Compositions and methods for rapid identification and phenotypic antimicrobial susceptibility testing of bacteria and fungi

Abstract

The present invention relates to compositions and methods for the use of polymerase chain reaction (PCR) as a reporter assay for rapid and simultaneous bacterial identification and phenotype testing for antimicrobial susceptibility (AST). The current invention uses a strategy that has shown the ability for multiplexing and for handling polymicrobial samples for antimicrobial susceptibility testing.

Description

EXAMPLE 12 PCRID / AST Assay Protocol Methods and Materials: a. Prepare antimicrobial (Abx) Plate ahead of time and store at -80C until needed i. Diluent - Cation Adjusted Mueller Hinton Broth (CAMHB) ii. Final Vol - 50pl / well iii. Remove from -80C and let thaw at 30min / Room Temp prior to use TABLE XXXI: Antimicrobial (Abx) Plate Layout Antibiotic (Abx) Plate Layout 123456789 10 11 12 OAbx l / 4Abx 1 / 2 Abx lAbx 2Abx 4Abx OAbx 1 / 4 Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx l / 4Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx 1 / 4 Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx l / 4Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx 1 / 4Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx l / 4Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx 1 / 4 Abx 1 / 2 Abx lAbx 2Abx 4Abx OAbx l / 4Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx 1 / 4 Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx l / 4Abx 1 / 2 Abx lAbx 2 Abx 4Abx OAbx 1 / 4 Abx 1 / 2Abx lAbx 2Abx 4 Abx OAbx l / 4Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx 1 / 4 Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx l / 4Abx 1 / 2 Abx lAbx 2 Abx 4 Abx OAbx 1 / 4 Abx 1 / 2 Abx lAbx 2 Abx 4 Abx b. Overnight cultures in CAMHB - 37°C / 16-18hrs / 500rpm i. 1 Opl glycerol stock + 490pl CAMHB in 2mL 96-well Deep Well Plate c.     Normalize cultures to 1.00E+06 CFU / mL by Optical Density (OD) d.     Prepare Test Plate by adding 50pl normalized test isolate to appropriate wells of Abx Plate as outlined TABLE XXXII Test Isolate Layout on Abx Plate Test Isolate Layout on Antibiotic (Abx) Plate 1 23456789 10 11 12 Isolate 1 Isolate 9 Isolate 2 Isolate 10 Isolate 3 Isolate 11 Isolate 4 Isolate 12 Isolate 5 Isolate 13 lsolate_6 lsolate_14 Isolate 7 lsolate_15 lsolate_8 Isol ate J6 e. Incubate Test Plate at 37°C / 4hrs / no shaking f. Prepare PCR Reagents according to TABLE IV g.     Add 45 pl Master Mix to each well of a PCR Assay Plate h.     Following incubation, stamp 5pl / well of Test Plate to PCR Assay Plate i. Final Vol - 50pl / well i. For Test Plate, continue incubating at 37°C / 12-16hrs / no shaking to determine reference method Minimum Inhibitory Concentration (MIC) j. Load PCR Assay Plate to cobas® z 480 instrument and run under conditions of TABLE IV. k. Following incubation read Test Plate for MIC and determine phenotypic Susceptible / Intermediate / Resistant interpretation. EXAMPLE 13 Real-Time PCR ID and AST Assay of Enterobacterales order Rapid identification and phenotypic antimicrobial susceptibility testing of Enterobacterales utilizing three distinct target genes, gyrB, rpH\ and rpoB, and three classes of antibacterial agents ciprofloxacin (fluoroquinolone), gentamicin (aminoglycoside), and meropenem (carbapenem) was performed. The primer / probe sets used were as follows. For gyrB, SEQ ID NO: 8 (forward primer), SEQ ID NO: 9 (reverse primer), SEQ ID NO: 10 (probe); for rplP, SEQ ID NO: 5 (forward primer), SEQ ID NO: 6 (reverse primer), SEQ ID NO: 7 (probe); for rpoB, SEQ ID NO: 11 (forward primer), SEQ ID NOs: 12-14 (reverse primers), SEQ ID NOs: 15-16 (probe). The antimicrobial susceptibility of K. pneumoniae strains 0143 (antimicrobial resistant strain) and 16565 (antimicrobial sensitive strain) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of the indicated antimicrobials, and after 4h of incubation were subjected to PCR-based rapid ID / AST testing using the protocol of Example 12. The results are shown on FIG. 33. The percentages on the Y-axis depicted as “Fold Change Abx level 1” were determined using the calculation 2A-(Abx_Level_l_Ct - Reference_Ct) or2A-(ACt). The Abx Level indication does not relate to an actual concentration that was used but is rather an indication of which 2-fold dilution is being referred to where Abx Level 1 is the lowest concentration and each Level up is 2-fold higher concentration (see TABLE XXXI). To give an example of how Fold Change is calculated, if the Reference Ct value (i.e. the Ct value with no antimicrobial added) is 20 and the Abx Level l Ct value is 22, then the Fold Change = 2A-(22-20) = 2A-2 = ’A x ’A =25%. Based on these calculations, strains resistant to the antimicrobial which have lower ACt values will have higher “Fold Change” values than strains that are sensitive to the antimicrobial which have higher ACt values, and in FIG. 33, Abx Level 1 was able to produce the best separation between the resistant strain Kpn 0143 and the sensitive strain Kpn 16565. These data further indicate that all three gene targets (gyrB, rplB, rpoB) can be utilized to obtain correct susceptibility results for both Kpn strains, in determining sensitivity or resistance to ciprofloxacin, gentamicin, and meropenem. However, there may be instances in which any given target gene may perform better or worse for determining sensitivity or resistance to a given antimicrobial. Taken together, these results indicate that different target genes and alleles can be utilized for rapid PCR-based ID / AST of the Enterobacterales order as long as the primers and probes can exhibit correct inclusivity and exclusivity criteria for Enterobacterales as was shown in Example 2, FIGS 5-7. EXAMPLE 14 Real-Time PCR ID and AST Assay of Pseudomonas aeruginosa Rapid Identification and phenotypic antimicrobial susceptibility testing of Pseudomonas aeruginosa utilizing three distinct target genes, tuf gyrB, rpoB, and three classes of antibacterial agents, ciprofloxacin, gentamicin, and meropenem, was performed. The primer / probe sets used were as follows. For tuf, SEQ ID NO: 32 (forward primer), SEQ ID NO: 33 (reverse primer), SEQ ID NO: 34 (probe); for gyrB, SEQ ID NO: 35 (forward primer), SEQ ID NO: 36 (reverse primer), SEQ ID NO: 37 (probe); for rpoB, SEQ ID NO: 38 (forward primer), SEQ ID NO: 39 (reverse primer), SEQ ID NO: 40 (probe). The antimicrobial susceptibility of P. aeruginosa strains 16657 (resistant) and 17816 (sensitive) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of the indicated antimicrobials, and after 4h of incubation were subjected to PCR-based rapid ID / AST testing using the protocol of Example 12. The results, as shown in FIG. 34, indicate that all three gene targets can be utilized to obtain correct susceptibility results for both P. aeruginosa strains, though some target alleles do seem to perform better for some antimicrobials. Taken together, these results indicate that different target genes and alleles can be utilized for rapid PCR-based ID / AST given they provide the correct inclusivity and exclusivity criteria for P. aeruginosa (see FIGs. 11-13). EXAMPLE 15 Real-Time PCR ID and AST Assay of Acinetobacter baumanii Rapid Identification and phenotypic antimicrobial susceptibility testing of Acinetobacter baumanii utilizing three distinct target genes, ompA, rpoB, gyrB, and three classes of antibacterial agents, ciprofloxacin, gentamicin, and meropenem, was performed. The primer / probe sets used were as follows. For ompA, SEQ ID NO: 20 (forward primer), SEQ ID NO: 21 (reverse primer), SEQ ID NO: 22 (probe); for rpoB, SEQ ID NO: 23 (forward primer), SEQ ID NO: 24 (reverse primer), SEQ ID NO: 25 (probe); for gyrB, SEQ ID NO: 26 (forward primer), SEQ ID NO: 27 (reverse primer), SEQ ID NO: 28 (probe). The antimicrobial susceptibility of A. baumannii strains 17694 (resistant) and 16421 (sensitive) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of the indicated antimicrobials, and after 4h of incubation were subjected to PCR-based rapid ID / AST testing using the protocol of Example 12. The results, as shown in FIG. 35, indicate that all three gene targets can be utilized to obtain correct susceptibility results for both Abi strains, though some target alleles do seem to perform better for some antimicrobials. Taken together, these results indicate that different target genes and alleles can be utilized for rapid PCR-based ID / AST given they provide the correct inclusivity and exclusivity criteria for A. baumannii (see FIGs. 8-10). EXAMPLE 16 Real-Time PCR ID and AST Assay of Staphylococcus aureus Rapid Identification and phenotypic antimicrobial susceptibility testing of Staphylococcus, aureus utilizing three distinct target genes (gyrB, ddlA, tuf) and one class of antibacterial agent, cefoxitin (cephalosporin) was performed. The primer / probe sets used were as follows. For gyrB, SEQ ID NO: 73 (forward primer), SEQ ID NO: 74 (reverse primer), SEQ ID NO: 75 (probe); for ddlA, SEQ ID NO: 76 (forward primer), SEQ ID NO: 77 (reverse primer), SEQ ID NO: 78 (probe); for tuf SEQ ID NO: 79 (forward primer), SEQ ID NO: 80 (reverse primer), SEQ ID NO: 81 (probe). The antimicrobial susceptibility of S. aureus strains 15509 (resistant) and 16405 (sensitive) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of the indicated antimicrobial, and after 4h of incubation were subjected to PCR-based rapid ID / AST testing using the protocol of Example 12. The results, as shown in FIG. 36, indicate that all three gene targets can be utilized to obtain correct susceptibility results for both S. aureus strains, though some target alleles do seem to perform better. Taken together, these results indicate that different target genes and alleles can be utilized for rapid PCR-based ID / AST given they provide the correct inclusivity and exclusivity criteria for S. aureus (see FIGs. 21-22). EXAMPLE 17 Real-Time PCR ID and AST Assay of Enterococcus faecium Rapid Identification and phenotypic antimicrobial susceptibility testing of Enterococcus faecium utilizing three distinct target genes (rpoB, ddl, gyrB) and two classes of antibacterial agents, ampicillin (beta-lactam) and vancomycin (glycopeptide) was performed. The primer / probe sets used were as follows. For rpoB, SEQ ID NO: 53 (forward primer), SEQ ID NO: 54 (reverse primer), SEQ ID NO: 55 (probe); for ddl, SEQ ID NOs: 56-57 (forward primers), SEQ ID NOs: 58-59 (reverse primers), SEQ ID NOs: 60-61 (probes); forgyrB, SEQ ID NOs: 62-63 (forward primers), SEQ ID NOs: 64-65 (reverse primers), SEQ ID NO: 66 (probe). The antimicrobial susceptibility of E. faecium strains 18483 (resistant) and 18446 (sensitive) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document Ml00 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of the indicated antimicrobial, and after 4h of incubation were subjected to PCR-based rapid ID / AST testing using the protocol of Example 12. The results, as shown in FIG. 37, indicate that all three gene targets can be utilized to obtain correct susceptibility results for both E. faecium strains, though some target alleles do seem to perform better. Taken together, these results indicate that different target genes and alleles can be utilized for rapid PCR-based ID / AST given they provide the correct inclusivity and exclusivity criteria for E. faecium (see FIGs. 17-19). EXAMPLE 18 Real-Time PCR ID and AST Assay of Candida genus Rapid Identification and phenotypic antimicrobial susceptibility testing of Candida can be performed with the target genes RDN18 (18s ribosomal RNA) and RDN58 (5.8s ribosomal RNA) using the primers and probes as shown in FIG. 38 which are for RDN18'. SEQ ID NO: 88 (forward primer), SEQ ID NO: 89 (reverse primer), SEQ ID NO: 90 (probe); andforRDN58: SEQ ID NO: 91 (forward primer), SEQ ID NO: 92 (reverse primer), SEQ ID NO: 93 (probe). The correct inclusivity and exclusivity criteria for Candida are shown in FIGs. 26-27. EXAMPLE 19 Generic Real-Time PCR ID and AST Assay Rapid Identification and phenotypic antimicrobial susceptibility testing of any given Gramnegative or Gram-positive bacteria can be performed with the widely conserved 16s ribosomal RNA gene as target and using the primers and probe as shown in FIG. 39, which are SEQ ID NO: 94 (forward primer), SEQ ID NO: 95 (reverse primer), and SEQ ID NO: 96 (probe). EXAMPLE 20 Multiplex PCR ID Assay with Breakpoint Groups FIG. 40A shows the inclusivity and exclusivity performance of a Gram-negative pathogen PCR multiplex master mix. The Acinetobacter PCR detection set utilized forward primer SEGP2603 (SEQ ID NO: 20), reverse primer SEGP2606 (SEQ ID NO: 21) and probe SEGP2769 (SEQ ID NO: 22) that targets the ompA gene (see TABLE V) and assay results are reported in channel 1. The Pseudomonas aeruginosa PCR detection set utilized forward primer SEGP2341 (SEQ ID NO: 32), reverse primer SEGP2342 (SEQ ID NO: 33) and probe SEGP2343 (SEQ ID NO: 34) that targets the tuf gene (see TABLE VIII) and assay results are reported in channel 2. The Enterobacterales PCR detection set utilized forward primer SEGP1899 (SEQ ID NO: 8), reverse primer SEGP1901 (SEQ ID NO: 9) and probe SEGP2016 (SEQ ID NO: 10) and targets the gyrB gene (see TABLE III) and assay results are reported in channel 3. General bacterial PCR detection set utilized forward primer SEGP1830 (SEQ ID NO: 94), reverse primer SEGP1831 (SEQ ID NO: 95) and probe SEGP1895.1 (SEQ ID NO: 96) targets the 16s rRNA gene (see TABLE XXVIII) and assay results are reported in channel 4. Lastly, a generic internal control PCR detection set utilized forward primer SEGP1952 (ACAACCGCGCCATACATGTCAAGA<t_BB_dC>; SEQ ID NO: 97), reverse primer SEGP1953 (GTCGGGCCGCTTATACAGT ACCA<t_BB_dC>; SEQ ID NO: 98) and probe SEGP1954 (<CY5.5>TGCGCGTCCCG<BHQ_2>TTTTGATACTTCGTAACGGTGC<Phos>; SEQ ID NO: 99) and assay results are reported in channel 5. The breakpoint groups, channels, and dye wavelengths are summarized in FIG. 40B. The concentration of the genomic DNA was roughly 2-10 ng / pL for all samples. The multiplex reaction was tested against genomic DNA isolated from common Gram-negative pathogens: E. coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, P. aeruginosa, A. baumannii, and A. pittii. Additionally, no meaningful amplification was observed with genomic DNA isolated from common Gram-positive pathogens (data not shown). As designed, amplification curves are observed in the correct channel for desired pathogens, indicating the multiplex reaction has very strong inclusivity and exclusivity. FIG. 41A shows the inclusivity and exclusivity performance of a Gram-positive pathogen PCR multiplex master mix. The Streptococcus PCR detection set utilized forward primer SEGP1705 (SEQ ID NO: 100), reverse primer SEGP1706 (SEQ ID NO: 101) and probe SEGP1709.1 (SEQ ID NO: 102) that targets the tuf gene (see TABLE XXV) and assay results are reported in channel 1. The Staphylococcus PCR detection set utilized forward primer SEGP1835 (SEQ ID NO: 79), reverse primer SEGP1836 (SEQ ID NO: 80) and probe SEGP1838 (SEQ ID NO: 81) that targets the tuf gene (see TABLE XXI) and assay results are reported in channel 2. The Enterococcus PCR detection set utilized forward primer SEGP2522 (SEQ ID NO: 53), reverse primer SEGP2525 (SEQ ID NO: 54) and probe SEGP2770 (SEQ ID NO: 55) that targets the rpoB gene (see TABLE XV) and assay results are reported in channel 3. General bacterial PCR detection set utilized forward primer SEGP1830 (SEQ ID NO: 94), reverse primer SEGP1831 (SEQ ID NO: 95) and probe SEGP1895.1 (SEQ ID NO: 96) that targets the 16s rRNA gene (see TABLE XXVIII) and assay results are reported in channel 4. Lastly, a generic internal control PCR detection set utilized forward primer SEGP1952 (SEQ ID NO: 97), reverse primer SEGP1953 (SEQ ID NO: 98) and probe SEGP1954 (SEQ ID NO: 99) and assay results are reported in channel 5. The breakpoint groups, channels, and dye wavelengths are summarized in FIG. 41B. The concentration of the genomic DNA was roughly 2-10 ng / pL for all samples. The multiplex reaction was tested against purified genomic DNA from common Gram-positive pathogens: S. agalactiae, S. pneumoniae, S. pyogenes, E.faecium, E.faecalis, S. aureus, andS. epidermidis. Additionally, no meaningful amplification was observed with genomic DNA isolated from common Gram-negative pathogens (data not shown). As designed, amplification curves are observed in the correct channel for desired pathogens, indicating the multiplex reaction has very strong inclusivity and exclusivity. EXAMPLE 21 Analysis of PCR-AST Assay FIG. 42 contains graphs from a series of PCR-AST assays on diverse Gram-negative strains showing different thresholds that can be used to distinguish between susceptible and resistant isolates of multiple pathogen groups separated into different channels and interpreted using statistical separation of populations as outlined in FIG. 4. The thresholds associated with ciprofloxacin susceptibility are shown for A) Acinetobacter baumanni (Abi) using primers / probe of SEQ ID NOs: 17-19 that target the ompA gene, B) Enterobacteriaceae (Entero) using primers / probe of SEQ ID NOs: 1-3 that target the rplP gene, and C) Pseudomonas aeruginosa (Pae) using primers / probe as shown in TABLE XXXIII and target the O-antigen acetylase gene, and are based on change in Ct value at 2 pg / mL ciprofloxacin relative to no ciprofloxacin control (ACt), Relative Fluorescence Intensity (RFI) at 0.5 pg / mL ciprofloxacin and ACt at 1 pg / mL ciprofloxacin, and Slope prior to the Ct fluorescence value at 0.5 pg / mL ciprofloxacin (Slope) and ACt at 1 pg / mL ciprofloxacin. TABLE XXXIII Oligonucleotides for detecting Pseudomonas aeruginosa Primers and Probes that hybridize to O-antigen acetylase gene in P. aeruginosa Oligonucleotide Type Oligonucleotide Name SEQ ID NO: Sequence Modifications Forward primer RMPFP01 130 ACGTTTTCCCTTCGCTG<t_BB_dA> t_BB_dA= t-butylbenzyl-dA Reverse primer 1 RMPRP02 131 GTACAGTGACCAGCCAT<t_BB_dC> t_BB_dC= t-butylbenzyl-dC Reverse primer 2 RMPRP04 132 GCGAAACAATCCAGGCCAT<t_BB_d C> t_BB_dC= t-butylbenzyl-dC Probe RMP04 133 <FAM_Thr>CCTACG<BHQ_2>TGAAT GCGCTGTTCGATGCGTTGGC<Phos> < FAMThr >: Fluorophore <BHQ_2>: Quencher <Phos>: Phosphate FIG. 43 A) shows the distribution of the resistant and susceptible isolates that were tested for Abi, Pae, and for the Enterobacteriaceae family subdivided into the strains E. cloacae (Eel), E. Coli (Eco), K aerogenes (Kae), and K pneumonia (Kpn). The sensitivity, specificity, and categorical agreement for ciprofloxacin across species using the thresholds in FIG. 42 are shown in FIG. 43B). Sensitivity is defined as Total Positives / (Total Positives + False Negatives); Specificity is defined as Total Negatives / (Total Negatives + False Positives); Categorical Agreement is defined as (Total Positives + Total Negatives) / (Total Positives + False Negatives + Total Negatives + False Positives). FIG. 44 contains graphs from a second PCR-AST assay where thresholds associated with gentamicin susceptibility are shown for A) Abi, B) Entero, and C) Pae, using the respective primers / probe sets, and are based on Inflection cycle at 1 pg / mL gentamicin, changes in Absolute Fluorescence Intensity (AAFI) at 1 pg / mL gentamicin and 8 pg / mL gentamicin, and Goodness of Fit for the curve fit to the raw fluorescence data at 16 pg / mL gentamcin and AAFI at 4 pg / mL gentamicin. FIG. 45A) shows the distribution of the resistant and susceptible isolates that were tested for Abi, Pae, and for the Enterobacteriaceae strains Enterobacter cloacae (Eel), Escherichia coli (Eco), Klebsiella aerogenes (Kae) and Klebsiella pneumonia (Kpn). The sensitivity, specificity and categorical agreement for gentamicin across species using the thresholds in FIG. 44 are seen in FIG 45B). FIG. 46 contains graphs from a third PCR-AST assay where thresholds associated with meropenem susceptibility are shown for A) Abi, B) Entero, and C) Pae, using the respective primers / probe sets, and are based on change in Ct value at 4 pg / mL meropenem relative to no meropenem control (ACt), change in Ct value at 4 pg / mL meropenem relative to the lowest meropenem concentration at 0.25 pg / mL (AAbx-Ct) and the absolute Ct value (Ct) at 0.25 pg / mL meropenem, and the Absolute Fluorescence Intensity (AFI) at 1 pg / mL meropenem and ACt at 4 pg / mL meropenem. FIG. 47A) shows the distribution of the resistant and susceptible isolates that were tested for Abi, Pae, and for the Enterobacteriaceae strains Eel, Eco, Kae and Kpn. The sensitivity, specificity and categorical agreement for gentamicin across species using the thresholds in FIG. 46 are seen in FIG 47B). FIG. 48A) describes the workflow for testing bacteria isolates directly from positive blood culture samples, which were created by spiking a fixed concentration of bacteria into whole blood, separating red blood cells, inoculating plasma containing bacteria into a commercial blood culture bottle, incubating overnight, and then following the PCR-AST assay protocol as described in EXAMPLE 12 for testing isolates known for being resistant or susceptible to gentamicin. FIG. 48B) shows the results of this experiment where the change in Ct value (ACt) are used to distinguish between resistant and susceptible isolates, showing that phenotypic results can be obtained on bacteria directly from positive blood culture. EXAMPLE 22 Multiplex ID-AST PCR Assay of Polymicrobial Samples A. Kpn / Abi Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of two Gram-negative organisms, Klebsiella pneumonia (Kpn) and Acinetobacter baumannii (Abi) with different susceptibility combinations were co-incubated together in the absence or presence of three different antibiotics, ciproflaxocin, gentamicin and meropenem, at varying concentrations. Detection of the Kpn signal was from an ATTO-labeled probe and detection of the Abi signal was from a HEX-labeled probe. Primers and probes used in this assay are shown in TABLE XXXIV and the results are shown on FIG. 49. Each species displayed the appropriate phenotype in the corresponding detection channel as indicated by a delta-Ct threshold that separates susceptible (sensitive) and resistant strains, thereby providing accurate antimicrobial susceptibility results for this polymicrobial situation. TABLE XXXIV Oligonucleotides Used in Kpn and Abi ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Klebsiella pneumoniae and Acinetobacter baumannii Oligonucleotide Type Oligonucleotide Name SEQID NO: Sequence Modifications Forward primers SEGP1899 SEGP1813 8 29 TGTCGAATTCTTATGACTCCTCCA GTAACCCTAACGCTACTGCACGT Reverse primers SEGP1901 SEGP1815 9 30 CGCGAGCGCTTCGTCGA GGTTGATCCCAAGCGAAACCT Probes SEGP2016 SEGP1951 10 31 <HEX>CCGGTCTGC<ZEN>ACCAC ATGGTATTCGAGGTGG<3IABkFQ> <ATTO>TCGAAGGT<BHQ_2>CAC ACAGATAACACT<Phos> <HEX>: Fluorophore <ATTO>: Fluorophore <ZEN>: Quencher <BHQ_2>: Quencher <3IABkFQ>: 3 ’ Blocker <Phos>: 3' Blocker B. Kpn / Sar Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of one Gram-negative organism Klebsiella pneumonia (Kpn) and one Gram-positive 5 organism Staphylococcus aureus (Sar) with different susceptibility combinations were coincubated together in the absence or presence of three different antibiotics, ciprofloxacin, cefoxitin and meropenem, at varying concentrations. Detection of the Kpn signal was from a HEX-labeled probe and detection of the Sar signal was from a FAM-labeled probe. Primers and probes used in this assay are shown in TABLE XXXV and the results are shown on FIG. 50. 10 N / A indicates that there is no clinically relevant interpretation for the corresponding bacteria-drug combination. Each species displayed the appropriate phenotype in the corresponding detection channel as indicated by a delta-Ct threshold that separates susceptible (sensitive) and resistant strains, thereby providing accurate antimicrobial susceptibility results for this polymicrobial situation. TABLE XXXV Oligonucleotides Used in Kpn and Sar ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Klebsiella pneumoniae and Staphylococcus aureus Oligonucleotide Type Oligonucleotide Name SEQ ID NO: Sequence Modification s Forward primers SEGP1899 SEGP1835 8 79 TGTCGAATTCTTATGACTCCTCCAGTA CCGTGTTGAACGTGGTCAAATCAAA Reverse primers SEGP1901 SEGP1836 9 80 CGCGAGCGCTTCGTCGA AGCAGCTAATACTTGACCACGTTGTA Probes SEGP2016 SEGP1838 10 81 <HEX>CCGGTCTGC<ZEN>ACCACATG GTATTCGAGGTGG<3IABkFQ> <FAM>AGACTACGC<ZEN>TGAAGCTG GTGAC<3IABkFQ> <HEX>: Fluorophore <FAM>: Fluorophore <ZEN>: Quencher <3IABkFQ>: 3 ’ Blocker C. Kpn / Cal Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of one Gram-negative organism, Klebsiella pneumonia (Kpn), and one fungal 5 organism, Candida albicans (Cal) with different susceptibility combinations were co-incubated together in the absence or presence of two different antibiotics, ciprofloxacin and meropenem, at varying concentrations. Detection of the Kpn signal was from a HEX-labeled probe and detection of the Cal signal was from a FAM-labeled probe. Primers and probes used in this assay are shown in TABLE XXXVI and the results are shown on FIG. 51. N / A indicates that 10 there is no clinically relevant interpretation for the corresponding organism-drug combination. Cal susceptibility for fluconazole is indicated. The Kpn strains displayed the appropriate phenotype in the corresponding detection channel as indicated by a delta-Ct threshold that separates susceptible and resistant isolates, providing accurate antimicrobial susceptibility results. 15 TABLE XXXVI Oligonucleotides Used in Kpn and Cal ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Klebsiella pneumoniae and Candida albicans Oligonucleotide Type Oligonucleotide Name SEQ ID NO: Sequence Modifications Forward primers SEGP1899 SEGP1712 8 88 TGTCGAATTCTTATGACTCCTCCAGTA CGTTTTCATTAATCAAGAACGAAAGTTA Reverse primers SEGP1901 SEGP1713 9 89 CGCGAGCGCTTCGTCGA ACCGATCCCTAGTCGGCATA Probes SEGP2016 SEGP1716 10 90 <HEX>CCGGTCTGC<ZEN>ACCACATGGT ATTCGAGGTGG<3IABkFQ> <FAM>AGACTACGA<ZEN>CGGTATCTGA TCATCTTCGATCCC<3IABkFQ> <HEX>: Fluorophore <FAM>: Fluorophore <ZEN>: Quencher <3IABkFQ>: 3 ’ Blocker D. Efs / Sar Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of two Gram-positive organisms, Enterococcus faecalis (Efs) and Staphylococcus aureus (Sar), with different susceptibility combinations were co-incubated together in the 5 absence or presence of vancomycin at varying concentrations. Detection of the Efs signal was from a HEX-labeled probe and detection of the Sar signal was from a FAM-labeled probe. Primers and probes used in this assay are shown in TABLE XXXVII and the results are shown on FIG. 52. Both species displayed the appropriate phenotype in the corresponding detection channel as indicated by a delta-Ct threshold that separates susceptible and resistant isolates, 10 providing accurate antimicrobial susceptibility results for this polymicrobial situation. TABLE XXXVII Oligonucleotides Used in Efs and Sar ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Enterococcus faecalis and Staphylococcus aureus Oligonucleotid e Type Oligonucleotide Name SEQID NO: Sequence Modifications Forward primers SEGP1624 SEGP1835 56 79 CGTAGCATTCTATGATTATGAAGCC CCGTGTTGAACGTGGTCAAATCAAA Reverse primers SEGP1625 SEGP1836 58 80 CATCGTGTAAGCTAACTTCG AGCAGCTAATACTTGACCACGTTGTA Probes SEGP1626 SEGP1838 60 81 <HEX>CAGATTCCA<ZEN>GCCGAAGTG CC<3IABkFQ> <FAM>AGACTACGC<ZEN>TGAAGCTGG TGAC<3IABkFQ> <HEX>: Fluorophore <FAM>: Fluorophore <ZEN>: Quencher <3IABkFQ>: 3 ’ Blocker E. Sar / Cal Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of one Gram-positive organism, Staphylococcus aureus (Sar) and one fungal 15 organism Candida albicans (Cal), with different susceptibility combinations were co-incubated together in the absence or presence of cefoxitin at varying concentrations. Detection of the Sar signal was from a FAM-labeled probe and detection of the Cal signal was from a HEX-labeled probe. Primers and probes used in this assay are shown in TABLE XXXVIII and the results are shown on FIG. 53. N / A indicates that there is no clinically relevant interpretation for the corresponding organism-drug combination. Cal susceptibility for fluconazole is indicated. The Sar strains displayed the appropriate phenotype in the corresponding detection channel as indicated by a delta-Ct threshold that separates susceptible and resistant isolates, providing accurate antimicrobial susceptibility results. TABLE XXXVIII Oligonucleotides Used in Sar and Cal ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Staphylococcus aureus and Candida albicans Oligonucleotide Type Oligonucleotide Name SEQID NO: Sequence Modifications Forward primers SEGP1835 SEGP1712 79 88 CCGTGTTGAACGTGGTCAAATCAAA CGTTTTCATTAATCAAGAACGAAAGTTA Reverse primers SEGP1836 SEGP1713 80 89 AGCAGCTAATACTTGACCACGTTGTA ACCGATCCCTAGTCGGCATA Probes SEGP1838 SEGP1717 81 134 <FAM>AGACTACGC<ZEN>TGAAGCTGGT GAC<3IABkFQ> <HEX>AGACTACGA<ZEN>CGGTATCTGA TCATCTTCGATCCC<3IABkFQ> <HEX>: Fluorophore <FAM>: Fluorophore <ZEN>: Quencher <3IABkFQ>: 3 ’ Blocker EXAMPLE 23 PCR Assays for Determining Mechanism of Carbapenem Resistance PCR assays that target the blaKPC, blaVIM, blaNDM, and blaOXA-48 genes were tested against Gram-negative pathogens with known mechanisms of carbapenem resistance: K. pneumoniae, E. cloacae , P. aeruginosa, A. baumannii, E. coli andK. aerogenes. The primers and probes used in this assay are listed in TABLE XXXIX. The concentration of the genomic DNA was roughly 2-10 ng / pL for all samples other than the no template control. The results of the experiment are shown on FIG. 54. Growth curves, depicted as Positive (Pos) in the figure were observed only for the targeted resistance mechanism. No meaningful amplification was observed for non-target resistance mechanisms, thereby demonstrating good inclusivity and exclusivity profiles for this particular combination of primers and probes for detecting common mechanisms of carbapenem resistance. TABLE XXXIX Oligonucleotides Used in Carbapenem Resistance PCR Assay Gene Target Oligonucleotide Type Oligonucleotide Name SEQ ID NO: Sequence Modification s blaKPC Forward Primer SEGP2124 103 GCGATACCACGTTCCGTCTG blaVIM SEGP2135 104 CCGAGTGGTGAGTATCCGAC blaNDM SEGP2127 105 TTTGGCGATCTGGTTTTCCG blaOXA-48 SEGP2133 106 GGCACGTATGAGCAAGATGC blaKPC Reverse Primer SEGP2125 107 CGGTCGTGTTTCCCTTTAGC b la VIM SEGP2136 108 GAATGCGTGGGAATCTCGTTC blaNDM SEGP2128 109 ATCAAACCGTTGGAAGCGAC blaOXA-48 SEGP2134 110 GTTTGACAATACGCTGGCTGC blaKPC Probe SEGP2126 111 <CFR_635>AGCGGCAGCAGTT T<BHQ_2>GTTGATTG<Phos> <CFR_635>: Fluorophore <BHQ_2>: Quencher <Phos>: 3' Blocker blaVIM SEGP2137 112 <CFR_63 5>CGCTGTATC AATC A A<BHQ_2>AAGCAACTCATCA< Phos> blaNDM SEGP2129 113 <CFR_635>AGACATTCGGTGC GA<BHQ_2>GCTGGC<Phos> blaOXA-48 SEGP2346 114 <CFR_635>TCGGGCAATGT<BH Q_2>AGACAGTTTCTGGCTCGA CG<Phos> EXAMPLE 24 species-specific PCRID-AST assays PCR assays using forward primer SEGP2164 (SEQ ID NO: 115), reverse primer SEGP2166 5 (SEQ ID NO: 116) and probe SEGP2167 (SEQ ID NO: 117) that target the citC gene of P. stuartii, and also forward primer SEGP2119 (SEQ ID NO: 118), reverse primer SEGP2121 (SEQ ID NO: 119) and probe SEGP2120 (SEQ ID NO: 120) that target the invA gene of Salmonella were tested against common Gram-negative pathogens: E. coll, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, C. freundii, P. stuartii, P. 10 rettgeri, S. enterica, S. maltophilia, P. aeruginosa, A. baumannii, andA.pittii. The sequences are shown in TABLE XL. Gram-positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng / pL for all samples, besides the no template control which was 0 ng / pL. As shown in FIG. 55, meaningful amplification curves were species-specific. No meaningful amplification was 15 observed for non-target organisms, thereby demonstrating good inclusivity and exclusivity profiles for the four combinations of primers and probes for detecting the respective Gram negative target species. These results represent non-limiting examples of species specific detection sets that allow improved breakpoint based AST calling for some specific species within the order Enter obac ter ales. CLSI guidelines indicate that some Enterobacterales species such as those shown here are resistant to specific aminoglycoside drugs, while the majority of Enterobacterales species are not. TABLE XL Oligonucleotides for detecting P. stuartii and Salmonella Primers and Probes targeting citC gene of P. Stuartii and invA gene of Salmonella Oligonucleotide Type Oligonucleotide Name SEQ ID NO: Sequence Modifications Forward primer SEGP2164 SEGP2119 115 118 GCCATCGTGATGAATGCCAATCC TGACCATTTCAATGGGAACTCTGC Reverse primer SEGP2166 SEGP2121 116 119 TCAGAGCCTTTGTGGATAGTGAGA AGATCGCCAATCAGTCCTAACGA Probe SEGP2167 SEGP2120 117 120 <FAM>TTGGCTACA<ZEN>TTTATT TGTCGTCAAAGAAGATACCTCACG CTTCC<3IABkFQ> <FAM>CAAAGGCGA<ZEN>GCAGC CGCTCAGTATTGAGGA<3IABkFQ> <FAM>: Fluorophore <ZEN>: Quencher <3IABkFQ>: 3' Blocker PCR assays using forward primer SEGP2921 (SEQ ID NO: 121), reverse primer SEGP2922 (SEQ ID NO: 122) and probe SEGP2923 (SEQ ID NO: 123) that target the gyrB gene of X agalactiae, forward primer SEGP2947 (SEQ ID NO: 85), reverse primer SEGP2949 (SEQ ID NO: 86) and probe SEGP2951 (SEQ ID NO: 87) that target the ddlA gene of S. agalactiae, forward primer SEGP2777 (SEQ ID NO: 124), reverse primer SEGP2778 (SEQ ID NO: 125) and probe SEGP2779 (SEQ ID NO: 126) that target the tuf gene of S. pneumoniae and forward primer SEGP2113 (SEQ ID NO: 127), reverse primer SEGP2114 (SEQ ID NO: 128) and probe SEGP2115 (SEQ ID NO: 129) that target the speB gene of S. pyogenes were tested against common Gram-positive pathogens: S. agalactiae, S. pneumoniae, S. pyogenes, E. faecium, E. faecalis, S. aureus, and S. epidermidis. The sequences are shown in TABLE XLI. Gramnegative organisms were also tested and showed no meaningful amplification (data not shown).The concentration of the genomic DNA was roughly 2-10 ng / pL for all samples, besides the no template control which was 0 ng / pL. As shown in FIG. 56, meaningful amplification curves were species-specific. No meaningful amplification was observed for nontarget organisms, thereby demonstrating good inclusivity and exclusivity profiles for the four combinations of primers and probes for detecting the respective Gram-positive target species. These results represent non-limiting examples of species-specific detection sets that allow improved breakpoint based AST calling for some specific species within the Staphylococcus and Streptococcus genera (see CLSI breakpoint tables in FIG. 31), by having these ID-wells a more general ID / AST detection set such as those shown in FIG. 41 can be utilized. TABLE XLI Oligonucleotides for detecting S. agalactiae, S. pneumoniae and S. pyogenes Primers and Probes targeting gyrB gene of S. agalactiae, ddlA gene of S. agalactiae, tuf gene of S. pneumonia, speB gene of S. pyogenes Oligonucleotide Type Oligonucleotide Name SEQID NO: Sequence Modifications Forward primer SEGP2921 SEGP2947 SEGP2777 SEGP2113 121 85 124 127 ACCACTGTATTTGATTTTGATAAATTAGCCAAA CACAAGAATTTGATGAAATGCCATCTTCA GTGACTCTAAATACGAAGACATCGTT CGGAAGAAGCCGTCAGAGAC Reverse primer SEGP2922 SEGP2949 SEGP2778 SEGP2114 122 86 125 128 TTCTCATTGATAAACTCAACGTATGAACCTA ACAATTGCATTATCATCATAGATATCACTTGGA GCAATGGTTTGTCAGTGTCACG ATGGTGCTGACGGACGTAAC Probe SEGP2923 SEGP2951 SEGP2779 SEGP2115 123 87 126 129 <FAM>ACTAAGAAT<ZEN>CTCCATTTCAGACA AGCGAGAAGGTCAAGAAGTTG<3IABkFQ> <FAM>TAATGACAA<ZEN>ACCAAACTGTTGAT TTAGACAAAATGGTTCGTCCA<3IABkFQ> <FAM>TGAACACAG<ZEN>TTGATGAGTATATC CCA<3IABkFQ> <FAM>CACCCCAAC<ZEN>CCCAGTTAACA<3IA BkFQ> <FAM>: Fluorophore <ZEN>: Quencher <3IABkFQ>: 3' Blocker The impact of using species-specific primer / probe sets in making accurate calls in PCR ID-AST assays can be seen in FIG. 57. In the left panel, use of non-species-specific primers and probes may result in the inability to discriminate between susceptible and resistant strains. In contrast, in the right panel, the use of species-specific primer / probe sets that provide identification enables separate interpretation for each individual species, leading to improved Categorial Agreement to the CLSI breakpoint guidelines. EXAMPLE 25 Interpretation of PCR ID-AST assay data FIG. 58 depicts a workflow of a PCR ID-AST assay data interpretation strategy wherein a sigmoidal function is fit to the raw PCR curve data followed by calculation of curve parameters and features. Features are then compared between the presence of various antibiotic concentrations and the no-antibiotic reference to derive relative feature changes. Regression modeling of feature values and changes across antibiotic levels are also used to generate additional features that correspond to the feature dose-response relationship, and may include the use of Ordinary Least Squares, Ridge Regression, Lasso, Elastic Net, Bayesian Regression, or Logistic Regression models. Features are then assembled into a dataframe and are input into separate machine learning algorithms along with the ground truth MIC, or ground truth S / I / R, in order to train predictive models, which may include Neural Networks, Tree-Based Models, Support Vector Machine, or Nearest-Neighbor classifiers. Training consists of splitting the data into a training set and a hold-out test set, followed by splitting the training set into k-folds with crossvalidation to search the appropriate hyperparameter space for each type of classifier. Models are then selected based on average crossvalidation scores as well as performance on the held-out test set. Trained models then participate as an ensemble to return the final predicted MIC, which can be based on unweighted voting, weighted voting, average probabilities, weighted probabilities, or interpreted by a downstream classifier of the aforementioned classifier types. FIG. 59 shows a diagram indicating how species ID, Antimicrobial Susceptibility Testing, Resistance Mechanism detection, and Universal 16s rRNA phenotypic information is combined to return a result, wherein species ID is used to select the appropriate algorithm for MIC prediction which is then compared to the appropriate breakpoints from regulatory bodies to determine susceptibility information. Detection of a resistance mechanism associated with the antibiotic that was tested can then influence the susceptibility result that is returned depending on whether its presence is consistent with the predicted MIC. In the absence of a species ID, the 16s rRNA phenotypic information can be used to return a generic MIC with no susceptibility result, which can be used in conjunction with a species ID that is determined in an alternative fashion, such as mass spectrometry. There are specific examples of using algorithmic elements to improve breakpoint based AST calling. One example is the use of resistance mechanism detection to adjust phenotype result calling. Each resistance mechanism can have one or more antibiotic substrates associated with its activity which are known a priori. These mechanisms can also have different time-frames in which their activity can be detected. Some of these resistance mechanisms do not have robust activity within 4 hours and can only be detected phenotypically after much longer incubation times (12-24 hours). For these resistance mechanisms an organism may be identified as susceptible to a given drug simply because the resistance mechanism has not manifested sufficiently within a 4 hour time frame. Detection of these types of resistance mechanisms via separate PCR wells allows for the correction of discordant phenotypic results. A specific example is Serratia marsescens that sometimes encodes a SME carbapenemase resistance mechanism which is inducible, but not within a 4 hour time frame. Thus these resistant S. marsescens strains will appear to be phenotypically susceptible to meropenem, but detection of the SME gene will allow the correct phenotypic prediction which is meropenem resistance. Another example is the use of phenotypic susceptibility from one or more antibiotics to predict susceptibility for other antibiotics. Because resistance mechanisms often have overlapping substrate specificity this means that susceptibility to some antibiotics is directly correlated with 5 susceptibility to other antibiotics. Likewise, resistance to some antibiotics is directly correlated with resistance to other antibiotics. This is similar to the Expert Rules system that many AST product manufacturers employ whereas data collected from the PCR ID-AST assays of the present invention would be employed as an adjunct to other methods of phenotypic result interpretation. A specific example would be a strain that is susceptible to the antibiotic 10 ertapenem will always be susceptible to the antibiotic meropenem due to the nature of carbapenemases and their substrate specificity which is always higher for degradation of ertapenem. Similarly, any strain that is resistant to meropenem will also be resistant to ertapenem for the same reason. While the foregoing invention has been described in some detail for purposes of clarity and 15 understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made. For example, all the techniques and apparatus described above can be used in various combinations.

Claims

1. A method to simultaneously identify and determine the antimicrobial susceptibility of a target group of bacteria or fungi from a polymicrobial biological sample that have similar or identical clinical breakpoints for at least one antimicrobial or one antimicrobial class, the method comprising- performing a single quantitative real-time PCR assay as a reporter in the presence of at least one concentration of at least one antimicrobial or antimicrobial class using primer and probe oligonucleotides that hybridize more selectively to a target gene that is from the target group of bacteria or fungi compared to the target gene that is not from the target group of bacteria or fungi, and- identifying the target group of bacteria or fungi by detecting a signal generated during the single quantitative real-time PCR assay that is specific to the target group of bacteria or fungi and wherein the target group of bacteria or fungi comprises a taxonomic order, a taxonomic family, a taxonomic genus, or a taxonomic species;wherein the target gene for determining the Enterobacterales order is rplP, ompA, tuf, gyrB, or rpoB; the target gene for determining the Enterobacteriaceae family is rplP, ompA, tuf, gyrB, or rpoB; the target gene for determining the Enterococcus genus is tuf, rpoB, sodA, ddl, or gyrB; the target gene for determining the Pseudomonas genus is gyrB, O-antigen acetylase, rpoB, ecfX, or tuf; the target gene for determining the Acinetobacter genus is ompA, tusA, rpoB, or gyrB; the target gene for determining Strenotrophomonas maltophilia is fdnG, gyrB, or tuf; the target gene for determining Staphylococcus aureus is CPE, gyrB, nuc, rpoB, tuf, or ddlA; the target gene for determining the Staphylococcus epidermidis is altE, or femA; the target gene for determining Coagulase-negative Staphylococci is rpoB, tuf, or sodA; the target gene for determining the Streptococcus genus is tuf, gyrB, sip, or ddlA; the target gene for determining Streptococcus pneumonia is lytA, SP2020, or piaB; the target gene for determining Proteus mirabilis is UreR, or UreC; and / or the target gene for determining Candida albicans is ACT, RPB-1, 5.8s ribosomal RNA, or 18s ribosomal RNA.

2. The method of claim 1 further comprising a step selected from- verifying the identification of the target group of bacteria or fungi with additional primer and probe oligonucleotides that hybridize more selectively to a second target2020388104   31 Mar 2026gene that is from the target group of target bacteria or fungi compared to the second target gene that is not from the target group of bacteria or fungi; or- determining a mechanism for an antimicrobial susceptibility phenotype or for a toxin or virulence phenotype; orboth the verifying and the determining steps.

3. The method of claim 1 or 2 further comprising simultaneously identifying and determining the antimicrobial susceptibility of more than one target group of bacteria or fungi, wherein each target group of bacteria or fungi has similar or identical clinical breakpoints for at least one antimicrobial or one antimicrobial class.

4. The method of any one of claims 1 to 3, wherein the target group of bacteria or fungi are present in bloodstream infections (BSI), gastrointestinal infections, respiratory infections, urinary infections, nasal infections, rectal infections or wound infections.

5. The method of any one of claims 1 to 4, wherein single quantitative real-time PCR assay is a single multiplexed quantitative real-time PCR assay to simultaneously identify and determine the antimicrobial susceptibility of a plurality of bacterial or fungal strains from the polymicrobial biological sample.

6. The method of claim 5, wherein the polymicrobial biological sample is selected from whole blood, plasma, serum, red blood cell fraction, saliva, cerebrospinal fluid, semen, urine, stool, rectal swab, nasal swab, wound swab, dermal swab, bile, lymph, sputum, lavage fluid, or a combination thereof.

7. The method of claim 6, wherein the polymicrobial biological sample is cultured prior to performing the PCR assay.

8. The method of any one of claims 5 to 7, wherein the plurality of bacterial or fungal strains is grouped into at least one group of bacteria or fungi that have similar or identical clinical breakpoints for at least one antimicrobial or antimicrobial class.

9. The method of claim 8, wherein the plurality of bacterial or fungal strains is grouped into more than one group of bacteria or fungi wherein each group of bacteria or fungi has similar or identical clinical breakpoints for at least one antimicrobial or one antimicrobial class.

10. The method of any one of claims 5 to 9, wherein the identification of the plurality of bacterial or fungal strains utilizes a plurality of strain-specific 5' nuclease (TaqMan) oligonucleotide probes, each probe labeled with a fluorescent dye and each fluorescent dye having a different emission wavelength from another fluorescent dye.

11. The method of any one of claims 1 to 10, wherein the primer and probe oligonucleotides that hybridize more selectively to the rplP, gyrB, or rpoB target gene that is in the2020388104   31 Mar 2026Enterobacterales taxonomic order than to the target gene that is not in the Enterobacterales taxonomic order is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 1-16; and / orwherein the primer and probe oligonucleotides that hybridize more selectively to the tuf, rpoB, ddl, or gyrB target gene that is in the Enterococcus genus than to the target gene that is not in the Enterococcus genus is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 50-66; and / orwherein the primer and probe oligonucleotides that hybridize more selectively to the ompA, rpoB, or gyrB target gene that is in the Acinetobacter genus than to the target gene that is not in the Acinetobacter genus is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 17-31; and / orwherein the primer and probe oligonucleotides that hybridize more selectively to the tuf, gyrB, or rpoB target gene that is in the Pseudomonas genus than to the target gene that is not in the Pseudomonas genus is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 32-40; and / orwherein the primer and probe oligonucleotides that hybridize more selectively to the fdnG, gyrB, or tuf target gene that is in the Strenotrophomonas maltophilia species than to the target gene that is not in the Strenotrophomonas maltophilia species is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 41-49; and / or wherein the primer and probe oligonucleotides that hybridize more selectively to the CPE, gyrB, or ddlA target gene that is in the Staphylococcus aureus species than to the target gene that is not in the Staphylococcus aureus species is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 67-69, and 72-78; and / or wherein the primer and probe oligonucleotides that hybridize more selectively to the tuf target gene that is in the Staphylococcus genus than to the target gene that is not in the Staphylococcus genus is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 79-81; and / orwherein the primer and probe oligonucleotides that hybridize more selectively to the 5.8s ribosomal RNA or the 18s ribosomal RNA target gene that is in the Candida genus than to the target gene that is not in the Candida genus is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 88-93; and / orwherein the primer and probe oligonucleotides that hybridize more selectively to tuf target gene that is in the Streptococcus genus than to the target gene that is not in the Streptococcus genus species is selected from the group comprising the nucleotide sequences comprising SEQ ID NOs: 100-102.

Images