISPR-Cas system), zinc finger motifs, TAL (transcription activator-like) effectors and PPR (pentatricopeptide repeat) motifs, as well as restriction enzymes, transcription factors, RNA polymerases, and other proteins that contain a DNA-binding domain and do not have DNA double-strand cleavage ability.

[0029] Zinc finger motifs are composed of the linkage of 3 to 6 different Cys2His2 type zinc finger units (each finger recognizing approximately 3 bases) and can recognize target nucleotide sequences of 9 to 18 bases. Zinc finger motifs can be prepared by known methods such as modular assembly (Nat Biotechnol (2002) 20: 135-141), OPEN method (Mol Cell (2008) 31: 294-301), CoDA method (Nat Methods (2011) 8: 67-69), and E. coli one-hybrid method (Nat Biotechnol (2008) 26:695-701). For details on the preparation of zinc finger motifs, see, for example, Japanese Patent No. 4968498.

[0030] TAL effectors have a modular repeating structure consisting of approximately 34 amino acids, and the binding stability and base specificity are determined by the 12th and 13th amino acid residues (referred to as RVD) of a single module. Since each module is highly independent, it is possible to create TAL effectors specific to target nucleotide sequences simply by linking modules together. Methods for creating TAL effectors using open resources (REAL method (Curr Protoc Mol Biol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), and Golden Gate method (Nucleic Acids Res (2011) 39: e82), etc.) have been established, allowing for the relatively simple design of TAL effectors for target nucleotide sequences. For details on the creation of TAL effectors, see, for example, Japanese Patent Publication No. 2013-513389.

[0031] Each PPR motif consists of 35 amino acids, and a sequence of PPR motifs that recognize a single nucleic acid base is configured to recognize a specific nucleotide sequence. Only the 1st, 4th, and ii(-2)th amino acids of each motif recognize the target base. There is no dependency on motif configuration, and there is no interference between motifs on either side. Therefore, similar to TAL effectors, it is possible to create PPR proteins specific to target nucleotide sequences simply by linking PPR motifs. For details on PPR motif construction, refer to WO2011 / 111829 A1.

[0032] Furthermore, when using fragments of restriction enzymes, transcription factors, RNA polymerases, etc., the DNA-binding domains of these proteins are well known, so fragments containing these domains but lacking DNA double-strand cleavage ability can be easily designed and constructed.

[0033] In this specification, the "nucleic acid modifying enzyme" is not particularly limited in type as long as it can modify the sequence of a nucleic acid. Typically, it includes nucleases, and more typically, nucleases that can cleave double-stranded DNA. Also, in this specification, "modification" may include cleavage. In this specification, the "nucleic acid modifying enzyme" may be a nucleic acid enzyme complex.

[0034] The nucleic acid sequence recognition module used in the present invention may be a fusion protein with a nucleic acid modifying enzyme, or a protein binding domain such as an SH3 domain, a PDZ domain, a GK domain, and a GB domain and their binding partners may be fused to the nucleic acid sequence recognition module and the nucleic acid modifying enzyme, respectively, and provided as a protein complex through the interaction between the domain and its binding partner. Alternatively, an intein may be fused to the nucleic acid sequence recognition module and the nucleic acid modifying enzyme, respectively, and the two can be ligated by ligation after each protein synthesis.

[0035] Examples of the nucleic acid modifying enzyme having the nucleic acid sequence recognition module that can be used in the present invention include artificial nucleases such as zinc finger nuclease (ZFN), TAL effector nuclease (TALEN) which is a ligation of a transcription activator-like (TAL) effector and a DNA endonuclease, a protein in which a pentatricopeptide repeat (PPR) protein and various nucleases are ligated, and a CRISPR-Cas system containing one or more gRNAs.

[0036] The nucleic acid-modifying enzyme having a nucleic acid sequence recognition module used in the present invention may be directly introduced into a target cell, or may be carried out by introducing a nucleic acid encoding the nucleic acid-modifying enzyme. Further, the nucleic acid sequence recognition module and the nucleic acid-modifying enzyme may be separately introduced into the target cell (separately introducing the nucleic acid encoding the nucleic acid sequence recognition module and the nucleic acid encoding the nucleic acid-modifying enzyme), and a part of the nucleic acid sequence recognition module (for example, guide RNA) and the nucleic acid-modifying enzyme having the remaining part of the nucleic acid sequence recognition module may be separately introduced (separately introducing the nucleic acid encoding a part of the nucleic acid sequence recognition module (for example, guide RNA) and the nucleic acid encoding the nucleic acid-modifying enzyme having the remaining part of the nucleic acid sequence recognition module).

[0037] The introduction of the nucleic acid-modifying enzyme having a nucleic acid sequence recognition module used in the present invention into cells can be carried out by various known methods. Such methods include, for example, calcium phosphate-mediated transfection, electroporation, liposome transfection, lipofection, gene gun, microinjection, viral vector method, virus-like particle method, Agrobacterium method, agroinfiltration method, PEG-calcium method, sonoporation method, lipid nanoparticle method, and the like. In the production method of the present invention, the introduction of the nucleic acid-modifying enzyme having a nucleic acid sequence recognition module into cells may be performed multiple times. Regarding the detailed introduction method, conditions, etc. of the nucleic acid-modifying enzyme having a nucleic acid sequence recognition module used in the present invention into the target cell, it can be appropriately designed based on methods known per se (for example, JP 2013-128413 A, Patent No. 5896547, Patent No. 5931022, WO2018 / 025206 A1, etc.). Further, the introduction method, conditions, etc. described in the description regarding the CRISPR-Cas system containing one or more kinds of gRNAs described later may be appropriately used.

[0038] In one aspect of the present invention, the nucleic acid-modifying enzyme having a nucleic acid sequence recognition module is a CRISPR-Cas system comprising one or more gRNAs. In this specification, "CRISPR-Cas system" typically comprises a Cas protein and guide RNA (gRNA) as described below. In this specification, "Cas protein" may include a Cascade complex as described below. In this specification, "gRNA" is not particularly limited as long as it recruits the Cas protein to a target (nucleotide) sequence (site), and includes, for example, pre-crRNA, crRNA, tracrRNA, or a complex of crRNA and tracrRNA (single guide RNA (sgRNA)) as described below. In the present invention, the "CRISPR-Cas system" may be of class 1 or class 2, as long as cells with the desired genome modified by the production method of the present invention are obtained.

[0039] Examples of CRISPR-Cas systems belonging to Class 2 include the Type II CRISPR-Cas system using the Cas9 protein. The Cas protein in a Class 2 CRISPR-Cas system is not particularly limited, as long as it forms a complex with gRNA, recognizes the target sequence in the target gene and the protospacer adjacent motif (PAM) adjacent to it, and binds to it. Preferably, it is Cas9 or Cpf1 or a modification thereof.

[0040] Examples of Cas9 include Cas9 derived from Streptococcus pyogenes (SpCas9; PAM sequence NGG (N is A, G, T, or C; the same applies below)), Cas9 derived from Streptococcus thermophilus (StCas9; PAM sequence NNAGAAW), Cas9 derived from Neisseria meningitidis (NmCas9; PAM sequence NNNNGATT), Cas9 derived from Staphylococcus aureus (SaCas9; PAM sequence: NNGRRT), and Campylobacter jejuni. Examples of Cas9 derived from jejuni (CjCas9; PAM sequence: NNNVRYM (V is A, G, or C; R is A or G; Y is T or C; M is A or C)) include, but are not limited to, these. From a size standpoint, preferably, Cas9 is SaCas9 or CjCas9 or a variant thereof. Examples of Cpf1 (Cas12a) include, but are not limited to, Cpf1 derived from Francisella novicida (FnCpf1; PAM sequence NTT), Cpf1 derived from Acidaminococcus sp. (AsCpf1; PAM sequence NTTT), and Cpf1 derived from Lachnospiraceae bacterium (LbCpf1; PAM sequence NTTT).

[0041] As the above Cas protein, a protein in which the ability of the Cas protein to cleave at least one strand (preferably both strands) of double-stranded DNA has been inactivated may be used. For example, in the case of SpCas9, a modified version in which the 10th Asp residue is converted to an Ala residue and / or the 840th His residue is converted to an Ala residue (a modified version lacking the ability to cleave both strands of double-stranded DNA may be referred to as "dSpCas9") can be used. Alternatively, in the case of SaCas9, a modified version in which the 10th Asp residue is converted to an Ala residue and / or the 556th Asp residue, the 557th His residue and / or the 580th Asn residue are converted to Ala residues (a modified version lacking the ability to cleave both strands of double-stranded DNA may be referred to as "dSaCas9") can be used. In the case of CjCas9, a modified form can be used in which the 8th Asp residue is converted to an Ala residue and / or the 559th His residue is converted to an Ala residue (a modified form lacking the ability to cleave both strands of double-stranded DNA is sometimes referred to as "dCjCas9"). In the case of FnCpf1, a modified form can be used in which the 917th Asp residue is converted to an Ala residue and / or the 1006th Glu residue is converted to an Ala residue. Furthermore, modified forms in which some of the amino acids of these proteins are modified may be used, as long as the ability to bind to the target (nucleotide) sequence is maintained. Examples of such modified forms include shortened modified forms in which some of the amino acid sequences are deleted. Specifically, an example of such a modified form is dSaCas9 in which amino acids 721 to 745 are deleted (the deleted portion may be replaced with a peptide linker known to the public, etc.).

[0042] gRNAs for CRISPR-Cas systems belonging to Class 2 can be appropriately designed using methods that are already known. Specifically, for example, when using Cas9 as the Cas protein, the design can be done by using a publicly available guide RNA design website (CRISPRDesignTool, CRISPRdirect, etc.) to list sequences, for example, 21mer sequences, that have a PAM adjacent to the 3' end of the target gene's CDS sequence (e.g., NNGRRT in the case of SaCas9). Candidate sequences with a small number of off-target sites in the host genome into which a Class 2 CRISPR-Cas system is introduced can be used as gRNAs. If the guide RNA design software used does not have a function to search for off-target sites in the host genome, off-target sites can be searched for by, for example, performing a Blast search on the host genome for the 8-12 nucleotides on the 3' end of the candidate sequence (seed sequences with high discriminatory ability for target nucleotide sequences). Even when using Cas proteins that recognize different PAMs, gRNAs can be designed and produced in a similar manner.

[0043] Examples of CRISPR-Cas systems belonging to Class 1 include the Type I CRISPR-Cas system. The Type I CRISPR-Cas system comprises six types, A through F, with Type IE (especially Type IE derived from Escherichia coli) or Type ID (especially Type ID derived from Microcystis aeruginosa) being preferred. Near the CRISPR receptor is a cas operon encoding Cas (CRISPR-associated) proteins such as Cas1, Cas2, and the proteins that constitute the Cascade complex. Among the cas operons of types IA through IF, the nuclease / helicase Cas3 (however, Cas3 in Type ID does not possess these activities, and Cas10d functions as a nuclease / helicase) and the group of proteins excluding Cas1, Cas2, and Cas4, which are involved in the cleavage of foreign genes during immune acquisition, constitute the Cascade complex. The addition of Cas3 (or a complex of Cas3 and Cas10d) to the Cascade complex allows it to exhibit DNA recognition and cleavage functions similar to Cas9 or Cas12a in the type II CRISPR-Cas system.

[0044] Types IA, IB, and ID are relatively more abundant in archaea, while types IC, IE, and IF are more abundant in bacteria. Types IA have been analyzed in S. solfataricus and T. tenax, type IB in Haloferax volcanii, type IC in B. halodurans, type ID in M. aeruginosa, type IE in Escherichia coli, and type IF in P. aeruginosa, Escherichia coli, and P. atospeticum. In type IE, one molecule of crRNA forms a Cascade complex with Cse1 (also known as CasA, Cas8e), Cse2 (also known as CasB, Cas11), Cas7 (also known as CasC, Cas4), Cas5 (also known as CasD), and Cas6 (also known as CasE) in a ratio of 1:2:6:1:1 molecules, respectively. In type ID systems, Cas7, Cas5 (Csc1), and Cas6 form a Cascade complex with one crRNA molecule in a 6:1:1 ratio. In type ID CRISPR-Cas systems, GTA, GTC, GTT, etc., can be used as protospacer adjacent motif (PAM) sequences, while in type IE CRISPR-Cas systems, ATG, AAG, AGG, GAG, TAG, AAA, etc., can be used. Furthermore, in type IA CRISPR-Cas systems, TCN (where N is A, T, G, or C) can be used, in type IB CRISPR-Cas systems, TTC, ACT, TAA, TAT, TAG, CAC, etc., in type IC CRISPR-Cas systems, NTTC (where N is A, T, G, or C) can be used, and in type IF CRISPR-Cas systems, CC, etc., can be used. In this specification, unless otherwise specified, nucleotide sequences are written from 5' to 3'.

[0045] In a Type IA CRISPR-Cas system, Cas8a1, Csa5 (Cas11), Cas5, Cas6, and Cas7 are used as components of the Cascade complex. In a Type IB CRISPR-Cas system, Cas8b1, Cas5, Cas6, and Cas7 are used as components of the Cascade complex. In a Type IC CRISPR-Cas system, Cas8c, Cas5, and Cas7 are used as components of the Cascade complex. In a Type IF CRISPR-Cas system, Csy1 (Cas8f), Csy2 (Cas5), Cas6, and Csy3 (Cas7) are used as components of the Cascade complex. In a Type IG CRISPR-Cas system, Cst1 (Cas8a1), Cas5, Cas6, and Cst2 (Cas7) are used as components of the Cascade complex. In this specification, the Cas3, Cas10d, and Cascade proteins may be collectively referred to as "Cas proteins."

[0046] In the type I CRISPR-Cas system, precrRNA (if there are multiple spacer sequences, it will be repeat, spacer 1, repeat, spacer 2, repeat, (and so on)) having a structure consisting of repeats of a repeat sequence and a target recognition region (spacer region) is cleaved by Cas6 (for types IA, B, D-E) or Cas5 (for type IC) to become mature crRNA. In this specification, "precrRNA" means RNA having at least a repeat, spacer 1, and repeat, which is cleaved in the cell by Cas6 or Cas5 to become functional crRNA. The repeat structure of precrRNA is illustrated in Figure 1 (Source: Zheng Y. et al., Front Bioeng Biotechnol. 2020 Mar 4;8:62). The target recognition region sequence (sometimes referred to as the "spacer sequence") is originally a sequence derived from foreign DNA that was incorporated during the process of adaptation in nature, but this sequence can be designed based on the sequence of the target DNA.

[0047] The type I Cascade complex forms a complex with crRNA (hereinafter sometimes referred to as the "Cascade-crRNA complex"). Subsequently, the Cascade-crRNA complex partially unwinds the double-stranded DNA containing the PAM sequence and target sequence, forming a structure called an R-loop and binding to it. At this time, the Cascade-crRNA complex itself undergoes a structural change and binds to the Cas3 protein (a complex of Cas3 and Cas10d in the case of type ID). The Cas3 protein (Cas10d in the case of type ID) has DNA nickase activity and DNA helicase activity, and introduces a nick into the non-target strand (the strand in which the target recognition region of the crRNA is not complementary-bound (hybridized)). In the type I CRISPR-Cas3 system, the PAM is located on the non-target strand, and typically, a nick is introduced into the upstream (5' side) region of the PAM sequence on the non-target strand. Subsequently, a helicase unwinding reaction results in a deletion on the upstream side of the PAM sequence.

[0048] Therefore, unless otherwise specified in this specification, "target sequence" refers to the sequence targeted by guide RNA, including precrRNA and crRNA, also called a protospacer sequence, and means the sequence adjacent to the 3' side of the PAM on the non-target strand where the PAM is located. The target sequence is a sequence homologous to the sequence of the target sequence recognition region (sometimes called a "spacer sequence") present in the gRNA (specifically, crRNA) (however, U in RNA sequences shall be read as T in DNA sequences).

[0049] In a Type I CRISPR-Cas system, every six bases there is a base that the crRNA does not recognize on the target sequence and therefore does not contribute to sequence specificity. If we denote the base in the region that does not contribute to target sequence recognition of the crRNA as X, and the base that contributes to target sequence recognition as N (A, T, G, or C), then for example, 5'-NNNNNXNNNNNXNNNNNXNNNNNXNNNNNXNN-3' can be used as the target sequence. Even if the crRNA spacer sequence and the target sequence do not have a 100% sequence match, binding and target DNA cleavage via Cas3 or Cas10d can still occur. Therefore, crRNA having a spacer sequence in which at least one (e.g., two, three, four, five, or more) bases are substituted, deleted, added, and / or inserted in the base sequence portion represented by N can also be used in the manufacturing method of the present invention. Thus, "homologous sequences" include not only sequences that are completely identical to the target sequence (e.g., the target sequence), but also sequences in which at least one (e.g., two, three, four, five or more) bases are substituted, deleted, added, and / or inserted.

[0050] The target sequence can be appropriately selected depending on the purpose. Examples of target sequences include the sequences of Human Leukocyte Antigen (HLA) genes and their regulatory regions. In this specification, the sequences of Human Leukocyte Antigen (HLA) genes and their regulatory regions may be simply referred to as HLA genes. Examples of HLA genes include HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, HLA-DRA, HLA-DRB, HLA-DPA, HLA-DPB, HLA-DQA, HLA-DQB, and MHC class II transactivator (CIITA) genes. Each HLA gene is known to have sequence diversity; for example, the HLA-A gene has many HLA types such as HLA-A02 and HLA-A27 due to differences in its amino acid and base sequences. In one embodiment, the target sequence can be appropriately designed using chr6:29,910,754-29,910,776 (HLA-A), chr6:31,324,492-31,324,514 (HLA-B), and chr16:10,989,541-10,989,563 (CIITA) as target coordinates.

[0051] The gRNA of the present invention may have one or more (e.g., 1, 2, 3, 4 or more) functional molecules bound to it. The functional molecules can typically be bound to the 5' end and / or 3' end. Examples of functional molecules include fluorescent dyes (Cy3, Alexa, etc.), fluorescent proteins, luciferase, biotin, avidin, His-tagged peptides, GST-tagged peptides, FLAG-tagged peptides, arginine-rich peptide P007 and B peptide (HaiFang Yin et al., Human Molecular Genetics, Vol. 17(24), 3909-3918 (2008)), m3G-CAP (Pedro MD Moreno et al., Nucleic Acids Res., Vol. 37, 1925-1935 (2009)), TAT peptides, N-acetylgalactosamine (GalNAc), lipids such as cholesterol and fatty acids (e.g., vitamin E (tocopherol, tocotrienol), vitamin A, and vitamin D), fat-soluble vitamins such as vitamin K (e.g., acylcarnitine), intermediate metabolites such as acyl-CoA, glycolipids, and glycerides.

[0052] Examples of double-stranded DNA (possessed by cells) that can be modified by the manufacturing method of the present invention include chromosomal DNA, mitochondrial DNA, chloroplast DNA (hereinafter collectively referred to as "genomic DNA"), and exogenous DNA (e.g., plasmid DNA, viral DNA), but genomic DNA, particularly chromosomal DNA, is preferred. In this specification, "modification" means that a nucleotide or nucleotide sequence on a DNA strand is deleted, replaced with another nucleotide and / or nucleotide sequence, and / or inserted into a region on a DNA strand. Modification on genomic DNA may also be referred to as "genome editing."

[0053] In step (1), the introduction of the CRISPR-Cas system containing gRNA into cells is not particularly limited as long as cells with the desired double-stranded DNA modification can be obtained, and for example, methods known to the present day may be used. In one embodiment, Cas9, Cas3, Cas10d, and Cascade proteins may be fusion proteins with heterologous proteins having the desired enzymatic activity (e.g., deaminase activity, activator activity, integrase activity, recombinase activity, polymerase activity, ligase activity, etc.).

[0054] The DNA encoding the Cas protein is typically provided in the form of an expression vector containing the DNA. Examples of expression vectors include viral vectors such as retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpesviruses, and Sendai viruses, as well as plasmid vectors, episomal vectors, artificial chromosome vectors, and transposon vectors (piggyBac, piggyBat, TolII).

[0055] Examples of promoters used in expression vectors include the EF1α promoter, ACTB promoter, UbqC promoter, PGK promoter, CAG promoter, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Roussarcoma virus) promoter, MoMuLV (Morony's mouse leukemia virus) LTR, HIV LTR, and HSV-TK (herpes simplex virus thymidine kinase) promoter. Among these, the EF1α promoter, ACTB promoter, UbqC promoter, PGK promoter, CAG promoter, and SRα promoter are preferred.

[0056] In addition to the promoter, the expression vector may optionally contain enhancers, terminators, IRESs, 2A coding sequence enhancers, poly(A) addition signals, SV40 origins of replication, and select marker genes. Examples of select marker genes include drug resistance genes and fluorescent protein genes.

[0057] The expression vector may be a combination of individual expression vectors capable of expressing one of each component of the CRISPR-Cas system (for example, in the case of type IE, the Cse1 protein, Cse2 protein, Cas7 protein, Cas5 protein, Cas6 protein, Cas3 protein, and crRNA factor), or one expression vector may be prepared to express multiple of these factors, or one expression vector may be prepared to express all of these factors.

[0058] When a single expression vector expresses multiple of these factors, each component of the CRISPR-Cas system may be linked by a 2A sequence that induces self-cleavage or an IRES (Internal Ribosome Entry Site) sequence that has a ribosome binding site. Examples of 2A sequences include P2A sequences derived from Porcine teschovirus, T2A sequences derived from Thosea asigne, F2A sequences derived from foot-and-mouth disease virus, and E2A sequences derived from equine rhinitis A virus. The IRES sequence may be a sequence derived from a virus such as Encephalomyocarditis virus or Foot-and-mouth disease virus, or it may be a sequence derived from mRNA in cells. This makes it possible to individually express two or more proteins from a single mRNA.

[0059] The promoter for expressing the Cas protein may be an inducible promoter. Examples of inducible promoters include those that can induce expression by adding or removing an expression-regulating substance to the culture medium, light irradiation, temperature changes, etc. An inducible promoter may induce protein expression by adding an expression-regulating substance to the culture medium, or by removing the expression-regulating substance from the culture medium. Specifically, examples of inducible promoters include, but are not limited to, Tet-ON / Tet-OFF promoters (inducible by adding or removing tetracycline or its derivatives (e.g., doxycycline)), metallothionein promoters (inducible by heavy metal ions), heat shock protein promoters (inducible by heat shock), and steroid-responsive promoters (inducible by steroid hormones or their derivatives).

[0060] The introduction of the CRISPR-Cas system into cells in the form of nucleic acids, nucleic acid-containing expression vectors, or proteins can be carried out by various known methods. Examples of such methods include calcium phosphate-mediated transfection, electroporation, liposome transfection, lipofection, gene guns, microinjection, viral vector methods, virus-like particle methods, Agrobacterium methods, agroinfiltration methods, PEG-calcium methods, sonoporation methods, and lipid nanoparticle methods. In the production method of the present invention, the introduction of the CRISPR-Cas system into cells may be carried out multiple times.

[0061] The DNA encoding the Cas protein can be obtained, for example, by isolating the region containing the ORF of the desired Cas protein from the Cas operon using genomic PCR, with the genomic DNA from the above-mentioned bacterial species as a template. Alternatively, the DNA encoding the Cas protein can be cloned by synthesizing oligo DNA primers based on the cDNA sequence information or amino acid sequence information of the protein to be used (for example, information from databases such as NCBI GenBank), and amplifying it by RT-PCR using the total RNA or mRNA fraction prepared from cells that produce the protein as a template. Examples of NCBI accession numbers include NP_417240.1 for the Cse1 protein belonging to type IE from E. coli, NP_417239.1 for the Cse2 protein, NP_417238.1 for the Cas7 protein, and NP_417237.2 for the Cas5 protein. Examples of NCBI accession numbers for the Cas6 protein include NP_417236.1. Similarly, examples of NCBI accession numbers for the Cas3 protein include NP_417241.1. Other Cas proteins can also be obtained from NCBI GenBank and other databases. Furthermore, sequences from novel microbial species can be obtained using the BLAST program with microbial genome data obtained through metagenomic analysis.

[0062] The Cas protein may have one or more amino acids substituted, deleted, added, and / or inserted from the amino acid sequence described in the accession number above, as long as it retains the function of the protein. Alternatively, the Cas protein may consist of an amino acid sequence that is 70% or more, preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more (e.g., 96%, 97%, 98%, 99%, or more) identical to the amino acid sequence described in the accession number above. The identity of the amino acid sequence can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool).

[0063] The cloned DNA can be prepared by ligating it with Cas9, Cas3, Cas10d, or Cascade proteins, either directly, or optionally digested with restriction enzymes, or by adding sequences encoding appropriate linkers and / or nuclear localization signals (or organelle localization signals if the target double-stranded DNA is mitochondrial or chloroplast DNA), to prepare DNA encoding a fusion protein. The organelle localization signals, including the nuclear localization signal, may be added individually or in multiple sequences (e.g., added to both the N-terminus and C-terminus of the protein).

[0064] RNA encoding Cas9, Cas3, Cas10d, or Cascade proteins can be synthesized, for example, by an IVT reaction using DNA encoding Cas9, Cas3, Cas10d, or Cascade proteins as a template.

[0065] Cas9, Cas3, Cas10d, or Cascade proteins can also be produced using in vitro translation systems. Alternatively, they can be obtained by expressing the proteins in cells using expression vectors, and then isolating and purifying the proteins from the cells.

[0066] (ii) Steps (2) to (4) When there are multiple types of genes (usually 2 copies) at a single gene locus, each of these is called an allele. In step (2) of the manufacturing method of the present invention, the sequence of a predetermined region containing the target sequence in both alleles of the cells into which the CRISPR-Cas system was introduced in step (1) is analyzed. The predetermined region is a region of 0.5 kb to 2.0 kb, preferably a region of about 1.0 kb, that contains the target sequence. The position of the target sequence in this region is typically within 10 bases upstream of the PAM sequence, preferably between the 3rd and 4th bases upstream of the PAM sequence.

[0067] The above region includes exons and introns in the nearest neighbor (adjacent to the target sequence) of the target sequence. In one embodiment, the region may be obtained from double-stranded DNA (e.g., genomic DNA) of cells into which the CRISPR-Cas system has been introduced using a capture panel. Enrichment of the exon region may be performed using a method known to the public, for example, using a commercially available kit from Twist Bioscience. If both the exon and intron regions are to be enriched, a custom panel that captures not only the desired exons but also the introns may be prepared using a method known to the public, and then spiked into a commercially available kit. For example, a custom panel may be designed and prepared as appropriate using a design algorithm from Twist Bioscience. Analysis of the region can typically be performed using a next-generation sequencer and a method known to the public.

[0068] The analysis in step (2) may be performed using a method that is already known, but when the location of the double-stranded DNA to be knocked out (e.g., genomic DNA) is such that it is performed in a region with very high diversity, such as HLA-A or HLA-B, the sequence may differ from the reference sequence (e.g., Caucasian sequences called hg19 or hg38) that is commonly used to map (align) next-generation sequencing data. For example, if hg19 is used in the analysis of HLA editing, the sequence obtained from the sequencing may be mismapped (aligned), which can cause a decrease in the accuracy of the analysis. In such cases, the accuracy of the analysis may be improved by using a specific sequence obtained by replacing the HLA-A and HLA-B gene sequences of hg19 with the sequence with the highest frequency of HLA in Japanese people as a reference sequence when analyzing the HLA-edited strain.

[0069] Based on the analysis results from step (2), step (3) involves selecting cells in which the desired modifications have been confirmed in both alleles.

[0070] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0071] Example 1: Examination of methods for confirming genome editing (evaluation by whole-genome analysis and Sanger sequencing) <Whole-genome analysis> Using the same method as steps (1) to (12) of Example 2 described later, the QHJI14s04 strain, which has the highest expression rate of approximately 8.4% in Japanese individuals and is held by the Cell Preparation Facility of the Kyoto University iPS Cell Research Foundation, was genome edited to produce the target cells by homozygous HLA-A24, HLA-B52, and HLA-ClassII TA. A library for whole-genome sequencing was prepared from gDNA extracted from these cells (36 clones (specifically, 36 clones of C01, C02, C03, C04, C05, C06, C07, C08, C10, C11, C12, C13, C14, C15, C16, C17, C19, C20, C21, C23, C24, C25, C26, C27, C28, C29, C34, C35, C37, C38, C39, C41, C42, C46, ​​C47, and C48)). The prepared library was sequenced using NovaSeq 6000 (Illumina Corporation) with 151 bp paired-end (PE) sequencing, and whole-genome sequencing data with a sequencing depth of 54x or greater was obtained. Using previously obtained whole-genome sequencing data from iPS cells (starting material) as a control, SNV / Indel and CNV analyses were performed on 36 samples targeted for analysis. For HLA-KO regions, the mapping status was visualized using a genome browser (Integrative Genomics Viewer; IGV). During this process, soft-clipped bases were displayed and alignment was performed visually, and the presence of base sequences in other regions was confirmed. If necessary, blastn was used to search for the origin regions of the soft-clipped bases.

[0072] Analysis results (Tables 1-5) revealed that two clones, C24 and C37, were candidate strains that underwent HLA-KO editing as intended. C16 could also be considered a candidate if a large deletion was acceptable. In many strains, sequences from other target regions were observed in the KO target region. Furthermore, multiple strains exhibited the same KO pattern.

[0073]

[0074]

[0075]

[0076]

[0077]

[0078] <Sanger Sequencing Analysis> Sanger sequencing was performed according to standard procedures using the primers listed in Table 6 below.

[0079]

[0080] The evaluation was performed according to the following criteria: (i) Eliminate any entries without a knockout. (ii) Exclude entries with frame shifts (check for INDEL: + / - 3 (multiples) or greater). (iii) Keep entries that meet the following conditions.

[0081] Pattern 1: When either or one of the insertions and deletions is between 5 and 20 (a) Main insertions and deletions account for 75% or more (2) (b) Other percentages are 5% or less

[0082] Pattern 2: When both insertions and deletions are less than 5 (a) close to 100% or 50% (b) no other indices (exclude cases where the mutation pattern is unclear.)

[0083] The Sanger sequencing analysis results are shown below (Table 7).

[0084]

[0085] The analysis results (Table 7) show that the two clones C5 and C34, which have circles in three regions, successfully underwent genome editing for all three types of HLA-A24, HLA-B52, and CIITA. Furthermore, a key feature of this genome editing was that it performed double knockout of HLA-A24 and HLA-B52 using a single guide RNA. The five clones C5, C6, C8, C14, and C34 show successful double knockout genome editing of HLA-A24 and HLA-B52. This result differs from the previously mentioned whole-genome analysis results (Tables 1-5), which identified two clones, C24 and C37, as candidate strains that underwent HLA-KO editing as intended. For example, C5, selected by Sanger sequencing, showed significant structural mutations from whole-genome analysis, indicating that Sanger sequencing was inaccurate in its determination.

[0086] From the above, it became clear that Sanger sequencing makes it difficult to determine whether or not a clone has undergone the desired genome editing. Therefore, based on the above results, an alternative evaluation method to whole-genome sequencing was considered in the manufacturing process of HLA genome-edited cells, given the time and other constraints. As a result of the consideration, exome sequencing was considered, but the results of the above Sanger sequencing suggested that genome editing had caused large-scale structural mutations. Furthermore, the inventors had the knowledge that analysis can be difficult even with exome sequencing when there are large-scale structural mutations (Figure 2), so they designed a probe that also captures introns near the editing target and spiked it into an existing exome panel with the intention of obtaining the desired intron sequence, and performed Example 2.

[0087] The analysis method described in Figure 2 above is outlined below. A pre-library was prepared using the Twist Library Preparation EF Kit from gDNA extracted from clone name HLAtest02-3-C3. Subsequently, exon enrichment was performed using Twist Comprehensive Exome to prepare a library for whole-exome sequencing. The prepared library was sequenced using NovaSeq 6000 (Illumina Corporation) with 101 bp paired-end (PE) connections, and whole-exome sequencing data with a CDS sequencing depth of 72x was obtained. Sequences in which the HLA-A and HLA-B gene sequences of hg19 were replaced with HLA-A24 and HLA-B52 were used as reference sequences for mapping, and the mapping status for HLA-B knockout was visualized using a genome browser (Integrative Genomics Viewer; IGV). The central exon had only about half the number of reads, and considering soft-clipped bases, a monoallelic deletion was expected, but it was difficult to distinguish due to the small number of reads involving introns.

[0088] Example 2: Manufacturing of HLA Genome-Edited Cells In this example, the YZWJs524 cell line, which is homozygous for the HLA-A24-B52-DR15 HLA type (the highest expression rate in Japanese people at approximately 8.4%) and is owned by the Cell Preparation Facility of the Kyoto University iPS Cell Research Foundation, was genome-edited to produce the target cells by editing HLA-A24, HLA-B52, and HLA-Class II TA. Specifically, the manufacturing was carried out by the following steps (1) to (23) (Figure 3).

[0089] (1) Thawing and seeding of frozen vial of starting material (YZWJs524 strain) One frozen vial of YZWJs524 strain was thawed and suspended in StemFit AK03N (Ajinomoto Healthy Supply) + Y-27632 (Fujifilm Wako Pure Chemical Industries) medium (hereinafter also referred to as "StemFit+Y medium"). 6.5 × 10⁶ units were placed in two wells of a 6-well plate coated with iMatrix-511MG (Nippi). 4 cells / well, 8.5 × 10 4Seeds were sown in the order of cells / well.

[0090] (2) Medium exchange of 6-well plates: The medium of the 6-well plates was exchanged on the 1st, 4th, and 5th day following thawing and seeding. If subculturing was to be performed on the 7th day following seeding, the medium was also exchanged on the 6th day. Before exchanging the medium, cell images of each seeding concentration were checked, and the wells to be subculturised were determined during the medium exchange the day before subculturing. The wells that most closely resembled the "selected well" image sample were selected by comparing them with the cell image sample.

[0091] (3) Subculturing from 6-well plate to 6-well plate: Subculturing was performed from the 5th to 7th day after thawing and seeding. From the 4th to 6th day after thawing and seeding (the day before subculturing), cell images of each well cultured in the 6-well plate were checked and compared with the cell image sample to confirm that the well was the closest to the "selected well" image sample. Cells from the selected well of the 6-well plate were detached with 0.5X TrypLE Select (Thermo Fisher Scientific) solution and suspended in StemFit+Y medium. 2.6 × 10⁶ cells were placed in a 6-well plate coated with iMatrix-511MG. 4 Cells / well were seeded in 24 wells (4 x 6-well plates) and cultured in an incubator. If the number of cells was insufficient when seeding the fourth plate, seeding was performed for the number of wells that could be seeded.

[0092] (4) Medium replacement in 6-well plates The medium in the 6-well plates was replaced on the 1st and 4th day following the day after subculturing, and electroporation was performed on the 5th day following the day after sowing. If electroporation was performed from the 6th day following the day after sowing, the medium was also replaced on the 5th day.

[0093] (5) Electroporation of Cas9 gRNA and sub-seeding into 12-well plates were performed on the 5th or 6th day following the sub-seeding. At the time of electroporation, cells were detached from 4 wells at a time using 0.5X TrypLE Select solution and suspended in StemFit+Y medium. After cell counting, the number of cells was 1.5 × 10⁶. 6 Cells were separated into cells / tube sections and used for electroporation. At 4 wells, the cell count was 1.5 × 10⁶. 6 If the number of cells was insufficient, the cell suspension from the 4-well detachment was discarded, and a new 6-well cell detachment was performed, followed by electroporation. After preparation, the gRNA concentration was measured using nanodrops.

[0094] <Procedure for preparing the gRNA-Cas9 mixed solution> Two types of gRNA were mixed together, and then the Cas9 protein was added. Details of the gRNA and Cas9 protein are as follows. (i) gRNA • Product names: YZWJ-HLA / A24 / B52-001, YZWJ-C2TA-002 • Purification grade: in vivo • Manufacturer: GeneDesign • Sequence (5'→3'): (YZWJ-HLA / A24 / B52-001 (Sequence ID 11)) (GCGCGAUCCGCAGGUUCUCU)GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (YZWJ-C2TA-002 (Sequence ID 12)) (GCUGAACUGGUCGCAGUUGA)GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC For the gRNAs shown in Sequence IDs 11 and 12 above, the target (spacer) sequence of the guide RNA is shown in parentheses. The scaffold sequence of the sgRNA is shown outside the parentheses. (ii) Cas9 protein / Recombinant Cas9 Protein (Takara Bio Inc.) (3 mg / ml)

[0095] <Method for generating and subculturing KO cells (bulk)> 1.5 × 106 Live cells were suspended in Nucleofector's introduction reagent (a mixture of P3 Primary Cell Solution and supplement solution), mixed with a single-reaction gRNA-Cas9 mixture, and then placed in a cuvette. The cuvette was set in the Nucleofector, and the program was set to "CA137" to introduce gRNA+Cas9 into the iPS cells. The cuvette was removed from the Nucleofector. StemFit+Y medium was added to the cuvette to collect the gRNA+Cas9-introduced iPS cells, and the cells were seeded into a 12-well plate coated with iMatrix-511MG. Cells were seeded into 4 wells of the 12-well plate after each electroporation (4 wells / 12-well plate × 3 electroporations, total 12 wells / 12-well plate seeding). The plate was shaken to spread the cells uniformly, and the cells were cultured in an incubator. These cultured cells were designated as KO cells (bulk).

[0096] (6) Medium change for 12-well plates: Medium was changed on the 3rd and 5th day following the day after subculturing, and subculturing to 6-well plates and 12-well plates was carried out on the 6th or 7th day following the day after sowing. If subculturing was carried out on the 7th day following the day after sowing, medium was also changed on the 6th day.

[0097] (7) Passing from 12-well plate to 6-well plate, preparation of 12-well plate for HLA-A knockout evaluation. On the 6th or 7th day after seeding, photographs of the cells cultured in the 12-well plate were taken to confirm that the colony morphology and number of colonies were close to the cell photograph sample. The cells from the 12-well plate were detached from each well with 0.5X TrypLE Select solution and suspended in StemFit+Y medium in each well. After cell counting, 2.6 × 10⁶ cells were placed in a 6-well plate coated with iMatrix-511MG. 4Cells were seeded at cells / well and cultured in an incubator. Also, at the time of this passage, a 12-well plate for in-process testing (HLA-A knockout evaluation) and a 1-well / 12-well plate for negative control were prepared. The number of cells seeded in the 12-well plate was 10.2×10 3 cells / well. When the total viable cell count was less than 3.62 ×10 4 cells, the 12-well plate was seeded preferentially, and the remaining total volume was seeded in the 6-well plate.

[0098] (8) HLA-A Knockout Evaluation Test (FCM Test) For the 12-well plate for in-process testing prepared in (7), an HLA-A knockout evaluation test (FCM test) was performed 5 - 7 days after the start of culture. From the bulk cells with a knockout efficiency of 30 - 80%, those with a high knockout efficiency were selected in order, and cells for the maximum number of single cell cloning operations were obtained.

[0099] (9) Medium Exchange of the 6-well Plate Medium exchange of the 6-well plate was performed on the 1st and 4th days from the day after the passage of the medium. Single cell cloning was performed on the 5th - 7th days from the day after seeding. When single cell cloning was performed on the 6th or 7th day from the day after seeding, medium exchange was performed from the 5th day until the day before passage.

[0100] (10) Cloning and Subculture of Cells into the 96-well Plate From the 5th - 7th days after the day of cell seeding, 6 wells (maximum 6 wells) of the bulk cells selected in the FMC test in (8) were used for single cell cloning. The timing of performing single cell cloning (5th - 7th days after the day of cell seeding) was determined to obtain a colony morphology and number of colonies similar to the cell photo specimens. The cells in the 1-well / 6-well plate were detached with 0.5X TrypLE Select solution and suspended in PBS + Y-27632 medium (hereinafter also referred to as "PBS + Y medium"). When detaching the cells, a cell scraper was not used, and the cell suspension was prepared by pipetting.

[0101] Using UP.SIGHT (Mito Kogyo), cells were seeded at a rate of 1 cell / well into 1-2 96-well plates coated with iMatrix-511MG. The 96-well plates were then placed in an IncuCyte S3 incubator, and cell culture was started. After placing the 96-well plates in the IncuCyte® S3 (Sartorius), time-lapse images were taken to confirm that the cells were single-cell origin. This subculturing process was performed on 6 or more 96-well plates.

[0102] (11) Medium exchange for 96-well plates: Medium exchange was performed in each well of the 96-well plate two days after the day following subculturing. Thereafter, medium exchange was performed on the 5th, 8th, and 9th days. For plates that were not subculturised on the 10th day, medium exchange was performed from the 10th day until the day before subculturing.

[0103] (12) Passaging from 96-well plate to 96-well plate (1st time) (Preparation of 96-well plates for manufacturing and quality testing) Three to five 96-well plates were passed over to 96-well plates on the 10th and 11th days following the first passaging. Cell observation was performed on the 96-well plates, and wells where colonies had formed were marked. After detaching the cells using 0.5X TrypLE Select solution, the cells were converted into a PBS cell suspension, and the cell turbidity was seeded onto 96-well plates coated with iMatrix-511MG (for manufacturing). After seeding onto the 96-well plates for manufacturing, StemFit+Y medium was added to the remaining cell suspension, and the cells were cultured in an incubator as samples for exome sequencing testing.

[0104] (13) Exome Sequencing Test The 96-well plate prepared in (12) for exome sequencing was subjected to exome sequencing 1 to 2 days after the start of culture (Figure 4). The number of samples subjected to exome sequencing was 152. The specific details of the exome sequencing test are as follows: <Exome Sequencing Test using Twist reagents> 13-1 DNA Extraction (152 samples) After removing the culture medium from all wells on the 96-well plate, the lysate was added to all wells to lyse the cells. Samples were collected from the wells to be analyzed using the JANUS automated dispenser (PerkinElmer) and arranged on two 96-well plates. The reagent for extraction was added to the wells containing the samples and centrifugation was performed. Subsequently, the eluate was added and centrifugation was performed to recover the DNA. 13-2 DNA Concentration Measurement The DNA concentration was measured using a Qubit Flex Fluorometer (Thermo Fisher Scientific). 13-3 Preparation of Exome Test Libraries (Using HLA Custom Panels) Dilution was performed using the JANUS automated dispenser, and 10 μl of 5 ng / μl sample was dispensed. However, for samples requiring concentration, 10 μl was dispensed. Prelibraries were prepared from the dispensed DNA using the Sciclone NGSx (PerkinElmer) library preparation system and the Twist Library Preparation EF Kit. The concentration of the prelibraries was measured using a Qubit Flex Fluorometer. Using the JANUS automated dispenser, a prelibrary volume of 187.5 ng was dispensed. However, if the volume exceeded 19 μl, 19 μl was dispensed. Sequence libraries were prepared from the prelibraries dispensed using the Sciclone NGSx library preparation system, the Twist Comprehensive Exome, and a custom panel (a custom panel designed to cover the full length of HLA-A, HLA-B, and CIITA).13-4 Library Size and Concentration Measurement The size was measured using TapeStation (Agilent Technologies). qPCR was performed using QuantStudio3 (Thermo Fisher Scientific), and the concentration was measured by qPCR based on the measured size. 13-5 Library Sequencing Using a Next-Generation Sequencer The prepared library was sequenced in three separate steps using NovaSeq 6000 (Illumina) with 101 bp paired-end (PE) sequences. 13-6 Confirmation of KO Sites Using HLA-Matched Reference Sequences The obtained sequence data was mapped using BWA mem to reference sequences in which the HLA-A and HLA-B gene sequences of hg19 were replaced with HLA-A24 and HLA-B52, respectively, to create a BAM file. The BAM file was analyzed using GATK HaplotypeCaller. Furthermore, BAM file realignment was performed using abra2, and the realigned BAM file was analyzed using Socrates. A file summarizing the obtained indels and structural mutations was created. 13-7 Selection of 2 samples from 152 samples (Tables 8-14) and (Figure 5) The obtained indels and structural mutations were visually confirmed, and ultimately 2 samples were selected (marked with ○ in the confirmation column of Tables 8-14). In addition, 18 samples that could not be determined due to insufficient data were marked as undeterminable (marked with - in the confirmation column of Tables 8-14).

[0105] The HLA custom panel was designed primarily around sequences in the 0.5kb–2.0kb region containing the aforementioned target sequences in both alleles of genome-edited cells. Cell lines in which frameshift editing or stop codons were confirmed in the HLA-A / B, / CIITA cleavage prediction region were used for passage from 96-well plates to 12-well plates. The above exome sequencing analysis allowed for the selection of cells with the desired genome editing (Tables 8–14) and (Figure 5).

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113] (14) Medium change for 96-well plates: Medium was changed on the 1st, 4th, and 5th days following the day after subculturing, and subculturing (2nd time) was performed on the 96-well plates from the 5th to the 7th day. If subculturing was performed from the 7th day following the day after sowing, medium change was also performed on the 6th day.

[0114] (15) Passing from 96-well plate to 96-well plate (second time) On the 6th or 7th day following the passaging, 3 to 5 96-well plates that had been passaged on the 10th and 11th days in (12) were passed into 96-well plates. Cell observation was performed on the 96-well plates, and wells where colonies had formed were marked. After detaching the cells using 0.5X TrypLE Select solution, the cells were converted into a PBS cell suspension, and the cell turbidi was seeded onto 96-well plates coated with iMatrix-511MG. After seeding the cell turbidi, the cells were cultured in an incubator.

[0115] (16) The medium of the 96-well plate was changed on the 1st, 4th, and 5th day following the subculturing of the 96-well plate. Clones selected based on the results of the exome assay were subculturised into a 12-well plate from the 4th to 7th day following the seeding. However, if there were wells that became confluent before the results of the exome assay were available, subculturing was performed in advance.

[0116] (17) Following the results of the exome assay for passage from a 96-well plate to a 12-well plate, cells from selected clones were detached with 0.5X TrypLE Select solution and a PBS cell suspension was prepared. After cell counting, 10.2 × 10⁶ cells were placed on a 12-well plate coated with iMatrix-511MG. 3 Cells were seeded in cells / wells and cultured in an incubator.

[0117] (18) Medium change in 12-well plates was performed on day 1, day 4, and day 5 following the day after seeding, and subculturing was performed from day 4 to day 7 following the day after seeding. Photographs of the cells were checked before performing the medium change.

[0118] (19) When subculturing from one 12-well plate to another, if the number of colonies is less than the photographic sample during cell culture, or if cell proliferation is poor and it is judged that there is a high possibility of losing clones when subculturing to a 6-well plate, do not proceed to "(20) Subculturing from a 12-well plate to a 6-well plate" described later, but subculture again to a 12-well plate and perform maintenance culture. Cells from the 12-well plate were detached with 0.5X TrypLE Select solution and suspended in StemFit+Y medium. 10.2 × 10⁶ cells were placed on a 12-well plate coated with iMatrix-511MG. 3 Each cell was seeded in cells / well and cultured in an incubator. The cell count was 10.2 × 10⁶. 3 If the number of cells was insufficient, the entire amount was sown.

[0119] (20) Passing from 12-well plate to 6-well plate Photographs of cells cultured in the 12-well plate were taken 4 to 6 days after passing to the 12-well plate. Cells from the 12-well plate were detached with 0.5X TrypLE Select solution and suspended in StemFit+Y medium. 2.6 × 10⁶ cells were then transferred to a 6-well plate coated with iMatrix-511MG. 4Each cell was seeded at a rate of cells / well into 3-well / 6-well plates and cultured in an incubator. The cell count was 7.8 × 10⁶. 4 If there are not enough cells, seed only the number of cells available in the wells, 2.6 × 10 4 If the cells could not be sown, the remaining amount was sown.

[0120] (21) Medium exchange for 6-well plates was performed on the 1st, 4th, and 5th days following subculturing, and freezing was performed on the 4th to 7th days. Before performing the medium exchange, cell images of each well were checked to determine which wells would be frozen the following day. If freezing was performed on the 7th day following seeding, the medium exchange was performed on the 6th day.

[0121] (22) When subculturing from one 6-well plate to another, if the number of colonies is less than that of the cell photograph sample during cell culture, cell proliferation is poor, and it is determined that a sufficient amount of frozen sample cannot be obtained if frozen, do not proceed to "(23) Freezing," but subculture again into a 6-well plate and perform maintenance culture. Detach the cells from the 6-well plate with 0.5X TrypLE Select solution and suspend them in StemFit+Y medium. Place 2.6 × 10⁶ cells into a 6-well plate coated with iMatrix-511MG. 4 Each cell is seeded into a 3-well / 6-well plate at a rate of cells / well and cultured in an incubator. The cell count is 7.8 × 10⁶. 4 If there are not enough cells, seed only the number of cells available in the wells, 2.6 × 10 4 If the cells could not be sown, the remaining amount was sown.

[0122] (23) Using a frozen STEM-CELLBANKER GMP grade, 1.2 × 10⁶ cells (clones) (cells with modified double-stranded DNA genomes obtained by the manufacturing method of the present invention) are used for each cell (clone) in a 6-well plate. 6 A cell suspension was prepared at cells / ml and dispensed into approximately 16 cryotubes, each containing 200 μl. However, 3.84 × 10 6Even if cells are not obtained from the cells, it is not considered a deviation, and three 0.72 × 10⁴ aliquots are available. 6 Once the cells were obtained, the freezing process was carried out. The number of cells was 0.72 × 10⁶. 6 Cells smaller than 100 (clones) were discontinued and discarded. After dispensing, the caps of each tube were tightened and the dispensing volume was visually confirmed. The dispensed products were removed from the safety cabinet, placed into pre-cooled bicells, and then moved to a cryogenic freezer (-80°C). Freezing was started within one hour of adding STEM CELL BANKER to the cells. Within one week from the day after moving to the cryogenic freezer (-80°C), the frozen products were moved to liquid nitrogen storage containers and stored. Furthermore, whole-genome sequencing was performed using the frozen products (23) for the two samples selected in the exome assay described in 13-7 above to confirm the accuracy of the exome assay.

[0123] An example of a cell with the desired genome edited, prepared in Example 2, is shown in Figure 5.

[0124] Example 3: Production of HLA Genome-Edited Cells In this example, using the same method as steps (1) to (12) of Example 2 described above, the target cells were produced by genome editing of HLA-A24, HLA-B52, and HLA-Class II TA in the QHJI14s04 strain, which has the highest expression rate of approximately 8.4% in Japanese individuals and is owned by the Cell Preparation Facility of the Kyoto University iPS Cell Research Foundation. Exome sequencing tests were performed using the same method as in Example 2 described above. The number of samples subjected to exome sequencing tests was 67.

[0125] Six samples were selected from 67 samples using exome sequencing (marked with ○ in the confirmation column of Tables 15 and 16). Two samples that could not be determined were set aside (marked with - in the confirmation column of Tables 15 and 16). Of the six samples selected by exome sequencing, whole-genome sequencing analysis was performed on frozen samples of four samples to confirm the accuracy of the exome sequencing. Production of the remaining two samples was discontinued because the cells did not grow. Furthermore, whole-genome sequencing analysis of the two reserved samples using frozen samples revealed that they did not have the desired editing. As a result, four samples with the desired genome editing were selected (Tables 15 and 16).

[0126]

[0127]

[0128] This invention is useful because it improves the accuracy of genome editing confirmation in situations requiring high throughput, enabling a stable supply of cells with desired double-stranded DNA (e.g., genomic DNA) modifications. Furthermore, it is useful because it eliminates the need for cross-checking by performing immunohistochemical staining as a primary test to confirm knockout in the production of cells with desired gene knockout (e.g., induced pluripotent stem cells), allowing confirmation to be performed solely by sequence analysis. In addition, it is useful because it enables confirmation of gene (including oncogene) mutations on exons within the production process of cells with modified double-stranded DNA (e.g., genomic DNA) as needed.

[0129] This application is based on Japanese Patent Application No. 2024-225859 (filing date: December 20, 2024), the contents of which are fully incorporated herein.

Claims

1. A method for producing cells in which double-stranded DNA has been modified, comprising: (2) introducing a nucleic acid modifying enzyme having a nucleic acid sequence recognition module into cells; (3) analyzing the sequence of a 0.5 kb to 2.0 kb region containing a target sequence in both alleles of each cell in the cells into which the nucleic acid modifying enzyme having the nucleic acid sequence recognition module has been introduced, wherein the region includes an exon and an intron nearest to the target sequence; and (4) selecting cells in which modification has been confirmed in both alleles.

2. The method according to claim 1, wherein the nucleic acid-modifying enzyme having a nucleic acid sequence recognition module is at least one selected from the group consisting of a CRISPR-Cas system containing one or more gRNAs, a zinc finger nuclease, a TAL effector nuclease, and a protein obtained by linking a PPR protein and a nuclease.

3. The method according to claim 1 or 2, wherein the nucleic acid modifying enzyme having a nucleic acid sequence recognition module is a CRISPR-Cas system containing one or more gRNAs.

4. The method according to any one of claims 1 to 3, wherein the double-stranded DNA is genomic DNA.

5. The method according to any one of claims 2 to 4, wherein the CRISPR-Cas system comprises two or more gRNAs.

6. The method according to any one of claims 1 to 5, wherein the period of step (2) is 11 days or less.

7. The method according to any one of claims 1 to 6, further comprising the step of (4) expanding the culture of the selected cells.

8. The method according to any one of claims 1 to 7, wherein the 0.5 kb to 2.0 kb region containing the target sequence in both alleles of each cell is a region of approximately 1.0 kb.

9. The method according to any one of claims 1 to 8, wherein at least one of the target sequences is a sequence within an HLA gene.

10. The method according to claim 9, wherein the sequence within the HLA gene is at least one selected from the group consisting of HLA-A, HLA-B, and CIITA.

11. The method according to any one of claims 1 to 10, wherein the cell in which the double-stranded DNA has been modified is a pluripotent stem cell.

12. The method according to claim 11, wherein the pluripotent stem cells are induced pluripotent stem cells.

13. Cells in which double-stranded DNA is modified, produced by the method according to any one of claims 1 to 12.