Nucleic acid vector, transgenic plant, methods for producing a transgenic plant cell and for expressing a polynucleotide sequence of interest in a plant cell, and use of a plant, plant part, plant cell or seed.

Abstract

The present disclosure relates to compositions and methods for promoting the transcription of a nucleotide sequence in a plant or plant cell, employing a promoter of a gmtefs1 gene. Some embodiments relate to a promoter or a 5α UTR of a gmtefs1 gene that functions in plants to promote the transcription of functionally linked nucleotide sequences. Other embodiments relate to a 3α UTR or a terminator of a gmtefs1 gene that functions in plants to promote the transcription of functionally linked nucleotide sequences.

Description

1 / 137 Descriptive Report of the Invention Patent for NUCLEIC ACID VECTOR, TRANSGENIC PLANT, METHODS FOR PRODUCING A TRANSGENIC PLANT CELL AND FOR EXPRESSING A POLYNUCLEOTIDE SEQUENCE OF INTEREST IN A PLANT CELL AND USE OF A PLANT, PLANT PART, PLANT CELL OR SEED. INCORPORATION BY REFERENCE.

[001] This application claims the benefit of Provisional Patent Application serial number US 62 / 587,034, filed November 16, 2017, which is expressly incorporated by reference herein in its entirety.

[002] Incorporated by way of reference, in its entirety, is a computer-readable nucleotide / amino acid sequence listing submitted concurrently with this document and identified as follows: a 30.0 KB ASCII (Text) file named 80596_ST25 on November 16, 2017. BACKGROUND

[003] Many plant species have the capacity to be transformed with transgenes to introduce agronomically desirable traits or characteristics. The resulting plant species are developed and / or modified to have particular desirable traits. In general, desirable traits include, for example, improving nutritional value, increasing yield, conferring resistance to pests or diseases, increasing tolerance to stress and drought, improving horticultural qualities (e.g., pigmentation and growth), conferring herbicide tolerance, enabling the production of industrially useful compounds and / or plant materials, and / or enabling the production of pharmaceuticals.

[004] Transgenic plant species comprising multiple transgenes stacked at a single genomic locus are Petition 870210100564, dated 10 / 29 / 2021, page 5 / 151 2 / 137 produced through plant transformation technologies. Plant transformation technologies result in the introduction of a transgene into a plant cell, recovery of a fertile transgenic plant containing the stably integrated copy of the transgene in the plant genome, and subsequent transgene expression through transcription and translation outputs in transgenic plants possessing desirable traits and phenotypes. However, innovative gene regulatory elements that allow the production of transgenic plant species to highly express multiple manipulated transgenes as a set of traits are desirable.

[005] Similarly, innovative gene regulatory elements that allow the expression of a transgene in particular tissues or organs of a plant are desirable. For example, increased plant resistance to infection by soil-borne pathogens can be achieved by transforming the plant genome with a pathogen resistance gene, so that the pathogen resistance protein is robustly expressed in the plant roots. Alternatively, it may be desirable to express a transgene in plant tissues that are at a particular stage of development or growth, such as cell division or elongation. Furthermore, it may be desirable to express a transgene in leaf and stem tissues of a plant to provide herbicide tolerance, or resistance to aboveground insects and pests.

[006] Therefore, there is a need for innovative gene regulatory elements that can lead to desirable levels of transgene expression in specific plant tissues. BRIEF SUMMARY

[007] In embodiments of the present invention, the disclosure relates to a nucleic acid vector comprising a promoter functionally linked to: a polylinking sequence; a sequence of Petition 870210100564, dated 10 / 29 / 2021, p. 6 / 151 3 / 137 non-GmTEFsl heterologous coding, wherein said promoter comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO:2. In other embodiments, said promoter is 371 bp in length. In other embodiments, the promoter consists of a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO:2. In further embodiments, said promoter is functionally linked to a heterologous coding sequence. Consequently, the heterologous coding sequence encodes a selectable marker protein, an insecticide resistance protein, a herbicide tolerance protein, a nitrogen use efficiency protein, a water use efficiency protein, a small RNA molecule, a nutritional quality protein, or a DNA-binding protein. In other embodiments, the nucleic acid vector comprises a terminator polynucleotide sequence.In further embodiments, the nucleic acid vector comprises a 3' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises a 5' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises an intron sequence. In further embodiments, said promoter has tissue-constitutive expression. In other embodiments, the nucleic acid vector comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO:2 functionally linked to a heterologous coding sequence. In other embodiments, said plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, Glycine max, cotton, Arabidopsis, tobacco, sunflower, and canola. In yet another embodiment, said plant is Glycine max. In some embodiments, the heterologous coding sequence is inserted into the genome. Petition 870210100564, dated 10 / 29 / 2021, page 7 / 151 4 / 137 of said plant. In other embodiments, the promoter comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID NO:2, and said promoter is functionally linked to a heterologous coding sequence. In further embodiments, the transgenic plant comprises an untranslated 3' sequence. In other embodiments, said heterologous coding sequence has tissue-constitutive expression. In further embodiments, the transgenic plant comprises said promoter of 371 bp in length.

[008] In embodiments of the present disclosure, the disclosure relates to a method for producing a transgenic plant cell, wherein the method comprises the steps of transforming a plant cell with a gene expression cassette comprising a GmTEFs1 promoter functionally linked to at least one polynucleotide sequence of interest; isolating the transformed plant cell comprising the gene expression cassette; and producing a transgenic plant cell comprising the GmTEFs1 promoter functionally linked to at least one polynucleotide sequence of interest. In other embodiments, the transformation of a plant cell is performed using a plant transformation method.In some embodiments, the plant transformation method is selected from a group consisting of an Agrobacterium-mediated transformation method, a biolistic transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method. In other embodiments, the polynucleotide sequence of interest is expressed in a plant cell. In other embodiments, the polynucleotide sequence of interest is stably integrated into the genome of the transgenic plant cell. In other embodiments, the method comprises regenerating the transgenic plant cell. Petition 870210100564, dated 10 / 29 / 2021, page 8 / 151 5 / 137 gene expression in a transgenic plant; and obtain the transgenic plant, wherein the transgenic plant comprises the gene expression cassette comprising the GmTEFs1 promoter functionally linked to at least one polynucleotide sequence of interest. In other embodiments, the transgenic plant cell is either a monocotyledonous transgenic plant cell or a dicotyledonous transgenic plant cell. Examples of dicotyledonous transgenic plant cells include an Arabidopsis plant cell, a tobacco plant cell, a Glycine max plant cell, a canola plant cell, and a cotton plant cell. Examples of monocotyledonous transgenic plant cells include a Zea mays plant cell, a rice plant cell, and a wheat plant cell. In some embodiments, the GmTEFs1 promoter comprises the polynucleotide of SEQ ID NO:2.In other embodiments, the GmTEFs1 promoter comprises a first polynucleotide sequence of interest functionally linked to the 3' end of SEQ ID NO:2. In further embodiments, the method comprises introducing into the plant cell a polynucleotide sequence of interest functionally linked to a GmTEFs1 promoter. In other embodiments, the polynucleotide sequence of interest functionally linked to the GmTEFs1 promoter is introduced into the plant cell by a plant transformation method. Examples of plant transformation methods include an Agrobacterium-mediated transformation method, a biolistic transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method. In other embodiments, the polynucleotide sequence of interest is expressed in embryonic cell tissue.In additional embodiments, the polynucleotide sequence of interest is stably integrated into the plant cell genome. In some embodiments, the cell... Petition 870210100564, dated 10 / 29 / 2021, page 9 / 151 6 / 137 A transgenic plant is either a monocotyledonous plant cell or a dicotyledonous plant cell. Examples of dicotyledonous plant cells include an Arabidopsis plant cell, a tobacco plant cell, a Glycine max plant cell, a canola plant cell, and a cotton plant cell. Examples of monocotyledonous plant cells include a Zea mays plant cell, a rice plant cell, and a wheat plant cell.

[009] In embodiments of the present disclosure, the disclosure relates to a transgenic plant cell comprising a GmTEFs1 promoter. In other embodiments, the transgenic plant cell comprises a transgenic event. In other embodiments, the transgenic event comprises an agronomic trait. Examples of agronomic traits include an insecticide resistance trait, herbicide tolerance trait, nitrogen use efficiency trait, water use efficiency trait, nutritional quality trait, DNA linkage trait, selectable marker trait, small RNA trait, or any combination thereof. In other embodiments, the agronomic trait comprises a herbicide-tolerant trait. In one aspect of this embodiment, the herbicide-tolerant trait comprises an aad-1 coding sequence. In yet another embodiment, the transgenic plant cell produces a commodity product.Examples of a commodity product include protein concentrate, protein isolate, grain, bran, flour, oil, or fiber. In other embodiments, the transgenic plant cell is selected from the group consisting of a dicotyledonous plant cell or a monocotyledonous plant cell. For example, the dicotyledonous plant cell is a Glycine max plant cell. In further embodiments, the GmTEFs1 promoter comprises a polynucleotide with at least 95% sequence identity to the polynucleotide of SEQ ID NO:2. In other embodiments, the GmTEFs1 promoter has a length of 371 bp. Petition 870210100564, dated 10 / 29 / 2021, page 10 / 151 7 / 137 ment. In some embodiments, the GmTEFs1 promoter consists of SEQ ID NO:2. In subsequent embodiments, the GmTEFs1 promoter comprises a first polynucleotide sequence of interest functionally linked to the 3' end of SEQ ID NO:2. In other embodiments, the agronomic trait is expressed in plant tissues. In other embodiments, the isolated polynucleotide comprises a nucleic acid sequence with at least 95% sequence identity to the polynucleotide of SEQ ID NO:2. In further embodiments, the isolated polynucleotide triggers constitutive tissue expression. In other embodiments, the isolated polynucleotide comprises expression activity within a plant cell. In some embodiments, the isolated polynucleotide comprises an open reading frame polynucleotide encoding a polypeptide; and a termination sequence. In subsequent embodiments, the polynucleotide of SEQ ID NO:2 is 371 base pairs in length.

[0010] In embodiments of the present disclosure, the disclosure relates to a gene expression cassette comprising a promoter functionally linked to a heterologous coding sequence, wherein the promoter comprises a polynucleotide comprising at least 95% sequence identity with SEQ ID NO:2. In some embodiments, the polynucleotide has at least 95% sequence identity with SEQ ID NO:2. In further embodiments, the gene expression cassette comprises an intron. In further embodiments, the gene expression cassette comprises a 5' UTR. In subsequent embodiments, the promoter has tissue-constitutive expression. In other embodiments, the promoter is functionally linked to a heterologous coding sequence encoding a polypeptide or a small RNA gene. Examples of the encoded polypeptide or small RNA gene include Petition 870210100564, dated 10 / 29 / 2021, p. 11 / 151 8 / 137 in a heterologous coding sequence that confers insecticide resistance, herbicide tolerance, a nucleic acid that confers nitrogen use efficiency, a nucleic acid that confers water use efficiency, a nucleic acid that confers nutritional quality, a nucleic acid that confers DNA-binding protein, and a nucleic acid that encodes a selectable marker. In additional embodiments, the gene expression cassette comprises a 3' untranslated region. For example, the 3' untranslated region has at least 95% sequence identity with SEQ ID NO:4. In additional embodiments, the gene expression cassette comprises a 5' untranslated region. For example, the 5' untranslated region has at least 95% sequence identity with SEQ ID NO:3. In additional embodiments, the gene expression cassette comprises a terminator region. For example, the terminator region has at least 95% sequence identity with SEQ ID NO:5.In other embodiments, the present disclosure relates to a recombinant vector comprising the gene expression cassette, wherein the vector is selected from a group consisting of a plasmid, a cosmid, a bacterial artificial chromosome, a virus, and a bacteriophage. In other embodiments, the present disclosure relates to a transgenic cell comprising the gene expression cassette. In one aspect of this embodiment, the transgenic cell is a transgenic plant cell. In other aspects of this embodiment, the transgenic plant comprises the transgenic plant cell. In further aspects, the transgenic plant is a monocotyledonous plant or a dicotyledonous plant. Examples of a monocotyledonous plant include a maize plant, a rice plant, and a wheat plant. In further aspects of this embodiment, the transgenic plant produces a seed comprising the gene expression cassette. In other embodiments, the promoter is a tissue-constitutive promoter. Petition 870210100564, dated 10 / 29 / 2021, page 12 / 151 9 / 137 In some cases, the prosecutor is a founding prosecutor.

[0011] The above characteristics and others will be made more evident from the detailed description of various modalities, which follow with reference to the attached figures. BRIEF DESCRIPTION OF THE FIGURES

[0012] Figure 1 provides a picture of a linear synthetic DNA fragment containing the GmTEFs1 promoter, the 5' UTR, and the terminator linked by the multiple cloning site. DETAILED DESCRIPTION I. Overview of various modalities

[0013] The development of transgenic plant products is becoming increasingly complex. Commercially viable transgenic plants now require the stacking of multiple transgenes at a single locus. Plant promoters and 3' UTRs / terminators used for basic research or biotechnological applications are generally unidirectional, directing only one gene that has been fused at its 3' end (downstream) to the promoter or at its 5' end (upstream) to the 3' UTR / terminator. Consequently, each heterologous transgene / coding sequence typically needs a promoter and 3' UTR / terminator for expression, where multiple regulatory elements are required to express multiple transgenes in a gene stack. With an increasing number of transgenes in gene stacks, the same promoter and / or 3' UTR / terminator is routinely used to achieve optimized levels of expression patterns for different transgenes.Achieving optimized levels of heterologous transgene / coding sequence expression is necessary for the production of a unique polygenic trait. Unfortunately, multi-gene constructs driven by the same promoter and / or UTR 3'-terminator are known to cause gene silencing, resulting in less effective transgenic products. Petition 870210100564, dated 10 / 29 / 2021, page 13 / 151 10 / 137 in the field. Repeated promoters and / or 3' UTR / terminator elements can lead to homology-based gene silencing. Furthermore, repetitive sequences in a transgene / heterologous coding sequence can lead to homologous intragene locus recombination resulting in polynucleotide rearrangements. Transgene silencing and rearrangement will likely have an undesirable effect on the performance of a transgenic plant produced to express transgenes. Also, excess transcription factor (TF) binding sites due to promoter repetition can cause depletion of endogenous TFs leading to transcriptional deactivation. Given the need to introduce multiple genes into plants for metabolic manipulation and trait stacking, a variety of promoters and / or 3' UTR / terminators is needed to develop transgenic crops that trigger the expression of multiple genes.

[0014] A particular problem in identifying promoters and / or 3' UTRs / terminators is the need to identify tissue-specific / preferential promoters, related to specific cell types, developmental stages, and / or functions in the plant that are not expressed in other plant tissues. Tissue-specific (i.e., tissue-preferential) or organ-specific promoters drive gene expression in a certain tissue, such as the grain, root, leaf, or tapetum of the plant. Tissue-stage and developmental-specific promoters and / or 3' UTRs / terminators can initially be identified from observing gene expression, which are expressed in particular tissues or at particular time periods during plant development.These tissue-specific / preferred promoters and / or 3' UTRs / terminators are required for certain applications in the transgenic plant industry and are necessary because they allow specific expression of heterologous genes. Petition 870210100564, dated 10 / 29 / 2021, page 14 / 151 11 / 137 selectively expresses the heterologous gene in a tissue- and / or developmental stage, indicating differential expression of the heterologous gene in various organs, tissues, and / or times, but not in other undesirable tissues. For example, increased plant resistance to infection by soil-borne pathogens can be achieved by transforming the plant genome with a pathogen resistance gene, so that the pathogen resistance protein is robustly expressed in the plant roots. Alternatively, it may be desirable to express a heterologous transgene / coding sequence in plant tissues that are at a particular developmental or growth stage, such as cell division or elongation.Another application is the convenience of using tissue-specific / preferred promoters and / or 3' UTRs / terminators to confirm the expression of transgenes encoding an agronomic trait in specific tissue types, such as developing parenchyma cells. As such, a particular problem in identifying promoters and / or 3' UTRs / terminators is how to identify the promoters and relate the identified promoter to cell development properties for tissue-specific / preferred expression.

[0015] Another problem related to promoter identification is the need to clone all relevant cis-acting and trans-activating transcriptional control elements so that the cloned DNA fragment drives transcription in the desired specific expression pattern. Since these control elements are located distal to the translation initiation or start site, the size of the polynucleotide selected to comprise the promoter is important for providing the expression level and expression patterns of the promoter polynucleotide sequence. Promoter lengths are known to contain functional information, and different genes have been shown to have longer or shorter promoters. Petition 870210100564, dated 10 / 29 / 2021, page 15 / 151 12 / 137 shorter than the promoters of other genes in the genome. Elucidating the transcription start site of a promoter and predicting the functional gene elements in the promoter region is challenging. In addition to the challenge, there is the complexity, diversity, and inherent degenerate nature of regulatory motifs and cis and trans regulatory elements (Blanchette, Mathieu, et al. Genome-wide computational prediction of transcriptional regulatory modules reveals new insights into human gene expression. Genome research 16.5 (2006): 656-668). Cis and trans regulatory elements are located in the distal parts of the promoter, regulating the spatial and temporal expression of a gene to occur only at necessary sites and at specific times (Porto, Milena Silva, et al. Plant promoters: an approach of structure and function. Molecular biotechnology 56.1 (2014): 38-49).Consequently, the identification of the promoting regulatory elements requires an appropriate sequence of a specific size containing the necessary cis and trans regulatory elements, so that it will result in driving the expression of a functionally linked transgene / heterologous coding sequence in a desirable manner.

[0016] Methods and compositions are provided to overcome such problems through the use of GmTEFs1 gene regulatory elements to express transgenes in planta. II. Terms and Abbreviations

[0017] Throughout the application, several terms are used. In order to provide a clear and consistent understanding of the descriptive report and claims, including the scope to be given to these terms, the following definitions are provided.

[0018] As used in this document, the articles, a, an and the include plural references unless the context clearly and unambiguously states otherwise. Petition 870210100564, dated 10 / 29 / 2021, page 16 / 151 13 / 137

[0019] The term isolate, as used in this document, means that it has been removed from its natural environment or removed from other compounds present when the compound is first formed. The term isolate encompasses materials isolated from natural sources, as well as materials (e.g., nucleic acids and proteins) recovered after preparation by recombinant expression in a host cell, or chemically synthesized compounds such as nucleic acid molecules, proteins, and peptides.

[0020] The term purified, as used in this document, refers to the isolation of a molecule or compound in a form that is substantially free of contaminants normally associated with the molecule or compound, in a native or natural environment, or substantially enriched in concentration relative to other compounds present when the compound is first formed, and means that have increased in purity as a result of being separated from other components of the original composition.The term purified nucleic acid is used in this document to describe a nucleic acid sequence that has been separated from, produced separately from, or purified away from, other biological compounds including, but not limited to, polypeptides, lipids, and carbohydrates, while effecting a chemical or functional change in the component (for example, a nucleic acid may be purified from a chromosome by removing protein contaminants and breaking chemical bonds that connect the nucleic acid to the remaining DNA in the chromosome).

[0021] The term synthetic, as used in this document, refers to a polynucleotide molecule (i.e., DNA or RNA) that has been created through chemical synthesis as an in vitro process. For example, synthetic DNA can be created during a reaction in an Eppendorf™ tube, so that the synthetic DNA is en Petition 870210100564, dated 10 / 29 / 2021, page 17 / 151 14 / 137 zymatically produced from a native strand of DNA or RNA. Other laboratory methods can be used to synthesize a polynucleotide sequence. Oligonucleotides can be chemically synthesized in an oligo synthesizer by solid-phase synthesis using phosphoramidites. The synthesized oligonucleotides can be annealed together as a complex, thus producing a synthetic polynucleotide. Other methods for chemically synthesizing a polynucleotide are known in the art and can be readily implemented for use in the present disclosure.

[0022] The term approximately, as used in this document, means greater than or less than the stated value or range of values ​​by 10 percent, but is not intended to designate any value or range of values ​​only within that broader definition. Each value or range of values ​​preceded by the term approximately is also intended to encompass the absolute value or range of values ​​declared.

[0023] For the purposes of this disclosure, a gene includes a region of DNA that encodes a gene product (see below), as well as all regions of DNA that regulate the production of the gene product, whether or not such regulatory sequences are adjacent to the coding and / or transcribed sequences. Consequently, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translation regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, threshold elements, origins of replication, matrix binding sites, introns, and locus control regions.

[0024] As used in this document, the terms native or natural define a condition found in nature. A Petition 870210100564, dated 10 / 29 / 2021, p. 18 / 151 15 / 137 Native DNA sequence is a DNA sequence found in nature that was produced by natural means or traditional reproductive techniques, but not generated by genetic modification (e.g., using molecular biology / transformation techniques).

[0025] As used in this document, a transgene is defined as a nucleic acid sequence that encodes a gene product, including, for example, but not limited to, mRNA. In one embodiment, the transgene / heterologous coding sequence is an exogenous nucleic acid, wherein the transgene / heterologous coding sequence has been introduced into a host cell by genetic manipulation (or the progeny thereof) in which the transgene / heterologous coding sequence is not normally found. In one example, a transgene / heterologous coding sequence encodes an industrially or pharmaceutically useful compound, or a gene encoding a desirable agricultural trait (e.g., a herbicide resistance gene). In yet another example, a transgene / heterologous coding sequence is an antisense nucleic acid sequence, wherein the expression of the antisense nucleic acid sequence inhibits the expression of a target nucleic acid sequence.In one embodiment, the transgene / heterologous coding sequence is either an endogenous nucleic acid, where additional genomic copies of the endogenous nucleic acid are desirable, or a nucleic acid that is in the antisense orientation with respect to the sequence of a target nucleic acid in a host organism.

[0026] As used in this document, the term non-GmTEFs1 transgene or non-GmTEFs1 gene is any heterologous transgene / coding sequence that has less than 80% sequence identity with the GmTEFs1 gene coding sequence.

[0027] As used in this document, sequence of Petition 870210100564, dated 10 / 29 / 2021, p. 19 / 151 16 / 137 Heterologous DNA coding means any coding sequence other than that which naturally codes for the GmTEFs1 gene or any homolog of the expressed GmTEFs1 protein. The term heterologous is used in the context of this invention for any combination of nucleic acid sequences that are not normally found closely associated in nature.

[0028] A gene product, as defined herein, is any product produced by a gene. For example, a gene product may be the direct transcription product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, interfering RNA, ribozyme, structural RNA, or any other type of RNA) or a protein produced by translation of an mRNA. Gene products also include RNA that is modified by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation. Gene expression may be influenced by external signals, for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression. Gene expression may also be regulated anywhere along the DNA-to-RNA-to-protein pathway.The regulation of gene expression occurs, for example, through controls that act on transcription, translation, RNA transport and processing, degradation of intermediate molecules such as mRNA, or through the activation, deactivation, compartmentalization, or degradation of specific protein molecules after they have been made, or by combinations thereof. Gene expression can be measured at the RNA level or at the protein level by any method known in the art, including, without limitation, Northern blot, RT-PCR, Western blot, or in vitro, in situ, or in vivo protein activity assay(s). Petition 870210100564, dated 10 / 29 / 2021, page 20 / 151 17 / 137

[0029] As used in this document, the term gene expression refers to the process by which the encoded information of a nucleic acid transcription unit (including, for example, genomic DNA) is converted into an operational, non-operational, or structural part of a cell, often including the synthesis of a protein. Gene expression can be influenced by external signals, for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression. Gene expression can also be regulated anywhere along the DNA-to-RNA-to-protein pathway. Regulation of gene expression occurs, for example, through controls acting on transcription, translation, RNA transport and processing, degradation of intermediate molecules such as mRNA, or through the activation, deactivation, compartmentalization, or degradation of specific protein molecules after they have been made, or by combinations thereof.Gene expression can be measured at the RNA level or at the protein level by any method known in the art, including, without limitation, Northern blot, RT-PCR, Western blot, or in vitro, in situ, or in vivo protein activity assay (or in vitro, in situ, or in vivo protein activity assays).

[0030] As used in this document, homology-based gene silencing (HBGS) is a generic term that includes both transcriptional gene silencing and post-transcriptional gene silencing. Silencing of a target locus by an unbound silencing locus can result from inhibition of transcription (transcriptional gene silencing; TGS) or degradation of mRNA (post-transcriptional gene silencing; PTGS), due to the production of double-stranded RNA (dsRNA) corresponding to the promoter or transcript sequences, respectively. The involvement of distinct cellular components in each process suggests that TGS and Petition 870210100564, dated 10 / 29 / 2021, p. 21 / 151 18 / 137 PTGS induced by dsRNA likely result from the diversification of a common, long-standing mechanism. However, a strict comparison of TGS and PTGS has been difficult to achieve because it generally depends on the analysis of distinct silencing loci. In some cases, a single transgene locus can trigger both TGS and PTGS due to the production of dsRNA corresponding to the promoter and transcribed sequences of different target genes. Mourrain et al. (2007) Plant 225:365-379. It is likely that siRNAs are the actual molecules that trigger TGS and PTGS in homologous sequences: in this model, siRNAs would trigger the silencing and methylation of homologous sequences in cis and trans through the spreading of transgene sequence methylation in the endogenous promoter.

[0031] As used in this document, the term nucleic acid molecule (or nucleic acid or polynucleotide) may refer to a polymeric form of nucleotides, which may include both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic and mixed polymer forms thereof. A nucleotide may refer to a ribonucleotide, deoxyribonucleotide, or a modified form of any type of nucleotide. A nucleic acid molecule, as used in this document, is synonymous with nucleic acid and polynucleotide. The nucleic acid molecule is normally at least 10 bases long, unless otherwise specified. The term may refer to an RNA or DNA molecule of indeterminate length. The term includes single-stranded and double-stranded forms of DNA.A nucleic acid molecule may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide bonds.

[0032] Nucleic acid molecules may be chemically or biochemically modified, or may contain nucleic acid bases. Petition 870210100564, dated 10 / 29 / 2021, page 22 / 151 19 / 137 non-natural or derived nucleotides, as will be readily observed by those skilled in the art. Such modifications include, for example, identifications, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications (e.g., uncharged linkages: e.g., methyl phosphonates, phosphotriesters, phosphoramidites, carbamates, etc.; charged linkages: e.g., phosphorothioates, phosphorodithioates, etc.; pendant chemical moieties: e.g., peptides; intercalators: e.g., acridine, psoralen, etc.; chelating agents; alkylating agents; and modified linkages: e.g., anomeric alpha nucleic acids, etc.). The term nucleic acid molecule also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpin, circular, and padlock conformations.

[0033] Transcription proceeds in a 5' to 3' direction along a DNA strand. This means that RNA is made by the sequential addition of ribonucleotide-5'-triphosphates to the 3' end of the growing chain (with a necessary elimination of the pyrophosphate). In a linear or circular nucleic acid molecule, distinct elements (e.g., particular nucleotide sequences) may be termed upstream or 5' relative to an additional element if they are or would be linked to the same nucleic acid in the 5' direction of that element. Similarly, distinct elements may be downstream or 3' relative to an additional element if they are or would be linked to the same nucleic acid in the 3' direction of that element.

[0034] A base position, as used in this document, refers to the location of a given nucleotide or base residue in a designated nucleic acid. The designated nucleic acid can be defined by alignment (see below) with a reference nucleic acid. Petition 870210100564, dated 10 / 29 / 2021, page 23 / 151 20 / 137

[0035] Hybridization refers to the linking of two polynucleotide strands through hydrogen bonds. Oligonucleotides and their analogues hybridize through hydrogen bonds, which include Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding, between complementary bases. In general, nucleic acid molecules consist of nitrogenous bases that are pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the linking of pyrimidine to purine is called base pairing. More specifically, A will hydrogen bond with T or U, and G will bond with C. Complementary refers to base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.

[0036] Specifically hybridizable and specifically complementary are terms that indicate a sufficient degree of complementarity so that stable and specific binding occurs between the oligonucleotide and the target DNA or RNA. The oligonucleotide does not need to be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when the binding of the oligonucleotide to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to prevent non-specific binding of the oligonucleotide to non-target sequences under conditions where specific binding is desirable, for example, under physiological conditions in the case of in vivo assays or systems. Such binding is termed specific hybridization.

[0037] The hybridization conditions that result in particular degrees of stringency will vary depending on the nature of the hybridization method chosen and the composition and length of the sequences. Petition 870210100564, dated 10 / 29 / 2021, p. 24 / 151 21 / 137 nucleic acid hybridization conditions. In general, the hybridization temperature and the ionic strength (especially the concentration of Na+ and / or Mg2+) of the hybridization buffer will contribute to the hybridization stringency, although washing times also influence the stringency. Calculations regarding the hybridization conditions necessary to achieve particular degrees of stringency are discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd edition, volumes 1 to 3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, chapters 9 and 11.

[0038] As used in this document, stringent conditions encompass conditions under which hybridization will occur only if there is less than 50% divergence between the hybridization molecule and the target DNA. Stringent conditions further include particular levels of stringency. Thus, as used in this document, moderate stringency conditions are those under which molecules with more than 50% sequence divergence will not hybridize; high stringency conditions are those under which sequences with more than 20% divergence will not hybridize; and very high stringency conditions are those under which sequences with more than 10% divergence will not hybridize.

[0039] In particular embodiments, the astringent conditions may include hybridisation at 65 °C, followed by washes at 65 °C with 0.1x SSC / 0.1% SDS for 40 minutes.

[0040] The following are representative non-limiting hybridization conditions: Very High Stringency: Hybridization in SSC 5x buffer at 65 °C for 16 hours; washing twice in SSC 2x buffer at room temperature for 15 minutes each; and washing twice in SSC 0.5x buffer at 65 °C for 20 minutes each. Petition 870210100564, dated 10 / 29 / 2021, p. 25 / 151 22 / 137 High Stringency: Hybridization in SSC buffer 5x to 6x at 65 to 70 °C for 16 to 20 hours; washing twice in SSC buffer 2x at room temperature for 5 to 20 minutes each; and washing twice in SSC buffer 1x at 55 to 70 °C for 30 minutes each. Moderate Stringency: Hybridize in SSC buffer 6x at room temperature (55°C) for 16 to 20 hours; wash at least twice in SSC buffer 2x to 3x at room temperature (55°C) for 20 to 30 minutes each.

[0041] In particular embodiments, specifically hybridizable nucleic acid molecules can remain linked under very high stringency hybridization conditions. In these and additional embodiments, specifically hybridizable nucleic acid molecules can remain linked under high stringency hybridization conditions. In these and additional embodiments, specifically hybridizable nucleic acid molecules can remain linked under moderate stringency hybridization conditions.

[0042] As used in this document, the term oligonucleotide refers to a short nucleic acid polymer. Oligonucleotides can be formed by cleaving longer nucleic acid segments or by polymerizing individual nucleotide precursors. Automated synthesizers allow the synthesis of oligonucleotides up to several hundred base pairs in length. Because oligonucleotides can bind to a complementary nucleotide sequence, they can be used as probes to detect DNA or RNA. DNA-composed oligonucleotides (oligodeoxyribonucleotides) can be used in PCR, a technique for amplifying small DNA sequences. In PCR, the oligonucleotide is typically referred to as a primer, which allows a DNA polymerase to extend the oligonucleotide and replicate the complementary strand. Petition 870210100564, dated 10 / 29 / 2021, page 26 / 151 23 / 137

[0043] The terms sequence identity percent or identity percent or identity are used interchangeably to refer to a sequence comparison based on identical matches between consequently identical positions in the compared sequences between two or more amino acid or nucleotide sequences. The identity percent refers to the extent to which two optimally aligned polynucleotide or peptide sequences are invariant over a component alignment window, for example, nucleotides or amino acids. Hybridization experiments and mathematical algorithms known in the art can be used to determine the identity percent. Many mathematical algorithms exist as sequence alignment computer programs known in the art that calculate the identity percent.These programs can be categorized as global sequence alignment programs or local sequence alignment programs.

[0044] Global sequence alignment programs calculate the percentage of identity of two sequences by comparing end-to-end alignments in order to find exact matches, dividing the number of exact matches by the length of the shorter sequences, and then multiplying by 100. Basically, it is the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (query) polynucleotide molecule compared to a test (subject) polynucleotide molecule when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps).

[0045] Local sequence alignment programs are similar in their calculation, but only compare aligned fragments of sequences instead of using end-to-end analysis. Petition 870210100564, dated 10 / 29 / 2021, page 27 / 151 24 / 137 end. Local sequence alignment programs, such as BLAST, can be used to compare specific regions of two sequences. A BLAST comparison of two sequences results in an E-value, or expectation value, which represents the number of different alignments with scores equal to, or better than, the raw alignment score, S, that are expected to occur in a random database search. The lower the E-value, the more significant the match. Because database size is an element in E-value calculations, E-values ​​obtained by BLASTing against public databases, such as GENBANK, generally increased over time for any given input query / match.In defining criteria for polypeptide function prediction security, a high BLAST match is considered in this document to have an E-value for superior BLAST accuracy less than 1E-30; a medium BLAST E-value from 1E-30 to 1E-8; and a low BLAST E-value greater than 1E-8. Protein function assignment in the present invention is determined using combinations of E-values, identity percentage, query coverage, and accuracy coverage. Query coverage refers to the percentage of the query sequence that is represented in the BLAST alignment. Accuracy coverage refers to the percentage of the database entry that is represented in the BLAST alignment.In one embodiment of the invention, the function of a query polypeptide is inferred from the function of a conserved protein sequence where either (1) hit_p<1e-30 or % identity >35% AND query_coverage >50% AND hit_coverage >50%, or (2) hit_p<1e-8 AND query_coverage >70% AND hit_coverage >70%. The following abbreviations are produced during a BLAST analysis of a sequence.

[0046] Methods for aligning sequences for comparison Petition 870210100564, dated 10 / 29 / 2021, p. 28 / 151 25 / 137 are well known in the art. Several alignment programs and algorithms are described. In one embodiment, the present disclosure relates to calculating the percentage identity between two polynucleotide or amino acid sequences using the AlignX alignment program from the Vector NTI package (Invitrogen, Carlsbad, CA). The AlignX alignment program is a global sequence alignment program for polynucleotides or proteins. In another embodiment, the present disclosure relates to calculating the percentage identity between two polynucleotide or amino acid sequences using the MegAlign program from the LASERGENE bioinformatics computing package (MegAlign™ (©1993-2016). DNASTAR. Madison, WI). The MegAlign program is a global sequence alignment program for polynucleotides or proteins.In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Clustal package of alignment programs, including, but not limited to, ClustalW and ClustalV (Higgins and Sharp (1988) Gene. Dec. 15;73(1):237 to 244; Higgins and Sharp (1989) CABIOS 5:151 to 153; Higgins et al. (1992) Comput. Appl. Biosci. 8:189-91). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the GCG package of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, WI). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the BLAST package of alignment programs, for example, but not limited to, BLASTP, BLASTN, BLASTX, etc. (Altschul et al. (1990) J. Mol. Biol. 215:403 to 410).Other examples of such BLAST alignment programs include Gapped-BLAST or PSI-BLAST (Altschul et al., 1997). In a. Petition 870210100564, dated 10 / 29 / 2021, p. 29 / 151 In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the FASTA package of alignment programs, including, but not limited to, FASTA, TFASTX, TFASTY, SSEARCH, LALIGN, etc. (Pearson (1994) Comput. Methods Genome Res. [Proc. Int. Symp.], Date of Meeting, 1992 (Suhai and Sandor, Eds.), Plenum: New York, NY, pp. 111-20). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotides or amino acid sequences using the T-Coffee alignment program (Notredame, et al. (2000) J. Mol. Biol. 302, 205-217). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotides or amino acid sequences using the DIALIGN package of alignment programs, including, but not limited to, DIALIGN, CHAOS, DIALIGN-TX, DIALIGN-T, etc. (Al Ait, et al.(2013) DIALIGN in GOBICS Nucleic Acids Research 41, W3-W7). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the MUSCLE alignment program package (Edgar (2004) Nucleic Acids Res. 32(5): 1792-1797). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the MAFFT alignment program (Katoh, et al. (2002) Nucleic Acids Research 30(14): 3059-3066). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Genoogle program (Albrecht, Felipe. arXiv150702987v1 [cs.DC] July 10, 2015). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the HMMER program package. Petition 870210100564, dated 10 / 29 / 2021, p. 30 / 151 27 / 137 but (Eddy. (1998) Bioinformatics, 14:755-63). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the PLAST package of alignment programs, including, but not limited to, TPLASTN, PLASTP, KLAST and PLASTX (Nguyen & Lavenier. (2009) BMC Bioinformatics, 10:329). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the USEARCH alignment program (Edgar (2010) Bioinformatics 26(19), 2460-61). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the SAM package of alignment programs (Hughey & Krogh (Jan. 1995) Technical Report UCSC0CRL-95-7, University of California, Santa Cruz).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the IDF Finder (O'Kane, KC, The Effect of Inverse Document Frequency Weights on Indexed Sequence Retrieval, Online Journal of Bioinformatics, Volume 6 (2) 162-173, 2005). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Parasail alignment program. (Daily, Jeff. Parasail: SIMD C library for global, semi-global and local paired sequence alignments. BMC Bioinformatics. 17:18. February 10, 2016). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotides or amino acid sequences using the ScalaBLAST alignment program (Oehmen C, Nieplocha J.ScalaBLAST: A scalable implementation of BLAST for high-performance data-intensive bioinformatics analysis. IEEE Transactions on Parallel & Distributed Systems 17 (8):. Petição 870210100564, de 29 / 10 / 2021, pág. 31 / 151 28 / 137 740-749 Aug. 2006). In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the SWIPE alignment program (Rognes, T. Faster Smilth-Waterman database searches with inter-sequence SIMD parallelization. BMC Bioinformatics. 12, 221 (2011)). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the ACANA alignment program (Weichun Huang, David M. Umbach, and Leping Li, Accurate anchoring alignment of divergent sequences. Bioinformatics 22:2934, January 1, 2006). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the DOTLET alignment program (Junier, T. & Pagni, M. DOTLET: diagonal plots in a web browser. Bioinformatics 16(2): 178-9 Feb. 2000).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the G-PAS alignment program (Frohmberg, W., et al. G-PAS 2.0 - an enhanced version of the protein alignment tool with an effective backtracking routine on multiple GPUs. Bulletin of the Polish Academy of Sciences Technical Sciences, Vol. 60, 491, Nov. 2012). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the GapMis alignment program (Flouri, T. et al., GapMis: A tool for pairwise sequence alignment with a single gap. Recent Pat DNA Gene Seq. 7(2): 84-95, Aug. 2013).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the EMBOSS package of alignment programs, including, but not limited to: Petition 870210100564, dated 10 / 29 / 2021, page 32 / 151 29 / 137 Matcher, Needle, Stretcher, Water, Wordmatch, etc. (Rice, P., Longden, I. & Bleasby, A. EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics 16(6) 276-77 (2000)). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Ngila alignment program (Cartwright, R. Ngila: global pairwise alignments with logarithmic and affine gap costs. Bioinformatics. 23(11): 1427-1428. June 1, 2007). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the probA, also known as propA, alignment program (Mückstein, U., Hofacker, IL, & Stadler, PF. Stochastic pairwise alignments. Bioinformatics 18 Suppl. 2:S153-60. 2002).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the SEQALN package of alignment programs (Hardy, P. & Waterman, M. The Sequence Alignment Software Library at USC. 1997). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the SIM package of alignment programs, including, but not limited to, GAP, NAP, LAP, etc. (Huang, X & Miller, W. A Time-Efficient, Linear-Space Local Similarity Algorithm. Advances in Applied Mathematics, vol. 12 (1991) 337-57). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the UGENE alignment program (Okonechnikov, K., Golosova, O. & Fursov, M. Unipro UGENE: a unified bioinformatics toolkit. Bioinformática. 2012 28:1166-67).In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide sequences. Petition 870210100564, dated 10 / 29 / 2021, p. 33 / 151 30 / 137 or amino acids using the BAli-Phy alignment program (Suchard, MA & Redelings, BD. BAli-Phy: simultaneous Bayesian inference of alignment and phylogeny. Bioinformatics. 22:2047-48. 2006). In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Base-By-Base alignment program (Brodie, R., et al. Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments, BMC Bioinformatics, 5, 96, 2004). In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the DECIPHER alignment program (ES Wright (2015) DECIPHER: harnessing local sequence context to improve protein multiple sequence alignment. BMC Bioinformatics, doi:10.1186 / s12859-015-0749-z.).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the FSA alignment program (Bradley, RK, et al. (2009) Fast Statistical Alignment. PLoS Computational Biology. 5:e1000392). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Geneious alignment program (Kearse, M., et al. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28(12), 1647-49). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Kalig alignment program (Lassmann, T. & Sonnhammer, E. Kalig an accurate and fast multiple sequence alignment algorithm. BMC Bioinformatics 2005 6:298).In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two sequences. Petition 870210100564, dated 10 / 29 / 2021, p. 34 / 151 31 / 137 polynucleotide or amino acid sequences using the MAVID alignment program (Bray, N. & Pachter, L. MAVID: Constrained Ancestral Alignment of Multiple Sequences. Genome Res. April 2004; 14(4): 693-99). In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the MSA alignment program (Lipman, DJ, et al. A tool for multiple sequence alignment. Proc. Nat'l Acad. Sci. USA. 1989; 86:4412-15). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotides or amino acid sequences using the MultAlin alignment program (Corpet, F., Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res., 1988, 16(22), 10.881 to 10.890).In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the LAGAN or MLAGAN alignment programs (Brudno, et al. LAGAN and Multi-LAGAN: efficient tools for large-scale multiple alignment of genomic DNA. Genome Research April 2003; 13(4): 721-31). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Opal alignment program (Wheeler, TJ, & Kececiouglu, JD. Multiple alignment by aligning alignments. Proceedings of the 15th ISCB conference on Intelligent Systems for Molecular Biology. Bioinformatics. 23, i559-68, 2007). In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the PicXAA package of programs, including, but not limited to, PicXAA, PicXAA-R, PicXAA-Web, etc.(Mohammad, S., Sahraeian, E. & Yoon, B. PicXAA: greedy probabilistic construction of maximum expected accuracy alignment de multiple sequences. Nucleic Acids Research. Petição 870210100564, de 29 / 10 / 2021, pág. 35 / 151 32 / 137 38(15):4917-28. 2010). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the PSAlign alignment program (SZE, S.-H., Lu, Y., & Yang, Q. (2006) A polynomial time solvable formulation of multiple sequence alignment Journal of Computational Biology, 13, 309-19). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the StatAlign alignment program (Novák, Á., et al. (2008) StatAlign: an extendable software package for joint Bayesian estimation of alignments and evolutionary trees. Bioinformatics, 24(20):2403-2404).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Gap alignment program of Needleman and Wunsch (Needleman and Wunsch, Journal of Molecular Biology 48:443-453, 1970). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the BestFit alignment program of Smith and Waterman (Smith and Waterman, Advances in Applied Mathematics, 2:482-489, 1981, Smith et al., Nucleic Acids Research 11:2205-2220, 1983). These programs produce biologically significant multiple sequence alignments of divergent sequences. The best-match alignments calculated for the selected sequences are aligned so that identities, similarities, and differences can be observed.

[0047] The term similarity refers to a comparison between amino acid sequences and takes into account not only identical amino acids in corresponding positions, but also amino acids with similar functionality in corresponding positions. Thus, a similarity between polypeptide sequences indicates Petition 870210100564, dated 10 / 29 / 2021, p. 36 / 151 33 / 137 also shows a functional similarity, in addition to sequence similarity.

[0048] The term homology is sometimes used to refer to the level of similarity between two or more amino acid or nucleic acid sequences in terms of percentage of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of evolutionary relationship, generally evidenced by similar functional properties among different nucleic acids or proteins that share similar sequences.

[0049] As used in this document, the term variants means substantially similar sequences. For nucleotide sequences, naturally occurring variants can be identified using well-known molecular biology techniques, such as, for example, polymerase chain reaction (PCR) and hybridization techniques as outlined in this document.

[0050] For nucleotide sequences, a variant comprises a deletion and / or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and / or a substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a native nucleotide sequence comprises a naturally occurring nucleotide sequence. For nucleotide sequences, naturally occurring variants can be identified using well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques, as highlighted below. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, using site-directed mutagenesis. Generally, variants of a nucleotide sequence Petition 870210100564, dated 10 / 29 / 2021, page 37 / 151 34 / 137 particular nucleotides of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with that particular nucleotide sequence as determined by sequence alignment programs and parameters described elsewhere in this document. A biologically active variant of a nucleotide sequence of the invention may differ from that sequence by as little as 1 to 15 nucleic acid residues, by 1 to 10, as 6 to 10, by 5, 4, 3, 2 or even 1 nucleic acid residue.

[0051] As used in this document, the term functionally linked refers to a first nucleic acid sequence that is functionally linked to a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For example, a promoter is functionally linked to a coding sequence when the promoter affects the transcription or expression of the coding sequence. When recombinantly produced, functionally linked nucleic acid sequences are usually contiguous and, when necessary, to join two protein coding regions in the same reading frame. However, the elements do not need to be contiguous to be functionally linked.

[0052] As used in this document, the term promoter refers to a region of DNA that is generally located upstream (toward the 5' end of a gene) of a gene and is required to initiate and trigger transcription of the gene. A promoter may allow the appropriate activation or repression of a gene that it controls. A promoter may contain specific sequences that are recognized by transcription factors. These factors may be Petition 870210100564, dated 10 / 29 / 2021, page 38 / 151 35 / 137 binding to a promoter DNA sequence results in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the gene's coding region. The promoter generally refers to all gene regulatory elements located upstream of the gene, including upstream promoters, 5' UTRs, introns, and leader sequences.

[0053] As used in this document, the term upstream promoter refers to a contiguous polynucleotide sequence that is sufficient to direct transcription initiation. As used in this document, an upstream promoter encompasses the transcription initiation site with various sequence motifs, which include the TATA Box, primer sequence, TFIIB recognition elements, and other promoter motifs (Jennifer, EF et al., (2002) Genes & Dev., 16: 2583-2592). The upstream promoter provides the site of action for RNA polymerase II, which is a multi-subunit enzyme with basal or general transcription factors such as TFII A, B, D, E, F, and H. These factors combine into a transcription pre-initiation complex that catalyzes RNA synthesis from the DNA template.

[0054] Upstream promoter activation is achieved by the additional sequence of DNA sequence regulatory elements to which various proteins bind and subsequently interact with the transcription initiation complex to activate gene expression. These gene regulatory element sequences interact with specific DNA binding factors. These sequence motifs can sometimes be referred to as cis elements. Such cis elements, to which developmentally specific or tissue-specific transcription factors bind, individually or in combination, can determine the spatiotemporal expression pattern of a promoter at the transcriptional level. These cis elements vary widely in the type of control they exert on Petition 870210100564, dated 10 / 29 / 2021, page 39 / 151 36 / 137 genes are functionally linked. Some elements act to increase the transcription of functionally linked genes in response to environmental responses (e.g., temperature, humidity, and injury). Other cis-elements may respond to developmental cues (e.g., germination, seed maturation, and flowering) or spatial information (e.g., tissue specificity). See, for example, Langridge et al., (1989) Proc. Natl. Acad. Sci. USA 86:3219-23. These cis-elements are located at varying distances from the transcription starting point; some cis-elements (called proximal elements) are adjacent to a minimal core promoter region, while other elements may be positioned several kilobases upstream or downstream of the promoter (enhancers).

[0055] As used in this document, the terms 5' untranslated region or 5' UTR are defined as the untranslated segment at the 5' end of pre-mRNAs or mature mRNAs. For example, in mature mRNAs, a 5' UTR typically harbors a 7-methylguanosine cap at its 5' end and is involved in many processes such as splicing, polyadenylation, mRNA export towards the cytoplasm, identification of the 5' end of the mRNA by the translation machinery, and protection of mRNAs against degradation.

[0056] As used in this document, the term intron refers to any nucleic acid sequence contained within a gene (or expressed polynucleotide sequence of interest) that is transcribed but not translated. Introns include untranslated nucleic acid sequences in an expressed DNA sequence, as well as the corresponding sequence in RNA molecules transcribed from it. A construct described in this document may also contain sequences that enhance translation and / or mRNA stability, such as introns. An example of such an intron is the pri Petition 870210100564, dated 10 / 29 / 2021, p. 40 / 151 37 / 137 first intron of gene II of the Arabidopsis thaliana histone H3 variant or any other commonly known intron sequence. Introns can be used in combination with a promoter sequence to enhance translation and / or mRNA stability.

[0057] As used in this document, the terms transcription terminator or terminator are defined as the segment transcribed at the 3' end of pre-mRNAs or mature mRNAs. For example, longer stretches of DNA beyond the polyadenylation signal site are transcribed as a pre-mRNA. This DNA sequence typically contains a transcription termination signal for the appropriate processing of the pre-mRNA into mature mRNA.

[0058] As used in this document, the term 3' untranslated region or 3' UTR is defined as the untranslated segment at the 3' terminus of pre-mRNAs or mature mRNAs. For example, in mature mRNAs, this region harbors the poly-(A) tail and is known to have many roles in mRNA stability, translation initiation, and mRNA export. In addition, the 3' UTR is considered to include the polyadenylation signal and transcription terminator.

[0059] As used in this document, the term polyadenylation signal designates a nucleic acid sequence present in mRNA transcripts that allows transcripts, when in the presence of a poly-(A) polymerase, to be polyadenylated at the polyadenylation site, for example, located 10 to 30 bases downstream of the poly-(A) signal. Many polyadenylation signals are known in the art and are useful for the present invention. An exemplary sequence includes AAUAAA and variants thereof, as described in Loke J., et al., (2005) Plant Physiology 138(3); 1457-1468.

[0060] A DNA-linking transgene is a polynucleotide coding sequence that codes for a DNA-binding protein. The DNA-binding protein has the ability to bind to Petition 870210100564, dated 10 / 29 / 2021, p. 41 / 151 38 / 137 subsequent mode to another molecule. A binding protein can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein), and / or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and / or it can bind to one or more molecules of a different protein or different proteins. A binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding, and protein-binding activity.

[0061] Examples of DNA-binding proteins include meganucleases, zinc fingers, CRISPRs, and TALEN binding domains that can be genetically modified to bind to a predetermined nucleotide sequence. Typically, genetically modified DNA-binding proteins (e.g., zinc fingers, CRISPRs, or TALEN) are proteins that are non-naturally occurring. Non-limiting examples of methods for genetically modified DNA-binding proteins are design and selection. A designed DNA-binding protein is a non-naturally occurring protein whose design / composition results primarily from rational criteria. Rational criteria for design include applying substitution rules and computerized algorithms to process information in a database that stores information on existing ZFP, CRISPR, and / or TALEN designs and binding data. See, for example, U.S. Patents 6,140,081; 6,453,242; and 6,534.261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496 and U.S. Application Nos. 20110301073, 20110239315 and 20119145940.

[0062] A zinc finger DNA-binding protein (or binding domain) is a protein, or a domain within a Petition 870210100564, dated 10 / 29 / 2021, page 42 / 151 39 / 137 larger protein that binds DNA in a sequence-specific manner through one or more zinc fingers, which are amino acid sequence regions within the binding domain whose structure is stabilized through coordination with a zinc ion. The term zinc finger DNA-binding protein is generally abbreviated as zinc finger protein or ZFP. Zinc finger binding domains can be genetically modified to bind to a predetermined nucleotide sequence. Non-limiting examples of methods for genetically modifying zinc finger proteins are design and selection. An engineered zinc finger protein is a non-naturally occurring protein whose design / composition results primarily from rational criteria.Rational design criteria include applying substitution rules and computerized algorithms to process information in a database that stores existing ZFP design information and linkage data. See, for example, U.S. Patents Nos. 6,140,081; 6,453,242; 6,534,261 and 6,794,136; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496.

[0063] In other examples, the DNA-binding domain of one or more of the nucleases comprises a naturally occurring or genetically modified (non-naturally occurring) TAL effector DNA-binding domain. See, for example, Patent Application No. 20110301073, incorporated by reference in its entirety herein. Plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. The pathogenicity of Xanthomonas depends on a conserved type III secretion system (T3S) that injects more than one different effector protein into the plant cell. Among these injected proteins are transcription activator-like effectors (TALENs) that mimic plant transcriptional activators and Petition 870210100564, dated 10 / 29 / 2021, page 43 / 151 40 / 137 manipulate the plant transcriptome (see Kay et al., (2007) Science 318:648-651). These proteins contain a DNA-binding domain and a transcriptional activation domain. One of the best-characterized TAL effectors is AvrBs3 from Xanthomonas campestgris pv. vesicatoria (see Bonas et al., (1989) Mol Gen Genet 218: 127136 and WO2010079430). TAL effectors contain a centralized tandem repeat domain, where each repeat contains approximately 34 amino acids, which are key to the DNA-binding specificity of these proteins. In addition, they contain a nuclear localization sequence and a transcriptional activation domain (for an evaluation, see Schornack S, et al., (2006) J Plant Physiol 163(3): 256-272). Furthermore, two genes in the phytopathogenic bacteria Ralstonia solanacearum, designated brg11 and hpx17, were found to be homologous to the AvrBs3 family of Xanthomonas in the biovar R strain.Solanacearum GMI1000 and in the biovar 4 strain RS1000 (See Heuer et al., (2007) Appl and Enviro Micro 73(13): 4379-4384). These genes are 98.9% identical in nucleotide sequence to each other, but differ by a 1,575 bp deletion in the hpx17 repeat domain. However, both gene products have less than 40% sequence identity with Xanthomonas AvrBs3 family proteins. See, for example, U.S. Patent Application No. 20110301073, incorporated by reference in its entirety.

[0064] The specificity of these TAL effectors depends on the sequences found in the tandem repeats. The repeated sequence comprises approximately 102 bp and the repeats are typically 91 to 100% homologous to each other (Bonas et al., ibid). The polymorphism of the repeats is normally located at positions 12 and 13 and appears to be a one-to-one correspondence between the identity of the hypervariable diresidues at positions 12 and 13 with the identity of the hypervariable diresidues at positions 12 and 13. Petition 870210100564, dated 10 / 29 / 2021, p. 44 / 151 41 / 137 date of the contiguous nucleotides in the target sequence of the TAL effector (see Moscow and Bogdanove, (2009) Science 326:1501 and Boch et al., (2009) Science 326:1509-1512). Experimentally, the natural code for DNA recognition of these TAL effectors was determined such that an HD sequence at positions 12 and 13 leads to cytosine (C) binding, NG binds to T, NI to A, C, G or T, NN binds to A or G, and ING binds to T. These DNA-binding repeats were assembled into proteins with new combinations and repeat numbers, to produce artificial transcription factors that have the ability to interact with new sequences and activate the expression of a non-endogenous reporter gene in plant cells (Boch et al., ibid).Genetically modified TAL proteins were ligated to a Fok I cleavage domain to produce a TAL effector domain nuclease fusion (TALEN) that exhibits activity in a yeast reporter assay (plasmid-based target).

[0065] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas (CRISPR Associated) nuclease system is a recently genetically modified nuclease system based on a bacterial system that can be used for genome-wide genetic manipulation. It is based, in part, on the adaptive immune response of many bacteria and Archaea. When a virus or plasmid invades a bacterium, segments of the invader's DNA are converted into CRISPR RNA (crRNA) by the immune response. This crRNA then associates, through a region of partial complementarity, with another type of RNA called tracrRNA to guide the Cas9 nuclease to a region homologous to the crRNA in the target DNA called a protospacer. Cas9 performs DNA cleavage to generate blunt ends at double-strand breaks (DSBs) at sites specified by a 20-nucleotide guide sequence contained within the crRNA transcript. Cas9 requires Petition 870210100564, dated 10 / 29 / 2021, p. 45 / 151 42 / 137 of both crRNA and tracrRNA for site-specific DNA recognition and cleavage. This system has now been genetically modified so that crRNA and tracrRNA can be combined into one molecule (the single guide RNA), and the equivalent crRNA portion of the single guide RNA can be genetically modified to guide Cas9 nuclease to target any desired sequence (see Jinek et al., (2012) Science 337, pages 816-821, Jinek et al., (2013), eLife 2:e00471, and David Segal, (2013) eLife 2:e00563). In other examples, crRNA associates with tracrRNA to guide Cpf1 nuclease to a region homologous to crRNA to cleave DNA with staggered ends (see Zetsche, Bernd, et al. Cell 163.3 (2015): 759-771).Thus, the CRISPR / Cas system can be genetically modified to create a DSB at a desired target in a genome, and DSB repair can be influenced by the use of repair inhibitors to cause an increase in error-prone repair.

[0066] In other examples, the heterologous DNA-linking transgene / coding sequence is a site-specific nuclease comprising a genetically modified (unnaturally occurring) meganuclease (also described as a migrating endonuclease). Recognition sequences for migrating endonucleases or meganucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, ISce IV, I-Csm I, I-Pan I, I-Sce II, I-Ppo I, I-Sce III, I-Cre I, I-Tev I, I-Tev II, and ITevIII are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al., (1997) Nucleic Acids Res. 25:3379-30 3388; Dujon et al., (1989) Gene 82:115-118; Perler et al., (1994) Nucleic Acids Res. 22, 11127; Jasin (1996) Genet. Trends 12:224-228; Gimble et al., (1996) J. Mol. Biol. 263:163-180; Argast et al., (1998) J. Mol. Biol. 280:345-353 and the New England Biolabs catalog. Furthermore, the DNA binding specificity of Petition 870210100564, dated 10 / 29 / 2021, p. 46 / 151 43 / 137 migrating endonucleases and meganucleases can be genetically modified to bind to unnatural target sites. See, for example, Chevalier et al., (2002) Molec. Cell 10:895-905; Epinat et al., (2003) Nucleic Acids Res. 5 31:2952-2962; Ashworth et al., (2006) Nature 441:656-659; Paques et al., (2007) Current Gene Therapy 7:4966; US Patent Application No. 20070117128. The DNA-binding domains of migrating endonucleases and meganucleases can be altered within the context of the nuclease as a whole (i.e., so that the nuclease includes the cognate cleavage domain) or can be fused to a heterologous cleavage domain.

[0067] As used in this document, the term transformation encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation; lipofection; microinjection (Mueller et al., (1978) Cell 15:579-85); Agrobactenum-mediated transfer; direct DNA uptake; WHISKERS™-mediated transformation; and microprojectile bombardment. These techniques can be used for both stable and transient transformation of a plant cell. Stable transformation refers to the introduction of a nucleic acid fragment into the genome of a host organism resulting in genetically stable inheritance. After stable transformation, the nucleic acid fragment is stably integrated into the genome of the host organism and any subsequent generation.Host organisms containing the transformed nucleic acid fragments are called transgenic organisms. Transient transformation refers to the introduction of a nucleic acid fragment into the nucleus, or organelle containing DNA, of a host organism, resulting in gene expression without genetically stable inheritance. Petition 870210100564, dated 10 / 29 / 2021, page 47 / 151 44 / 137

[0068] An exogenous nucleic acid sequence. In one example, a transgene / heterologous coding sequence is a sequence of genes (e.g., a herbicide-resistant gene), a gene encoding an industrially or pharmaceutically useful compound, or a gene encoding a desired agricultural trait. In yet another example, the transgene / heterologous coding sequence is an antisense nucleic acid sequence, in which the expression of the antisense nucleic acid sequence inhibits the expression of a target nucleic acid sequence. A transgene / heterologous coding sequence may contain regulatory sequences functionally linked to the transgene / heterologous coding sequence (e.g., a promoter). In some embodiments, a polynucleotide sequence of interest is a transgene.However, in other embodiments, a polynucleotide sequence of interest is either an endogenous nucleic acid sequence, where additional genomic copies of the endogenous nucleic acid sequence are desired, or a nucleic acid sequence that is in the antisense orientation relative to the sequence of a target nucleic acid molecule in the host organism.

[0069] As used in this document, the term a transgenic event is produced by the transformation of plant cells with heterologous DNA, that is, a nucleic acid construct that includes a heterologous transgene / coding sequence of interest, regeneration of a plant population resulting from the insertion of the heterologous transgene / coding sequence into the plant genome, and selection of a particular plant characterized by the insertion at a particular genomic location. The term event refers to the original transformant and the progeny of the transformation that include the heterologous DNA. The term event also refers to progeny produced by a sexual cross between the transformant and another variety. Petition 870210100564, dated 10 / 29 / 2021, page 48 / 151 45 / 137 The term "event" refers to the transgene / heterologous coding sequence inserted and flanking genomic DNA (genomic / transgene DNA) of the transformed parent. Even after repeated backcrossing to a recurrent parent, the transgene / heterologous coding sequence inserted and flanking genomic DNA (genomic / transgene DNA) of the transformed parent is present in the progeny of the cross at the same chromosomal location. The term "event" also refers to the DNA of the original transformant and its progeny comprising the inserted DNA and flanking genomic sequence immediately adjacent to the inserted DNA that was expected to be transferred to progeny receiving inserted DNA, including the transgene / heterologous coding sequence of interest, as a result of a sexual cross of a parental lineage that includes the inserted DNA (e.g., the original transformant and progeny resulting from self-pollination) and a parental lineage that does not contain the inserted DNA.

[0070] As used in this document, the terms Polymerase Chain Reaction or PCR define a procedure or technique in which minute quantities of nucleic acid, RNA and / or DNA are amplified, as described in U.S. Patent No. 4,683,195 issued July 28, 1987. In general, sequence information from the ends of the region of interest or beyond needs to be available so that oligonucleotide primers can be designed; these primers will be identical or similar in sequence to the opposite strands of the template to be amplified. The 5' terminal nucleotides of the two primers may coincide with the ends of the amplified material. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, etc. See generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51:263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY, 1989). Petition 870210100564, dated 10 / 29 / 2021, page 49 / 151 46 / 137

[0071] As used in this document, the term primer refers to an oligonucleotide capable of acting as a synthesis initiation point along a complementary strand when conditions are suitable for the synthesis of a primer extension product. Synthesis conditions include the presence of four different deoxyribonucleotide triphosphates and at least one polymerization-inducing agent such as reverse transcriptase or DNA polymerase. These are present in a suitable buffer, which may include constituents that are cofactors or that affect conditions such as pH and the like at various suitable temperatures. A primer is preferably a single-stranded sequence so that amplification efficiency is optimal, but double-stranded sequences may be used.

[0072] As used in this document, the term probe refers to an oligonucleotide that hybridizes to a target sequence. In the TaqMan® or TaqMan®-style assay procedure, the probe hybridizes to a portion of the target located between the annealing sites of the two primers. A probe includes about eight nucleotides, about ten nucleotides, about fifteen nucleotides, about twenty nucleotides, about thirty nucleotides, about forty nucleotides, or about fifty nucleotides. In some embodiments, a probe includes from about eight nucleotides to about fifteen nucleotides. A probe may also include a detectable identifier, for example, a fluorophore (Texas-Red®, fluorescein isothiocyanate, etc.). The detectable identifier can be covalently attached directly to the probe oligonucleotide, for example, located at the 5' end of the probe or at the 3' end of the probe.A probe that includes a fluorophore may also include a burst cooler, for example, Black Hole Quencher™, Iowa Black™, etc. Petition 870210100564, dated 10 / 29 / 2021, p. 50 / 151 47 / 137

[0073] As used in this document, the terms restriction endonucleases and restriction enzymes refer to bacterial enzymes, each of which cuts double-stranded DNA at, or near, a specific nucleotide sequence. Type 2 restriction enzymes recognize and cleave DNA at the same site and include, but are not limited to, XbaI, BamHI, HindIII, EcoRI, XhoI, SalI, KpnI, AvaI, PstI, and SmaI.

[0074] As used in this document, the term vector is used interchangeably with the terms construct, cloning vector, and expression vector and means the vehicle by which a DNA or RNA sequence (e.g., an exogenous gene) can be introduced into a host cell so as to transform the host and promote the expression (e.g., transcription and translation) of the introduced sequence. A nonviral vector is intended to mean any vector that does not comprise a virus or retrovirus. In some embodiments, a vector is a DNA sequence comprising at least one origin of DNA replication and at least one selectable marker gene. Examples include, but are not limited to, a plasmid, cosmid, bacteriophage, bacterial artificial chromosome (BAC), or virus carrying exogenous DNA into a cell. A vector may also include one or more genes, antisense molecules, and / or selectable marker genes and other genetic elements known in the art.A vector can transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid and / or protein molecules encoded by the vector.

[0075] The term plasmid defines a circular strand of nucleic acid capable of autosomal replication in both a prokaryotic and a eukaryotic host cell. The term includes nucleic acid that can be either DNA or RNA and can be single-stranded or double-stranded. The defining plasmid can also include sequences that Petition 870210100564, dated 10 / 29 / 2021, pp. 51 / 151 48 / 137 correspond to a bacterial origin of replication.

[0076] As used herein, the term selectable marker gene defines a gene or other expression cassette that encodes a protein that facilitates the identification of cells into which the selectable marker gene is inserted. For example, a selectable marker gene encompasses reporter genes, as well as genes used in plant transformation to, for example, protect plant cells from a selective agent or provide resistance / tolerance to a selective agent. In one embodiment, only those cells or plants that receive a functional selectable marker have the ability to divide or be grown under conditions that have a selective agent. The term positive marker refers to plants that have been transformed to include a selectable marker gene.

[0077] As used in this document, the term detectable marker refers to a detectable identifier, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, chemiluminescent compound, metal chelator, or enzyme. Examples of detectable markers include, but are not limited to, the following: fluorescent identifiers (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic identifiers (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescence, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal-binding domains, epitope labels). In one embodiment, a detectable marker may be fixed by spacer arms of varying lengths to reduce potential steric hindrance.

[0078] As used in this document, the terms casse Petition 870210100564, dated 10 / 29 / 2021, page 52 / 151 49 / 137 te, expression cassette and gene expression cassette refer to a segment of DNA that can be inserted into a nucleic acid or polynucleotide at specific restriction sites or by homologous recombination. As used in this document, the DNA segment comprises a polynucleotide encoding a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette into the appropriate reading frame for transcription and translation. In one embodiment, an expression cassette may include a polynucleotide encoding a polypeptide of interest and that has elements beyond the polynucleotide that facilitate transformation in a specific host cell. In another embodiment, a gene expression cassette may also include elements that allow for enhanced expression of a polynucleotide encoding a polypeptide of interest in a host cell.These elements may include, but are not limited to: a promoter, a minimal promoter, an enhancer, a response element, a terminator sequence, a polyadenylation sequence, and the like.

[0079] As used herein, a linker or spacer is a link, molecule, or group of molecules that links two separate entities together. Linkers and spacers may provide ideal spacing between the two entities or may provide a labile link that allows the two entities to be separated from each other. Labile linkers include photocleavable groups, acid-labile chemical portions, base-labile chemical portions, and enzyme-cleavable groups. The terms polylinker or multiple cloning sites, as used herein, define a cluster of three or more Type 2 restriction enzyme sites located within 10 nucleotides of each other in a nucleic acid sequence. In other examples, the Petition 870210100564, dated 10 / 29 / 2021, page 53 / 151 50 / 137 The term polylinker, as used in this document, refers to a stretch of nucleotides that are targeted to join two sequences by means of any known continuous cloning method (i.e., Gibson Assembly®, NEBuilder HiFiDNA Assembly®, Golden Gate Assembly, BioBrick® Assembly, etc.). Constructs comprising a polylinker are used for insertion and / or excision of nucleic acid sequences as the coding region of a gene.

[0080] As used in this document, the term control refers to a sample used in an analytical procedure for comparison purposes. A control can be positive or negative. For example, when the purpose of an analytical procedure is to detect a differently expressed transcript or polypeptide in cells or tissue, it is generally preferable to include a positive control, such as a sample from a known plant that exhibits the desired expression, and a negative control, such as a sample from a known plant that does not have the desired expression.

[0081] As used in this document, the term plant includes a complete plant and any offspring, cell, tissue, or part of a plant. A class of plant that may be used in the present invention is generally as broad as the class of mutagenic lower and higher plants, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. Thus, plant includes monocotyledonous and dicotyledonous plants. The term plant parts includes any part (or any parts) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); a plant cutting; a plant cell; a plant cell culture; a plant organ (e.g., pollen, embryos, flowers, fruits, buds, leaves, roots, stems, and explants). Petition 870210100564, dated 10 / 29 / 2021, page 54 / 151 51 / 137 Plant tissue or plant organ can be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may have the ability to regenerate a plant that has the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and to regenerate a plant that has substantially the same genotype as the plant. Conversely, some plant cells do not have the ability to be regenerated to produce plants. Regenerable cells in a plant cell or tissue culture can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, grains, ears, cobs, husks, or stems.

[0082] Plant parts include harvestable parts and parts useful for propagating progeny plants. Plant parts useful for propagation include, for example, and without limitation: seed; fruit; a cutting; a seedling; a tuber; and a rootstock. A harvestable part of a plant may be any useful part of a plant, including, for example, and without limitation: flower; pollen; seedling; tuber; leaf; stem; fruit; seed; and root.

[0083] A plant cell is the structural and physiological unit of the plant, comprising a protoplast and a cell wall. A plant cell may be in the form of a single isolated cell, or an aggregate of cells (e.g., a friable callus and a cultured cell), and may be part of a higher organized unit (e.g., a plant tissue, plant organ, and plant). Thus, a plant cell may be a protoplast, a cell-producing gamete, or a cell or collection of cells that can regenerate into a complete plant. In this way, a seed, which comprises multiple plant cells and has the capacity to regenerate into a complete plant, is considered a plant cell in the form of a plant cell. Petition 870210100564, of 10 / 29 / 2021, page 55 / 151 52 / 137 data in this document.

[0084] As used in this document, the term small RNA refers to several classes of non-coding ribonucleic acid (ncRNA). The term small RNA describes the short chains of ncRNA produced in bacterial, animal, plant, and fungal cells. These short chains of ncRNA can be produced naturally within the cell or can be produced by the introduction of an exogenous sequence that expresses the short chain or ncRNA. Small RNA sequences do not directly encode a protein, and differ in function from other RNA in that small RNA sequences are only transcribed and not translated. Small RNA sequences are involved in other cellular functions, including gene expression and modification. Small RNA molecules are typically composed of about 20 to 30 nucleotides. Small RNA sequences can be derived from longer precursors.The precursors form structures that fold back into each other in self-complementary regions; these are then processed by the nuclease Dicer in animals or DCL1 in plants.

[0085] There are many types of small RNA, both natural and artificially produced, including microRNAs (miRNAs), short interfering RNAs (siRNAs), antisense RNAs, short hairpin RNAs (shRNAs), and small nucleolar RNAs (snoRNAs). Certain types of small RNA, such as microRNAs and siRNAs, are important in gene silencing and RNA interference (RNAi). Gene silencing is a genetic regulation process in which a gene that would normally be expressed is switched off by an intracellular element, in this case, small RNA. The protein that would normally be formed from this genetic information is not formed due to the interference, and the information encoded in the gene is bloPetição 870210100564, dated 29 / 10 / 2021, pág. 56 / 151 53 / 137 falls of the expression.

[0086] As used in this document, the term small RNA encompasses RNA molecules described in the literature as tiny RNA (Storz, (2002) Science 296:1260-3; Illangasekare et al., (1999) RNA 5:1482-1489); prokaryotic small RNA (sRNA) (Wassarman et al., (1999) Trends Microbiol. 7:37-45); eukaryotic non-coding RNA (ncRNA); micro-RNA (miRNA); non-small mRNA (snmRNA); functional RNA (fRNA); transfer RNA (tRNA); catalytic RNA [e.g., ribozymes, including self-acylated ribozymes (Illangasekare et al., (1999) RNA 5:1482-1489); small nucleolar RNAs (snoRNAs), tmRNA (also known as 10S RNA, Muto et al., (1998) Trends Biochem Sci. 23:25 to 29; and Gillet et al., (2001) Mol Microbiol.42:879-885); RNAi molecules, including without limitation small interfering RNA (siRNA), endoribonuclease-prepared siRNA (e-siRNA), hairpin-shaped short RNA (shRNA), and temporally small regulated RNA (stRNA), spliced ​​siRNA (d-siRNA), and aptamers, oligonucleotides and other synthetic nucleic acids comprising at least one uracil base.

[0087] Unless specifically explained otherwise, all technical and scientific terms used in this document have the same meaning as that commonly understood by those of ordinary skill in the art to which this disclosure pertains. Definitions of terms common in molecular biology may be seen in, for example: Lewin, Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Meyers (ed.), Molecular Biology and Biotechnology: A Comprehensive Table Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). III. GmTEFs1 Gene Regulatory Elements and Nucleic Acids Petition 870210100564, dated 10 / 29 / 2021, p. 57 / 151 54 / 137 which comprise the same

[0088] Methods and compositions are provided for using a promoter of a Glycine max Glyma19g07240 gene (elongation factor 1 alpha) to express non-GmTEFs1 transgenes in plants. In one embodiment, a promoter can be a GmTEFs1 gene promoter of SEQ ID NO:2.

[0089] In one embodiment, a polynucleotide comprising a promoter is provided, wherein the promoter is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% identical to SEQ ID NO:2. In one embodiment, a promoter is a GmTEFs1 gene promoter comprising a polynucleotide at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% identical to the polynucleotide of SEQ ID NO:2. In one embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID NO:2. In one embodiment, a nucleic acid vector is provided that comprises a GmTEFs1 promoter of SEQ ID NO:2. In one embodiment, a polynucleotide is provided that comprises a GmTEFs1 promoter that is functionally linked to a polylinker.In one embodiment, a gene expression cassette is provided comprising a GmTEFs1 promoter that is functionally linked to a non-GmTEFs1 transgene. In another embodiment, a nucleic acid vector is provided comprising a GmTEFs1 promoter that is functionally linked to a non-GmTEFs1 transgene. In one embodiment, the promoter consists of SEQ ID NO:2. In an illustrative embodiment, a nucleic acid vector comprises a GmTEFs1 promoter that is functionally linked to a transgene, wherein the transgene / coding sequence is heterologous. Petition 870210100564, dated 10 / 29 / 2021, pp. 58 / 151 55 / 137 may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linking transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[0090] In one embodiment, a nucleic acid vector comprises a gene expression cassette, as disclosed herein. In one embodiment, a vector may be a plasmid, a cosmid, a bacterial artificial chromosome (BAC), a bacteriophage, a virus, or a polynucleotide fragment excised for use in direct transformation or gene targeting as a donor DNA.

[0091] Transgene expression can also be regulated by a 5' UTR region located downstream of the promoter sequence. Both a promoter and a 5' UTR can regulate the expression of a heterologous transgene / coding sequence. Although a promoter is required to trigger transcription, the presence of a 5' UTR can increase expression levels that result in mRNA transcription for translation and protein synthesis. A 5' UTR gene region assists in the stable expression of a transgene. In another embodiment, a 5' UTR is functionally linked to a GmTEFs1 promoter. In one embodiment, a 5' UTR may be the 5' UTR of GmTEFs1 from SEQ ID NO:3.

[0092] In one embodiment, a polynucleotide comprising a 5' UTR is provided, wherein the 5' UTR is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% identical to SEQ ID NO:3. In one embodiment, a 5' UTR is a GmTEFs1 5' UTR comprising a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, Petition 870210100564, dated 10 / 29 / 2021, pp. 59 / 151 56 / 137 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID NO:3. In one embodiment, an isolated polynucleotide is provided comprising at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID NO:3. In one embodiment, a nucleic acid vector comprising the 5' UTR of GmTEFs1 of SEQ ID NO:3 is provided. In one embodiment, a polynucleotide comprising a 5' UTR of GmTEFs1 that is functionally linked to a polylinker is provided. In one embodiment, a gene expression cassette is provided comprising a 5' GmTEFs1 UTR that is functionally linked to a non-GmTEFs1 transgene. In another embodiment, a nucleic acid vector is provided comprising a 5' GmTEFs1 UTR that is functionally linked to a non-GmTEFs1 transgene. In one embodiment, the 5' UTR consists of SEQ ID NO:3.In an illustrative embodiment, a nucleic acid vector comprises a 5' UTR of GmTEFs1 that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[0093] Transgene expression can also be regulated by an intron region located downstream of the promoter sequence. Both a promoter and an intron can regulate the expression of a transgene / heterologous coding sequence. Although a promoter is required to trigger transcription, the presence of an intron can increase expression levels that result in mRNA transcription for translation and protein synthesis. A gene region of Petition 870210100564, dated 10 / 29 / 2021, page 60 / 151 57 / 137 intron assists in the stable expression of a transgene. In another embodiment, an intron is functionally linked to a GmTEFs1 promoter. In one embodiment, an intron can be the 5' UTR of GmTEFs1 from SEQ ID NO:28.

[0094] In one embodiment, a polynucleotide comprising an intron is provided, wherein the intron is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% identical to SEQ ID NO:28. In one embodiment, an intron is a GmTEFs1 intron comprising a polynucleotide with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID NO:28. In another embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID NO:28. In one embodiment, a nucleic acid vector comprising a GmTEFs1 intron of SEQ ID NO:28 is provided. In another embodiment, a polynucleotide comprising a GmTEFs1 intron that is functionally linked to a polylinker is provided.In one embodiment, a gene expression cassette is provided comprising a GmTEFs1 intron that is functionally linked to a non-GmTEFs1 transgene. In another embodiment, a nucleic acid vector is provided comprising a GmTEFs1 intron that is functionally linked to a non-GmTEFs1 transgene. In one embodiment, the intron consists of SEQ ID NO:28. In an illustrative embodiment, a nucleic acid vector comprises a GmTEFs1 intron that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, or a nitrogen efficiency transgene. Petition 870210100564, dated 10 / 29 / 2021, p. 61 / 151 58 / 137 water use, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[0095] In accordance with one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a GmTEFs1 promoter functionally linked to a polylinker sequence, a non-GmTEFs1 gene or a non-GmTEFs1 transgene or combinations thereof. In one embodiment, the recombinant gene cassette comprises a GmTEFs1 promoter functionally linked to a non-GmTEFs1 gene or transgene. In one embodiment, the recombinant gene cassette comprises a GmTEFs1 promoter, as disclosed herein, that is functionally linked to a polylinker sequence.The polyligand is operationally linked to the GmTEFs1 promoter in such a way that inserting an encoding sequence into one of the polyligand's restriction sites will operationally link the encoding sequence, enabling expression of the encoding sequence when the vector is transformed or transfected into a host cell.

[0096] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmTEFs1 promoter and a non-GmTEFs1 gene. In one embodiment, the GmTEFs1 promoter of SEQ ID NO: 2 is functionally linked to the 5' end of the non-GmTEFs1 gene or transgene. In another embodiment, the GmTEFs1 promoter sequence comprises SEQ ID NO: 2 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO: 2. According to one embodiment, a nucleic acid vector comprising a gene cassette consisting of a Petition 870210100564, dated 10 / 29 / 2021, p. 62 / 151 59 / 137 GmTEFs1 promoter and a non-GmTEFs1 gene, wherein the GmTEFs1 promoter is functionally linked to the 5' end of the non-GmTEFs1 gene, and the GmTEFs1 promoter sequence comprises SEQ ID NO:2 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with a SEQ ID NO:2. In another embodiment, the GmTEFs1 promoter sequence consists of SEQ ID NO:2 or the 371 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with a SEQ ID NO:2.

[0097] In accordance with one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a 5' GmTEFs1 UTR functionally linked to a polylinker sequence, a non-GmTEFs1 gene or transgene, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a 5' GmTEFs1 UTR functionally linked to a non-GmTEFs1 gene or transgene. In one embodiment, the recombinant gene cassette comprises a 5' GmTEFs1 UTR, as disclosed herein, which is functionally linked to a polylinker sequence.The polyligand is operationally linked to the GmTEFs1 UTR 5' such that inserting an encoding sequence into one of the polyligand's restriction sites will operationally link the encoding sequence, enabling the expression of the encoding sequence when the vector is transformed or transfected into a host cell.

[0098] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 5' UTR of GmTEFs1 and a non-GmTEFs1 gene. In one embodiment, the 5' UTR of GmTEFs1 from SEQ ID NO:3 is functionally linked to the 5' end of the non-GmTEFs1 gene or transgene. In Petition 870210100564, dated 10 / 29 / 2021, p. 63 / 151 60 / 137 In another embodiment, the 5' UTR sequence of GmTEFs1 comprises SEQ ID NO:3 or a sequence having 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:3. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 5' UTR of GmTEFs1 and a non-GmTEFs1 gene, wherein the 5' UTR of GmTEFs1 is functionally linked to the 5' end of the non-GmTEFs1 gene, and the 5' UTR of the GmTEFs1 gene comprises SEQ ID NO:3 or a sequence having 80, 85, 90, 95, 99, or 100% sequence identity with a SEQ ID NO:3. In an additional embodiment, the 5' UTR of the GmTEFs1 gene consists of SEQ ID NO:3 or a 248 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:3.

[0099] In accordance with one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a GmTEFs1 intron functionally linked to a polylinker sequence, a non-GmTEFs1 gene or transgene, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a GmTEFs1 intron functionally linked to a non-GmTEFs1 gene or transgene. In one embodiment, the recombinant gene cassette comprises a GmTEFs1 intron, as disclosed herein, that is functionally linked to a polylinker sequence.The polyligand is operationally linked to the GmTEFs1 intron in such a way that inserting an encoding sequence into one of the polyligand's restriction sites will operationally link the encoding sequence, enabling expression of the encoding sequence when the vector is transformed or transfected into a host cell.

[00100] In accordance with a modality, a is provided Petition 870210100564, dated 10 / 29 / 2021, page 64 / 151 61 / 137 nucleic acid vector comprising a gene cassette consisting of a GmTEFs1 intron and a non-GmTEFs1 gene. In one embodiment, the GmTEFs1 intron of SEQ ID NO:28 is functionally linked to the 5' end of the non-GmTEFs1 gene or transgene. In another embodiment, the GmTEFs1 intron sequence comprises SEQ ID NO:28 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:28. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmTEFs1 intron and a non-GmTEFs1 gene, wherein the GmTEFs1 intron is functionally linked to the 5' end of the non-GmTEFs1 gene, and the GmTEFs1 gene intron sequence comprises SEQ ID NO:28 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:28.In an additional embodiment, the GmTEFs1 gene intron consists of SEQ ID NO:28 or an 895 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:28.

[00101] A GmTEFs1 promoter may also comprise one or more additional sequence elements. In some embodiments, a GmTEFs1 promoter may comprise an exon (e.g., a leader or signal peptide such as a chloroplast transition peptide or ER retention signal). For example, and without limitation, a GmTEFs1 promoter may encode an exon embedded in the GmTEFs1 promoter as an additional embodiment.

[00102] Methods and compositions are further provided for using a 3' UTR of a Glyma19g07240 gene (Glycine max elongation factor 1 alpha) to terminate the expression of non-GmTEFs1 transgenes in a plant. In one embodiment, a 3' UTR terminator can be the 3' UTR of GmTEFs1 from SEQ ID NO:4.

[00103] In one embodiment, a polynucleotide is provided that Petition 870210100564, dated 10 / 29 / 2021, page 65 / 151 62 / 137 comprises a 3' UTR, wherein the 3' UTR is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% identical to SEQ ID NO:4. In one embodiment, a 3' UTR is a GmTEFs1 3' UTR comprising a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% identical to the polynucleotide of SEQ ID NO:4. In one embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID NO:4. In one embodiment, a nucleic acid vector is provided that comprises a 3' UTR of GmTEFs1 of SEQ ID NO:4. In one embodiment, a polynucleotide is provided that comprises a 3' UTR of GmTEFs1 that is functionally linked to a polylinker.In one embodiment, a gene expression cassette is provided comprising a 3' GmTEFs1 UTR that is functionally linked to a non-GmTEFs1 transgene. In another embodiment, a nucleic acid vector is provided comprising a 3' GmTEFs1 UTR that is functionally linked to a non-GmTEFs1 transgene. In one embodiment, the 3' UTR consists of SEQ ID NO: 4. In an illustrative embodiment, a nucleic acid vector comprises a 3' GmTEFs1 gene UTR that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[00104] In accordance with a modality, a Petition 870210100564, dated 10 / 29 / 2021, p. 66 / 151 63 / 137 nucleic acid vector comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a 3' GmTEFs1 UTR functionally linked to a polylinker sequence, a non-GmTEFs1 gene or heterologous transgene / coding sequence, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a 3' GmTEFs1 UTR functionally linked to a non-GmTEFs1 gene or transgene. In another embodiment, the recombinant gene cassette comprises a 3' GmTEFs1 UTR, as disclosed herein, which is functionally linked to a polylinker sequence.The polyligand is operationally linked to the GmTEFs1 UTR 3' such that inserting an encoding sequence into one of the polyligand's restriction sites will operationally link the encoding sequence, enabling the expression of the encoding sequence when the vector is transformed or transfected into a host cell.

[00105] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 3' UTR of GmTEFs1 and a non-GmTEFs1 gene. In one embodiment, the 3' UTR of GmTEFs1 of SEQ ID NO:4 is functionally linked to the 3' end of the non-GmTEFs1 gene or transgene. In another embodiment, the 3' UTR sequence of GmTEFs1 comprises SEQ ID NO:4 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:4. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 3' UTR of GmTEFs1 and a non-GmTEFs1 gene, wherein the 3' UTR of GmTEFs1 is functionally linked to the 3' end of the non-GmTEFs1 gene, and the 3' UTR of GmTEFs1 comprises SEQ ID NO:4 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with a SEQ Petition 870210100564, dated 10 / 29 / 2021, p. 67 / 151 64 / 137 ID NO:4. In an additional embodiment, the GmTEFsl UTR 3' sequence consists of SEQ ID NO:4 or a 739 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4.

[00106] Methods and compositions are further provided for using a terminator of a Glyma19g07240 gene (Glycine max elongation factor 1 alpha) to terminate the expression of non-GmTEFs1 transgenes in a plant. In one embodiment, a terminator may be the GmTEFs1 terminator of SEQ ID NO:5.

[00107] In one embodiment, a polynucleotide comprising a terminator is provided, wherein the terminator is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% identical to SEQ ID NO:5. In one embodiment, a terminator is a GmTEFs1 terminator comprising a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% identical to the polynucleotide of SEQ ID NO:5. In one embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID NO:5. In one embodiment, a nucleic acid vector is provided that comprises a GmTEFs1 terminator of SEQ ID NO:5. In one embodiment, a polynucleotide is provided that comprises a GmTEFs1 terminator that is functionally linked to a polylinker.In one embodiment, a gene expression cassette is provided comprising a GmTEFs1 terminator that is functionally linked to a non-GmTEFs1 transgene. In another embodiment, a nucleic acid vector is provided comprising a GmTEFs1 terminator that is functionally linked to a non-GmTEFs1 transgene. In one embodiment, the terminator consists of the SEQ ID NO:. Petition 870210100564, dated 10 / 29 / 2021, p. 68 / 151 65 / 137 5. In an illustrative embodiment, a nucleic acid vector comprises a GmTEFs1 terminator that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[00108] In accordance with one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a GmTEFs1 terminator functionally linked to a polylinker sequence, a non-GmTEFs1 gene or transgene, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a GmTEFs1 terminator functionally linked to a non-GmTEFs1 gene or transgene. In one embodiment, the recombinant gene cassette comprises a GmTEFs1 terminator, as disclosed herein, functionally linked to a polylinker sequence.The polyligand is operationally linked to the GmTEFs1 terminator in such a way that inserting an encoding sequence into one of the polyligand's restriction sites will operationally link the encoding sequence, enabling the expression of the encoding sequence when the vector is transformed or transfected into a host cell.

[00109] In accordance with one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmTEFs1 terminator and a non-GmTEFs1 gene. In one embodiment, the GmTEFs1 terminator of SEQ ID NO:5 is Petition 870210100564, dated 10 / 29 / 2021, p. 69 / 151 66 / 137 functionally linked to the 3' end of the non-GmTEFs1 gene or transgene. In another embodiment, the GmTEFs1 terminator sequence comprises SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:5. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmTEFs1 terminator and a non-GmTEFs1 gene, wherein the GmTEFs1 terminator is functionally linked to the 3' end of the non-GmTEFs1 gene, and the GmTEFs1 terminator sequence comprises SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO:5. In an additional embodiment, the GmTEFs1 terminator sequence consists of SEQ ID NO:5 or an 897 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5.

[00110] In one embodiment, a nucleic acid construct is provided comprising a GmTEFs1 promoter and a non-GmTEFs1 gene and optionally one or more of the following elements: a) an untranslated region 5'; b) an intron; and c) an untranslated region 3', wherein the GmTEFs1 promoter consists of SEQ ID NO:2 or a sequence that has 95% sequence identity with SEQ ID NO:2; The 5' UTR of GmTEFs1 consists of a known 5' UTR, SEQ ID NO:3, or a sequence that has 95% sequence identity with SEQ ID NO:3; and the 3' UTR consists of a known 3' UTR, SEQ ID NO:4, or a sequence that has 95% sequence identity with the Petition 870210100564, dated 10 / 29 / 2021, p. 70 / 151 67 / 137 SEQ ID NO:4; furthermore, wherein said GmTEFsl promoter is functionally linked to said heterologous transgene / coding sequence and each optional element, when present, is also functionally linked to both the promoter and the transgene. In a further embodiment, a transgenic cell comprising the nucleic acid construct disclosed immediately above is provided. In one embodiment, the transgenic cell is a plant cell, and in a further embodiment, a plant is provided, wherein the plant comprises said transgenic cells.

[00111] In one embodiment, a nucleic acid construct is provided comprising a GmTEFs1 promoter and a non-GmTEFs1 gene and optionally one or more of the following elements: a) an untranslated region 5'; b) an intron; and c) a 3' terminator region, wherein the GmTEFs1 promoter consists of SEQ ID NO:2 or a sequence that has 95% sequence identity with SEQ ID NO:2; The 5' UTR of GmTEFs1 consists of a known 5' UTR, SEQ ID NO:3, or a sequence that has 95% sequence identity with SEQ ID NO:3; and the 3' terminator consists of a known 3' terminator, SEQ ID NO:5, or a sequence that has 95% sequence identity with SEQ ID NO:5; furthermore, wherein said GmTEFs1 promoter is functionally linked to said heterologous transgene / coding sequence, and each optional element, when present, is also functionally linked to both the promoter and the transgene. In a further embodiment, a transgenic cell comprising the naked acid construct is provided. Petition 870210100564, dated 10 / 29 / 2021, p. 71 / 151 68 / 137 cleico revealed immediately above. In one embodiment, the transgenic cell is a plant cell, and in a further embodiment, a plant is provided, wherein the plant comprises said transgenic cells.

[00112] Another aspect of the present disclosure comprises a functional variant that differs in one or more nucleotides from those of the nucleotide sequences comprising the regulatory element provided herein. Such a variant is produced as a result of one or more modifications (e.g., deletion, rearrangement, or insertion) of the nucleotide sequences comprising the sequence described herein. For example, fragments and variants of the GmTEFs1 promoter sequence of SEQ ID NO: 2 can be used in a DNA construct or in a gene expression cassette to trigger the expression of a heterologous coding sequence. As used herein, the term fragment refers to a portion of the nucleic acid sequence.The GmTEFs1 promoter sequence fragments of SEQ ID NO: 2 can retain the biological activity of transcription initiation, more particularly of transcription triggering in a constitutively expressed manner. Alternatively, fragments of a nucleotide sequence that are useful as hybridization probes may not necessarily retain biological activity. The nucleotide sequence fragments for the promoter region of the GmTEFs1 promoter sequence of SEQ ID NO:2 can be in the range of at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, up to the full-length nucleotide sequence of the invention for the gene promoter region.

[00113] A biologically active portion of a GmTEFs1 promoter sequence from SEQ ID NO:2 can be prepared by isolating Petition 870210100564, dated 10 / 29 / 2021, page 72 / 151 69 / 137 a portion of the GmTEFsl promoter sequence from SEQ ID NO:2 and evaluating the promoter activity of the portion. The nucleic acid molecules that are fragments of a GmTEFs1 promoter nucleotide sequence comprise at least about 16, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,550, 1,600, 1,650 or 1,700 nucleotides or up to the number of nucleotides present in a full-length GmTEFs1 promoter sequence disclosed herein.

[00114] Variant nucleotide sequences also encompass sequences derived from a mutagenic and recombinogenic procedure, such as DNA scrambling. With such a procedure, the GmTEFs1 promoter nucleotide sequences of SEQ ID NO:2 can be manipulated to create a new GmTEFs1 promoter. In this way, recombinant polynucleotide libraries are generated from a population of sequence-related polynucleotides comprising sequence regions that have substantial sequence identity and can be recombined homologously in vitro or in vivo. Strategies for such DNA scrambling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA i: 10,747 to 10,751; Stemmer (1994) Nature 570:389 to 391; Crameri et al. (1997) Nature Biotech. 75:436 to 438; Moore et al. (1997) J. Mol. Biol. 272:336 to 347; Zhang et al. (1997) Proc. Natl. Academic. Sci. USA £4:4,504 to 4,509; Crameri et al.(1998) Nature 527:288 to 291; and US Patents 5,605,793 and 5,837,458.

[00115] The nucleotide sequences of the present disclosure can be used to isolate the corresponding sequences from other organisms, particularly other plants, more specifically other monocotyledons. In this way, methods such as PCR, hybridization Petition 870210100564, dated 10 / 29 / 2021, p. 73 / 151 70 / 137 identification and similar methods can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Isolated sequences based on their sequence identity with the entire GmTEFs1 promoter sequence presented herein or with fragments thereof are encompassed by the present invention.

[00116] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify the corresponding DNA sequences of genomic DNA extracted from any plant of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), later referred to as Sambrook. See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York).Known PCR methods include, but are not limited to, methods using paired primers, nested primers, single-specific primers, degenerate primers, gene-specific primers, vector-specific primers, primers with partially erroneous pairing, and the like.

[00117] In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments from a chosen organism. Hybridization probes can be identified with a detectable group, such as P32 or any other Petition 870210100564, dated 10 / 29 / 2021, page 74 / 151 71 / 137 detectable marker. Thus, for example, hybridization probes can be produced by labeling synthetic oligonucleotides based on the GmTEFs1 promoter sequence of the invention. Methods for preparing hybridization probes and for constructing genomic libraries are generally known in the art and are disclosed in Sambrook. For example, the complete GmTEFs1 promoter sequence disclosed herein, or one or more portions thereof, can be used as a probe capable of specifically hybridizing with corresponding GmTEFs1 promoter sequences and messenger RNAs. To obtain specific hybridization under a variety of conditions, such probes include sequences that are unique among GmTEFs1 promoter sequences and are at least about 10 nucleotides long or at least about 20 nucleotides long.These probes can be used to amplify the corresponding GmTEFs1 promoter sequence from a chosen plant via PCR. This technique can be used to isolate additional coding sequences from a desired organism, or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include screening hybridization of DNA libraries transferred to plates (plates or colonies; see, for example, Sambrook).

[00118] According to one embodiment, the nucleic acid vector further comprises a sequence encoding a selectable marker. According to one embodiment, the recombinant gene cassette is functionally ligated to an Agrobacterium T-DNA edge. According to one embodiment, the recombinant gene cassette further comprises a first and a second T-DNA edge, wherein the first T-DNA edge is functionally ligated to one end of a gene construct, and the second Petition 870210100564, dated 10 / 29 / 2021, pp. 75 / 151 72 / 137 The T-DNA border is functionally linked to the other end of a gene construct. The first and second T-DNA borders of Agrobacterium can be independently selected from T-DNA border sequences originating from bacterial strains selected from the group consisting of an Agrobacterium nopalin-synthesizing T-DNA border, an Agrobacterium ocotopin-synthesizing T-DNA border, an Agrobacterium mannopin-synthesizing T-DNA border, an Agrobacterium succinamopine-synthesizing T-DNA border, or any combination thereof.In one embodiment, an Agrobacterium strain selected from the group consisting of a nopalin-synthesizing strain, a mannopin-synthesizing strain, a succinamopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence functionally linked to a sequence selected from SEQ ID NO:2 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:2.In another embodiment, the first and second T-DNA edges of Agrobacterium can be independently selected from T-DNA edge sequences originating from bacterial strains selected from the group consisting of a nopaline-synthesizing Agrobacterium T-DNA edge, an octopin-synthesizing Agrobacterium T-DNA edge, a mannopin-synthesizing Agrobacterium T-DNA edge, a succinamopine-synthesizing Agrobacterium T-DNA edge, or any combination thereof. In one embodiment, an Agrobacterium strain selected from the group consisting of a nopaline-synthesizing strain, a mannopin-synthesizing strain, a succinamopine-synthesizing strain, or an octopin-synthesizing strain is... Petition 870210100564, dated 10 / 29 / 2021, p. 76 / 151 73 / 137 necida, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence functionally linked to a sequence selected from SEQ ID NO:3 or a sequence that has 80, 85, 90, 95 or 99% sequence identity with a SEQ ID NO:3. In one embodiment, an Agrobacterium strain selected from the group consisting of a nopalin-synthesizing strain, a mannopin-synthesizing strain, a succinamopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence functionally linked to a sequence selected from SEQ ID NO:4 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4.In one embodiment, an Agrobacterium strain selected from the group consisting of a nopalin-synthesizing strain, a mannopin-synthesizing strain, a succinamopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence functionally linked to a sequence selected from SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5.

[00119] Transgenes of interest that are suitable for use in the constructs now disclosed include, but are not limited to, coding sequences that confer (1) resistance to pests or disease, (2) herbicide tolerance, (3) value-added agronomic traits such as; yield enhancement, nitrogen use efficiency, water use efficiency, and nutritional quality, (4) site-specific binding of a protein to DNA, (5) small RNA expression, and (6) selectable markers. According to. Petition 870210100564, dated 10 / 29 / 2021, page 77 / 151 74 / 137 of a modality, the heterologous transgene / coding sequence encodes a selectable marker or gene product that confers insecticide resistance, herbicide tolerance, small RNA expression, nitrogen use efficiency, water use efficiency, or nutritional quality. 1. Insect Resistance

[00120] Several insect resistance genes can be functionally linked to the GmTEFs1 promoter comprising SEQ ID NO: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 2. Additionally, insect resistance genes can be functionally linked to the 5' UTR of GmTEFs1 comprising SEQ ID NO: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 3. Insect resistance genes can be functionally linked to the GmTEFs1 intron comprising SEQ ID NO: 28, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 28. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmTEFs1 comprising SEQ ID NO:4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4.Furthermore, insect resistance genes can be functionally linked to the GmTEFs1 terminator comprising SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5. Functionally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Exemplary insect resistance coding sequences are known in the art. As modalities of insect resistance coding sequences that can be functionally linked to them... Petition 870210100564, dated 10 / 29 / 2021, page 78 / 151 75 / 137 regulatory elements of the present disclosure, the following traits are provided. Example coding sequences providing resistance to Lepidopteran insects include: crylA; cry1A.105; crylAb; crylAb(truncated); cry1Ab-Ac (fusion protein); crylAc (marketed as Widestrike®); crylC; crylF (marketed as Widestrike®); cry1Fa2; cry2Ab2; cry2Ae; cry9C; mocrylF; pinlI (protease inhibitor protein); vip3A(a); and vip3Aa20. Example coding sequences providing resistance to Coleoptera insects include: cry34Ab1 (marketed as Herculex®); cry35Ab1 (marketed as Herculex®); cry3A; cry3Bb1; dvsnf7; and mcry3A. Example coding sequences that provide resistance to multiple insects include ecry31.Ab. The above list of insect resistance genes is not intended to be limiting. Any insect resistance genes are covered by this disclosure. 2. Herbicide Tolerance

[00121] Several herbicide tolerance genes can be functionally linked to the gGmTEFs1 promoter comprising SEQ ID NO: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 2. Additionally, insect resistance genes can be functionally linked to the 5' UTR of GmTEFs1 comprising SEQ ID NO: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 3. Insect resistance genes can be functionally linked to the GmTEFs1 intron comprising SEQ ID NO: 28, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 28. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmTEFs1 comprising SEQ ID NO:4, or a sequence that has 80, 85, 90, 95, or 99% identity to Petition 870210100564, dated 10 / 29 / 2021, p. 79 / 151 76 / 137 sequence with a SEQ ID NO: 4. In addition, insect resistance genes can be functionally linked to the GmTEFs1 terminator comprising SEQ ID NO: 5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 5. Functionally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Exemplary herbicide tolerance coding sequences are known in the art. As embodiments of herbicide tolerance coding sequences that can be functionally linked to the regulatory elements of the present disclosure, the following traits are provided. The herbicide glyphosate contains a mode of action by inhibiting the EPSPS enzyme (5-enolpyruvylshikimate-3-phosphate synthase). This enzyme is involved in the biosynthesis of aromatic amino acids, which are essential for plant growth and development.Several enzymatic mechanisms are known in the art that can be used to inhibit this enzyme. The genes encoding such enzymes can be functionally linked to the gene regulatory elements of the present disclosure. In one embodiment, selectable marker genes include, but are not limited to, genes encoding glyphosate resistance genes, including: EPSPS mutant genes, such as 2mEPSPS genes, cp4 EPSPS genes, mEPSPS genes, dgt-28 genes; aroA genes; and glyphosate degradation genes, such as glyphosate acetyltransferase (gat) genes and glyphosate oxidase (gox) genes. These traits are currently marketed as Gly-Tol™, Optimum® GAT®, Agrisure® GT, and Roundup Ready®. Resistance genes to glufosinate and / or bialaphos compounds include dsm-2, bar, and pat genes. The bar and pat traits are currently marketed as LibertyLink®. Also included are tolerance genes that provide resistance to 2,4-D genes, such as aad-1 genes. Petition 870210100564, dated 10 / 29 / 2021, pp. 80 / 151 77 / 137 (it should be noted that aad-1 genes still have activity against arloxyphenoxypropionate herbicides) and aad-12 genes (it should be noted that aad-12 genes still have activity against synthetic pyidyloxyacetate auxins). These traits are marketed as Enlist® crop protection technology. Resistance genes for ALS inhibitors (sulfonylureas, imidazolinones, triazolpyrimidines, pyrimidinylthiobenzoates, and sulfonylaminocarbonyltriazolinones) are known in the art. These resistance genes most commonly result from point mutations in the gene sequence encoding ALS. Other ALS inhibitor resistance genes include hra genes, csr1-2 genes, Sr-HrA genes, and surB genes. Some of the traits are marketed under the trade name Clearfield®. Herbicides that inhibit HPPD include pyrazolones such as pyrazoxyphene, benzophenone, and topramezone; Triketones, such as mesotrione, sulcotrione, tembotrione, benzobicyclone; and diketonitriles such as isoxaflutol.These exemplary HPPD herbicides may be tolerated by known traits. Examples of HPPD inhibitors include the hppdPF_W336 gene (for isoxaflutol resistance) and the avhppd-03 gene (for meostrione resistance). An example of oxynil herbicide-tolerant traits includes the bxn gene, which has been shown to confer resistance to the herbicide / antibiotic bromoxynil. Resistance genes for dicamba include the dicamba monooxygenase (dmo) gene, as disclosed in International PCT Application No. WO 2008 / 105890. Resistance genes for PPO- or PROTOX-inhibiting herbicides (e.g., acifluorfen, butafenacil, flupropazil, pentoxazone, carfentrazone, fluazolate, piraflufen, aclonifen, azaphenidine, flumioxazin, flumiclorac, bifenox, oxyfluorfen, lactofen, fomesafen, fluoroglycophene, and sulfentrazone) are known in the art.Exemplary genes that confer PPO resistance include overexpression of a PPO enzyme from wild-type Arabidopsis thaliana (Lermontova I e. Petition 870210100564, dated 10 / 29 / 2021, p. 81 / 151 78 / 137 Grimm B, (2000) Overexpression of plastic protoporphyrinogen IX oxidase leads to resistance to the diphenyl ether herbicide acifluorfen. Plant Physiol 122: 75-83.), the PPO gene of B. subtilis (Li, X. and Nicholl D. 2005. Development of PPO-resistant inhibitor crops and cultures. Pest Manag. Sci. 61: 277-285 and Choi KW, Han O, Lee HJ, Yun YC, Moon YH, Kim MK, Kuk YI, Han SU and Guh JO, (1998) Generation of resistance to the diphenyl ether herbicide, oxyfluorfen, via expression of the Bacillus subtilis protoporphyrinogen oxidase gene in transgenic tobacco plants. Biosci Biotechnol Biochem 62:558-560.) Resistance genes for pyridinium- or phenoxy propionic acids and cyclohexones include ACCase inhibitor-coding genes (e.g., Acc1-S1, Acc1-S2, and Acc1-S3). Exemplary genes that confer resistance to cyclohexanediones and / or aryloxyphenoxypropanoic acid include haloxyfop, diclofop, phenoxyprop, fluazifop, and quizalofop.Finally, herbicides can inhibit photosynthesis, including triazine or benzonitrile, and be provided with tolerance by psbA genes (triazine tolerance), 1s+ genes (triazine tolerance), and nitrilase genes (benzonitrile tolerance). The above list of herbicide tolerance genes is not intended to be limiting. Any herbicide tolerance genes are covered by this disclosure. 3. Agronomic Traits

[00122] Several agronomic trait genes can be functionally linked to the GmTEFs1 promoter comprising SEQ ID NO: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 2. Additionally, insect resistance genes can be functionally linked to the 5' UTR of GmTEFs1 comprising SEQ ID NO: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 3. Insect resistance genes can be functionally linked to the GmTEFs1 intron comprising SEQ ID NO: 28, Petition 870210100564, dated 10 / 29 / 2021, page 82 / 151 79 / 137 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:28. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmTEFs1 comprising SEQ ID NO:4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. Furthermore, insect resistance genes can be functionally linked to the GmTEFs1 terminator comprising SEQ ID NO:5, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5. The functionally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Exemplary sequences for coding agronomic traits are known in the art.The following traits are provided as examples of agronomic trait coding sequences that can be functionally linked to the regulatory elements of the present disclosure. Delayed fruit softening, as provided by the pg genes, inhibits the production of the polygalacturonase enzyme responsible for breaking down pectin molecules in the cell wall, thus causing delayed fruit softening. Furthermore, the acc genes for delayed fruit ripening / senescence act to suppress the normal expression of the native acc synthase gene, resulting in reduced ethylene production and delayed fruit ripening. While the accd genes metabolize the ethylene precursor of the fruit ripening hormone, resulting in delayed fruit ripening. Alternatively, the sam-k genes cause delayed ripening by reducing S-adenosylmethionine (SAM), a substrate for ethylene production.Water stress tolerance phenotypes, as provided by cspB genes, maintain normal cellular functions under water stress conditions, preserving... Petition 870210100564, dated 10 / 29 / 2021, page 83 / 151 80 / 137, thus, RNA stability and translation. Another example includes the EcBetA genes, which catalyze the production of the osmoprotective compound glycine betaine, conferring tolerance to water stress. Additionally, the RmBetA genes catalyze the production of the osmoprotective compound glycine betaine, conferring tolerance to water stress. Photosynthesis and yield enhancement are provided by the bbx32 gene, which expresses a protein that interacts with one or more endogenous transcription factors to regulate the plant's diurnal / nocturnal physiological processes. Ethanol production can be increased by the expression of the amy797E genes, which encode a thermostable alpha-amylase enzyme that enhances bioethanol production, thereby increasing the thermostability of the amylase used in starch degradation.Finally, modified amino acid compositions can result through the expression of cordapA genes that encode a dihydrodipicolinate synthase enzyme that increases the production of the amino acid lysine. The above list of agronomic trait coding sequences is not intended to be limiting. Any agronomic trait coding sequence is covered by this disclosure. 4. DNA-Binding Proteins

[00123] Several DNA-linking transgenes / heterologous coding sequence genes / heterologous coding sequences may be functionally linked to the GmTEFs1 promoter comprising SEQ ID NO: 2, or a sequence having 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 2. Additionally, insect resistance genes may be functionally linked to the 5' UTR of GmTEFs1 comprising SEQ ID NO: 3, or a sequence having 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 3. Insect resistance genes may be functionally linked to the GmTEFs1 intron that Petition 870210100564, dated 10 / 29 / 2021, p. 84 / 151 81 / 137 comprises SEQ ID NO:28, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:28. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmTEFs1 comprising SEQ ID NO:4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. Furthermore, insect resistance genes can be functionally linked to the GmTEFs1 terminator comprising SEQ ID NO:5, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5. Functionally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Exemplary DNA-binding protein coding sequences are known in the art.As examples of DNA-binding protein coding sequences that can be functionally linked to the regulatory elements of the present disclosure, the following types of DNA-binding proteins may include: Zinc Fingers, TALENS, CRISPRs, and meganucleases. The above list of DNA-binding protein coding sequences is not intended to be exhaustive. Any DNA-binding protein coding sequences are covered by the present disclosure. 5. Small RNA

[00124] Several small RNA sequences can be functionally linked to the GmTEFs1 promoter comprising SEQ ID NO: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 2. Furthermore, insect resistance genes can be functionally linked to the 5' UTR of GmTEFs1 comprising SEQ ID NO: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 3. Insect resistance genes can be li Petition 870210100564, dated 10 / 29 / 2021, pp. 85 / 151 82 / 137 functionally identical to the GmTEFsl intron comprising SEQ ID NO:28, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:28. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmTEFs1 comprising SEQ ID NO:4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4. Furthermore, insect resistance genes can be functionally linked to the GmTEFs1 terminator comprising SEQ ID NO:5, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5. The functionally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Exemplary small RNA traces are known in the art.As examples of small RNA coding sequences that can be functionally linked to the regulatory elements of the present discovery, the following traits are provided. For example, the anti-efe small RNA for delayed fruit ripening / senescence delays fruit ripening by suppressing ethylene production through silencing the ACO gene encoding an ethylene-forming enzyme. The ccomt small RNA altered lignin production reduces guanacyl (G) lignin content by inhibiting endogenous S-adenosyl-L-methionine: trans-caffeoyl CoA 3-O-methyltransferase (CCOMT gene). Furthermore, Black Spot Injury Tolerance in Solanum verrucosum can be reduced by the Ppo5 small RNA which triggers the degradation of Ppo5 transcripts to block black spot injury development.Also included is the small RNA dvsnf7 which inhibits the Western Corn Rootworm with dsRNA containing a 240 bp fragment of the Western Corn Rootworm Snf7 gene. The modified starches / carbohydrates po. Petition 870210100564, dated 10 / 29 / 2021, page 86 / 151 83 / 137 dem result from small RNAs, such as small RNA pPhL (degrades PhL transcripts to limit the formation of reducing sugars through starch degradation) and small RNA pR1 (degrades R1 transcripts to limit the formation of reducing sugars through starch degradation). Additional benefits are observed, such as reduced acrylamide resulting from small RNA asnl which triggers Asn1 degradation to impair asparagine formation and reduce polyacrylamide. Finally, the non-browning phenotype of small RNA pgas suppression results in PPO suppression to produce apples with a non-browning phenotype. The above list of small RNAs is not intended to be limiting. Any small RNA coding sequences are covered by this disclosure. 6. Selectable Markers

[00125] Several selectable markers, also described as reporter genes, can be functionally linked to the GmTEFs1 promoter comprising SEQ ID NO: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 2. Additionally, insect resistance genes can be functionally linked to the 5' UTR of GmTEFs1 comprising SEQ ID NO: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 3. Insect resistance genes can be functionally linked to the GmTEFs1 intron comprising SEQ ID NO: 28, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 28. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmTEFs1 comprising SEQ ID NO:4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:4.Furthermore, insect resistance genes can be linked to... Petition 870210100564, dated 10 / 29 / 2021, page 87 / 151 84 / 137 functionally linked sequences to the GmTEFsl terminator comprising SEQ ID NO:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO:5. Functionally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Many methods are available to confirm the expression of selectable markers in transformed plants, including, for example, DNA sequencing and PCR (polymerase chain reaction), Southern blotting, RNA blotting, immunological methods for detecting an expressed vector protein. But, typically reporter genes are observed through visual observation of proteins that, when expressed, produce a colored product.Exemplary reporter genes are known in the art and encode β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP, Phi-YFP), red fluorescent protein (DsRFP, RFP, etc.), β-galactosidase, and the like (See Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, NY, 2001, the contents of which are incorporated into this document in their entirety by reference).

[00126] Selectable marker genes are used for the selection of transformed cells or tissues. Selectable marker genes include genes that encode antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO), spectinomycin / streptionomycin (AAD) resistance, and hygromycin phosphotransferase (HPT or HGR) resistance, as well as genes that confer resistance to herbicide compounds. Herbicide resistance genes generally encode for a modified target protein insensitive to the herbicide or for an enzyme that degrades or detoxifies the herbicide in the plant before it can act. For example, glyphosate resistance was Petition 870210100564, dated 10 / 29 / 2021, page 88 / 151 85 / 137 obtained using genes encoding mutant target enzymes, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Genes and mutants for EPSPS are well known, and further described below. Resistance to glufosinate ammonium, bromoxynil and 2,4-dichlorophenoxyacetate (2,4-D) was obtained using bacterial genes encoding PAT or DSM-2, a nitrilase, an AAD-1 or an AAD-12, each of which are examples of proteins that detoxify their respective herbicides.

[00127] In one embodiment, herbicides can inhibit the growth point or meristem, including imidazolinone or sulfonylurea, and genes for acetohydroxyacid synthase (AHAS) and acetolactate synthase (ALS) resistance / tolerance to these herbicides are well known. Glyphosate resistance genes include mutant 5-enolpyruvylshikimate-3-phosphate synthase (EPSP) and dgt-28 genes (through the introduction of recombinant nucleic acids and / or various forms of in vivo mutagenesis of native EPSP genes), aroA genes, and glyphosate acetyltransferase (GAT) genes, respectively. Resistance genes for other phosphono compounds include bar and pat genes from Streptomyces species, including Streptomyces hygroscopicus and Streptomyces viridichromogenes, and pyridinoxy or phenoxypropionic acids and cyclohexones (ACCase inhibitor encoding genes).Exemplary genes conferring resistance to cyclohexanediones and / or aryloxyphenoxypropanoic acid (including haloxyfop, diclofop, phenoxyprop, fluazifop, quizalofop) include acetyl coenzyme A carboxylase (ACCase) genes; Acc1-S1, Acc1-S2, and Acc1-S3. In one embodiment, herbicides may inhibit photosynthesis, including triazine (psbA and 1s+ genes) or benzonitrile (nitrilase gene). Furthermore, such selectable markers may include positively selected markers such as phosphomannose isomerase (PMI) enzyme.

[00128] In one embodiment, selectable marker genes in. Petition 870210100564, dated 10 / 29 / 2021, p. 89 / 151 86 / 137 include, but are not limited to, genes encoding: 2,4-D; neomycin phosphotransferase II; cyanamide hydratase; aspartate kinase; dihydrodipicolinate synthase; tryptophan decarboxylase; desensitized dihydrodipicolinate synthase and aspartate kinase; bar gene; tryptophan decarboxylase; neomycin phosphotransferase (NEO); hygromycin phosphotransferase (HPT or HYG); dihydrofolate reductase (DHFR); phosphinothricin acetyltransferase; 2,2-dichloropropionic acid dehalogenase; acetohydroxyacid synthase; 5-enolpyruvylshikimate phosphate synthase (aroA); haloarylnitrilase; acetyl-coenzyme A carboxylase; dihydropteroate synthase (sul I); and photosystem II 32 kD polypeptide (psbA). One embodiment also includes selectable marker genes encoding resistance to: chloramphenicol; methotrexate; hygromycin; spectinomycin; bromoxynil; glyphosate; and phosphinothricin. The above list of selectable marker genes is not intended to be exhaustive.Any selectable marker or reporter gene is covered by this disclosure.

[00129] In some embodiments, coding sequences are synthesized for optimal expression in a plant. For example, in one embodiment, a gene's coding sequence has been modified by codon optimization to enhance expression in plants. An insecticide transgene resistance, a herbicide transgene tolerance, a nitrogen transgene use efficiency, a water transgene use efficiency, a nutritional quality transgene, a DNA linkage transgene, or a selectable marker transgene / heterologous coding sequence may be optimal for expression in a particular plant species or, alternatively, may be modified for optimal expression in dicotyledonous or monocotyledonous plants. Plant-preferred codons can be determined from the highest frequency codons in the proteins expressed in the greatest quantity in the plant species. Petition 870210100564, dated 10 / 29 / 2021, pp. 90 / 151 87 / 137 of particular interest. In one embodiment, a coding sequence, gene, heterologous coding sequence, or transgene / heterologous coding sequence is designed to be expressed in plants at a higher level, resulting in greater transformation efficiency. Methods for optimizing plant genes are well known. Guidelines related to the optimization and production of synthetic DNA sequences can be found, for example, in documents WO2013016546, WO2011146524, WO1997013402, U.S. Patent No. 6166302, and U.S. Patent No. 5380831, incorporated herein by reference. Transformation

[00130] Suitable methods for plant transformation include any method by which DNA can be introduced into a cell, for example and without limitation: electroporation (see, for example, U.S. Patent 5,384,253); microprojectile bombardment (see, for example, U.S. Patents 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861 and 6,403,865); Agrobacterium-mediated transformation (see, for example, U.S. Patents 5,635,055, 5,824,877, 5,591,616; 5,981,840, and 6,384,301); and protoplast transformation (see, for example, U.S. Patent 5,508,184).

[00131] A DNA construct can be introduced directly into the genomic DNA of the plant cell using techniques such as agitation with silicon carbide fibers (see, for example, U.S. Patents 5,302,523 and 5,464,765), or DNA constructs can be introduced directly into plant tissue using biolistic methods such as DNA particle bombardment (see, for example, Klein et al. (1987) Nature 327:70-73). Alternatively, the DNA construct can be introduced into the plant cell via nanoparticle transformation (see, for example, Application for Petition 870210100564, dated 10 / 29 / 2021, pp. 91 / 151 88 / 137 U.S. Patent No. 20090104700, which is incorporated herein by reference in its entirety.

[00132] Furthermore, gene transfer can be achieved using non-Agrobacterium bacteria or viruses, such as Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus and / or tobacco mosaic virus. See, for example, Chung et al. (2006) Trends Plant Sci. 11(1):1-4.

[00133] Through the application of transformation techniques, cells of virtually any plant species can be stably transformed, and these cells can be developed into transgenic plants by well-known techniques. For example, techniques that may be particularly useful in the context of cotton transformation are described in U.S. Patent Nos. 5,846,797, 5,159,135, 5,004,863 and 6,624,344; techniques for transforming Brassica plants, in particular, are described, for example, in U.S. Patent 5,750,871; techniques for transforming soybean grains are described, for example, in U.S. Patent 6,384,301; and techniques for transforming Zea mays are described, for example, in U.S. Patents 7,060,876 and 5,591,616, and International Application PCT WO 95 / 06722.

[00134] After effective delivery of an exogenous nucleic acid to a recipient cell, a transformed cell is usually identified for further culture and plant regeneration. In order to enhance the ability to identify transformants, it may be desirable to employ a selectable marker gene with the transformation vector used to generate the transformation. In an illustrative embodiment, a population of transformed cells can be examined by exposing the cells to a selective agent or agents, or the cells can be analyzed for the desired marker gene trait.

[00135] The cells that survive exposure to a selective agent Petition 870210100564, dated 10 / 29 / 2021, pp. 92 / 151 89 / 137 vo, or cells that have been classified as positive in an analysis assay, can be cultured in media that support plant regeneration. In one embodiment, any suitable plant tissue culture medium can be modified by including additional substances such as growth regulators. The tissue can be maintained in a basic medium with growth regulators until sufficient tissue is available to initiate plant regeneration efforts, or after repeated cycles of manual selection, until the tissue morphology is suitable for regeneration (e.g., at least 2 weeks) and then transferred to conducting media for shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots have formed, they are transferred to a conducting medium for root formation.Once sufficient roots have formed, the plants can be transferred to soil for further growth and maturation. Transgenic Plants

[00136] In one embodiment, a plant, plant tissue, or plant cell comprises a GmTEFs1 promoter. In one embodiment, a plant, plant tissue, or plant cell comprises the GmTEFs1 promoter of a sequence selected from SEQ ID NO:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:2. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:2 that is operationally linked to a non-GmTEFs1 gene. In an illustrative embodiment, a plant, plant tissue, or plant cell comprises Petition 870210100564, dated 10 / 29 / 2021, pp. 93 / 151 90 / 137 a gene expression cassette comprising a GmTEFsl promoter that is functionally linked to a transgene or heterologous coding sequence, wherein the transgene or heterologous coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA-linking transgene, a selectable marker transgene, or a combination thereof.

[00137] In accordance with one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a GmTEFs1 promoter-derived sequence functionally linked to a transgene, wherein the GmTEFs1 promoter-derived sequence comprises a SEQ ID NO:2 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:2. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:2 functionally linked to a non-GmTEFs1 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant.In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO: 2 or a sequence that has 80%, 85%, 90%, 95%, or 95%. Petition 870210100564, dated 10 / 29 / 2021, pp. 94 / 151 91 / 137 99.5% sequence identity with a SEQ ID NO:2 functionally linked to a non-GmTEFs1 gene. In one embodiment, the plant, plant tissue, or plant cell comprises a promoter functionally linked to a heterologous transgene / coding sequence wherein the promoter consists of SEQ ID NO:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:2. According to one embodiment, the gene construct comprising a GmTEFs1 gene promoter functionally linked to a heterologous transgene / coding sequence is incorporated into the genome of the plant, plant tissue, or plant cell.

[00138] In one embodiment, a plant, plant tissue, or plant cell comprises a 5' UTR of GmTEFs1. In one embodiment, a plant, plant tissue, or plant cell comprises the 5' UTR of GmTEFs1 of a sequence selected from SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:3. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:3, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:3 that is operationally linked to a non-GmTEFs1 gene.In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a 5' UTR of GmTEFs1 that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, or a nutritional quality transgene. Petition 870210100564, dated 10 / 29 / 2021, pp. 95 / 151 92 / 137 onal, a DNA linking transgene, a selectable marker transgene, or combinations thereof.

[00139] According to one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a 5' UTR-derived sequence of GmTEFs1 functionally linked to a transgene, wherein the 5' UTR-derived sequence of GmTEFs1 comprises a SEQ ID NO:3 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:3. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:3 functionally linked to a non-GmTEFs1 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant.In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max). In accordance with one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:3 functionally linked to a non-GmTEFs1 gene. In one embodiment, the plant, plant tissue, or plant cell comprises a 5' UTR functionally linked to a heterologous transgene / coding sequence, wherein the 5' UTR consists of SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:3. According to one embodiment, the... Petition 870210100564, dated 10 / 29 / 2021, pp. 96 / 151 93 / 137 gene construct comprising a 5' UTR of the GmTEFsl gene functionally linked to a heterologous transgene / coding sequence is incorporated into the plant genome, plant tissue, or plant cell.

[00140] In one embodiment, a plant, plant tissue, or plant cell comprises a GmTEFs1 intron. In one embodiment, a plant, plant tissue, or plant cell comprises the GmTEFs1 intron of a sequence selected from SEQ ID NO:28 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:28. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:28, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:28 that is operationally linked to a non-GmTEFs1 gene.In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a GmTEFs1 intron that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof.

[00141] In accordance with one embodiment, a plant, plant tissue or plant cell is provided, wherein the plant, plant tissue or plant cell comprises a GmTEFs1 intron-derived sequence functionally linked to a transgene, wherein the GmTEFs1 intron-derived sequence comprises a sequence Petition 870210100564, dated 10 / 29 / 2021, pp. 97 / 151 94 / 137SEQ ID NO:28 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:28. In one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:28 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:28 functionally linked to a non-GmTEFs1 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant. In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max).According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO:28 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:28 functionally linked to a non-GmTEFs1 gene. In another embodiment, the plant, plant tissue, or plant cell comprises an intron functionally linked to a heterologous transgene / coding sequence, wherein the intron consists of SEQ ID NO:28 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:28. According to one embodiment, the gene construct comprising a GmTEFs1 intron sequence functionally linked to a heterologous transgene / coding sequence is incorporated into the genome of the plant, plant tissue, or plant cell.

[00142] In one embodiment, a plant, plant tissue or plant cell comprises a 3' UTR of GmTEFs1. In one embodiment, a plant, plant tissue or plant cell comprises the 3' UTR Petition 870210100564, dated 10 / 29 / 2021, pp. 98 / 151 95 / 137 of GmTEFs1 from a sequence selected from SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:4. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:4, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:4 that is operationally linked to a non-GmTEFs1 gene.In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a 3' UTR of GmTEFs1 that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof.

[00143] According to one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a 3' UTR-derived sequence of GmTEFs1 functionally linked to a transgene, wherein the 3' UTR-derived sequence of GmTEFs1 comprises a SEQ ID NO:4 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:4. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:4 functionally linked to a non-GmTEFs1 gene. In one embodiment, the Petition 870210100564, dated 10 / 29 / 2021, pp. 99 / 151 96 / 137 plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant. In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybean, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybean (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:4 functionally linked to a non-GmTEFs1 gene.In one embodiment, the plant, plant tissue, or plant cell comprises a 3' UTR functionally linked to a heterologous transgene / coding sequence, wherein the 3' UTR consists of SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:4. According to one embodiment, the gene construct comprising a functionally linked 3' UTR sequence of the GmTEFs1 gene is incorporated into the genome of the plant, plant tissue, or plant cell.

[00144] In one embodiment, a plant, plant tissue, or plant cell comprises a GmTEFs1 terminator. In one embodiment, a plant, plant tissue, or plant cell comprises the GmTEFs1 terminator of a sequence selected from SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:5. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO:5, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% identity. Petition 870210100564, dated 10 / 29 / 2021, pp. 100 / 151 97 / 137 of sequence with a sequence selected from SEQ ID NO:5 that is operationally linked to a non-GmTEFs1 gene. In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a GmTEFs1 terminator that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof.

[00145] In accordance with one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a GmTEFs1 terminator-derived sequence functionally linked to a transgene, wherein the GmTEFs1 terminator-derived sequence comprises a SEQ ID NO:5 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:5. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:5 functionally linked to a non-GmTEFs1 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant.In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max). According to one... Petition 870210100564, dated 10 / 29 / 2021, pp. 101 / 151 In one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:5 functionally linked to a non-GmTEFs1 gene. In another embodiment, the plant, plant tissue, or plant cell comprises a terminator functionally linked to a heterologous transgene / coding sequence wherein the terminator consists of SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID NO:5. According to one embodiment, the gene construct comprising a GmTEFs1 gene terminator sequence functionally linked to a heterologous transgene / coding sequence is incorporated into the genome of the plant, plant tissue, or plant cell.

[00146] In one embodiment, a plant, plant tissue, or plant cell, according to the methods disclosed herein, may be a dicotyledonous plant. The dicotyledonous plant, plant tissue, or plant cell may be, but not limited to, alfalfa, rapeseed, canola, Indian mustard, Ethiopian mustard, soybean, sunflower, cotton, beans, broccoli, cabbage, cauliflower, celery, cucumber, eggplant, lettuce; melon, pea, pepper, peanut, potato, pumpkin, radish, spinach, beet, sunflower, tobacco, tomato, and watermelon.

[00147] An individual skilled in the art will recognize that, after the exogenous sequence has been stably incorporated into transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending on the species to be crossed.

[00148] The present disclosure also covers the seeds of the transgenic plants described above, wherein the seed has the heterologous transgene / coding sequence or gene construct that Petition 870210100564, dated 10 / 29 / 2021, pp. 102 / 151 99 / 137 contains the gene regulatory elements of the present disclosure. The present disclosure further covers the progeny, clones, cell lines or cells of the transgenic plants described above, wherein said progeny, clone, cell line or cell has the transgene / heterologous coding sequence or gene construct that contains the gene regulatory elements of the present disclosure.

[00149] The present disclosure also covers the cultivation of the transgenic plants described above, wherein the transgenic plant has the transgene / heterologous coding sequence or gene construct containing the gene regulatory elements of the present disclosure. Consequently, such transgenic plants can be genetically modified to, inter alia, have one or more desired transgenic traits or events containing the gene regulatory elements of the present disclosure, by being transformed with nucleic acid molecules according to the invention, and can be harvested or cultivated by any method known to those skilled in the art. Method of Expressing a Transgene

[00150] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmTEFs1 promoter functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the GmTEFs1 promoter consists of a sequence selected from SEQ ID NO:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:2. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmTEFs1 promoter functionally linked to at least one heterologous transgene / coding sequence. Petition 870210100564, dated 10 / 29 / 2021, pp. 103 / 151 100 / 137 functional to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a GmTEFs1 promoter functionally linked to at least one transgene.

[00151] In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 promoter operationally linked to at least one transgene. In one embodiment, the GmTEFs1 promoter consists of a sequence selected from SEQ ID NO:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:2. In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 promoter operationally linked to at least one transgene.In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 promoter operationally linked to at least one transgene. In another embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a GmTEFs1 promoter functionally linked to at least one transgene. In another embodiment, a method for expressing at least one... Petition 870210100564, dated 10 / 29 / 2021, pp. 104 / 151 101 / 137 transgene / heterologous coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette comprising a GmTEFs1 promoter functionally linked to at least one transgene.

[00152] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 5' UTR of GmTEFs1 functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the 5' UTR of GmTEFs1 consists of a sequence selected from SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:3. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 5' UTR of GmTEFs1 functionally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises growing a plant tissue or plant cell comprising a 5' UTR of GmTEFs1 functionally linked to at least one transgene.

[00153] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises growing a plant comprising a gene expression cassette comprising a 5' UTR of GmTEFs1 operationally linked to at least one transgene. In one embodiment, the 5' UTR of GmTEFs1 consists of a sequence selected from SEQ ID NO:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a selected sequence a. Petition 870210100564, dated 10 / 29 / 2021, pp. 105 / 151 102 / 137 from SEQ ID NO:3. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 5' UTR of GmTEFs1 operationally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 5' UTR of GmTEFs1 operationally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a 5' UTR of GmTEFs1 functionally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette comprising a 5' UTR of GmTEFs1 functionally linked to at least one transgene.

[00154] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmTEFs1 intron functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the GmTEFs1 intron consists of a sequence selected from SEQ ID NO:28 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:28. In one embodiment Petition 870210100564, dated 10 / 29 / 2021, pp. 106 / 151 103 / 137 of, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmTEFs1 intron functionally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a GmTEFs1 intron functionally linked to at least one transgene.

[00155] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 intron operationally linked to at least one transgene.In one embodiment, the GmTEFs1 intron consists of a sequence selected from SEQ ID NO:28 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:28. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 intron operationally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 intron operationally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a GmTEFs1 ligand intron. Petition 870210100564, dated 10 / 29 / 2021, pp. 107 / 151 104 / 137 functionally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises growing a plant tissue or plant cell comprising a gene expression cassette comprising a GmTEFs1 intron functionally linked to at least one transgene.

[00156] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises growing a plant comprising a GmTEFs1 3' UTR functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the GmTEFs1 3' UTR consists of a sequence selected from SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:4.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 3' UTR of GmTEFs1 functionally linked to at least one transgene. In another embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a 3' UTR of GmTEFs1 functionally linked to at least one transgene.

[00157] In another embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmTEFs1 operationally linked to at least one transgene. In another embodiment, the 3' UTR of GmTEFs1 consists of a sequence selected from SEQ ID NO:4 or a sequence that has 80%, 85%, 90%, 95% or. Petition 870210100564, dated 10 / 29 / 2021, pp. 108 / 151 105 / 137 99.5% sequence identity with a sequence selected from SEQ ID NO:4. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmTEFs1 operationally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmTEFs1 operationally linked to at least one transgene. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a 3' UTR of GmTEFs1 functionally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette comprising a 3' UTR of GmTEFs1 functionally linked to at least one transgene.

[00158] In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmTEFs1 terminator functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the GmTEFs1 terminator consists of a sequence selected from SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with Petition 870210100564, dated 10 / 29 / 2021, pp. 109 / 151 106 / 137 a sequence selected from SEQ ID NO:5. In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmTEFs1 terminator functionally linked to at least one transgene. In another embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a GmTEFs1 terminator functionally linked to at least one transgene.

[00159] In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 terminator operationally linked to at least one transgene. In one embodiment, the GmTEFs1 terminator consists of a sequence selected from SEQ ID NO:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID NO:5. In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 terminator operationally linked to at least one transgene.In one embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmTEFs1 terminator operationally linked to at least one transgene. In another embodiment, a method for expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell. Petition 870210100564, dated 10 / 29 / 2021, pp. 110 / 151 107 / 137 comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a GmTEFs1 terminator functionally linked to at least one transgene. In one embodiment, a method for expressing at least one transgene / heterologous coding sequence in a plant tissue or plant cell comprises cultivating a plant tissue or plant cell comprising a gene expression cassette containing a GmTEFs1 terminator functionally linked to at least one transgene.

[00160] The following examples are provided to illustrate specific features and / or modalities. The examples should not be interpreted as limiting the disclosure to the specific features or modalities exemplified. EXAMPLES Example 1: Identification of Regulatory Elements in Soybean Genomic Sequences

[00161] Total mRNA expression profiles for 25 soybean tissues (var. Williams 82) were obtained by Next-Generation Sequencing (NGS) and used to identify candidate soybean genes for obtaining regulatory elements. The included tissues were collected from young seedlings (expanded cotyledons, roots, and hypocotyls), V5 (leaves and stems), and R5 soybean plants (leaves, flowers, different stages of seed development, and pods). Endogenous soybean genes exhibiting the desired expression profile were identified as potential candidates for obtaining regulatory sequences.

[00162] One of the genes with the desired expression pattern was Glyma19g07240, which was ubiquitously expressed. This gene was identified as the GmTEFs1 gene, which encodes translation elongation factor 1 alpha (UniProtKB - O04299_SOYBN) (Apweiler, Rolf, et al.). Petition 870210100564, dated 10 / 29 / 2021, pp. 111 / 151 108 / 137 al. UniProt: the universal protein knowledge base. Nucleic acid research 32. suppl_1 (2004): D115-D119; available at http: / / www.uniprot.org / ), thus, this gene was described as GmTEFs1. Regulatory sequences of the GmTEFs1 gene were isolated and characterized for their ability to trigger transgene expression. The GmTEFs1 promoter is provided in this document as SEQ ID NO:2.

[00163] The regulatory sequences of the Glyma19g07240 gene (GmTEFs1) were defined as a sequence of ~1.4 kb upstream of the ATG of the Glyma19g07240 gene for the promoter and 5' untranslated leader (UTR) and ~0.6 kb downstream of the stop codon of the Glyma19g07240 gene for the 3' UTR and terminator. To further refine the regulatory sequences, additional analyses of the regulatory elements were completed. Putative upstream and downstream regulatory sequences were evaluated for the presence of transposable sequence marks, repressive DNA (methylation), and chromatin (histone-H3lysine-4-dimethylation, commonly abbreviated as H3K4me2) using methods as previously disclosed in U.S. Patent Publication No. 20150128309A1, which is incorporated herein by reference in its entirety. DNA sequences from the Glyma19g07240 gene containing repressive DNA and chromatin marks were excluded from the obtained upstream and downstream regulatory sequence.Long extensions (100 bp or more) of AT-rich sequences (>75% AT-rich) within the 5' and 3' sequences were also avoided as a means of reducing difficulties with the de novo synthesis of DNA fragments.

[00164] The resulting upstream regulatory sequence of GmTEFs1 contained both a promoter (SEQ ID NO:2) and a 5' UTR (SEQ ID NO:3) containing an 895 bp intron (SEQ ID NO:28). The downstream sequences included a 3' UTR (SEQ ID NO:4) and a Petition 870210100564, dated 10 / 29 / 2021, pp. 112 / 151 109 / 137 terminator (SEQ ID NO:4) of the GmTEFsI gene. Terminator sequences extended ~100 to 200 bp beyond the last known polyadenylation site. Two guanine base pairs were deleted from the candidate GmTEFs1 terminator (SEQ ID NO:5) to remove undesirable restriction sites.

[00165] The sequences obtained from the soybean genome of the terminator and promoter / UTR 5' of the GmTEFs1 gene (Glyma19g07240) are provided in this document. Example 2: Cloning of Soybean Regulatory Sequences

[00166] The promoter, 5' UTR, and 3' UTR / terminator sequences of the GmTEFs1 gene were synthesized using DNA2.0. A diagram of the synthetic fragment is shown in Figure 1. A linker containing multiple cloning sites was included between the 5' promoter / UTR with the intron and the 3' UTR / terminator sequence.

[00167] The synthetic GmTEFs1 fragment (promoter / 5' UTR and terminator) was cloned into an Accession Gate entry vector, and the RFP / AAD12 reporter gene (SEQ ID NO:10) was inserted between the 5' UTR and the terminator. The reporter gene was the dual reporter encoding a translation fusion protein containing the RFP and AAD12 polypeptides linked with the rigid helical peptide linker, LAE(EAAAK)5AAA described by Arai et al. (2001), Protein Eng, 14, 529-532 and Marqusee et al. (1987), Proc Natl Acad Sci USA, 84, 8898-8902. The resulting expression cassette (SEQ ID NO:11) was moved to a binary vector and identified as pDAB122124. This binary vector also contained the Green Fluorescent Protein (GFP) gene driven by the Arabidopsis Ubiquitin3 (AtUbi3) UTR 5' promoter and terminated by the Arabidopsis Ubiquitin 3 (AtUbi3) terminator.Similarly, the binary vector contained the synthetic phosphophinothricin N-acetyltransferase (PAT) gene from Streptomyces viridochromogenes, which was activated by the Mandibular vein mosaic virus promoter. Petition 870210100564, dated 10 / 29 / 2021, pp. 113 / 151 110 / 137 oca (CsVMV) and terminated by the Agrobacterium tumefaciens Orf1 terminator (AtuOrfl). The GFP and PAT gene expression cassettes are provided as SEQ ID NO:12.

[00168] The cloning steps for the regulatory sequences of GmAct7-2 and GmGAPC1 were similar to those described above for GmTEFs1. GmAct7-2 was tested on the pDAB122133 construct and GmGAPC1 was tested on the pDAB122134 construct. Example 3: N. benthamiana Leaf Infiltrations and Temporary Expression Trials Triggered by GmTEFs1, GmAct7-2 and GmGAPC1 from Reporter RFP / AAD12

[00169] Next, N. benthamiana plants were grown in the greenhouse under a 16-hour photoperiod at 27 °C / 24 °C. Plants aged 20 to 24 days were used for temporary expression assays. For this, the top 3 to 4 leaves were infiltrated using a mixture of two modified Agrobacterium tumefaciens strains. The first strain was used in all infiltrations and carried the pDAB112236 construct containing the transgene that expressed the P19 silencing suppressor (Voinnet et al, (1999), Proc Natl Acad Sci USA, 96, 14.147 to 14.152). The second Agrobactenum strain was either the experimental strain carrying a test construct (with the regulatory elements GmTEFs1, GmAct7-2, or GmGAPC1) or a reference control construct (Table 1).The reference constructs used contained the reporter gene RFP / AAD12 under the control of the Arabidopsis thaliana Ubiquitin 14::Arabidopsis thaliana Ubiquitin 14 terminator (AtUbi14 / AtUbi14) and the Arabidopsis thaliana Ubiquitin 10::Agrobacterium tumefaciens Orf23 promoter (AtUbi10 / AtuOrf23). Mixing ratios were based on Optical Density (OD) readings. The density of all Agrobacterium cultures was set to OD 2.0. After infiltration, plants were grown in a Conviron™ until the infiltrated leaves were saturated. Petition 870210100564, dated 10 / 29 / 2021, pp. 114 / 151 111 / 137 samples were taken on the fifth day after infiltration. Fluorescence data for reporter genes were collected using a Typhoon™ digitizer with 25 to 30 individual 1.5 cm leaf discs for each construct.

[00170] All N. benthamiana samples were scanned in three channels; chlorophyll (488 nm blue laser, 670 nm BP30, 580 nm split), GFP (488 nm blue laser, 520 nm BP40, 580 nm split), and RFP (532 nm green laser, 580 nm BP30). The photomultiplier voltage (PMT) setting used for N. benthamiana was 340 for chlorophyll, 340 for GFP, and 360 for RFP.

[00171] The results of the transient assay test of N. benthamiana are shown in Table 1. Analysis of the fluorescence produced by the reporter transgene RFP / AAD12 revealed that the GmTEFs1 regulatory sequences resulted in mean RFP fluorescence (1,283.3 pixels / area) that was significantly higher (p<0.0001) than the mean background fluorescence (26.1 pixels / area). It was observed that the RFP / AAD12 fluorescence of the GmTEFs1 regulatory sequences was lower (p<0.0001) than the mean RFP / AAD12 fluorescence of the constructs triggered by the AtUbi14 / AtUbi14 and AtUbi10 / AtuOrf23 reference regulatory elements; 7,567.4 and 3,084.5 pixels / area, respectively. The significantly higher RFP / AAD12 fluorescence than background supported by GmTEFs1 regulatory elements indicated that the Glyma19g07240 GmTEFs1 regulatory sequences were functional and could be used to trigger the expression of a heterologous transgene in temporary N-leaf assays.Benthamian.

[00172] Conversely, for the GmTEFs1 regulatory sequences that triggered significantly higher average RFP / AAD12 fluorescence expression than the background, the GmAct2-2 and GmGAPCI regulatory sequences contained within the constructs Petition 870210100564, dated 10 / 29 / 2021, pp. 115 / 151 112 / 137 pDAB122333 and pDAB122134, respectively, produced only low levels of expression that were similar to the background (Table 1). These results demonstrate that the de novo isolated GmAct2-2 and GmGAPCI candidate regulatory sequences lacked the ability to trigger RFP / AAD12 transgene expression. The lack of RFP / AAD12 expression in the pDAB122333 and pDAB122134 constructs was not due to unsatisfactory infiltration because the second transgene within these constructs, GFP, exhibited strong fluorescence that was significantly higher than the background (p<0.0001). Thus, these results show that the de novo candidate regulatory sequences Glyma06g15520 and Glyma06g01850 lacked the ability to trigger heterologous reporter transgene expression.

[00173] Based on these results, the pDAB122333 and pDAB122134 constructs carrying GmAct7-2 and GmGAPC1, respectively, have not yet been pursued. In contrast, the pDAB122124 construct containing the GmTEFs1 regulatory sequences and exhibiting high constitutive levels of RFP / AAD12 fluorescence, compared to the background of N. benthamiana leaves, was advanced for further testing in stably transformed Arabidopsis transgenic plants. Petition 870210100564, dated 10 / 29 / 2021, pp. 116 / 151 TABLE 1. Results of RFP / AAD12 fluorescence assay on temporarily transformed N. benthamiana leaves. Construct Element Name Regulator Number of Samples RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error P19 only None (Background) 216 26.1 24.0 14.4 1.0 34.6 33.5 14.0 1.0 pDAB 117559 AtUbi14 / AtUbi14 261 7567.4*** 6698.4 5191.7 321.4 9770.9*** 9230.0 4609.7 285.3 pDAB 117560 AtUbi10 / AtuOrf23 260 3084.5*** 2760.0 1984.2 123.1 8915.9*** 8737.2 5404.7 335.2 pDAB 122133 GmAct7-2 / GmAct7-2 60 25.3 26.4 7.0 0.9 14206.1** * 12874.3 6178.5 797.6 pDAB 122134 GmGAPC1 / GmGAPC1 30 25.3 24.6 5.1 0.9 5295.7*** 5184.5 2085.8 380.8 pDAB 122124 GmTEFs1 / GmTEFs1 60 1283.3*** 1236.5 785.0 101.3 6952.7*** 6294.7 4459.6 575.7 Note: *** indicates the RFP or GFP means that are significantly higher (p<0.0001) than the mean background fluorescence. Due to the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of each construct with the corresponding fluorescence means of the P19 background control only. Statistical analyses were conducted using the JMP® statistical package. Example 4: Agrobacterium-mediated transformation of Arabidopsis and Molecular Analyses of Transgenic Events 113 / 137 Petition 870210100564, dated 10 / 29 / 2021, pp. 117 / 151 114 / 137

[00174] The Columbia-0 (Col-0) ecotype of Arabidopsis thaliana was used to test the expression of the RFP / AAD12 reporter under the control of GmTEFs1 regulatory elements. A standard Arabidopsis transformation procedure was used to produce transgenic seed by the flowering immersion method (Clough and Bent, 1998). Ti seeds were sown in sorting trays (26.6 x 53.34 x 2.54 cm (10.5X21x1), TO Plastics Inc., Clearwater, MN). For this, 200 mg of cold stratified seeds (0.1% agar + 385 mg / l Liberty for 48 hours before sowing) were distributed into sorting trays using a modified air-driven sprayer to distribute 10 mL of seed suspension per sorting tray. The trays were covered with moisture domes, marked with seed identifiers, and placed in a Conviron™ with an individual irrigation tray under each tray. The moisture dome was removed approximately five days after sowing.The first irrigation of the selection trays was done using subirrigation with Hoagland fertilizer approximately 10 to 14 days after sowing. In addition to herbicide stratification, the plants were sprayed with a 0.2% solution (20 μL / 10 mL of distilled H2O) of Liberty™ herbicide seven and nine days after sowing. Liberty™-resistant T1 plants were transplanted from selection trays to two-inch (five-centimeter) pots and allowed to grow for seven to ten days before sampling for molecular analysis.

[00175] Next, DNA was extracted from the leaves using a leaf of approximately 0.5 square centimeters of Arabidopsis that was removed from each plant. Samples were collected in a 96-well DNA extraction plate. Then, 200 μL of extraction buffer was added to each well and the tissue was broken up with three mm stainless steel microspheres using a pulverizer. Petition 870210100564, dated 10 / 29 / 2021, pp. 118 / 151 115 / 137 Kleko™ tissue macerator (three minutes at maximum setting). After tissue maceration, DNA was isolated using the BioSprint 96 DNA Plant™ Kit.

[00176] For qPCR, the number of transgene copies was assessed using a hydrolysis probe designed to detect the pat and aad12 genes (Table 2). The endogenous Arabidopsis gene, AtTafII15 (Arabidopsis locus: AT4G31720), was used for standardization of the DNA template concentration (Table 2). qPCR was performed as follows: 10 μl of Probes Master™ mixture with a final concentration of 0.4 μM of each primer and 0.2 μM of each probe. PCR cycles were performed using 95 °C for 10 min, followed by 40 amplification cycles (95 °C for 1 min, 60 °C for 40 min, and 72 °C for 1 s) and 40 °C for 1 s. All qPCR assays were performed in biplex format, with pat or aad12 assays paired with the assay for the endogenous AtTafII15 gene. cp scores, the point at which the fluorescence signal crosses the background threshold, were determined using the advanced relative quantification algorithm, based on the ΔΔΦ method (LightCycler® software version 1).5) were used to analyze real-time PCR data. All samples were then calibrated to a known hemizygous plant to obtain the transgene copy number. Up to 100 T1 events that were identified as being resistant to Liberty™ were screened to identify single- and double-copy transgene events that were used for further transgene expression analyses in T1 transgenic plants. Petition 870210100564, dated 10 / 29 / 2021, pp. 119 / 151 116 / 137 TABLE 2. Primers and probes used for genotyping and zygosity analysis of transgenic Arabidopsis plants. Oligo Name Oligo Sequence Fluorophore Identification Target Gene AtTafII15 F SEQ ID NO:13 GAGGATTAGGG 1 1 1 CAA CGGAG — AtTafII15 AtTafII15 R SEQ ID NO:14 GAGAATTGAGCTGAGAC GAGG — AtTafII15 AtTafII 15Probe SEQ ID NO:15 AGAGAAG1 1 1 CGACGGA 1 1 1CGGGC HEX AtTafII15 Initiator PAT A SEQ ID NO:16 ACAAGAGTGGATTGATG ATCTAGAGAGGT — PAT Initiator PAT S SEQ ID NO:17 Clll GATGCCTATGTGA CACGTAAACAGT — PAT Probe PAT_AS SEQ ID NO:18 AGGGTGTTGTGGCTGGT ATTGCTTACGCT Cy5 PAT AAD12 F SEQ ID NO:19 CAGAGTCCATGCTCACC AAT — AAD12 AAD12 R SEQ ID NO:20 ACGTGGCAACTTGAAAT CC — AAD12 Probe AAD12 SEQ ID NO:21 TGGAGATGTGGTTGTGT GGGACAA Cy5 (T1) or FAM (T2) AAD12 Example 5: Evaluation of Genes Functionally Linked to GmTEFs1 Regulatory Sequences in Arabidopsis Ti Plants

[00177] To evaluate the expression of the reporter gene RFP / AAD12 aci Petition 870210100564, dated 10 / 29 / 2021, pp. 120 / 151 117 / 137 Driven by the regulatory elements of the GmTEFs1 promoter, GmTEFs1 UTR 5', and GmTEFs1 terminator, single-copy transgenic events were identified and analyzed for RFP / AAD12 fluorescence using the Typhoon instrument. All samples were digitized in three channels: chlorophyll (488 nm blue laser, 670 nm BP30, 580 nm split), GFP (488 nm blue laser, 520 nm BP40, 580 nm split), and RFP (532 nm green laser, 580 nm BP30). The definition of PMT for leaf tissue was chlorophyll 400, GFP 400, and RFP 420. For fluorescence analyses in leaves, fully expanded rosette leaves from low-copy transgenic events (1 to 2 copies) were harvested from each plant and sorted from the adaxial (top) side. The Contour Drawing function was used to highlight leaf shapes, and normalized fluorescence was determined by dividing the signal volume by leaf surface area. The results are shown in Table 3.

[00178] Analysis of Ti events regarding RFP / AAD12 fluorescence revealed that GmTEFs1 regulatory elements supported high mean RFP / AAD12 fluorescence (804.4 pixels / area) which was statistically higher (p<0.0001) than the mean background fluorescence (350.5 pixels / area) detected in the non-transgenic wild-type control (Wt) (Table 3). These results show that GmTEFs1 regulatory sequences triggered higher expression than the RFP / AAD12 reporter background in transgenic Arabidopsis thaliana plants. The mean RFP / AAD12 fluorescence produced by GmTEFs1 regulatory elements was lower than the RFP / AAD12 fluorescence levels of the pDAB117559 and pDAB117560 reference constructs (p<0.0001, not shown). In the constructs pDAB117559 and pDAB117560, the reporter RFP / AAD12 was under the control of the following regulatory elements: Arabidopsis thaliana promoter, Ubiquitin 14::Arabidopsis thaliana terminator. Petition 870210100564, dated 10 / 29 / 2021, pp. 121 / 151 118 / 137 in Ubiquitin 14 and the Arabidopsis thaliana promoter Ubiquitin 10::terminator of Agrobacterium tumefaciens Orf23, respectively. Although the fluorescence supported by RFP / AAD12 was lower than the positive controls pDAB117559 and pDAB117560, it was higher than the background fluorescence, indicating that GmTEFs1 supports low transgene expression, but statistically higher than the background. Based on these results, the pDAB122124 transgenic events containing the GmTEFs1 regulatory sequences were advanced for further characterization in Arabidopsis T2. Petition 870210100564, dated 10 / 29 / 2021, pp. 122 / 151 TABLE 3. Results of RFP / AAD12 reporter gene expression test / heterologous coding sequence expression in leaves of transgenic Arabidopsis Ti plants. Construct Regulatory Element Number of Events RFP Fluorescence GFP Fluorescence Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Wt None (Background) 57 350.5 269.3 231.4 30.7 665.2 614.1 218.0 28.9 pDAB 117559 AtUbi14 / AtUbi14 60 1492.3*** 1537.3 495.2 63.9 5164.1*** 5164.7 1605.8 207.3 pDAB 117560 AtUbi10 / AtuOrf23 63 1547.6*** 1556.1 504.5 63.6 5521.2*** 5515.4 1434.3 180.7 pDAB 122124 GmTEFs1 / GmTEFs1 15 804.4*** 766.7 248.9 64.3 6397.5*** 6369.5 741.0 191.3 Note: *** indicates means that differ from the mean fluorescence of the Wt control at p<0.0001. Due to the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of each construct with the corresponding fluorescence means of the Wt background control. Statistical analyses were conducted using the JMP® statistical package. 119 / 137 Petition 870210100564, dated 10 / 29 / 2021, pp. 123 / 151 120 / 137 Example 6: Expression of Genes Functionally Linked to GmTEFsl Regulatory Sequences in Arabidopsis T2 Plant Leaves

[00179] The GmTEFs1 regulatory sequences exhibited lower expression levels, but significantly higher than the background, compared to the expression levels of the reference regulatory sequences Arabidopsis thaliana Ubiquitin 14 promoter::Arabidopsis thaliana Ubiquitin 14 terminator and Arabidopsis thaliana Ubiquitin 10 promoter::Agrobacterium tumefaciens Orf23 terminator in Arabidopsis Ti (EXAMPLE 5). Selected events containing the GmTEFs1 regulatory sequences that trigger the RFP / AAD12 reporter gene were advanced for further characterization in Arabidopsis T2 plants. Consequently, five Ti plants expressing medium to high levels of RFP / AAD12 and GFP were selected. These five plants contained pDAB122124 transgenic events and were selected for T2 plant testing. From these four events, 56 plants were cultivated for each event.The T2 plants were genotyped at the molecular level, as described in EXAMPLE 4. Based on the molecular analyses, all homozygous plants and a comparable number of hemizygous plants were retained for fluorescence analysis of single-copy events. To simplify the interpretation of data for two-copy transgenic events, only hemizygous plants were retained for expression analyses.

[00180] The results of the analyses in T2 transgenic plants are provided in Table 4. The results for homozygous (1 copy) and hemizygous (1 and 2 copies) events containing the RFP / AAD12 transgene under the control of GmTEFs1 regulatory elements exhibited RFP / AAD12 fluorescence that was significantly higher than the background fluorescence of non-trans control plants. Petition 870210100564, dated 10 / 29 / 2021, pp. 124 / 151 121 / 137 genes. Although the mean RFP / AAD12 fluorescence produced by hemizygous and homozygous transgenic plants carrying the GmTEFs1 regulatory elements was significantly higher than the background fluorescence (Table 4), this fluorescence was lower than that of the reference constructs pDAB117559 and pDAB117560 (p<0.0002, not shown). In the pDAB117559 and pDAB117560 constructs, the RFP / AAD12 reporter was under the control of the following regulatory elements: Arabidopsis thaliana Ubiquitin 14 promoter::Arabidopsis thaliana Ubiquitin 14 terminator and Arabidopsis thaliana Ubiquitin 10 promoter::Agrobacterium tumefaciens Orf23 terminator, respectively. These results demonstrate that GmTEFs1 regulatory sequences support robust transgene expression across two generations of transgenic events. Petition 870210100564, dated 10 / 29 / 2021, pp. 125 / 151 TABLE 4. Results of RFP / AAD12 reporter gene expression test / heterologous coding sequence expression in leaves of transgenic Arabidopsis T2 plants. Construct Regulatory Elements Zygocity Number of plants RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Wt None (background) none 15 1137.5 1062.9 384.0 99.2 337.0 322.8 60.3 15.6 pDAB 117559 AtUbi14 / AtUbi14 hemi 26 10943.2** * 10394.5 2862.0 561.3 3352.3*** 3355.0 380.2 74.6 homo 40 17194.3** * 16208.0 6090.0 962.9 5649.3*** 6144.2 1509.4 238.7 pDAB 117560 AtUbi10 / Atu- Orf23 hemi 25 8239.2*** 8031.3 1928.4 385.7 3436.3*** 3312.6 674.3 134.9 homo 50 15334.3** * 15077.5 4080.2 577.0 6308.3*** 6152.4 1385.5 195.9 pDAB 122124 GmTEFs1 / GmTEFs1 hemi 26 2127.4*** 1938.9 577.1 113.2 2602.9*** 2680.0 360.6 70.7 homo 13 2881.2*** 2461.5 1182.2 327.9 3867.8*** 3550.6 1210.9 335.9 Note: *** indicates means that differ from the mean fluorescence of the Wt control at p<0.0001. Due to the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of each construct with the corresponding fluorescence means of the Wt background control. Statistical analyses were conducted using the JMP® statistical package. 122 / 137 Petition 870210100564, dated 10 / 29 / 2021, pp. 126 / 151 123 / 137

[00181] Interrogation of individual transgenic events (Table 5) revealed that the RFP / AAD12 fluorescence detected in the two single-copy events (pDAB122124-033 and pDAB122124-065) had a mean RFP / AAD12 fluorescence that was higher than the mean Wt fluorescence (Table 5). In these single-copy transgenic events, homozygous plants exhibited higher RFP / AAD12 fluorescence than hemizygous plants, indicating that transgene expression in these events was copy number dependent. Three events that had a complex transgene locus (two copies) also exhibited higher RFP / AAD12 fluorescence than the background, although AAD12 expression levels were lower than those of the homozygous single-copy events (p=0.0091, not shown), indicating a possibility that complex locus structures, with potential DNA rearrangements, may have impacted RFP / AAD12 expression.

[00182] In summary, testing of transgenic Arabidopsis T2 events showed that GmTEFs1 regulatory elements trigger heritable expression of the RFP / AAD12 reporter gene that is higher than the Wt background fluorescence. These results reaffirm that GmTEFs1 regulatory elements are effective in triggering heritable transgene expression in stably transformed Arabidopsis plants. Petition 870210100564, dated 10 / 29 / 2021, pp. 127 / 151 TABLE 5. Results of RFP / AAD12 reporter gene expression test / heterologous coding sequence expression in leaves of homozygous and hemizygous plants of individual Arabidopsis T2 events. Construct; Regulatory Elements Event Zygocy Number of plants RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Col-0 None (background) none 15 1137.5 1062.9 384.0 99.2 337.0 322.8 60.3 15.6 pDAB 117559;AtUbi14 / AtUbi14 117559057 hemi 5 10415,0 10400,7 930,2 416,0 3529,5 3519,1 159,8 71,5 homo 8 17840,7 19158,8 3743,1 1323,4 6196,5 6607,7 1257,6 444,6 117559062 hemi 6 9320,9 9586,9 808,9 330,2 3486,9 3472,2 161,6 66,0 homo 9 14534,0 16156,6 3679,1 1226,4 5455,1 6345,2 1482,7 494,2 117559- 246 hemi 5 14037,8 13650,2 1112,2 497,4 3351,0 3316,9 488,5 218,4 homo 9 23442,5 25126,5 5547,1 1849,0 5724,0 5870,9 1573,9 524,6 117559- 314 hemi 5 13987,2 13806,8 1671,9 747,7 3411,0 3489,6 465,9 208,3 homo 4 21176,8 20884,0 7321.8 3660.9 5296.8 5217.0 2391.4 1195.7 117559- 391 hemi 5 7279.7 7364.9 922.8 412.7 2956.2 3020.1 350.4 156.7 homo 10 11855.0 12938.5 2711.7 857.5 5459.9 5750.6 1475.0 466.4 pDAB 117560;AtUbi10 / AtuOrf23 117560- 191 hemi 5 8889.2 9549.1 2092.5 935.8 3831.1 4015.2 859.5 384.4 homo 6352.1 6030.2 1756.8 555.6 117560- 254 hemi 5 9158.7 8167.0 2264.3 1012.6 3611.3 3358.9 664.3 297.1 homo 710.1.494 4009.6 1267.9 6283.7 6343.9 1273.8 402.8 117560- hemi 5 6506.8 6287.3 948.7 424.3 3066.4 3136.1 256.9; 124 / 137 Petition 870210100564, of 29 / 10 / 2021, p. 128 / 151 Construct; Regulatory Elements Event 288 Zygocity Number of plants RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error homo 10 18550.4 18921.9 3158.6 998.8 7007.3 6673.1 1175.3 371.7 117560- 325 hemi 5 7716.5 6838.0 1951.7 872.8 3172.3 3092.6 668.9 299.1 homo 10 14238.9 13152.0 4636.8 1466.3 6230.7 5924.0 1444.7 456.9 117560- 353 hemi 5 8924.7 8444.1 1354.0 605.5 3500.2 3459.6 733.6 328.1 homo 10 13848.3 13274.9 2821.9 892.4 5667.9 5782.0 1125.1 355.8 pDAB 122124;GmTEFsl / GmTEFsl 122124195 (two-copy event) hemi 5 1956.82*** 1845.9 184.2 82.4 2776.7*** 2832.6 192.3 86.0 122124033 hemi 6 2997.42*** 3050.55 366.7 149.7 2453.8*** 2420.2 470.9 192.28 homo 5 3760.4** 3670.8 1316.1 588.6 4041.2*** 4202.9 1114.1 498.2 122124049 (two-copy event) hemi 5 1758.7* 1861.3 391.9 175.3 2554.1*** 2703.2 461.1 206.2 122124065 hemi 5 1894.8* 1813.6 420.2 187.9 2627.3*** 2745.3 325.9 145.7 homo 8 2331.6* 2246.7 713.2 252.2 3759.4*** 3301.1 1330.3 470.3; 125 / 137 Petition 870210100564, dated 10 / 29 / 2021, pp. 129 / 151 Construct; Regulatory Elements Event Zygoticity Number of plants RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error 122124117 (two-copy event) hemi 5 1855.3*** 1817.8 217.0 97.0 2632.2*** 2656.7 322.0 144.0 Note: Statistical analyses of the mean RFP and GFP fluorescence of individual pDAB122124 events were conducted separately for each zygosity class. Due to small sample sizes and the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of an event to the mean control fluorescence Wt. Stars indicate the mean RFP and GFP fluorescence of pDAB122124 transgenic events (hemizygotes or heterozygotes) that is significantly higher than the mean control fluorescence Wt; *** - p-values ​​less than or equal to 0.0002, ** - p-values ​​less than 0.001, and * - p-values ​​less than or equal to 0.01. Statistical analyses were performed using the JMP® statistical package. 126 / 137 Petition 870210100564, dated 10 / 29 / 2021, pp. 130 / 151 127 / 137 Example 7: Production of Transgenic Soybean Plants and Estimation of Transgene Copy Number Using Real-Time TaqMan® PCR

[00183] The regulatory elements of GmTEFs1 (pDAB122124) were further tested in transgenic soybean plants. Transgenic soybean plants were produced using the split seed transformation method described in Pareddy et al., US 2014 / 0173774 A1, incorporated herein by reference in its entirety. Transgenic seedlings were molecularly analyzed to determine the transgene copy number. For this purpose, leaf tissue samples from transgenic soybean plants and non-transgenic controls were collected in 96-well collection tubes. Tissue disruption was performed using 2 mm tungsten microspheres. After tissue maceration, genomic DNA was isolated in high-throughput format using the MagAttract Plant™ kit (Qiagen, Hilden, Germany) on the Agilent BioCel™.The number of transgenic copies of PAT was determined using a hydrolysis probe assay, analogous to the TaqMan® assay, in biplex with an internal soybean reference gene, GMS116 (GMFL01-25-J19, GenBank Accession No.: AK286292.1). The assays were designed using LightCycler® Probe Design 2.0 software. The transgenic presence / absence of the Spectinomycin resistance gene (SpecR) was determined using a hydrolysis probe assay, analogous to the TaqMan® assay, in biplex with an internal soybean reference gene, GMS116. This assay was designed to detect the SpecR gene located on the main chain of the binary constructs used for transformation. Only events where there was no amplification with the SpecR probe were regenerated because this indicated that the main chain fragments were not likely to be present in the transgenic soybean genome. Petition 870210100564, dated 10 / 29 / 2021, pp. 131 / 151 128 / 137 amplification of all genes of interest (PAT, SpecR, GMS116), the LightCycler®480 Probes Master™ mixture (Roche Applied Science) was prepared at a final concentration of 1x in a 10 μL volume multiplex reaction containing 0.4 μM of each primer and 0.2 μM of each probe (primer and probe composition listed in TABLE 7). A two-step amplification reaction was performed using the LIGHTCYCLER 480 system™ (Roche Applied Science), with an extension at 60 °C for 60 seconds with fluorescence acquisition.

[00184] Real-time PCR data analysis was performed using LightCycler® version 1.5 software with the advanced relative quantification module and was based on the AACt method. For PAT, a known single-copy gDNA sample was included in each test and used as a single-copy calibrator. In addition, each test, for all genes of interest, included a wild-type (Maverick) sample as a negative control. TABLE 6. Primer and Probe Information for PAT and SpecR gene hydrolysis probe assay located on the main chain and internal reference (GMS116). All sequences are indicated as 5'-3'. OLIGO SEQUENCE TYPE PAT F ACAAGAGTGGATTGATGATCTAGAGA (SEQ ID NO:22) Initiator PAT R ClllGATGCCTATGTGACACGTAAAC (SEQ ID NO:23) Initiator PAT PR 6FAM- CCAGCGTAAGCAATACCAGCCACAACACC3BHQ 1 (SEQ ID NO:24) Hydrolysis probe SpecR F CGCCGAAGTATCGACTCAACT (SEQ ID NO:25) Initiator SpecR R GCAACGTCGGTTCGAGATG (SEQ ID NO:26) Initiator SpecR PR 6FAM-TCAGAGGTAGTTGGCGTCATCGAG3BHQ 1 (SEQ ID NO:27) Hydrolysis probe Petition 870210100564, dated 10 / 29 / 2021, pp. 132 / 151 129 / 137 Example 8: Evaluation of the Expression of GmTEFsl Regulatory Sequences in Ti Soybean Plants

[00185] The expression of genes by GmTEFs1 regulatory elements was tested in transgenic soybean plants. For this analysis, stable soybean plant transformations were generated as described in EXAMPLE 7. Transgenic seedlings carrying low transgene copy numbers (1 to 2 copies) of the GmTEFs1 regulatory element construct transformations (pDAB122124) and the control reference construct (pDAB117560) were generated, and T1 seeds were collected and used for greenhouse planting. T1 soybean plants were grown in a greenhouse and genotyped for the transgene as described in EXAMPLE 7.

[00186] To evaluate the expression of the RFP / AAD12 reporter gene driven by the GmTEFs1 promoter, GmTEFs1 UTR 5', and GmTEFs1 terminator regulatory elements, transgenic plants were identified and analyzed for RFP / AAD12 fluorescence using the Typhoon instrument. All samples were digitized in three channels: chlorophyll (488 nm blue laser, 670 nm BP30, 580 nm split), GFP (488 nm blue laser, 520 nm BP40, 580 nm split), and RFP (532 nm green laser, 580 nm BP30). The PMT definition for leaf tissue was chlorophyll 400, GFP 400, and RFP 420. Leaves were collected from the highest fully expanded leaf in V3 soybean plants. For scanning, three leaf discs were cut from each leaf collected. The fluorescence results of the reporter genes RFP / AAD12 and GFP are shown in Table 7. The expression of the reporter gene triggered by the GmTEFs1 regulatory sequences was robust (1,507.5 pixels / area for hemizygous plants and 2.674.2 pixels / area for homozygotes) and highly significant above the background (613.1 pixels / area, p<0.0001, Table 7). The average RFP / AAD12 fluorescence specified by the pDAB122124 plants. Petition 870210100564, dated 10 / 29 / 2021, pp. 133 / 151 130 / 137 hemizygous and homozygous plants carrying GmTEFs1 regulatory sequences had lower expression of RFP / AAD12 driven by the Arabidopsis thaliana Ubiquitin 10::terminator of Agrobacterium tumefaciens Orf23 (p<0.0001 for hemizygous and homozygous plants, not shown). Although the expression of GmTEFs1-driven RFP / AAD12 was lower than that of the control, this expression level is sufficient for reliable transgene expression in Ti soybean. Petition 870210100564, dated 10 / 29 / 2021, pp. 134 / 151 TABLE 7. Results of RFP / AAD12 reporter gene expression test / heterologous coding sequence expression in leaves of single-copy Ti transgenic soybean events. Construct Regulatory Elements Consensus Zygocy Number of plants Number of digitized leaf discs RFP Fluorescence (pixels / area) GFP Fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Wt Maverick Null 4 12 613.1 608.8 64.5 18.6 235.4 238.0 11.6 3.3 pDAB 117560 AtUbi10 / AtuOrf23 Hemi 12 36 3075.6* ** 3055.5 1036.4 172.7 2084.2* ** 2072.2 377.3 62.9 Homo 11 33 4559.2* ** 4300.7 2059.8 358.6 4085.2* ** 4308.5 1094.8 190.6 pDAB 122124 GmTEFs1 / GmTEFs1 Hemi 24 72 1507.5* ** 1263.5 723.0 85.2 992.2 *** 655.9 833.4 98.2 Homo 23 69 2674.2* ** 2337.1 1305.3 157.1 2019.3* ** 320.4 1877.9 226.1 Note: *** indicates means that differ from the mean fluorescence of the Wt control at p<0.0001. Due to the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of each construct with the corresponding fluorescence means of the Wt background control. Statistical analyses were conducted using the JMP® statistical package. 131 / 137 Petition 870210100564, dated 10 / 29 / 2021, pp. 135 / 151 132 / 137

[00187] Interrogation of individual soybean transgenic events (Table 8) revealed that RFP / AAD12 fluorescence was detected in all four single-copy events that were evaluated. For all transgenic events, homozygous plants exhibited higher RFP / AAD12 fluorescence than hemizygous sisters, thus indicating that transgene expression in these events was copy number dependent.

[00188] In summary, testing of transgenic Ti soybean events showed that GmTEFs1 regulatory elements trigger heritable expression of the RFP / AAD12 reporter gene that is higher than the Wt background in multiple independent transgenic events. These results reaffirm that GmTEFs1 regulatory elements are effective in triggering heritable transgene expression in stably transformed soybean plants. Petition 870210100564, dated 10 / 29 / 2021, pp. 136 / 151 TABLE 8. Results of RFP / AAD12 reporter gene expression test / heterologous coding sequence expression in leaves of homozygous and hemizygous plants of individual T2 soybean events. Construct Regulatory Elements Event Consensus Zygocy Number of plants Number of leaf discs RFP fluorescence (pixels / area) GFP fluorescence (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Maverick None None Null 4 12 613.1 608.8 64.5 18.6 235.4 238.0 11.6 3.3 pDAB 117560 AtUbi10 / AtuOrf23 117560 -670 Hemi 6 18 2463.2 *** 2562.1 805.5 189.9 1941.5 *** 1875.1 439.1 103.5 Homo 6 18 4002.2 *** 3884.2 1918.3 452.2 3631.2 *** 3829.9 1203.8 283.7 117560 -691 Hemi 6 18 3687.9 *** 3528.3 876.8 206.7 2226.9 *** 2172.5 239.0 56.3 Homo 5 15 5227.6 4562.0 2086.1 538.6 4630.0 4616.6 630.0 162.7 pDAB 122124 GmTEFs1 / GmTEFs1 122124 -213 Hemi 6 18 2450.0 *** 2329.2 744.7 175.5 2128.5 *** 2067.5 291.7 68.7 Homo 6 18 2715.8 *** 2760.2 441.1 104.0 3979.9 *** 4009.2 524.1 123.5 122124 -220 Hemi 6 18 1066.0 *** 1034.1 286.1 67.4 221.1 *** 231.0 30.1 7.1 Homo 6 18 1852.7 *** 1562.6 705.5 166.3 243.7 *** 239.6 19.7 4,7 122124 -221 Hemi 6 18 1137.6 *** 1210.5 251.8 59.3 265.0 *** 270.9 58.7 13.8 Homo 6 18 2470.4 *** 2088.6 1022.5 241.0 295.4 *** 302.2 22.6 5.3 122124 -230 Hemi 6 18 1376.3*** 1263.5 416.6 98.2 1354.1 *** 1262.3 340.1 80.2 Homo 5 15 3854.5*** 3228.0 1936.3 500.0 3865.9 *** 3709.8 568.0 146.7 133 / 137 Note: *** indicates means that differ from the mean fluorescence of the Wt control at p<0.0001. Due to the presence of unequal variances, Welch's t-test was used to compare the mean RFP or GFP fluorescence of each construct with the corresponding fluorescence means of the Wt background control. Statistical analyses were conducted using the JMP® statistical package. Petition 870210100564, dated 10 / 29 / 2021, pp. 137 / 151 134 / 137 Example 9: Agrobacterium-Mediated Transformation of Genes Functionally Linked to the GmTEFs1 Promoter, the 5' UTR of GmTEFs1, the 3' UTR of GmTEFs1 and / or the GmTEFs1 Terminator

[00189] Soybeans can be transformed with genes functionally linked to the GmTEFs1 promoter, the 5' UTR of GmTEFs1, the 3' UTR of GmTEFs1 and / or the GmTEFs1 terminator using the same techniques previously described in Example 11 or Example 13 of patent application WO 2007 / 053482.

[00190] Cotton can be transformed with genes functionally linked to the GmTEFs1 promoter, the GmTEFs1 5' UTR, the GmTEFs1 3' UTR and / or the GmTEFs1 terminator using the same techniques previously described in Example No. 14 of US Patent No. 7,838,733 or in Example No. 12 of patent application WO 2007 / 053482 (Wright et al.).

[00191] Canola can be transformed with genes functionally linked to the GmTEFs1 promoter, the GmTEFs1 5' UTR, the GmTEFs1 3' UTR and / or the GmTEFs1 terminator using the same techniques previously described in Example No. 26 of U.S. Patent No. 7,838,733 or in Example No. 22 of patent application WO 2007 / 053482 (Wright et al.).

[00192] Wheat can be transformed with genes functionally linked to the GmTEFs1 promoter, the GmTEFs1 5' UTR, the GmTEFs1 3' UTR and / or the GmTEFs1 terminator using the same techniques previously described in Example 23 of patent application WO 2013 / 116700A1 (Lira et al.).

[00193] Rice can be transformed with genes functionally linked to the GmTEFs1 promoter, the GmTEFs1 5' UTR, the GmTEFs1 3' UTR and / or the GmTEFs1 terminator using the same techniques previously described in Example 19 of patent application WO 2013 / 116700A1 (Lira et al.). Petition 870210100564, dated 10 / 29 / 2021, pp. 138 / 151 135 / 137 Example 10: Agrobacterium-mediated transformation of genes functionally linked to GmTEF1 regulatory elements.

[00194] In light of the present disclosure, additional crops can be transformed, according to the embodiments of the present disclosure, using techniques that are known in the art. For Agrobacterium-mediated transformation of rye, see, for example, Popelka JC, Xu J, Altpeter F., Generation of transgenic low copy number rye after biolistic gene transfer and production of transgenic castor bean (Secale cereale L.) instantly without transgenic markers, Transgenic Res. Oct. 2003;12(5):587-596.). For Agrobacterium-mediated transformation of sorghum, see, for example, Zhao et al., Agrobacterium-mediated transformation of sorghum, Plant Mol Biol. Dec. 2000;44(6):789 to 798. For Agrobacterium-mediated transformation of barley, see, for example, Tingay et al., Agrobacterium tumefaciens-mediated barley transformation, The Plant Journal, (1997) 11: 1369 to 1376. For Agrobacterium-mediated transformation of wheat, see, for example, Cheng et al.Genetic Transformation of Wheat Mediated by Agrobacterium tumefaciens, Plant Physiol. Nov. 1997;115(3):971-980. For Agrobacterium-mediated transformation of rice, see, for example, Hiei et al., Rice transformation mediated by Agrobacterium tumefaciens, Plant Mol. Biol. Sept. 1997;35(1-2):205-218.

[00195] The Latin names for these and other plants are given below. It should be clear that other transformation techniques (not Agrobacterium) can be used to transform genes functionally linked to the GmTEFs1 promoter, the GmTEFs1 5' UTR, the GmTEFs1 3' UTR and / or the GmTEFs1 terminator, for example, in these or other plants. Examples include, but are not limited to; Maize (Zea mays), Wheat (Triticum spp.), Rice (Ory Petition 870210100564, dated 10 / 29 / 2021, pp. 139 / 151 136 / 137 za spp. and Zizania spp.), Barley (Hordeum spp.), Cotton (Abroma augusta and Gossypium spp.), Soybean (Glycine max), Sugar beet and table beet (Beta spp.), Sugarcane (Arenga pinnata), Tomato (Lycopersicon esculentum and other spp., Physalis ixocarpa, Solanum incanum and other spp., and Cyphomandra betacea), Potato (Solanum tuberosum), Sweet potato (Ipomoea batatas), Rye (Secale spp.), Peppers (Capsicum annuum, chinense and frutescens), Lettuce (Lactuca sativa, perennis and pulchella), Cabbage (Brassica spp.), Celery (Apium graveolens), Eggplant (Solanum melongena), Peanut (Arachis hypogea), Sorghum (Sorghum spp.), Alfalfa (Medicago sativa), Carrot (Daucus carota), Beans (Phaseolus spp. and other genera), Oats (Avena sativa and strigosa), Peas (Pisum, Vigna and Tetragonolobus spp.), Sunflower (Helianthus annuus), Pumpkin (Cucurbita spp.), Cucumber (Cucumis sativa), Tobacco (Nicotiana spp.)), Arabidopsis (Arabidopsis thaliana), Grass (Lolium, Agrostis, Poa, Cynodon, and other genera), Clover (Trifolium), Vetch (Vicia). The transformation of such plants, with genes functionally linked to the GmTEFs1 promoter, the GmTEFs1 5' UTR, the GmTEFs1 3' UTR, and / or the GmTEFs1 terminator, for example, is contemplated in the embodiments of this disclosure.

[00196] The use of the GmTEFs1 promoter, the GmTEFs1 5' UTR, the GmTEFs1 3' UTR, and / or the GmTEFs1 terminator to activate functionally linked genes can be employed in many evergreen and deciduous timber species. Such applications are also within the scope of the embodiments of this disclosure. These species include, but are not limited to: alder (Alnus spp.), ash (Fraxinus spp.), aspen and poplar species (Populus spp.), beech (Fagus spp.), birch (Betula spp.), cherry (Prunus spp.), eucalyptus (Eucalyptus spp.), walnut (Carya spp.), maple (Acer spp.), oak (Quercus spp.).) and pine (Pinus spp.).

[00197] The use of the GmTEFs1 promoter, the 5' UTR of GmTEFs1, Petition 870210100564, dated 10 / 29 / 2021, pp. 140 / 151 The use of the 137 / 137 UTR 3' of GmTEFsl and / or the GmTEFsl terminator to activate functionally linked genes can be employed in ornamental and fruit-bearing species. Such applications also fall within the scope of the modalities of this disclosure. Examples include, but are not limited to: rose (Rosa spp.), burning bush (Euonymus spp.), petunia (Petunia spp.), begonia (Begonia spp.), rhododendron (Rhododendron spp.), wild apple or apple (Malus spp.), pear (Pyrus spp.), peach (Prunus spp.) and marigolds (Tagetes spp.).

[00198] Although various exemplary aspects and embodiments have been discussed above, those skilled in the art will recognize certain modifications, permutations, additions, and subcombinations thereof. It is therefore intended that the appended claims and claims introduced hereafter be interpreted as including all such modifications, permutations, additions, and subcombinations to the extent that they are within their true spirit and scope. Petition 870210100564, dated 10 / 29 / 2021, pages 141 / 151

Claims

1 / 3 CLAIMS 1. Nucleic acid vector, characterized in that it comprises a promoter functionally linked to a heterologous polynucleotide sequence of: a) a polylinking sequence; b) a heterologous coding sequence of non-Glycine max elongation factor 1 alpha (non-GmTEFs1); or c) a combination of a) and b); wherein said promoter comprises a polynucleotide sequence as set forth by SEQ ID NO:

2.

2. Nucleic acid vector, according to claim 1, characterized in that said promoter is 371 base pairs long.

3. Nucleic acid vector, according to claim 1, characterized in that said promoter consists of a polynucleotide sequence as set forth by SEQ ID NO:

2.

4. Nucleic acid vector, according to claim 1, characterized in that said promoter is functionally linked to a heterologous coding sequence.

5. Nucleic acid vector, according to claim 4, characterized in that the heterologous coding sequence encodes a selectable marker protein, an insecticide resistance protein, a herbicide tolerance protein, a nitrogen use efficiency protein, a water use efficiency protein, a small RNA molecule, a nutritional quality protein or a DNA-binding protein.

6. Nucleic acid vector, according to claim 1, characterized in that it further comprises a terminator polynucleotide sequence.

7. Nucleic acid vector, according to claim 1, characterized in that it further comprises an untranslated 3' polynucleotide sequence.

8. Nucleic acid vector, according to claim 1, characterized in that it further comprises a 5' untranslated polynucleotide sequence.

9. Nucleic acid vector, according to claim 1, characterized in that it further comprises an intron sequence.

10. Nucleic acid vector, according to claim 1, characterized in that said promoter has tissue-constitutive expression.

11. Method for producing a transgenic plant cell, the method being characterized in that it comprises the steps of: a) transforming a plant cell with a gene expression cassette comprising a GmTEFs1 promoter, wherein said promoter is as defined by SEQ ID NO:2, functionally linked to at least one polynucleotide sequence of interest; b) isolating the transformed plant cell comprising the gene expression cassette; and c) producing a transgenic plant cell comprising the GmTEFs1 promoter functionally linked to at least one polynucleotide sequence of interest. Petition 870250034267, dated 29 / 04 / 2025, p. 14 / 66 3 / 3 12. Method for expressing a polynucleotide sequence of interest in a plant cell, characterized in that it comprises introducing into the plant cell a polynucleotide sequence of interest functionally linked to a GmTEFs1 promoter, wherein said promoter is as set forth by SEQ ID NO:

2. Petition 870250034267, dated 29 / 04 / 2025, p. 15 / 66

Images