HIF1 activating polynucleotides and method of treatment thereof

Abstract

The present invention provides hepatocyte nuclear hypoxia-inducible factor 1 (HIF1) activating polynucleotides capable of activating, upregulating or restoring expression of HIF1, compositions comprising one or more of the HIF1 activating polynucleotides and method of use and treatment thereof. The present invention also provides a pharmaceutical composition comprising a nanoparticle encapsulating any embodiment of the one or more HIF1 activating polynucleotide of the present invention. In an embodiment, the nanoparticle comprises an exosome.

Description

FIELD OF THE INVENTION 5          The present invention provides hepatocyte nuclear hypoxia-inducible factor 1 (HIF1) activating polynucleotides capable of activating, upregulating or restoring expression of HIF1, compositions comprising one or more of the HIF1 activating polynucleotides and method of use and treatment thereof. 10                 BACKGROUND OF THE INVENTION Hypoxia-inducible factor 1 (HIF1) is a master regulator of hypoxia able to control a broad range of genes that facilitate cellular adaption to low O2 environments. The ability of the cell to adapt to low O2 environments contributes to the recovery of neuronal cells following cerebral ischemia and reperfusion. Because of the ability of HIF1 to drive survival 15 of the cell during low O2 stress and ischemic stroke HIF1, and the ability to activate HIF1 expression, has been of interest as a potential therapeutic to treat stroke or traumatic brain injury1. We have learned that many genes in the human genome are regulated epigenetic ally by long non-coding RNAs (IncRNA), many of which are antisense to the protein coding gene which they may regulate. Previous studies have observed that small interfering RNA (siRNA) 20 targeting of gene regulatory IncRNAs can result in de-repression of gene expression and transcriptional activation2,3. Therefore, there is a need for siRNA based pharmaceutical composition and method of treatment using the pharmaceutical composition capable of upregulating or activating HIF1 expression to treat HIF1 related illnesses such as stroke and traumatic brain injury (TBI), wherein the siRNA is capable of targeting various HIF1 25 associated antisense IncRNA. SUMMARY OF THE INVENTION The present invention provides a pharmaceutical composition comprising hypoxiainducible factor 1 (HIF1) activating polynucleotide capable of activating HIF1 expression, 30 wherein the HIF1 activating polynucleotide comprises a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a ribozyme, a deoxyribozyme, an aptamer, or a combination thereof. In an embodiment, the nucleotide sequence of the siRNAs is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 5, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 1, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, or SEQ ID NO. 11. The present invention also provides a method of treatment of a subject suffering from a HIF1-associated disease comprising the step of administering a therapeutically effective amount of the pharmaceutical composition of claim 1 to the subject to activate HIF1 gene expression in the subject. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates the schematic of the HIF1 a gene locus with the sense mRNA transcript (in blue) displayed alongside the HIFla antisense regions, IncRNA transcripts, (in green). Both siRNA target sites (in red) and primer targets are visualized (in grey) as described in Table 1 and 2, as were used to assess the effects of siRNA treatment on HIFla expression. Figure 2 illustrates the schematic of the HIFla gene locus with the sense mRNA transcript (in blue) displayed alongside the HIFla antisense regions, IncRNA transcripts, (in green). Both siRNA target sites (in red) and primer targets of the spliced and unspliced transcripts are visualized (in grey) as described in Table 1 and 2, as were used to assess the effects of siRNA treatment on HIFla expression. Figure 3 illustrates the HIFla gene expression changes (shown as fractions of the control) in siRNA (lOpM) transfected HEK-293T cells. HEK-293T cells were transfected in triplicated and the average expression of HIFla shown as means ± SEM error of the means and P values from 72hrs post-transfection with HIF1A primer specific for exon 12 of HIF1 mRNAs. Figure 4 illustrates the effect of siRNA HIFasP5 (lOpM) on HIFla mRNA (setl) and HIFla IncRNA (set2) expression. Results of siRNA HIFasP5 experimental delta-delta CT data represented as fractions of the control (miN-367) for primer setl and set2. qRT-PCR carried out on RNA collected 72 hours post-transfection. P<0.05 represents the significant difference between group. Figure 5 illustrates the HIFla gene expression changes with siRNA (lOpM) HIFasP2, HIFasP5, HIFasPll, HIFasP12, HIFasP13, and the control (miN-367) transfected HEK-293T cells. HEK-293T cells were transfected and triplicated and the average expression of HIFla shown as means ± SEM error bars at 72hrs post-transfection with HIF1A primer set6 (Spliced) and set7 (Unspliced)(Table 2). P<0.05 represents the significant difference between group. Figure 6 illustrates the HIF1A promoter and HIF1A-AS1 location as well as siHIFl.P2 and siHIFl.P5 target sites to control HIF1A-AS1 expression. Figure 7 illustrates the exosome mediated activation of HIF1 expression. Stable HEK293 cell lines containing both HIFasP2 and HIFasP5 as well as exosome packaging machinery, were found to activate HIF1 expression in transwell assays. Briefly, stable HEK293 cells were co-cultured with untreated HEK293 recipient cells using 0.45pM transwell plates. At 96hrs post co-culture the recipient cells were collected and HIF1 expression determined. The results of triplicated treated cells are shown with the standard deviations and p values from a paired T-test. DETAILED DESCRIPTION OF THE INVENTION As used in this specification and in claims which follow, the singular forms “a”, “an” and “the” include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to “an ingredient” includes mixtures of ingredients, reference to “an active pharmaceutical agent” includes more than one active pharmaceutical agent, and the like. As used herein, the term “about” as a modifier to a quantity is intended to mean + or -20%,+ or - 15%,+ or - 10% or + or - 5%, inclusive of the quantity being modified. As used herein, the term “protein domain” or “domain” means a region of the polypeptide of a protein. In an embodiment, a protein domain is itself folded as a compact structure independent of rest polypeptide region. In an embodiment, the same or similar protein domain within different protein can share similar or identical functions. For example, ferlin proteins comprises multiple C2 domains and a transmembrane domain, and sometimes a Fer domain, DysF domain, or a combination thereof. As used herein, the term "nucleic acid" refers to nucleotides (e.g., deoxyribonucleotides or ribonucleotides) and polymers thereof in either single-, double- or multiple-stranded form, or complements thereof. The terms "polynucleotide," "oligonucleotide," "oligo" or the like refer, in the usual and customary sense, to a linear sequence of nucleotides. The term "nucleotide" refers, in the usual and customary sense, to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified versions thereof. Examples of nucleic acids contemplated herein include single and double stranded DNA, single and double stranded RNA, and hybrid molecules having mixtures of single and double stranded DNA and RNA. Examples of nucleic acids contemplated herein include any types of RNA (e.g., antisense RNA, mRNA, siRNA, miRNA, shRNA, guide RNA, dicer substrate RNA, dicer substrate siRNAs (dsiRNAs) (dsiRNA are cleaved by the RNase I class endoribonuclease dicer into 21-23 base duplexes having 2-base 3'-overhangs siRNA), and any type of DNA, genomic DNA, plasmid DNA, and minicircle DNA, and any fragments thereof. The term "duplex" in the context of nucleic acids refers, in the usual and customary sense, to double strandedness. Nucleic acids can be linear or branched. For example, nucleic acids can be a linear chain of nucleotides or the nucleic acids can be branched, e.g., such that the nucleic acids comprise one or more arms or branches of nucleotides. Optionally, the branched nucleic acids are repetitively branched to form higher ordered structures such as dendrimers and the like. As used herein, the term “subject,” “individual” or “patient” is used interchangeably herein, which refers to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. As used herein, the term “effective amount” or “a therapeutically effective amount” of a drug, compound, pharmacologically active agent or a pharmaceutical composition comprises administering an amount thereof necessary to achieve a desired result. The exact amount required will vary from subject to subject, depending on the species, age, general condition of the subject, the severity of the disease, the particular active agent, its mode of administration, the desired outcome, and the like. In certain embodiments of the present invention, a “therapeutically effective amount” of a drug, compound, pharmacologically active agent or a pharmaceutical composition is that amount effective for inhibiting progression or reversing of any disease disclosed herein in a subject or a biological sample (e.g., in cells). In certain embodiments, disease progression is inhibited by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 100% or any percentage or percentage ranges falling within these values. In certain embodiments, the drug, compound, pharmacologically active agent or a pharmaceutical composition inhibits disease progression by at least about 25%, at least about 50%, at least about 75%, at least about 90% or at least about 100% or any percentage or percentage ranges falling within these values. In certain embodiments of the present invention, a “therapeutically effective amount” refers to an amount of a drug, compound, pharmacologically active agent or a pharmaceutical composition sufficient to cause reversal of disease. In certain embodiments, the disease is reversed by about 1%, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 100% or any percentage or percentage ranges falling within these values. As used herein, the term “target” or “targeting” a polynucleotide comprises regulating the expression level, biological function, or a combination thereof, of the polynucleotide. In an embodiment, the regulation comprises direct regulation or indirect regulation. Indirect regulation comprises regulating expression level, biological function, or a combination thereof, of the polynucleotide through regulation of a regulator of the polynucleotide. In an embodiment, the regulator of the polynucleotide comprises an antisense RNA or a long noncoding RNA (Inc RNA). The present invention provides HIF1 activating polynucleotides capable of targeting HIF1 gene. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene. In an embodiment, without being bound to theory, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by regulating the expression of HIF1 antisense RNA. In an embodiment, the HIF1 antisense RNA comprises HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the H1F1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by upregulating the expression of HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by downregulating the expression of HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores the expression of the HIF1 gene by downregulating the expression of HIF1A-AS1. In an embodiment, without being bound to theory, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by regulation of HIF1 antisense RNA. In an embodiment, the HIF1 antisense RNA comprises HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by regulation of HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the regulation of HIF1 expression by HIF1 antisense RNA comprises disrupting or interfering with regulation of HIF1 gene expression by the HIF1 antisense RNA. In an embodiment, without being bound to theory, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by increasing the HIF1 spliced:unspliced transcript ratio. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by upregulating expression of spliced HIF1 transcripts. In an embodiment, the HIF 1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by downregulating expression of unspliced HIF1 transcripts. In an embodiment, the HIF1 unspliced transcript comprises a longer intronic region than the HIF1 spliced transcript. In an embodiment, the HIF1 unspliced transcript comprises a longer intronic region than the HIF1 spliced transcript at a region between exon 1 and exon 2. In an embodiment, the nucleotide sequence of the spliced transcript is about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 100% identical to the nucleotide sequence of ENST00000337138.9, ENST00000539097.2, ENST00000394997.5, or ENST00000323441.10 deposited in the Ensembl genome browser which is hereby incorporated in its entirety.1 In an embodiment, the nucleotide sequence of the unspliced transcript is about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 100% identical to the nucleotide sequence of ENST00000337138.9, ENST00000539097.2, ENST00000394997.5, or ENST00000323441.10 deposited in the Ensembl genome browser.1 In an embodiment, the HIF1 activating polynucleotide of the present invention is about 10 to about 100 nucleotides (nt) in length such as about lOnt, about 20nt, about 30nt about 40nt about 50nt, about 60nt, about 70nt, about 80nt, about 90nt or about lOOnt including any lengths or length ranges falling within these values. In an embodiment, the HIF1 activating polynucleotide of the present invention is about 15 to about 50 nt in length, about 20 to about 30 nt in length or about 21 to about 23 nt in length. In an embodiment, the HIF1 activating polynucleotide of the present invention is double stranded or single stranded. In an embodiment, the HIF1 activating polynucleotide of the present invention is blunt ended or comprise overhanging ends. In an embodiment, the HIF1 activating polynucleotide of the 1 http: / / genome.ucsc.edu / cgi- bin / hgTracks?db = hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode =0&nonVirtPosition=&position=chr14%3A61695513%2D61748258&hgsid=2192935708_mol6hM1APIxvNkjYy2O xjFU5yWnS. present invention is chemically synthesized or recombinantly produced. In an embodiment, one strand of the HIF1 activating polynucleotide of the present invention comprises nucleotide sequence having sufficient complementarity to HIF1 antisense RNA for the polynucleotide to directly regulate the HIF1 antisense RNA via RNA interference. In an embodiment, the HIF1 activating polynucleotide of the present invention comprises a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a ribozyme, a deoxyribozyme, an aptamer, or a combination thereof. In an embodiment, the HIF1 activating polynucleotide comprises a siRNA. In an embodiment, the nucleotide sequence of the siRNA of the present invention is about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, or SEQ ID NO. 11. In an embodiment, the HIF1 activating polynucleotide of the present invention comprises a shRNA. In an embodiment, the shRNA of the present invention comprises a first nucleotide sequence and a second nucleotide sequence wherein the second nucleotide sequence is complementary to the first nucleotide sequence. In an embodiment, the nucleotide sequence of the first nucleotide sequence of the shRNA of the present invention is about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, or SEQ ID NO. 11. In an embodiment, the shRNA of the present invention further comprises a loop connecting the first nucleotide sequence and the second nucleotide sequence. In an embodiment, the nucleotide sequence of the loop of the shRNA of the present invention is about 2-9 bp such as about 2, 3, 4, 5, 6, 7, 8 or 9 bp including any bp or bp ranges falling within these values. In an embodiment, the nucleotide sequence of the loop of the shRNA of the present invention is about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 100% identical to the nucleotide sequence of SEQ ID NO. 26, SEQ ID NO. 27 or SEQ ID No. 28. SEQ ID NO. 1 (HIFasPl): UCGCCGGGGGAGAAGGCGGCG SEQ ID NO. 2 (HIFasP2): GACAGCGGGGGAGCCCGGCCG SEQ ID NO. 3 (HIFasP3): CGGGCCGAGGGAAUGGGCUUA SEQ ID NO. 4 (HIFasP4): AGCAGCAGAAACAAAAAGGCU SEQ ID NO. 5 (HIFasP5): CGGCCCAGGAGCCCAGGGCGG SEQ ID NO. 6 (HIFasP6): UCUUCCAAGAAGGAAAUCAGA SEQ ID NO. 7 (HIFasP7): GAUGGUGGAGGAAAAAAAGGA SEQ ID NO. 8 (HIFasP8): AUAAGCAGAAGAGUAAAAUAA SEQ ID NO. 9 (HIFasP9): UCUACAAAGAAAAAGCUUCAU SEQ ID NO. 10 (HIFasPIO): CGUCUUGGAAAAACUAUCCAC SEQ ID NO. 11 (HIFasPll): CCAUCUAAAAAACAAAGUUUG SEQ ID NO. 26: TTGC SEQ ID NO. 27: CCUGACCCA SEQ ID No. 28: AAGCACA In an embodiment, the HIF1 antisense RNA comprises HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, any isoforms thereof or a combination thereof. In another embodiment, the HIF1 antisense RNA comprises a HIF1 antisense RNA exon, a HIF1 antisense RNA intron, a HIF1 antisense RNA regulator element, or a combination thereof. In an embodiment, the regulatory element comprises a promoter, a transcriptional enhancer, a transcriptional repressor, or a combination thereof. In an embodiment, any embodiment of the HIF activating polynucleotide of the present invention upregulates the expression of the H1F1 gene in a subject by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 150%, about 200%, about 250%, about 300%, about 350%, about 500%, about 750% or about 1000% compared to the level of the expression of the HIF1 gene in the subject prior to administration of the polynucleotide of the present invention to the subject. In an embodiment, any embodiment of the HIF1 activating polynucleotide of the present invention restores the expression of the HIF1 gene to at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% of the normal HIF1 expression level of the subject when healthy. In an embodiment, any embodiment of the HIF1 activating polynucleotide of the present invention restores the expression of the HIF1 gene to at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% of normal HIF1 expression level of an average healthy human being. In an embodiment, any embodiment of the HIF1 activating polynucleotide of the present invention restores the expression of the HIF1 gene to at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% of normal HIF1 expression level of an average healthy human being having the same or about the same biometrics of the subject such as age, sex, height, weight etc... or a combination thereof. The present invention also provides a pharmaceutical composition comprising a nanoparticle encapsulating any embodiment of the one or more HIF1 activating polynucleotide of the present invention. In an embodiment, the nanoparticle comprises chemical nanoparticles such as but not limited to lipid nanoparticle, polymer nanoparticle, lipid-polymer hybrid nanoparticle and biological nanoparticles such as but not limited to liposome, exosome, virus or virus-like particle. In an embodiment, the nanoparticle comprises an exosome. In an embodiment, the nanoparticle comprises an exosome prepared from an exosome-based packaging and delivery system. In an embodiment, the system comprises a low immunogenic exosome-based packaging and delivery system. In an embodiment, the packaging mechanism of the exosome-based packaging and delivery system of the present invention is of human origin rendering the system low or non-immunogenic to human subjects. In an embodiment, the exosome-based RNA package and delivery system of the present invention comprises an exosome producing cell, a cargo RNA and a fusion protein plasmid, wherein the cargo RNA comprises any embodiment of the one or more HIF1 activating polynucleotide of the present invention. In an embodiment, fusion protein expressed by the exosome producing cell based on the fusion protein plasmid comprises an exosome associated transmembrane protein fused to a packaging protein. In an embodiment, the exosome associated transmembrane protein comprises CD9, CD37, CD53, CD63, CD68, CD81, CD82, LAMP-1, LAMP-2A, LAMP-2B, LAMP-2C, lactadherin, or PTGFRN. In an embodiment, the packaging protein comprises an RNA-binding protein. In an embodiment, the packaging protein is endogenous to a subject. Various embodiments for the recombinant fusion protein comprising an exosome associated transmembrane protein and a packaging protein were disclosed in PCT application no. PCT / US2021 / 026892 filed 12 April, 2021, the contents of which are incorporated by reference herein in their entireties. In an embodiment, the cargo RNA comprises a package RNA and a packaging domain wherein the packaging domain is capable of binding to the packaging protein of the fusion protein. In an embodiment, the packaging domain further comprises stabilizing domains. In an embodiment, the stabilizing domain comprises OH domain and / or MorrisMotif domain wherein the nucleotide sequence of the OH domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 12 and the nucleotide sequence of the MorrisMotif domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 13. SEQ ID NO. 12: GACGTCTATAGGTCGTGTCACCG SEQ ID NO. 13: CGCGTCGCGCGCGTCGCG In an embodiment, the exosome-based packaging and delivery system further comprises an argonaute 2 (Ago2) plasmid. In an embodiment, the Ago2 comprises S387A mutation. Overexpression of Ago2 or the S387A mutant thereof increases the packaging efficiency of the cargo RNA into the exosomes in an exosome-producing cell. In an embodiment, the pharmaceutical composition comprising a nanoparticle encapsulating any embodiment of the one or more HIF1 activating polynucleotide of the present invention further comprises a nanoparticle payload release enhancer. In an embodiment, the nanoparticle release enhancer enhances the release of payload from the nanoparticle by at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, or at least about 25-fold. In an embodiment, the nanoparticle payload release enhancer comprises a modified myoferlin protein. In an embodiment, the modified myoferlin protein comprises C2F, C2G and transmembrane domain. In an embodiment, the nucleotide sequence of the C2F domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 14. In an embodiment, the nucleotide sequence of the C2G domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 15. In an embodiment, the nucleotide sequence of the transmembrane domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 16. SEQ ID NO. 14 (C2F): CAGTTTCGGGAATTACCGACAGCGTCCCACAGGAATGCACGGTTAGGATTTACA TTGTTCGAGGCTTAGAGCTCCAGCCCCAGGACAACAATGGCCTGTGTGACTTAC ATAAAAATAACACTGGGCAAAAAAGTCATTGAAGACCGAGATCACTACATTCCC AACACTCTCAACCCAGTCTTTGGCAGGATGTACGAACTGAGCTGACTTACCTCA AGAAAAAGACCTGAAAATTTCTGTCTATGATTATGACACCTTTACCCGGGATGA AAAAGTAGGAGAGACAATTATTGATCTGGAAAACCGATTCCTTTCCCGCTTTGG GTCCCACTGCGGCATACCAGAGGAGTACTGTGTTTCTGGAGTC SEQ ID NO. 15 (C2G): CCTTTCAACATCACACCCCGGAAAGCCAAGAAATACTACCTGCGTGTGATCATC TGGAACACCAAGGATGTTATCTTGGATGAGAAAAGCATCACAGGAGAGGAAAT GAGTGACATCTACGTCAAAGGCTGGGTTCCTGGCAATAAGAAAACAAACAGAA AACAGATGTCCATTACAGATCTTTGGATGGTGAAGGGAATTTTAACTGGCGATTT GTTTTCCCGTTTGACTACCTTCCAGCCGAACAACTCTGTATCGTTGCGAAAAAAG AGCATTTCTGGAGTATTGACCAAACGGAATTTCGAATCCCACCCAGGCTGATCA TTCAGATATGGGACAATGACAAGTTTTCTCTGGATGACTACTTGGGTTTCCTAGA ACT TGACTTGCGTCAC SEQ ID NO. 16 (transmembrane domain): CCGGACCTCAAAGCCATGAACCCCCTTAAAGCCAAGACAGCCTCCCTCTTTGAG CAGAAGTCCATGAAAGGATGGTGGCCATGCTACGCAGAGAAAGATGGCGCCCG CGTAATGGCTGGGAAAGTGGAGATGACATTGGAAATCCTCAACGAGAAGGAGG CCGACGAGAGGCCAGCCGGGAAGGGGCGGGACGAACCCAACATGAACCCCAAG CTGGACTTACCAAATCGACCAGAAACCTCCTTCCTCTGGTTCACCAACCCATGCA AGACCATGAAGTTCATCGTGTGGCGCCGCTTTAAGTGGGTCATCATCGGCTTGCT GTTCCTGCTTATCCTGCTGCTCTTCGTGGCCGTG In an embodiment, the modified myoferlin protein comprises C2A, FerA, FerB, DysFN and transmembrane domain. In an embodiment, the nucleotide sequence of the C2A domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 17. In an embodiment, the nucleotide sequence of the FerA domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 18. In an embodiment, the nucleotide sequence of the FerB is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 19. In an embodiment, the DysFN domain comprises DysFN-1, DysFN-2, or a combination thereof. In an embodiment, the nucleotide sequence of the DysFN-1 is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 20. In an embodiment, the nucleotide sequence of the DysFN-2 is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 21. SEQ ID NO. 17 (C2A): ATGCTGCGAGTGATTGTGGAATCTGCCAGCAATATCCCTAAAACGAAATTTGGC AAGCCGGATCCTATTGTTTCTGTCATTTTTAAGGATGAGAAAAAGAAAACAAAG AAAGTTGATAATGAATTGAACCCTGTCTGGAATGAGATTTTGGAGTTTGACTTGA GGGGTATACCACTGGACTTTTCATCTTCCCTTGGGATTATTGTGAAAGATTTTGA GACAATTGGACAAAATAAATTAATTGGCACGGCGACTGTAGCCCTGAAGGACCT GACTGGTGACCAGAGCAGATCCCTGCCGTACAAGCTGATCCCCTGCTAAATGAA AGAGGGCAAGATACTGGGGCCACCATTGACTTGGTGATCGGCTATGATCCGCCT TCTGCTCCACATCCAAATGACCTGAGC SEQ ID NO. 18 (FerA): CGCAAACAAATATAGAAGCTCTAAAATCAGGGATACAAGGTAAAATTCCTGCA AACCAGCTGGCTGAATTGTGGCTGAAGCTGATAGATGAAGTTATAGAAGACACG AGATACACGTTGCCTCTCACAGAAGGAAAAGCCAACGTCACAGTTCTCGATACT CAGATCCGAAAG SEQ ID NO. 19 (FerB): TGGCTTGATAAATTAATGCAGCTGACTGAAGAGCCACAGAACAGCATGCCTGAC ATCATCATCTGGATGATCCGGGGAGAGAAGAGACTGGCCTATGCACGAATTCCC GCACATCAGGTCTTGTACTCCACCAGTGGTGAGAATGCATCTGGAAAATACTGT GGGAAAACCCAAACCATCTTTCTGAAGTATCCACAGGAGAAAAACAACGGGCA SEQ ID NO. 20 (DysFN-1): GCTGTGGAGAAGAAGTTTAACAGCTTCGCAGAAGGAACTTTCACCGTCTTTGCT GAAATGTATGAAAATCAAGCTCTCATGTTTGGAAAATGGGGTACTCTGGATTAG TAGGACGTCATAAGTTTTCGATGTCACAGGAAAAATAAAACTCAAGAGGGAATT TTTTCTGCCT SEQ ID NO. 21 (DysFN-2): GATCCTGAAAGAAGCTTGCTGACTGAGGCAGATGAGGTCACACGGAGTCACT GATGAAGTCTACCAGAACGAGAGCCGCTACCCCGGGGGCGACTGGAAGCCGGC CGAGGACACCTACACGGATGCGAACGGCGATAAAGCAGCATCACCCAGCGAGT TGACTTGTCCT In an embodiment, any embodiment of the modified myoferlin protein of the present invention further comprises C2B, C2C, C2D, C2E domains, or a combination thereof. In an embodiment, the nucleotide sequence of the C2A domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 22. In an embodiment, the nucleotide sequence of the FerA domain is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 23. In an embodiment, the nucleotide sequence of the FerB is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO 24. In an embodiment, the DysFN domain comprises DysFN-1, DysFN-2, or a combination thereof. In an embodiment, the nucleotide sequence of the DysFN-1 is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 25. SEQ ID NO. 22 (C2B): CCACAGGACTTCCAGATCCGCGTCCGAGTGATTGAGGGCCGACAGTTAAGTGGC AACAACATAAGGCCTGTGGTCAAAGTTCACGTCTGTGGCCAGACACACCGAACA AGAATCAAGAGAGGAAACAACCCTTTTTTTGATGAGTTGTTTTTCTACAATGTCA ACATGACCCCTTCTGAATTGATGGATGAGATCATCAGCATCCGGGTTTATAATTC TCACTCTCTGCGGGCAGATTGTCTGATGGGGGAATTTAAGATTGATGTTGGATTT GTTTATGATGAACCTGGCCATGCTGTCATGAGAAAGTGGCTTCTTCTCAATGACC CG SEQ ID NO. 23 (C2C): ACCTTCTTGCTGAAAATCTACCGAGCTGAGGACATCCCCCAGATGATGATGCCTT CCACAGACAGTAAAGGAAATATTTGGAGGCAATGAGATAAGAAAAATCTCGTG GATCCTTTTGTAGAAGTTTCCTTTGCTGGAAAAAAGGTTTGTACAAACATAATTG AGAAGAATGCAAACCCAGAGTGGAATCAGGTCGTCAATCTTCAGATCAAGTTTC CTTCAGTGTGTGAAAAAATAAAACTAACAATATATGACTGGGACCGTACTAAAA ATGATGTAGTTGGAACAACATATTACACCCTCTAAAATTGCTGCCTCTGGTGGGG AAGGGAAGATTTCTCATCTTCGGGAACTGGGGCTGCATCATATACAGTAAACAC AGGAGAAACAGAGGTAGGCTTTGTTCCAACGTTTGGACCTTGTTACCTGAATCTT TATGGAAGCCCCAGAGAGTACACGGGATTCCAGACCCCTATGATGAG SEQ ID NO. 24 (C2D): ACCCCCATTGTTTCCTGCAATTTTGACAGAGCACATTACCATCTGCGCTGTATGT CTATCAGCCAGAAACCTCTTGGCTTTAGATAAGGATAGCTTTTCAGATCCATATG CTCATATCTGTTTCCTCCATCGGAGCAAAACCACTGAGATCATCCATTCAACCCT GAATCCCACGGGGACCAAACAATTATATTCGATGAAGTTGAAATCTATGGGGAA CCCCAAACAGTTCTACAGAATCCACCCAAAGTTATCATGGAACTTTTTGACAATG ACCAAGGGGCAAAGATGAATTTTTAGGACGAAGCATTTTCTCTCCTGTGGTGAA ACTGAACTCAGAAATGGACATCACACCCAAACTTCTCTGGCACCCAGTAATGAA TGGAGACAAAGCC SEQ ID NO. 25 (C2E): AGAAATATGAAAAACTCCAGATGGCTTCTATCACATCCCCCAGTCTTGTTGTGGA GTGTGGAGGAGAAAGGGTGGAATCGGTGGTGATCAAAAACCTTAAGAAGACAC CCAACTTTCCAAGTTCTGTTCTCTTCATGAAAGTGTTCTTGCCCAAGGAGGAATT GTACATGCCCCCACTGGTGATCAAGGTCATCGACCACAGGCAGTTTGGGCGGAA GCCTGTCGTCGGC In an embodiment, the modified myoferlin protein of the present invention does not comprise the C2A domain wherein the nucleotide sequence of the C2A domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 17. In an embodiment, the modified myoferlin protein of the present invention does not comprise the C2B domain wherein the nucleotide sequence of the C2B domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 22. In an embodiment, the modified myoferlin protein of the present invention does not comprise the C2C domain wherein the nucleotide sequence of the C2C domain is about 80%, 85%, 90%,95% or 100% identical to SEQ ID NO. 23. In an embodiment, the modified myoferlin protein of the present invention does not comprise the C2D domain wherein the nucleotide sequence of the C2D domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 24. In an embodiment, the modified myoferlin protein of the present invention does not comprise the C2E domain wherein the nucleotide sequence of the C2E domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 25. In an embodiment, the modified myoferlin protein of the present invention does not comprise the C2F domain wherein the nucleotide sequence of the C2F domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 14. In an embodiment, the modified myoferlin protein of the present invention does not comprise the C2G domain wherein the nucleotide sequence of the C2G domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 15. In an embodiment, the modified myoferlin protein of the present invention does not comprise the FerA domain wherein the nucleotide sequence of the FerA domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 18. In an embodiment, the modified myoferlin protein of the present invention does not comprise the FerB domain wherein the nucleotide sequence of the FerB domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 19. In an embodiment, the modified myoferlin protein of the present invention does not comprise the DysFN-1 domain wherein the nucleotide sequence of the DysFN-1 domain is about 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO. 20. In an embodiment, the modified myoferlin protein of the present invention does not comprise the DysFN-2 domain wherein the amino acid sequence of the DysFN-2 domain is about 80%, 85%, 90%, 95% or 100% identical to or similar to SEQ ID NO. 21. In an embodiment, any embodiment of the nanoparticle encapsulating any embodiment of the HIF1 activating polynucleotide of the present invention upregulates the expression of the HIF1 gene in a subject by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 150%, about 200%, about 250%, about 300%, about 350%, about 500%, about 750% or about 1000% compared to the level of the expression of the HIF1 gene in the subject prior to administration of the polynucleotide of the present invention to the subject. In an embodiment, any embodiment of the nanoparticle encapsulating any embodiment of the HIF1 activating polynucleotide of the present invention restores the expression of the HIF1 gene to at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% of the normal HIF1 gene expression level of the subject when healthy. In an embodiment, any embodiment of the nanoparticle encapsulating the polynucleotide of the present invention restores the expression of the HIF1 gene to at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% of normal HIF1 expression level of an average healthy human being. In an embodiment, any embodiment of the nanoparticle encapsulating any embodiment of the HIF1 activating polynucleotide of the present invention restores the expression of the HIF1 gene to at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% of normal HIF1 expression level of an average healthy human being having the same biometrics of the subject such as age, sex, height, weight etc... or a combination thereof. The present invention also provides a method of activating, upregulating or restoring HIF1 gene expression in a subject. In an embodiment, the method of activating, upregulating or restoring the HIF1 gene expression of the present invention comprises the step of administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising the one or more HIF1 activating polynucleotide of the present invention to the subject. In an embodiment, the method of activating, upregulating or restoring the H1F1 gene expression of the present invention comprises the step of regulating the expression of HIF1 antisense RNA in a subject by administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising the one or more HIF1 activating polynucleotide of the present invention to the subject. In an embodiment, the HIF1 antisense RNA comprises HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the HIF1 activating polynucleotide of the present invention upregulates the expression of HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the HIF1 activating polynucleotide of the present invention downregulates the expression of HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the method of activating, upregulating or restoring the HIF1 gene expression comprises the step of upregulating the expression of HIF1A-AS3 in a subject by administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising one or more HIF1 activating polynucleotide of the present invention to the subject. In an embodiment, the method of activating, upregulating or restoring the HIF1 gene expression comprises the step of downregulating the expression of HIF1A-AS1 in a subject by administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising one or more HIF1 activating polynucleotide of the present invention to the subject. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores HIF1 gene expression by regulation of HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the method of activating, upregulating or restoring the HIF1 gene expression comprises the step of regulating HIF1A-AS3 in a subject by administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising the one or more HIF1 activating polynucleotide of the present invention to the subject. In an embodiment, the method of activating, upregulating or restoring the HIF1 gene expression comprises the step of regulating HIF1A-AS1 in a subject by administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising one or more HIF1 activating polynucleotide of the present invention to the subject. In an embodiment, activating, upregulating or restoring HIF1 gene expression in a subject comprises increasing HIF1 spliced:unspliced transcript ratio in a subject by administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising the one or more HIF1 activating polynucleotide of the present invention to the subject. In an embodiment, the H1F1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by increasing the HIF1 splicedmnspliced transcript ratio. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by upregulating expression of spliced HIF1 transcripts. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by downregulating expression of unspliced HIF1 transcripts. In an embodiment, the HIF1 unspliced transcript comprises a longer intronic region than the HIF1 spliced transcript. In an embodiment, the HIF1 unspliced transcript comprises a longer intronic region than the HIF1 spliced transcript at a region between exon 1 and exon 2. In an embodiment, the subject is diagnosed with a HIF1-associated disease. In an embodiment, the HIF1-associated disease comprises traumatic brain injury, ischemic diseases such as myocardial infarction, stroke, or peripheral artery disease, cancers, anemia such as anemia of chronic renal disease, cardiovascular remodeling, preeclampsia, neurodegenerative diseases, or other angiogenesis-related diseases. In an embodiment, the subject comprises a cell, a tissue, or an organ of a mammal such as a human or a mouse. In an embodiment, the method of upregulating or restoring the HIF1 gene expression comprises the step of upregulating the expression of HIF1A-AS3. The present invention also provides a method of treatment of a HIF1-associated disease of a subject comprising a step of activating, upregulating or restoring HIF1 gene expression in a subject in a subject by administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising one or more HIF1 activating polynucleotide of the present invention to the subject. In an embodiment, the method of activating, upregulating or restoring HIF1 gene expression in a subject comprises the step of regulating the expression of HIF1 antisense RNA in a subject by administration to the subject of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising one or more HIF1 activating polynucleotide of the present invention. In an embodiment, the HIF1 antisense RNA comprises HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the HIF1 activating polynucleotide of the present invention upregulates the expression of HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the HIF1 activating polynucleotide of the present invention downregulates the expression of HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the H1F1 activating polynucleotide of the present invention upregulations or restores HIF1 gene expression by regulation of HIF1 A-AS 1, HIF1A-AS2, HIF1A-AS3, or a combination thereof. In an embodiment, the method of altering the HIF1 gene expression comprises regulating the expression of HIF1 splicedmnspliced transcript ratio comprising the administration of a therapeutically effective amount of any embodiment of the pharmaceutical composition comprising one or more HIF1 activating polynucleotide of the present invention. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by increasing the HIF1 splicedmnspliced transcript ratio. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by upregulating expression of spliced HIF1 transcripts. In an embodiment, the HIF1 activating polynucleotide of the present invention activates, upregulates or restores expression of HIF1 gene by downregulating expression of unspliced HIF1 transcripts. In an embodiment, the HIF1 unspliced transcript comprises a longer intronic region than the HIF1 spliced transcript. In an embodiment, the HIF1 unspliced transcript comprises a longer intronic region than the HIF1 spliced transcript at a region between exon 1 and exon 2. In an embodiment, the subject is diagnosed with a HIF1-associated disease. In an embodiment, the HIF1-associated disease comprises traumatic brain injury, ischemic diseases such as myocardial infarction, stroke, or peripheral artery disease, cancers, anemia such as anemia of chronic renal disease, cardiovascular remodeling, preeclampsia, neurodegenerative diseases, or other angiogenesis-related diseases. In an embodiment, the subject comprises a cell, a tissue, or an organ of a mammal such as a human or a mouse. In an embodiment, the method of treatment of a HIF1-associated disease comprises the step of administering a therapeutic effective amount of any embodiment of the pharmaceutical composition comprising one or more HIF1 activating polynucleotide of the present invention to a subject. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral, or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal, intramuscular injection, intrathecal, intraventricular, intracerebral, or intracerebroventricular administration. The route and site of administration may be chosen to enhance delivery or targeting of the disrupting agent comprising a site-specific targeting moiety to a particular location. The pharmaceutical compositions described herein may be administered in dosages sufficient to activate the expression of the target gene or the biological activity of nontranslated target sequences (e.g. regulatory sequences) in a cell, tissue or organism under treatment. The specific dosages of the HIF1 activating polynucleotide described herein administered to a given subject will depend on factors such as the route of administration and physical characteristics of the subject (including health status) and so forth. For example, the appropriate dosage of a given pharmaceutical composition comprising the HIF1 activating polynucleotide described herein may depend on a variety of factors including, but not limited to, a subject’s physical characteristics (e.g. age, weight, sex), the progression (i.e. pathological state) of a given coronavirus infection, and other factors that will be readily recognised by one skilled in the art. Various general considerations that may be considered when determining an appropriate dosage are described, for example, in Gennaro et al. (Eds), (1990), “Remington's Pharmaceutical Sciences”, Mack Publishing Co., Easton, Pennsylvania, USA; and Gilman et al. (Eds), (1990), “Goodman And Gilman’s: The Pharmacological Bases of Therapeutics”, Pergamon Press. Non-limiting examples of suitable dosages of the inhibitory nucleic acids described herein include those in the range of about 0.001 to 50 milligrams per kilogram body weight of the recipient per day such as about 0.001, 0.002, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.5, 1.0, 2.0, 5.0, 10.0, 05.0, 20.0, 25.0, 30.0, 35.0, 40.0, 45.0 or 50.0 milligrams per kilogram bodyweight of the recipient per day including any mg / kg body weight or mg / kg body weight ranges falling within these values. Those of ordinary skill in the art will be able, by routine experimentation, to determine an effective, non-toxic amount of the pharmaceutical compositions and / or HIF1 activating polynucleotides described herein to include in a dosage or in a series of dosages to achieve the desired therapeutic outcome. Typically, in therapeutic applications, the treatment would be for the duration of the infection, disease state or condition. Further, it will be apparent to one of ordinary skill in the art that the optimal quantity and spacing of individual dosages will be determined by the nature and extent of the infection, disease state or condition being treated, the form, route and site of administration, and the nature of the particular individual being treated. Such optimum conditions can also be determined using conventional techniques. In many instances, it will be desirable to have several or multiple administrations of a pharmaceutical composition described herein. For example, they may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times. The administrations may be from about one to about twelve week intervals, and in certain embodiments from about one to about four week intervals. Periodic re-administration may be desirable in the case of recurrent exposure to a particular pathogen targeted by a pharmaceutical composition described herein. It will also be apparent to one of ordinary skill in the art that the optimal course of treatment can be ascertained using conventional course of treatment determination tests. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. In general, the terms used in the disclosure should not be construed to limit the technology to the specific embodiments disclosed in the specification, unless the above detailed description explicitly defines such terms. Accordingly, the actual scope of the technology encompasses the disclosed embodiments and all equivalent ways of practicing or implementing the technology. EXAMPLES Example 1: siRNAs meditated the transcriptional activation of HIF1 Materials and Experimental Methods Cell culture Human embryonic kidney 293T (HEK-293T) cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% Fetal Bovine Serum and 1% L-Glutamine and grown in a humidified incubator at 37°C with 5% CO2. Cells were cultured into T25 flasks from frozen cell pellets and expanded into T75 flasks. Cell cultures were normally passaged to keep healthy growth after reaching 80-90% confluency. siRNAs and oligos reconstitution for stock solution According to Invitrogen protocol, resuspended the siRNA in RNA-free water at a final concentration of lOpM (LOOOpL for lOnmol siRNA). Stored at -20°C until use. Oligos (Primers) were reconstituted in lx TE buffer as recommended by Sigma-Aldrich by taking the number of nanomoles (nm) provided and multiply the number of nanomoles by ten. Working solution was then diluted by 1 / 10. Stored all siRNAs and oligos at -20°C until use. siRNAs transfection The HEK-293T cell were seeded in 12-well plates with the density of 1.5 x 105 cells per well in 1mL of complete growth media. Allowed cells to adhere and grow for 24 hours before transfection once 50-80% confluency was reached. Each siRNA was prepared in triplicate for transfection by diluting 1 pL of a control (miN-367) or tested-nonsilencing siRNA (lOpM) into lOOpL of Opti-MEM reduced serum media. Also, 2pL of lipofectamine™ 2000 was diluted into lOOpL of Opti-MEM reduced serum media and incubated at room temperature for 5 minutes. Diluted siRNA and lipofectamine™ 2000 were then mixed and left for 25 minutes at room temperature to form the complexes. Remove growth medium from cells and replaced with 1mL of complete growth medium. The complexes were added drop wise to each well of the seeded 12-well plate and mixed gently by rocking the plate back and forth. Cells were left to grow for 72 hours before collection. (The information of each pair of siRNAs is shown in Table 1.) The siRNAs highlighted in yellow were found to functionally activate HIF1 expression following transfection into liver cell lines (Table 1). Table 1_______________________________________________________________ siRNAs in the experiment___________________________________________ Human siRNAs Control (miRN367) Sense CUUUCCGCUGGGGACUUUCU Antisense AGAAAGUCCCCAGCGGAAAG HIFlasPl Sense UCGCCGGGGGAGAAGGCGGCG Antisense CGCCGCCUUCUCCCCCGGCGA HIFlasP2 Sense GACAGCGGGGGAGCCCGGCCG Antisense CGGCCGGGCUCCCCCGCUGUC HlFlasP3 Sense CGGGCCGAGGGAAUGGGCUUA Antisense UAAGCCCAUUCCCUCGGCCCG HIFlasP4 Sense AGCAGCAGAAACAAAAAGGCU Antisense AGCCUUUUUGUUUCUGCUGCU HIFlasP5 Sense CGGCCCAGGAGCCCAGGGCGG Antisense CCGCCCUGGGCUCCUGGGCCG HIFlasP6 Sense UCUUCCAAGAAGGAAAUCAGA Antisense UCUGAUUUCCUUCUUGGAAGA HIFlasP7 Sense GAUGGUGGAGGAAAAAAAGGA Antisense UCCUUUUUUUCCUCCACCAUC Mouse siRNAs HIFlasP8 Sense AUAAGCAGAAGAGUAAAAUAA Antisense UUAUUUUACUCUUCUGCUUAU HIFlasP9 Sense UCUACAAAGAAAAAGCUUCAU Antisense AUGAAGCUUUUUCUUUGUAGA HIFlasPIO Sense CGUCUUGGAAAAACUAUCCAC Antisense GUGGAUAGUUUUUCCAAGACG HIFlasPll Sense CCAUCUAAAAAACAAAGUUUG RNA isolation and Reverse Transcription The transfected cells were collected after lysis buffer treatment then centrifuged at 300 x g for 5 minutes. The RNA of the cells was harvested using the Qiagen RNeasy Mini Kit. The 5 RNA from transfected cells was checked the purity by using Nanodrop and then reverse transcribed into cDNA using the LunaScript® RT SuperMix Kit and associated protocol. qRT-PCR The Promega GoTaq qPCR Sybr green was used for master mix preparation. For one sample, this required 7pL of Sybr green master mix with 1.4pL of each forward and reverse 10 primer, 3.08pL of RNase free water and 0.5p L of cDNA (<100ng / rxn). The cycling conditions for the synthesis of qRT-PCR were initial denaturation at 95°c for 10 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 30 seconds (40 cycles), and a final extension step at 72°C for 10 minutes. These were run using both the Qaigen Rotor-gene PCR cycler. Housekeeping beta actin mRNA was used as internal control for comparison of relative RNA expression. Relative gene expression was evaluated by using 2( A ACT) method. (The information of primers is shown in Table 2.) Table 2 qRT-PCR in the experiment________ Human HIF1 a Oligos (Letter notation) (A)HIFIF sense (B) HIF1R antisense (C) HIFlasF sense (D) HIF1 asR antisense (E) HIFlas3.1F sense (F) HIFlas3.1R antisense (G) HIFlas3.2F sense (H) HIFlas3.2R antisense (I) HIFlas3.3F sense (J) HIFlas3.3R antisense (K) HIF 1_ Variant l_SplicedFl sense (L) HIFl_Variantl_SplicedRl antisense (M) HIFl_Variantl_UnsplicedFl sense (N) HIFl_Variantl_UnsplicedRl antisense H1Fl_Variant2_UnsplicedR2 antisense HIFl_Variant2_UnsplicedF3 sense HIF1 _Variant2_UnsplicedR3 antisense HIFlas3.1F sense CTCACCAAACAGAGCAGGAA TGACTCAAAGCGACAGATAACA TCTTCGGTACTTTACGCACCC TTTTCCTCTGCGTTCTGGAGC TGAAGGTTCTCAAACGTCAGT CTTGGCAAGCATTCTGTGTTT TCCGCATGCTTGGTATTCTC CCTTGTCTTGGCTCCATTCT GATGGTAAGCCTCATCACAGAG CAGATCTCGGCGAAGTAAAGAA GGCGCGAACGACAAGAA GTGGAAGTGGCAACTGATGA CTTCTCTTCTCCGCGTGTG CGAGGGAATGGGCTTACTTT GAGCAGCAGCAGAAACAA CCCAATGTCGGAGTTTGGAA GTCCTGCGTTAAATCTACAGTATCA TGAAGGTTCTCAAACGTCAGT HIFlas3.1R antisense HIFlas3.3F sense HIFlas3.3R antisense HIFlas3.4F sense HIFlas3.4R antisense Mouse HIFla Oligos MuHIF_Fl sense MuHIF_Rl antisense MuHlF_F2 sense MuHIF_R2 antisense CTTGGCAAGCATTCTGTGTTT GATGGTAAGCCTCATCACAGAG CAGATCTCGGCGAAGTAAAGAA AGAGGCTCAACACCAA ACTTGTAAGAAGAATGTGCT CACCCATTTCTAC CGGTAACAGTTTGCCCAGA TCTGGAAGGTATGTGGCATTTAT CACAACTACAGAGGGACTGTTT MuHIF_F3 sense MuHIF_R3 antisense MuHIF_F4 sense MuHIF_R4 antisense GmFl sense GmRl antisense GmF2 sense GmR2 antisense GmFl_shrt sense GmR2_shrt antisense GmFl_mid sense GmR2_mid antisense Beta Actin F sense Beta Actin R antisense TGAGGCTCACCATCAGTTATTT CAGTCCATCTGTGCCTTCAT CTGAGACAGGAGGAGGGTAAT TGCAGTACCACAGCAAGAAG AGGTGTTCAGAGTTCAATGGG ACATTCCCACGTAGTGTCTTG TCTCAGCTACACTATGCTTTCTTT ACATCTACTAGACAGCAGGTACT CATGTCTATGGGAGTGTGTCAG ACTAGTTTCAAGCCAGGTAAGG CACCATCTGCTTATCTGGATGT AGCCTCCTGGTGGTATTAGT ACAGCCTGGATAGCAACG CACCAACTGGGACGACAT Results Effect of siRNAs targeting HIF1 antisense IncRNAs on HIF1 gene expression To clearly determine regarding the role and function of HIF1 and those IncRNAs found in association with HIF1, we screened several siRNAs (Figure 1) targeted to the various antisense IncRNAs (Figure 1) HIF1 has several splice variants (Figure 2) and therefore we developed several primer sets (Table 2) to interrogate the effects of siRNA targeting the various HIF1 antisense IncRNAs (Table 1). The siRNA constructs were designed to specifically target and silence particular antisense IncRNA loci (Figure 1 and Figure 2). Previous studies have observed that siRNA targeting of gene regulatory IncRNAs can result in de-repression of gene expression and transcriptional activation2,3. We hypothesized that siRNA targeting of the various HIF1 associated antisense RNAs, e.g. HIF1A-AS1, HIF1A-AS3, could result in a means to activate HIF1 expression as a means to treating stroke and TBI. To test this hypothesis, we carried out an initial screen in HEK293 cells and determined that several siRNAs targeted to various IncRNAs result in activation of HIF1 expression (Figure 3). From these data it became apparent that HIFasP5 is the dominant HIF1 activating siRNAs. To confirm this a transient transfection of HEK293 cells was carried out and HIF1 expression determined. Notably, HIFasP5 activation was observed for HIF1 but there didn’t appear to be any appreciable changes in the HIF1-AS1 expression (primer set C+D, Figure 4). These data suggest that perhaps the siRNA targeting of HIF1A-AS3 variant 1 (HIFasP6 and HIFasPl1) and siRNA targeting of HIF1A-AS3 variant 2 by HIFasP15 might be functional gene enhancers and that adding these antisense IncRNAs to cells may enhance HIF1 expression. Next we interrogated spliced vs. unspliced changes in HIF1 expression and observed that HIFasP2 resulted in significant changes in HIF1 spliced gene expression, suggesting that HIFasP2, like HIFasP5 is a viable activator of HIF1 expression (Figure 5). Collectively the studies in Figures 1-5 suggest that HIFasP2 and HIFasP5 are HIF1 activating siRNAs (Table 3, Figure 6) by targeting HTF1-ASI(Table 1). The exact mechanism of action remains unknown, as there was no observed repression of the targeted HIF1-AS1 transcript (Table 4). To determine if HIFasP2 and HIFasP5 are viable HIF1 activators when delivered to cells by the action of exosomes, we developed stable HIFasP2 and HIFasP5 dual expressing HEK stable cell lines and assessed to what extent these cells can generate exosomes which can deliver the HIF1 activating phenotype observed in transient siRNA transfections (Figure 3). Table 3 Top candidate shRNAs packaged into HEK293 EVs. siRNA Sense 5’->3’ Antisense 5-’>3’ siHIFl.P5 CGGCCCAGGAGCCCAGGGCGG CCGCCCTGGGCTCCTGGGCCG siHIFl.P2 GACAGCGGGGGAGCCCGGCCG CGGCCGGGCTCCCCCGCTGTC Table 4 HIF1-AS1, ENST00000557544.2, length=1039. AGGCGGGCGGGGTCGCCGGGGGAGAAGGCGGCGGGCCGAGGGAATGGGCTTACTTTTTC TTGTCGTTCGCGCCGCCGGCGCCCTCCATGGTGAATCGGTCCCCGCGATGTCTTCACGGC GGGCGGCCCCCAGGCTCGCTCCGGCCTAAGCGCTGGCTCCCTCCACACGCGGAGAAGAG AAGGAAAGACTACAGTTCAACTGTCAATTGGTTGATCACCCGGATTTTATCTACACCTTA GCCTATGGTTGTTCATCTCGTCTCTGCCTATGGCCCATTGACTCCCGGATCCCAGCTCCAT TCTTCGGTACTTTACGCACCCTGCTTCCAGTACCCCAACCAGAAGAATATATATAGCAGT TAACTGTCAGCTGGCGAAAAGGAGGAAAATTCAGGAAGATAAAATAGCTGAATGAATTA TCCCCGCTCCAGAACGCAGAGGAAAAATGAAATGGCCAGACCCAGATGTTAAAAATGTG TTCCTTGCTCTTTCCTGCCCTAGCAAGGGCTGTTCCATGTTTAGGGGATGAATGCCGCTGA GAGTATTAGCAAAAATACATGTGTCATTGAGTCTGAGGAAGATAACTGAGACATACAGG TAT TTCTCATAATGCATGTGGGCATCCATAGACATATTCTTAAATGGCTTAAGGACTTGGAAA CTACCTCTAGGAAACCTGAAACTTGAATGTTGGTCCACTAGGGAGAAGAAATGTTCCATT AGCCTTCCAACTAAAGAAATACACTATCAAGAAGAACATTAGCTGTGTGTCCTATAAGCT TGGGAGAATAACTTACTTTTATTTTAATACATATGTTACTTTTATGGTCAGTATTTTGGTA AAATATATGCTCTATTATGGCAGTAATTTGTCTGTCTTATTAAATGCTATATCTGCAGTAC CTTCTGTGCATAACACAGCAAAGGAGCTCAATAAATATCATTTTGTTGCTGCCCTAAAAA GAGTTCCAGGAGCACTGGTGTGTAGAAGCTCTGGAAATAAGGAATGGTGTGAATAAATA AATAGCTTACTTGGAAGC To determine the ability of HEK293 cells to package and deliver HIF1 activating shRNAs (HIFasP2 and HIFasP5) to recipient cells we carried out a transwell validation experiment using our proprietary exosome shRNA packaging system, described in or provisional patent application entitled (Low Immunogenic Exosome-Based RNA Package and Delivery System, Composition and Method of Preparation Thereof). This experiment requires a transwell plate and HEK293 cells. First, we generated shRNA expressing plasmids based on the top candidate siRNAs, e.g. HIFasP2 and HIFasP5 and then co-cutlured these stable cell lines with naive recipient HEK293 cell lines. In this experiment we observed that stable HIFasP2 and HIFasP5 dual shRNA exosome producing cell lines were able to deliver potent activation of HIF1 in transwell assays (Figure 7). These data suggest that HIFasP2 and HIFasP5 si / shRNAs can serve as potent activators of HIF1 and can be delivered by the action of exosomes, which are also known to readily permeate the blood brain barrier. Collectively, we describe here 2 highly specific HIF1 activating siRNAs (Table 3) and a stable cell line derived to produce HIFasP2 and HIFasP5 dual shRNA exosomes that can be used in an exosome manufacturing platform to produce brain directed shEVs that can activate HIF1 expression as a means to treat stroke and / or TBI. It can be appreciated by those skilled in the art that changes could be made to the examples described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular examples disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims. References which are each hereby incorporated in their entireties. 1. Shi H. Hypoxia inducible factor 1 as a therapeutic taget in ischmic stroke. Curr Med Chern. 2009; 16(34):4593-600. Doi: 10.2174 / 092986709789760779. PubMed PMID: 19903149; PMCID: PMC2819104. 2. Morris KV, Santos S, Turner AM, Pastori C, Hawkins PG. Bidirectional transcription directs both transcriptional gene activation and suppression in human cells. PLoS Genet. 208;4(ll):el000258. Epub 20081114. Doi: 10.1371 / joumal.pgen. 1000258. PubMed PMID: 19008947; PMCID: PMC2576438. 3. Morris KV. RNA-directed transcriptional gene silencing and activation in human cells. Oligonucleotides. 2009; 19(4):299-306. Doi: 10.1089 / oli.2009.0212. PubMed PMID: 19943804; PMCID: PMC2861411.

Claims

1. A pharmaceutical composition comprising hypoxia-inducible factor 1 (HIF1) activating polynucleotide capable of activating HIF1 expression, wherein the HIF1 activating polynucleotide comprises a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a ribozyme, a deoxyribozyme, an aptamer, or a combination thereof.

2. The pharmaceutical composition of claim 1, wherein the HIF1 activating polynucleotide targets HIF1 antisense RNA, wherein the HIF1 antisense RNA comprises HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or an isoform thereof.

3. The pharmaceutical composition of claim 1, wherein the HIF1 antisense RNA comprises a HIF1 antisense RNA exon, a HIF1 antisense RNA intron, a HIF1 antisense RNA regulator element, or a combination thereof, wherein the regulatory element comprises a promoter, a transcriptional repressor, or a combination thereof.

4. The pharmaceutical composition of claim 1, wherein the nucleotide sequence of the siRNAs is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 5, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 1, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, or SEQ ID NO. 11.

5. The pharmaceutical composition of claim 1, wherein the shRNA comprises a first nucleotide sequence and a second nucleotide sequence wherein the second nucleotide sequence is complementary to the first nucleotide sequence and wherein the nucleotide sequence of the first nucleotide sequence is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 2, SEQ ID NO. 5, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 1, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, or SEQ ID NO. 11.

6. The pharmaceutical composition of claim 5, wherein the shRNA further comprises a loop that connects the first nucleotide sequence and the second nucleotide sequence, wherein nucleotide sequence of the loop is about 80%, about 85%, about 90%, about 95% or about 100% identical to SEQ ID NO. 26, SEQ ID NO. 27 or SEQ ID NO. 28.

7. The pharmaceutical composition of claim 1 wherein the HIF1 activating polynucleotide increases HIF1 spliced:unspliced transcript ratio.

8. The polynucleotide of claims 1, wherein the HIF1 activating polynucleotide is double stranded or single stranded, wherein the HIF1 activating polynucleotide is blunt endedor comprise overhanging ends and wherein the HIF 1 activating polynucleotide is chemically synthesized or recombinantly produced.

9. The pharmaceutical composition of claim 1 further comprising a nanoparticle wherein the nanoparticle encapsulates the HIF1 activating polynucleotide, wherein the nanoparticle comprises chemical nanoparticle, biological nanoparticle, or a combination thereof, wherein the chemical nanoparticle comprises lipid nanoparticle, polymer nanoparticle, lipid-polymer hybrid nanoparticle and wherein the biological nanoparticles comprises liposome, exosome, virus or vims-like particle.

10. The pharmaceutical composition of claim 9, wherein the nanoparticle comprises exosome prepared from an exosome-based packaging and delivery system wherein the exosome-based packaging and delivery system comprises an exosome producing cell, a cargo RNA, and a fusion protein plasmid, wherein the cargo RNA comprises the HIF1 activating polynucleotide, wherein the fusion protein plasmid encodes a fusion protein, wherein the exosome producing cell is capable of expressing the fusion protein based on the fusion protein plasmid and wherein the fusion protein comprises an exosome associated transmembrane protein fused to a packaging protein.

11. The pharmaceutical composition of claim 10, wherein the packaging protein is of human origin.

12. The pharmaceutical composition of claim 10, wherein the packaging protein comprises CD9, CD37, CD53, CD63, CD68, CD81, CD82, LAMP-1, LAMP-2A, LAMP-2B, LAMP-2C, lactadherin, or PTGFRN.

13. The pharmaceutical composition of claim 10 further comprising an Ago2 plasmid encoding an Ago2 protein wherein the exosome producing cell is capable of expressing the Ago2 protein based on the Ago2 plasmid and wherein the Ago2 protein is capable of complexing with the cargo RNA.

14. The pharmaceutical composition of claim 13, wherein the Ago2 plasmid comprises S387A mutation.

15. The pharmaceutical composition of claim 10 further comprising a modified myoferlin protein capable of enhancing nanoparticle payload release.

16. The pharmaceutical composition of claim 15, wherein the modified myoferlin protein comprises C2F, C2G and transmembrane domain.

17. The pharmaceutical composition of claim 15, wherein the modified myoferlin protein comprises C2A, Fer A, FerB, DysFN and transmembrane domain.

18. A method of treatment of a subject suffering from a HIF1-associated diseasecomprising the step of administering a therapeutically effective amount of the pharmaceutical composition of claim 1 to the subject to activate HIF1 gene expression in the subject.

19. The method of claim 18, wherein the pharmaceutical composition of claim 1 activates the HIF1 gene expression in the subject by regulating HIF1 antisense RNA, wherein the HIF1 antisense RNA comprises HIF1A-AS1, HIF1A-AS2, HIF1A-AS3, or an isoform thereof.

20. The method of claim 19, wherein the H1F1 antisense RNA comprises a HIF1 antisense RNA exon, a HIF1 antisense RNA intron, a HIF1 antisense RNA regulator element, or a combination thereof, wherein the regulatory element comprises a promoter, a transcriptional repressor, or a combination thereof.

21. The method of claim 18, wherein the step of administration of the pharmaceutical composition of claim 1 to the subject increases HIF1 splicedmnspliced transcript ratio in the subject.

22. The method of claim 18, wherein the subject is diagnosed with a HIF1-associated disease, wherein the H1F1-associated disease comprises traumatic brain injury, ischemic diseases such as myocardial infarction, stroke, or peripheral artery disease, cancers, anemia such as anemia of chronic renal disease, cardiovascular remodeling, preeclampsia, neurodegenerative diseases, or other angiogenesis-related diseases.

23. The method of claim 18, wherein the administration step is performed by topical, oral, or parenteral administration wherein the topical administration comprises ophthalmic, vaginal, rectal, intranasal or transdermal administration and wherein the parenteral administration   comprises   intravenous   drip, subcutaneous, intraperitoneal,intramuscular    injection,    intrathecal,    intraventricular, intracerebral, orintracerebroventricular administration.

Images