Affinity-binder-based assay compositions and methods for spatial proteomics

Aptamer-based assays with proximity ligation and extension techniques provide efficient, cost-effective spatial proteomics by simplifying the capture process and maintaining spatial information, addressing the inaccuracies of RNA-based protein estimation and multiple capture steps in existing methods.

WO2026143014A1PCT designated stage Publication Date: 2026-07-02ILLUMINA INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/060925
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-23
Filing Date
2025-12-22
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Existing methods for spatial proteomics fail to accurately map protein expression patterns due to the non-one-to-one relationship between RNA transcripts and proteins, and existing aptamer-based assays require multiple capture steps, which are inefficient and costly.

Method used

Aptamer-based assays that utilize proximity ligation and extension techniques for single-step capture and detection of analytes, incorporating capture oligonucleotides that stochastically attach to analytes, allowing for spatial tagging and sequencing without additional capture steps.

Benefits of technology

This approach enables efficient, cost-effective spatial proteomics by retaining spatial information and reducing assay complexity, facilitating automation and improved spatial mapping of proteins within tissue samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025060925_02072026_PF_FP_ABST
    Figure US2025060925_02072026_PF_FP_ABST
Patent Text Reader

Abstract

Aptamer detection techniques with chemistry attachment with proximity hybridization and extension are described in an aptamer-based assay. In an embodiment, capture oligonucleotides can be used such that the capture oligonucleotides attach to spatially-fixed analytes in a fixed tissue sample. Aptamers that hybridize to the capture oligonucleotides are tagged with an extension sequence that can then be used for subsequent capture and spatial tagging steps.
Need to check novelty before this filing date? Find Prior Art

Description

AFFINITY-BINDER-BASED ASSAY COMPOSITIONS AND METHODS FOR SPATIAL PROTEOMICSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to and the benefit of U.S. Provisional Application No. 63 / 738,262, filed December 23, 2024 and titled “AFFINITY-BINDER-BASED ASSAY COMPOSITIONS AND METHODS FOR SPATIAL PROTEOMICS”, the disclosure of which is hereby incorporated by reference in its entirety herein.REFERENCE TO ELECTRONIC SEQUENCE LISTING

[0002] The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on December 18, 2025, is named “ILUM0212PCT.xml” and is 19,996 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.BACKGROUND

[0003] The disclosed technology relates generally to analyte detection and / or identification techniques used in conjunction with an affinity-binder assay, such as an aptamer-based assay for spatial proteomics. In particular, the technology disclosed relates to analyte modification techniques that can be used in conjunction with aptamer capture to uniquely identify captured analytes as well as spatially tag aptamers.

[0004] The subject matter discussed in this section should not be assumed to be prior art merely as a result of its mention in this section. Similarly, a problem mentioned in this section or associated with the subject matter provided as background should not be assumed to have been previously recognized in the prior art. The subject matter in this section merely representsdifferent approaches, which in and of themselves can also correspond to implementations of the claimed technology.

[0005] Protein expression patterns help define a cell’s identity and state. RNA transcripts are often used as a surrogate for protein expression, but the relationship between abundance of proteins and mRNA is not one-to-one. There are differences caused by RNA regulation and / or protein regulation, such as posttranscriptional, translational, protein degradation and RNA regulation. Therefore, direct nucleic acid sequencing of RNA transcripts may not provide an accurate estimation of protein expression.

[0006] Aptamers are single stranded nucleic acid molecules that bind to molecular targets, such as proteins, with high affinity and specificity. Advancements in aptamer selection and design include Systematic Evolution of Ligands by Exponential enrichment (SELEX). In SELEX, high affinity aptamers for different analytes of interest can be isolated from a combinatorial library, permitting high throughput characterization of aptamer-target binding and multiplexed assays for analytes in a complex biological sample. Upon aptamer binding to an analyte target, the binding event can be detected to characterize the presence and concentration of various analytes in the biological sample.

[0007] There is a need for technologies to map spatial proteomes in a tissue sample. Certain diseases (for example and without limitation, Alzheimer’s disease) are characterized by aberrant protein deposition, and understanding these protein deposits may elucidate the mechanisms underlying these disorders. Aptamers targeting cell membrane or nuclear membrane proteins can also be used to define cell and nuclear boundaries, simplifying cell segmentation of spatial transcriptomic data.BRIEF DESCRIPTION

[0008] In one embodiment, the present disclosure provides a method of analyte detection. The method includes contacting analytes of sample with a plurality of aptamers to form analyteaptamer complexes, wherein individual aptamers of the plurality of the aptamers have aspecific affinity for respective different analytes of the analytes; contacting the analyteaptamer complexes with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-aptamer-capture oligonucleotide complexes; and generating extension products for individual analyte-aptamer-capture oligonucleotide complexes by extending from an end of an individual aptamer hybridized to an individual capture oligonucleotide using the individual capture oligonucleotide as a template to generate an extension product within the individual analyteaptamer-capture oligonucleotide complex such that the individual aptamer is extended with a tag comprising a complement of a sequence of the individual capture oligonucleotide. The method also includes capturing the extension products on a capture surface using surface capture oligonucleotides immobilized on the capture surface; extending the surface capture oligonucleotides to generate complementary strands of the extension products; capturing 3’ end of the extension products using spatial bridge oligonucleotides immobilized on the capture surface such that the extension products form bridges; extending from the 3’ ends of the extension product using the spatial bridge oligonucleotides as templates to spatially tag the extension products with different unique tags associated with respective different locations of the spatial bridge oligonucleotides on the capture surface; and sequencing the spatially tagged extension products to generate sequencing data comprising aptamer identities associated with the different locations.

[0009] In one embodiment, the present disclosure provides a substrate for analyte detection. The substrate includes a capture surface onto which a plurality of analytes of a tissue sample are fixed; a plurality of surface capture oligonucleotides distributed across the capture surface; and a plurality of spatial bridge oligonucleotides distributed across the capture surface, wherein each individual spatial bridge oligonucleotide comprises a unique spatial identification sequence associated with an individual location on the capture surface. The substrate also includes a plurality of aptamers and capture oligonucleotides bound to the analytes to form analyte-aptamer-capture oligonucleotide complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective differentanalytes of the analytes, and wherein ends of the individual aptamers are hybridized to regions of the individual capture oligonucleotides within the complexes.

[0010] In one embodiment, the present disclosure provides a kit for analyte detection including a plurality of aptamers wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes, and wherein each individual aptamer of the plurality comprises: an aptamer binding region; and a non-binding region, the non-binding region comprising a first adapter sequence and a capture primer. The kit also includes a plurality of capture oligonucleotides, wherein each capture oligonucleotide of the plurality comprises: a functional group configured to cross-link to an amino acid of the analyte; a linker; a capture region complementary to the capture primer; and a capture extension region adjacent to the capture region.

[0011] In one embodiment, the present disclosure provides a method of forming a spatial proteome sequencing library. The method includes contacting analytes of sample fixed on a capture surface with a plurality of capture oligonucleotides and a plurality of aptamers to form analyte-aptamer-capture oligonucleotide-complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes; hybridizing ends of the plurality of aptamers to capture oligonucleotides within individual analyte-aptamer-capture oligonucleotide complexes; extending the ends of the hybridized aptamers to generate extension products that are captured on the capture surface via the extended ends; copying the extension products on the capture surface; tagging the copied extension products spatial identification sequences associated with respective locations of the capture surface; and generating a spatial protein sequencing library from the tagging copied extension products.

[0012] In one embodiment, the present disclosure provides a spatial mRNA / protein co-assay method. The method includes contacting protein analytes of sample fixed on a capture surface with a plurality of capture oligonucleotides and a plurality of aptamers to form analyteaptamer-capture oligonucleotide-complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes;hybridizing ends of the plurality of aptamers to capture oligonucleotides within individual analyte-aptamer-capture oligonucleotide complexes; extending the ends of the hybridized aptamers to generate extension products that are captured on the capture surface via the extended ends; copying the extension products on the capture surface; tagging the copied extension products with spatial identification sequences associated with respective locations of the capture surface; capturing mRNA analytes of the sample on the capture surface; tagging the copied extension products with the spatial identification sequences associated with respective locations of the capture surface; and determining relationships between location of the protein analytes and the mRNA analytes based on the spatial identification sequences.BRIEF DESCRIPTION OF THE DRAWINGS

[0013] These and other features, aspects, and advantages of the disclosed embodiments will become better understood when the following detailed description is read with reference to the accompanying drawings in which like characters represent like parts throughout the drawings, wherein:

[0014] FIG. l is a flow diagram of a method for analyte detection using stochastic attachment of capture oligonucleotide(s) to analytes, in accordance with aspects of the present disclosure;

[0015] FIG. 2 is an example analyte detection workflow for spatial proteomics with analyte modification, in accordance with aspects of the present disclosure;

[0016] FIG. 3 is a schematic illustration of an example aptamer and capture oligonucleotide arrangement, in accordance with aspects of the present disclosure;

[0017] FIG. 4 is a schematic illustration of an example aptamer and capture oligonucleotide arrangement, in accordance with aspects of the present disclosure;

[0018] FIG. 5 is a schematic illustration of an example surface capture oligonucleotide and spatial bridge oligonucleotide arrangement, in accordance with aspects of the present disclosure;

[0019] FIG. 6 is a schematic illustration of an example complimentary strand product of the workflow of FIG. 2 that is generated from an aptamer to form an amplification template for sequencing, in accordance with aspects of the present disclosure;

[0020] FIG. 6 is a schematic illustration of example aptamer arrangements including identification sequences and primer, in accordance with aspects of the present disclosure;

[0021] FIG. 7 is a schematic illustration of an example spatial capture from a fixed tissue sample, in accordance with aspects of the present disclosure;

[0022] FIG. 8 is a schematic illustration of an example spatial capture for protein and mRNA analytes from a fixed tissue sample, in accordance with aspects of the present disclosure;

[0023] FIG. 9 is a schematic illustration of a capture surface for spatial capture for protein and mRNA analytes from a fixed tissue sample in a co-assay, in accordance with aspects of the present disclosure;

[0024] FIG. 10 is a schematic illustration of different aptamer arrangements for dynamic range compression, in accordance with aspects of the present disclosure;

[0025] FIG. 11 is a schematic illustration of different arrangements for indirect aptamer detection, in accordance with aspects of the present disclosure;

[0026] FIG. 12 shows attachment of a capture oligonucleotides to available cysteines on an analyte, in accordance with aspects of the present disclosure;

[0027] FIG. 13 shows attachment of a mixture of capture oligonucleotides to different analytes via cross-linking to available amino acids in the analytes, in accordance with aspects of the present disclosure;

[0028] FIG. 12 is an example analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure;

[0029] FIG. 13 shows an example sequencing workflow using an analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure; and

[0030] FIG. 14 is a schematic diagram of a sequencing device for acquiring sequencing data for spatial proteomics and / or spatial transcriptomics, in accordance with aspects of the present disclosure.DETAILED DESCRIPTION

[0031] The following discussion is presented to enable any person skilled in the art to make and use the technology disclosed, and is provided in the context of a particular application and its requirements. Various modifications to the disclosed implementations will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other implementations and applications without departing from the spirit and scope of the technology disclosed. Thus, the technology disclosed is not intended to be limited to the implementations shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.

[0032] The emerging field of spatial proteogenomics is being driven by the development of new technologies that allow the mapping of single cell-omes to their spatial locations in a tissue slice. One method for spatially mapping single-cell transcriptomes (called the ex situ approach) involves the use of a surface coated with barcoded oligonucleotides, where the spatial location of each barcode is known. The barcoded oligonucleotides are localized into individual features, where every oligonucleotide in the same feature carries the same spatial barcode. Different implementations of this surface include a bead array, a spotted array, a clustered flow cell, or clustered particles arranged on a surface. These oligonucleotides also contain an oligo(dT) capture sequence that binds mRNA and acts as a primer for reverse transcription. A tissue section is then placed on this surface and polyA mRNA molecules within the tissue diffuse to the features and are captured on the surface. The captured RNA is reverse transcribed into cDNA, linking the spatial barcode with the cDNA sequence. This is followed by library prep and sequencing on a standard (e.g., Illumina) sequencer. Duringanalysis, the spatial barcode is used to map the physical location of the molecule from which the read is derived. The disclosed spatial proteomics and / or spatial proteogenomics techniques may be used in conjunction with affinity binders, such as aptamers, to augment spatial transcriptome information with spatial proteome information.

[0033] Aptamers are short single stranded nucleic acid molecules (ssDNA or ssRNA) that can bind to their specific target molecules with high affinity. Accordingly, aptamers can be used for multi omic applications, such as proteome characterization of a sample in a high-throughput manner. In some cases, an aptamer-based assay may be performed using two separate beadbased captures. Accordingly, some aptamer-based assays are performed using a two-step capture and separation.

[0034] Disclosed herein are techniques that employ chemistry attachment with proximity ligation (CAPL) for next generation sequencing for affinity-based spatial proteomics. In general, aptamers may be provided to capture cognate targets (e.g., analytes, target proteins, sample proteins, sample) in solution. Rather than using two separate capture steps, the disclosed techniques may use proximity hybridization and extension in conjunction with aptamer-analyte complex formation such that a detectable oligonucleotide(s) is generated as a result of the proximity hybridization. As a result, in certain embodiments, the disclosed aptamer-based assays may use a single capture step using immobilized or surface-associated aptamers. The extension products may be ready for detection (e.g., sequencing) without a secondary capture step. Accordingly, the techniques described herein facilitate automation improvements, enable a streamlined process, eliminate steps in existing workflows, and decrease assay costs. Further, because the aptamer-analyte complexes can be detected in situ without an additional aptamer capture step that severs the link between analyte location and aptamer location, the one-step capture disclosed herein may facilitate improved spatial information for spatial proteomics. Thus, embodiments of the disclosed technique may include aptamer-based detection with spatial tagging for use in spatial proteomics. In certain embodiments, the disclosed techniques may be part of a co-assay that detects a spatial transcriptome together with a spatial proteome.

[0035] In an embodiment, the analytes in an aptamer-based assay may be associated with (e.g., cross-linked or covalently bound to) capture oligonucleotide(s) to facilitate detection of analyte-aptamer complexes. Analyte attachment may include complex formation between a capture oligonucleotide and the analyte in a manner links the capture oligonucleotides to one or more amino acid types (and not other amino acid types) of the analytes. Because the pool of analytes can be a complex mixture of different proteins (including some that are covered by the assay and, in certain cases, some proteins that are not assayed), the particular amino acid locations that the capture oligonucleotides are attached to the analytes may be uncharacterized, e.g., non-specific or stochastic. Nonetheless, with sufficient coverage of the analytes with attached capture oligonucleotides, the proximity -based ligation can occur for most or all of the analytes of interest. By way of example, if the capture oligonucleotides include a functional group that can cross-link to only one amino acid type, such as lysine, a cross-linking reaction can be conducted under conditions to facilitate cross-linking of a capture oligonucleotide to available lysines in the pool of analytes. Each respective analyte type may have a different amino acid sequence and, thus, different numbers and positions of lysines. Accordingly, some analytes may have 30 or more attachment sites while other analytes may have 5 or fewer or even none. Further, all available attachment sites may not be cross-linked, depending on the structure of the protein and whether the attachment site is positioned to accept the capture oligonucleotide (e.g., is not interior-facing or sterically hindered). However, the proximitybased extension can successfully occur via hybridization of only one capture oligonucleotide to an aptamer bound to the analyte, even in a case where the cross-linking does not occur at all available attachment sites, which provides redundancy and tolerance for different assay conditions. Thus, as provided herein, the attachment may include an attachment to a specific amino acid type but in a manner that is undefined or uncharacterized with respect to the number and position of attached potential amino acid targets for a particular analyte and / or analyte pool.

[0036] Proximity extension of capture oligonucleotides (e.g., single-stranded oligonucleotides) partially hybridized to aptamers occurs in the presence of analyte-aptamer complex formation. Therefore, generation and detection of extension products from ahybridized end that acts as an extension primer may serve as a proxy detection for analytes in a sample of interest. As disclosed herein, the capture oligonucleotide and an affinity binder, such as aptamers, antibodies, etc., may, when hybridized, permit extension to generate an extension product that is directly or indirectly detectable. In certain embodiments, lack of extension products generated for particular aptamers provides a negative result indicative of no or low levels of analyte.

[0037] In one example, the capture oligonucleotide(s) include a capture region that serves as an extension template for a 3 ’ capture primer region of the aptamer. For example, the disclosed aptamers may include a non-binding region that, in embodiments, does not participate in analyte binding and that includes the capture primer region. When an individual analyte is complexed with an individual aptamer, the non-binding region of the aptamer is positioned in sufficient proximity to a capture oligonucleotide(s) to permit proximity hybridization and extension. After extension, an extended aptamer is formed in which the 3’ region of the extended aptamer includes a sequence that is complementary to the capture region and the capture extension template. The extended region of the aptamer can be captured on a solid support that includes immobilized primers having a complementary sequence (e.g., at least in part a same sequence as the capture oligonucleotides. The capture aptamer can be copied using the immobilized primers, and the copied strand can be tagged with a spatial tag that reflects the location of the analyte relative to the solid support.

[0038] With the foregoing in mind, FIG. 1 is a flow diagram of a method 10 for analyte detection in affinity binder-based assays as disclosed herein using stochastic attachment of capture oligonucleotide(s) to analytes. The method 10 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the method 10 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the blocks of the method 10 may be omitted. It should be noted that affinity-binder and aptamers may be used interchangeably.

[0039] At block 12 of the method 10, capture oligonucleotide(s) may be attached to sample analytes. For example, the capture oligonucleotide(s) may include a functional group (e.g., across-linking moiety, a functional group) that may associate with (e.g., cross-link or covalently bind to) one or more types of amino acids present in the analyte based on the type of functional group. By way of example, the functional group may include oxaziridine, which can bind to available methionine residues of the sample analytes. Accordingly, the capture oligonucleotide(s) may be modified with a particular functional group at an end (e.g., a 3’ or 5’ end) or within the nucleotide to select for a specific functional group-amino acid interaction.

[0040] In general, the association of the capture oligonucleotide(s) to the sample analytes is driven by interactions (e.g., cross-linking, covalent interactions) between the functional groups of the capture oligonucleotide(s) and the amino acids of the sample analytes that are available for modification. For example, available amino acids may be amino acids positioned generally towards an exterior structure of the analyte. However, it should be understood that analytes may have complex structures (folds, sheets, loops), and available amino acids may include amino acids positioned within a cavity or loop.

[0041] In certain embodiments, the capture oligonucleotide(s) may be universal or conserved, such that the pool of analytes in a sample are coupled to capture oligonucleotide(s) having a same sequence. The capture oligonucleotide(s), as described herein, may be used with various types of sample analytes (e.g., proteins) to modify these analytes to carry nucleotide sequences that facilitate subsequent detection steps. In this way, the capture oligonucleotide(s) may randomly associate to any available amino acid on the surface of the sample analyte based on the functional group at the end of the capture oligonucleotide(s). While the binding of the capture oligonucleotide(s) to an amino acid residue is a specific interaction mediated via the type of functional group, the association of capture oligonucleotide(s) to a sample analyte is a stochastic process that is variable depending on the structure and / or type of amino acid resides present within a sample analyte. Accordingly, this association process may be uncharacterized and will occur in a manner that is agnostic to what type of protein it is (e.g., albumin, cytokines, kinases, etc.). For example, the attachment may include coupling of capture oligonucleotide(s) to different positions or amino acids such that the analyte has a sufficient capture nucleotide modification coverage for proximity-basedligation. It should be understood that the modification may include one or more different amino acid types, such that adequate coverage of different analytes having respective different amino acid sequences can be achieved.

[0042] In certain embodiments, the attachment may occur in different stages. In some embodiment, one or more capture oligonucleotide(s) may associate with a sample to form a capture oligonucleotide-aptamer complex (e.g., capture oligonucleotide-affinity binder complex). The capture oligonucleotide(s)-aptamer complex may subsequently contact aptamers to form the aptamer-analyte-capture oligonucleotide(s) complex. In some embodiments, aptamers may bind to a sample to form an aptamer-analyte complex. The aptamer-analyte complex may contact capture oligonucleotides(s), wherein the capture oligonucleotide(s) may associate with the aptamer-analyte complex to form the aptameranalyte-capture oligonucleotide(s) complex (e.g., affinity binder-analyte-capture oligonucleotide(s) complex. In other words, the capture oligonucleotides can be described herein as a “protein agnostic” or “non-protein specific” binding moiety that is able to associate with multiple proteins regardless of the type of protein or their activity, and as discussed more herein, may label different proteins at different amounts depending on the sequence of the proteins and the type of interaction mediating the binding moiety of this element.

[0043] The modified analytes having associated capture oligonucleotide(s), when bound to respective aptamers, are brought together such that proximity-based hybridization occurs between one of the analyte’s capture oligonucleotide(s) and the bound aptamer. For example, at block 14 of the method 10, the analyte-attached capture oligonucleotide(s) may be hybridized to the analyte-bound aptamer to form a partially double-stranded oligonucleotide structure. In general, a portion of the aptamer may include an analyte-binding region that exhibits a high affinity for an analyte of interest, which permits the formation of an aptameranalyte complex. In some embodiments, the aptamer may associate (i.e., bind via the analytebinding region) with the sample analyte prior to modification of the analytes via the nonspecific or stochastic attachment of the capture oligonucleotide(s). Alternatively, the aptamer may associate (i.e., bind via the analyte-binding region) with the sample analyte after or inconjunction with the attachment of the capture oligonucleotide(s) to the sample analytes. Accordingly, when the sample analyte is complexed with an individual aptamer, the nonbinding region of the aptamer is positioned in sufficient proximity to a capture oligonucleotide(s) to enable hybridization between complementary regions.

[0044] At block 16 of the method 10, the hybridized aptamer can be extended from a 3’ end using a DNA polymerase and using a single-stranded region of the capture oligonucleotide as a template. Thus, the aptamer can be tagged or appended with a complement to a sequence of the capture oligonucleotide, which may be used in conjunction with downstream detection via sequencing in block 18.

[0045] The extended aptamer or extension product is provided for a detection assay, e.g., a sequencing reaction. For example, the extension product may be captured on a solid surface (e g., a capture bead). After extension, the extension product may include a complement to a template portion of the capture oligonucleotide. Thus, the disclosed workflow may not only eliminate additional surface-based capture steps, but also in embodiments may provide an aptamer-based assay in which analyte capture and detection may permit retention of spatial information as generally discussed herein.

[0046] By way of example. FIG. 2 is an example spatial proteomic assay workflow 50 with analyte modification. The workflow 50 may include a sample 52, wherein the sample 52 may include one or more sample analytes, e.g., protein(s) 54. It should be understood that the single illustrated protein(s) 54 is by way of example, and the illustrated workflow may apply to the pool of analytes present in the sample. This workflow 50 enables the precise spatial mapping of proteins within tissue samples based on capture of extended strands generated from associated aptamers at particular locations on a surface. The sample 52 may include tissue slices mounted onto a capture surface 51, such as a glass slide pre-coated with spatial barcodes (e.g., spatial identification sequences) and surface capture oligos. Spatial barcodes serve as unique identifiers for specific locations on the slide, while surface capture oligos are designed to bind the released extended aptamers.

[0047] The illustrated capture may initiate by contacting aptamer(s) 56 with the protein(s) 54 under conditions that permit formation of analyte-aptamer complexes 61. The mounted tissue can be soaked with modified aptamers 56, forming the analyte-aptamer complexes 61. The aptamer(s) 56 may include one or more non-binding regions 59 and an analyte-binding region 57, wherein the analyte-binding region 57 exhibits a high affinity for the protein(s) 54. Accordingly, the analyte-binding region 57 of the aptamer(s) 56 may enable the formation of an aptamer-analyte complex 61. Any non-specific aptamers are washed away, which may include a challenge step. The workflow 50 may use a polyanionic molecule to challenge nonspecific aptamer interactions to increase a specificity of the formed analyte-aptamer complexes 61. As noted, the aptamer contact with the analyte(s) 54 may occur on a surface 51 of the tissue slice or other fixed sample such that the aptamers 56 generally spatially associate at locations on the surface 51 to which the respective analytes 54 are fixed.

[0048] In the illustrated workflow 50, capture oligonucleotide(s) 60 (e.g., protein-labeling oligonucleotide(s)) may associate with the aptamer-analyte complex 61 to form an aptameranalyte-capture oligonucleotide(s) complex 63 (i.e., analyte-aptamer-capture oligonucleotide(s) complex 63). For example, a portion (e.g. one end) of the capture oligonucleotide(s) 60 may be modified to include a functional group to facilitate an interaction (e.g., cross-linking, covalent interactions) with amino acid(s) of the protein(s) 54. In this way, the capture oligonucleotide(s) 60 may associate with the protein(s) 54, which is mediated by the interaction between the functional group and the amino acid on the surface of the protein(s) 54. It should be noted that one or more, two or more, or three or more capture oligonucleotide(s) 60 may associate with one protein(s) 54 such that each individual capture protein(s) 54 is associated with one or more capture oligonucleotide(s) 60. In some embodiments, it should be noted that the capture oligonucleotide(s) 60 and aptamer(s) 56 may contact the protein(s) 54 co-currently. In some embodiments, it should be noted that the capture oligonucleotide(s) 60 may contact the protein(s) 54 before the aptamer(s) 56.

[0049] The analyte modification with the capture oligonucleotide(s) 60 may be performed on the pool of protein(s) 54 present in the tissue sample 52. Thus, in embodiments, the captureoligonucleotide(s) 60 may all have a same sequence relative to one another, even when associated with different protein(s) 54. However, each individual aptamer(s) 56 specific for an individual analyte (e.g., protein(s) 54) has a unique sequence analyte-binding region 57 relative to other aptamer(s) 56. As further described herein, the aptamer(s) 56 may, in embodiments, include the non-binding region 59 that does not directly interact with the protein(s) 54. The non-binding region 59 may include one or more conserved regions, such as a capture primer region or an adapter (e.g., sequencing adapter), that is conserved between different aptamers. In some embodiments, the non-binding region may include a unique aptamer identification sequence that is different from the analyte-binding region 57 but that is uniquely identifying for the aptamer 56.

[0050] Once the protein(s) 54 is complexed with the aptamer(s) 56 and the capture oligonucleotide(s) 60, a non-binding region 59 of the aptamer(s) 56 may be positioned in sufficient proximity to a portion of the capture oligonucleotide(s) 60 to permit hybridization. As discussed, the capture oligonucleotide(s) 60 may have a conserved sequence to permit binding a corresponding conserved non-binding region 59 of the aptamer(s) 56. Thus, any capture oligonucleotide can hybridize to the non-binding region 59 of any aptamer 56 in an embodiment. The sequence of the non-binding region 59 and its complement on the capture oligonucleotide 60 can be selected to avoid binding to any analyte-binding regions 57 within the aptamer pool. The non-binding region 59 may be 8-50 bases in length in an embodiment. In one embodiment, the non-binding region 59 may be selected to have a relatively low melting temperature (e.g., between 48°C and 65°C) to permit temperature-mediated disassociation and removal of capture oligonucleotides 60 that hybridize to the non-binding region 59 but that are not associated with any analyte 54. In this manner, the aptamer tagging occurs only when an individual analyte 54 has a bound aptamer 56 as well as a cross-linked or otherwise associated capture oligonucleotide 60. Non-cross-linked capture oligonucleotides 60 can be removed / washed at melting temperatures used to dissociate the hybridized regions of the aptamer 56 and capture oligonucleotide 60. It should be understood that the heat dissociation may also occur in workflows 50 in which the capture oligonucleotides 60 are applied to the analytes 54 prior to or in conjunction with aptamer contact.

[0051] In some embodiments, non-specific oligonucleotide blockers may be provided to the analyte-aptamer-capture oligonucleotide complexes 63. In general, the non-specific oligonucleotide blockers 202 reduce background from aptamer(s) 56 binding to non-cognate proteins.

[0052] The aptamer-analyte-capture oligonucleotide(s) complex 63 may be subsequently challenged. For example, a non-specific aptamer or compound may be provided to reduce any non-specific interactions between aptamers and proteins.

[0053] After hybridization and removal of unassociated capture oligonucleotides 60, a 3’ hybridized end of the aptamer(s) 56 can be extended via a DNA polymerase using the capture oligonucleotide as template. Hybridization and extension may only occur when the aptamer(s) 56 and the capture oligonucleotide(s) 60 are in close proximity and stabilized on the analyte surface. Thus, the aptamer 56 is tagged with the complement of the capture oligonucleotide. In certain cases, the capture oligonucleotide may include a modified end or base to limit extension. After extension, the analyte(s)54 can be removed (e.g., via proteinase K treatment).

[0054] In certain embodiments, the protein(s) 54 may be removed prior to subsequent detection steps. For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitate degradation of the protein(s) 54. In other embodiments, heat, chemical degradation, or may be used for the degradation of the sample protein(s) 54. In some embodiments, the ligated oligonucleotide(s) 64 may be cleaved from the sample protein(s) 54 via chemical or enzymatic means.

[0055] The capture surface 51 of the tissue sample 52 may include one or more types of surface-immobilized oligonucleotides that can be used to add a spatial tag. Accordingly, the capture surface 51 can be modified such that each spatial location (e.g., well, individual location of the capture surface 51) is associated with a unique spatial tag. In the illustrated embodiment, a first single-stranded oligonucleotide functions as a capture oligonucleotide 80 and is capable of hybridizing to the extended portion of the extension product 70 to capture the aptamer 56. Because the hybridization is mediated by the extended portion, unextendedaptamers 56 are not captured by the capture oligonucleotides 80 at earlier points in the workflow 60. That is, the extension tag for the aptamers 56 is not incorporated until after aptamer-analyte complex formation. Accordingly, those aptamers 56 without a corresponding analyte 54 in the sample 52 are not able to hybridize to the surface-bound capture oligonucleotides 80. Further, because the extended portion of the extension product 70 is a conserved sequence, the capture oligonucleotides 80 may also have complementary conserved sequences. In an embodiment, all capture oligonucleotides 80 may have a same sequence relative to one another. In contrast, a second single-stranded oligonucleotide type, illustrated as spatial bridge oligonucleotides 82, may include sequences that differ from one another on the basis of unique spatial tags or spatial identification sequences associated with different spatial locations on the capture surface 51.

[0056] The extension product 70, in this case the tagged aptamer 56, after release from the analyte 54 or removal of the analyte 54, diffuses and is captured on the capture surface 51 at a spatial location generally corresponding to the location of the analyte 54 in the tissue sample, e.g. location at the time of fixation of the tissue. Thus, there is a relationship between the analyte location and the capture location of the aptamer 56, permitting spatial mapping. After capture, the extension product 70 serves as a template for extension (e.g., polymerase extension) of the capture oligonucleotide 80 to form a complementary sequence 88. After a denaturing step, the extension product 70 including the aptamer 56 can be washed away, leaving the surface-immobilized complimentary sequence 88. The complimentary sequence 88 is tagged with the spatial tag via bridge formation and extension. Thus, the complimentary sequence 88 contains both the copy of the aptamer 56, providing protein information, and the spatial barcode, indicating the spatial location. After tagging, the complimentary sequence 88 can be cleaved from the capture surface 51 for downstream analysis (e.g. sequencing).

[0057] FIG. 3 is an example aptamer and capture oligonucleotide arrangement. Each aptamer 56 may include one or more non-binding regions 59 and an analyte binding region or regions 57. A first non-binding region 59a may include a bridge region 100 on a 5' end. The bridge region may be used for downstream capture / tagging steps. In an embodiment, the bridgeregion is a TSO adapter sequence to enable co-assays with mRNA transcripts (see FIG. 9). A second non-binding region 59b at a 3' end region 102 may include an adapter sequence 106 (e.g., a A14'ME’ sequence) as a primer site for subsequent amplification and adding sequencing primers and indexes. This is followed by the capture primer 108, which can be designed with a sequence / length having a low enough melting temperature (e.g., between 48°C and 65°C Tm) to the capture oligonucleotide 60 to hybridize only when spatially co-localized with a complex 63.

[0058] In the illustrated example, a capture oligonucleotide 60 may include a functional group 110 to permit analyte association. The functional group may be positioned at a 5’ end as in FIG. 3 or at a 3’ end as in FIG. 4. In FIG. 3, the capture region 112, having a sequence complementary to the capture primer 108, is at a 3’ end of the capture oligonucleotide 60. A capture extension sequence 114 is adjacent and just 5’ of the capture region 112. A linker region 110 is positioned close to the functional group 110, and the linker region 111 can be generally selected to be flexible / long enough to allow the capture region 112 to come into contact with the aptamer 56.

[0059] The linker region sequence may include nucleotide linkers, polyethylene glycol (PEG) linkers, poly T bases, poly A bases, etc. In one embodiment, the linker sequence including nucleotide bases may range from about 1 to about 30 nucleotides. In another embodiment, linker sequences including PEG linkers may be about 25 carbons long. It should be noted that the linker sequence is compatible with the chemical group 110.

[0060] In the illustrated example, the capture oligonucleotide may have one or more modified bases to limit extension from one or both 3’ ends. For example, an internal extension blocker 120 (e.g., LNA nucleotides or the start of a PEG linker) can prevent extension into the linker region 111. A 3’ blocked end 122 can prevent concurrent extension from the 3’ end of the capture oligonucleotide 60. FIG. 4 shows an arrangement in which the functional group 110 is at a 3’ end, and the hybridization between the capture primer 108 and the capture region 112 permits extension to an end of the capture oligonucleotide 60. Regardless of the arrangementof the capture oligonucleotide 60, the capture oligonucleotide 60 may be a conserved sequence that is the same sequence within a particular reaction or reactions.

[0061] Using the capture extension sequence 114 as a template as discussed herein adds the complement of the capture extension sequence 114 to the aptamer such that the extension product 70 is formed. The extension product can be captured and copied using the surface capture oligonucleotides 80, as shown in FIG. 5, which includes a capture sequence 142 that is a same sequence as the capture extension sequence 114. Thus, the complementary sequence on the extension product 70 can be captured. A 5’ end 130 of the surface capture oligonucleotides 80 may include a cleavable region 140 having a cleavable moiety or sequence. This permits the generated spatially tagged complementary sequence 80 (see FIG.2) to be cleaved from the capture surface 51 for downstream analysis. In certain cases, the surface capture oligonucleotides 80 may include at least a portion of the capture primer to enhance tagged aptamer capture. The surface capture oligonucleotides 80 may be conserved sequences that are a same sequence distributed across or patterned onto the capture surface 51.

[0062] The capture surface 51 may also include spatial bridge oligonucleotides 82. The spatial bridge oligonucleotides 82 can differ from one another at least in part on the basis of unique spatial identification sequences 152. The spatial bridge oligonucleotides 82 are distributed across or patterned onto the capture surface 51 such that different locations on the capture surface are associated with different spatial identification sequences 152. The capture surface 51 may be mapped in advance such that the locations of the different spatial identification sequences 152 on the capture surface 51 are characterized and stored in a memory. The spatial bridge oligonucleotides 82 includes a bridge region 144 that is a same sequence as the bridge region 100 of the aptamer 56. Accordingly, when the aptamer strand is copied, the bridge region 144 is copied to generate a bridge’ sequence in the complementary strand 88 (see FIG.2). The bridge’ sequence can be captured by the bridge region 144 of the spatial bridge oligonucleotide 82. Hybridization at the bridge region 144 permits the complementary strand 88 to be extended at its 3’ end using the spatial bridge oligonucleotide 82 as a template to tag the complementary strand 88 with the spatial identification sequence 152 and, in certainembodiments, an adapter sequence 150. The complement of both the spatial identification sequence 152 and the adapter sequence 150 is added to the 3’ end of the complementary strand 88 via extension. The spatial bridge oligonucleotides 82 thus provide a template that includes a first variable region (spatial identification sequence 152) and a second conserved region (adapter sequence 150) that is the same in all of the spatial bridge oligonucleotides 82. Accordingly, the spatial bridge oligonucleotides 82 are partially conserved and partially variable.

[0063] FIG. 6 shows an example complementary strand 88 after spatial tagging and cleavage from the capture surface 51 at the cleavage site 140. The complementary strand 88 is generated as a copy of the extension product 70 extending from the surface capture oligonucleotide 80. Thus, after cleavage, the complementary strand 88 includes a portion of the surface capture oligonucleotide 80 that includes the capture extension sequence 142 The complementary strand also includes conserved adapter sequences 164, 174 that flank the analyte binding region copy 168, the bridge copy 170 and the spatial identification sequence copy 172. The conserved adapter sequences 164, 174 can serve as primer binding sites for amplification primers 180, 182 that can generate sequencing fragments 188 for a sequencing library that includes a pool of the generated sequencing fragments 188 from different analytes. The primers can be used to add indexes as appropriate for the desired sequencing platform. In an embodiment, sequencing data generated from the fragments 188 generates reads of the analyte binding region copy 168 and the spatial identification sequence copy 172 or their complements in a single read, permitting association of the analyte identity (determined from the aptamer sequence or its complement) with a spatial location (determined from the spatial identification sequence or its complement).

[0064] FIG. 7 shows an example capture surface 51 for a fixed tissue sample 52 that includes analytes 54 immobilized thereon in aptamer-analyte-capture oligonucleotide complexes 63. After removal of the analytes 54 from the complexes 63, the generated extension products 70 diffuse to locations on the capture surface 51 that generally correspond to locations of the analytes 54. For example, as shown in FIG. 7, a first analyte 54a that is generally near oradjacent to a second analyte 54b with also form adjacent complexes 63, 63b, which in turn leads to extension products 70a, 70b that are captured relatively close to one another on the capture surface 51 by capture oligonucleotides 80. Thus, the sequencing data generated from the extension products 70a, 70b after spatial tagging will reflect that the analytes 54a, 54b are present in the sample 52 in relatively close locations.

[0065] The capture surface 51 may include a lawn of distributed capture oligonucleotides 80 and spatial bridge oligonucleotides 82. In an embodiment, capture oligonucleotides 80 and spatial bridge oligonucleotides 82 may be provided in relatively equal concentrations on the capture surface 51 and / or arranged such that capture oligonucleotides 80 and spatial bridge oligonucleotides 82 are adjacent to or in sufficiently close proximity to allow bridge formation as discussed herein. In an embodiment, the capture oligonucleotides 80 and spatial bridge oligonucleotides 82 may be patterned or provided in specific wells or patterned binding sites. A patterned surface may provide spatial location without decoding. In certain cases, such as with transcriptome co-assays (see FIGS. 8-9), the capture oligonucleotides 80 and the mRNA transcript capture oligonucleotides may be different from one another and present in different relative amounts. For example, the capture oligonucleotides 80 may be present in greater amounts or lesser amounts relative to the mRNA transcript capture oligonucleotides.

[0066] As part of the assay, certain analytes 54 may be fluorescently tagged to permit visualization of membrane or other biomarker proteins such that, for example, locations of a cell membrane on the capture surface can be determined. Thus, in addition to spatial tagging, the disclosed embodiments may also include a step of fluorescent tagging and capture surface optical visualization.

[0067] FIGS. 8-9 shows how a workflow of the disclosure can be modified to be compatible with a protein / mRNA co- assay. FIG. 8 shows an example capture surface 51 for a fixed tissue sample 52 that includes analytes 54 immobilized thereon in aptamer-analyte-capture oligonucleotide complexes 63. In addition, mRNA transcripts 190 are immobilized and captured by mRNA capture oligonucleotides, as generally discussed with respect to FIG. 9.Embodiments of the present disclosure include a co-assay for spatial transcriptomics that generates spatial data from protein analyte locations and from mRNA transcript locations

[0068] FIG. 9 shows an example capture product of the complementary strand on the capture surface 51 as well as a captured mRNA transcript 190 captured by an mRNA capture oligonucleotide 198 that includes a polyT sequence and appropriate adapter / barcode sequences depending on the desired sequencing platform. A template switching reverse transcriptase (RT) is used to add a template switch oligonucleotide (TSO) sequence to the 3’ end of the cDNA or the copied aptamer sequence. This TSO sequence then acts as a primer landing site for copying the extended capture oligonucleotide. If desired, the mRNA and the aptamer-derived products can be separated from one another for different assay processing steps. A second strand can dehybridized from the surface, and the shorter aptamer sequences / complementary strand sequences are separated from the longer cDNA sequences using a solid- phase reversible immobilization (SPRI) step. In some aspects, a ligation-based preparation is used.

[0069] FIG. 10 is an example of different aptamer arrangements that may be used for dynamic range compression to compress detected amounts of high-abundancy proteins within a dynamic range to permit concurrent detection with low-abundancy proteins. Aptamers 56 that bind to high abundancy proteins may be provided as a mixture in the detection workflow with dummy aptamers 56* that have a same binding affinity for the high abundancy proteins but that block or otherwise do not permit efficient detection such that the detection outcome is lowered in the presence of the dummy aptamers 56*. The illustrated dummy aptamers 56* are by way of example, and may include arrangements with partial or complete removal of the capture primer 108, partial or complete removal of the bridge 106, or both. Techniques for dynamic range compression as disclosed in WO2023196528A1, hereby incorporated by reference in its entirety herein, may be used in conjunction with the aptamer-based assays herein. The ratio of the dummy aptamers 56* to the standard aptamers 56 may be adjusted based on the abundance of a particular analyte. Low abundance analytes may not have any dummy aptamers 56*, while high abundance analytes may have ratios of dummy: standardaptamers of 1:1 or 2:1 or more. In another embodiment, an aptamer 56 specific for a high abundance analyte may be designed with a reduced capture primer length to further decrease its Tm such that it has reduced hybridization strength to the capture oligonucleotides relative to aptamers 56 for lower abundance analytes. This may avoid additional synthesis of dummy aptamers, because the reduction in performance of the aptamer itself acts to reduce the detection efficiency.

[0070] FIG. 11 shows different aptamer arrangements for indirect detection of aptamer sequences. The non-binding region 59 of the aptamer(s) 56 does not bind to the protein(s) 54 and / or does not significantly impact binding affinity of the analyte-binding region 57, and as such, the sequence of the non-binding region 59 may be selected to avoid interaction with the protein(s) 54. The non-binding region 59 may be used as a proxy for detection of the aptamer(s) 56 binding to a respective protein(s) 54. Accordingly, the non-binding region 59 may include a bar code or identification sequence 210 that can be used to detect an aptameranalyte interaction. Each aptamer ID sequence 210 is selected to be uniquely associated with an individual aptamer(s) 56. Accordingly, the non-binding region 59 can include a bar code or identification sequence 210 that is unique to the individual aptamer 56. Thus, different aptamers 56 are associated with respective different identification sequences 210 that are all different from one another and are uniquely identifying. In an embodiment, uniquely identifying sequences are uniquely identifying while accounting for barcode errors (e.g., a 1-2 nucleotide sequence error) during sequencing. Further, the identification sequence 210 may be designed such that the identification sequence 210 is different from the aptamer sequence. In an embodiment, the identification sequence may be 10-50 bases in length.

[0071] In another embodiment, the aptamer 56 may be detected using a reporter probe 220 that binds to the aptamer identification sequence 210, rather than the analyte-binding region 57. The reporter probe 220 carries a complement 222 of the aptamer identification sequence 210 and, therefore, extension of the reporter probe 220 using the capture oligonucleotide 60 and processing using the workflow steps of FIG. 2 will yield a complementary strand 88 thatdoes not carry the analyte binding-region sequence 57 but instead carries the aptamer identification sequence 210 to serve as a proxy detection sequence.

[0072] FIGs. 12-13 illustrate attachment of capture oligonucleotides 60 to analytes 54. The functional group 110 permits association of the capture oligonucleotide(s) 60 to the protein(s) 54. Accordingly, the functional group 110 may be chosen to permit a particular interaction between the functional group and one or more amino acids of the protein(s) 54. For example, the functional group 110 may be an oxaziridine group such that the capture oligonucleotide(s) 60 can bind to available methionine groups of the protein(s) 54. Additional modifications of the functional group 110 include, but are not limited to, succinyl groups (e.g., binds to available lysine groups), maleimide groups (e.g., binds to available cysteine groups as in the embodiment of FIG. 12), cyclohexenone groups (e.g., binds to histidine groups), glyoxal groups or guanidinium groups (e.g., binds to arginine groups), or carbodiimide (e.g., 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC)) groups (e.g., binds to aspartic acid groups and glutamic acid groups). Furthermore, it should be noted that the functional group 110 retains functionality under biological conditions (e.g., pH ~7) to ensure protein(s) 54 integrity during the process. Accordingly, the functional group 110 may be chosen to permit the interaction between the functional groupllO of the capture oligonucleotide(s) 60 and any of the amino acids associated with protein(s) 54. It should be noted that the capture oligonucleotide(s) 60 may be relatively fast to cross-link with the amino acids associated with protein(s) 54 in solution.

[0073] It should be noted that while the illustrated embodiments depict the protein agnostic attachment of capture oligonucleotides to the analytes, in some embodiments, aptamers may be bound to the analytes as well, which may also affect the attachment process of the capture oligonucleotide to the analytes. By way of example, FIG. 12 shows attachment of a capture oligonucleotides to an analyte via cross-linking to available cysteines in the analyte. In the illustrated example, protein 54a is an individual analyte that exhibits various amino acids on its surface (e g., alanine, cysteine, glycine, methionine, lysine). Interaction (e.g., association) between the capture oligonucleotide(s) 60 and protein 54 may be mediated by modification ofa portion of the capture oligonucleotide(s) 60. For example, an end of the capture oligonucleotide(s) 60 may include functional group 110, wherein functional group 110 is a maleimide group that binds to cysteine. This permits the capture oligonucleotide 60 to associate with available cysteine residues on the protein 54. In the illustrated example, two capture oligonucleotide(s) 60 interact (e.g., cross link, covalently bind) to two available cysteine residues. However, no attachment is seen to an interior or unavailable cysteine. It should be noted that two or more capture oligonucleotide(s) 60 may bind to an individual protein 54.

[0074] With the preceding in mind, FIG. 13 shows attachment of a mixture of capture oligonucleotides 60to different analytes via cross-linking to available amino acids in the analytes. In general, a sample 52 may include various analytes (e.g., protein(s) 54) that differentiate in their structure. In the illustrated example, protein 54a and protein 54b represent two different analytes within a sample 52. In particular, protein 54a includes amino acid residues that are different relative to protein 54b. Accordingly, a mixture of capture oligonucleotide(s) 60 may be provided to permit association with protein 54a and protein 54b, whereby the capture oligonucleotides 60 include different functional groups 110a, 110b, 110c to account for different amino acid sequences and availability for modification. For example, the mixture may include the capture oligonucleotide(s) 60 with functional group 110a, wherein functional group 110a is a maleimide group that binds to cysteine residues. The mixture may also include the capture oligonucleotide(s) 60 with functional group 110b, wherein functional group 110b is an oxaziridine group that binds to methionine residues. The mixture may further include capture oligonucleotide(s) 60 with functional group 110c, wherein functional group 110c is a succinyl group that binds to lysine residues. As shown in the illustrated example, not all available amino acid targets for the functional groups may be modified, which may be stochastic and / or based on the arrangement of the surface amino acids for any particular analyte 54. For example, even surface amino acids may be unavailable for binding because of crowding from attached capture oligonucleotides 60 already in place. In this way, providing a mixture of capture oligonucleotide(s) 60 advantageously enables sampling of a variety of analytes within a sample. Furthermore, this increases the likelihood of detecting an aptamer-analyte complex as contacting analytes to a mixture of capture oligonucleotide(s) 60 allows a variety of functional group-amino acid interactions to be probed.

[0075] FIG. 14 is a schematic diagram of a sequencing device 500 that may be used in conjunction with the disclosed embodiments for aptamer detection as generally discussed herein. The sequencing device 500 comprises a computing device 504 and a sample handling or processing 502 for sequencing a genomic sample or other nucleic-acid polymer. In some versions, the sequencing device 500 analyzes nucleotide fragments or oligonucleotides extracted from genomic samples to generate nucleotide reads or other data utilizing computer implemented methods and systems either directly or indirectly on sequencing device 500. More particularly, the sequencing device 500 receives nucleotide- sample slides (e.g., flow cells comprising nucleotide fragments extracted or generated from samples and further copies and determines the nucleobase sequence of such nucleotide fragments. It should be understood that sequencing device (810) may represent a version of systems that are in an integrated device or separate or distributed systems.

[0076] In some versions, the sequencing device 500 utilizes SBS to sequence nucleotide fragments into nucleotide reads and determine nucleobase calls for the nucleotide reads. The sequencing device 500 may further store the nucleobase calls as part of base-call data that is formatted as a binary base call (BCL) file and send the BCL file to a local device and / or the server device(s). Sequencing device 500 may communicate the BCL file and / or other data to local device and / or client device via a network or directly (i.e., bypassing the network).

[0077] The sequence device 500 may be implemented according to any sequencing technique, such as those incorporating sequencing-by-synthesis methods described in U.S. Patent Publication Nos. 2007 / 0166705; 2006 / 0188901; 2006 / 0240439; 2006 / 0281109; 2005 / 0100900; U.S. Pat. No. 7,057,026; WO 05 / 065814; WO 06 / 064199; WO 07 / 010,251, the disclosures of which are incorporated herein by reference in their entireties. Alternatively, sequencing by ligation techniques may be used in the sequencing device 500. Such techniques use DNA ligase to incorporate oligonucleotides and identify the incorporation of such oligonucleotides and are described in U.S. Pat. No. 6,969,488; U.S. Pat. No. 6,172,218; andU.S. Pat. No. 6,306,597; the disclosures of which are incorporated herein by reference in their entireties. Some embodiments can utilize nanopore sequencing, whereby target nucleic acid strands, or nucleotides exonucleolytically removed from target nucleic acids, pass through a nanopore. As the target nucleic acids or nucleotides pass through the nanopore, each type of base can be identified by measuring fluctuations in the electrical conductance of the pore (U.S. Patent No. 7,001,792; Soni & Meller, Clin. Chem. 53, 1996-2001 (2007); Healy, Nanomed.2, 459-481 (2007); and Cockroft, et al. J. Am. Chem. Soc. 130, 818-820 (2008), the disclosures of which are incorporated herein by reference in their entireties). Yet other embodiments include detection of a proton released upon incorporation of a nucleotide into an extension product. For example, sequencing based on detection of released protons can use an electrical detector and associated techniques that are commercially available from Ion Torrent (Guilford, CT, a Life Technologies subsidiary) or sequencing methods and systems described in US 2009 / 0026082 Al; US 2009 / 0127589 Al; US 2010 / 0137143 Al; or US 2010 / 0282617 Al, each of which is incorporated herein by reference in its entirety. Particular embodiments can utilize methods involving the real-time monitoring of DNA polymerase activity. Nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and y-phosphate-labeled nucleotides, or with zeromode waveguides as described, for example, in Levene et al. Science 299, 682-686 (2003); Lundquist et al. Opt. Lett. 33, 1026-1028 (2008); Korlach et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the disclosures of which are incorporated herein by reference in their entireties. Other suitable alternative techniques include, for example, fluorescent in situ sequencing (FISSEQ), and Massively Parallel Signature Sequencing (MPSS). In particular embodiments, the sequencing device 500 may be a HiSeq, MiSeq, or HiScanSQ from Illumina (La Jolla, CA). In other embodiment, the sequencing device 500 may be configured to operate using a CMOS sensor with nanowells fabricated over photodiodes such that DNA deposition is aligned one-to-one with each photodiode.

[0078] The sequencing device 500 may be “one-channel” a detection device, in which only two of four nucleotides are labeled and detectable for any given image. For example, thymine may have a permanent fluorescent label, while adenine uses the same fluorescent label in adetachable form. Guanine may be permanently dark, and cytosine may be initially dark but capable of having a label added during the cycle. Accordingly, each cycle may involve an initial image and a second image in which dye is cleaved from any adenines and added to any cytosines such that only thymine and adenine are detectable in the initial image but only thymine and cytosine are detectable in the second image. Any base that is dark through both images in guanine and any base that is detectable through both images is thymine. A base that is detectable in the first image but not the second is adenine, and a base that is not detectable in the first image but detectable in the second image is cytosine. By combining the information from the initial image and the second image, all four bases are able to be discriminated using one channel.

[0079] In the depicted embodiment, the sequencing device 500 includes a separate sample processing device 502 and an associated computer 504. However, as noted, these may be implemented as a single device. Further, the associated computer 504 may be local to or networked or otherwise in communication with the sample processing device 502. In the depicted embodiment, the biological sample may be loaded into the sample processing device 502 on a sample substrate 510, e.g., a flow cell or slide, that is imaged to generate sequence data. For example, reagents that interact with the biological sample fluoresce at particular wavelengths in response to an excitation beam generated by an imager 512 and thereby return radiation for imaging. For instance, the fluorescent components may be generated by fluorescently tagged nucleic acids that hybridize to complementary molecules of the components or to fluorescently tagged nucleotides that are incorporated into an oligonucleotide using a polymerase. As will be appreciated by those skilled in the art, the wavelength at which the dyes of the sample are excited and the wavelength at which they fluoresce will depend upon the absorption and emission spectra of the specific dyes. Such returned radiation may propagate back through the directing optics. This retrobeam may generally be directed toward detection optics of the imager 512.

[0080] The imager detection optics may be based upon any suitable technology, and may be, for example, a charged coupled device (CCD) sensor that generates pixilated image data basedupon photons impacting locations in the device. However, it will be understood that any of a variety of other detectors may also be used including, but not limited to, a detector array configured for time delay integration (TDI) operation, a complementary metal oxide semiconductor (CMOS) detector, an avalanche photodiode (APD) detector, a Geiger-mode photon counter, or any other suitable detector. TDI mode detection can be coupled with line scanning as described in U.S. Patent No. 7,329,860, which is incorporated herein by reference. Other useful detectors are described, for example, in the references provided previously herein in the context of various nucleic acid sequencing methodologies.

[0081] The imager 512 may be under processor control, e.g., via a processor 514, and the sample receiving device 502 may also include I / O controls 516, an internal bus 518, nonvolatile memory 520, RAM 522 and any other memory structure such that the memory is capable of storing executable instructions, and other suitable hardware components that may be similar to those described with regard to FIG. 31. Further, the associated computer 504 may also include a processor 524, I / O controls 526, communications circuity 527, and a memory architecture including RAM 528 and non-volatile memory 530, such that the memory architecture is capable of storing executable instructions 532. The hardware components may be linked by an internal bus, which may also link to the display 534. In embodiments in which the sequencing device 500 is implemented as an all-in-one device, certain redundant hardware elements may be eliminated.

[0082] The processor 514, 524 may be programmed to assign individual sequencing reads to a sample based on the associated index sequence or sequences according to the techniques provided herein. In particular embodiments, based on the image data acquired by the imager 512, the sequencing device 500 may be configured to generate sequencing data that includes base calls for each base of a sequencing read. Further, based on the image data, even for sequencing reads that are performed in series, the individual reads may be linked to the same location via the image data and, therefore, to the same template strand. In this manner, index sequencing reads may be associated with a sequencing read of an insert sequence before being assigned to a sample of origin. The processor 514, 524 may also be programmed to performdownstream analysis on the sequences corresponding to the inserts for a particular sample subsequent to assignment of sequencing reads to the sample.

[0083] In certain embodiments, the I / O controls 516, 526 may be configured to receive user inputs that automatically select sequencing parameters based on the aptamer(s) 56 and / or capture oligonucleotide(s) 60 and the associated sequence library preparation techniques. For example, in cases where custom primers or dark cycles are incorporated into the sequencing run, the sequencing device can select from preprogrammed operating instructions and / or receive user inputs to cause the sequencing device to operate according to the desired sequence parameters. In an embodiment, the user input may be a selection of a sequence library preparation kit or reading a barcode or identifier of a sequence library preparation kit.

[0084] In embodiments of the disclosed techniques, aptamer detection for a particular sample 52 may be based on a presence of the aptamer sequence or an aptamer identification sequence for an individual aptamer(s) 56 in the sequencing data generated by the sequencing device 500. Accordingly, in an embodiment, the sequencing device 500 may perform analysis of sequence reads to identify one or more aptamer sequences for a panel of aptamers. Based on the identified aptamers, a notification or report of positive aptamer identification may be generated. In an embodiment, the notification is provided on the display 534 or communicated via the communications circuitry 527 to a remote device or a cloud server.

[0085] In an embodiment, spatial tagging, detection, and co-assays described herein may include techniques as dissed in WO2024138170, which is incorporated herein by reference in its entirety for all purposes. In an embodiment, a sequencing read generated as discussed herein may include an aptamer sequence or an aptamer identification sequence uniquely associated with a individual aptamer(s) 56. The system 500 can access and / or report analyte identities based on the aptamer sequence or an aptamer identification sequence. Further, the sequencing read can include a spatial identification sequence. The system 500 can access and / or report locations of individual analytes based on the aptamer sequence or an aptamer identification sequence and the spatial identification sequence. Analysis of protein and / ormRNA co-locations or relationships may be as discussed in US11739381B2, which is incorporated herein by reference in its entirety for all purposes.

[0086] In another aspect, the methods described herein are applicable to nanopore sequencing such as that described in U.S. Patent Publication No. 2015-0344945 and U.S. Patent Publication No. 2015 / 0152495, which are incorporated herein by reference in their entireties and for all purposes. In one embodiment, provided herein are methods of attaching a tether as described herein to a barrier comprising one or more nanopores. A “barrier” may refer to a structure that normally inhibits passage of molecules from one side of the barrier to the other side of the barrier. The molecules for which passage is inhibited can include, for example, ions or water-soluble molecules such as nucleic acids, proteins, nucleotides, and amino acids. A pore (e.g. a nanopore or plurality of nanopores as described herein) can be disposed within a barrier, and the aperture of the pore can permit passage of molecules from one side of the barrier to the other side of the barrier. Barriers include membranes of biological origin, and non-biological barriers such as solid-state membranes.

[0087] The tether can optionally comprise a polynucleotide sequence. The methods can include extending a tether by contacting the tether with a template independent polymerase as described herein, whereupon the template independent polymerase incorporates a terminal 3'-modified ddNTP comprising a 3 '-functional moiety capable of participating in a click chemistry reaction into the tether. The 3 '-functional moiety can be reacted with a 5 '-functional moiety located on the barrier comprising the one or more nanopores. In certain embodiments, the 5 '-functional moiety is attached to a moiety on the nanopore or the barrier adjacent to a nanopore. The moiety can be a molecule forming the barrier itself, e.g. a lipid or cholesterol in the instance of biological nanopores, or the solid support / polymer in the instance of non-biological nanopores. In one embodiment, the 3 '-functional moiety can be reacted with a cholesterol-containing tag for use in translocating a polynucleotide through a nanopore as described herein and provided in, for example, U.S. Patent Publication No. 2015 / 0152495, International Patent Publication No. W02015 / 081211, and International Patent ApplicationNo. PCT / US2014 / 067560, each of which is incorporated by reference herein in its entirety and for all purposes.

[0088] The term “analyte-binding region” refers to an oligonucleotides (ssDNA or ssRNA) that will form a cognate target by binding to an analyte of interest. The “analyte-binding region” may include one or more portions that permit binding of the analyte-binding region to the analyte. For example, the one or more portions may include an aptamer region that will bind to the analyte of interest with high affinity. It should be noted that the analyte-binding region may include other sequences (e.g., identification sequences) to enable downstream sequencing and analysis.

[0089] As used herein, an aptamer may refer to a non-naturally occurring nucleic acid that has specific binding affinity for a target molecule. The binding of the aptamer to the target molecule can result in catalytically changing the target molecule, reacting with the target molecule in a way that modifies or alters the target molecule or the functional activity of the target molecule, covalently attaching to the target molecule (as in a suicide inhibitor), and facilitating the reaction between the target molecule and another molecule. In one embodiment, the target molecule is a three-dimensional chemical structure, other than a polynucleotide, that binds to the aptamer through a mechanism which is predominantly independent of Watson / Crick base pairing or triple helix binding. In an embodiment, the aptamer is not a nucleic acid having the known physiological function of being bound by the target molecule.

[0090] Aptamers include nucleic acids that are identified from a candidate mixture of nucleic acids. A specific binding affinity of an aptamer for its target may refer to aptamer binding to its target generally with a much higher degree of affinity than it binds to other, non-target, components in a mixture or sample. Different aptamers may have either the same number or a different number of nucleotides. Aptamers may be DNA, RNA, or modified aptamers and may be single stranded, double stranded, or contain double stranded regions. The aptamers discussed herein can be used in any diagnostic, imaging, high throughput screening or targetvalidation techniques or procedures or assays for which aptamers, oligonucleotides, antibodies and ligands, without limitation can be used.

[0091] In certain embodiments of the disclosure, the disclosed aptamer(s) 56 and / or capture oligonucleotide 60 can include one or more conserved regions, such as a conserved primer region, e.g., a first conserved primer region and a second conserved primer region. A conserved region is conserved between at least some other aptamer of a set of aptamer(s) 56 (or capture oligonucleotide of a set of capture oligonucleotide(s) 60) such that the conserved region has an identical or similar nucleotide sequence as compared between the probes. For example, for a given capture oligonucleotide, all capture oligonucleotide(s) 60 can have a same first conserved primer region. Furthermore, for a given aptamer, all aptamer(s) 56 can have a same second conserved primer region. In this manner, primers based on the first conserved primer region and the second conserved primer region can be used to amplify any ligated oligonucleotides 64.

[0092] One or more oligonucleotides as discussed herein may include an identification sequence that can include one or more nucleotide sequences that can be used to identify one or more specific aptamers. The identification sequence can be an artificial sequence. The identification sequence can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides. In some embodiments, the identification sequence comprises at least about 10, 20, 30, 40, 50, 60, 7080, 90, 100 or more consecutive nucleotides. In some embodiments, at least a portion of the identification sequence in a probe is different.

[0093] One or more oligonucleotides as discussed herein may include an affinity tag. Affinity tags can be useful for a variety of applications, for example the bulk separation of target nucleic acids hybridized to hybridization tags. As used herein, the term “affinity tag” or “tag sequence” and grammatical equivalents can refer to a component of a multi-component complex, wherein the components of the multi-component complex specifically interact with or bind to each other. For example an affinity tag can include biotin or poly-His that can bind streptavidin or nickel, respectively. Other examples of multiple-component affinity tag complexes are listed,for example, U.S. Patent Application Pub. No. 2012 / 0208705, U.S. Patent Application Pub. No. 2012 / 0208724 and Int. Patent Application Pub. No. WO 2012 / 061832, each of which is incorporated by reference in its entirety.

[0094] The disclosed embodiments provide a different oligonucleotides designed to be complementary to a target sequence, such that hybridization occurs. As outlined below, this complementarity need not be perfect; there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. Thus, by “substantially complementary” herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions.

[0095] A variety of hybridization conditions may be used in the present workflows, including high, moderate and low stringency conditions. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g. 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g. greater than 50 nucleotides).

[0096] In certain embodiments, contacting steps may be run under stringency conditions which allows formation of the hybridization complex only within an analyte-aptamer-capture oligonucleotide complex. Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration,salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc. The size of the primer nucleic acid may vary, as will be appreciated by those in the art, in general varying from 5 to 500 nucleotides in length. Primers may be between 10 and 100, between 15 and 50, and from 10 to 35 depending on the use and amplification technique.

[0097] In some embodiments, adapter may be incorporated onto aptamers or oligonucleotides derived therefrom as generally disclosed herein. Any suitable adapter may be used. The adapter can include a library-specific index tag sequence (e.g., i5, i7). The index tag sequence may be attached to the aptamer-derived and tagged oligonucleotides before sequencing. The index tag may be part of the template for amplification. The index tag may be a synthetic sequence of nucleotides which is added to the target as part of the template preparation step. Accordingly, a library-specific index tag is a nucleic acid sequence tag which is attached to each of the target molecules of a particular library, the presence of which is indicative of or is used to identify the library from which the target molecules were isolated. Preferably, the index tag sequence is 20 nucleotides or less in length. For example, the index tag sequence may be 1-10 nucleotides or 4-6 nucleotides in length. A four nucleotide index tag gives a possibility of multiplexing 256 samples on the same array, a six base index tag enables 4,096 samples to be processed on the same array. The adapters may contain more than one index tag so that the multiplexing possibilities may be increased.

[0098] The adapters may include any other suitable sequence in addition to the index tag sequence. For example, the adapters may include universal extension primer sequences, which are typically located at the 5' or 3' end of the adapter and the resulting polynucleotide for sequencing. The universal extension primer sequences may hybridize to complementary primers bound to a surface of a solid substrate. The complementary primers include a free 3' end from which a polymerase or other suitable enzyme may add nucleotides to extend the sequence using the hybridized library polynucleotide as a template, resulting in a reverse strand of the library polynucleotide being coupled to the solid surface. Such extension may be part of a sequencing run or cluster amplification.

[0099] In some embodiments, the adapters include one or more universal sequencing primer sequences. The universal sequencing primer sequences may bind to sequencing primers to al, may include a “sequencing adapter” or “sequencing adapter site”, that is to say a region that comprises one or more sites that can hybridize to a primer. In some embodiments, a sequence can include at least a first primer site useful for amplification, sequencing, and the like.

[0100] After adapter incorporation, the disclosed tagged oligonucleotides may be sequenced. In one example, the sequencing may be via Illumina’s sequencing-by-synthesis and reversible terminator-based sequencing chemistry. Illumina's sequencing technology relies on the attachment of fragmented genomic DNA to a planar, optically transparent surface on which oligonucleotide anchors are bound. Template DNA is end-repaired to generate 5'-phosphorylated blunt ends, and the polymerase activity of Klenow fragment is used to add a single A base to the 3' end of the blunt phosphorylated DNA fragments. This addition prepares the DNA fragments for ligation to oligonucleotide adapters, which have an overhang of a single T base at their 3' end to increase ligation efficiency. The adapter oligonucleotides are complementary to the flow-cell anchors. Under limiting-dilution conditions, adapter-modified, single-stranded template DNA is added to the flow cell and immobilized by hybridization to the anchors. Attached DNA fragments are extended and bridge amplified to create an ultra-high density sequencing flow cell with hundreds of millions of clusters, each containing ~ 1,000 copies of the same template. In one embodiment, the randomly fragmented genomic DNA is amplified using PCR before it is subjected to cluster amplification. Alternatively, an amplification-free genomic library preparation is used, and the randomly fragmented genomic DNA is enriched using the cluster amplification alone. The templates are sequenced using a robust four-color DNA sequencing-by-synthesis technology that employs reversible terminators with removable fluorescent dyes. High-sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Sequence are aligned against a truth table or stored correlations between aptamer identity and identification sequences using specially developed data analysis pipeline software.

[0101] The adapters may include sequence from Illumina® sequencing preparations, A14, Bl 5, and may be incorporated via amplification and / or ligation and extension. Certain arrangements that include indexes may incorporate a custom or bridged primer during sequencing to accommodate the different indexes. Other embodiments may include custom options for sequencing libraries using single reads from surface P5 for example, or for adding dark sequencing by synthesis cycles where common sequences exist in adapter regions.

[0102] The adapter sequences A14-ME, ME, B15-ME, ME', A14, Bl 5, and ME are provided below:

[0103] A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1)

[0104] Bl 5-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 2)

[0105] ME': 5'-phos-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3)

[0106] A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 4)

[0107] B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5)

[0108] ME: AGATGTGTATAAGAGACAG (SEQ ID NO. : 6)

[0109] The adapters can include a region having the sequence of a universal Illumina® capture primer or a region specifically hybridizing with a universal Illumina® capture primer. Universal Illumina® capture primers include, e.g., P5 5’-AATGATACGGCGACCACCGA-3’ ((SEQ ID NO: 7)) or P7 (5’-CAAGCAGAAGACGGCATACGA-3’ (SEQ ID NO: 8)), or fragments thereof. A region specifically hybridizing with a universal Illumina® capture primer can include, e.g., the reverse complement sequence of the Illumina® capture primer P5 ("antiPS": 5’-TCGGTGGTCGCCGTATCATT-3’ (SEQ ID NO: 9) or P7 ("anti-P7": 5’-TCGTATGCCGTCTTCTGCTTG-3’ (SEQ ID NO: 10)), or fragments thereof.

[0110] The adapters can additionally or alternatively include a region having the sequence of an Illumina® sequencing primer, or fragment thereof, or a region specifically hybridizing with an Illumina® sequencing primer, or fragment thereof. Illumina® sequencing primers include, e g., SBS3 (5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ (SEQ ID NO: 11)) or SBS8 (5’-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3’ (SEQ ID NO: 12)). A region specifically hybridizing with an Illumina® sequencing primer, or fragment thereof, can include, e.g., the reverse complement sequence of the Illumina® sequencing primer SBS3 ("anti-SBS3": 5’- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3’ (SEQ ID NO: 13)) or SBS8("anti-SBS8":5’-AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG-3’ (SEQ ID NO: 14)), or fragments thereof. The incorporation of sequencing primer sequences may be either directly or via subsequent amplification, ligation, or other sequencing library preparation steps.

[0111] In an embodiment, the sequencing may use Illumina® NGS primers. The following primers are shown by way of example.Read 1 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3 ’ (SEQ ID NO: 15)Read 25’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 16)Paired End Read 1 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT(SEQIDNO: 17)Paired End Read 2 5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT (SEQ ID NO: 18)Index 1 Read 5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG(SEQ ID NO: 19)Index 2 Read 5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (SEQ ID NO: 20)

[0112] It should be understood that the index read primers may be designed to include the particular index sequence associated with a particular sample in an aptamer-based assay. Thus, the index primers may have a nucleotide region, shown as i5 or i7, that varies in sequence between different samples of a multiplexed sample. Other samples in the run can be prepared with primers that include their respective indexes. Accordingly, certain sequence reads may be obtained with universal primers while other sequence reads are obtained with primers or a mix of primers that are specific to indexes of one or more samples in a multiplexed reaction.

[0113] In an embodiment, unique molecular identifiers (UMIs) may be incorporated onto the capture oligonucleotide(s) 60, e.g., via ligation. UMIs are short sequences used to uniquely tag each molecule in a sample library to provide error correction and reduce sequencing bias.

[0114] The term “affinity binder” refers to a molecule that may associate (e.g., bind) to a sample analyte. Exemplary analytes include proteins (e g., antibodies) or oligonucleotides (e.g., aptamers).

[0115] The term “sample” herein may refer to a sample, typically derived from a biological fluid, cell, tissue, organ, or organism, comprising analytes or molecules if interest, such as proteins. Exemplary analytes include proteins, polypeptides, nucleic acids, carbohydrates, lipids, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies, affibodies, antibody mimics, viruses, pathogens, toxic substances, substrates, metabolites, transition state analogs, cofactors, inhibitors, drugs, dyes, nutrients, growth factors, cells, tissues, and any fragment or portion of any of the foregoing. In some embodiments, a target molecule is a protein.

[0116] A sample may include, but is not limited to sputum / oral fluid, amniotic fluid, blood, biological fluids, a blood fraction, or fine needle biopsy samples (e.g., surgical biopsy, fine needle biopsy, etc.), urine, peritoneal fluid, pleural fluid, and the like. Although the sample is often taken from a human subject (e g., patient), the sample may be from any organism. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparingplasma from blood, diluting viscous fluids and so forth. Methods of pretreatment may also involve, but are not limited to, fdtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatment methods are typically such that the nucleic acid(s) of interest remain in the test sample, sometimes at a concentration proportional to that in an untreated test sample (e.g., namely, a sample that is not subjected to any such pretreatment method(s)). Such “treated” or “processed” samples are still considered to be biological “test” samples with respect to the methods described herein. In some aspects, a tissue section can be contacted with a surface, for example, by laying the tissue on the surface. The tissue can be freshly excised from an organism or it may have been previously preserved for example by freezing (e.g., fresh frozen tissue), embedding in a material such as paraffin (e.g., formalin fixed paraffin embedded (FFPE) samples), formalin fixation, infiltration, dehydration or the like. Optionally, a tissue section can be attached to a surface, for example, using techniques and compositions described in, for example, U.S. Patent No.11,390,912, incorporated by reference herein in its entirety. In some aspects, a tissue can be permeabilized and the cells of the tissue lysed when the tissue is in contact with a surface. Any of a variety of treatments can be used such as those set forth above in regard to lysing cells. Target proteins and / or nucleic acids that are released from a tissue that is permeabilized can be captured by capture oligonucleotides on the surface. The thickness of a tissue sample or other biological sample that is contacted with a surface in a method set forth herein can be any suitable thickness desired. In representative aspects, the thickness will be at least 0.1 pm, 0.25 pm, 0.5 pm, 0.75 pm, 1 pm, 5 pm, 10 pm, 50 pm, 100 pm or thicker. Alternatively or additionally, the thickness of a biological sample that is contacted with a surface will be no more than 100 pm, 50 pm, 10 pm, 5 pm, 1 pm, 0.5 pm, 0.25 pm, 0.1 pm or thinner.

[0117] As used herein, “surface” can refer to a part of a substrate or support structure that is accessible to contact with reagents, beads, or analytes. The surface can be substantially flat or planar. Alternatively, the surface can be rounded or contoured. Example contours that canbe included on a surface are wells (e.g., microwells or nanowells), depressions, pillars, ridges, channels or the like. Example materials that can be used as a substrate or support structure include glass such as modified or functionalized glass; plastic such as acrylic, polystyrene or a copolymer of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane or TEFLON; polysaccharides or cross-linked polysaccharides such as agarose or Sepharose; nylon; nitrocellulose; resin; silica or silica- based materials including silicon and modified silicon, carbon-fibre; metal; inorganic glass; optical fibre bundle, or a variety of other polymers. A single material or mixture of several different materials can form a surface useful in certain examples. In some examples, a surface comprises wells (e.g., microwells or nanowells). In some aspects, the surface comprises wells in an array of wells (e.g., microwells or nanowells) on glass, silicon, plastic or other suitable solid supports with patterned, covalently-linked gel such as poly(N-(5-azidoacetamidylpentyl)acrylamide-coacrylamide) (PAZAM, see, for example, U.S. Pat. App. Pub. No.2014 / 0079923 Al, which is incorporated herein by reference). In some examples, a support structure can include one or more layers. Non- limiting examples of a surface include a bead array, a spotted array, clustered particles arranged on a surface of a chip, a film, a multi -well plate, and a flow cell.

[0118] In a certain aspect, a “surface” and / or "substrate" disclosed herein may further comprise islands or clusters of immobilized capture agents or capture oligonucleotides. The islands or clusters can be generated on the surface of a substrate (e.g., a flowcell) by using bridge amplification. In such a case, the substrate comprises a plurality of immobilized capture oligonucleotides on the surface of the substrate, which bind with complementary adapter regions present on nearby primers or oligonucleotides to form bridge-like structures; these bridge-like structures are then extended using a polymerase enzyme, generating a double stranded molecule, that is then denatured to leave a single- stranded capture oligo anchored to the substrate. After multiple iterations of the foregoing process, islands or clusters of immobilized capture oligonucleotides are created. An example of the foregoing process that can be used with the methods and compositions disclosed herein can be found in WO 2022 / 015913 Al, which is incorporated herein by reference in its entirety. In a particular aspect, the nearby primers or oligonucleotides are attached to the substrate (e.g., a flowcell)by a selectively cleavable linker. Each island or cluster may be roughly circular or oval in shape. Each island or cluster may have an average diameter of 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, 500 nm, 550 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, 850 nm, 900 nm, 950 nm, 1000 nm, 1050 nm, 1100 nm, 1200 nm, or a range that includes or is in between any two of the forgoing diameters. In a further aspect, the surface of the substrate (e g., a flowcell) comprises per 1 mm2of surface area 0.3, 0.4, 0.5, 0.6.0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6.1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 million clusters, or range including or between any two of the forgoing numbers. In a particular aspect, a "substrate" as disclosed herein comprises islands or clusters of immobilized capture oligonucleotides comprising adapter sequence(s), a spatial address sequence, an optional sequence primer site, and a capture moiety for a targeted analyte. In yet a further aspect, each cluster or island on the substrate (e.g., a flowcell) comprises capture oligonucleotides that have a unique spatial address sequence, so the x,y location of each cluster or island can be identified. In such a case, the x,y location of each cluster or island can be determined by decoding the spatial address sequence. Methods to decode the spatial address sequence include, but are not limited, the decoding-by-hybridization or the decoding-by-sequencing methods disclosed herein.

[0029] As used herein, the term "interstitial region" refers to an area in a substrate or on a surface that separates other areas of the substrate or surface. For example, an interstitial region can separate one feature of an array from another feature of the array. The two regions that are separated from each other can be discrete, lacking contact with each other. In another example, an interstitial region can separate a first portion of a feature from a second portion of a feature. The separation provided by an interstitial region can be partial or full separation. Interstitial regions will typically have a surface material that differs from the surface material of the features on the surface. For example, features of an array can have an amount or concentration of capture agents or capture oligonucleotides that exceeds the amount or concentration present at the interstitial regions. In some aspects the capture agents or primers may not be present at the interstitial regions.

[0119] In some aspects, the substrate includes an array of wells or depressions in a surface. This may be fabricated as is generally known in the art using a variety of techniques, including,but not limited to, photolithography, stamping techniques, molding techniques and microetching techniques. As will be appreciated by those in the art, the technique used will depend on the composition and shape of the array substrate.

[0120] Exemplary flow cells include, but are not limited to those used in a nucleic acid sequencing apparatus such as flow cells for the Genome Analyzer®, MiSeq®, NextSeq® or HiSeq® platforms commercialized by Illumina, Inc. (San Diego, Calif.); or for the SOLiD™ or Ion Torrent™ sequencing platform commercialized by Life Technologies (Carlsbad, Calif). Exemplary flow cells and methods for their manufacture and use are also described, for example, in WO 2014 / 142841 Al; U.S. Pat. App. Pub. No. 2010 / 0111768 Al and U.S. Pat. No.8, 951, 781, each of which is incorporated herein by reference. A flowcell can be "a nonpatterned flowcell", where the surface(s) of the flowcell comprises randomly or semi -randomly arranged features (e.g., areas comprising clusters or islands of oligonucleotides). Alternatively, the flowcell can be a "patterned flowcell," where the flowcell comprises features (e.g., nanowells) at fixed locations across the surface(s) of the flowcell. The features of a "patterned flowcell" can further comprise immobilized oligonucleotides, or clusters or islands of immobilized oligonucleotides A "patterned flowcell" can be an "ordered substrate" in that the features of the patterned flowcell have an assigned x,y spatial address, or an x,y spatial address that can be readily determined.

[0121] A "complementary" oligonucleotide may comprise a sequence of nucleotides that can form a double-stranded structure by matching base-pairs with another oligonucleotide or part thereof. A “complementary” oligonucleotide may have at least 85%, 90%, 95%, 98%, 99% or 100% overall sequence identity to the complementary sequence.

[0122] As used herein, a “primer” is a nucleic acid molecule that can hybridize to a target sequence, such as an adapter attached to a library fragment. In some aspects, an amplification primer can serve as a starting point for template amplification and cluster generation. As another example, a synthesized nucleic acid (template) strand may include a site to which a primer (e.g., a sequencing primer) can hybridize in order to prime synthesis of a new strand that is complementary to the synthesized nucleic acid strand. Any primer can include anycombination of nucleotides or analogs thereof. In some examples, the primer is a singlestranded oligonucleotide or polynucleotide. The primer length can be any number of bases long and can include a variety of non-natural nucleotides. In various aspects, the sequencing primer is a short strand, ranging from 5 to 60 bases, from 10 to 60 bases, from 10 to 20 bases, from 10 to 30 bases, from 10 to 40 bases, from 10 to 50 bases, or from 20 to 40 bases. One of skill can adjust these factors to provide optimum hybridization and signal production for a given hybridization procedure. The primer permits the addition of a nucleotide residue thereto, or oligonucleotide or polynucleotide synthesis therefrom, under suitable conditions. In an aspect the primer is a DNA primer, i.e., a primer consisting of, or largely consisting of, deoxyribonucleotide residues. The primers are designed to have a sequence that is the complement of a region of tempi ate / target DNA to which the primer hybridizes. The addition of a nucleotide residue to the 3' end of a primer by formation of a phosphodiester bond results in a DNA extension product. The addition of a nucleotide residue to the 3' end of the DNA extension product by formation of a phosphodiester bond results in a further DNA extension product. In another aspect the primer is an RNA primer. In aspects, a primer is hybridized to a target polynucleotide. A “primer” is complementary to a polynucleotide template, and complexes by hydrogen bonding or hybridization with the template to give a primer / template complex for initiation of synthesis by a polymerase, which is extended by the addition of covalently bonded bases linked at its 3' end complementary to the template in the process of DNA synthesis.

[0123] As used herein, the term "adapter" refers generally to any linear nucleic acid molecule that can be added to an oligonucleotide of the disclosure. In some aspects, adapters are copied onto the library molecules using templated polymerase synthesis. In some aspects, adapters include two reverse complementary oligonucleotides forming a double-stranded structure. In some aspects, an adapter includes two oligonucleotides that are complementary at one portion and mismatched at another portion, forming a Y-shape or fork-shaped adapter that is double stranded at the complementary portion and has two floppy overhangs at the mismatched portion. In some aspects, an adapter is a template switch oligonucleotide (TSO) adapter.

[0124] The term "template switch oligonucleotide" refers to an oligonucleotide template to which polymerase activity is switched from an initial template (e.g., a single-stranded nucleic acid provided by a sample of the invention). In one aspect of the invention, the template switch oligonucleotide is a DNA / RNA hybrid oligonucleotide that is used by a template-dependent DNA or RNA polymerase (preferably RT, preferably MMLV RT) to continue reverse transcription, i.e., template-independent, after the enzyme (preferably MMLV RT) reaches the 5 '-end of the template nucleic acid and adds nucleotides to the 3' -end of the synthesized cDNA or cRNA strand by its terminal transferase activity. The 3 '- end of the TSO hybridizes to nucleotides added by the terminal transferase activity of the template-dependent DNA or RNA polymerase, effectively extending the 5' -end of the template DNA or RNA, such that the template-dependent DNA or RNA polymerase (preferably RT, more preferably MMLV RT) also reverse transcribes the remaining 5 portion of the TSO, which contains the defined sequence to be added to the 5' -end of the template nucleic acid. The TSO may comprise one or more modified or non-naturally occurring nucleotides (or analogs thereof). For example, the template switching oligonucleotide may comprise one or more nucleotide analogs (e.g., LNA, FANA, 2 '-O- methyl ribonucleotide, 2' -fluoro ribonucleotide, etc.), ligation modifications (e.g., phosphorothioate, 3'-3' and 5'-5' reverse ligation), 5 'and / or 3' terminal modifications (e.g., 5 'and / or 3' amino, biotin, DIG, phosphate, thiol, dye, quencher, etc.), one or more fluorescently labeled nucleotides, or any other feature that provides a desired function to the template switching oligonucleotide.

[0125] The terms "P5" and "P7" may be used when referring to examples of adapters. The terms "P5”' (P5 primer) and "P7’" (P7 primer) refer to the complement of P5 and P7, respectively. It will be understood that any suitable adapter can be used in the methods presented herein, and that the use of P5 and P7 are exemplary aspects only. Uses of adapters such as P5 and P7 or their complements on flowcells are known in the art, as exemplified by the disclosures of WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO 1998 / 044151, and WO 2000 / 018957, each of which is incorporated herein by reference in its entirety. For example, any suitable forward amplification primer, whether immobilized or in solution, can be useful in the methods presented herein for hybridization to acomplementary sequence and amplification of a sequence. Similarly, any suitable reverse amplification primer, whether immobilized or in solution, can be useful in the methods presented herein for hybridization to a complementary sequence and amplification of a sequence. One of skill in the art will understand how to design and use primer sequences that are suitable for capture and / or amplification of nucleic acids as presented herein.

[0040] As used herein, the term “barcode” is may refer to a series of nucleotides in an oligonucleotide that can be used to identify the oligonucleotide, a spatial address on a surface (i.e., a “spatial barcode” or “spatial address sequence”), a characteristic of the oligonucleotide, and / or a manipulation that has been carried out on the oligonucleotide. The barcode can be a naturally occurring nucleotide sequence or a nucleotide sequence that does not occur naturally in the organism from which the barcoded nucleic acid was obtained. In aspects, a barcode is unique in a pool of barcodes that differ from one another in sequence, or is uniquely associated with a particular sample polynucleotide in a pool of sample polynucleotides. In aspects, every barcode in a pool of adapters is unique, such that sequencing reads including the barcode can be identified as originating from a single sample polynucleotide molecule on the basis of the barcode alone. In other aspects, individual barcode sequences may be used more than once, but adapters including the duplicate barcodes are associated with different sequences and / or in different combinations of barcoded adaptors, such that sequence reads may still be uniquely distinguished as originating from a single sample polynucleotide molecule on the basis of a barcode and adjacent sequence information (e.g., sample polynucleotide sequence, and / or one or more adjacent barcodes). In aspects, barcodes are about or at least about 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75 or more nucleotides in length. In aspects, barcodes are shorter than 20, 15, 10, 9, 8, 7, 6, or 5 nucleotides in length. In aspects, barcodes are about 10 to about 50 nucleotides in length, such as about 15 to about 40 or about 20 to about 30 nucleotides in length. In a pool of different barcodes, barcodes may have the same or different lengths. In general, barcodes are of sufficient length and include sequences that are sufficiently different to allow the identification of sequencing reads that originate from the same sample polynucleotide molecule. In aspects, each barcode in a plurality of barcodes differs from every other barcode in the plurality by at least three nucleotide positions, such as at least 3, 4, 5, 6,7, 8, 9, 10, or more nucleotide positions. In some aspects, substantially degenerate barcodes may be known as random. In some aspects, a barcode may include a nucleic acid sequence from within a pool of known sequences. In some aspects, the barcodes may be pre-defined.

[0126] In various aspects, an oligonucleotide of the disclosure, or a modified form thereof, is generally about 5 nucleotides to about 200 nucleotides in length. In further aspects, an oligonucleotide of the disclosure is about 5 to about 125 nucleotides in length, about 5 to about 100 nucleotides in length, about 5 to about 90 nucleotides in length, about 5 to about 50 nucleotides in length, about 5 to about 45 nucleotides in length, about 5 to about 40 nucleotides in length, about 5 to about 35 nucleotides in length, about 5 to about 30 nucleotides in length, about 5 to about 25 nucleotides in length, about 5 to about 20 nucleotides in length, about 5 to about 15 nucleotides in length, about 5 to about 10 nucleotides in length, about 10 to about 150 nucleotides in length, about 10 to about 125 nucleotides in length, about 10 to about 100 nucleotides in length, about 10 to about 90 about 10 to about 50 nucleotides in length, about 10 to about 45 nucleotides in length, about 10 to about 40 nucleotides in length, about 10 to about 35 nucleotides in length, about 10 to about 30 nucleotides in length, about 10 to about 25 nucleotides in length, about 10 to about 20 nucleotides in length, about 10 to about 15 nucleotides in length, and all oligonucleotides intermediate in length of the sizes specifically disclosed to the extent that the oligonucleotide is able to achieve the desired result. Accordingly, in various aspects, an oligonucleotide of the disclosure is or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 or more nucleotides in length. In further aspects, an oligonucleotide of the disclosure is less than 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69,70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or more nucleotides in length.

[0127] As used herein, the term "immobilized" when used in reference to an oligonucleotide may refer to direct or indirect attachment to a surface via covalent or non-covalent bond(s). In certain aspects, covalent attachment can be used, but all that is required is that the oligonucleotides remain stationary or attached to a surface under conditions in which it is intended to use the surface, for example, in applications requiring nucleic acid capture, amplification, and / or sequencing. Oligonucleotides to be used as capture oligonucleotides can be immobilized such that a 3'-end is available for enzymatic extension and at least a portion of the sequence is capable of hybridizing to a complementary sequence. Immobilization can occur via hybridization to a surface attached oligonucleotide, in which case the immobilized oligonucleotide or polynucleotide can be in the 3' -5' orientation. Alternatively, immobilization of oligonucleotides can comprise use of a selectively cleavable linker. Examples of selectively cleavable linkers include, but are not limited to, biotin-based molecules (e.g., desthiobiotin molecule(s) (ddBio)), PC Linker, and a recognition site for a rare-cutter enzyme. Typically, the selectively cleavable linker can be cleaved by heating, competitive binding, pH change, chemical cleavage, enzymatic cleavage and / or photo-cleavage. Cleaving the selectively cleavable linker results in the release the nucleic acid, or a portion thereof, from the substrate or feature of the substrate.

[0128] As used herein, the term “DNA polymerase” and “nucleic acid polymerase” are used in accordance with their plain ordinary meanings and refer to enzymes capable of synthesizing nucleic acid molecules from nucleotides (e.g., deoxyribonucleotides). Typically, a DNA polymerase adds nucleotides to the 3 '-end of a DNA strand, one nucleotide at a time. In aspects, the DNA polymerase is a Pol I DNA polymerase, Pol II DNA polymerase, Pol III DNA polymerase, Pol IV DNA polymerase, Pol V DNA polymerase, Pol 0 DNA polymerase,Pol [i DNA polymerase, Pol X DNA polymerase, Pol G DNA polymerase, Pol a DNA polymerase, Pol 5 DNA polymerase, Pol s DNA polymerase, Pol r| DNA polymerase, Pol i DNA polymerase, Pol K DNA polymerase, Pol C, DNA polymerase, Pol y DNA polymerase, Pol 0 DNA polymerase, Pol v DNA polymerase, or a thermophilic nucleic acid polymerase (e.g. Therminator y, 9° N polymerase (exo-), Therminator II, Therminator III, or Therminator IX). In aspects, the DNA polymerase is a modified archaeal DNA polymerase. In aspects, the polymerase is a reverse transcriptase. For example, a polymerase catalyzes the addition of a next correct nucleotide to the 3'-OH group of the primer via a phosphodiester bond, thereby chemically incorporating the nucleotide into the primer. Optionally, the polymerase used in the provided methods is a processive polymerase. Optionally, the polymerase used in the provided methods is a distributive polymerase.

[0129] It is to be understood that the subject matter described herein is not limited in its application to the details of construction and the arrangement of components set forth in the description herein or illustrated in the drawings hereof. The subject matter described herein is capable of other implementations and of being practiced or of being carried out in various ways. Also, it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. As used herein, an element or step recited in the singular and proceeded with the word “a” or “an” should be understood as not excluding plural of said elements or steps, unless such exclusion is explicitly stated. Furthermore, references to “one example” are not intended to be interpreted as excluding the existence of additional examples that also incorporate the recited features. The use of “including,” “comprising,” or “having” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.

[0130] This written description uses examples to enable any person skilled in the art to practice the disclosed embodiments, including making and using any devices or systems and performing any incorporated methods. The patentable scope is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from theliteral language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.

Claims

CLAIMSWhat is claimed is:

1. A method of analyte detection, comprising:contacting analytes of sample with a plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes;contacting the analyte-aptamer complexes with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-aptamer-capture oligonucleotide complexes;generating extension products for individual analyte-aptamer-capture oligonucleotide complexes by:extending from an end of an individual aptamer hybridized to an individual capture oligonucleotide using the individual capture oligonucleotide as a template to generate an extension product within the individual analyte-aptamer-capture oligonucleotide complex such that the individual aptamer is extended with a tag comprising a complement of a sequence of the individual capture oligonucleotide;capturing the extension products on a capture surface using surface capture oligonucleotides immobilized on the capture surface;extending the surface capture oligonucleotides to generate complementary strands of the extension products;capturing 3’ end of the extension products using spatial bridge oligonucleotides immobilized on the capture surface such that the extension products form bridges;extending from the 3’ ends of the extension product using the spatial bridge oligonucleotides as templates to spatially tag the extension products with different unique tags associated with respective different locations of the spatial bridge oligonucleotides on the capture surface; andsequencing the spatially tagged extension products to generate sequencing data comprising aptamer identities associated with the different locations.

2. The method of claim 1, wherein the sample comprises a fixed tissue sample, wherein the analytes of the fixed tissue sample are immobilized on the capture surface.

3. The method of claim 1 or 2, comprising degrading the analytes after generating the extension product.

4. The method of claim 3, comprising using proteinase K to degrade the analytes.

5. The method of any one of the preceding claims, wherein the individual aptamer comprises a 3’ end region capture primer sequence that does not bind the analyte and that hybridizes to a complementary capture region sequence of the individual capture oligonucleotide.

6. The method of claim 5, wherein the capture primer sequence is conserved between all of the aptamers in the sample.

7. The method of any one of the preceding claims, wherein an individual capture oligonucleotide comprises a functional group with a specific affinity to a subset of amino acids of the analytes.

8. The method of claim 7, wherein the functional group comprises oxaziridine, succinyl, or maleimide.

9. The method of claim 7 or 8, wherein the functional group is coupled to a 3’ end, a 5’ end, or an internal nucleotide of the individual capture oligonucleotide.

10. The method of claim 9, wherein the plurality of capture oligonucleotides comprises a mix of different functional groups, each different functional group having affinity for a different subset of amino acids.

11. The method of any one of the preceding claims, wherein the surface capture oligonucleotides have a same nucleotide sequence relative to one another and are distributed across the capture surface.

12. The method of any one of the preceding claims, wherein the spatial bridge oligonucleotides comprise a first region comprising a conserved nucleotide sequence conserved relative to other spatial bridge oligonucleotides and a second region comprising a spatial identification sequence that is unique to each individual spatial bridge oligonucleotide.

13. The method of claim 12, wherein the complementary strands comprise complements of the first region and the second region.

14. The method of claim 13, wherein a complement of the first region comprises an adapter sequence.

15. The method of any one of the preceding claims, wherein the spatial bridge oligonucleotides are distributed across the capture surface.

16. The method of any one of the preceding claims, wherein the plurality of capture oligonucleotides has a same nucleotide sequence relative to one another.

17. The method of any one of the preceding claims, wherein the individual capture oligonucleotide comprises a blocked end and / or a blocked internal nucleotide to block extension.

18. The method of any one of the preceding claims, wherein the surface capture oligonucleotides comprise a same sequence as the complement of the sequence of the individual capture oligonucleotide.

19. The method of any one of the preceding claims, comprising cleaving the tagged complementary strands from the capture surface before the sequencing.

20. The method of any one of the preceding claims, comprising generating a sequencing library from the complementary strands before the sequencing.

21. The method of any one of the preceding claims, wherein the capture oligonucleotides are associated via cross-linking to one or more amino acids of individual target analytes.

22. The method of any one of the preceding claims, wherein the plurality of capture oligonucleotides binds to two or more subsets of amino acids.

23. The method of any one of the preceding claims, wherein the plurality of capture oligonucleotides binds to three or more subsets of amino acids.

24. The method of any one of the preceding claims, wherein the capture oligonucleotides comprise a linker sequence.

25. The method of any one of the preceding claims, comprising providing free nucleic acids to react with unbound capture oligonucleotides.

26. The method of any one of the preceding claims, wherein the sample is contacted with the plurality of aptamers and the plurality of capture oligonucleotides concurrently.

27. The method of any one of the preceding claims, wherein the individual aptamer comprises:a bridge region, wherein a portion of the spatial bridge oligonucleotides comprise a sequence of the bridge region;an aptamer binding region; anda non-binding region, the non-binding region comprising a first adapter sequence and a capture primer, wherein the capture primer hybridizes to a portion of the individual capture oligonucleotide.

28. The method of claim 27, wherein the capture primer is at a 3’ end of the individual aptamer and wherein the bridge is at a 5’ end of the individual aptamer.

29. The method of any one of the preceding claims, wherein the individual capture oligonucleotide comprises:a functional group configured to cross-link to an amino acid of the analyte;a linker;a capture region complementary to a non-binding region of the individual aptamer; anda capture extension region adjacent to the capture region.

30. The method of claim 29, wherein the capture region is at a 3’ end of the individual capture oligonucleotide.

31. The method of claim 1, comprising providing dummy aptamers having a same aptamer binding region as a subset of the plurality of aptamers, wherein the dummy aptamers do not hybridize to the capture oligonucleotides.

32. The method of claim 1, comprising providing dummy aptamers having a same aptamer binding region as a subset of the plurality of aptamers, wherein complementary strands comprising the dummy aptamers do not hybridize to the spatial bridgeoligonucleotides.

33. A substrate for analyte detection, comprising:a capture surface onto which a plurality of analytes of a tissue sample are fixed;a plurality of surface capture oligonucleotides distributed across the capture surface;a plurality of spatial bridge oligonucleotides distributed across the capture surface, wherein each individual spatial bridge oligonucleotide comprises a unique spatial identification sequence associated with an individual location on the capture surface;a plurality of aptamers and capture oligonucleotides bound to the analytes to form analyte-aptamer-capture oligonucleotide complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes, and wherein ends of the individual aptamers are hybridized to regions of the individual capture oligonucleotides within the complexes.

34. The substrate of claim 33, comprising a plurality of RNA transcript capture oligonucleotides distributed across the capture surface.

35. The substrate of claim 34, wherein the plurality of RNA transcript capture oligonucleotides comprises a polyT or polyA sequence.

36. The substrate of claim 33, wherein the plurality of surface capture oligonucleotides have a same sequence relative to one another.

37. The substrate of claim 33, wherein the plurality of surface capture oligonucleotides comprise a same sequence as a region of the capture oligonucleotides.

38. The substrate of claim 33, wherein each individual spatial bridge oligonucleotide comprises a first region comprising a conserved nucleotide sequence conserved relative to other spatial bridge oligonucleotides and a second region comprising the spatial identification sequence.

39. A kit for analyte detection, comprising:a plurality of aptamers wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes, and wherein each individual aptamer of the plurality comprises:an aptamer binding region; anda non-binding region, the non-binding region comprising a first adapter sequence and a capture primer; anda plurality of capture oligonucleotides, wherein each capture oligonucleotide of the plurality comprises,a functional group configured to cross-link to an amino acid of the analyte;a linker;a capture region complementary to the capture primer; and a capture extension region adjacent to the capture region.

40. A method of forming a spatial proteome sequencing library, comprising:contacting analytes of sample fixed on a capture surface with a plurality of capture oligonucleotides and a plurality of aptamers to form analyte-aptamer-capture oligonucleotide-complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes;hybridizing ends of the plurality of aptamers to capture oligonucleotides within individual analyte-aptamer-capture oligonucleotide complexes;extending the ends of the hybridized aptamers to generate extension products that are captured on the capture surface via the extended ends;copying the extension products on the capture surface;tagging the copied extension products with spatial identification sequences associated with respective locations of the capture surface; andgenerating a spatial protein sequencing library from the tagging copied extension products.

41. The method of claim 40, wherein individual aptamers of the plurality of aptamers are not immobilized on the capture surface via an affinity binder.

42. A spatial mRNA / protein co-assay method, comprising:contacting protein analytes of sample fixed on a capture surface with a plurality of capture oligonucleotides and a plurality of aptamers to form analyte-aptamer-capture oligonucleotide-complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes;hybridizing ends of the plurality of aptamers to capture oligonucleotides within individual analyte-aptamer-capture oligonucleotide complexes;extending the ends of the hybridized aptamers to generate extension products that are captured on the capture surface via the extended ends;copying the extension products on the capture surface;tagging the copied extension products with spatial identification sequences associated with respective locations of the capture surface;capturing mRNA analytes of the sample on the capture surface;tagging the copied extension products with the spatial identification sequences associated with respective locations of the capture surface; anddetermining relationships between location of the protein analytes and the mRNA analytes based on the spatial identification sequences.

43. The method of claim 42, wherein individual aptamers of the plurality of aptamers associated with membrane proteins comprise a fluorescent tag.

44. The method of claim 43, comprising imaging the capture surface to determine membrane protein locations based on the fluorescent tag.