Oligonucleotide compositions and methods of use thereof

Chirally controlled DMD oligonucleotides with specific chemical modifications address the limitations of existing oligonucleotides by enhancing exon skipping and reducing toxicity, achieving efficient production of functional dystrophin proteins for muscular dystrophy treatment.

AU2026204897A1Pending Publication Date: 2026-07-16WAVE LIFE SCI LTD

Patent Information

Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
WAVE LIFE SCI LTD
Filing Date
2026-06-24
Publication Date
2026-07-16

AI Technical Summary

Technical Problem

Existing oligonucleotides for therapeutic applications, such as those targeting muscular dystrophy, face challenges with instability, poor cell penetration, and distribution due to their susceptibility to nucleases and limited splicing efficiency, which affects their efficacy in modulating exon skipping and protein production.

Method used

Development of chirally controlled DMD oligonucleotides with specific chemical modifications and stereochemistry, including non-negatively charged internucleotidic linkages like cyclic guanidine moieties, to enhance splicing efficiency and reduce toxicity, thereby increasing the skipping of exons 51 or 53 and promoting the production of functional dystrophin protein variants.

Benefits of technology

The chirally controlled DMD oligonucleotides demonstrate significantly enhanced exon skipping, up to 100-fold improvement compared to reference conditions, with reduced toxicity and immune response, facilitating the production of internally truncated but functional dystrophin proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000134_0000
    Figure 00000134_0000
Patent Text Reader

Abstract

20 26 20 48 97 24 J un 2 02 6 A B S T R A C T 2 0 2 6 2 0 4 8 9 7 2 4 J u n 2 0 2 6
Need to check novelty before this filing date? Find Prior Art

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional application of Australian application no. 2019265904, the entire disclosure of which is incorporated herein by reference. This application claims priority to United States Provisional Application Nos. 62 / 670,709, filed May 11, 2018, 62 / 715,684, filed August 07, 2018, 62 / 723,375, filed August 27, 2018, 62 / 776,432, filed December 06, 2018, and PCT Application No. PCT / US19 / 27109, filed April 11, 2019, the entirety of each of which is incorporated herein by reference. BACKGROUND

[0002] Oligonucleotides are useful in therapeutic, diagnostic, research and nanomaterials applications. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) for therapeutics can be limited, for example, because of their instability against extra- and intracellular nucleases and / or their poor cell penetration and distribution. There is a need for new and improved DMD oligonucleotides and DMD oligonucleotide compositions, such as, e.g., new DMD oligonucleotides and DMD oligonucleotide compositions capable of modulating skipping of Dystrophin exon 51 or exon 53 for treatment of muscular dystrophy. SUMMARY

[0003] Among other things, the present disclosure encompasses the recognition that structural elements of DMD oligonucleotides, such as base sequence, chemical modifications (e.g., modifications of sugar, base, and / or internucleotidic linkages, and patterns thereof), and / or stereochemistry (e.g., stereochemistry of backbone chiral centers (chiral internucleotidic linkages), and / or patterns thereof), can have a significant impact on DMD oligonucleotide properties, e.g., skipping of exon 51 or 53, toxicities, stability, protein binding characteristics, etc.

[0004] In some embodiments, the present disclosure provides a DMD oligonucleotide or a DMD oligonucleotide composition capable of mediating skipping of DMD exon 51 or exon 53. In some embodiments, a DMD oligonucleotide or a DMD oligonucleotide composition is useful for treatment of muscular dystrophy. In some embodiments, a DMD oligonucleotide or DMD oligonucleotide composition is a DMD oligonucleotide or DMD oligonucleotide composition disclosed herein (including but not limited to, in Table A1).

[0005] In some embodiments, as demonstrated by example data described herein, provided technologies are particularly useful for reducing levels of a mutant mRNA (e.g., a DMD transcript comprising a deleterious mutation) and / or proteins encoded thereby, and increasing levels of repaired mRNA (e.g., a DMD transcript in which exon 51 or exon 53 is skipped to delete, correct or 2026204897   24 Jun 2026 compensate for a deleterious mutation) and / or proteins encoded thereby.

[0006] In some embodiments, provided technologies are particularly useful for modulating splicing of DMD transcripts, e.g., to increase levels of desired splicing products and / or to reduce levels of undesired splicing products. In some embodiments, provided technologies are particularly useful for reducing levels of DMD transcripts, e.g., pre-mRNA, RNA, etc., and in many instances, reducing levels of products arising from or encoded by such DMD transcripts such as mRNA, proteins, etc. In some embodiments, a pre-mRNA or mRNA or RNA is transported from one cellular compartment (e.g., nucleus, cytoplasm, etc.) to another, and / or has been modified by one or more enzyme.

[0007] For example, in some embodiments, a Dystrophin gene can comprise an exon comprising one or more mutations associated with muscular dystrophy (including but not limited to Duchenne (Duchenne’s) muscular dystrophy (DMD) and Becker (Becker’s) muscular dystrophy (BMD)). In some embodiments, a disease-associated exon comprises a mutation (e.g., a missense mutation, a frameshift mutation, a nonsense mutation, a premature stop codon, etc.) in an exon. In some embodiments, the present disclosure provides compositions and methods for effectively skipping a disease-associated Dystrophin exon, while maintaining or restoring the reading frame so that a shorter (e.g., internally truncated) but partially functional dystrophin (e.g., a variant) can be produced.

[0008] Among other things, the present disclosure demonstrates that chemical modifications and / or stereochemistry can be used to modulate DMD transcript splicing by DMD oligonucleotide compositions. In some embodiments, the present disclosure provides combinations of chemical modifications and stereochemistry to improve properties of DMD oligonucleotides, e.g., their capabilities to alter splicing of DMD transcripts. In some embodiments, the present disclosure provides chirally controlled DMD oligonucleotide compositions that, when compared to a reference condition (e.g., absence of the composition, presence of a reference composition (e.g., a stereorandom composition of DMD oligonucleotides having the same constitution (as understood by those skilled in the art, unless otherwise indicated constitution generally refers to the description of the identity and connectivity (and corresponding bond multiplicities) of the atoms in a molecular entity but omitting any distinction arising from their spatial arrangement), a different chirally controlled DMD oligonucleotide composition, etc.), combinations thereof, etc.), provide increased skipping of DMD exon 51 or DMD exon 53 to produce a modified (e.g., repaired) mRNA, which can be translated to produce an internally truncated but at least partially functional Dystrophin protein variant.

[0009] In some embodiments, compared to a reference condition, provided chirally controlled DMD oligonucleotide compositions are surprisingly effective. In some embodiments, splicing of DMD exon 51 or 53 can be enhanced by more than 5, 10, 15, 20, 25, 30, 40, 50, or 100 fold. 2026204897   24 Jun 2026

[0010] The present disclosure recognizes challenges of providing low toxicity DMD oligonucleotide compositions and methods of use thereof. In some embodiments, the present disclosure provides DMD oligonucleotide compositions and methods with reduced toxicity. In some embodiments, the present disclosure provides DMD oligonucleotide compositions and methods with reduced induction of immune responses.

[0011] In some embodiments, the present disclosure provides DMD oligonucleotides with enhanced antagonism of hTLR9 activity. In some embodiments, muscular dystrophy is associated with inflammation in, e.g., muscle tissues. In some embodiments, provided technologies (e.g., DMD oligonucleotides, compositions, methods, etc.) provides both enhanced activities (e.g., exon-skipping activities) and hTLR9 antagonist activities which can be beneficial to one or more conditions and / or diseases associated with inflammation. In some embodiments, provided DMD oligonucleotides and / or compositions thereof provides both exon-skipping capabilities and decreased levels of toxicity and / or inflammation.

[0012] In some embodiments, a DMD oligonucleotide comprises multiple internucleotidic linkages, each independently selected from various types. Various types of internucleotidic linkages differ in properties. Without wishing to be bound by any theory, the present disclosure notes that a natural phosphate linkage (phosphodiester internucleotidic linkage) is anionic and may be unstable when used by itself without other chemical modifications in vivo; a phosphorothioate internucleotidic linkage is anionic, generally more stable in vivo than a natural phosphate linkage, and generally more hydrophobic; a neutral internucleotidic linkage such as one exemplified in the present disclosure comprising a cyclic guanidine moiety is neutral at physiological pH, can be more stable in vivo than a natural phosphate linkage, and more hydrophobic.

[0013] In some embodiments, a DMD oligonucleotide comprises a modified internucleotidic linkage which is a non-negatively charged (neutral or cationic) internucleotidic linkage in that at a pH [e.g., human physiological pH (~ 7.4), pH of a delivery site (e.g., an organelle, cell, tissue, organ, organism, etc.), etc.]. Without wishing to be bound by any particular theory, in at least some cases, a neutral internucleotidic linkage in a DMD oligonucleotide can provide improved properties and / or skipping of exon 51 or 53, e.g., improved delivery, improved resistance to exonucleases and endonucleases, improved cellular uptake, improved endosomal escape and / or improved nuclear uptake, etc., compared to a comparable nucleic acid which does not comprises a neutral internucleotidic linkage.

[0014] In some embodiments, a non-negatively charged internucleotidic linkage comprises a cyclic guanidine moiety. In some embodiments, non-negatively charged internucleotidic linkage has the structure of: (n001) or a stereoisomer thereof (e.g., n001R or n001S). In some 2026204897   24 Jun 2026 embodiments, a neutral internucleotidic linkage comprising a cyclic guanidine moiety is chirally controlled. In some embodiments, the present disclosure pertains to a composition comprising a DMD oligonucleotide comprising at least one neutral internucleotidic linkage and at least one phosphorothioate internucleotidic linkage.

[0015] Among other things, the present disclosure encompasses the recognition that stereorandom DMD oligonucleotide preparations contain a plurality of distinct chemical entities that differ from one another, e.g., in the stereochemical structure of individual backbone chiral centers within the DMD oligonucleotide chain. Without control of stereochemistry of backbone chiral centers, stereorandom DMD oligonucleotide preparations provide uncontrolled (or stereorandom) compositions comprising undetermined levels of DMD oligonucleotide stereoisomers. Even though these stereoisomers may have the same base sequence and / or chemical modifications, they are different chemical entities at least due to their different backbone stereochemistry, and they can have, as demonstrated herein, different properties, e.g., skipping of exon 51 or 53, toxicities, distribution etc. Among other things, the present disclosure provides chirally controlled compositions that are or contain particular stereoisomers of DMD oligonucleotides of interest; in contrast to chirally uncontrolled compositions, chirally controlled compositions comprise controlled levels of particular stereoisomers of DMD oligonucleotides. In some embodiments, a particular stereoisomer may be defined, for example, by its base sequence, its pattern of backbone linkages, its pattern of backbone chiral centers, and pattern of backbone phosphorus modifications, etc. As is understood in the art, in some embodiments, base sequence may refer solely to the sequence of bases and / or to the identity and / or modification status of nucleoside residues (e.g., of sugar and / or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil) in a DMD oligonucleotide and / or to the hybridization character (i.e., the ability to hybridize with particular complementary residues) of such residues. In some embodiments, the present disclosure demonstrates that property improvements (e.g., improved skipping of exon 51 or 53, lower toxicities, etc.) achieved through inclusion and / or location of particular chiral structures within a DMD oligonucleotide can be comparable to, or even better than those achieved through use of chemical modifications, e.g., particular backbone linkages, residue modifications, etc. (e.g., through use of certain types of modified phosphates [e.g., phosphorothioate, substituted phosphorothioate, etc.], sugar modifications [e.g., 2’- modifications, etc.], and / or base modifications [e.g., methylation, etc.]). In some embodiments, the present disclosure demonstrates that chirally controlled DMD oligonucleotide compositions of DMD oligonucleotides comprising certain chemical modifications (e.g., 2’-F, 2’-OMe, phosphorothioate internucleotidic linkages, etc.) demonstrate unexpectedly high exon-skipping efficiency.

[0016] In some embodiments, the present disclosure provides a DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides which: 1) have a common base sequence complementary to a target sequence in a DMD transcript; 2026204897   24 Jun 2026 and 2) comprise one or more modified sugar moieties and modified internucleotidic linkages, wherein the DMD oligonucleotide is a DMD oligonucleotide described herein (e.g., in Table A1).

[0017] In some embodiments, a provided DMD oligonucleotide composition is characterized in that, when it is contacted with a DMD transcript in a DMD transcript splicing system, splicing of the DMD transcript is altered (e.g., skipping of exon 51 or 53 is increased) relative to that observed under a reference condition selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof.

[0018] In some embodiments, a reference condition is absence of the composition. In some embodiments, a reference condition is presence of a reference composition. Example reference compositions comprising a reference plurality of DMD oligonucleotides are extensively described in this disclosure. In some embodiments, DMD oligonucleotides of the reference plurality have a different structural elements (chemical modifications, stereochemistry, etc.) compared with DMD oligonucleotides of the plurality in a provided composition. In some embodiments, a reference composition is a stereorandom preparation of DMD oligonucleotides having the same chemical modifications. In some embodiments, a reference composition is a mixture of stereoisomers while a provided composition is a chirally controlled DMD oligonucleotide composition of one stereoisomer. In some embodiments, DMD oligonucleotides of the reference plurality have the same base sequence, same sugar modifications, same base modifications, same internucleotidic linkage modifications, and / or same stereochemistry as DMD oligonucleotide of the plurality in a provided composition but different chemical modifications, e.g., base modification, sugar modification, internucleotidic linkage modifications, etc.

[0019] Example splicing systems are widely known in the art. In some embodiments, a splicing system is an in vivo or in vitro system including components sufficient to achieve splicing of a relevant target DMD transcript. In some embodiments, a splicing system is or comprises a spliceosome (e.g., protein and / or RNA components thereof). In some embodiments, a splicing system is or comprises an organellar membrane (e.g., a nuclear membrane) and / or an organelle (e.g., a nucleus). In some embodiments, a splicing system is or comprises a cell or population thereof. In some embodiments, a splicing system is or comprises a tissue. In some embodiments, a splicing system is or comprises an organism, e.g., an animal, e.g., a mammal such as a mouse, rat, monkey, dog, human, etc.

[0020] In some embodiments, the present disclosure provides a DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides of a particular DMD oligonucleotide type defined by: 1) base sequence; 2) pattern of backbone linkages; 2026204897   24 Jun 2026 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications, wherein the DMD oligonucleotide is a DMD oligonucleotide described herein (e.g., in Table A1).

[0021] In some embodiments, the present disclosure provides a DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides of a particular DMD oligonucleotide type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications, which composition is chirally controlled and it is enriched, relative to a substantially racemic preparation of DMD oligonucleotides having the same base sequence, for DMD oligonucleotides of the particular DMD oligonucleotide type, the DMD oligonucleotide composition being characterized in that, when it is contacted with the DMD transcript in a DMD transcript splicing system, splicing of the DMD transcript is altered (e.g., skipping of exon 51 or 53 is increased) relative to that observed under reference conditions selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof, wherein the DMD oligonucleotide is a DMD oligonucleotide described herein (e.g., in Table A1).

[0022] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide in Table A1, wherein the oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) chirally controlled internucleotidic linkages (e.g., those of S, R, nS, or nR), and wherein the oligonucleotide is optionally in a pharmaceutically acceptable salt form. In some embodiments, the oligonucleotide is provided as a sodium salt.

[0023] In some embodiments, as described herein a plurality of oligonucleotides share the same constitution. In some embodiments, for a chirally controlled internucleotidic linkage of a plurality of oligonucleotides in a composition, at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, of all oligonucleotides in the composition that share the same constitution of the plurality of the oligonucleotides share the same linkage phosphorus configuration at the chirally controlled internucleotidic linkage.

[0024] In some embodiments, a DMD transcript is of a Dystrophin gene or a variant thereof.

[0025] In some embodiments, the present disclosure provides a composition comprising any DMD oligonucleotide disclosed herein. In some embodiments, the present disclosure provides a composition comprising any chirally controlled DMD oligonucleotide disclosed herein. In some 2026204897   24 Jun 2026 embodiments, the present disclosure provides a composition comprising any chirally controlled DMD oligonucleotide disclosed herein, wherein the DMD oligonucleotide is capable of mediating skipping of DMD exon 51 or DMD exon 53.

[0026] In some embodiments, the present disclosure pertains to any individual DMD oligonucleotide described herein (e.g., in Table A1).

[0027] In some embodiments, a provided DMD oligonucleotide and / or composition is capable of mediating skipping of exon 51. In some embodiments, non-limiting examples of such DMD oligonucleotides and compositions include those of: WV-12494, WV-12130, WV-12131, WV-12132, WV-12133, WV-12134, WV-12135, WV-12136, WV-12496, WV-12495, WV-12123, WV- 12124, WV-12125, WV-12126, WV-12127, WV-12128, WV-12129, WV-12553, WV-12554, WV- 12555, WV-12556, WV-12557, WV-12558, WV-12559, WV-12872, WV-12873, WV-12876, WV- 12877, WV-12878, WV-12879, WV-12880, WV-12881, WV-12882, and WV-12883, and other DMD oligonucleotides having a base sequence which comprises at least 15 contiguous bases of any of these DMD oligonucleotides.

[0028] In some embodiments, a DMD oligonucleotide, e.g., a DMD oligonucleotide, is capable of mediating skipping of exon 53. Non-limiting examples of such DMD oligonucleotides include: WV-12880, WV-13826, WV-13827, WV-14791, WV-9517, WV-13835, WV-13864, WV-14344, and other DMD oligonucleotides having a base sequence which comprises at least 15 contiguous bases of any of these DMD oligonucleotides.

[0029] In some embodiments, the present disclosure pertains to a method of manufacturing any DMD oligonucleotide disclosed herein (e.g., in Table A1).

[0030] In some embodiments, the present disclosure pertains to a medicament comprising any DMD oligonucleotide disclosed herein (e.g., in Table A1).

[0031] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition of a DMD oligonucleotide selected from any of the Tables.

[0032] In some embodiments, a DMD oligonucleotide comprises an internucleotidic linkage which is a natural phosphate linkage or a phosphorothioate internucleotidic linkage. In some embodiments, a phosphorothioate internucleotidic linkage is not chirally controlled. In some embodiments, a phosphorothioate internucleotidic linkage is a chirally controlled internucleotidic linkage (e.g., Sp or Rp).

[0033] In some embodiments, a DMD oligonucleotide comprises a non-negatively charged internucleotidic linkage. In some embodiments, a DMD oligonucleotide comprises a neutral internucleotidic linkage. In some embodiments, a neutral internucleotidic linkage is or comprises a cyclic guanidine moiety.

[0034] In some embodiments, an internucleotidic linkage comprises a guanidine moiety. In some embodiments, an internucleotidic linkage comprises a cyclic guanidine moiety. In some 2026204897   24 Jun 2026 embodiments, an internucleotidic linkage comprising a cyclic guanidine moiety has the structure of: n001. In some embodiments, a neutral internucleotidic linkage or internucleotidic linkage comprising a cyclic guanidine moiety is stereochemically controlled.

[0035] In general, properties of DMD oligonucleotide compositions as described herein can be assessed using any appropriate assay. Relative toxicity and / or protein binding properties for different compositions (e.g., stereocontrolled vs non-stereocontrolled, and / or different stereocontrolled compositions) are typically desirably determined in the same assay, in some embodiments substantially simultaneously and in some embodiments with reference to historical results.

[0036] Those of skill in the art will be aware of and / or will readily be able to develop appropriate assays for particular DMD oligonucleotide compositions. The present disclosure provides descriptions of certain particular assays, for example that may be useful in assessing one or more features of DMD oligonucleotide composition behavior e.g., complement activation, injection site inflammation, protein biding, etc.

[0037] For example, certain assays that may be useful in the assessment of toxicity and / or protein binding properties of DMD oligonucleotide compositions may include any assay described and / or exemplified herein.

[0038] In some embodiments, the present disclosure provides a DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides which share the same base sequence, wherein oligonucleotides of the plurality comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 chirally controlled internucleotidic linkages. In some embodiments, the present disclosure provides a DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides which share the same constitution, wherein oligonucleotides of the plurality comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 chirally controlled internucleotidic linkages. In some embodiments, when an oligonucleotide compositions is contacted with a DMD transcript in a DMD transcript splicing system, splicing of the DMD transcript is altered (e.g., skipping of exon 51 or 53 is increased) relative to that observed under a reference condition selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof. In some embodiments, splicing products with one exon skipped (e.g., in some embodiments, exon 51; in some embodiments, exon 53) and / or proteins encoded thereby are provided at an increased level (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 or more fold) compared to a reference condition.

[0039] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, comprising a plurality of DMD oligonucleotides of a particular DMD oligonucleotide type defined by: 1) base sequence; 2026204897   24 Jun 2026 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications, wherein: oligonucleotides of the plurality comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 chirally controlled internucleotidic linkages; and the DMD oligonucleotide composition being characterized in that, when it is contacted with a DMD transcript in a DMD transcript splicing system, splicing of the DMD transcript is altered (e.g., skipping of exon 51 or 53 is increased) relative to that observed under a reference condition selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof.

[0040] In some embodiments, the present disclosure provides a method for treating or preventing muscular dystrophy, comprising administering to a subject a DMD oligonucleotide composition described herein.

[0041] In some embodiments, the present disclosure provides a method for treating or preventing muscular dystrophy, comprising administering to a subject a DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides, which: 1) have a common base sequence complementary to a target sequence in a DMD transcript; and 2) comprise one or more modified sugar moieties and modified internucleotidic linkages, the DMD oligonucleotide composition being characterized in that, when it is contacted with the DMD transcript in a DMD transcript splicing system, splicing of the DMD transcript is altered (e.g., skipping of exon 51 or 53 is increased) relative to that observed under reference conditions selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof, wherein the DMD oligonucleotide is a DMD oligonucleotide described herein (e.g., in Table A1).

[0042] In some embodiments, the present disclosure provides a method for treating or preventing muscular dystrophy, comprising administering to a subject a chirally controlled DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides of a particular DMD oligonucleotide type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications, which composition is chirally controlled and it is enriched, relative to a substantially racemic preparation of DMD oligonucleotides having the same base sequence, for DMD oligonucleotides of 2026204897   24 Jun 2026 the particular DMD oligonucleotide type, wherein: the DMD oligonucleotide composition being characterized in that, when it is contacted with the DMD transcript in a DMD transcript splicing system, splicing of the DMD transcript is altered (e.g., skipping of exon 51 or 53 is increased) relative to that observed under reference conditions selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof, wherein the DMD oligonucleotide is a DMD oligonucleotide described herein (e.g., in Table A1).

[0043] In some embodiments, provided oligonucleotides comprise at least one, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 non-negatively charged internucleotidic linkages, which are optionally and independently chirally controlled. In some embodiments, a provided oligonucleotide comprises a chirally controlled non-negatively charged internucleotidic linkage. In some embodiments, a non-negatively charged internucleotidic linkage is n001.

[0044] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, comprising a plurality of DMD oligonucleotides of a particular DMD oligonucleotide type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications, wherein: oligonucleotides of the plurality comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 chirally controlled internucleotidic linkages; and oligonucleotides of the plurality comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 non-negatively charged internucleotidic linkages.

[0045] In some embodiments, in a muscular dystrophy, after skipping DMD exon 51 or DMD exon 53, functions of dystrophin can be restored, or at least partially restored, through an internally truncated but at least partially functional Dystrophin protein variant.

[0046] In some embodiments, a muscular dystrophy includes but is not limited to Duchenne (Duchenne’s) muscular dystrophy (DMD) and Becker (Becker’s) muscular dystrophy (BMD).

[0047] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a DMD oligonucleotide or a DMD oligonucleotide composition of the present disclosure and a pharmaceutically acceptable carrier.

[0048] In some embodiments, the present disclosure provides a method for treating muscular dystrophy, Duchenne (Duchenne’s) muscular dystrophy (DMD), or Becker (Becker’s) muscular dystrophy (BMD), comprising administering to a subject susceptible thereto or suffering therefrom a composition described in the present disclosure. 2026204897   24 Jun 2026

[0049] In some embodiments, the present disclosure provides a method for treating muscular dystrophy, Duchenne (Duchenne’s) muscular dystrophy (DMD), or Becker (Becker’s) muscular dystrophy (BMD), comprising administering to a subject susceptible thereto or suffering therefrom a composition comprising any DMD oligonucleotide disclosed herein. In some embodiments, a composition is a pharmaceutical composition comprising an effective amount of an oligonucleotide and is chirally controlled. In some embodiments, an oligonucleotide is provided as a salt form, e.g., a sodium salt.

[0050] In some embodiments, the present disclosure provides a method for treating muscular dystrophy, Duchenne (Duchenne’s) muscular dystrophy (DMD), or Becker (Becker’s) muscular dystrophy (BMD), comprising (a) administering to a subject susceptible thereto or suffering therefrom a composition comprising any DMD oligonucleotide disclosed herein, and (b) administering to the subject an additional treatment which is capable of preventing, treating, ameliorating or slowing the progress of at least one symptom of muscular dystrophy, Duchenne (Duchenne’s) muscular dystrophy (DMD), or Becker (Becker’s) muscular dystrophy (BMD). DEFINITIONS

[0051] As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001.

[0052] Approximately: As used herein, the terms “approximately” or “about” in reference to a number are generally taken to include numbers that fall within a range of 5%, 10%, 15%, or 20% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value). In some embodiments, use of the term “about” in reference to dosages means ± 5 mg / kg / day.

[0053] Comparable: The term “comparable” is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of results obtained or phenomena observed. In some embodiments, comparable sets of conditions or circumstances are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will appreciate that sets of conditions are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under the different sets of conditions or circumstances are caused by or indicative of the variation in those features that are varied. 2026204897   24 Jun 2026

[0054] Dosing regimen: As used herein, a “dosing regimen” or “therapeutic regimen” refers to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regime comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount.

[0055] Heteroatom: The term “heteroatom” means an atom that is not carbon or hydrogen. In some embodiments, a heteroatom is oxygen, sulfur, nitrogen, phosphorus, boron or silicon (including any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or a substitutable nitrogen of a heterocyclic ring (for example, N as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR+ (as in N-substituted pyrrolidinyl); etc.). In some embodiments, a heteroatom is boron, nitrogen, oxygen, silicon, sulfur, or phosphorus. In some embodiments, a heteroatom is nitrogen, oxygen, silicon, sulfur, or phosphorus.   In some embodiments, a heteroatom is nitrogen, oxygen, sulfur, or phosphorus. In some embodiments, a heteroatom is nitrogen, oxygen or sulfur.

[0056] In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant, and / or microbe).

[0057] In vivo: As used herein, the term “in vivo” refers to events that occur within an organism (e.g., animal, plant, and / or microbe).

[0058] Partially unsaturated: As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.

[0059] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a controlled therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical 2026204897   24 Jun 2026 compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.

[0060] Pharmaceutically acceptable: As used herein, the phrase “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0061] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0062] Pharmaceutically acceptable salt: The term “pharmaceutically acceptable salt”, as used herein, refers to salts of such compounds that are appropriate for use in pharmaceutical contexts, i.e., salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in 2026204897   24 Jun 2026 detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate,    tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate. In some embodiments, a provided compound, e.g., an oligonucleotide, comprises one or more acidic groups (e.g., natural phosphate linkage groups, phosphorothioate linkage groups, etc.) and a pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium (e.g., an ammonium salt of N(R)3, wherein each R is independently as defined and described in the present disclosure) salt. Representative alkali or alkaline earth metal salts include salts of sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, a pharmaceutically acceptable salt is a sodium salt. In some embodiments, a pharmaceutically acceptable salt is a potassium salt. In some embodiments, a pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate. In some embodiments, a provided compound comprises more than one acid groups, for example, an oligonucleotide may comprise two or more acidic groups (e.g., in natural phosphate linkages and / or modified internucleotidic linkages). In some embodiments, a pharmaceutically acceptable salt, or generally a salt, of such a compound comprises two or more cations, which can be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or generally, a salt), each acidic group having sufficient acidity independently exists as its salt form (e.g., in an oligonucleotide comprising natural phosphate linkages and phosphorothioate internucleotidic linkages, each of the natural phosphate linkages and phosphorothioate internucleotidic linkages independently exists as its salt form). In 2026204897   24 Jun 2026 some embodiments, a pharmaceutically acceptable salt of an oligonucleotide, e.g., a provided DMD oligonucleotide, is a sodium salt of a provided DMD oligonucleotide. In some embodiments, a pharmaceutically acceptable salt of an oligonucleotide, e.g., a DMD oligonucleotide, is a sodium salt of such an oligonucleotide, wherein each acidic linkage, e.g., each natural phosphate linkage and phosphorothioate internucleotidic linkage, exists as a sodium salt form (all sodium salt).

[0063] Protecting group: The term “protecting group,” as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3rd edition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Also included are those protecting groups specially adapted for nucleoside and nucleotide chemistry, e.g., those described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06 / 2012, the entirety of Chapter 2 is incorporated herein by reference. Suitable amino-protecting groups include methyl carbamate, ethyl carbamante, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluoroenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC),    1,1-dimethyl-2,2,2-trichloroethyl   carbamate (TCBOC),    1-methyl-1-(4- biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-1-butylphenyl)-1-methylethyl carbamate (t- Bumeoc), 2-(2’- and 4’-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithio carbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivative, N’-p-toluenesulfonylaminocarbonyl derivative, N’-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzyl thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N,N- 2026204897   24 Jun 2026 dimethylcarboxamido)benzyl carbamate,    1,1 -dimethyl-3-( N,N-dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p’-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide,     3-phenylpropanamide,     picolinamide,     3-pyridylcarboxamide,     N- benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N’-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide,           3-(o-nitrophenyl)propanamide,           2-methyl-2-(o- nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide,     4,5-diphenyl-3-oxazolin-2-one,     N-phthalimide,     N- dithiasuccinimide (Dts),   N-2,3-diphenylmaleimide,   N-2,5-dimethylpyrrole,   N-1,1,4,4- tetramethyldisilylazacyclopentane adduct (STABASE),   5-substituted 1,3-dimethyl-1,3,5- triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM),     N-3-acetoxypropylamine,     N-(1-isopropyl-4-nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N’-oxide, N-1,1-dimethylthiomethyleneamine, N- benzylideneamine,    N-p-methoxybenzylideneamine,    N-diphenylmethyleneamine,    N-[(2- pyridyl)mesityl]methyleneamine,        N-(N’,N’-dimethylaminomethylene)amine,        N,N’- isopropylidenediamine,       N-p-nitrobenzylideneamine,       N-salicylideneamine,       N-5- chlorosalicylideneamine,        N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine,        N- cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivative, N-diphenylborinic acid derivative, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelate,   N-zinc   chelate,   N-nitroamine,   N-nitrosoamine,   amine   N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide,    o-nitrobenzenesulfenamide    (Nps),    2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide,                          2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys), p-toluenesulfonamide (Ts), 2026204897   24 Jun 2026 benzenesulfonamide,      2,3,6,-trimethyl-4-methoxybenzenesulfonamide      (Mtr),      2,4,6- trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide      (Pmc),      methanesulfonamide      (Ms),      P- trimethylsilylethanesulfonamide         (SES),         9-anthracenesulfonamide,        4-(4’,8’- dimethoxynaphthylmethyl)benzenesulfonamide          (DNMBS),          benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0064] Suitably protected carboxylic acids further include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

[0065] Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl,   1-methoxycyclohexyl,   4-methoxytetrahydropyranyl   (MTHP), 4- methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl    (CTMP),    1,4-dioxan-2-yl,    tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl,      2,2,2-trichloroethyl,      2-trimethylsilylethyl,      2- (phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p -halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl,     p,p ’-dinitrobenzhydryl,      5-dibenzosuberyl,      triphenylmethyl,      a- naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4’-bromophenacyloxyphenyl)diphenylmethyl, 4,4’,4’’-tris(4,5-dichlorophthalimidophenyl)methyl,       4,4’,4’’-tris(levulinoyloxyphenyl)methyl,       4,4’,4’’- tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4’,4’’-dimethoxyphenyl)methyl, 1,1-bis(4- 2026204897   24 Jun 2026 methoxyphenyl)-1’-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxido, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate,   p-chlorophenoxyacetate,    3- phenylpropionate,       4-oxopentanoate       (levulinate),       4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec), 2-(triphenylphosphonio) ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-napththyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate,    2-(methylthiomethoxy)ethyl,    4-(methylthiomethoxy)butyrate,    2- (methylthiomethoxymethyl)benzoate,    2,6-dichloro-4-methylphenoxyacetate,    2,6-dichloro-4- (1,1,3,3-tetramethylbutyl)phenoxyacetate,              2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate,     (E)-2-methyl-2-butenoate,     o- (methoxycarbonyl)benzoate, a-naphthoate, nitrate, alkyl N, N,N’,N’-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1-methoxyethylidene ortho ester, 1-ethoxyethylidine ortho ester, 1,2-dimethoxyethylidene ortho ester,    a-methoxybenzylidene    ortho ester,    1-(N,N- dimethylamino)ethylidene derivative,   a-(N,N’-dimethylamino)benzylidene   derivative, 2- oxacyclopentylidene ortho ester,    di-t-butylsilylene    group (DTBS),    1,3-(1,1,3,3- tetraisopropyldisiloxanylidene) derivative (TIPDS),    tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronate, and phenyl boronate.

[0066] In some embodiments, a hydroxyl protecting group is acetyl, t-butyl, tbutoxymethyl, methoxymethyl, tetrahydropyranyl, 1 -ethoxyethyl, 1 -(2-chloroethoxy)ethyl, 2- trimethylsilylethyl, p- 2026204897   24 Jun 2026 chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6- dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifiuoroacetyl, pivaloyl, 9- fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl,      2-(4-cyanophenyl)ethyl      2-(4-nitrophenyl)ethyl      (NPE),      2-(4- nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl,        levulinyl,        2-(dibromomethyl)benzoyl        (Dbmb),        2- (isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or    9-(p- methoxyphenyl)xanthine-9-y1 (MOX). In some embodiments, each of the hydroxyl protecting groups is, independently selected from acetyl, benzyl, t- butyldimethylsilyl, t-butyldiphenylsilyl and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4,4'-dimethoxytrityl group.

[0067] In some embodiments, a phosphorous protecting group is a group attached to the internucleotide phosphorous linkage throughout oligonucleotide synthesis. In some embodiments, the phosphorous protecting group is attached to the sulfur atom of the internucleotide phosphorothioate linkage. In some embodiments, the phosphorous protecting group is attached to the oxygen atom of the internucleotide phosphorothioate linkage. In some embodiments, the phosphorous protecting group is attached to the oxygen atom of the internucleotide phosphate linkage. In some embodiments the phosphorous protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-l-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0068] Protein: As used herein, the term “protein” refers to a polypeptide (i.e., a string of at least two amino acids linked to one another by peptide bonds). In some embodiments, proteins include only naturally-occurring amino acids. In some embodiments, proteins include one or more non-naturally-occurring amino acids (e.g., moieties that form one or more peptide bonds with adjacent amino acids). In some embodiments, one or more residues in a protein chain contain a non-aminoacid moiety (e.g., a glycan, etc). In some embodiments, a protein includes more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means. In some embodiments, proteins contain l-amino acids, d-amino acids, or both; in some embodiments, proteins contain one or more amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. The term “peptide” is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino 2026204897   24 Jun 2026 acids, less than 20 amino acids, or less than 10 amino acids.

[0069] Subject: As used herein, the term “subject” or “test subject” refers to any organism to which a provided compound or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject may be suffering from, and / or susceptible to a disease, disorder, and / or condition, e.g., muscular dystrophy.

[0070] Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the art will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0071] Suffering from: An individual who is “suffering from” a disease, disorder, and / or condition, e.g., muscular dystrophy has been diagnosed with and / or displays one or more symptoms of the disease, disorder, and / or condition, e.g., muscular dystrophy.

[0072] Susceptible to: An individual who is “susceptible to” a disease, disorder, and / or condition, e.g., muscular dystrophy is one who has a higher risk of developing the disease, disorder, and / or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition, e.g. muscular dystrophy may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition, e.g., muscular dystrophy may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition, e.g., muscular dystrophy may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition, e.g., muscular dystrophy will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition, e.g., muscular dystrophy will not develop the disease, disorder, and / or condition.

[0073] Systemic:   The phrases “systemic administration,” “administered systemically,” “peripheral administration,” and “administered peripherally” as used herein have their art-understood meaning referring to administration of a compound or composition such that it enters the recipient’s system.

[0074] Tautomeric forms: The phrase “tautomeric forms,” as used herein and generally understood in the art, is used to describe different isomeric forms of organic compounds that are capable of facile interconversion. Tautomers may be characterized by the formal migration of a hydrogen atom or proton, accompanied by a switch of a single bond and adjacent double bond. In 2026204897   24 Jun 2026 some embodiments, tautomers may result from prototropic tautomerism (i.e., the relocation of a proton). In some embodiments, tautomers may result from valence tautomerism (i.e., the rapid reorganization of bonding electrons). All such tautomeric forms are intended to be included within the scope of the present disclosure. In some embodiments, tautomeric forms of a compound exist in mobile equilibrium with each other, so that attempts to prepare the separate substances results in the formation of a mixture. In some embodiments, tautomeric forms of a compound are separable and isolatable compounds. In some embodiments of the disclosure, chemical compositions may be provided that are or include pure preparations of a single tautomeric form of a compound. In some embodiments of the disclosure, chemical compositions may be provided as mixtures of two or more tautomeric forms of a compound. In certain embodiments, such mixtures contain equal amounts of different tautomeric forms; in certain embodiments, such mixtures contain different amounts of at least two different tautomeric forms of a compound. In some embodiments of the disclosure, chemical compositions may contain all tautomeric forms of a compound. In some embodiments of the disclosure, chemical compositions may contain less than all tautomeric forms of a compound. In some embodiments of the disclosure, chemical compositions may contain one or more tautomeric forms of a compound in amounts that vary over time as a result of interconversion. In some embodiments of the disclosure, the tautomerism is keto-enol tautomerism. One of skill in the chemical arts would recognize that a keto-enol tautomer can be “trapped” (i.e., chemically modified such that it remains in the “enol” form) using any suitable reagent known in the chemical arts in to provide an enol derivative that may subsequently be isolated using one or more suitable techniques known in the art. Unless otherwise indicated, the present disclosure encompasses all tautomeric forms of relevant compounds, whether in pure form or in admixture with one another.

[0075] Therapeutic agent: As used herein, the phrase “therapeutic agent” refers to any agent that, when administered to a subject, has a therapeutic effect and / or elicits a desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition, e.g., muscular dystrophy.

[0076] Therapeutically effective amount: As used herein, the term “therapeutically effective amount” means an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a therapeutic regimen. In some embodiments, a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, e.g., muscular dystrophy, to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As will be appreciated by those of ordinary skill in this art, the effective amount of a substance may vary depending on such factors as the desired biological endpoint, the substance to be delivered, the target cell or tissue, etc. For example, the effective amount of compound in a 2026204897   24 Jun 2026 formulation to treat a disease, disorder, and / or condition, e.g., muscular dystrophy is the amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and / or reduces incidence of one or more symptoms or features of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are utilized to deliver a therapeutically effective amount.

[0077] Treat: As used herein, the term “treat,” “treatment,” or “treating” refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition, e.g., muscular dystrophy. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition, e.g., muscular dystrophy. In some embodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and / or condition, for example for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition.

[0078] Unit dose:   The expression “unit dose” as used herein refers to an amount administered as a single dose and / or in a physically discrete unit of a pharmaceutical composition. In many embodiments, a unit dose contains a predetermined quantity of an active agent. In some embodiments, a unit dose contains an entire single dose of the agent. In some embodiments, more than one unit dose is administered to achieve a total single dose. In some embodiments, administration of multiple unit doses is required, or expected to be required, in order to achieve an intended effect. A unit dose may be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined quantity of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained release formulation or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose may be present in a formulation that includes any of a variety of components in addition to the therapeutic agent(s). For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., may be included as described infra. It will be appreciated by those skilled in the art, in many embodiments, a total appropriate daily dosage of a particular therapeutic agent may comprise a portion, or a plurality, of unit doses, and may be decided, for example, by the attending physician within the scope of sound medical judgment. In some embodiments, the specific effective dose level for any particular subject or organism may depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of specific active compound employed; specific composition employed; age, body weight, general health, sex and diet of the subject; time of administration, and rate of excretion of the specific active compound employed; duration of the treatment; drugs and / or additional therapies used in combination or coincidental with specific compound(s) employed, and like factors well known in the medical arts.

[0079] Unsaturated: The term "unsaturated," as used herein, means that a moiety has one or 2026204897   24 Jun 2026 more units of unsaturation.

[0080] Wild-type: As used herein, the term “wild-type” has its art-understood meaning that refers to an entity having a structure and / or activity as found in nature in a “normal” (as contrasted with mutant, diseased, altered, etc) state or context. Those of ordinary skill in the art will appreciate that wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).

[0081] Nucleic acid: The term “nucleic acid” includes any nucleotides, analogs thereof, and polymers thereof. The term “polynucleotide” as used herein refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) or analogs thereof. These terms refer to the primary structure of the molecules and include double- and single-stranded DNA, and double- and single-stranded RNA. These terms include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs and modified polynucleotides such as, though not limited to, methylated, protected and / or capped nucleotides or polynucleotides. The terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus-atom bridges (also referred to herein as “internucleotidic linkages”). The term encompasses nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, natural natural phosphate internucleotidic linkages or non-natural internucleotidic linkages. Examples include, and are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. Unless otherwise specified, the prefix poly- refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units and wherein the prefix oligo- refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.

[0082] Nucleotide: The term “nucleotide” as used herein refers to a monomeric unit of a polynucleotide that consists of a heterocyclic base, a sugar, and one or more phosphate groups or phosphorus-containing internucleotidic linkages. Naturally occurring bases, (guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)) are derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included. Naturally occurring sugars include the pentose (five-carbon sugar) deoxyribose (which is found in natural DNA) or ribose (which is found in natural RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included, such as sugars with 2’-modifications, sugars in locked nucleic acid (LNA) and phosphorodiamidate morpholino oligomer (PMO). Nucleotides are linked via internucleotidic linkages to form nucleic acids, or polynucleotides. Many internucleotidic linkages are known in the art (such as, though not limited to, natural phosphate linkage, phosphorothioate linkages, boranophosphate linkages and the like). Artificial nucleic acids 2026204897   24 Jun 2026 include PNAs (peptide nucleic acids), phosphotriesters, phosphorothionates, H-phosphonates, phosphoramidates,       boranophosphates,       methylphosphonates,       phosphonoacetates, thiophosphonoacetates and other variants of the phosphate backbone of native nucleic acids, etc. In some embodiments, a nucleotide is a natural nucleotide comprising a naturally occurring nucleobase, a natural occurring sugar and the natural phosphate linkage. In some embodiments, a nucleotide is a modified nucleotide or a nucleotide analog, which is a structural analog that can be used in lieu of a natural nucleotide.

[0083] Modified nucleotide: The term “modified nucleotide” includes any chemical moiety which differs structurally from a natural nucleotide but is capable of performing at least one function of a natural nucleotide. In some embodiments, a modified nucleotide comprises a modification at a sugar, base and / or internucleotidic linkage. In some embodiments, a modified nucleotide comprises a modified sugar, modified nucleobase and / or modified internucleotidic linkage. In some embodiments, a modified nucleotide is capable of at least one function of a nucleotide, e.g., forming a subunit in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.

[0084] Analog: The term “analog” includes any chemical moiety which differs structurally from a reference chemical moiety or class of moieties, but which is capable of performing at least one function of such a reference chemical moiety or class of moieties. As non-limiting examples, a nucleotide analog differs structurally from a nucleotide but performs at least one function of a nucleotide; a nucleobase analog differs structurally from a nucleobase but performs at least one function of a nucleobase; a sugar analog differs structurally from a nucleobase but performs at least one function of a sugar, etc.

[0085] Nucleoside: The term “nucleoside” refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or modified sugar.

[0086] Modified nucleoside: The term "modified nucleoside" refers to a chemical moiety which is chemically distinct from a natural nucleoside, but which is capable of performing at least one function of a nucleoside. In some embodiments, a modified nucleoside is derived from or chemically similar to a natural nucleoside, but which comprises a chemical modification which differentiates it from a natural nucleoside. Non-limiting examples of modified nucleosides include those which comprise a modification at the base and / or the sugar. Non-limiting examples of modified nucleosides include those with a 2'-modification at a sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (which lack a nucleobase). In some embodiments, a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.

[0087] Nucleoside analog: The term "nucleoside analog" refers to a chemical moiety which is chemically distinct from a natural nucleoside, but which is capable of performing at least one 2026204897   24 Jun 2026 function of a nucleoside. In some embodiments, a nucleoside analog comprises an analog of a sugar and / or an analog of a nucleobase. In some embodiments, a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising a complementary sequence of bases.

[0088] Sugar: The term “sugar” refers to a monosaccharide or polysaccharide in closed and / or open form. In some embodiments, sugars are monosaccharides. In some embodiments, sugars are polysaccharides. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term “sugar” also encompasses structural analogs used in lieu of conventional sugar molecules, such as glycol, polymer of which forms the backbone of the nucleic acid analog, glycol nucleic acid (“GNA”), etc. As used herein, the term “sugar” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, a sugar is D-2-deoxyribose. In some embodiments, a sugar is beta-D-deoxyribofuranose. In some embodiments, a sugar moiety is a beta-D-deoxyribofuranose moiety. In some embodiments, a sugar is D-ribose. In some embodiments, a sugar is beta-D-ribofuranose. In some embodiments, a sugar moiety is a beta-D-ribofuranose moiety. In some embodiments, a sugar is optionally substituted beta-D-deoxyribofuranose or beta-D-ribofuranose. In some embodiments, a sugar moiety is an optionally substituted beta-D-deoxyribofuranose or beta-D-ribofuranose moiety. In some embodiments, a sugar moiety / unit in an oligonucleotide, e.g., a DMD oligonucleotide, nucleic acid, etc. is a sugar which comprises one or more carbon atoms each independently connected to an internucleotidic linkage, e.g., optionally substituted beta-D-deoxyribofuranose or beta-D-ribofuranose whose 5’-C and / or 3’-C are each independently connected to an internucleotidic linkage (e.g., a natural phosphate linkage, a modified internucleotidic linkage, a chirally controlled internucleotidic linkage, etc.).

[0089] Modified sugar: The term “modified sugar” refers to a moiety that can replace a sugar. A modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of a sugar. In some embodiments, a modified sugar is substituted beta-D-deoxyribofuranose or beta-D-ribofuranose. In some embodiments, a modified sugar comprises a 2’-modification. In some embodiments, a modified sugar comprises a linker (e.g., optionally substituted bivalent heteroaliphatic) connecting two sugar carbon atoms (e.g., C2 and C4), e.g., as found in LNA. In some embodiments, a linker is -O-CH(R)-, wherein R is as described in the present disclosure. In some embodiments, a linker is -O-CH(R)-, wherein O is connected to C2, and -CH(R)- is connected to C4 of a sugar, and R is as described in the present disclosure. In some embodiments, R is methyl. In some embodiments, R is -H. In some embodiments, -CH(R)- is of S configuration. In some embodiments, -CH(R)- is of R configuration.

[0090] Nucleobase: The term “nucleobase” refers to the parts of nucleic acids that are involved in the hydrogen-bonding that binds one nucleic acid strand to another complementary strand 2026204897   24 Jun 2026 in a sequence specific manner. The most common naturally-occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a modified nucleobase is a substituted nucleobase which nucleobase is selected from A, T, C, G, U, and tautomers thereof. In some embodiments, the naturally-occurring nucleobases are modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally-occurring nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase is a “modified nucleobase,” e.g., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of the nucleobase and retains the property of hydrogen-bonding that binds one nucleic acid strand to another in a sequence specific manner. In some embodiments, a modified nucleobase can pair with all of the five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes or activity of the oligonucleotide duplex. As used herein, the term “nucleobase” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, a nucleobase is an optionally substituted A, T, C, G, or U, or a substituted nucleobase which nucleobase is selected from A, T, C, G, U, and tautomers thereof.

[0091] Modified nucleobase: The terms "modified nucleobase", "modified base" and the like refer to a chemical moiety which is chemically distinct from a nucleobase, but which is capable of performing at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase which comprises a modification. In some embodiments, a modified nucleobase is capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases. In some embodiments, a modified nucleobase is a substituted nucleobase which nucleobase is selected from A, T, C, G, U, and tautomers thereof.

[0092] Chiral ligand: The term “chiral ligand” or “chiral auxiliary” refers to a moiety that is chiral and can be incorporated into a reaction so that the reaction can be carried out with certain stereoselectivity. In some embodiments, the term may also refer to a compound that comprises such a moiety.

[0093] Blocking group: The term “blocking group” refers to a group that masks the reactivity of a functional group. The functional group can be subsequently unmasked by removal of the blocking group. In some embodiments, a blocking group is a protecting group.

[0094] Moiety: The term “moiety” refers to a specific segment or functional group of a molecule. Chemical moieties are often recognized chemical entities embedded in or appended to a molecule. In some embodiments, a moiety of a compound is a monovalent, bivalent, or polyvalent 2026204897   24 Jun 2026 group formed from the compound by removing one or more -H and / or equivalents thereof from a compound. In some embodiments, depending on its context, “moiety” may also refer to a compound or entity from which the moiety is derived from.

[0095] Solid support: The term “solid support” when used in the context of preparation of nucleic acids, oligonucleotides, or other compounds refers to any support which enables synthesis of nucleic acids, oligonucleotides or other compounds. In some embodiments, the term refers to a glass or a polymer, that is insoluble in the media employed in the reaction steps performed to synthesize nucleic acids, and is derivatized to comprise reactive groups. In some embodiments, the solid support is Highly Cross-linked Polystyrene (HCP) or Controlled Pore Glass (CPG). In some embodiments, the solid support is Controlled Pore Glass (CPG). In some embodiments, the solid support is hybrid support of Controlled Pore Glass (CPG) and Highly Cross-linked Polystyrene (HCP).

[0096] Reading frame: The term “reading frame” refers to one of the six possible reading frames, three in each direction, of a double stranded DNA molecule. The reading frame that is used determines which codons are used to encode amino acids within the coding sequence of a DNA molecule.

[0097] Antisense:   As used herein, an "antisense" nucleic acid molecule comprises a nucleotide sequence which is complementary to a "sense" nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule, complementary to an mRNA sequence or complementary to the coding strand of a gene. Accordingly, an antisense nucleic acid molecule can associate via hydrogen bonds to a sense nucleic acid molecule. In some embodiments, transcripts, e.g., DMD transcripts, may be generated from both strands. In some embodiments, transcripts may or may not encode protein products. In some embodiments, when directed or targeted to a particular nucleic acid sequence, a “antisense” sequence may refer to a sequence that is complementary to the particular nucleic acid sequence.

[0098] Oligonucleotide: the term "oligonucleotide" refers to a polymer or oligomer of nucleotide monomers, containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, natural phosphate linkages, or non-natural internucleotidic linkages.

[0099] Oligonucleosides of the present disclosure can be of various lengths. In particular embodiments, oligonucleosides can range from about 20 to about 200 nucleosides in length. In various related embodiments, oligonucleosides, single-stranded, double-stranded, and triple-stranded, can range in length from about 4 to about 10 nucleosides, from about 10 to about 50 nucleosides, from about 20 to about 50 nucleosides, from about 15 to about 30 nucleosides, from about 20 to about 30 nucleosides in length. In some embodiments, the oligonucleoside is from about 9 to about 39 nucleosides in length. In some embodiments, the oligonucleoside is at least 15 nucleosides in length. In some embodiments, the oligonucleoside is at least 20 nucleosides in length. In some embodiments, the oligonucleoside is at least 25 nucleosides in length. In some embodiments, the oligonucleoside is 2026204897   24 Jun 2026 at least 30 nucleosides in length. In some embodiments, the oligonucleoside is a duplex of complementary strands of at least 18 nucleosides in length. In some embodiments, the oligonucleoside is a duplex of complementary strands of at least 21 nucleosides in length. In some embodiments, for the purpose of oligonucleotide lengths, each nucleoside counted independently comprises an optionally substituted nucleobase selected from A, T, C, G, U and their tautomers.

[00100] Internucleotidic linkage: As used herein, the phrase “internucleotidic linkage” refers generally to a linkage, typically a phosphorus-containing linkage, between nucleotide units of a nucleic acid or an oligonucleotide, and is interchangeable with “inter-sugar linkage”, “internucleosidic linkage,” and “phosphorus atom bridge,” as used above and herein. As appreciated by those skilled in the art, natural DNA and RNA contain natural phosphate linkages. In some embodiments, an internucleotidic linkage is a natural phosphate linkage (-OP(O)(OH)O-, typically existing as its anionic form -OP(O)(O-)O- at pH e.g., ~7.4), as found in naturally occurring DNA and RNA molecules. In some embodiments, an internucleotidic linkage is a modified internucleotidic linkage (or non-natural internucleotidic linkage), which is structurally different from a natural phosphate linkage but may be utilized in place of a natural phosphate linkage, e.g., phosphorothioate internucleotidic linkage, PMO linkages, etc. In some embodiments, an internucleotidic linkage is a modified internucleotidic linkage wherein one or more oxygen atoms of a natural phosphodiester linkage are independently replaced by one or more organic or inorganic moieties. In some embodiments, such an organic or inorganic moiety is selected from but not limited to =S, =Se, =NR’, -SR’, -SeR’, -N(R’)2, B(R’)3, -S-, -Se-, and -N(R’)-, wherein each R’ is independently as defined and described below. In some embodiments, an internucleotidic linkage is a phosphotriester linkage. In some embodiments, an internucleotidic linkage is a phosphorothioate diester linkage 0 4o-p-o4 (phosphorothioate internucleotidic linkage,       SH , typically existing as its anionic form -OP(O)(S-)O- at pH e.g., ~7.4). It is understood by a person of ordinary skill in the art that an internucleotidic linkage may exist as an anion or cation at a given pH due to the existence of acid or base moieties in the linkage.

[00101] Unless otherwise specified, the Rp / Sp designations preceding an oligonucleotide sequence describe the configurations of linkage phosphorus in chirally controlled internucleotidic linkages sequentially from 5’ to 3’ of the oligonucleotide sequence.

[00102] Oligonucleotide type: As used herein, the phrase “oligonucleotide type” is used to define oligonucleotides that have a particular base sequence, pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, natural phosphate linkages, phosphorothioate internucleotidic linkages, negatively charged internucleotidic linkages, neutral internucleotidic linkages etc), pattern of backbone chiral centers (i.e. pattern of linkage phosphorus stereochemistry (Rp / Sp)), and pattern of backbone phosphorus modifications. In some embodiments, oligonucleotides 2026204897   24 Jun 2026 of a common designated “type” are structurally identical to one another.

[00103] One of skill in the art will appreciate that synthetic methods of the present disclosure provide for a degree of control during the synthesis of an oligonucleotide (e.g., a DMD oligonucleotide) strand such that each nucleotide unit of the oligonucleotide strand can be designed and / or selected in advance to have a particular stereochemistry at the linkage phosphorus and / or a particular modification at the linkage phosphorus, and / or a particular base, and / or a particular sugar. In some embodiments, an oligonucleotide strand is designed and / or selected in advance to have a particular combination of stereocenters at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of bases. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of one or more of the above structural characteristics. The present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type. In some embodiments, all such molecules are structurally identical to one another. In some embodiments, provided compositions comprise a plurality of oligonucleotides of different types, typically in pre-determined (non-random) relative amounts. In some embodiments, an oligonucleotide is a DMD oligonucleotide as described herein.

[00104] Chiral control: As used herein, “chiral control” refers to control of the stereochemical designation of a chiral linkage phosphorus in a chiral internucleotidic linkage within an oligonucleotide (e.g., a DMD oligonucleotide). In some embodiments, a control is achieved through a chiral element that is absent from the sugar and base moieties of an oligonucleotide, for example, in some embodiments, a control is achieved through use of one or more chiral auxiliaries during oligonucleotide preparation as exemplified in the present disclosure, which chiral auxiliaries often are part of chiral phosphoramidites used during oligonucleotide preparation. In contrast to chiral control, a person having ordinary skill in the art appreciates that conventional oligonucleotide synthesis which does not use chiral auxiliaries cannot control stereochemistry at a chiral internucleotidic linkage if such conventional oligonucleotide synthesis is used to form the chiral internucleotidic linkage. In some embodiments, the stereochemical designation of each chiral linkage phosphorus in a chiral internucleotidic linkage within an oligonucleotide is controlled.

[00105] Chirally controlled oligonucleotide composition: The terms “chirally controlled (stereocontrolled or stereodefined) oligonucleotide composition”, “chirally controlled (stereocontrolled or stereodefined) nucleic acid composition”, and the like, as used herein, refers to a composition that comprises a plurality of oligonucleotides (or nucleic acids, chirally controlled oligonucleotides or chirally controlled nucleic acids) which share 1) a common base sequence, 2) a 2026204897   24 Jun 2026 common pattern of backbone linkages; 3) a common pattern of backbone chiral centers, and 4) a common pattern of backbone phosphorus modifications (oligonucleotides of a particular type), wherein the plurality of oligonucleotides (or nucleic acids) share the same stereochemistry at one or more chiral internucleotidic linkages (chirally controlled internucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp, not a random Rp and Sp mixture as non-chirally controlled internucleotidic linkages). Level of the plurality of oligonucleotides (or nucleic acids) in a chirally controlled oligonucleotide composition is non-random (pre-determined, controlled). Chirally controlled oligonucleotide compositions are typically prepared through chirally controlled oligonucleotide preparation to stereoselectively form one or more chiral internucleotidic linkages (e.g., using chiral auxiliaries as exemplified in the present disclosure, compared to non-chirally controlled (stereorandom, non-stereoselective, racemic) oligonucleotide synthesis such as traditional phosphoramidite-based oligonucleotide synthesis using no chiral auxiliaries or chiral catalysts to purposefully control stereoselectivity). A chirally controlled oligonucleotide composition is enriched, relative to a substantially racemic preparation of oligonucleotides having the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone phosphorus modifications, for oligonucleotides of the plurality. In some embodiments, a chirally controlled oligonucleotide composition comprises a plurality of oligonucleotides of a particular oligonucleotide type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications, wherein it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence, pattern of backbone linkages, and pattern of backbone phosphorus modifications, for oligonucleotides of the particular oligonucleotide type. As one having ordinary skill in the art readily appreciates, such enrichment can be characterized in that compared to a substantially racemic preparation, at each chirally controlled internucleotidic linkage, a higher level of the linkage phosphorus has the desired configuration. In some embodiments, each chirally controlled internucleotidic linkage independently has a diastereopurity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with respect to its chiral linkage phosphorus. In some embodiments, each independently has a diastereopurity of at least 90%. In some embodiments, each independently has a diastereopurity of at least 95%. In some embodiments, each independently has a diastereopurity of at least 97%. In some embodiments, each independently has a diastereopurity of at least 98%. In some embodiments, oligonucleotides of a plurality have the same constitution. In some embodiments, oligonucleotides of a plurality have the same constitution and stereochemistry, and are structurally identical.

[00106] In some embodiments, the plurality of oligonucleotides in a chirally controlled oligonucleotide composition share the same base sequence, the same, if any, nucleobase, sugar, and internucleotidic linkage modifications, and the same stereochemistry (Rp or Sp) independently at linkage phosphorus chiral centers of one or more chirally controlled internucleotidic linkages, though stereochemistry of certain linkage phosphorus chiral centers may differ. In some embodiments, about 2026204897   24 Jun 2026 0.1%-100%, (e.g., about 1%-100%, 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition are oligonucleotides of the plurality. In some embodiments, about 0.1%-100%, (e.g., about 1%-100%, 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition that share the common base sequence are oligonucleotides of the plurality. In some embodiments, about 0.1%-100%, (e.g., about 1%-100%, 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition that share the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone phosphorus modifications are oligonucleotides of the plurality. In some embodiments, about 0.1%-100%, (e.g., about 1%-100%, 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition, or of all oligonucleotides in a composition that share a common base sequence (e.g., of a plurality of oligonucleotide or an oligonucleotide type), or of all oligonucleotides in a composition that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications (e.g., of a plurality of oligonucleotide or an oligonucleotide type), or of all oligonucleotides in a composition that share a common base sequence, a common patter of base modifications, a common pattern of sugar modifications, a common pattern of internucleotidic linkage types, and / or a common pattern of internucleotidic linkage modifications (e.g., of a plurality of oligonucleotide or an oligonucleotide type), or of all oligonucleotides in a composition that share the same constitution, are oligonucleotides of the plurality. In some embodiments, a percentage is at least (DP)NCI, wherein DP is a percentage selected from 85%-100%, and NCI is the number of chirally controlled internucleotidic linkage. In some embodiments, DP is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, DP is at least 85%. In some embodiments, DP is at least 90%. In some embodiments, DP is at least 95%. 2026204897   24 Jun 2026 In some embodiments, DP is at least 96%. In some embodiments, DP is at least 97%. In some embodiments, DP is at least 98%. In some embodiments, DP is at least 99%. In some embodiments, DP reflects diastereopurity of linkage phosphorus chiral centers chirally controlled internucleotidic linkages. In some embodiments, diastereopurity of a linkage phosphorus chiral center of an internucleotidic linkage may be typically assessed using an appropriate dimer comprising such an internucleotidic linkage and the two nucleoside units being linked by the internucleotidic linkage. In some embodiments, the plurality of oligonucleotides share the same stereochemistry at about 1-50 (e.g., about 1-10, 1-20, 5-10, 5-20, 10-15, 10-20, 10-25, 10-30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral internucleotidic linkages. In some embodiments, the plurality of oligonucleotides share the same stereochemistry at about 0.1%-100% (e.g., about 1%-100%, 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95100%, 50%-90%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of chiral internucleotidic linkages. In some embodiments, each chiral internucleotidic linkage is a chiral controlled internucleotidic linkage, and the composition is a completely chirally controlled oligonucleotide composition. In some embodiments, not all chiral internucleotidic linkages are chiral controlled internucleotidic linkages, and the composition is a partially chirally controlled oligonucleotide composition. In some embodiments, a chirally controlled oligonucleotide composition comprises predetermined levels of individual oligonucleotide or nucleic acids types. For instance, in some embodiments a chirally controlled oligonucleotide composition comprises one oligonucleotide type at a predetermined level (e.g., as described above). In some embodiments, a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type, each independently at a predetermined level. In some embodiments, a chirally controlled oligonucleotide composition comprises multiple oligonucleotide types, each independently at a predetermined level. In some embodiments, a chirally controlled oligonucleotide composition is a composition of oligonucleotides of an oligonucleotide type, which composition comprises a predetermined level of a plurality of oligonucleotides of the oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition is a chirally controlled DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is a composition of oligonucleotides of a DMD oligonucleotide type.

[00107] Chirally pure: as used herein, the phrase “chirally pure” is used to describe an oligonucleotide or compositions thereof, in which all or nearly all (the rest are impurities) of the oligonucleotide molecules exist in a single diastereomeric form with respect to the linkage phosphorus atoms. In many embodiments, as appreciated by those skilled in the art, a chirally pure oligonucleotide composition is substantially pure in that substantially all of the oligonucleotides in the 2026204897   24 Jun 2026 composition are structurally identical (being the same stereoisomer).

[00108] Linkage phosphorus: as defined herein, the phrase “linkage phosphorus” is used to indicate that the particular phosphorus atom being referred to is the phosphorus atom present in an internucleotidic linkage, which phosphorus atom corresponds to the phosphorus atom of a natural phosphate linkage as occurs in naturally occurring DNA and RNA. In some embodiments, a linkage phosphorus atom is in a modified internucleotidic linkage. . In some embodiments, a linkage phosphorus atom is chiral.

[00109] For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 67th Ed., 1986-87, inside cover.

[00110] Unless otherwise specified, salts, such as pharmaceutically acceptable acid or base addition salts, stereoisomeric forms, and tautomeric forms, of compounds (e.g., DMD oligonucleotides, agents, etc.) are included. Unless otherwise specified, singular forms “a”, “an”, and “the” include the plural reference unless the context clearly indicates otherwise (and vice versa). Thus, for example, a reference to “a compound” may include a plurality of such compounds. DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[00111] Synthetic oligonucleotides provide useful molecular tools in a wide variety of applications. For example, oligonucleotides are useful in therapeutic, diagnostic, research, and new nanomaterials applications. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, by their susceptibility to endo- and exo-nucleases. As such, various synthetic counterparts have been developed to circumvent these shortcomings. These include synthetic oligonucleotides that contain chemical modification, e.g., base modifications, sugar modifications, backbone modifications, etc., which, among other things, render these molecules less susceptible to degradation and improve other properties of oligonucleotides, e.g., DMD oligonucleotides. Chemical modifications may also lead to certain undesired effects, such as increased toxicities, etc. From a structural point of view, modifications to natural phosphate linkages can introduce chirality, and certain properties of oligonucleotides may be affected by the configurations of the phosphorus atoms that form the backbone of the oligonucleotides.

[00112] In some embodiments, the present disclosure pertains to a DMD oligonucleotide or DMD oligonucleotide composition, which has a sequence at least partially complementary to a DMD target nucleic acid, and, in some embodiments, is capable of mediating skipping of a DMD exon. In some embodiments, a DMD oligonucleotide or DMD oligonucleotide composition is capable of mediating skipping of DMD exon 51 or 53.

[00113] In some embodiments, a DMD oligonucleotide or DMD oligonucleotide composition comprises any of various modifications to the internucleotidic linkages (e.g., backbone), sugars, 2026204897   24 Jun 2026 and / or nucleobases.

[00114] In some embodiments, a DMD oligonucleotide or DMD oligonucleotide composition is any DMD oligonucleotide or DMD oligonucleotide composition disclosed herein (e.g., in Table A1).

[00115] In some embodiments, the chirality of the backbone (e.g., the configurations of the phosphorus atoms) or inclusion of natural phosphate linkages or non-natural internucleotidic linkages in the backbone and / or modifications of a sugar and / or nucleobase, and / or the addition of chemical moieties can affect properties and activities of DMD oligonucleotides, e.g., the ability of a DMD oligonucleotide (e.g., a DMD oligonucleotide antisense to a Dystrophin (DMD) DMD transcript sequence) to skip DMD exon 51 or DMD exon 53, and / or other properties of a DMD oligonucleotide, including but not limited to, increased stability, improved pharmacokinetics, and / or decreased immunogenicity, etc. Suitable assays for assessing properties and / or activities of provided compounds, e.g., DMD oligonucleotides, and compositions thereof are widely known in the art and can be utilized in accordance with the present disclosure.

[00116] In some embodiments, a DMD transcript is pre-mRNA. In some embodiments, a splicing product is mature RNA. In some embodiments, a splicing product is mRNA. In some embodiments, splicing modulation or alteration comprises skipping DMD exon 51 or DMD exon 53.

[00117] In some embodiments, provided DMD oligonucleotides in provided compositions, e.g., DMD oligonucleotides of a plurality, comprise base modifications, sugar modifications, and / or internucleotidic linkage modifications. In some embodiments, provided DMD oligonucleotides comprise base modifications and sugar modifications. In some embodiments, provided DMD oligonucleotides comprise base modifications and internucleotidic linkage modifications. In some embodiments, provided DMD oligonucleotides comprise sugar modifications and internucleotidic modifications. In some embodiments, provided compositions comprise base modifications, sugar modifications, and internucleotidic linkage modifications. Example chemical modifications, such as base modifications, sugar modifications, internucleotidic linkage modifications, etc. are widely known in the art including but not limited to those described in this disclosure. In some embodiments, a modified base is substituted A, T, C, G or U. In some embodiments, a sugar modification is 2’-modification. In some embodiments, a 2’-modification is 2-F modification. In some embodiments, a 2’-modification is 2’-OR1, wherein R1 is not hydrogen. In some embodiments, a 2’-modification is 2’-OR1, wherein R1 is optionally substituted alkyl. In some embodiments, a 2’-modification is 2’-OMe. In some embodiments, a 2’-modification is 2’-MOE. In some embodiments, a modified sugar moiety is a bridged bicyclic or polycyclic ring. In some embodiments, a modified sugar moiety is a bridged bicyclic or polycyclic ring having 5-20 ring atoms wherein one or more ring atoms are optionally and independently heteroatoms. Example ring structures are widely known in the art, such as those found in BNA, LNA, etc. 2026204897   24 Jun 2026

[00118] In some embodiments, provided DMD oligonucleotides comprise one or more modified internucleotidic linkages. In some embodiments, provided DMD oligonucleotides comprise one or more chiral modified internucleotidic linkages. In some embodiments, provided DMD oligonucleotides comprise one or more chirally controlled chiral modified internucleotidic linkages. In some embodiments, provided DMD oligonucleotides comprise one or more natural phosphate linkages. In some embodiments, provided DMD oligonucleotides comprise one or more modified internucleotidic linkages and one or more natural phosphate linkages. In some embodiments, a modified internucleotidic linkage is a phosphorothioate linkage. In some embodiments, each modified internucleotidic linkage is a phosphorothioate linkage.

[00119] In some embodiments, provided DMD oligonucleotides comprise both one or more modified internucleotidic linkages and one or more natural phosphate linkages. In some embodiments, DMD oligonucleotides comprising both modified internucleotidic linkage and natural phosphate linkage and compositions thereof provide improved properties, e.g., skipping of exon 51 or 53 and toxicities, etc. In some embodiments, a modified internucleotidic linkage is a chiral internucleotidic linkage. In some embodiments, a modified internucleotidic linkage is a phosphorothioate linkage. In some embodiments, a modified internucleotidic linkage is a substituted phosphorothioate linkage.

[00120] Among other things, the present disclosure encompasses the recognition that stereorandom DMD oligonucleotide preparations contain a plurality of distinct chemical entities that differ from one another, e.g., in the stereochemical structure of individual backbone linkage phosphorus chiral centers within the DMD oligonucleotide chain. Without control of stereochemistry of backbone chiral centers, stereorandom DMD oligonucleotide preparations provide uncontrolled compositions comprising undetermined levels of DMD oligonucleotide stereoisomers with respect to the uncontrolled chiral centers, e.g., chiral linkage phosphorus. Even though these stereoisomers may have the same base sequence, they are different chemical entities at least due to their different backbone stereochemistry, and they can have, as demonstrated herein, different properties, e.g., skipping of exon 51 or 53, toxicities, etc. Among other things, the present disclosure provides new DMD oligonucleotide compositions wherein stereochemistry of one or more linkage phosphorus chiral centers are independently controlled (e.g., in chirally controlled internucleotidic linkages). In some embodiments, the present disclosure provides chirally controlled DMD oligonucleotide compositions which are or contain particular stereoisomers of DMD oligonucleotides of interest.

[00121] In some embodiments, in a DMD oligonucleotide, a pattern of backbone chiral centers can provide improved activity(s) or characteristic(s), including but not limited to: improved skipping of DMD exon 51 or DMD exon 53, increased stability, increased activity, low toxicity, low immune response, improved protein binding profile, increased binding to certain proteins, and / or enhanced delivery. 2026204897   24 Jun 2026

[00122] In some embodiments, provided DMD oligonucleotides comprise one or more non- negatively charged internucleotidic linkages. In some embodiments, a non-negatively charged internucleotidic linkage is a positively charged internucleotidic linkage. In some embodiments, a non-negatively charged internucleotidic linkage is a neutral internucleotidic linkage. In some embodiments, a modified internucleotidic linkage (e.g., a non-negatively charged internucleotidic linkage) comprises an optionally substituted guanidine moiety. In some embodiments, a modified internucleotidic linkage comprises an optionally substituted cyclic guanidine moiety. In some embodiments, a modified internucleotidic linkage comprises an optionally substituted cyclic X <n /    %        % r >=n o r >=n^ o r >=n, o <\         A N T\ \ w o .    \ w o .      \ w xo guanidine moiety and has the structure of:               ^,               ^, or , wherein W is O. In some embodiments, a non-negatively charged internucleotidic linkage is stereochemically controlled.

[00123] In some embodiments, provided DMD oligonucleotides can bind to a DMD transcript, and change the splicing pattern of the DMD transcript by inducing (e.g., mediating) skipping of exon 51 or 53. In some embodiments, provided DMD oligonucleotides provides exonskipping of an exon, with efficiency greater than a comparable DMD oligonucleotide under one or more suitable conditions, e.g., as described herein. In some embodiments, a provided skipping efficiency is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190% more than, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or more fold of, that of a comparable DMD oligonucleotide under one or more suitable conditions, e.g., as described herein.

[00124] In some embodiments, compared to a reference condition, provided chirally controlled DMD oligonucleotide compositions are surprisingly effective. In some embodiments, skipping of exon 52 or 53 (e.g., as measured by increased levels of desired mRNA, proteins, etc., decreased levels of undesired mRNA, proteins, etc.) can be enhanced by more than 5, 10, 15, 20, 25, 30, 40, 50, or 100 fold. In some embodiments, a change is measured by increase of a desired mRNA level compared to a reference condition. In some embodiments, a change is measured by decrease of an undesired mRNA level compared to a reference condition. In some embodiments, a reference condition is absence of DMD oligonucleotide treatment. In some embodiments, a reference condition is a stereorandom composition of DMD oligonucleotides having the same base sequence and chemical modifications.

[00125] In some embodiments, a provided DMD oligonucleotide composition is characterized in that, when it is contacted with the DMD transcript in a DMD transcript splicing system, splicing of the DMD transcript is altered (e.g., exon 51 or 53 is skipped) relative to that observed under reference conditions selected from the group consisting of absence of the composition, presence of a reference 2026204897   24 Jun 2026 composition, and combinations thereof. In some embodiments, a desired splicing product (e.g., one lacking exon 51 or 53) is increased 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 fold or more. In some embodiments, a desired splicing reference is absent (e.g., cannot be reliably detected by quantitative PCR) under reference conditions. In some embodiments, as exemplified in the present disclosure, levels of the plurality of DMD oligonucleotides, e.g., a plurality of DMD oligonucleotides, in provided compositions are pre-determined.

[00126] In some embodiments, DMD oligonucleotides having a common base sequence may have the same pattern of nucleoside modifications, e.g. , sugar modifications, base modifications, etc. In some embodiments, a pattern of nucleoside modifications may be represented by a combination of locations and modifications. In some embodiments, all non-chiral linkages (e.g., PO) may be omitted. In some embodiments, DMD oligonucleotides having the same base sequence have the same constitution.

[00127] In some embodiments, a DMD oligonucleotide composition is chirally controlled.

[00128] In some embodiments, a DMD oligonucleotide composition is not stereorandom, and is not a racemic preparation of a diastereoisomers.

[00129] As understood by a person having ordinary skill in the art, a stereorandom or racemic preparation of DMD oligonucleotides is prepared by non-stereoselective and / or low-stereoselective coupling of nucleotide monomers, typically without using any chiral auxiliaries, chiral modification reagents, and / or chiral catalysts. In some embodiments, in a substantially racemic (or chirally uncontrolled) preparation of DMD oligonucleotides, all or most coupling steps are not chirally controlled in that the coupling steps are not specifically conducted to provide enhanced stereoselectivity. An example substantially racemic preparation of DMD oligonucleotides is the preparation of phosphorothioate DMD oligonucleotides through sulfurizing phosphite triesters from commonly used phosphoramidite DMD oligonucleotide synthesis with either tetraethylthiuram disulfide or (TETD) or 3H-1, 2-bensodithiol-3-one 1, 1-dioxide (BDTD), a well-known process in the art. In some embodiments, substantially racemic preparation of DMD oligonucleotides provides substantially racemic DMD oligonucleotide compositions (or chirally uncontrolled DMD oligonucleotide compositions). In some embodiments, at least one coupling of a nucleotide monomer has a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, each internucleotidic linkage independently has a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, a diastereoselectivity is lower than about 60:40. In some embodiments, a diastereoselectivity is lower than about 70:30. In some embodiments, a diastereoselectivity is lower than about 80:20. In some embodiments, a diastereoselectivity is lower than about 90:10. In some 2026204897   24 Jun 2026 embodiments, a diastereoselectivity is lower than about 91:9. In some embodiments, at least one internucleotidic linkage has a diastereoselectivity lower than about 90:10. In some embodiments, each internucleotidic linkage independently has a diastereoselectivity lower than about 90:10. In some embodiments, a non-chirally controlled internucleotidic linkage has a diastereomeric purity no more than 90%, 85%, 80%, 75%, 70%, 65%, 60%, or 55%. In some embodiments, the purity is no more than 90%. In some embodiments, the purity is no more than 85%. In some embodiments, the purity is no more than 80%.

[00130] In contrast, in chirally controlled DMD oligonucleotide composition, at least one and typically each chirally controlled internucleotidic linkage, such as those of DMD oligonucleotides of chirally controlled DMD oligonucleotide compositions, independently has a diastereomeric purity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more with respect to the chiral linkage phosphorus. In some embodiments, a diastereomeric purity is 95% or more. In some embodiments, a diastereomeric purity is 96% or more. In some embodiments, a diastereomeric purity is 97% or more. In some embodiments, a diastereomeric purity is 98% or more. In some embodiments, a diastereomeric purity is 99% or more. Among other things, technologies of the present disclosure routinely provide chirally controlled internucleotidic linkages with high diastereomeric purity.

[00131] As appreciated by a person having ordinary skill in the art, diastereoselectivity of a coupling or diastereomeric purity (diastereopurity) of an internucleotidic linkage can be assessed through the diastereoselectivity of a dimer formation / diastereomeric purity of the internucleotidic linkage of a dimer formed under the same or comparable conditions, wherein the dimer has the same 5’- and 3’-nucleosides and internucleotidic linkage.

[00132] In some embodiments, the present disclosure provides chirally controlled (and / or stereochemically pure) DMD oligonucleotide compositions comprising a plurality of DMD oligonucleotides defined by having: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single DMD oligonucleotide in that at least about 10% of the DMD oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers, wherein the oligonucleotide is provided herein (e.g., in Table A1).

[00133] In some embodiments, the present disclosure provides chirally controlled DMD oligonucleotide composition of a plurality of DMD oligonucleotides, wherein the composition is enriched, relative to a substantially racemic preparation of the same DMD oligonucleotides, for DMD oligonucleotides of a single DMD oligonucleotide type. In some embodiments, the present disclosure provides chirally controlled DMD oligonucleotide composition of a plurality of DMD 2026204897   24 Jun 2026 oligonucleotides wherein the composition is enriched, relative to a substantially racemic preparation of the same DMD oligonucleotides, for DMD oligonucleotides of a single DMD oligonucleotide type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications, wherein the oligonucleotide is provided herein (e.g., in Table A1).

[00134] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition comprising a plurality of DMD oligonucleotides of a particular DMD oligonucleotide type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications. wherein the composition is enriched, relative to a substantially racemic preparation of DMD oligonucleotides having the same base sequence and length, for DMD oligonucleotides of the particular DMD oligonucleotide type, wherein the oligonucleotide is provided herein (e.g., in Table A1).

[00135] In some embodiments, DMD oligonucleotides of a DMD oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of sugar modifications. In some embodiments, DMD oligonucleotides of a DMD oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, DMD oligonucleotides of a DMD oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, DMD oligonucleotides of a particular type have the same constitution. In some embodiments, DMD oligonucleotides of a DMD oligonucleotide type are identical.

[00136] In some embodiments, a chirally controlled DMD oligonucleotide composition is a substantially pure preparation of a DMD oligonucleotide type in that DMD oligonucleotides in the composition that are not of the DMD oligonucleotide type are impurities form the preparation process of said DMD oligonucleotide type, in some case, after certain purification procedures.

[00137] In some embodiments, at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the DMD oligonucleotides in the composition have a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.

[00138] In some embodiments, DMD oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a 2026204897   24 Jun 2026 common pattern of backbone phosphorus modifications. In some embodiments, DMD oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, DMD oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of sugar modifications. In some embodiments, DMD oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, DMD oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers are identical.

[00139] In some embodiments, purity of a chirally controlled DMD oligonucleotide composition of a DMD oligonucleotide type is expressed as the percentage of DMD oligonucleotides in the composition that are of the DMD oligonucleotide type. In some embodiments, at least about 10% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 20% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 30% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 40% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 50% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 60% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 70% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 80% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 90% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 92% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 94% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 95% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 96% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition 2026204897   24 Jun 2026 are of the same DMD oligonucleotide type. In some embodiments, at least about 97% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 98% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type. In some embodiments, at least about 99% of the DMD oligonucleotides in a chirally controlled DMD oligonucleotide composition are of the DMD oligonucleotide type.

[00140] In some embodiments, purity of a chirally controlled DMD oligonucleotide composition can be controlled by stereoselectivity of each coupling step in its preparation process. In some embodiments, a coupling step has a stereoselectivity (e.g., diastereoselectivity) of 60% (60% of the new internucleotidic linkage formed from the coupling step has the intended stereochemistry). After such a coupling step, the new internucleotidic linkage formed may be referred to have a 60% purity. In some embodiments, each coupling step has a stereoselectivity of at least 60%. In some embodiments, each coupling step has a stereoselectivity of at least 70%. In some embodiments, each coupling step has a stereoselectivity of at least 80%. In some embodiments, each coupling step has a stereoselectivity of at least 85%. In some embodiments, each coupling step has a stereoselectivity of at least 90%. In some embodiments, each coupling step has a stereoselectivity of at least 91%. In some embodiments, each coupling step has a stereoselectivity of at least 92%. In some embodiments, each coupling step has a stereoselectivity of at least 93%. In some embodiments, each coupling step has a stereoselectivity of at least 94%. In some embodiments, each coupling step has a stereoselectivity of at least 95%. In some embodiments, each coupling step has a stereoselectivity of at least 96%. In some embodiments, each coupling step has a stereoselectivity of at least 97%. In some embodiments, each coupling step has a stereoselectivity of at least 98%. In some embodiments, each coupling step has a stereoselectivity of at least 99%. In some embodiments, each coupling step has a stereoselectivity of at least 99.5%. In some embodiments, each coupling step has a stereoselectivity of virtually 100%.

[00141] In some embodiments, in provided compositions, at least 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97% or 99% of DMD oligonucleotides that have the base sequence of a particular DMD oligonucleotide type (defined by 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone phosphorus modifications) are DMD oligonucleotides of the particular DMD oligonucleotide type. In some embodiments, at least 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97% or 99% of DMD oligonucleotides that have the base sequence, the pattern of backbone linkages, and the pattern of backbone phosphorus modifications of a particular DMD oligonucleotide type are DMD oligonucleotides of the particular DMD oligonucleotide type. 2026204897   24 Jun 2026

[00142] In some embodiments, a provided DMD oligonucleotide comprises one or more chiral, modified phosphate linkages. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of DMD oligonucleotides that include one or more modified backbone linkages, bases, and / or sugars.

[00143] In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 80%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 85%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 90%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 91%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 92%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 93%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 94%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 95%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 96%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 97%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 98%. In some embodiments, provided chirally controlled (and / or stereochemically pure) preparations are of a stereochemical purity of greater than about 99%.

[00144] In some embodiments, one or more is one. In some embodiments, one or more is two. In some embodiments, one or more is three. In some embodiments, one or more is four. In some embodiments, one or more is five. In some embodiments, one or more is six. In some embodiments, one or more is seven. In some embodiments, one or more is eight. In some embodiments, one or more is nine. In some embodiments, one or more is ten. In some embodiments, one or more is at least one. In some embodiments, one or more is at least two. In some embodiments, one or more is at least three. In some embodiments, one or more is at least four. In some embodiments, one or more is at least five. In some embodiments, one or more is at least six. In some embodiments, one or more is at least seven. In some embodiments, one or more is at least eight. In some embodiments, one or more is at least nine. In some embodiments, one or more is at least ten.

[00145] In some embodiments, a base sequence, e.g., a common base sequence of a plurality of DMD oligonucleotide, a base sequence of a particular DMD oligonucleotide type, etc., comprises or is a sequence complementary to a gene or DMD transcript (e.g., of Dystrophin or DMD). In some 2026204897   24 Jun 2026 embodiments, a common base sequence comprises or is a sequence 100% complementary to a gene.

[00146] In some embodiments, linkage phosphorus of chiral internucleotidic linkages are chirally controlled. In some embodiments, a chiral internucleotidic linkage is phosphorothioate internucleotidic linkage. In some embodiments, each chiral internucleotidic linkage in a DMD oligonucleotide of a provided composition is a phosphorothioate internucleotidic linkage.

[00147] As appreciated by those skilled in the art, internucleotidic linkages, natural phosphate linkages, phosphorothioate internucleotidic linkages, etc. may exist in their salt forms depending on pH of their environment. Unless otherwise indicated, such salt forms are included in the present application when such internucleotidic linkages are referred to.

[00148] In some embodiments, DMD oligonucleotides of the present disclosure comprise one or more modified sugar moieties. In some embodiments, DMD oligonucleotides of the present disclosure comprise one or more modified base moieties. As known by a person of ordinary skill in the art and described in the disclosure, various modifications can be introduced to sugar and base moieties. For example, in some embodiments, a modification is a modification described in US9006198, WO2014 / 012081, WO / 2015 / 107425, and WO / 2017 / 062862, the sugar and base modifications of each of which are incorporated herein by reference. Dystrophin

[00149] In some embodiments, the present disclosure provides technologies, e.g., DMD oligonucleotides, compositions, methods, etc., related to the dystrophin (DMD) gene or a product encoded thereby (a DMD transcript, a protein (e.g., various variants of the dystrophin protein), etc.).

[00150] In some embodiments, the present disclosure provides technologies, including DMD oligonucleotides and compositions and methods of use thereof, for treatment of muscular dystrophy, including but not limited to, Duchenne Muscular Dystrophy (also abbreviated as DMD) and Becker Muscular Dystrophy (BMD). In some embodiments, DMD comprises one or more mutations. In some embodiments, such mutations are associated with reduced biological functions of dystrophin protein in a subject suffering from or susceptible to muscular dystrophy.

[00151] In some embodiments, the dystrophin (DMD) gene or a product thereof, or a variant or portion thereof, may be referred to as DMD, BMD, CMD3B, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272, MRX85, or dystrophin; External IDs: OMIM: 300377 MGI: 94909; HomoloGene: 20856; GeneCards: DMD; In Human: Entrez: 1756; Ensembl: ENSG00000198947; UniProt: P11532; RefSeq (mRNA): NM_000109; NM_004006; NM_004007; NM_004009; NM_004010; RefSeq (protein): NP_000100; NP_003997; NP_004000; NP_004001; NP_004002; Location (UCSC): Chr X: 31.1 - 33.34 Mb; In Mouse: Entrez: 13405; Ensembl:  ENSMUSG00000045103; UniProt:  P11531; RefSeq (mRNA):  NM_007868; NM_001314034;  NM_001314035;  NM_001314036;  NM_001314037; RefSeq (protein): 2026204897   24 Jun 2026 NP_001300963; NP_001300964; NP_001300965; NP_001300966; NP_001300967; Location (UCSC): Chr X: 82.95 - 85.21 Mb.

[00152] The DMD gene reportedly contains 79 exons distributed over 2.3 million bp of genetic real estate on the X chromosome; however, only approximately 14,000 bp (<1%) is reported to be used for translation into protein (coding sequence). It is reported that about 99.5% of the genetic sequence, the intronic sequences, is spliced out of the 2.3 million bp initial heteronuclear RNA DMD transcript to provide a mature 14,000 bp mRNA that includes all key information for dystrophin protein production. In some embodiments, patients with DMD have mutation(s) in the DMD gene that prevent the appropriate construction of the wild-type DMD mRNA and / or the production of the wild-type dystrophin protein, and patients with DMD often show marked dystrophin deficiency in their muscle.

[00153] In some embodiments, a dystrophin DMD transcript, e.g., mRNA, or protein encompasses those related to or produced from alternative splicing. For example, sixteen alternative DMD transcripts of the dystrophin gene were reported following an analysis of splicing patterns of the DMD gene in skeletal muscle, brain and heart tissues. Sironi et al. 2002 FEBS Letters 517: 163-166.

[00154] It is reported that dystrophin has several isoforms. In some embodiments, dystrophin refers to a specific isoform. At least three full-length dystrophin isoforms have been reported, each controlled by a tissue-specific promoter. Klamut et al. 1990 Mol. Cell. Biol. 10: 193-205; Nudel et al. 1989 Nature 337: 76-78; Gorecki et al. 1992 Hum. Mol. Genet. 1: 505-510. The muscle isoform is reportedly mainly expressed in skeletal muscle but also in smooth and cardiac muscles [Bies, R.D., Phelps, S.F., Cortez, M.D., Roberts, R., Caskey, C.T. and Chamberlain, J.S. 1992 Nucleic Acids Res. 20: 1725-1731], the brain dystrophin is reportedly specific for cortical neurons but can also be detected in heart and cerebellar neurons, while the Purkinje-cell type reportedly accounts for nearly all cerebellar dystrophin [Gorecki et al. 1992 Hum. Mol. Genet. 1: 505-510]. Alternative splicing reportedly provides a means for dystrophin diversification: the 3’ region of the gene reportedly undergoes alternative splicing resulting in tissue-specific DMD transcripts in brain neurons, cardiac Purkinje fibers, and smooth muscle cells [Bies et al. 1992 Nucleic Acids Res. 20: 1725-1731; and Feener et al. 1989 Nature 338: 509-511] while 12 patterns of alternative splicing have been reported in the 5’ region of the gene in skeletal muscle [Surono et al. 1997 Biochem. Biophys. Res. Commun. 239: 895-899].

[00155] In some embodiments, a dystrophin mRNA, gene or protein is a revertant version. Among others, revertant dystrophins were reported in, for example: Hoffman et al. 1990 J. Neurol. Sci. 99:9-25; Klein et al. 1992 Am. J. Hum. Genet. 50: 950-959; and Chelly et al. 1990 Cell 63: 12391348; Arahata et al. 1998 Nature 333: 861-863; Bonilla et al. 1988 Cell 54: 447-452; Fanin et al. 1992 Neur. Disord. 2: 41-45; Nicholson et al. 1989 J. Neurol. Sci. 94: 137-146; Shimizu et al. 1988 Proc. Jpn. Acad. Sci. 64: 205-208; Sicinzki et al. 1989 Science 244: 1578-1580; and Sherratt et al. Am. J. 2026204897   24 Jun 2026 Hum. Genet. 53: 1007-1015.

[00156] Various mutations in the DMD gene can and / or were reported to cause muscular dystrophy, including some in exon 51 or 53. Muscular Dystrophy

[00157] Compositions comprising one or more DMD oligonucleotides described herein can be used to treat or delay onset of muscular dystrophy, or at least one symptom thereof. In some embodiments, muscular dystrophy (MD) is any of a group of muscle conditions, diseases, or disorders that results in (increasing) weakening and breakdown of skeletal muscles over time. The conditions, diseases, or disorders differ in which muscles are primarily affected, the degree of weakness, when symptoms begin, and how quickly symptoms worsen. Many MD patients will eventually become unable to walk. In many cases musuclar dystrophy is fatal. Some types are also associated with problems in other organs, including the central nervous system. In some embodiments, the muscular dystrophy is Duchenne (Duchenne’s) Muscular Dystrophy (DMD) or Becker (Becker’s) Muscular Dystrophy (BMD).

[00158] In some embodiments, a symptom of Duchenne Muscular Dystrophy is reportedly muscle weakness associated with muscle wasting, with the voluntary muscles being first affected, especially those of the hips, pelvic area, thighs, shoulders, and calves. Muscle weakness can reportedly also occur later, in the arms, neck, and other areas. Calves are reportedly often enlarged. Symptoms reportedly usually appear before age six and may appear in early infancy. Other physical symptoms reportedly are: awkward manner of walking, stepping, or running (in some cases, patients tend to walk on their forefeet, because of an increased calf muscle tone), frequent falls, fatigue, difficulty with motor skills (e.g., running, hopping, jumping), lumbar hyperlordosis, possibly leading to shortening of the hip-flexor muscles, unusual overall posture and / or manner of walking, stepping, or running, muscle contractures of Achilles tendon and hamstrings impair functionality, progressive difficulty walking, muscle fiber deformities, pseudohypertrophy (enlarging) of tongue and calf muscles, higher risk of neurobehavioral disorders (e.g., ADHD), learning disorders (e.g., dyslexia), and non-progressive weaknesses in specific cognitive skills (e.g., short-term verbal memory), which are believed to be the result of absent or dysfunctional dystrophin in the brain, eventual loss of ability to walk (usually by the age of 12), skeletal deformities (including scoliosis in some cases), and trouble getting up from lying or sitting position.

[00159] In some embodiments, Becker muscular dystrophy (BMD) is reportedly caused by mutations that give rise to shortened but in-frame DMD transcripts resulting in the production of truncated but partially functional protein(s). Such partially functional protein(s) were reported to retain the critical amino terminal, cysteine rich and C-terminal domains but usually lack elements of the central rod domains which were reported to be of less functional significance. England et al. 1990 2026204897   24 Jun 2026 Nature, 343, 180-182.

[00160] In some embodiments, BMD phenotypes range from mild DMD to virtually asymptomatic, depending on the precise mutation and the level of dystrophin produced. Yin et al. 2008 Hum. Mol. Genet. 17: 3909-3918.

[00161] In some embodiments, dystrophy patients with out-of-frame mutations are generally diagnosed with the more severe Duchenne Muscular Dystrophy, and dystrophy patients with in-frame mutations are generally diagnosed with the less severe Becker Muscular Dystrophy. However, a minority of patients with in-frame deletions are diagnosed with Duchenne Muscular Dystrophy, including those with deletion mutations starting or ending in exons 50 or 51, which encode part of the hinge region, such as deletions of exons 47 to 51, 48 to 51, and 49 to 53. Without wishing to be bound by any particular theory, the present disclosure notes that the patient-to-patient variability in disease severity despite the presence of the same exon deletion reportedly may be related to the effect of the specific deletion breakpoints on mRNA splicing efficiency and / or patterns; translation or DMD transcription efficiency after genome rearrangement; and stability or function of the truncated protein structure. Yokota et al. 2009 Arch. Neurol. 66: 32. Exon Skipping as a Treatment for Muscular Dystrophy

[00162] In some embodiments, a treatment for muscular dystrophy comprises the use of a DMD oligonucleotide which is capable of mediating skipping of Dystrophin (DMD) exon 51 or 53. In some embodiments, the present disclosure provides methods for treatment of muscular dystrophy comprising administering to a subject suffering therefrom or susceptible thereto a DMD oligonucleotide, or a composition comprising a DMD oligonucleotide. Particularly, among other things, the present disclosure demonstrates that chirally controlled DMD oligonucleotide / chirally controlled DMD oligonucleotide compositions are unexpectedly effective for modulating exon skipping compared to otherwise identical but non-chirally controlled DMD oligonucleotide / oligonucleotide compositions. In some embodiments, the present disclosure demonstrates incorporation of one or more non-negatively charged internucleotidic linkage into a DMD oligonucleotide can greatly improve delivery and / or overall exon skipping efficiency.

[00163] In some embodiments, a treatment for muscular dystrophy employs the use of a DMD oligonucleotide, wherein the DMD oligonucleotide is capable of mediating (e.g., directing) skipping of DMD exon 51 or DMD exon 53. In some embodiments, a DMD oligonucleotide is capable of mediating the skipping of an exon which comprises a mutation (e.g., a frameshift, insertion, deletion, missense, or nonsense mutation, or other mutation), wherein translation of the mRNA with a skipped exon produces a truncated but functional (or largely functional) DMD protein.

[00164] In some embodiments, a composition comprising a DMD oligonucleotide is useful for treatment of a Dystrophin-related disorder of the central nervous system. In some embodiments, 2026204897   24 Jun 2026 the present disclosure pertains to a method of treatment of a Dystrophin-related disorder of the central nervous system, wherein the method comprises the step of administering a therapeutically effective amount of a DMD oligonucleotide to a patient suffering from a Dystrophin-related disorder of the central nervous system. In some embodiments, a DMD oligonucleotide is administered outside the central nervous system (as non-limiting examples, intravenously or intramuscularly) to a patient suffering from a Dystrophin-related disorder of the central nervous system, and the DMD oligonucleotide is capable of passing through the blood-brain barrier into the central nervous system. In some embodiments, a DMD oligonucleotide is administered directly into the central nervous system (as non-limiting example, via intrathecal, intraventricular, intracranial, etc., delivery).

[00165] In some embodiments, a Dystrophin-related disorder of the central nervous system, or a symptom thereof, can be any one or more of: decreased intelligence, decreased long term memory, decreased short term memory, language impairment, epilepsy, autism spectrum disorder, attention deficit hyperactivity disorder (ADHD), obsessive-compulsive disorder, learning problem, behavioral problem, a decrease in brain volume, a decrease in grey matter volume, lower white matter fractional anisotropy, higher white matter radial diffusivity, an abnormality of skull shape, or a deleterious change in the volume or structure of the hippocampus, globus pallidus, caudate putamen, hypothalamus, anterior commissure, periaqueductal gray, internal capsule, amygdala, corpus callosum, septal nucleus, nucleus accumbens, fimbria, ventricle, or midbrain thalamus. In some embodiments, a patient exhibiting muscle-related symptoms of muscular dystrophy also exhibits symptoms of a Dystrophin-related disorder of the central nervous system.

[00166] In some embodiments, a Dystrophin-related disorder of the central nervous system is related to, associated with and / or caused by an abnormality in the level, activity, expression and / or distribution of a gene product of the Dystrophin gene, such as full-length Dystrophin or a smaller isoform of Dystrophin, including, but not limited to, Dp260, Dp140, Dp116, Dp71 or Dp40. In some embodiments, a DMD oligonucleotide is administered into the central nervous system of a muscular dystrophy patient in order to ameliorate one or more systems of a Dystrophin-related disorder of the central nervous system. In some embodiments, a Dystrophin-related disorder of the central nervous system is related to, associated with and / or caused by an abnormality in the level, activity, expression and / or distribution of a gene product of the Dystrophin gene, such as full-length Dystrophin or a smaller isoform of Dystrophin, including, but not limited to, Dp260, Dp140, Dp116, Dp71 or Dp40. In some embodiments, administration of a DMD oligonucleotide to a patient suffering from a Dystrophin-related disorder of the central nervous system increases the level, activity, and / or expression and / or improves the distribution of a gene product of the Dystrophin gene.

[00167] In some embodiments, the present disclosure provides technologies for modulating dystrophin pre-mRNA splicing, whereby exon 51 or exon 53 is excised to remove a mutation.

[00168] In some embodiments, in a DMD patient, a DMD gene comprises an exon comprising 2026204897   24 Jun 2026 a mutation, and the disorder is at least partially treated by skipping of DMD exon 51 or DMD exon 53.

[00169] In some embodiments, in a DMD patient, a DMD gene or DMD transcript has a mutation in an exon(s), which is a missense or nonsense mutation and / or deletion, insertion, inversion, translocation or duplication.

[00170] In some embodiments, in a treatment for muscular dystrophy, an exon of DMD (e.g., exon 51 or 53) is skipped, wherein the exon encodes a string of amino acids not essential for DMD protein function, or whose skipping can provide a fully or at least partially functional DMD protein.

[00171] In some embodiments, in a treatment for muscular dystrophy, a DMD oligonucleotide is capable of mediating skipping of DMD exon 51 or 53, thereby creating an mRNA from which can be translated into an artificially internally truncated DMD protein variant which provides at least partially improved or fully restored biological activity.

[00172] In some embodiments, an internally truncated DMD protein variant produced from a dystrophin DMD transcript with a skipped exon 51 or skipped exon 53 is more functional than a terminally truncated DMD protein e.g., produced from a dystrophin DMD transcript with an out-offrame deletion.

[00173] In some embodiments, an internally truncated DMD protein variant produced from a dystrophin DMD transcript with a skipped exon 51 or skipped exon 53 is more resistant to nonsense-mediated decay, which can degrade a terminally truncated DMD protein, e.g., produced from a dystrophin DMD transcript with an out-of-frame deletion.

[00174] In some embodiments, a treatment for muscular dystrophy employs the use of a DMD oligonucleotide, wherein the DMD oligonucleotide is capable of mediating skipping of DMD exon 51 or DMD exon 53.

[00175] In some embodiments, the present disclosure encompasses the recognition that the nature and location of a DMD mutation may be utilized to design an exon-skipping strategy. In some embodiments, if a DMD patient has a mutation in an exon, skipping of the mutated exon can produce an internally truncated (internally shortened) but at least partially functional DMD protein variant.

[00176] In some embodiments, a DMD patient has a mutation which alters splicing of a DMD transcript, e.g., by inactivating a site required for splicing, or activating a cryptic site so that it becomes active for splicing, or by creating an alternative (e.g., unnatural) splice site. In some embodiments, such a mutation causes production of proteins with low or no activities. In some embodiments, splicing modulation, e.g., exon skipping, suppression of such a mutation, etc., can be employed to remove or reduce effects of such a mutation, e.g., by restoring proper splicing to produce proteins with restored activities, or producing an internally truncated dystrophin protein variant with improved or restored activities, etc.

[00177] In some embodiments, restoring the reading frame can convert an out-of-frame 2026204897   24 Jun 2026 mutation to an in-frame mutation; in some embodiments, in humans, such a change can transform severe Duchenne Muscular Dystrophy into milder Becker Muscular Dystrophy.

[00178] In some embodiments, a DMD patient or a patient suspected to have DMD is analyzed for DMD genotype prior to administration of a composition comprising a DMD oligonucleotide.

[00179] In some embodiments, a DMD patient or a patient suspected to have DMD is analyzed for DMD phenotype prior to administration of a composition comprising a DMD oligonucleotide.

[00180] In some embodiments, a DMD patient is analyzed for genotype and phenotype to determine the relationship of DMD genotype and DMD phenotype prior to administration of a composition comprising a DMD oligonucleotide.

[00181] In some embodiments, a patient is genetically verified to have dystrophy prior to administration of a composition comprising a DMD oligonucleotide.

[00182] In some embodiments, analysis of DMD genotype or genetic verification of DMD or a patient comprises determining if the patient has one or more deleterious mutations in DMD.

[00183] In some embodiments, analysis of DMD genotype or genetic verification of DMD or a patient comprises determining if the patient has one or more deleterious mutations in DMD and / or analyzing DMD splicing and / or detecting splice variants of DMD, wherein a splice variant is produced by an abnormal splicing of DMD.

[00184] In some embodiments, analysis of DMD genotype or genetic verification of DMD informs the selection of a composition comprising a DMD oligonucleotide useful for treatment.

[00185] In some embodiments, an abnormal or mutant DMD gene or a portion thereof is removed or copied from a patient or a patient’s cell(s) or tissue(s) and the abnormal or mutant DMD gene, or a portion thereof comprising the abnormality or mutation, or a copy thereof, is inserted into a cell. In some embodiments, this cell can be used to test various compositions comprising a DMD oligonucleotide to predict if such a composition would be useful as a treatment for the patient. In some embodiments, the cell is a myoblast or myotubule.

[00186] In some embodiments, an individual or patient can produce, prior to treatment with a DMD oligonucleotide, one or more splice variants of DMD, often each variant being produced at a very low level. In some embodiments, any appropriate method can be used to detect low levels of splice variants being produced in a patient prior to, during or after administration of a DMD oligonucleotide.

[00187] In some embodiments, a patient and / or the tissues thereof are analyzed for production of various splicing variants of a DMD gene prior to administration of a composition comprising a DMD oligonucleotide.

[00188] In some embodiments, the present disclosure provides methods for designing a DMD 2026204897   24 Jun 2026 oligonucleotide (e.g., a DMD oligonucleotide capable of mediating skipping of DMD exon 51 or DMD exon 53 of DMD). In some embodiments, the present disclosure utilizes rationale design described herein and optionally sequence walks to design DMD oligonucleotides, e.g., for testing exon skipping in one or more assays and / or conditions. In some embodiments, an efficacious DMD oligonucleotide is developed following rational design, including using various information of a given biological system.

[00189] In some embodiments, in a method for developing DMD oligonucleotides, DMD oligonucleotides are designed to anneal to one or more potential splicing-related motifs and then tested for their ability to mediate exon skipping. Example Technologies for Assessing Oligonucleotides and Oligonucleotide Compositions

[00190] Various technologies for assessing properties and / or activities of DMD oligonucleotides can be utilized in accordance with the present disclosure, e.g., US 20170037399, WO 2017 / 015555, WO 2017 / 015575, WO 2017 / 192664, WO 2017 / 062862, WO 2017 / 192679, WO 2017 / 210647, etc.

[00191] For example, DMD oligonucleotides can be evaluated for their ability to mediate exon skipping in various assays, including in vitro and in vivo assays, in accordance with the present disclosure. In vitro assays can be performed in various test cells described herein or known in the art, including but not limited to, A48-50 Patient-Derived Myoblast Cells. In vivo tests can be performed in test animals described herein or known in the art, including but not limited to, a mouse, rat, cat, pig, dog, monkey, or non-human primate.

[00192] As non-limiting examples, a number of assays are described below for assessing properties / activities of DMD oligonucleotides. Various other suitable assays are available and may be utilized to assess DMD oligonucleotide properties / activities, including those of DMD oligonucleotides not designed for exon skipping (e.g., for DMD oligonucleotides that may involve RNase H for reducing levels of target DMD transcripts, assays described in US 20170037399, WO 2017 / 015555, WO 2017 / 015575, WO 2017 / 192664, WO 2017 / 192679, WO 2017 / 210647, etc.).

[00193] A DMD oligonucleotide can be evaluated for its ability to mediate skipping of exon 51 or 53 in the Dystrophin RNA, which can be tested, as non-limiting examples, using nested PCR, qRT-PCR, and / or sequencing.

[00194] A DMD oligonucleotide can be evaluated for its ability to mediate protein restoration (e.g., production of an internally truncated Dystrophin protein variant lacking the amino acids corresponding to the codons encoded in the skipped exon, which has improved functions compared to proteins (if any) produced prior to exon skipping), which can be evaluated by a number of methods for protein detection and / or quantification, such as western blot, immunostaining, etc. Antibodies to dystrophin are commercially available or if desired, can be developed for desired purposes. 2026204897   24 Jun 2026

[00195] A DMD oligonucleotide can be evaluated for its ability to mediate production of a stable restored protein. Stability of restored protein can be tested, in non-limiting examples, in assays for serum and tissue stability.

[00196] A DMD oligonucleotide can be evaluated for its ability to bind protein, such as albumin. Example related technologies include those described, e.g., in WO 2017 / 015555, WO 2017 / 015575, etc.

[00197] A DMD oligonucleotide can be evaluated for immuno activity, e.g., through assays for cytokine activation, complement activation, TLR9 activity, etc. Example related technologies include those described, e.g., in WO 2017 / 015555, WO 2017 / 015575, WO 2017 / 192679, WO 2017 / 210647, etc.

[00198] In some embodiments, efficacy of a DMD oligonucleotide can be tested, e.g., in in silico analysis and prediction, a cell-free extract, a cell transfected with artificial constructs, an animal such as a mouse with a human Dystrophin transgene or portion thereof, normal and dystrophic human myogenic cell lines, and / or clinical trials. It may be desirable to utilize more than one assay, as normal and dystrophic human myogenic cell lines may sometimes produce different efficacy results under certain conditions (Mitrpant et al. 2009 Mol. Ther. 17: 1418).

[00199] In some embodiments, DMD oligonucleotides can be tested in vitro in cells. In some embodiments, testing in vitro in cells involves gymnotic delivery of the DMD oligonucleotide(s), or delivery using a delivery agent or transfectant, many of which are known in the art and may be utilized in accordance with the present disclosure.

[00200] In some embodiments, DMD oligonucleotides can be tested in vitro in normal human skeletal muscle cells (hSkMCs). See, for example, Arechavala et al. 2007 Hum. Gene Ther. 18: 798810.

[00201] In some embodiments, DMD oligonucleotides can be tested in a muscle explant from a DMD patient. Muscle explants from DMD patients are reported in, for example, Fletcher et al. 2006 J. Gene Med. 8: 207-216; McClorey et al. 2006 Neur. Dis. 16: 583-590; and Arechavala et al. 2007 Hum. Gene Ther. 18: 798-810.

[00202] In some embodiments, cells are or comprise cultured muscle cells from DMD patients. See, for example: Aartsma-Rus et al. 2003 Hum. Mol. Genet. 8: 907-914.

[00203] In some embodiments, an individual DMD oligonucleotide may demonstrate experiment-to-experiment variability in its ability to skip exon 51 or 53 under certain circumstances. In some embodiments, an individual DMD oligonucleotide can demonstrate variability in its ability to skip exon 51 or 53 depending on which cells are used, the growth conditions, and other experimental factors. To control variations, typically DMD oligonucleotides to be tested and control DMD oligonucleotides are assayed under the same or substantially the same conditions.

[00204] In vitro experiments also include those conducted with patient-derived myoblasts. 2026204897   24 Jun 2026 Certain results from such experiments were described herein. In certain such experiments, cells were cultured in skeletal growth media to keep them in a dividing / immature myoblast state. The media was then changed to ‘differentiation’ media (containing insulin and 2% horse serum) concurrent with spiking DMD oligonucleotides in the media for dosing. The cells differentiated into myotubes as they were getting dosed for a suitable period of time, e.g., a total of 4d for RNA experiments and 6d for protein experiments (such conditions referenced as ‘0d pre-differentiation’ (0d + 4d for RNA, 0d + 6d for protein)).

[00205] Without wishing to be bound by any particular theory, the present disclosure notes that it may be desirable to know if DMD oligonucleotides are able to enter mature myotubes and induce skipping in these cells as well as ‘immature’ cells. In some embodiments, the present disclosure provided assays to test effects of DMD oligonucleotides in myotubes. In some embodiments, a dosing schedule different from the ‘0d pre-differentiation’ was used, wherein the myoblasts were pre-differentiated into myotubes in differentiation media for several days (4d or 7d or 10d) and then DMD oligonucleotides were administered. Certain related protocols are described in Example 19.

[00206] In some embodiments, the present disclosure demonstrated that, in the pre differentiation experiments, DMD oligonucleotides (excluding those which are PMOs) usually give about the same level of RNA skipping and dystrophin protein restoration, regardless of the number of days cells were cultured in differentiation media prior to dosing. In some embodiments, the present disclosure provides DMD oligonucleotides that may be able to enter and be active in myoblasts and in myotubes. In some embodiments, a DMD oligonucleotide is tested in vitro in A45-52 DMD patient cells (also designated D45-52 or del45-52) or A52 DMD patient cells (also designated D52 or del52) with 0, 4 or 7 days of pre-differentiation.

[00207] In some embodiments, DMD oligonucleotides can be tested in any one or more of various animal models, including non-mammalian and mammalian models; including, as non-limiting examples, Caenorhabditis, Drosophila, zebrafish, mouse, rat, cat, dog and pig. See, for example, a review in McGreevey et al. 2015 Dis. Mod. Mech. 8: 195-213.

[00208] Example use of mdx mice is reported in, for example: Lu et al. 2003 Nat. Med. 9: 1009; Jearawiriyapaisarn et al. 2008 Mol. Ther., 16, 1624-1629; Yin et al. 2008 Hum. Mol. Genet., 17, 3909-3918; Wu et al. 2009 Mol. Ther., 17, 864-871; Wu et al. 2008 Proc. Natl Acad. Sci. USA, 105, 14814-14819; Mann et al. 2001 Proc. Nat. Acad. Sci. USA 98: 42-47; and Gebski et al. 2003 Hum. Mol. Gen. 12: 1801-1811.

[00209] Efficacy of DMD oligonucleotides can be tested in dogs, such as the Golden Retriever Muscular Dystrophy (GRMD) animal model. Lu et al. 2005 Proc. Natl. Acad. Sci. U S A 102:198-203; Alter et al. 2006 Nat. Med. 12:175-7; McClorey et al. 2006 Gene Ther. 13:1373-81; and Yokota et al. 2012 Nucl. Acid Ther. 22: 306. 2026204897   24 Jun 2026

[00210] A DMD oligonucleotide can be evaluated in vivo in a test animal for efficient delivery to various tissues (e.g., skeletal, heart and / or diaphragm muscle); this can be tested, in nonlimiting examples, by hybridization ELISA and tests for distribution in animal tissue.

[00211] A DMD oligonucleotide can be evaluated in vivo in a test animal for plasma PK; this can be tested, as non-limiting examples, by assaying for AUC (area under the curve) and half-life.

[00212] In some embodiments, DMD oligonucleotides can be tested in vivo, via an intramuscular administration a muscle of a test animal.

[00213] In some embodiments, DMD oligonucleotides can be tested in vivo, via an intramuscular administration into the gastrocnemius muscle of a test animal.

[00214] In some embodiments, DMD oligonucleotides can be tested in vivo, via an intramuscular administration into the gastrocnemius muscle of a mouse.

[00215] In some embodiments, DMD oligonucleotides can be tested in vivo, via an intramuscular administration into the gastrocnemius muscle of a mouse model transgenic for the entire human dystrophin locus. See, for example: Bremmer-Bout et al. 2004 Mol. Ther. 10, 232-240.

[00216] Additional tests which can be performed to evaluate the efficacy of DMO DMD oligonucleotides include centrally nucleated fiber counts and dystrophin-positive fiber counts, and functional grip strength analysis. See, as non-limiting examples, experimental protocols reported in: Yin et al. 2009 Hum. Mol. Genet. 18: 4405-4414.

[00217] Additional methods of testing DMD oligonucleotides include, as non-limiting example, methods reported in: Kinali et al. 2009 Lancet 8: 918; Bertoni et al. 2003 Hum. Mol. Gen. 12: 1087-1099. Certain Examples of Oligonucleotides and Compositions

[00218] In some embodiments, the present disclosure provides DMD oligonucleotides and / or DMD oligonucleotide compositions that are useful for various purposes, e.g., modulating skipping, reducing levels of DMD transcripts, improving levels of beneficial proteins, treating conditions, diseases and disorders, etc. In some embodiments, the present disclosure provides DMD oligonucleotide compositions with improved properties, e.g., increased skipping of exon 51 or 53, reduced toxicities, etc. Among other things, DMD oligonucleotides of the present disclosure comprise chemical modifications, stereochemistry, and / or combinations thereof which can improve various properties and activities of DMD oligonucleotides. Non-limiting examples are listed in Table A1. In some embodiments, a DMD oligonucleotide type is a type as defined by the base sequence, pattern of backbone linkages, pattern of backbone chiral centers and pattern of backbone phosphorus modifications of a DMD oligonucleotide in Table A1, wherein the DMD oligonucleotide comprises at least one chirally controlled internucleotidic linkage (at least one R or S in “Stereochemistry / Linkage”). 2026204897   24 Jun 2026

[00219] In some embodiments, the present disclosure pertains to a DMD oligonucleotide described herein, e.g., in Table A1.

[00220] In the following table ID indicates identification or DMD oligonucleotide number; and Description indicates the modified sequence. Table Al. Example Oligonucleotides. ID Description Naked Sequence Linkage / Stereochemistry wv- 3152 fU * SfC * SfA * SfA * SfG * SfG * SmAfA * SmGfA * SmUfG * SmGfC * SfA * SfU * SfU * SfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SSSSS SOSOS ososssss s wv- 7336 fU * fC * fA * fA * fGfG * mAfA * mGmA * fU * mGmGfC * fA * fU*fU*fU*fC*fU UCAAGGAAGAUGGCAUUUCU xxxxo xoxox XOOXX XXX X wv- 9517 fC * SfU * SfC * SfC * SfG * SfG * SfU * SfU * SmCfU * SmG * SfA * SmAmGfG * SfU * SfG * SfU * SfU * SfC CUCCGGUUCUGAAGGUGUUC SSSSS sssoss soosssss wv- 12880 fC * SfU * SfCnOOlfC * SfG * SfGnOOlfU * SfU * SmCfU * SmG * SfA * SmAfG * SfG * SfU * SfGnOOlfU * SfU * SfC CUCCGGUUCUGAAGGUGUUC SS nX SS nX SSOSS SOSSSnXSS wv- 13405 GTTGCCTCCGGTTCTGAAGGTGTTC GTTGCCTCCGGTTCTGAAGGT GTTC OOOOO 00000 00000 OOOOO 0000 wv- 13406 CTCCGGTTCTGAAGGTGTTC CTCCGGTTCTGAAGGTGTTC OOOOO OOOOO OOOOO 0000 wv- 13407 TGCCTCCGGTTCTGAAGGTGTTCTTGTA TGCCTCCGGTTCTGAAGGTGTT CTTGTA OOOOO OOOOO OOOOO OOOOO OOOOO 00 wv- 13826 fU * SfC * SfC * SfG * SfG * SfU * SfU * SmCfU * SmG * SfA * SmAmGfG * SfU * SfG * SfU * SfU * SfC UCCGGUUCUGAAGGUGUUC SSSSS SSOSS soosssss wv- 13827 fC * SfU * SfC * SfC * SfG * SfG * SfU * SfU * SmCfU * SmG * SfA * SmAmGfG * SfU * SfG * SfU * SfU CUCCGGUUCUGAAGGUGUU SSSSS sssoss soossss wv- 13835 fU * SfC * SfC * SfG * SfG * SfU * SfU * SmCfU * SmG * SfA * SmAmGfG * SfU * SfG * SfU * SfU * SfC * SfU UCCGGUUCUGAAGGUGUUCU SSSSS SSOSS soosssss s wv- 13864 fC * SfU * SfCnOOIRfC * SfG * SfGnOOIRfU * SfU * SmCfU * SmG * SfA * SmAfG * SfG * SfU * SfGnOOIRfU * SfU * SfC CUCCGGUUCUGAAGGUGUUC SS nR SS nR SSOSS SOSSS nRSS wv- 14344 fC * SfU * SfCnOOIRfC * SfG * SfGnOOIRfU * SfU * SmCfU * SmG * SfA * SmAfGfG * SfU * SfGnOOIRfU * SfU * SfC CUCCGGUUCUGAAGGUGUUC SS nR SS nR SSOSS SOOSS nR SS wv- 14522 fU * SfC * SfAnOOlfA * SfG * SfGnOOlmAfA * SmGmA * SfU * SmGmGfC * SfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SSnXSSnX OSOSSOOSSS nX SS wv- 14523 fU * SfC * SfAnOOlfA * SfG * SfGnOOlmAfA * SmGmA * SfU * SmGmGfCnOO 1 fA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SSnXSSnX OSOSSOO nX SS nX SS wv- 14791 fU * SfC * SfCnOOIRfG * SfG * SfUnOOIRfU * SmCfU * SmG * SfA * SmAmGfG * SfU * SfGnOOIRfU * SfU * SfC * SfU UCCGGUUCUGAAGGUGUUCU SS nR SS nR SOSSSOOSSnRSSS wv- 15860 fU * SfC * SfAnOOlfA * SfG * SfG * SmAfA * SmGmA * SfU * SmGmGfCnOOlfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SSSOSOS SOO nXSSnXSS wv- 15861 fU * SfC * SfAnOOlfA * SfG * SfGnOOlmAfA * SmGmA * SfU * SmGmGfC * SfA * SfU * SfU * SfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SSnXSSnX OSOSSOOSSSSS S wv- 15862 fU * SfC * SfA * SfA * SfG * SfG * SmAfA * SmGmA * SfU * SmGmGfCnOOlfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SSSSS SOSOS SOO nXSSnXSS wv- 17859 fU * SfC * SfAnOOlfA * SfG * SfG * SmA * SfA * SmGmA * SfU * SmGmGfCnOOlfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SSSSS OSSOO nXSSnXSS wv- 17860 fU * SfC * SfAnOOlfA * SfG * SfG * SmAfA * SmGmA * SfU * SmGmG * SfCnOOlfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SSSOSOS SOS nXSSnXSS wv- 17861 fU * SfC * SfAnOOlfA * SfG * SfG * SmA * SfA * SmGmA * SfU * SmGmG * SfCnOOlfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SSSSS OSSOS nXSSnXSS wv- 17862 fU * SfC * SfAnOOlfA * SfG * SfG * SfA * SfA * SmGmA * SfU * SmGfG * SfCnOOlfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SSSSS OSSOS nXSSnXSS wv- 17863 fU * SfC * SfAnOOlfA * SfG * SfGnOOlmA * SfA * SmGmA * SfU * SmGmGfC * SfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SS nX SSOSS OOSSS nXSS wv- 17864 fU * SfC * SfAnOOlfA * SfG * SfGnOOlmAfA * SmGmA * SfU * SmGmG * SfC * SfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SSnXSSnX OSOSSOSS SS nX SS wv- 17865 fU * SfC * SfAnOOlfA * SfG * SfGnOOlmA * SfA * SmGmA * SfU * SmGmG * SfC * SfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SS nX SSOSS OSSSS nX SS wv- 17866 fU * SfC * SfAnOOlfA * SfG * SfGnOOlfA * SfA * SmGmA * SfU * SmGfG * SfC * SfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SS nX SSOSS OSSSS nX SS wv- 20034 fU * SfG * SfAnOOlfA * SfA * SfUnOOlfC * SfU * SmG * SfC * SmC * SfA * SmG * SfA * SfG * SfC * SfAnOOlfG * SfG * SfU UGAAAUCUGCCAGAGCAGGU SS nX SS nX SSSSS SSSSS nX SS wv- 20034 fU * SfG * SfAnOOlfA * SfA * SfUnOOlfC * SfU * SmG * SfC * SmC * SfA * SmG * SfA * SfG * SfC * SfAnOOlfG * SfG * SfU UGAAAUCUGCCAGAGCAGGU SS nX SS nX SSSSS SSSSS nX SS wv- 20037 fA * SfA * SfUnOOlfC * SfU * SfGnOOlfC * SfC * SmA * SfG * SmA * SfG * SmC * SfA * SfG * SfG * SfUnOOlfA * SfC * SfC AAUCUGCCAGAGCAGGUACC SS nX SS nX SSSSS SSSSS nX SS wv- 20040 fC * SfU * SfGnOOlfC * SfC * SfAnOOlfG * SfA * SmG * SfC * SmA * SfG * SmG * SfU * SfA * SfC * SfCnOOlfU * SfC * SfC CUGCCAGAGCAGGUACCUCC SS nX SS nX SSSSS SSSSS nX SS wv- 20043 fC * SfC * SfAnOOlfG * SfA * SfGnOOlfC * SfA * SmG * SfG * SmU * SfA * SmC * SfC * SfU * SfC * SfCnOOlfA * SfA * SfC CCAGAGCAGGUACCUCCAAC SS nX SS nX SSSSS SSSSS nX SS wv- 20046 fG * SfA * SfGnOOlfC * SfA * SfGnOOlfG * SfU * SmA * SfC * SmC * SfU * SmC * SfC * SfA * SfA * SfCnOOlfA * SfU * SfC GAGCAGGUACCUCCAACAUC SS nX SS nX SSSSS SSSSS nX SS wv- 20049 fC * SfA * SfGnOOlfG * SfU * SfAnOOlfC * SfC * SmU * SfC * SmC * SfA * SmA * SfC * SfA * SfU * SfCnOOlfA * SfA * SfG CAGGUACCUCCAACAUCAAG SS nX SS nX SSSSS SSSSS nX SS wv- 20050 fA * SfG * SfGnOOlfU * SfA * SfCnOOlfC * SfU * SmC * SfC * SmA * SfA * SmC * SfA * SfU * SfC * SfAnOOlfA * SfG * SfG AGGUACCUCCAACAUCAAGG SS nX SS nX SSSSS SSSSS nX SS wv- 20051 fG * SfG * SfUnOOlfA * SfC * SfCnOOlfU * SfC * SmC * SfA * SmA * SfC * SmA * SfU * SfC * SfA * SfAnOOlfG * SfG * SfA GGUACCUCCAACAUCAAGGA SS nX SS nX SSSSS SSSSS nX SS wv- 20052 fG * SfU * SfAnOOlfC * SfC * SfUnOOlfC * SfC * SmA * SfA * SmC * SfA * SmU * SfC * SfA * SfA * SfGnOOlfG * SfA * SfA GUACCUCCAACAUCAAGGAA SS nX SS nX SSSSS SSSSS nX SS wv- 20053 fU * SfA * SfCnOOlfC * SfU * SfCnOOlfC * SfA * SmA * SfC * SmA * SfU * SmC * SfA * SfA * SfG * SfGnOOlfA * SfA * SfG UACCUCCAACAUCAAGGAAG SS nX SS nX SSSSS SSSSS nX SS wv- 20054 fA * SfC * SfCnOOlfU * SfC * SfCnOOlfA * SfA * SmC * SfA * SmU * SfC * SmA * SfA * SfG * SfG * SfAnOOlfA * SfG * SfA ACCUCCAACAUCAAGGAAGA SS nX SS nX SSSSS SSSSS nX SS wv- 20055 fC * SfC * SfUnOOlfC * SfC * SfAnOOlfA * SfC * SmA * SfU * SmC * SfA * SmA * SfG * SfG * SfA * SfAnOOlfG * SfA * SfU CCUCCAACAUCAAGGAAGAU SS nX SS nX SSSSS SSSSS nX SS wv- 20056 fC * SfU * SfCnOOlfC * SfA * SfAnOOlfC * SfA * SmU * SfC * SmA * SfA * SmG * SfG * SfA * SfA * SfGnOOlfA * SfU * SfG CUCCAACAUCAAGGAAGAUG SS nX SS nX SSSSS SSSSS nX SS wv- 20057 fU * SfC * SfCnOOlfA * SfA * SfCnOOlfA * SfU * SmC * SfA * SmA * SfG * SmG * SfA * SfA * SfG * SfAnOOlfU * SfG * SfG UCCAACAUCAAGGAAGAUGG SS nX SS nX SSSSS SSSSS nX SS wv- 20058 fC * SfC * SfAnOOlfA * SfC * SfAnOOlfU * SfC * SmA * SfA * SmG * SfG * SmA * SfA * SfG * SfA * SfUnOOlfG * SfG * SfC CCAACAUCAAGGAAGAUGGC SS nX SS nX SSSSS SSSSS nX SS wv- 20059 fC * SfA * SfAnOOlfC * SfA * SfUnOOlfC * SfA * SmA * SfG * SmG * SfA * SmA * SfG * SfA * SfU * SfGnOOlfG * SfC * SfA CAACAUCAAGGAAGAUGGCA SS nX SS nX SSSSS SSSSS nX SS wv- 20060 fA * SfA * SfCnOOlfA * SfU * SfCnOOlfA * SfA * SmG * SfG * SmA * SfA * SmG * SfA * SfU * SfG * SfGnOOlfC * SfA * SfU AACAUCAAGGAAGAUGGCAU SS nX SS nX SSSSS SSSSS nX SS wv- 20061 fA * SfC * SfAnOOlfU * SfC * SfAnOOlfA * SfG * SmG * SfA * SmA * SfG * SmA * SfU * SfG * SfG * SfCnOOlfA * SfU * SfU ACAUCAAGGAAGAUGGCAUU SS nX SS nX SSSSS SSSSS nX SS wv- 20062 fC * SfA * SfUnOOlfC * SfA * SfAnOOlfG * SfG * SmA * SfA * SmG * SfA * SmU * SfG * SfG * SfC * SfAnOOlfU * SfU * SfU CAUCAAGGAAGAUGGCAUUU SS nX SS nX SSSSS SSSSS nX SS wv- 20063 fA * SfU * SfCnOOlfA * SfA * SfGnOOlfG * SfA * SmA * SfG * SmA * SfU * SmG * SfG * SfC * SfA * SfUnOOlfU * SfU * SfC AUCAAGGAAGAUGGCAUUUC SS nX SS nX SSSSS SSSSS nX SS wv- 20064 fU * SfC * SfAnOOlfA * SfG * SfGnOOlfA * SfA * SmG * SfA * SmU * SfG * SmG * SfC * SfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SS nX SSSSS SSSSS nX SS wv- 20064 fU * SfC * SfAnOOlfA * SfG * SfGnOOlfA * SfA * SmG * SfA * SmU * SfG * SmG * SfC * SfA * SfU * SfUnOOlfU * SfC * SfU UCAAGGAAGAUGGCAUUUCU SS nX SS nX SSSSS SSSSS nX SS wv- 20065 fC * SfA * SfAnOOlfG * SfG * SfAnOOlfA * SfG * SmA * SfU * SmG * SfG * SmC * SfA * SfU * SfU * SfUnOOlfC * SfU * SfA CAAGGAAGAUGGCAUUUCUA SS nX SS nX SSSSS SSSSS nX SS wv- 20066 fA * SfA * SfGnOOlfG * SfA * SfAnOOlfG * SfA * SmU * SfG * SmG * SfC * SmA * SfU * SfU * SfU * SfCnOOlfU * SfA * SfG AAGGAAGAUGGCAUUUCUAG SS nX SS nX SSSSS SSSSS nX SS wv- 20067 fA * SfG * SfGnOOlfA * SfA * SfGnOOlfA * SfU * SmG * SfG * SmC * SfA * SmU * SfU * SfU * SfC * SfUnOOlfA * SfG * SfU AGGAAGAUGGCAUUUCUAGU SS nX SS nX SSSSS SSSSS nX SS wv- 20068 fG * SfG * SfAnOOlfA * SfG * SfAnOOlfU * SfG * SmG * SfC * SmA * SfU * SmU * SfU * SfC * SfU * SfAnOOlfG * SfU * SfU GGAAGAUGGCAUUUCUAGUU SS nX SS nX SSSSS SSSSS nX SS wv- 20069 fG * SfA * SfAnOOlfG * SfA * SfUnOOlfG * SfG * SmC * SfA * SmU * SfU * SmU * SfC * SfU * SfA * SfGnOOlfU * SfU * SfU GAAGAUGGCAUUUCUAGUUU SS nX SS nX SSSSS SSSSS nX SS wv- 20070 fA * SfA * SfGnOOlfA * SfU * SfGnOOlfG * SfC * SmA * SfU * SmU * SfU * SmC * SfU * SfA * SfG * SfUnOOlfU * SfU * SfG AAGAUGGCAUUUCUAGUUUG SS nX SS nX SSSSS SSSSS nX SS wv- 20070 fA * SfA * SfGnOOlfA * SfU * SfGnOOlfG * SfC * SmA * SfU * SmU * SfU * SmC * SfU * SfA * SfG * SfUnOOlfU * SfU * SfG AAGAUGGCAUUUCUAGUUUG SS nX SS nX SSSSS SSSSS nX SS wv- 20071 fA * SfG * SfAnOOlfU * SfG * SfGnOOlfC * SfA * SmU * SfU * SmU * SfC * SmU * SfA * SfG * SfU * SfUnOOlfU * SfG * SfG AGAUGGCAUUUCUAGUUUGG SS nX SS nX SSSSS SSSSS nX SS wv- 20072 fG * SfA * SfUnOOlfG * SfG * SfCnOOlfA * SfU * SmU * SfU * SmC * SfU * SmA * SfG * SfU * SfU * SfUnOOlfG * SfG * SfA GAUGGCAUUUCUAGUUUGGA SS nX SS nX SSSSS SSSSS nX SS wv- 20073 fA * SfU * SfGnOOlfG * SfC * SfAnOOlfU * SfU * SmU * SfC * SmU * SfA * SmG * SfU * SfU * SfU * SfGnOOlfG * SfA * SfG AUGGCAUUUCUAGUUUGGAG SS nX SS nX SSSSS SSSSS nX SS wv- 20073 fA * SfU * SfGnOOlfG * SfC * SfAnOOlfU * SfU * SmU * SfC * SmU * SfA * SmG * SfU * SfU * SfU * SfGnOOlfG * SfA * SfG AUGGCAUUUCUAGUUUGGAG SS nX SS nX SSSSS SSSSS nX SS wv- 20074 fU * SfG * SfGnOOlfC * SfA * SfUnOOlfU * SfU * SmC * SfU * SmA * SfG * SmU * SfU * SfU * SfG * SfGnOOlfA * SfG * SfA UGGCAUUUCUAGUUUGGAGA SS nX SS nX SSSSS SSSSS nX SS wv- 20075 fG * SfG * SfCnOOlfA * SfU * SfUnOOlfU * SfC * SmU * SfA * SmG * SfU * SmU * SfU * SfG * SfG * SfAnOOlfG * SfA * SfU GGCAUUUCUAGUUUGGAGAU SS nX SS nX SSSSS SSSSS nX SS wv- 20076 fG * SfC * SfAnOOlfU * SfU * SfUnOOlfC * SfU * SmA * SfG * SmU * SfU * SmU * SfG * SfG * SfA * SfGnOOlfA * SfU * SfG GCAUUUCUAGUUUGGAGAUG SS nX SS nX SSSSS SSSSS nX SS wv- 20076 fG * SfC * SfAnOOlfU * SfU * SfUnOOlfC * SfU * SmA * SfG * SmU * SfU * SmU * SfG * SfG * SfA * SfGnOOlfA * SfU * SfG GCAUUUCUAGUUUGGAGAUG SS nX SS nX SSSSS SSSSS nX SS wv- 20077 fC * SfA * SfUnOOlfU * SfU * SfCnOOlfU * SfA * SmG * SfU * SmU * SfU * SmG * SfG * SfA * SfG * SfAnOOlfU * SfG * SfG CAUUUCUAGUUUGGAGAUGG SS nX SS nX SSSSS SSSSS nX SS wv- 20078 fA * SfU * SfUnOOlfU * SfC * SfUnOOlfA * SfG * SmU * SfU * SmU * SfG * SmG * SfA * SfG * SfA * SfUnOOlfG * SfG * SfC AUUUCUAGUUUGGAGAUGGC SS nX SS nX SSSSS SSSSS nX SS wv- 20079 fU * SfU * SfUnOOlfC * SfU * SfAnOOlfG * SfU * SmU * SfU * SmG * SfG * SmA * SfG * SfA * SfU * SfGnOOlfG * SfC * SfA UUUCUAGUUUGGAGAUGGCA SS nX SS nX SSSSS SSSSS nX SS wv- 20080 fU * SfU * SfCnOOlfU * SfA * SfGnOOlfU * SfU * SmU * SfG * SmG * SfA * SmG * SfA * SfU * SfG * SfGnOOlfC * SfA * SfG UUCUAGUUUGGAGAUGGCAG SS nX SS nX SSSSS SSSSS nX SS wv- 20081 fU * SfC * SfUnOOlfA * SfG * SfUnOOlfU * SfU * SmG * SfG * SmA * SfG * SmA * SfU * SfG * SfG * SfCnOOlfA * SfG * SfU UCUAGUUUGGAGAUGGCAGU SS nX SS nX SSSSS SSSSS nX SS wv- 20082 fC * SfU * SfAnOOlfG * SfU * SfUnOOlfU * SfG * SmG * SfA * SmG * SfA * SmU * SfG * SfG * SfC * SfAnOOlfG * SfU * SfU CUAGUUUGGAGAUGGCAGUU SS nX SS nX SSSSS SSSSS nX SS wv- 20083 fU * SfA * SfGnOOlfU * SfU * SfUnOOlfG * SfG * SmA * SfG * SmA * SfU * SmG * SfG * SfC * SfA * SfGnOOlfU * SfU * SfU UAGUUUGGAGAUGGCAGUUU SS nX SS nX SSSSS SSSSS nX SS wv- 20084 fA * SfG * SfUnOOlfU * SfU * SfGnOOlfG * SfA * SmG * SfA * SmU * SfG * SmG * SfC * SfA * SfG * SfUnOOlfU * SfU * SfC AGUUUGGAGAUGGCAGUUUC SS nX SS nX SSSSS SSSSS nX SS wv- 20085 fG * SfU * SfUnOOlfU * SfG * SfGnOOlfA * SfG * SmA * SfU * SmG * SfG * SmC * SfA * SfG * SfU * SfUnOOlfU * SfC * SfC GUUUGGAGAUGGCAGUUUCC SS nX SS nX SSSSS SSSSS nX SS wv- 20086 fU * SfU * SfUnOOlfG * SfG * SfAnOOlfG * SfA * SmU * SfG * SmG * SfC * SmA * SfG * SfU * SfU * SfUnOOlfC * SfC * SfU UUUGGAGAUGGCAGUUUCCU SS nX SS nX SSSSS SSSSS nX SS wv- 20087 fU * SfU * SfGnOOlfG * SfA * SfGnOOlfA * SfU * SmG * SfG * SmC * SfA * SmG * SfU * SfU * SfU * SfCnOOlfC * SfU * SfU UUGGAGAUGGCAGUUUCCUU SS nX SS nX SSSSS SSSSS nX SS wv- 20088 fU * SfG * SfGnOOlfA * SfG * SfAnOOlfU * SfG * SmG * SfC * SmA * SfG * SmU * SfU * SfU * SfC * SfCnOOlfU * SfU * SfA UGGAGAUGGCAGUUUCCUUA SS nX SS nX SSSSS SSSSS nX SS wv- 20089 fG * SfG * SfAnOOlfG * SfA * SfUnOOlfG * SfG * SmC * SfA * SmG * SfU * SmU * SfU * SfC * SfC * SfUnOOlfU * SfA * SfG GGAGAUGGCAGUUUCCUUAG SS nX SS nX SSSSS SSSSS nX SS wv- 20090 fG * SfA * SfGnOOlfA * SfU * SfGnOOlfG * SfC * SmA * SfG * SmU * SfU * SmU * SfC * SfC * SfU * SfUnOOlfA * SfG * SfU GAGAUGGCAGUUUCCUUAGU SS nX SS nX SSSSS SSSSS nX SS wv- 20091 fA * SfG * SfAnOOlfU * SfG * SfGnOOlfC * SfA * SmG * SfU * SmU * SfU * SmC * SfC * SfU * SfU * SfAnOOlfG * SfU * SfA AGAUGGCAGUUUCCUUAGUA SS nX SS nX SSSSS SSSSS nX SS wv- 20092 fG * SfA * SfUnOOlfG * SfG * SfCnOOlfA * SfG * SmU * SfU * SmU * SfC * SmC * SfU * SfU * SfA * SfGnOOlfU * SfA * SfA GAUGGCAGUUUCCUUAGUAA SS nX SS nX SSSSS SSSSS nX SS wv- 20093 fA * SfU * SfGnOOlfG * SfC * SfAnOOlfG * SfU * SmU * SfU * SmC * SfC * SmU * SfU * SfA * SfG * SfUnOOlfA * SfA * SfC AUGGCAGUUUCCUUAGUAAC SS nX SS nX SSSSS SSSSS nX SS wv- 20094 fU * SfG * SfGnOOlfC * SfA * SfGnOOlfU * SfU * SmU * SfC * SmC * SfU * SmU * SfA * SfG * SfU * SfAnOOlfA * SfC * SfC UGGCAGUUUCCUUAGUAACC SS nX SS nX SSSSS SSSSS nX SS wv- 20095 fG * SfG * SfCnOOlfA * SfG * SfUnOOlfU * SfU * SmC * SfC * SmU * SfU * SmA * SfG * SfU * SfA * SfAnOOlfC * SfC * SfA GGCAGUUUCCUUAGUAACCA SS nX SS nX SSSSS SSSSS nX SS wv- 20096 fG * SfC * SfAnOOlfG * SfU * SfUnOOlfU * SfC * SmC * SfU * SmU * SfA * SmG * SfU * SfA * SfA * SfCnOOlfC * SfA * SfC GCAGUUUCCUUAGUAACCAC SS nX SS nX SSSSS SSSSS nX SS wv- 20097 fC * SfA * SfGnOOlfU * SfU * SfUnOOlfC * SfC * SmU * SfU * SmA * SfG * SmU * SfA * SfA * SfC * SfCnOOlfA * SfC * SfA CAGUUUCCUUAGUAACCACA SS nX SS nX SSSSS SSSSS nX SS wv- 20098 fA * SfG * SfUnOOlfU * SfU * SfCnOOlfC * SfU * SmU * SfA * SmG * SfU * SmA * SfA * SfC * SfC * SfAnOOlfC * SfA * SfG AGUUUCCUUAGUAACCACAG SS nX SS nX SSSSS SSSSS nX SS wv- 20099 fG * SfU * SfUnOOlfU * SfC * SfCnOOlfU * SfU * SmA * SfG * SmU * SfA * SmA * SfC * SfC * SfA * SfCnOOlfA * SfG * SfG GUUUCCUUAGUAACCACAGG SS nX SS nX SSSSS SSSSS nX SS wv- 20100 fU * SfU * SfUnOOlfC * SfC * SfUnOOlfU * SfA * SmG * SfU * SmA * SfA * SmC * SfC * SfA * SfC * SfAnOOlfG * SfG * SfU UUUCCUUAGUAACCACAGGU SS nX SS nX SSSSS SSSSS nX SS wv- 20101 fU * SfU * SfCnOOlfC * SfU * SfUnOOlfA * SfG * SmU * SfA * SmA * SfC * SmC * SfA * SfC * SfA * SfGnOOlfG * SfU * SfU UUCCUUAGUAACCACAGGUU SS nX SS nX SSSSS SSSSS nX SS wv- 20102 fU * SfC * SfCnOOlfU * SfU * SfAnOOlfG * SfU * SmA * SfA * SmC * SfC * SmA * SfC * SfA * SfG * SfGnOOlfU * SfU * SfG UCCUUAGUAACCACAGGUUG SS nX SS nX SSSSS SSSSS nX SS wv- 20103 fC * SfC * SfUnOOlfU * SfA * SfGnOOlfU * SfA * SmA * SfC * SmC * SfA * SmC * SfA * SfG * SfG * SfUnOOlfU * SfG * SfU CCUUAGUAACCACAGGUUGU SS nX SS nX SSSSS SSSSS nX SS wv- 20104 fC * SfU * SfUnOOlfA * SfG * SfUnOOlfA * SfA * SmC * SfC * SmA * SfC * SmA * SfG * SfG * SfU * SfUnOOlfG * SfU * SfG CUUAGUAACCACAGGUUGUG SS nX SS nX SSSSS SSSSS nX SS wv- 20105 fU * SfU * SfAnOOlfG * SfU * SfAnOOlfA * SfC * SmC * SfA * SmC * SfA * SmG * SfG * SfU * SfU * SfGnOOlfU * SfG * SfU UUAGUAACCACAGGUUGUGU SS nX SS nX SSSSS SSSSS nX SS wv- 20106 fU * SfA * SfGnOOlfU * SfA * SfAnOOlfC * SfC * SmA * SfC * SmA * SfG * SmG * SfU * SfU * SfG * SfUnOOlfG * SfU * SfC UAGUAACCACAGGUUGUGUC SS nX SS nX SSSSS SSSSS nX SS wv- 20107 fA * SfG * SfUnOOlfA * SfA * SfCnOOlfC * SfA * SmC * SfA * SmG * SfG * SmU * SfU * SfG * SfU * SfGnOOlfU * SfC * SfA AGUAACCACAGGUUGUGUCA SS nX SS nX SSSSS SSSSS nX SS wv- 20108 fG * SfU * SfAnOOlfA * SfC * SfCnOOlfA * SfC * SmA * SfG * SmG * SfU * SmU * SfG * SfU * SfG * SfUnOOlfC * SfA * SfC GUAACCACAGGUUGUGUCAC SS nX SS nX SSSSS SSSSS nX SS wv- 20109 fU * SfA * SfAnOOlfC * SfC * SfAnOOlfC * SfA * SmG * SfG * SmU * SfU * SmG * SfU * SfG * SfU * SfCnOOlfA * SfC * SfC UAACCACAGGUUGUGUCACC SS nX SS nX SSSSS SSSSS nX SS wv- 20110 fA * SfA * SfCnOOlfC * SfA * SfCnOOlfA * SfG * SmG * SfU * SmU * SfG * SmU * SfG * SfU * SfC * SfAnOOlfC * SfC * SfA AACCACAGGUUGUGUCACCA SS nX SS nX SSSSS SSSSS nX SS wv- 20111 fA * SfC * SfCnOOlfA * SfC * SfAnOOlfG * SfG * SmU * SfU * SmG * SfU * SmG * SfU * SfC * SfA * SfCnOOlfC * SfA * SfG ACCACAGGUUGUGUCACCAG SS nX SS nX SSSSS SSSSS nX SS wv- 20112 fC * SfC * SfAnOOlfC * SfA * SfGnOOlfG * SfU * SmU * SfG * SmU * SfG * SmU * SfC * SfA * SfC * SfCnOOlfA * SfG * SfA CCACAGGUUGUGUCACCAGA SS nX SS nX SSSSS SSSSS nX SS wv- 20113 fC * SfA * SfCnOOlfA * SfG * SfGnOOlfU * SfU * SmG * SfU * SmG * SfU * SmC * SfA * SfC * SfC * SfAnOOlfG * SfA * SfG CACAGGUUGUGUCACCAGAG SS nX SS nX SSSSS SSSSS nX SS wv- 20114 fA * SfC * SfAnOOlfG * SfG * SfUnOOlfU * SfG * SmU * SfG * SmU * SfC * SmA * SfC * SfC * SfA * SfGnOOlfA * SfG * SfU ACAGGUUGUGUCACCAGAGU SS nX SS nX SSSSS SSSSS nX SS wv- 20115 fC * SfA * SfGnOOlfG * SfU * SfUnOOlfG * SfU * SmG * SfU * SmC * SfA * SmC * SfC * SfA * SfG * SfAnOOlfG * SfU * SfA CAGGUUGUGUCACCAGAGUA SS nX SS nX SSSSS SSSSS nX SS wv- 20116 fA * SfG * SfGnOOlfU * SfU * SfGnOOlfU * SfG * SmU * SfC * SmA * SfC * SmC * SfA * SfG * SfA * SfGnOOlfU * SfA * SfA AGGUUGUGUCACCAGAGUAA SS nX SS nX SSSSS SSSSS nX SS wv- 20117 fG * SfG * SfUnOOlfU * SfG * SfUnOOlfG * SfU * SmC * SfA * SmC * SfC * SmA * SfG * SfA * SfG * SfUnOOlfA * SfA * SfC GGUUGUGUCACCAGAGUAAC SS nX SS nX SSSSS SSSSS nX SS wv- 20118 fG * SfU * SfUnOOlfG * SfU * SfGnOOlfU * SfC * SmA * SfC * SmC * SfA * SmG * SfA * SfG * SfU * SfAnOOlfA * SfC * SfA GUUGUGUCACCAGAGUAACA SS nX SS nX SSSSS SSSSS nX SS wv- 20119 fU * SfU * SfGnOOlfU * SfG * SfUnOOlfC * SfA * SmC * SfC * SmA * SfG * SmA * SfG * SfU * SfA * SfAnOOlfC * SfA * SfG UUGUGUCACCAGAGUAACAG SS nX SS nX SSSSS SSSSS nX SS wv- 20120 fU * SfG * SfUnOOlfG * SfU * SfCnOOlfA * SfC * SmC * SfA * SmG * SfA * SmG * SfU * SfA * SfA * SfCnOOlfA * SfG * SfU UGUGUCACCAGAGUAACAGU SS nX SS nX SSSSS SSSSS nX SS wv- 20121 fG * SfU * SfGnOOlfU * SfC * SfAnOOlfC * SfC * SmA * SfG * SmA * SfG * SmU * SfA * SfA * SfC * SfAnOOlfG * SfU * SfC GUGUCACCAGAGUAACAGUC SS nX SS nX SSSSS SSSSS nX SS wv- 20122 fU * SfG * SfUnOOlfC * SfA * SfCnOOlfC * SfA * SmG * SfA * SmG * SfU * SmA * SfA * SfC * SfA * SfGnOOlfU * SfC * SfU UGUCACCAGAGUAACAGUCU SS nX SS nX SSSSS SSSSS nX SS wv- 20123 fG * SfU * SfCnOOlfA * SfC * SfCnOOlfA * SfG * SmA * SfG * SmU * SfA * SmA * SfC * SfA * SfG * SfUnOOlfC * SfU * SfG GUCACCAGAGUAACAGUCUG SS nX SS nX SSSSS SSSSS nX SS wv- 20124 fU * SfC * SfAnOOlfC * SfC * SfAnOOlfG * SfA * SmG * SfU * SmA * SfA * SmC * SfA * SfG * SfU * SfCnOOlfU * SfG * SfA UCACCAGAGUAACAGUCUGA SS nX SS nX SSSSS SSSSS nX SS wv- 20125 fC * SfA * SfCnOOlfC * SfA * SfGnOOlfA * SfG * SmU * SfA * SmA * SfC * SmA * SfG * SfU * SfC * SfUnOOlfG * SfA * SfG CACCAGAGUAACAGUCUGAG SS nX SS nX SSSSS SSSSS nX SS wv- 20126 fA * SfC * SfCnOOlfA * SfG * SfAnOOlfG * SfU * SmA * SfA * SmC * SfA * SmG * SfU * SfC * SfU * SfGnOOlfA * SfG * SfU ACCAGAGUAACAGUCUGAGU SS nX SS nX SSSSS SSSSS nX SS wv- 20127 fC * SfC * SfAnOOlfG * SfA * SfGnOOlfU * SfA * SmA * SfC * SmA * SfG * SmU * SfC * SfU * SfG * SfAnOOlfG * SfU * SfA CCAGAGUAACAGUCUGAGUA SS nX SS nX SSSSS SSSSS nX SS wv- 20128 fC * SfA * SfGnOOlfA * SfG * SfUnOOlfA * SfA * SmC * SfA * SmG * SfU * SmC * SfU * SfG * SfA * SfGnOOlfU * SfA * SfG CAGAGUAACAGUCUGAGUAG SS nX SS nX SSSSS SSSSS nX SS wv- 20129 fA * SfG * SfAnOOlfG * SfU * SfAnOOlfA * SfC * SmA * SfG * SmU * SfC * SmU * SfG * SfA * SfG * SfUnOOlfA * SfG * SfG AGAGUAACAGUCUGAGUAGG SS nX SS nX SSSSS SSSSS nX SS wv- 20130 fG * SfA * SfGnOOlfU * SfA * SfAnOOlfC * SfA * SmG * SfU * SmC * SfU * SmG * SfA * SfG * SfU * SfAnOOlfG * SfG * SfA GAGUAACAGUCUGAGUAGGA SS nX SS nX SSSSS SSSSS nX SS wv- 20131 fA * SfG * SfUnOOlfA * SfA * SfCnOOlfA * SfG * SmU * SfC * SmU * SfG * SmA * SfG * SfU * SfA * SfGnOOlfG * SfA * SfG AGUAACAGUCUGAGUAGGAG SS nX SS nX SSSSS SSSSS nX SS wv- 20132 fG * SfU * SfAnOOlfA * SfC * SfAnOOlfG * SfU * SmC * SfU * SmG * SfA * SmG * SfU * SfA * SfG * SfGnOOlfA * SfG * SfC GUAACAGUCUGAGUAGGAGC SS nX SS nX SSSSS SSSSS nX SS wv- 20133 fU * SfA * SfAnOOlfC * SfA * SfGnOOlfU * SfC * SmU * SfG * SmA * SfG * SmU * SfA * SfG * SfG * SfAnOOlfG * SfC * SfU UAACAGUCUGAGUAGGAGCU SS nX SS nX SSSSS SSSSS nX SS wv- 20134 fA * SfA * SfCnOOlfA * SfG * SfUnOOlfC * SfU * SmG * SfA * SmG * SfU * SmA * SfG * SfG * SfA * SfGnOOlfC * SfU * SfA AACAGUCUGAGUAGGAGCUA SS nX SS nX SSSSS SSSSS nX SS wv- 20135 fA * SfC * SfAnOOlfG * SfU * SfCnOOlfU * SfG * SmA * SfG * SmU * SfA * SmG * SfG * SfA * SfG * SfCnOOlfU * SfA * SfA ACAGUCUGAGUAGGAGCUAA SS nX SS nX SSSSS SSSSS nX SS wv- 20136 fC * SfA * SfGnOOlfU * SfC * SfUnOOlfG * SfA * SmG * SfU * SmA * SfG * SmG * SfA * SfG * SfC * SfUnOOlfA * SfA * SfA CAGUCUGAGUAGGAGCUAAA SS nX SS nX SSSSS SSSSS nX SS wv- 20137 fA * SfG * SfUnOOlfC * SfU * SfGnOOlfA * SfG * SmU * SfA * SmG * SfG * SmA * SfG * SfC * SfU * SfAnOOlfA * SfA * SfA AGUCUGAGUAGGAGCUAAAA SS nX SS nX SSSSS SSSSS nX SS wv- 20138 fG * SfU * SfCnOOlfU * SfG * SfAnOOlfG * SfU * SmA * SfG * SmG * SfA * SmG * SfC * SfU * SfA * SfAnOOlfA * SfA * SfU GUCUGAGUAGGAGCUAAAAU SS nX SS nX SSSSS SSSSS nX SS wv- 20139 fU * SfC * SfUnOOlfG * SfA * SfGnOOlfU * SfA * SmG * SfG * SmA * SfG * SmC * SfU * SfA * SfA * SfAnOOlfA * SfU * SfA UCUGAGUAGGAGCUAAAAUA SS nX SS nX SSSSS SSSSS nX SS wv- 20140 fC * SfU * SfGnOOlfA * SfG * SfUnOOlfA * SfG * SmG * SfA * SmG * SfC * SmU * SfA * SfA * SfA * SfAnOOlfU * SfA * SfU CUGAGUAGGAGCUAAAAUAU SS nX SS nX SSSSS SSSSS nX SS In Table Al: Spaces in Table Al are utilized for formatting and readability, e.g., OXXXXX XXXXX XXXXX XXXX illustrates the same stereochemistry as OXXXXXXXXXXXXXXXXXXX; * S and *S both indicate phosphorothioate internucleotidic linkage wherein the linkage phosphorus has .S'p configuration; etc. All DMD oligonucleotides listed in Tables Al are single-stranded. As described in the present application, they may be used as a single strand, or as a strand to form complexes with one or more other strands. Some sequences, due to their length, are divided into multiple lines. ID: Identification number for an oligonucleotide. WV-13405, WV-13406 and WV-13407 are fully PMO (morpholino oligonucleotides). 2026204897   24 Jun 2026 Abbreviations in Tables: n001: non-negatively charged linkage (which is stereorandom unless otherwise indicated (e.g., as n001R, or n001S)); n001R: n001 being chirally controlled and having the Rp configuration; n001S: n001 being chirally controlled and having the Sp configuration; nX: in Linkage / Stereochemistry, nO or nX indicates a stereorandom n001; nR: in Linkage / Stereochemistry, nR indicates n001 being chirally controlled and having the Rp configuration; nS: in Linkage / Stereochemistry, nS indicates n001 being chirally controlled and having the Sp configuration; H)-- / F, f: 2’-F modification on the following nucleoside (e.g., fA (    '     F , wherein BA is nucleobase A)); x^%0v*BA m: 2’-OMe modification on the following nucleoside (e.g., mA (    '     OMe , wherein BA is nucleobase A)); *, PS: Phosphorothioate; *R, R, Rp: Phosphorothioate in Rp conformation; *S, S, Sp: Phosphorothioate in Sp conformation; X: Phosphorothioate stereorandom; O, PO: phosphodiester (phosphate). When no internucleotidic linkage is specified between two nucleoside units, the internucleotidic linkage is a phosphodiester linkage (natural phosphate linkage).

[00221] In some embodiments, each phosphorothioate internucleotidic linkage of a DMD oligonucleotide is independently a chirally controlled internucleotidic linkage. In some embodiments, a provided DMD oligonucleotide composition is a chirally controlled DMD oligonucleotide composition of a DMD oligonucleotide type listed in Table A1, wherein each phosphorothioate internucleotidic linkage of the DMD oligonucleotide is independently a chirally controlled internucleotidic linkage.

[00222] In some embodiments, the present disclosure provides compositions comprising or consisting of a plurality of provided DMD oligonucleotides (e.g., chirally controlled DMD oligonucleotide compositions). In some embodiments, all DMD oligonucleotides of the plurality are of the same type, i.e., all have the same base sequence, pattern of backbone linkages, pattern of 2026204897   24 Jun 2026 backbone chiral centers, and pattern of backbone phosphorus modifications. In some embodiments, all DMD oligonucleotides of the same type are structural identical. In some embodiments, provided compositions comprise DMD oligonucleotides of a plurality of DMD oligonucleotides types, typically in controlled amounts. In some embodiments, a provided chirally controlled DMD oligonucleotide composition comprises a combination of two or more provided DMD oligonucleotide types.

[00223] In some embodiments, a DMD oligonucleotide composition of the present disclosure is a chirally controlled DMD oligonucleotide composition, wherein the sequence of the DMD oligonucleotides of its plurality comprises or consists of a base sequence listed in Table A1.

[00224] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13405. provides a DMD oligonucleotide

[00225] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13405. provides a DMD oligonucleotide

[00226] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13406. provides a DMD oligonucleotide

[00227] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13407. provides a DMD oligonucleotide

[00228] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13826. provides a DMD oligonucleotide

[00229] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13827. provides a DMD oligonucleotide

[00230] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13835. provides a DMD oligonucleotide

[00231] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13835. provides a DMD oligonucleotide

[00232] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-13864. provides a DMD oligonucleotide

[00233] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-14344. provides a DMD oligonucleotide

[00234] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-14522. provides a DMD oligonucleotide

[00235] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-14523. provides a DMD oligonucleotide

[00236] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-14791. provides a DMD oligonucleotide

[00237] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-15860. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00238] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-15860.

[00239] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-15861.

[00240] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-15862.

[00241] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-17859.

[00242] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-17860.

[00243] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-17861.

[00244] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-17862.

[00245] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-17863.

[00246] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-17864.

[00247] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-17865.

[00248] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-17866.

[00249] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-20034.

[00250] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-20037.

[00251] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-20040.

[00252] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-20043.

[00253] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-20046.

[00254] In some embodiments, the present disclosure provides a DMD oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide composition, wherein the DMD oligonucleotide is WV-20049.

[00255] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-20050. 2026204897   24 Jun 2026

[00256] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20051. provides a DMD oligonucleotide

[00257] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20052. provides a DMD oligonucleotide

[00258] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20053. provides a DMD oligonucleotide

[00259] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20054. provides a DMD oligonucleotide

[00260] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20055. provides a DMD oligonucleotide

[00261] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20056. provides a DMD oligonucleotide

[00262] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20057. provides a DMD oligonucleotide

[00263] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20058. provides a DMD oligonucleotide

[00264] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20059. provides a DMD oligonucleotide

[00265] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20060. provides a DMD oligonucleotide

[00266] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20061. provides a DMD oligonucleotide

[00267] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20062. provides a DMD oligonucleotide

[00268] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20063. provides a DMD oligonucleotide

[00269] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20064. provides a DMD oligonucleotide

[00270] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20065. provides a DMD oligonucleotide

[00271] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20066. provides a DMD oligonucleotide

[00272] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20067. provides a DMD oligonucleotide

[00273] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-20067. 2026204897   24 Jun 2026

[00274] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20068. provides a DMD oligonucleotide

[00275] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20069. provides a DMD oligonucleotide

[00276] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20070. provides a DMD oligonucleotide

[00277] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20071. provides a DMD oligonucleotide

[00278] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20072. provides a DMD oligonucleotide

[00279] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20073. provides a DMD oligonucleotide

[00280] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20074. provides a DMD oligonucleotide

[00281] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20075. provides a DMD oligonucleotide

[00282] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20076. provides a DMD oligonucleotide

[00283] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20076. provides a DMD oligonucleotide

[00284] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20077. provides a DMD oligonucleotide

[00285] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20078. provides a DMD oligonucleotide

[00286] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20079. provides a DMD oligonucleotide

[00287] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20080. provides a DMD oligonucleotide

[00288] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20081. provides a DMD oligonucleotide

[00289] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20082. provides a DMD oligonucleotide

[00290] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20083. provides a DMD oligonucleotide

[00291] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-20084. 2026204897   24 Jun 2026

[00292] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20085. provides a DMD oligonucleotide

[00293] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20086. provides a DMD oligonucleotide

[00294] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20087. provides a DMD oligonucleotide

[00295] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20088. provides a DMD oligonucleotide

[00296] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20089. provides a DMD oligonucleotide

[00297] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20090. provides a DMD oligonucleotide

[00298] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20091. provides a DMD oligonucleotide

[00299] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20092. provides a DMD oligonucleotide

[00300] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20093. provides a DMD oligonucleotide

[00301] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20094. provides a DMD oligonucleotide

[00302] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20095. provides a DMD oligonucleotide

[00303] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20096. provides a DMD oligonucleotide

[00304] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20097. provides a DMD oligonucleotide

[00305] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20098. provides a DMD oligonucleotide

[00306] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20099. provides a DMD oligonucleotide

[00307] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20100. provides a DMD oligonucleotide

[00308] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20101. provides a DMD oligonucleotide

[00309] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20102. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00310] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20103. provides a DMD oligonucleotide

[00311] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20104. provides a DMD oligonucleotide

[00312] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20105. provides a DMD oligonucleotide

[00313] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20106. provides a DMD oligonucleotide

[00314] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20107. provides a DMD oligonucleotide

[00315] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20108. provides a DMD oligonucleotide

[00316] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20109. provides a DMD oligonucleotide

[00317] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20110. provides a DMD oligonucleotide

[00318] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20111. provides a DMD oligonucleotide

[00319] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20112. provides a DMD oligonucleotide

[00320] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20113. provides a DMD oligonucleotide

[00321] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20114. provides a DMD oligonucleotide

[00322] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20115. provides a DMD oligonucleotide

[00323] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20116. provides a DMD oligonucleotide

[00324] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20117. provides a DMD oligonucleotide

[00325] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20118. provides a DMD oligonucleotide

[00326] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20119. provides a DMD oligonucleotide

[00327] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20120. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00328] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20121. provides a DMD oligonucleotide

[00329] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20122. provides a DMD oligonucleotide

[00330] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20123. provides a DMD oligonucleotide

[00331] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20124. provides a DMD oligonucleotide

[00332] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20125. provides a DMD oligonucleotide

[00333] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20126. provides a DMD oligonucleotide

[00334] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20127. provides a DMD oligonucleotide

[00335] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20128. provides a DMD oligonucleotide

[00336] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20129. provides a DMD oligonucleotide

[00337] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20130. provides a DMD oligonucleotide

[00338] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20131. provides a DMD oligonucleotide

[00339] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20132. provides a DMD oligonucleotide

[00340] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20133. provides a DMD oligonucleotide

[00341] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20134. provides a DMD oligonucleotide

[00342] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20135. provides a DMD oligonucleotide

[00343] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20136. provides a DMD oligonucleotide

[00344] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20137. provides a DMD oligonucleotide

[00345] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20138. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00346] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-20139.

[00347] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-20140.

[00348] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-13835.

[00349] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-13864.

[00350] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-14344.

[00351] In some embodiments, the present disclosure provides a chirally controlled composition of DMD oligonucleotide WV-13835.

[00352] In some embodiments, the present disclosure provides a chirally controlled composition of DMD oligonucleotide WV-13864.

[00353] In some embodiments, the present disclosure provides a chirally controlled composition of DMD oligonucleotide WV-14344.

[00354] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-13405.

[00355] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-13406.

[00356] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-13407.

[00357] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-13826.

[00358] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-13827.

[00359] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-13835.

[00360] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-13864.

[00361] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-14344.

[00362] In some embodiments, the present disclosure provides a DMD composition, wherein the DMD oligonucleotide is WV-14522.

[00363] In some embodiments, the present disclosure provides a DMD oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide composition, wherein the DMD oligonucleotide is WV-14523. 2026204897   24 Jun 2026

[00364] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-14791. provides a DMD oligonucleotide

[00365] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-15860. provides a DMD oligonucleotide

[00366] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-15861. provides a DMD oligonucleotide

[00367] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-15862. provides a DMD oligonucleotide

[00368] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-17859. provides a DMD oligonucleotide

[00369] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-17860. provides a DMD oligonucleotide

[00370] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-17861. provides a DMD oligonucleotide

[00371] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-17862. provides a DMD oligonucleotide

[00372] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-17863. provides a DMD oligonucleotide

[00373] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-17864. provides a DMD oligonucleotide

[00374] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-17865. provides a DMD oligonucleotide

[00375] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-17866. provides a DMD oligonucleotide

[00376] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20034. provides a DMD oligonucleotide

[00377] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20037. provides a DMD oligonucleotide

[00378] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20040. provides a DMD oligonucleotide

[00379] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20043. provides a DMD oligonucleotide

[00380] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20046. provides a DMD oligonucleotide

[00381] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20049. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00382] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20050. provides a DMD oligonucleotide

[00383] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20051. provides a DMD oligonucleotide

[00384] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20052. provides a DMD oligonucleotide

[00385] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20053. provides a DMD oligonucleotide

[00386] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20054. provides a DMD oligonucleotide

[00387] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20055. provides a DMD oligonucleotide

[00388] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20056. provides a DMD oligonucleotide

[00389] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20057. provides a DMD oligonucleotide

[00390] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20058. provides a DMD oligonucleotide

[00391] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20059. provides a DMD oligonucleotide

[00392] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20060. provides a DMD oligonucleotide

[00393] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20061. provides a DMD oligonucleotide

[00394] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20062. provides a DMD oligonucleotide

[00395] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20063. provides a DMD oligonucleotide

[00396] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20064. provides a DMD oligonucleotide

[00397] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20065. provides a DMD oligonucleotide

[00398] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20066. provides a DMD oligonucleotide

[00399] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20067. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00400] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20068. provides a DMD oligonucleotide

[00401] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20069. provides a DMD oligonucleotide

[00402] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20070. provides a DMD oligonucleotide

[00403] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20071. provides a DMD oligonucleotide

[00404] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20072. provides a DMD oligonucleotide

[00405] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20073. provides a DMD oligonucleotide

[00406] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20074. provides a DMD oligonucleotide

[00407] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20075. provides a DMD oligonucleotide

[00408] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20076. provides a DMD oligonucleotide

[00409] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20076. provides a DMD oligonucleotide

[00410] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20077. provides a DMD oligonucleotide

[00411] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20078. provides a DMD oligonucleotide

[00412] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20079. provides a DMD oligonucleotide

[00413] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20080. provides a DMD oligonucleotide

[00414] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20081. provides a DMD oligonucleotide

[00415] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20082. provides a DMD oligonucleotide

[00416] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20083. provides a DMD oligonucleotide

[00417] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20084. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00418] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20085. provides a DMD oligonucleotide

[00419] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20086. provides a DMD oligonucleotide

[00420] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20087. provides a DMD oligonucleotide

[00421] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20088. provides a DMD oligonucleotide

[00422] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20089. provides a DMD oligonucleotide

[00423] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20090. provides a DMD oligonucleotide

[00424] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20091. provides a DMD oligonucleotide

[00425] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20092. provides a DMD oligonucleotide

[00426] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20093. provides a DMD oligonucleotide

[00427] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20094. provides a DMD oligonucleotide

[00428] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20095. provides a DMD oligonucleotide

[00429] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20096. provides a DMD oligonucleotide

[00430] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20097. provides a DMD oligonucleotide

[00431] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20098. provides a DMD oligonucleotide

[00432] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20099. provides a DMD oligonucleotide

[00433] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20100. provides a DMD oligonucleotide

[00434] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20101. provides a DMD oligonucleotide

[00435] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20102. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00436] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20103. provides a DMD oligonucleotide

[00437] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20104. provides a DMD oligonucleotide

[00438] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20105. provides a DMD oligonucleotide

[00439] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20106. provides a DMD oligonucleotide

[00440] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20107. provides a DMD oligonucleotide

[00441] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20108. provides a DMD oligonucleotide

[00442] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20109. provides a DMD oligonucleotide

[00443] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20110. provides a DMD oligonucleotide

[00444] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20111. provides a DMD oligonucleotide

[00445] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20112. provides a DMD oligonucleotide

[00446] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20113. provides a DMD oligonucleotide

[00447] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20114. provides a DMD oligonucleotide

[00448] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20115. provides a DMD oligonucleotide

[00449] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20116. provides a DMD oligonucleotide

[00450] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20117. provides a DMD oligonucleotide

[00451] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20118. provides a DMD oligonucleotide

[00452] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20119. provides a DMD oligonucleotide

[00453] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20120. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00454] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20121. provides a DMD oligonucleotide

[00455] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20122. provides a DMD oligonucleotide

[00456] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20123. provides a DMD oligonucleotide

[00457] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20124. provides a DMD oligonucleotide

[00458] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20125. provides a DMD oligonucleotide

[00459] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20126. provides a DMD oligonucleotide

[00460] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20127. provides a DMD oligonucleotide

[00461] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20128. provides a DMD oligonucleotide

[00462] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20129. provides a DMD oligonucleotide

[00463] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20130. provides a DMD oligonucleotide

[00464] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20131. provides a DMD oligonucleotide

[00465] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20132. provides a DMD oligonucleotide

[00466] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20133. provides a DMD oligonucleotide

[00467] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20134. provides a DMD oligonucleotide

[00468] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20135. provides a DMD oligonucleotide

[00469] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20136. provides a DMD oligonucleotide

[00470] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20137. provides a DMD oligonucleotide

[00471] In some embodiments, the present disclosure composition, wherein the DMD oligonucleotide is WV-20138. provides a DMD oligonucleotide 2026204897   24 Jun 2026

[00472] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-20139.

[00473] In some embodiments, the present disclosure provides a DMD oligonucleotide composition, wherein the DMD oligonucleotide is WV-20140.

[00474] In some embodiments, such a provided oligonucleotide composition may be chirally controlled, and comprises a plurality of the oligonucleotides, wherein one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) internucleotidic linkages are chirally controlled. In some embodiments, each chiral internucleotidic linkage is independently chirally controlled. In some embodiments, a chirally controlled internucleotidic linkage is one that of S, R, nR or nS as indicated in “Linkage / Stereochemistry” in Table A1.

[00475] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-13405.

[00476] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-13406.

[00477] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-13407.

[00478] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-13826.

[00479] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-13827.

[00480] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-13835.

[00481] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-13864.

[00482] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-14344.

[00483] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-14522.

[00484] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-14523.

[00485] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-14791.

[00486] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-15860.

[00487] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-15861.

[00488] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-15862.

[00489] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-17859.

[00490] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-17860.

[00491] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-17861.

[00492] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-17862.

[00493] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-17863.

[00494] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-17864.

[00495] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-17865.

[00496] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-17866.

[00497] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20034.

[00498] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20037.

[00499] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20040.

[00500] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20043.

[00501] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20046.

[00502] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20049.

[00503] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20050.

[00504] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20051.

[00505] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20052.

[00506] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20053.

[00507] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-20054.

[00508] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20055.

[00509] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20056.

[00510] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20057.

[00511] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20058.

[00512] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20059.

[00513] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20060.

[00514] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20061.

[00515] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20062.

[00516] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20063.

[00517] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20064.

[00518] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20065.

[00519] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-20066.

[00520] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20067.

[00521] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20067.

[00522] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20068.

[00523] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20069.

[00524] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20070.

[00525] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20071.

[00526] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20072.

[00527] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20073.

[00528] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20074.

[00529] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20075.

[00530] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20076.

[00531] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-20076.

[00532] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20077.

[00533] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20078.

[00534] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20079.

[00535] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20080.

[00536] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20081.

[00537] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20082.

[00538] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20083.

[00539] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20084.

[00540] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20085.

[00541] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20086.

[00542] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20087.

[00543] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-20088.

[00544] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20089.

[00545] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20090.

[00546] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20091.

[00547] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20092.

[00548] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20093.

[00549] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20094.

[00550] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20095.

[00551] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20096.

[00552] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20097.

[00553] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20098.

[00554] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20099.

[00555] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-20100.

[00556] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20101.

[00557] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20102.

[00558] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20103.

[00559] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20104.

[00560] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20105.

[00561] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20106.

[00562] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20107.

[00563] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20108.

[00564] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20109.

[00565] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20110.

[00566] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20111.

[00567] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-20112.

[00568] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20113.

[00569] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20114.

[00570] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20115.

[00571] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20116.

[00572] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20117.

[00573] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20118.

[00574] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20119.

[00575] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20120.

[00576] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20121.

[00577] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20122.

[00578] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20123.

[00579] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-20124.

[00580] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20125.

[00581] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20126.

[00582] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20127.

[00583] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20128.

[00584] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20129.

[00585] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20130.

[00586] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20131.

[00587] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20132.

[00588] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20133.

[00589] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20134.

[00590] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20135.

[00591] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a 2026204897   24 Jun 2026 DMD exon and the DMD oligonucleotide is WV-20136.

[00592] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20137.

[00593] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20138.

[00594] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20139.

[00595] In some embodiments, the present disclosure provides a chirally controlled DMD oligonucleotide composition, wherein the DMD oligonucleotide is capable of mediating skipping of a DMD exon and the DMD oligonucleotide is WV-20140.

[00596] In some experiments, provided DMD oligonucleotides can provide surprisingly high skipping of exon 51 or 53, e.g., when compared to those of Drisapersen and / or Eteplirsen. For example, various chirally controlled DMD oligonucleotide compositions each showed a superior capability, in some embodiments many fold higher, to mediate skipping of exon 51 or 53 in dystrophin, compared to Drisapersen and / or Eteplirsen. Certain data are provided in the present disclosure as examples.

[00597] In some embodiments, when assaying example DMD oligonucleotides in mice, DMD oligonucleotides are intravenous injected via tail vein in male C57BL / 10ScSndmdmdx mice (4-5 weeks old), at tested amounts, e.g., 10 mg / kg, 30 mg / kg, etc. In some embodiments, tissues are harvested at tested times, e.g., on Day, e.g., 2, 7 and / or 14, etc., after injection, in some embodiments, fresh-frozen in liquid nitrogen and stored in -80 °C until analysis.

[00598] Various assays can be used to assess DMD oligonucleotide levels in accordance with the present disclosure. In some embodiments, hybrid-ELISA is used to quantify DMD oligonucleotide levels in tissues using test article serial dilution as standard curve: for example, in an example procedure, maleic anhydride activated 96-well plate (Pierce 15110) was coated with 50 pl of capture probe at 500 nM in 2.5% NaHCO3 (Gibco, 25080-094) for 2 hours at 37 °C. The plate was then washed 3 times with PBST (PBS + 0.1% Tween-20), and blocked with 5% fat free milk-PBST at 37 °C for 1 hour. Test article DMD oligonucleotide was serial diluted into matrix. This standard together with original samples were diluted with lysis buffer (4 M Guanidine; 0.33% N-Lauryl Sarcosine; 25 mM Sodium Citrate; 10 mM DTT) so that DMD oligonucleotide amount in all samples is less than 100 ng / mL. 20 pl of diluted samples were mixed with 180 pl of 333 nM detection probe diluted in PBST, then denatured in PCR machine (65 °C, 10 min, 95 °C, 15 min, 4 C °°). 50 pl of denatured samples were distributed in blocked ELISA plate in triplicates, and incubated overnight at 4 2026204897   24 Jun 2026 °C. After 3 washes of PBST, 1:2000 streptavidin-AP in PBST was added, 50 pl per well and incubated at room temperature for 1 hour. After extensive wash with PBST, 100 pl of AttoPhos (Promega S1000) was added, incubated at room temperature in dark for 10 min and read on plate reader (Molecular Device, M5) fluorescence channel: Ex435 nm, Em555 nm. Oligonucleotides in samples were calculated according to standard curve by 4-parameter regression.

[00599] In some embodiments, provided DMD oligonucleotides are stable in both plasma and tissue homogenates. Example Dystrophin Oligonucleotides and Compositions for Exon Skipping of Exon 51

[00600] In some embodiments, the present disclosure provides DMD oligonucleotides, DMD oligonucleotide compositions, and methods of use thereof for mediating skipping of exon 51 in DMD (e.g., of mouse, human, etc.).

[00601] In some embodiments, a provided DMD oligonucleotide and / or composition is capable of mediating skipping of exon 51.

[00602] In some embodiments, non-limiting examples of such DMD oligonucleotides and compositions include those of: WV-12494, WV-12130, WV-12131, WV-12132, WV-12133, WV-12134, WV-12135, WV-12136, WV-12496, WV-12495, WV-12123, WV-12124, WV-12125, WV- 12126, WV-12127, WV-12128, WV-12129, WV-12553, WV-12554, WV-12555, WV-12556, WV- 12557, WV-12558, WV-12559, WV-12872, WV-12873, WV-12876, WV-12877, WV-12878, WV- 12879, WV-12880, WV-12881, WV-12882, WV-12883, WV-3152, WV-15860, WV-20034, WV-20037, WV-20040, WV-20043, WV-20046, WV-20049, WV-20050, WV-20051, WV-20052, WV- 20053, WV-20054, WV-20055, WV-20056, WV-20057, WV-20058, WV-20059, WV-20060, WV- 20061, WV-20062, WV-20063, WV-20064, WV-20065, WV-20066, WV-20067, WV-20068, WV- 20069, WV-20070, WV-20071, WV-20072, WV-20073, WV-20074, WV-20075, WV-20076, WV- 20077, WV-20078, WV-20079, WV-20080, WV-20081, WV-20082, WV-20083, WV-20084, WV- 20085, WV-20086, WV-20087, WV-20088, WV-20089, WV-20090, WV-20091, WV-20092, WV- 20093, WV-20094, WV-20095, WV-20096, WV-20097, WV-20098, WV-20099, WV-20100, WV- 20101, WV-20102, WV-20103, WV-20104, WV-20105, WV-20106, WV-20107, WV-20108, WV- 20109, WV-20110, WV-20111, WV-20112, WV-20113, WV-20114, WV-20115, WV-20116, WV- 20117, WV-20118, WV-20119, WV-20120, WV-20121, WV-20122, WV-20123, WV-20124, WV- 20125, WV-20126, WV-20127, WV-20128, WV-20129, WV-20130, WV-20131, WV-20132, WV- 20133, WV-20134, WV-20135, WV-20136, WV-20137, WV-20138, WV-20139, WV-20140, and other DMD oligonucleotides having a base sequence which comprises at least 15 contiguous bases of any of these DMD oligonucleotides.

[00603] In some embodiments, the sequence of the region of interest for exon 51 skipping differs between the mouse and human. 2026204897   24 Jun 2026

[00604] Various assays can be utilized to assess DMD oligonucleotides for exon skipping in accordance with the present disclosure. In some embodiments, in order to test the efficacy of a particular combination of chemistry and stereochemistry of a DMD oligonucleotide intended for exon 51 skipping in human, a corresponding DMD oligonucleotide can be prepared which has the mouse sequence, and then tested in mouse. The present disclosure recognizes that in the human and mouse homologs of exon 51, a few differences exist (underlined below): M GTGGTTACTAAGGAAACTGTCATCTCCAAACTAGAAATGCCATCTTCTTTGCTGTTGGAG H GTGGTTACTAAGGAAACTGCCATCTCCAAACTAGAAATGCCATCTTCCTTGATGTTGGAG where M is Mouse, nt 7571-7630; and H is Human, nt 7665-7724.

[00605] Because of these differences, slightly different DMD oligonucleotides for skipping exon 51 can be prepared for testing in mouse and human. As a non-limiting example, the following DMD oligonucleotide sequences can be used for testing in human and mouse: HUMAN DMD oligonucleotide sequence: UCAAGGAAGAUGGCAUUUCU MOUSE DMD oligonucleotide sequence: GCAAAGAAGAUGGCAUUUCU Mismatches between human and mouse are underlined.

[00606] A DMD oligonucleotide intended for treating a human subject can be constructed with a particular combination of base sequence (e.g., UCAAGGAAGAUGGCAUUUCU), and a particular pattern of chemistry, internucleotidic linkages, stereochemistry, and additional chemical moieties (if any). Such a DMD oligonucleotide can be tested in vitro in human cells or in vivo in human subjects, but may have limited suitability for testing in mouse, for example, because base sequences of the two have mismatches.

[00607] A corresponding DMD oligonucleotide can be constructed with the corresponding mouse base sequence (GCAAAGAAGAUGGCAUUUCU) and the same pattern of chemistry, internucleotidic linkages, stereochemistry, and additional chemical moieties (if any). Such a DMD oligonucleotide can be tested in vivo in mouse. Several DMD oligonucleotides comprising the mouse base sequence were constructed and tested.

[00608] In some embodiments, a human DMD exon skipping DMD oligonucleotide can be tested in a mouse which has been modified to comprise a DMD gene comprising the human sequence.

[00609] Various DMD oligonucleotides comprising various patterns of modifications are described herein. The Tables below show test results of certain DMD oligonucleotides. Generally, numbers indicate the amount of skipping, wherein 100 would indicate 100% skipping and 0 would indicate no skipping, unless otherwise indicated. To assay exon skipping of DMD, DMD oligonucleotides were tested in vitro in A52 human patient-derived myoblast cells and / or A45-52 human patient-derived myoblast cells (human cells wherein the exon 52 or exons 45-52 were already deleted). Unless noted otherwise, in various experiments, DMD oligonucleotides were delivered gymnotically. 2026204897   24 Jun 2026 Table 1. Activity of certain DMD oligonucleotides Activity of various DMD exon 51 DMD oligonucleotides was tested in vitro. Numbers indicate amount of skipping DMD exon 23 (as a percentage of total mRNA, where 100 would represent 100% skipped). Amounts tested were: 10, 3.3 and 1.1 uM. Conc. 10 3.3 1.1 Conc. 10 3.3 1.1 WV-3152 20.8 9 4.1 WV-14522 36.9 10.4 4.7 22 10 4.9 27.4 10.4 4.2 17.3 9.3 3.2 21 12.6 5.6 21.3 7.2 4.4 26.5 10.4 5.7 WV-15860 27.4 13.2 12.7 WV-14523 27.2 8.1 6.2 30.4 15.4 9 28.3 8.5 4.9 33 14.2 6 18.4 9.1 3.6 33.4 16.9 5.9 18.7 9.6 4.4 WV-15861 26.6 9.2 5.6 Mock 0.21 28.5 6.1 5.4 0.35 34.1 8.2 5.2 0.48 29.9 11.1 4 0.24 WV-15862 30.7 7.8 33.3 7.2 21.9 15.1 6.8 26.4 13.2 7.2 Table 2. Activity of certain DMD oligonucleotides Oligonucleotides for skipping DMD exon 51 were tested in vitro. Numbers indicate amount of skipping DMD exon 23 (as a percentage of total mRNA, where 100 would represent 100% skipped). Concentrations of DMD oligonucleotides used: 10, 3.3 and 1.1 uM. 10uM 3.3uM 1.1uM 10uM 3.3uM 1.1uM Mock 0.2 0.3 0.2 WV-17861 37.6 22.6 9 0.3 0.2 0.3 38.8 22.5 8.9 0.2 0 0.2 40.7 24.4 13.2 0.2 0.6 0.2 41.7 25.4 11.6 WV-7336 3.1 1.6 0.7 WV-17862 38.4 18.9 8.1 8.9 1.8 0.1 34.1 19.6 9 5.4 1.4 0.9 34.8 26 10 4.9 1.5 0.7 36.1 21.4 9.5 WV-3152 32.4 26.5 7.5 WV-17863 32.7 18.2 9.2 27.2 22.2 8.4 35.1 18.9 9.3 28 14.5 7.6 34.8 18.2 8.6 2026204897   24 Jun 2026 26.8 14.8 7.3 30.7 17 9 WV-15860 43.3 25.7 10.2 WV-17864 37.3 23.6 11.7 37.9 23.8 9.6 41.4 23.3 10.6 38.4 24.5 11.2 39.9 20.6 17.5 42.4 21.9 11 38.8 21.7 10.2 WV-17859 42.3 26.7 16.3 WV-17865 35.9 16.5 9.3 41.3 26 16.8 34 16.7 7.5 39.9 22.9 15.5 34.4 17.5 11.9 48.6 23.6 14.9 34.1 17.8 9.8 WV-17860 38.1 19.3 11.7 WV-17866 48.7 28.4 17.7 35.3 19.2 12 43.3 28.6 13.1 41 28.2 16.4 44.5 24.8 15.4 40.4 21.9 11.1 45.1 30.5 16.3 Table 3. Activity of certain DMD oligonucleotides Oligonucleotides for skipping DMD exon 51 were tested in vitro. Numbers indicate amount of skipping DMD exon 23 (as a percentage of total mRNA, where 100 would represent 100% skipped). Concentrations of DMD oligonucleotides used: 10 and 3.3 uM. 10uM 3.3uM 10uM 3.3uM Mock 0 0 WV-20058 14.6 4.8 0 0 0 0 12 3.7 0 0 12.6 3.5 WV-20034 15.9 7 WV-20061 35.8 26.5 17.1 8.4 16.1 7.3 39.3 24.2 15.3 7.2 39.9 22.8 WV-20037 29.7 18.3 WV-20064 26.5 17.6 27.2 17.5 26.6 19.4 24.5 16.4 29.2 18.4 27.5 17.1 WV-20040 9.6 4.9 WV-20067 15.7 8.3 9.1 5.2 16.8 9.3 11.4 3.5 17.3 8.6 10.9 2.9 16.3 8.7 WV-20043 20.2 9.6 WV-20070 41.3 26.4 20.4 9.8 31.7 22.3 18.9 9.8 39.7 27.2 21 10.4 38.4 26.9 WV-20046 28.5 14.7 WV-20073 30.9 21.1 29.8 14.2 26.9 17.9 29.2 15.8 31.1 20.2 2026204897   24 Jun 2026 26.6 14.5 30.7 22.2 WV-20049 20.9 11.6 WV-20076 23.2 16.8 18.9 11.4 18.6 12.2 21.8 16.9 18.4 11.7 22.8 15.8 WV-20052 28.8 18.8 WV-3152 35.7 24.8 30.1 18.6 33.5 24.9 29.6 20.1 32.1 25.3 WV-20055 26.8 17 WV-15860 41.9 27.5 25.3 16.6 43.6 30.7 24.1 17 42.4 30 Table 4A. Activity of certain DMD oligonucleotides Oligonucleotides for skipping DMD exon 51 were tested in vitro. Oligonucleotides were dosed 4d at 10uM. Numbers indicate amount of skipping DMD exon 51 (as a percentage of total mRNA, where 100 would represent 100% skipped). WV-3152 19 20 12 14 WV-20093 35 34 35 38 WV-15860 29 31 26 23 WV-20092 25 26 25 25 WV-20140 1 1 1 1 WV-20091 28 27 30 32 WV-20139 3 3 2 2 WV-20090 21 19 22 22 WV-20138 2 3 WV-20089 8 7 8 9 WV-20137 4 5 WV-20088 22 21 26 25 WV-20136 WV-20087 28 28 33 32 WV-20135 5 5 5 5 WV-20086 25 25 27 26 WV-20134 5 6 5 4 WV-20085 33 31 30 31 WV-20133 17 17 13 13 WV-20084 21 22 21 21 WV-20132 8 8 6 6 WV-20083 21 21 19 17 WV-20131 14 16 12 12 WV-20082 42 37 32 30 WV-20130 10 9 8 8 WV-20081 41 41 30 30 WV-20129 12 14 11 11 WV-20080 49 44 26 25 WV-20128 9 9 8 8 WV-20079 42 38 53 51 WV-20127 8 8 WV-20078 27 28 36 35 WV-20126 7 8 8 7 WV-20077 10 10 10 10 WV-20125 8 8 8 8 WV-20076 45 45 45 41 WV-20124 22 21 21 21 WV-20075 40 31 37 42 WV-20123 13 13 14 12 WV-20074 55 57 53 56 WV-20122 11 12 12 11 WV-20073 51 55 51 50 WV-20121 21 22 22 21 WV-20072 41 36 37 36 WV-20120 28 30 32 33 WV-20071 42 40 44 46 WV-20119 52 50 WV-20070 18 18 25 25 WV-20118 39 37 27 26 WV-20069 11 11 10 9 2026204897   24 Jun 2026 WV-20117 18 17 15 18 WV-20068 20 17 20 18 WV-20116 20 20 17 17 WV-20067 12 9 11 11 WV-20115 8 8 8 6 WV-20066 12 11 13 12 WV-20114 19 20 15 14 WV-20065 16 15 16 14 WV-20113 20 18 17 15 WV-20064 37 35 37 36 WV-20112 16 15 12 12 WV-20063 19 24 22 WV-20111 31 30 33 31 WV-20062 6 6 7 7 WV-20110 14 14 14 12 WV-20061 24 23 26 24 WV-20109 20 21 25 24 WV-20060 16 17 16 17 WV-20108 27 25 22 22 WV-20059 55 42 62 67 WV-20107 20 19 16 14 WV-20058 28 30 33 33 WV-20106 44 42 34 37 WV-20057 37 38 37 34 WV-20105 23 22 18 18 WV-20056 35 34 33 35 WV-20104 41 40 33 28 WV-20055 40 40 WV-20103 48 52 53 53 WV-20054 25 25 35 36 WV-20102 54 52 55 59 WV-20053 43 45 46 46 WV-20101 38 39 38 43 WV-20052 47 47 53 46 WV-20100 52 51 48 50 WV-20051 30 33 30 30 WV-20099 53 51 47 48 WV-20050 29 28 28 26 WV-20098 46 44 45 46 WV-20049 41 41 38 38 WV-20097 47 46 51 48 WV-20049 24 23 22 21 WV-20096 45 41 42 43 WV-20095 43 41 50 47 WV-20094 55 50 57 55 Table 4B. Activity of certain DMD oligonucleotides Patient A48-50 cells were dosed for 4d with oligonucleotides in differentiation media. RNA was harvested by Trizol extraction. TaqMan signal was normalized to SFSR9 internal control. Numbers indicate amount of skipping DMD exon 51 (as a percentage of total mRNA, where 100 would represent 100% skipped). 10uM 3.3uM 10uM 3.3uM Mock 0 0 WV-20058 14.6 4.8 0 0 0 0 12 3.7 0 0 12.6 3.5 WV-20034 15.9 7 WV-20061 35.8 26.5 17.1 8.4 16.1 7.3 39.3 24.2 15.3 7.2 39.9 22.8 WV-20037 29.7 18.3 WV-20064 26.5 17.6 27.2 17.5 26.6 19.4 24.5 16.4 2026204897   24 Jun 2026 29.2 18.4 27.5 17.1 WV-20040 9.6 4.9 WV-20067 15.7 8.3 9.1 5.2 16.8 9.3 11.4 3.5 17.3 8.6 10.9 2.9 16.3 8.7 WV-20043 20.2 9.6 WV-20070 41.3 26.4 20.4 9.8 31.7 22.3 18.9 9.8 39.7 27.2 21 10.4 38.4 26.9 WV-20046 28.5 14.7 WV-20073 30.9 21.1 29.8 14.2 26.9 17.9 29.2 15.8 31.1 20.2 26.6 14.5 30.7 22.2 WV-20049 20.9 11.6 WV- 20076 23.2 16.8 18.9 11.4 18.6 12.2 21.8 16.9 18.4 11.7 22.8 15.8 WV- 20052 28.8 18.8 WV- 3152 35.7 24.8 30.1 18.6 33.5 24.9 29.6 20.1 32.1 25.3 WV-20055 26.8 17 WV-15860 41.9 27.5 25.3 16.6 43.6 30.7 24.1 17 42.4 30 Table 4C. Activity of certain DMD oligonucleotides Patient-derived A48-50 cells were dosed with oligonucleotide in differentiation media under free-uptake conditions for 4 days. RNA harvested by Trizol extraction. TaqMan signal for DMD ‘skipped’ and DMD ‘total’ transcripts were normalized to SFSR9 internal control. Numbers indicate amount of skipping DMD exon 51 (as a percentage of total mRNA, where 100 would represent 100% skipped). 10uM 3.3uM 1.1uM Mock 0.2 0.3 0.2 0.3 0.2 0.3 0.2 0 0.2 0.2 0.6 0.2 WV-7336 3.1 1.6 0.7 8.9 1.8 0.1 5.4 1.4 0.9 2026204897   24 Jun 2026 4.9 1.5 0.7 WV-3152 32.4 26.5 7.5 27.2 22.2 8.4 28 14.5 7.6 26.8 14.8 7.3 WV-15860 43.3 25.7 10.2 37.9 23.8 9.6 38.4 24.5 11.2 42.4 21.9 11 WV-17859 42.3 26.7 16.3 41.3 26 16.8 39.9 22.9 15.5 48.6 23.6 14.9 WV-17860 38.1 19.3 11.7 35.3 19.2 12 41 28.2 16.4 40.4 21.9 11.1 WV-17861 37.6 22.6 9 38.8 22.5 8.9 40.7 24.4 13.2 41.7 25.4 11.6 WV-17862 38.4 18.9 8.1 34.1 19.6 9 34.8 26 10 36.1 21.4 9.5 WV-17863 32.7 18.2 9.2 35.1 18.9 9.3 34.8 18.2 8.6 30.7 17 9 WV-17864 37.3 23.6 11.7 41.4 23.3 10.6 39.9 20.6 17.5 38.8 21.7 10.2 WV-17865 35.9 16.5 9.3 34 16.7 7.5 34.4 17.5 11.9 34.1 17.8 9.8 WV-17866 48.7 28.4 17.7 43.3 28.6 13.1 44.5 24.8 15.4 45.1 30.5 16.3 Table 4D. Activity of certain DMD oligonucleotides Patient-derived A48-50 cells were dosed with oligonucleotide in differentiation media under free- 2026204897   24 Jun 2026 uptake conditions for 4 days. RNA from 24WP harvested by bead-based extraction. TaqMan signal for DMD ‘skipped’ and DMD ‘total’ transcripts were normalized to SFSR9 internal control. Numbers indicate amount of skipping DMD exon 51 (as a percentage of total mRNA, where 100 would represent 100% skipped). 10uM 3.3uM 10uM 3.3uM Mock 0 0 WV-20058 14.6 4.8 0 0 0 0 12 3.7 0 0 12.6 3.5 WV-20034 15.9 7 WV-20061 35.8 26.5 17.1 8.4 16.1 7.3 39.3 24.2 15.3 7.2 39.9 22.8 WV-20037 29.7 18.3 WV-20064 26.5 17.6 27.2 17.5 26.6 19.4 24.5 16.4 29.2 18.4 27.5 17.1 WV-20040 9.6 4.9 WV-20067 15.7 8.3 9.1 5.2 16.8 9.3 11.4 3.5 17.3 8.6 10.9 2.9 16.3 8.7 WV-20043 20.2 9.6 WV-20070 41.3 26.4 20.4 9.8 31.7 22.3 18.9 9.8 39.7 27.2 21 10.4 38.4 26.9 WV-20046 28.5 14.7 WV-20073 30.9 21.1 29.8 14.2 26.9 17.9 29.2 15.8 31.1 20.2 26.6 14.5 30.7 22.2 WV-20049 20.9 11.6 WV-20076 23.2 16.8 18.9 11.4 18.6 12.2 21.8 16.9 18.4 11.7 22.8 15.8 WV-20052 28.8 18.8 WV-3152 35.7 24.8 30.1 18.6 33.5 24.9 29.6 20.1 32.1 25.3 WV-20055 26.8 17 WV-15860 41.9 27.5 25.3 16.6 43.6 30.7 24.1 17 42.4 30 2026204897   24 Jun 2026 Table 4E. Activity of certain DMD oligonucleotides Conditions and parameters: A48-50 cells (Delta 48-50) (no pre-differentiation) in 96WP in biological duplicate at 10uM for 4 days Samples were lysed and baked in bead lysis buffer, frozen at -80 Bead-based extraction with manual (vs Bravo) washes Numbers indicate amount of skipping DMD exon 51 (as a percentage of total mRNA, where 100 would represent 100% skipped). WV-3152 19 20 12 14 WV-20094 55 50 57 55 WV-15860 29 31 26 23 WV-20093 35 34 35 38 WV-20140 1 1 1 1 WV-20092 25 26 25 25 WV-20139 3 3 2 2 WV-20091 28 27 30 32 WV-20138 2 3 WV-20090 21 19 22 22 WV-20137 4 5 WV-20089 8 7 8 9 WV-20136 WV-20088 22 21 26 25 WV-20135 5 5 5 5 WV-20087 28 28 33 32 WV-20134 5 6 5 4 WV-20086 25 25 27 26 WV-20133 17 17 13 13 WV-20085 33 31 30 31 WV-20132 8 8 6 6 WV-20084 21 22 21 21 WV-20131 14 16 12 12 WV-20083 21 21 19 17 WV-20130 10 9 8 8 WV-20082 42 37 32 30 WV-20129 12 14 11 11 WV-20081 41 41 30 30 WV-20128 9 9 8 8 WV-20080 49 44 26 25 WV-20127 8 8 WV-20079 42 38 53 51 WV-20126 7 8 8 7 WV-20078 27 28 36 35 WV-20125 8 8 8 8 WV-20077 10 10 10 10 WV-20124 22 21 21 21 WV-20076 45 45 45 41 WV-20123 13 13 14 12 WV-20075 40 31 37 42 WV-20122 11 12 12 11 WV-20074 55 57 53 56 WV-20121 21 22 22 21 WV-20073 51 55 51 50 WV-20120 28 30 32 33 WV-20072 41 36 37 36 WV-20119 52 50 WV-20071 42 40 44 46 WV-20118 39 37 27 26 WV-20070 18 18 25 25 WV-20117 18 17 15 18 WV-20069 11 11 10 9 WV-20116 20 20 17 17 WV-20068 20 17 20 18 WV-20115 8 8 8 6 WV-20067 12 9 11 11 WV-20114 19 20 15 14 WV-20066 12 11 13 12 WV-20113 20 18 17 15 WV-20065 16 15 16 14 WV-20112 16 15 12 12 WV-20064 37 35 37 36 WV-20111 31 30 33 31 WV-20063 19 24 22 WV-20110 14 14 14 12 WV-20062 6 6 7 7 2026204897   24 Jun 2026 WV-20109 20 21 25 24 WV-20061 24 23 26 24 WV-20108 27 25 22 22 WV-20060 16 17 16 17 WV-20107 20 19 16 14 WV-20059 55 42 62 67 WV-20106 44 42 34 37 WV-20058 28 30 33 33 WV-20105 23 22 18 18 WV-20057 37 38 37 34 WV-20104 41 40 33 28 WV-20056 35 34 33 35 WV-20103 48 52 53 53 WV-20055 40 40 WV-20102 54 52 55 59 WV-20054 25 25 35 36 WV-20101 38 39 38 43 WV-20053 43 45 46 46 WV-20100 52 51 48 50 WV-20052 47 47 53 46 WV-20099 53 51 47 48 WV-20051 30 33 30 30 WV-20098 46 44 45 46 WV-20050 29 28 28 26 WV-20097 47 46 51 48 WV-20049 41 41 38 38 WV-20096 45 41 42 43 WV-20049 24 23 22 21 WV-20095 43 41 50 47 Table 4F. Activity of certain DMD oligonucleotides Delta 48-50 cells were treated under free uptake conditions with 10uM of oligonucleotide in differentiation media for four days. RNA was extracted with Agilent bead-based protocol and reverse transcribed with random hexamers. TaqMan assays were targeted toward the total DMD transcript or the exon-junction corresponding to the skipped transcript, each run in multiplex with hSFSR9 internal control. Numbers indicate amount of skipping DMD exon 51 (as a percentage of total mRNA, where 100 would represent 100% skipped). WV-3152 19 20 12 14 WV-20094 55 50 57 55 WV-15860 29 31 26 23 WV-20093 35 34 35 38 WV-20140 1 1 1 1 WV-20092 25 26 25 25 WV-20139 3 3 2 2 WV-20091 28 27 30 32 WV-20138 2 3 WV-20090 21 19 22 22 WV-20137 4 5 WV-20089 8 7 8 9 WV-20136 WV-20088 22 21 26 25 WV-20135 5 5 5 5 WV-20087 28 28 33 32 WV-20134 5 6 5 4 WV-20086 25 25 27 26 WV-20133 17 17 13 13 WV-20085 33 31 30 31 WV-20132 8 8 6 6 WV-20084 21 22 21 21 WV-20131 14 16 12 12 WV-20083 21 21 19 17 WV-20130 10 9 8 8 WV-20082 42 37 32 30 WV-20129 12 14 11 11 WV-20081 41 41 30 30 WV-20128 9 9 8 8 WV-20080 49 44 26 25 2026204897   24 Jun 2026 WV-20127 8 8 WV-20079 42 38 53 51 WV-20126 7 8 8 7 WV-20078 27 28 36 35 WV-20125 8 8 8 8 WV-20077 10 10 10 10 WV-20124 22 21 21 21 WV-20076 45 45 45 41 WV-20123 13 13 14 12 WV-20075 40 31 37 42 WV-20122 11 12 12 11 WV-20074 55 57 53 56 WV-20121 21 22 22 21 WV-20073 51 55 51 50 WV-20120 28 30 32 33 WV-20072 41 36 37 36 WV-20119 52 50 WV-20071 42 40 44 46 WV-20118 39 37 27 26 WV-20070 18 18 25 25 WV-20117 18 17 15 18 WV-20069 11 11 10 9 WV-20116 20 20 17 17 WV-20068 20 17 20 18 WV-20115 8 8 8 6 WV-20067 12 9 11 11 WV-20114 19 20 15 14 WV-20066 12 11 13 12 WV-20113 20 18 17 15 WV-20065 16 15 16 14 WV-20112 16 15 12 12 WV-20064 37 35 37 36 WV-20111 31 30 33 31 WV-20063 19 24 22 WV-20110 14 14 14 12 WV-20062 6 6 7 7 WV-20109 20 21 25 24 WV-20061 24 23 26 24 WV-20108 27 25 22 22 WV-20060 16 17 16 17 WV-20107 20 19 16 14 WV-20059 55 42 62 67 WV-20106 44 42 34 37 WV-20058 28 30 33 33 WV-20105 23 22 18 18 WV-20057 37 38 37 34 WV-20104 41 40 33 28 WV-20056 35 34 33 35 WV-20103 48 52 53 53 WV-20055 40 40 WV-20102 54 52 55 59 WV-20054 25 25 35 36 WV-20101 38 39 38 43 WV-20053 43 45 46 46 WV-20100 52 51 48 50 WV-20052 47 47 53 46 WV-20099 53 51 47 48 WV-20051 30 33 30 30 WV-20098 46 44 45 46 WV-20050 29 28 28 26 WV-20097 47 46 51 48 WV-20049 41 41 38 38 WV-20096 45 41 42 43 WV-20049 24 23 22 21 WV-20095 43 41 50 47 Table 4G. Activity of certain DMD oligonucleotides Delta 48-50 cells were treated under free uptake conditions with 10uM of oligonucleotide in differentiation media for four days. RNA was extracted with Agilent bead-based protocol and reverse transcribed with random hexamers. TaqMan assays were targeted toward the total DMD transcript or the exon-junction corresponding to the skipped transcript, each run in multiplex with hSFSR9 internal control. Numbers indicate amount of skipping DMD exon 51 (as a percentage of total mRNA, where 100 2026204897   24 Jun 2026 would represent 100% skipped). WV-3152 19 20 12 14 WV-20094 55 50 57 55 WV-15860 29 31 26 23 WV-20093 35 34 35 38 WV-20140 1 1 1 1 WV-20092 25 26 25 25 WV-20139 3 3 2 2 WV-20091 28 27 30 32 WV-20138 2 3 WV-20090 21 19 22 22 WV-20137 4 5 WV-20089 8 7 8 9 WV-20136 WV-20088 22 21 26 25 WV-20135 5 5 5 5 WV-20087 28 28 33 32 WV-20134 5 6 5 4 WV-20086 25 25 27 26 WV-20133 17 17 13 13 WV-20085 33 31 30 31 WV-20132 8 8 6 6 WV-20084 21 22 21 21 WV-20131 14 16 12 12 WV-20083 21 21 19 17 WV-20130 10 9 8 8 WV-20082 42 37 32 30 WV-20129 12 14 11 11 WV-20081 41 41 30 30 WV-20128 9 9 8 8 WV-20080 49 44 26 25 WV-20127 8 8 WV-20079 42 38 53 51 WV-20126 7 8 8 7 WV-20078 27 28 36 35 WV-20125 8 8 8 8 WV-20077 10 10 10 10 WV-20124 22 21 21 21 WV-20076 45 45 45 41 WV-20123 13 13 14 12 WV-20075 40 31 37 42 WV-20122 11 12 12 11 WV-20074 55 57 53 56 WV-20121 21 22 22 21 WV-20073 51 55 51 50 WV-20120 28 30 32 33 WV-20072 41 36 37 36 WV-20119 52 50 WV-20071 42 40 44 46 WV-20118 39 37 27 26 WV-20070 18 18 25 25 WV-20117 18 17 15 18 WV-20069 11 11 10 9 WV-20116 20 20 17 17 WV-20068 20 17 20 18 WV-20115 8 8 8 6 WV-20067 12 9 11 11 WV-20114 19 20 15 14 WV-20066 12 11 13 12 WV-20113 20 18 17 15 WV-20065 16 15 16 14 WV-20112 16 15 12 12 WV-20064 37 35 37 36 WV-20111 31 30 33 31 WV-20063 19 24 22 WV-20110 14 14 14 12 WV-20062 6 6 7 7 WV-20109 20 21 25 24 WV-20061 24 23 26 24 WV-20108 27 25 22 22 WV-20060 16 17 16 17 WV-20107 20 19 16 14 WV-20059 55 42 62 67 WV-20106 44 42 34 37 WV-20058 28 30 33 33 WV-20105 23 22 18 18 WV-20057 37 38 37 34 WV-20104 41 40 33 28 WV-20056 35 34 33 35 WV-20103 48 52 53 53 WV-20055 40 40 2026204897   24 Jun 2026 WV-20102 54 52 55 59 WV-20054 25 25 35 36 WV-20101 38 39 38 43 WV-20053 43 45 46 46 WV-20100 52 51 48 50 WV-20052 47 47 53 46 WV-20099 53 51 47 48 WV-20051 30 33 30 30 WV-20098 46 44 45 46 WV-20050 29 28 28 26 WV-20097 47 46 51 48 WV-20049 41 41 38 38 WV-20096 45 41 42 43 WV-20049 24 23 22 21 WV-20095 43 41 50 47 Example Dystrophin Oligonucleotides and Compositions for Exon Skipping of Exon 53

[00610] In some embodiments, the present disclosure provides DMD oligonucleotides, DMD oligonucleotide compositions, and methods of use thereof for mediating skipping of exon 53 in DMD (e.g., of mouse, human, etc.).

[00611] In some embodiments, a DMD oligonucleotide, e.g., a human DMD exon 53 skipping DMD oligonucleotide can be tested in a mouse which has been modified to comprise a DMD gene comprising the human exon 53 sequence.

[00612] In some embodiments, a DMD oligonucleotide, e.g., a DMD oligonucleotide, is capable of mediating skipping of exon 53. Non-limiting examples of such DMD oligonucleotides include: WV-12880, WV-13826, WV-13827, WV-14791, WV-9517, WV-13835, WV-13864, WV-14344, and other DMD oligonucleotides having a base sequence which comprises at least 15 contiguous bases of any of these DMD oligonucleotides.

[00613] Results of various experiments for skipping Dystrophin exon 53 are described in the present disclosure. For example, data from a sequence identification screen are shown below, in Table 5.

[00614] Additional DMD oligonucleotides were tested for their ability to mediate skipping of a DMD exon, as shown below. Full PMO (Morpholino) DMD oligonucleotides have the following sequences: PMO SR WV-13405 GTTGCCTCCGGTTCTGAAGGTGTTC PMO WV WV-13406 CTCCGGTTCTGAAGGTGTTC PMO WV-13407 TGCCTCCGGTTCTGAAGGTGTTCTTGTA WV-13407 is also designated PMO NS. Table 5. Example data of certain DMD oligonucleotides. Numbers indicate amount of skipping relative to control. Oligonucleotide Conc [uM] WV-9517 WV-13826 WV-13827 WV-13835 Mock 10uM 45.7 46.5 23.1 40.5 1.2 46.3 45.8 22.9 58.8 1.1 49.3 46.8 26.8 54.5 1.3 2026204897   24 Jun 2026 48.5 50.3 28.1 55.2 1.2 3.3uM 18.1 20.3 7.9 24.6 1 17 19.5 8.3 25.3 1.1 22.6 19.7 8.8 26.6 1.1 22.8 20.2 8.3 27.2 1.1 1.1uM 6 7 2.9 7.9 1 6 6.2 2.7 7.4 1.2 6.9 7.3 0.7 9.6 0.9 6.6 6.8 0.9 9.1 0.7 WV-9517 WV-12880 WV-13864 WV-14344 MOCK 10uM 36.1 60.2 66.8 47.9 0.9 38.3 62.0 67.0 46.8 1.0 44.5 60.9 68.7 56.8 1.2 43.9 59.2 69.6 56.3 1.0 3.3uM 15.4 38.3 45.3 25.1 0.9 15.8 37.3 45.6 27.0 0.9 18.8 37.9 50.5 39.2 1.0 18.8 39.6 49.3 38.9 1.0 1.1uM 4.7 15.8 21.5 12.2 0.6 4.9 14.4 22.6 12.4 0.9 6.4 18.5 24.9 17.2 1.1 6.2 16.2 13.2 17.1 0.9 0.3uM 2.2 5.0 6.6 5.7 0.8 1.8 5.0 5.9 5.7 0.9 2.7 7.4 8.2 7.2 1.0 2.7 7.5 8.2 6.9 1.0 Table 6. Example data of certain DMD oligonucleotides. Skipping efficiency of various DMD oligonucleotides, tested for skipping of DMD exon 53. Numbers represent skipping of exon 53. A45-52 patient myoblasts were differentiated for 7days, then treated with DMD oligonucleotide for 4d under gymnotic conditions in differentiation media. RNA was harvested by Trizol extraction and skipping analyzed by TaqMan. Conc. 10uM 3.3uM 1.1uM 0.3uM 0.1uM Mock 1.1 1.2 0.8 1.0 1.0 1.1 2.0 0.9 1.0 1.1 0.7 1.1 1.0 1.1 1.2 0.7 1.1 0.9 1.0 WV-13405 (PMO) 44.8 28.6 18.1 9.5 4.0 44.8 23.4 17.4 8.7 4.0 51.2 26.5 11.4 5.1 3.7 50.8 25.6 11.2 5.5 3.6 2026204897   24 Jun 2026 WV-9517 35.9 18.3 6.5 2.2 1.9 36.6 17.3 6.4 2.1 1.9 40.2 23.4 5.5 2.7 1.7 38.7 25.6 5.9 2.2 1.8 Wv-12880 57.3 36.3 16.4 4.8 7.5 55.8 37.0 18.1 2.8 4.7 57.5 35.9 16.6 8.0 7.4 58.9 33.0 16.5 7.2 6.8 WV-13864 68.1 45.1 22.6 10.5 7.4 68.0 44.5 23.0 12.0 5.6 67.5 43.1 24.3 8.4 6.0 64.8 44.5 19.9 3.3 6.1 WV-13835 40.2 21.5 6.3 2.8 2.0 39.4 20.3 9.7 2.5 2.0 50.0 21.0 5.5 3.2 2.0 47.7 20.6 6.0 3.3 2.2 WV-14791 41.4 25.9 7.4 4.7 0.7 40.3 24.8 5.8 4.0 0.5 40.1 24.9 9.1 4.3 3.9 41.3 27.2 8.9 4.6 3.5 WV-14344 50.1 28.6 13.6 6.4 3.8 47.4 28.6 8.8 5.8 4.7 54.9 46.1 18.0 11.4 6.6 55.7 38.3 18.7 11.8 6.0 Table 7. Example data of certain DMD oligonucleotides. Skipping efficiency of various DMD oligonucleotides, tested for skipping of DMD exon 53. Numbers represent skipping of exon 53. A45-52 patient myoblasts were treated with DMD oligonucleotide for 4d (4 days) under gymnotic conditions in differentiation media. RNA was harvested by Trizol extraction and skipping analyzed by TaqMan. 10uM 3.3uM 1.1uM 0.3uM 0.1uM Mock 0.7 0.6 0.6 0.6 0.7 0.7 0.7 0.6 0.6 0.7 0.6 0.6 0.6 0.7 0.7 0.5 0.5 0.7 0.6 0.7 Wv-13405 (PMO) 9.4 1.5 3.4 1.1 0.8 9.3 1.4 3.1 1.1 0.8 6.6 2.8 1.5 0.9 0.8 6.3 2.6 1.5 1.0 0.8 WV-9517 29.3 8.4 2.6 1.0 0.7 28.7 9.2 3.0 1.1 0.8 2026204897   24 Jun 2026 16.6 6.6 2.3 1.1 0.7 16.9 6.8 2.2 1.1 0.9 WV-12880 37.9 17.7 9.6 3.4 1.3 38.8 19.9 9.1 3.3 1.4 31.4 16.1 7.9 3.3 1.6 31.6 16.8 8.0 3.0 1.5 WV-13864 55.9 28.6 11.7 4.3 2.0 54.3 27.8 11.6 4.6 2.0 43.4 22.2 10.7 4.2 2.0 43.0 22.7 9.8 3.8 2.1 WV-13835 38.7 11.6 2.9 1.3 0.9 37.2 11.0 2.9 1.3 0.8 42.3 13.1 3.5 1.2 0.9 41.5 10.0 3.1 1.3 0.9 WV-14791 26.3 12.1 5.2 1.9 1.3 24.8 11.2 4.7 2.1 1.1 28.0 13.0 5.2 2.2 1.2 27.6 12.4 4.9 2.1 1.4 WV-14344 36.2 17.8 8.0 2.7 1.7 37.4 17.0 7.1 2.7 1.8 37.4 22.3 9.8 3.7 1.7 36.6 22.6 9.9 3.7 1.5 Several DMD oligonucleotides (including WV-9517, WV-13864, WV-13835, and WV-14791) were tested at various concentrations up to 30 uM for TLR9 activation in vitro in HEK-blue-TLR9 cells (16 hour gymnotic uptake). WV-13864 and WV-14791 comprise a chirally controlled non-negatively charged internucleotidic linkage in the Rp configuration. WV-9517, WV-13864, WV-13835, and WV-14791 did not exhibit significant TLR9 activation (less than 2-fold TLR9 induction; data not shown). WV-13864 and WV-14791 also exhibited negligible signal up to 30uM in PBMC cytokine release assay compared to water (data not shown). Example Methods for Preparing Oligonucleotides and Compositions

[00615] Among other things, the present disclosure provides technologies (methods, reagents, conditions, purification processes, etc.) for preparing oligonucleotides and oligonucleotide compositions, including chirally controlled oligonucleotides and chirally controlled oligonucleotide nucleotides. Various technologies (methods, reagents, conditions, purification processes, etc.), as described herein, can be utilized to prepare provided oligonucleotides and compositions thereof in accordance with the present disclosure, including but not limited to those described in US 9695211, US 9605019, US 9598458, US 2013 / 0178612, US 20150211006, US 20170037399, WO 2017 / 015555, WO 2017 / 062862, WO 2017 / 160741, WO 2017 / 192664, WO 2017 / 192679, WO 2026204897   24 Jun 2026 2017 / 210647, WO 2018 / 223056, WO 2018 / 237194, and / or WO 2019 / 055951, the preparation technologies of each of which are incorporated herein by reference.

[00616] In some embodiments, the present disclosure provides chirally controlled oligonucleotides, e.g., chirally controlled DMD oligonucleotides. In some embodiments, a provided chirally controlled DMD oligonucleotide is over 50% pure. In some embodiments, a provided chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD chirally controlled DMD oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over oligonucleotide is over about 55% pure. In some about 60% pure. In some about 65% pure. In some about 70% pure. In some about 75% pure. In some about 80% pure. In some about 85% pure. In some about 90% pure. In some about 91% pure. In some about 92% pure. In some about 93% pure. In some about 94% pure. In some about 95% pure. In some about 96% pure. In some about 97% pure. In some about 98% pure. In some about 99% pure. In some embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided embodiments, a provided chirally controlled DMD oligonucleotide is over about 99.5% pure. In some embodiments, a provided chirally controlled DMD oligonucleotide is over about 99.6% pure. In some embodiments, a provided chirally controlled DMD oligonucleotide is over about 99.7% pure. In some embodiments, a provided chirally controlled DMD oligonucleotide is over about 99.8% pure. In some embodiments, a provided chirally controlled DMD oligonucleotide is over about 99.9% pure. In some embodiments, a provided chirally controlled DMD oligonucleotide is over at least about 99% pure.

[00617] In some embodiments, a chirally controlled oligonucleotide composition, e.g., a chirally controlled DMD oligonucleotide composition, is a composition designed to comprise a single oligonucleotide type. In certain embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 55% diastereomerically pure. In some embodiments, such compositions are about 60% diastereomerically pure. In some embodiments, such compositions are about 65% diastereomerically pure. In some embodiments, such compositions are about 70% diastereomerically pure. In some embodiments, such compositions are about 75% diastereomerically pure. In some 2026204897   24 Jun 2026 embodiments, such compositions are about 80% diastereomerically pure. In some embodiments, such compositions are about 85% diastereomerically pure. In some embodiments, such compositions are about 90% diastereomerically pure. In some embodiments, such compositions are about 91% diastereomerically pure. In some embodiments, such compositions are about 92% diastereomerically pure. In some embodiments, such compositions are about 93% diastereomerically pure. In some embodiments, such compositions are about 94% diastereomerically pure. In some embodiments, such compositions are about 95% diastereomerically pure. In some embodiments, such compositions are about 96% diastereomerically pure. In some embodiments, such compositions are about 97% diastereomerically pure. In some embodiments, such compositions are about 98% diastereomerically pure. In some embodiments, such compositions are about 99% diastereomerically pure. In some embodiments, such compositions are about 99.5% diastereomerically pure. In some embodiments, such compositions are about 99.6% diastereomerically pure. In some embodiments, such compositions are about 99.7% diastereomerically pure. In some embodiments, such compositions are about 99.8% diastereomerically pure. In some embodiments, such compositions are about 99.9% diastereomerically pure. In some embodiments, such compositions are at least about 99% diastereomerically pure.

[00618] Among other things, the present disclosure recognizes the challenge of stereoselective (rather than stereorandom or racemic) preparation of oligonucleotides, e.g., DMD oligonucleotides. Among other things, the prese...

Claims

1. An oligonucleotide having the structure of WV-14791:fU * SfC * SfCn001RfG * SfG * SfUn001RfU * SmCfU * SmG * SfA * SmAmGfG * SfU * SfGn001RfU * SfU * SfC * SfU,or a pharmaceutically acceptable salt form thereof, wherein:f represents a 2’-F modified nucleoside;*S represents a Sp phosphorothioate;m represents a 2’-OMe modified nucleoside; andn001R is                wherein the phosphorus is of the Rp configuration.

2. An oligonucleotide having the structure of WV-13826:fU * SfC * SfC * SfG * SfG * SfU * SfU * SmCfU * SmG * SfA * SmAmGfG * SfU * SfG * SfU * SfU * SfC,or a pharmaceutically acceptable salt form thereof, wherein:f represents a 2’-F modified nucleoside;*S represents a Sp phosphorothioate;m represents a 2’-OMe modified nucleoside.

3. An oligonucleotide having the structure of WV-13864:fC * SfU * SfCn001RfC * SfG * SfGn001RfU * SfU * SmCfU * SmG * SfA * SmAfG * SfG * SfU * SfGn001RfU * SfU * SfC,or a pharmaceutically acceptable salt form thereof, wherein:f represents a 2’-F modified nucleoside;*S represents a Sp phosphorothioate;m represents a 2’-OMe modified nucleoside; and / n001R is                wherein the phosphorus is of the Rp configuration.

4. An oligonucleotide having the structure of WV-13835:fU * SfC * SfC * SfG * SfG * SfU * SfU * SmCfU * SmG * SfA * SmAmGfG * SfU * SfG * SfU * SfU * SfC * SfU,or a pharmaceutically acceptable salt form thereof, wherein:f represents a 2’-F modified nucleoside;*S represents a Sp phosphorothioate; andm represents a 2’-OMe modified nucleoside.2026204897   24 Jun 20265. An oligonucleotide having the structure of WV-143444:fC * SfU * SfCn001RfC * SfG * SfGn001RfU * SfU * SmCfU * SmG * SfA * SmAfGfG *SfU * SfGn001RfU * SfU * SfC,or a pharmaceutically acceptable salt form thereof, wherein:f represents a 2’-F modified nucleoside;*S represents a Sp phosphorothioate;m represents a 2’-OMe modified nucleoside; and / n001R is                wherein the phosphorus is of the Rp configuration.

6. The oligonucleotide of any one of claims 1-5, wherein the oligonucleotide is in a salt form.

7. The oligonucleotide of claim 6, wherein the salt form is a sodium salt.

8. The oligonucleotide of claim 7, wherein the number of sodium ions in the sodium salt equals the total number of phosphorothioate and phosphate linkages in the oligonucleotide.

9. A chirally controlled oligonucleotide composition comprising a plurality of the oligonucleotide of any one of claims 1-8, wherein it is enriched, relative to a substantially racemic preparation of oligonucleotides of the same base sequence of the oligonucleotide for the oligonucleotide.

10. A pharmaceutical composition, comprising a therapeutically effective amount of the oligonucleotide of any one of claims 1-8 and a pharmaceutically acceptable inactive ingredient selected from pharmaceutically acceptable diluents, pharmaceutically acceptable excipients, and pharmaceutically acceptable carriers.

11. The pharmaceutical composition of claim 10, wherein the pharmaceutical composition is a solution.

12. An oligonucleotide composition for use in treatment of a disease, said use comprising altering splicing of a target transcript, wherein: the oligonucleotide composition being characterized in that, when it is contacted with the target transcript in a transcript splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof.

13. The oligonucleotide composition for use of claim 12, wherein(a) the splicing of the target transcript is altered relative to absence of the composition, preferably wherein the target transcript is pre-mRNA of dystrophin, and wherein the alteration is that one or more exon is skipped at an increased level relative to absence of the composition, more preferably wherein exon 53 of dystrophin is skipped at an increased level relative to absence of the composition; or(b) wherein the oligonucleotide composition is a composition of any one of claims 9-11.2026204897   24 Jun 202614. An oligonucleotide of any one of claims 1 to 8, or a composition of any one of claims 9-13 for use in treating Duchenne muscular dystrophy, said use comprising administering to a subject susceptible thereto or suffering therefrom an oligonucleotide of any one of claims 1 to 8, or a composition of any one of claims 9-13.

15. A method for preventing or treating DMD, comprising administering to a subject susceptible thereto or suffering therefrom an effective amount of a DMD oligonucleotide.

16. The method of claim 15, wherein the subject is has a mutation of the DMD gene that is amenable to exon 51 skipping, and the DMD oligonucleotide can provide exon 51 skipping.

17. The method of claim 15, wherein the subject is has a mutation of the DMD gene that is amenable to exon 53 skipping, and the DMD oligonucleotide can provide exon 53 skipping.

18. The method of claim 15, wherein the oligonucleotide is an oligonucleotide of any one of claims 18.

19. The method of claim 15, wherein the oligonucleotide is administered in a composition of any one of claims 9-13.

20. A method for preparing an oligonucleotide, comprising using of a chiral auxiliary, phosphoramidite or an azide reagent, or a condition described in the specification.

21. An oligonucleotide, chiral auxiliary, phosphoramidite, composition or method described in the specification.