Microorganism to produce L-tryptophan and method to produce L-tryptophan using the same
Introducing pyruvate phosphate dikinase from Komagataeibacter xylinus into Corynebacterium microorganisms addresses the challenges of low phosphoenolpyruvate levels and high energy demands, resulting in enhanced L-tryptophan production capacity for industrial applications.
Patent Information
- Authority / Receiving Office
- BR · BR
- Patent Type
- Applications
- Current Assignee / Owner
- CJ CHEILJEDANG CORP
- Filing Date
- 2024-03-26
- Publication Date
- 2026-07-14
AI Technical Summary
Existing methods for L-tryptophan production in Corynebacterium microorganisms face challenges such as low phosphoenolpyruvate levels due to byproduct formation and high energy demands, leading to reduced production capacity.
Introduction of pyruvate phosphate dikinase derived from Komagataeibacter xylinus or its encoding polynucleotide into Corynebacterium microorganisms to enhance L-tryptophan production capacity.
The modified microorganisms exhibit increased L-tryptophan production yields, making them suitable for industrial-scale production.
Abstract
Description
1 / 73 Microorganism to produce L-tryptophan and method to produce L-tryptophan using the same Technical Field
[001] The present description refers to a microorganism of the genus Corynebacterium with an L-tryptophan production capacity, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced; a method for producing L-tryptophan, including culturing the microorganism in a medium; a composition for producing L-tryptophan, including the microorganism, a culture product of the microorganism, a fermented product of the microorganism or a combination of two or more thereof; and the use of the microorganism for the production of L-tryptophan. Fundamentals of the Technique
[002] A variety of studies on the production of target substances (e.g., amino acids) in microorganisms have been directed towards environmentally friendly and safe production methods, among which studies for the production of target substances in large quantities in microorganisms of the genus Corynebacterium have been continuously conducted. A microorganism of the genus Corynebacterium (Corynebacterium sp.), especially Corynebacterium glutamicum, is a gram-positive microorganism that is frequently used to produce L-amino acids and other useful substances. For the Petition 870250080732, dated 09 / 09 / 2025, page 19 / 98 2 / 73 production of L-amino acids and other useful substances, several studies for the development of microorganisms with high production efficiency and technologies for fermentation processes are underway.
[003] L-tryptophan, which is an essential amino acid, has been widely used as a raw material for pharmaceutical products, as food additives, infusion solutions, etc., and as a health food ingredient, etc. As such, L-tryptophan can be produced by a chemical synthesis method, an enzymatic reaction method, a fermentation method, etc., but the direct fermentation method using a microorganism is mainly used at present.
[004] Microorganisms have an aromatic biosynthetic pathway in which phosphoenolpyruvate (PEP), an intermediate in glycolysis, and erythrose-4-phosphate (E4P), a product of the pentose phosphate pathway, initiate polymerization by 3-deoxy-D-arabinoheptulosonate 7-phosphate (DAHP) synthase (EC 2.5.1.54) during L-tryptophan biosynthesis. According to previous studies, it has been demonstrated by intracellular quantitative analysis that the highest energy level is required for tryptophan biosynthesis among 20 amino acids (Proc. Natl. Acad. Sci. USA, (2002) V 99, pp. 3695-3700).
[005] Thus, in order to provide stable E4P, Petition 870250080732, dated 09 / 09 / 2025, page 20 / 98 3 / 73 The method of increasing biosynthesis by intensifying the expression of the tktA gene (NCBI gene ID: 12931960), which encodes transketolase (EC 2.2.1.1), has been studied (Current Opinion in Biotechnology, (2009) V20, pp. 651-658). In addition, studies on reducing the use of ATP, which is a high-energy substance, are underway in order to maintain intracellular energy levels (FEMS Microbiol Lett, (2009) V297, pp. 217-224).
[006] However, gluconeogenesis is generally known to have very low activity in nutrient-rich culture environments (J Bacteriol. Sept. 2013, 195(18), 4283–4296; Nature Communications volume 8, article number: 14316, 2017). Furthermore, there is a problem that the amount of phosphoenolpyruvate, a precursor of tryptophan, is decreased due to the production of byproducts such as acetic acid during the L-tryptophan production process, thus reducing L-tryptophan production.
[007] Therefore, research on effectively increasing L-tryptophan production capacity is still needed. DESCRIPTION TECHNICAL PROBLEM
[008] The present inventors confirmed that the production capacity of L-tryptophan was increased in the microorganism of the genus Corynebacterium, in which it is Petition 870250080732, dated 09 / 09 / 2025, page 21 / 98 4 / 73 introduced pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same, thus completing the present description. Technical Solution
[009] It is an objective of the present description to provide a microorganism of the genus Corynebacterium with the ability to produce L-tryptophan, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced.
[0010] In one embodiment, the pyruvate phosphate dikinase derived from Komagataeibacter xylinus may include an amino acid sequence of SEQ ID NO: 1
[0011] In another embodiment, the pyruvate phosphate dikinase derived from Komagataeibacter xylinus may be encoded by a ppdK gene.
[0012] As the microorganism according to any of the modalities described above, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.
[0013] As a microorganism according to any of the embodiments described above, the microorganism of the genus Corynebacterium may have an increased capacity for L-tryptophan production compared to an unmodified microorganism.
[0014] Another objective of the present description is to provide a method for the production of L-tryptophan, including carrying out Petition 870250080732, dated 09 / 09 / 2025, page 22 / 98 5 / 73 a culture of a microorganism of the genus Corynebacterium with the capacity to produce L-tryptophan, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced, in a medium
[0015] In one embodiment, the method may also include recovering L-tryptophan from the cultured microorganism, a culture product of the microorganism, a fermented product of the microorganism, or the culture medium.
[0016] It is yet another object of the present description to provide a composition for the production of L-tryptophan, including: a microorganism of the genus Corynebacterium with an L-tryptophan production capacity, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced; a culture product of the microorganism; a fermented product of the microorganism; or a combination of two or more of the same.
[0017] It is yet another objective of the present description to provide the use of a composition, which includes a microorganism of the genus Corynebacterium with an L-tryptophan production capacity, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced; a culture product of the microorganism; a fermented product of the microorganism; or Petition 870250080732, dated 09 / 09 / 2025, page 23 / 98 6 / 73 a combination of two or more of the same, for the production of L-tryptophan ADVANTAGEOUS EFFECTS
[0018] The microorganism of the genus Corynebacterium with an L-tryptophan production capacity, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced, provided in the present description, can produce L-tryptophan in high yields and therefore may be useful in the industrial production of L-tryptophan. DETAILED DESCRIPTION OF PREFERRED MODALITIES
[0019] The present description will be described in detail as follows. Meanwhile, each description and embodiment described in this document can be applied to other descriptions and embodiments, respectively. That is, all combinations of various elements described in this document fall within the scope of the present description. Furthermore, the scope of the present description is not limited by the specific description described below. In addition, a number of documents and patent documents have been cited throughout this descriptive report. The content of the cited documents and patent documents is incorporated into this document by reference in its entirety, and the level of technical field to which the present description belongs and the content of the present description will be described more clearly. Petition 870250080732, dated 09 / 09 / 2025, page 24 / 98 7 / 73 DEFINITIONS
[0020] As used in the descriptive report and attached claims, the singular forms *um* and *o / a* include plural referents, unless the context clearly indicates otherwise. Unless the context indicates otherwise, singular terms will include plural terms and plural terms will include singular terms. As used in the descriptive report and attached claims, unless indicated otherwise, the use of *ou* may be used to include *e* and / or.
[0021] As used in this document, the term "approximately" may be displayed before a particular numerical value. The term "approximately" as used in this document includes not only the exact number recited after the term, but also a range that is close to or near that number. Considering the context in which the number is presented, one can determine whether any number is close to or near the particular number presented. In one example, the term "approximately" may refer to a range of -10% to +10% of a numerical value. In another example, the term "approximately" may refer to a range of -5% to +5% of a given numerical value, but it is not limited to this.
[0022] As used in this document, descriptions, such as the terms first, second, third ... i), ii), iii) ... or (a), (b), (c), (d) ... Petition 870250080732, dated 09 / 09 / 2025, p. 25 / 98 8 / 73 can be used to distinguish similar constitutions. When the terms are used in reference to the steps of a method, use or assay, these terms do not mean that the steps are performed continuously or sequentially. For example, there may be no time interval between these steps, or they may be performed simultaneously, or they may be performed sequentially, randomly or in reverse order with several seconds, several minutes, several hours, several days or several months in between.
[0023] As used in this document, the term consisting of means that the total ratio of specific features, steps, ingredients, or other component(s) recited after the term is 100%. The features, steps, ingredients, or other component(s) that are recited after the term consisting of may be essential or mandatory. For example, in addition to the features, steps, ingredients, or other component(s) recited after the term consisting of, any other features, steps, ingredients, or other component(s), or non-essential features, steps, ingredients, or other component(s) may be excluded.
[0024] As used in this document, the term consisting essentially of may mean that when the characteristics, steps, ingredients or other(s) Petition 870250080732, dated 09 / 09 / 2025, page 26 / 98 9 / 73 The component(s) of the object claimed in this document are not substantially affected by the presence of one or more unspecified features, steps, ingredients or other component(s), one or more unspecified features, steps, ingredients or other component(s) may be present.
[0025] As used in this document, the term comprising / including means the presence of features, steps, ingredients or other component(s) recited after the term and does not exclude the presence or addition of one or more features, steps, ingredients or other component(s). The features, steps, ingredients or other components mentioned after the term comprising / including in this document may be essential or mandatory. However, in some embodiments, the term may also include any other non-essential features, steps, ingredients or other components. Proteins, Polypeptides
[0026] As used in this document, the term protein or polypeptide refers to a polymer or oligomer of consecutive amino acid residues. In this description, polypeptide, protein, and peptide may be used interchangeably.
[0027] In some cases, the term a sequence of Petition 870250080732, dated 09 / 09 / 2025, page 27 / 98 10 / 73 amino acids exhibiting activity can mean the polypeptide, protein, or peptide, and when the polypeptide, protein, peptide, or amino acid sequence exhibiting activity has catalytic activity, it can be referred to as an enzyme.
[0028] As used in this document, the term mature polypeptide or mature protein means a polypeptide or protein in a form without a signal sequence or propeptide sequence. A mature polypeptide or mature protein may be a functional form of a polypeptide or protein. Mature polypeptide or mature protein may refer to a polypeptide in a final form after translation; and / or post-translational modification. Examples of post-translational modification include N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, leader sequence removal, etc., but are not limited to these.
[0029] In the present description, unless otherwise indicated, amino acid sequences are described in an N-terminal to C-terminal direction.
[0030] With respect to amino acid sequences in the present description, although described as a polypeptide or protein comprising / including an amino acid sequence described by a specific sequence number, a polypeptide or protein consisting of an amino acid sequence described by a sequence number Petition 870250080732, dated 09 / 09 / 2025, page 28 / 98 11 / 73 specific, or a polypeptide or protein having an amino acid sequence described by a specific sequence number, it is evident that any polypeptide or protein having an amino acid sequence in which part(s) of the sequence(s) is / are deleted, modified, substituted, conservatively substituted or added may fall within the scope of this description if it has identical or corresponding activity to the polypeptide or protein consisting of the amino acid sequence of the corresponding sequence number. For example, polypeptides or proteins with sequence additions or deletions that do not alter the protein's function, naturally occurring mutations, silent mutations thereof, or conservative substitutions within, or upstream or downstream (N-terminal or C-terminal) of the polypeptide or protein sequences may be included, provided they have identical or corresponding activity to the activity of the polypeptide or protein.
[0031] For example, polypeptides or proteins that can be conjugated with a signal (or leader) sequence at the N-terminus involved in the translocation of proteins (polypeptides) co-translationally or post-translationally, or polypeptides or proteins that can be conjugated with another sequence or ligand to identify, purify, or synthesize the polypeptides or proteins may also be Petition 870250080732, dated 09 / 09 / 2025, page 29 / 98 12 / 73 within the scope of the polypeptide or protein amino acid sequence described by the specific number.
[0032] As used in this document, the term conservative substitution refers to the replacement of one amino acid by another amino acid with similar structural and / or chemical properties. Such amino acid substitution can generally occur based on the similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of a residue. Amino acids can be classified into the following groups:
[0033] In one example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; amino acids with polar or hydrophilic side chains (polar amino acids) include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In another example, amino acids with electrically charged side chains (electrically charged amino acids) include arginine, lysine, histidine, glutamic acid, and aspartate; and amino acids with uncharged side chains (uncharged amino acids; also referred to as neutral amino acids) include glycine, Petition 870250080732, dated 09 / 09 / 2025, page 30 / 98 13 / 73 alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In yet another example, aromatic amino acids include phenylalanine, tryptophan, and tyrosine. In yet another example, branched-chain amino acids include valine, leucine, and isoleucine. In yet another example, the 20 amino acids can be classified according to their size into 5 groups, starting with the groups of amino acids with a relatively small volume, that is, glycine, alanine, serine; cysteine, proline, threonine, aspartate, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine, but the classification of amino acids is not limited to these. Typically, conservative substitutions may have little or no effect on the activity of the polypeptide or protein. Gene, Polynucleotide
[0034] As used in this document, the term gene means a polynucleotide encoding a functional molecule and a polynucleotide including the upstream and downstream regions of the polynucleotide, or a functional RNA. In some embodiments, a gene may have a sequence (intron) inserted between each coding region (exon).
[0035] As used in this document, the term Petition 870250080732, dated 09 / 09 / 2025, page 31 / 98 14 / 73 A polynucleotide, nucleic acid, or nucleic acid molecule, which is a polymer of nucleotides composed of nucleotide monomers connected in a long chain by a covalent bond, is a strand of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) of at least a certain length. In the present description, polynucleotide, nucleic acid, or nucleic acid molecule may be used interchangeably. Identity, Homology
[0036] As used in this document, the term identity or homology refers to the degree of relatedness between two given amino acid sequences or nucleotide sequences and can be expressed as a percentage. The terms homology and identity can often be used interchangeably with each other.
[0037] Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms and can be used in conjunction with a standard gap penalty established by the program being used.
[0038] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined by a known computer algorithm, such as the FASTA program, using standard parameters as in Pearson et al. (1988) Proc. Natl. Acad. Sci. Petition 870250080732, dated 09 / 09 / 2025, page 32 / 98 15 / 73 USA 85:2444. Alternatively, it can be determined by the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), which is performed using the Needleman program from the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or later) (GCG program package (Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF et al., J MOLEC BIOL 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and CARILLO et al. (1988) SIAM J Applied Math 48:1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information.
[0039] Furthermore, whether any two polynucleotide sequences have homology, similarity, or identity can be determined by comparing sequences through Southern hybridization experiments under defined strict conditions, and the appropriate hybridization conditions to be defined can be determined by means of a method within the scope of the present description, which is known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but is not limited to thereto. Petition 870250080732, dated 09 / 09 / 2025, p. 33 / 98 16 / 73 Substantially, homologous or identical polynucleotide sequences are expected to hybridize with all, or at least about 50%, 60%, 70%, 80%, or 90% of the entire length of the sequences under stringent conditions.
[0040] As used in this document, stringent conditions refer to conditions that allow specific hybridization between polynucleotides. Such conditions are described in detail in the literature (see, Sambrook et al., supra, 9.50-9.51, 11.7-11.8).For example, stringent conditions may include conditions under which polynucleotides with high homology or identity, that is, polynucleotides with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, while polynucleotides with lower homology or identity than above do not hybridize with each other; or they may include common Southern hybridization washing conditions, i.e., washing once, specifically two or three times, at a salt concentration and temperature corresponding to 60 °C, 1*SSC, 0.1% SDS, specifically 60 °C, 0.1*SSC, 0.1% SDS and, more specifically, 68 °C, 0.1*SSC, 0.1% SDS.
[0041] Hybridization requires that two nucleotides have complementary sequences, although base mismatches are possible depending on the rigor of Petition 870250080732, dated 09 / 09 / 2025, p. 34 / 98 17 / 73 Hybridization. The term complementary is used to describe a relationship between nucleotide bases that can hybridize with each other. For example, in relation to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Therefore, the present description may also include an isolated nucleic acid fragment complementary to the entire sequence, as well as a base sequence substantially similar to it.
[0042] For example, polynucleotides with homology or identity to the polynucleotide of the present description can be detected using hybridization conditions including a hybridization step at a Tm value of 55 °C under the conditions described above. Furthermore, the Tm value can be 60 °C, 63 °C, or 65 °C, but is not limited to these, and can be appropriately adjusted by those skilled in the art, depending on the purpose thereof.
[0043] The appropriate rigor for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, and these variables are well known in the art (e.g., Sambrook et al., supra). Nucleic Acid Construct, Vector, Transformation
[0044] As used in this document, the term nucleic acid construct refers to a single- or double-stranded nucleic acid molecule that includes one or Petition 870250080732, dated 09 / 09 / 2025, p. 35 / 98 18 / 73 more regulatory sequences and that is artificially synthesized or engineered to include a specific sequence in a way that does not exist in nature or is isolated from nature.
[0045] As used in this document, the term vector refers to a DNA construct for delivering a target polynucleotide into a suitable host cell or host. In one example, the vector may contain the nucleotide sequence of a polynucleotide encoding the target polypeptide operationally linked to a suitable expression regulatory region (expression regulatory sequence) so as to be able to express the target polypeptide in a suitable host cell, but is not limited to this.
[0046] The expression regulatory region may include a promoter capable of initiating transcription, any operator sequence to regulate transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence to regulate transcription and translation termination. Once transformed into a suitable host cell (microorganism), the vector may replicate or function independently of the host genome, or it may integrate into the host genome.
[0047] The vector used in this description is not particularly limited and any known vector in Petition 870250080732, dated 09 / 09 / 2025, page 36 / 98 The 19 / 73 technique can be used. Examples of vectors typically used may include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, as a phage vector or cosmid vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc. can be used; and as a plasmid vector, those based on pDZ, pDC, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, and pET, etc. can be used. In one example, pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector, etc. can be used.
[0048] In one example, a target polynucleotide can be inserted into the chromosome via a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome can be performed by any method known in the art, for example, by homologous recombination, but is not limited to this. The vector may also include a selection marker to confirm insertion into the chromosome. The selection marker is to select the cells transformed with the vector, that is, to confirm the insertion of the target polynucleotide, and markers that provide selectable phenotypes, such as drug resistance, auxotrophy, resistance to cellular toxic agents, or expression of surface polypeptides, can be used. Only cells expressing the selection marker are able to survive or show different phenotypes under the environment. Petition 870250080732, dated 09 / 09 / 2025, page 37 / 98 20 / 73 treated with the selective agent, and thus the transformed cells can be selected.
[0049] As used in this document, the term transformation refers to the introduction of a vector containing a target polynucleotide into a host cell (microorganism) to alter the genetic characteristics of the host cell (microorganism). The transformed polynucleotide may be integrated into the host cell's (microorganism's) chromosome and located there or located extrachromosomally. Furthermore, the polynucleotide may include DNA and / or RNA. The polynucleotide may be introduced in a suitable form depending on the purpose of the introduction. For example, the polynucleotide to express the target polypeptide may be introduced into the host cell (microorganism) in the form of an expression cassette, which is a gene construct including all the elements necessary for its autonomous expression.The expression cassette may commonly include a promoter operationally linked to the polynucleotide, a transcription terminator, a ribosome binding site, or a translation terminator. The expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a host cell (microorganism) as is and operationally linked to sequences necessary for expression in the cell. Petition 870250080732, dated 09 / 09 / 2025, page 38 / 98 21 / 73 host, but it is not limited to that.
[0050] As used in this document, the term operationally linked refers to a constitution of placing a regulatory sequence in an appropriate position to regulate the expression of a coding sequence. Thus, the term operationally linked includes a linkage or connection between a regulatory region of a functional domain with a known or desired activity, such as a promoter, a stop codon, a signal sequence, or an enhancer, and a target (gene or polypeptide) so that the expression, secretion, or function of the target can be regulated according to the known or desired activity. For example, it may mean that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates the transcription of the polynucleotide encoding the target polypeptide.
[0051] As used in this document, the term expression includes any step involved in the production of a polypeptide, for example, transcription, post-transcriptional modification, translation, post-translational modification and secretion, etc., but is not limited to these.
[0052] As used in this document, the term expression vector refers to a linear or circular nucleic acid molecule including a target polynucleotide sequence and a regulatory sequence. Petition 870250080732, dated 09 / 09 / 2025, page 39 / 98 22 / 73 operationally linked for expression thereof. For example, it may contain the nucleotide sequence of a polynucleotide encoding the target polypeptide operationally linked to a suitable expression regulatory region (expression regulatory sequence) so as to be able to express the target polypeptide in a suitable host cell.
[0053] As used in this document, the term regulatory sequence refers to a polynucleotide sequence required for the expression of a target polynucleotide sequence. Each regulatory sequence may be native (derived from the same origin) or foreign (derived from different genes) to the coding sequence, or it may be a mutant sequence of the same or other artificial sequences. Examples of regulatory sequences may include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence to regulate transcription and translation termination. The smallest units of the regulatory sequence may include a promoter and a sequence to terminate transcription and translation.
[0054] As used in this document, the term genetic recombination refers to a natural process or Petition 870250080732, dated 09 / 09 / 2025, p. 40 / 98 23 / 73 artificial in which the elements that constitute genes, such as DNA or RNA, are altered from their original sequence during disassembly and reassembly.
[0055] As used in this document, the term recombinant gene refers to a gene with a new genomic constitution that develops as a result of genetic recombination, for example, chemical synthesis or genetic engineering technology, etc. As used in this document, the terms recombinant gene, recombinant DNA, and recombinant polynucleotide may be used interchangeably. In one example, a recombinant gene may include an artificial combination of nucleic acid fragments, such as regulatory sequences, that are not found in nature.
[0056] As used in this document, the term recombinant protein refers to a protein produced as a result of genetic recombination. Microorganism
[0057] As used in this document, the term microorganism (or strain) includes all wild-type microorganisms, or prokaryotic or eukaryotic microorganisms in which natural or artificial genetic modifications occur, and may be a microorganism in which a particular mechanism is weakened or enhanced due to the insertion of a foreign gene, or enhancement or Petition 870250080732, dated 09 / 09 / 2025, page 41 / 98 24 / 73 inactivation of the activity of an endogenous gene, etc., and may be a microorganism including genetic modification to produce a desired polypeptide, protein, or product. In the present description, microorganism, strain, host, and host cell may be used interchangeably.
[0058] As used in this document, the term recombinant microorganism refers to a microorganism that has been genetically modified and exhibits a different genotype and / or phenotype compared to a naturally occurring microorganism (for example, when genetic modifications have an effect on a coding nucleic acid sequence of a microorganism) and may include progeny or all potential progeny of the microorganism. As used in this document, the terms recombinant microorganism, genetically modified microorganism, recombinant host cell, recombinant cell, and recombinant strain may be used interchangeably. The recombinant microorganism, for example, may express genes that are not found in the native (non-recombinant) form, or may not express genes that are expressed in its native form, or may express native genes in a manner different from that expressed in its native form.
[0059] For example, the microorganism in the present description may be a microorganism (for example, Petition 870250080732, dated 09 / 09 / 2025, page 42 / 98 25 / 73 recombinant microorganism) into which pyruvate phosphate dikinase or a polynucleotide encoding the same is introduced, but is not limited to this.
[0060] As used in this document, the term microorganism with an L-tryptophan-producing capacity, which is a microorganism capable of producing L-tryptophan in an organism, may include all transmitted microorganisms with an L-tryptophan-producing capacity that do not endogenously have an L-tryptophan-producing capacity, or microorganisms that endogenously have an L-tryptophan-producing capacity. The L-tryptophan-producing capacity may be transmitted or enhanced by species improvement.
[0061] As used in this document, the term unmodified microorganism (strain) does not exclude a microorganism (strain) containing a mutation that may occur naturally and may refer to a wild-type microorganism (strain) or natural-type microorganism (strain) itself, or a microorganism (strain) before its trait is altered due to genetic modification caused by natural or artificial factors. As used in this document, unmodified microorganism (strain) may be used interchangeably with microorganism (strain) before modification, non-mutant microorganism (strain), origin microorganism, origin strain, microorganism Petition 870250080732, dated 09 / 09 / 2025, page 43 / 98 26 / 73 wild-type (strain), reference microorganism (strain), or standard microorganism (strain). In the present description, the term may refer to a microorganism (strain) into which pyruvate phosphate dikinase or a polynucleotide encoding the same is not introduced, or a microorganism (strain) prior to the introduction thereof, but is not limited to this. Furthermore, the unmodified microorganism in the present description may be a microorganism that does not include the polypeptide composed of SEQ ID NO: 1 or the polynucleotide composed of SEQ ID NO: 2, but is not limited to this. Increased Protein (Polypeptide) Activity
[0062] As used in this document, the term protein (polypeptide) activity enhancement means that the activity of a protein (polypeptide) is increased in a host cell (microorganism) compared to its endogenous activity. Enhancement can be used interchangeably with terms such as activation, upregulation, overexpression, enhancement, etc. The host cell (microorganism) can be a prokaryotic or eukaryotic microorganism.
[0063] Increased protein (polypeptide) activity can include both cases where a protein (polypeptide) activity not endogenously possessed by a host cell (microorganism) is Petition 870250080732, dated 09 / 09 / 2025, page 44 / 98 27 / 73 displayed, or a protein (polypeptide) activity is enhanced compared to endogenous activity or activity before modification.
[0064] For example, the description exhibiting a protein (polypeptide) activity not endogenously possessed or exhibiting enhanced protein (polypeptide) activity may be caused by the introduction of a protein (polypeptide), but is not limited to it.
[0065] As used in this document, the term protein (polypeptide) introduction means that a gene not originally possessed by a microorganism is expressed in the microorganism and thus the microorganism exhibits the activity of a particular protein, or the activity of a polypeptide is intensified, increased, or improved compared to the endogenous activity of the corresponding protein or the activity before the modification. For example, it can be caused by the introduction of a gene encoding the protein (polypeptide) into a host cell (microorganism). For example, it could be a case where a polynucleotide encoding a particular protein (polypeptide) is introduced into the chromosome of a host cell (microorganism), or a vector containing a polynucleotide encoding a particular protein (polypeptide) is introduced into a host cell (microorganism), thus exhibiting its activity or Petition 870250080732, dated 09 / 09 / 2025, page 45 / 98 28 / 73 improving activity.
[0066] Endogenous activity refers to the activity of a particular protein (polypeptide) originally possessed by a host cell (microorganism) before transformation or an unmodified host cell (microorganism) when a trait is altered by genetic variation due to a natural or artificial factor. Endogenous activity can also be used interchangeably with activity before modification.
[0067] Increased activity of a protein (polypeptide) compared to endogenous activity means that the activity and / or concentration (expression level) of the protein (polypeptide) in a host cell (microorganism) is improved, compared to the activity and / or concentration (expression level) of the polypeptide originally possessed by a host cell (microorganism) before transformation or an unmodified host cell (microorganism).
[0068] In one example, the increase may mean that the activity of a corresponding protein (polypeptide) not originally displayed is displayed, or the activity or concentration thereof is increased generally by about 1% or more, about 10% or more, about 25% or more, about 50% or more, about 75% or more, about 100% or more, about 150% or more, about 200% or more, about 300% Petition 870250080732, dated 09 / 09 / 2025, p. 46 / 98 29 / 73 or more, about 400% or more, or about 500% or more, maximum about 1,000% or about 2,000% or more, based on the activity or concentration of a host cell (microorganism) before transformation or an unmodified host cell (microorganism), but not limited to that.
[0069] The intensification of protein (polypeptide) activity can be achieved by introducing a foreign protein (polypeptide) or by increasing the activity of an endogenous protein (polypeptide). Whether or not the protein (polypeptide) activity is intensified can be confirmed from the activity level of the corresponding protein (polypeptide), its expression level, or the increase in the amount of products produced from the corresponding protein (polypeptide).
[0070] Enhancement of protein (polypeptide) activity can be achieved by several well-known methods in the art and is not limited, provided that it can enhance the activity of a target protein (polypeptide) compared to that of a host cell (microorganism) before modification. Specifically, genetic engineering and / or protein engineering, well-known to those skilled in the art, which is a common method in molecular biology, can be used, but the method is not limited to them (e.g., Sitnicka et al. Functional Analysis of Genes). Petition 870250080732, dated 09 / 09 / 2025, page 47 / 98 30 / 73 Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0071] Specifically, the enhancement of the protein (polypeptide) of the present description can be achieved by: a. increase the number of intracellular copies of a polynucleotide that codes for the protein (polypeptide); b. modify the expression regulatory region of a gene that codes for the protein (polypeptide) on the chromosome (for example, inducing a modification within the expression regulatory region, replacing it with a sequence with stronger activity or inserting a sequence with stronger activity); c. modify the nucleotide sequence that codes for the initiation codon or 5'-UTR of the gene transcript that codes for the protein (polypeptide); d. modify the amino acid sequence of the protein (polypeptide) so that the activity of the protein (polypeptide) is enhanced; e. modify the polynucleotide sequence that codes for the protein (polypeptide) so that the activity of the protein (polypeptide) is enhanced (for example, modifying the polynucleotide sequence of the coding gene to encode a protein (polypeptide) that has been modified to enhance the activity of the protein (polypeptide)); f. introduce a foreign protein (polypeptide) Petition 870250080732, dated 09 / 09 / 2025, page 48 / 98 31 / 73 displaying the activity of the protein (polypeptide) or a foreign polynucleotide that encodes the same; g. codon optimization of a polynucleotide that codes for the protein (polypeptide); h. analyze the tertiary structure of the protein (polypeptide) and, in this way, select and modify the exposed site, or chemically modify it; or i. a combination of two or more selected from above 1 to 8), but is not particularly limited to them.
[0072] For example, method 1) to increase the number of intracellular copies of a protein-coding polynucleotide (polypeptide) can be achieved by introducing a vector containing a protein-coding polynucleotide (polypeptide), which is operationally linked to a suitable regulatory sequence, into a host cell (microorganism). Alternatively, the method can be achieved by introducing one or two or more copies of protein-coding polynucleotides (polypeptide), which are operationally linked to a suitable regulatory sequence, into the chromosome of the host cell (microorganism). The introduction into the chromosome can be accomplished by introducing a vector, which is capable of inserting the polynucleotide into the host cell's (microorganism's) chromosome, into the host cell (microorganism), but is not limited to this. The vector is as described above. A Petition 870250080732, dated 09 / 09 / 2025, page 49 / 98 32 / 73 The regulatory sequence can be native (derived from the same origin) or foreign (derived from different genes) to the coding polynucleotide sequences, or it can be a mutant sequence of the same or other artificial sequences, and it can induce the expression of the polynucleotide in the host cell (microorganism).
[0073] Method 2) of replacing the expression regulatory region (or expression regulatory sequence) of a protein-coding (polypeptide) gene on the chromosome with a sequence with strong activity can be achieved, for example, by inducing a modification in the sequence through deletion, insertion, substitution, or a combination thereof to further enhance the activity of the expression regulatory region, or by replacing the sequence with a sequence with stronger activity. The expression regulatory region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating transcription and translation termination, etc. In one example, the method may include replacing the original promoter with a strong promoter, but is not limited to it.
[0074] Examples of known strong promoters may include promoters cj1 to cj7 (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, PR promoter Petition 870250080732, dated 09 / 09 / 2025, page 50 / 98 33 / 73 lambda phage, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US 10584338 B2), O2 promoter (US 10273491 B2), tkt promoter, yccA promoter, etc., but the strong promoter is not limited to these.
[0075] Method 3) of modifying the nucleotide sequence that codes for the initiation codon or 5'-UTR of the gene that codes for the protein (polypeptide) can be achieved, for example, by modifying the nucleotide sequence to code for another initiation codon with a higher rate of protein (polypeptide) expression compared to the endogenous initiation codon, or an RBS (ribosome binding site) sequence with a higher rate of protein (polypeptide) expression compared to the endogenous RBS sequence, but is not limited to it.
[0076] Methods 4) and 5) of modifying the amino acid sequence or the polynucleotide sequence of the protein (polypeptide) can be achieved by inducing a sequence modification through deletion, insertion, or substitution of the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence that codes for the protein (polypeptide), or a combination thereof to enhance the activity of the protein (polypeptide), or by replacing the sequence with a modified amino acid sequence or polynucleotide sequence to increase activity, but not limited to that. Substitution can Petition 870250080732, dated 09 / 09 / 2025, page 51 / 98 34 / 73 can, for example, be performed by inserting the polynucleotide into the chromosome by homologous recombination, but it is not limited to that.
[0077] Method 6) of introducing a foreign polynucleotide that exhibits protein (polypeptide) activity can be achieved by introducing into a host cell (microorganism) a foreign polynucleotide that codes for a protein (polypeptide) that exhibits the same / similar activity to the protein (polypeptide). The foreign polynucleotide can be used without limitation, regardless of its origin or sequence, as long as it exhibits the same / similar activity to the protein (polypeptide). The introduction can be performed by those skilled in the art by appropriately selecting a transformation method known in the art, and the expression of the introduced polynucleotide in the host cell allows the production of the protein (polypeptide), thus increasing its activity.
[0078] Method 7) of codon optimization of the protein-coding polynucleotide (polypeptide) can be achieved by codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell (microorganism), or by optimizing the codons of the same, so that optimized transcription and translation of the foreign polynucleotide can be achieved. Petition 870250080732, dated 09 / 09 / 2025, page 52 / 98 35 / 73 inside the host cell (microorganism).
[0079] Method 8) for analyzing the tertiary structure of the protein (polypeptide) and thus selecting and modifying the exposed site, or chemically modifying it, can be achieved, for example, by comparing the sequence information of the protein (polypeptide) to be analyzed with a database in which sequence information of known proteins is stored, to determine model protein candidates according to the degree of sequence similarity and thus confirm the structure based on the information, thus selecting and transforming or modifying the exposed site to be modified or chemically modified.
[0080] Such an increase in protein (polypeptide) activity may mean that the activity or concentration of the corresponding protein (polypeptide) is increased relative to the activity or concentration of a protein (polypeptide) expressed in a wild type or a host cell (microorganism) before modification, or that the amount of products produced from the corresponding protein (polypeptide) is increased, but is not limited to that.
[0081] Modification of part or all of the polynucleotide in the microorganism of the present description can be achieved by (a) homologous recombination through a Petition 870250080732, dated 09 / 09 / 2025, page 53 / 98 36 / 73 vector for chromosome insertion into the microorganism or genome editing using a chemically engineered nuclease (e.g., CRISPR-Cas9) and / or (b) being induced by light, such as ultraviolet rays and radiation, etc. and / or chemical treatments, but not limited to these. Cultivation
[0082] As used in this document, the term cultivation means that microorganisms are grown under suitably controlled environmental conditions. The cultivation process may be carried out in a suitable culture medium and under culture conditions known in the art. Such a cultivation process may be easily adjusted for use by those skilled in the art according to the strain to be selected. Specifically, the cultivation may be a batch culture, a continuous culture and / or a fed-batch culture, but is not limited to these.
[0083] As used in this document, the term medium refers to a mixture of materials that contains nutrients necessary for the cultivation of microorganisms as the main ingredient and provides nutrients and growth factors, along with water which is essential for survival and growth. Specifically, the medium and other culture conditions used to carry out the culture of the microorganism described herein may be any medium used for cultivation. Petition 870250080732, dated 09 / 09 / 2025, page 54 / 98 37 / 73 conventional culture of microorganisms without any particular limitation. For example, the microorganism of the present description can be cultured under aerobic conditions in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compounds, amino acids and / or vitamins, etc., while adjusting the temperature, pH, etc. For example, the culture medium for microorganisms of the genus Corynebacterium can be found in the literature [“Manual of Methods for General Bacteriology by the American Society for Bacteriology (Washington DC, USA, 1981)].
[0084] In the present description, the carbon source may include carbohydrates such as glucose, sucrose, lactose, fructose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, the carbon source may include natural organic nutrients such as starch hydrolysate, molasses, black molasses, rice bran, cassava, sugarcane molasses, and corn liquor, etc. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted to reducing sugar) may be used, and in addition, various other carbon sources in an appropriate amount may be used without limitation. These sources of Petition 870250080732, dated 09 / 09 / 2025, page 55 / 98 38 / 73 carbon can be used alone or in a combination of two or more types, but is not limited to them.
[0085] Nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in a combination of two or more types, but are not limited to them.
[0086] The phosphorus source may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts, etc. Examples of inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or appropriate precursors, etc., may be included. These constituent ingredients or precursors may be added to a medium in batch or continuous form, but these phosphorus sources are not limited to these.
[0087] In addition, the pH of the medium can be adjusted by Petition 870250080732, dated 09 / 09 / 2025, page 56 / 98 39 / 73 addition of a compound, such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. during the cultivation of the microorganism of the present description in an appropriate manner. Furthermore, bubble formation can be avoided during cultivation by using an antifoaming agent, such as fatty acid polyglycol ester. Additionally, oxygen gas or a gas containing oxygen can be injected into the medium in order to maintain aerobic conditions of the medium; or nitrogen gas, hydrogen gas, or carbon dioxide can be injected to maintain anaerobic or microaerobic conditions without gas injection, but the gas is not limited to these.
[0088] The temperature during cultivation as described herein may be in the range of 20 °C to 45 °C, specifically 25 °C to 40 °C, and cultivation may be continued for 10 hours to 160 hours, but is not limited to this.
[0089] As used in this document, the term culture product means a culture solution, a concentrated culture solution, a dry product of a culture solution, a culture filtrate, a concentrated culture filtrate or a dry product of a culture filtrate obtained by culturing a specific microorganism in a culture medium and means that the culture solution may include the specific microorganism while the filtrate of Petition 870250080732, dated 09 / 09 / 2025, page 57 / 98 40 / 73 culture does not substantially include the specific microorganism (in particular, it means substantially excluding a specific microorganism isolated by filtration, etc., but does not mean that the microorganism is completely excluded from the filtrate). The formulation of the culture product is not limited and may be, for example, a liquid, emulsion or solid.
[0090] As used in this document, the term fermentation means that microorganisms are not putrefactive during the process of decomposing organic matter using their own enzymes. The fermentation reaction and the decay reaction proceed by similar processes, but when decomposition produces useful substances, it is called fermentation, and when odorous or harmful substances are produced, it is called decay.
[0091] In the present description, the method for obtaining a fermented product from the microorganism is not particularly limited and can be obtained according to a method commonly used in the art or similar fields.
[0092] As used in this document, the term fermented product may include not only the fermented material itself, but also all types of materials, including fermented products produced from the microorganism, such as a material including the Petition 870250080732, dated 09 / 09 / 2025, page 58 / 98 41 / 73 fermented microorganism; a fermented product produced from the fermented microorganism; a fermented product of a culture product; a concentrated fermented product; a dried product of the fermented product, a filtrate of the fermented product; a concentrated filtrate of the fermented product, a dried product of the filtrate of the fermented product, an extract of the fermented product or a diluted solution of the fermented product, etc. Detailed Description of the Present Description
[0093] From now on, the modalities of this description will be described in detail as follows:
[0094] One aspect of the present description provides a microorganism of the genus Corynebacterium with an L-tryptophan production capability, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced.
[0095] As used in this document, the term pyruvate phosphate dikinase (PPDK) refers to an enzyme in the transferase family that catalyzes the reaction [ATP + pyruvate + phosphate → phosphoenolpyruvate (PEP) + diphosphate]. The pyruvate phosphate dikinase of the present description may be used interchangeably with PPDK. Specifically, the pyruvate phosphate dikinase of the present description may be a protein with pyruvate phosphate dikinase activity encoded by the ppdk gene, but its type is not Petition 870250080732, dated 09 / 09 / 2025, page 59 / 98 42 / 73 particularly limited, provided the protein has activity corresponding to pyruvate phosphate dikinase activity. The pyruvate phosphate dikinase encoded by the ppdk gene is known in the art, and the amino acid and polynucleotide sequences of pyruvate phosphate dikinase can be obtained from a known database, NCBI GenBank, etc., but is not limited to these.
[0096] In one example, pyruvate phosphate dikinase derived from Komagataeibacter xylinus may include the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence with 60% or more homology or identity with this, but is not limited as long as it has pyruvate phosphate dikinase activity. Specifically, any protein with the amino acid sequence of SEQ ID NO: 1, in which part of the sequence is deleted, modified, substituted, or added, may fall within the scope of pyruvate phosphate dikinase, provided it exhibits efficacy corresponding to that of pyruvate phosphate dikinase.Furthermore, any protein that has or includes an amino acid sequence with at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 1, consists of the above amino acid sequence, or consists essentially of the above amino acid sequence, and exhibits an efficacy corresponding to that of pyruvate phosphate dikinase may fall within the scope of pyruvate phosphate dikinase. Petition 870250080732, dated 09 / 09 / 2025, p. 60 / 98 43 / 73
[0097] Furthermore, the polynucleotide sequences encoding pyruvate phosphate dikinase derived from Komagataeibacter xylinus with the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence with 60% or more homology or identity can be obtained, for example, based on codon information known in the art. In one example, pyruvate phosphate dikinase may be encoded by a polynucleotide that may have or include the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the nucleotide sequence of SEQ ID NO: 2, consists of the above nucleotide sequence, or consists essentially of the above nucleotide sequence but is not limited to it.In addition, the nucleotide sequence of SEQ ID NO: 2 can be obtained from a known database, such as NCBI's GenBank, etc., but is not limited to these.
[0098] In the present description, the polynucleotide (gene) including the nucleotide sequence of SEQ ID NO: 2 may be used interchangeably with the polynucleotide (gene) possessing the nucleotide sequence of SEQ ID NO: 2, the polynucleotide (gene) consisting of the nucleotide sequence of SEQ ID NO: 2, or ppdk.
[0099] The polynucleotide described herein may Petition 870250080732, dated 09 / 09 / 2025, page 61 / 98 44 / 73 undergoes several modifications in the coding region without altering the amino acid sequence of the pyruvate phosphate dikinase of the present description, due to codon degeneracy or in consideration of preferred codons in an organism in which the pyruvate phosphate dikinase of the present description is to be expressed. Therefore, based on codon degeneracy, it is evident that polynucleotides that can be translated into polypeptides consisting of the amino acid sequence of the pyruvate phosphate dikinase of the present description or polypeptides with homology or identity with these can also be included. For example, the polynucleotide of the present description could be SEQ ID NO: 2, or a degenerate sequence thereof.
[00100] In another example, the polynucleotide of the present description may have or include a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with SEQ ID NO: 2, or may consist of or consist essentially of including a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with SEQ ID NO: 2, but is not limited to this.
[00101] Additionally, the polynucleotide of the present Petition 870250080732, dated 09 / 09 / 2025, page 62 / 98 45 / 73 description may include a probe that can be prepared from a known genetic sequence, for example, any sequence that can hybridize with a sequence complementary to all or part of the polynucleotide sequence of the present description under stringent conditions to encode the pyruvate phosphate dikinase of the present description without limitation.
[00102] For the purposes of this description, the microorganism described herein may include all microorganisms capable of producing the desired L-tryptophan by introducing pyruvate phosphate dikinase or a polynucleotide encoding the same. For example, the microorganism described herein is distinguished by the introduction of pyruvate phosphate dikinase activity, thereby increasing the capacity for L-tryptophan production, and may be a genetically modified microorganism or a recombinant microorganism, but is not limited to these. Specifically, the recombinant strain with an increased capacity for L-tryptophan production may be a microorganism with an increased capacity for L-tryptophan production compared to a wild-type natural microorganism, or an unmodified microorganism with endogenous pyruvate phosphate dikinase activity or without endogenous pyruvate phosphate dikinase activity, but is not limited to these.
[00103] In one example, the microorganism with a Petition 870250080732, dated 09 / 09 / 2025, page 63 / 98 46 / 73 L-tryptophan production capacity, which is a prokaryotic or eukaryotic microbial strain capable of producing L-tryptophan in an organism, may include all microorganisms that endogenously have an L-tryptophan production capacity, or microorganisms in which an L-tryptophan production capacity has been transmitted to a parental strain without L-tryptophan production capacity by the pyruvate phosphate dikinase activity introduced in the present description. The L-tryptophan production capacity may be transmitted or enhanced by species improvement.
[00104] The microorganism of the present description may include all microorganisms into which pyruvate phosphate dikinase or a polynucleotide encoding the same is introduced by various known methods.
[00105] In one example, the recombinant microorganism with an L-tryptophan production capacity may include all microorganisms that can be transformed via a vector and thus capable of producing L-tryptophan through the introduction of a foreign gene encoding pyruvate phosphate dikinase of the present description, specifically, a foreign gene encoding phosphate dikinase derived from Komagataeibacter xylinus.
[00106] For example, the microorganism for the production of L-tryptophan can be a microorganism in which it is Petition 870250080732, dated 09 / 09 / 2025, p. 64 / 98 47 / 73 introduced a polynucleotide sequence encoding a protein including the amino acid sequence of SEQ ID NO: 1, or a protein including an amino acid sequence with at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more homology or identity with SEQ ID NO: 1.
[00107] For example, the microorganism to produce Ltryptophan may be a microorganism into which a polynucleotide capable of encoding a protein is introduced including an amino acid sequence with at least 80% homology with the amino acid sequence of SEQ ID NO: 1; or a polynucleotide including a nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the nucleotide sequence of SEQ ID NO: 2.
[00108] In one example, the microorganism with an increased L-tryptophan production capacity of the present description may be a microorganism with an increased L-tryptophan production capacity compared to, but is not limited to, an unmodified microorganism. In one example, the unmodified microorganism that is the target strain for comparing the increase in L-tryptophan production capacity may be, but is not limited to, the CM05-9157 strain. Petition 870250080732, dated 09 / 09 / 2025, page 65 / 98 48 / 73 to this.
[00109] In one example, the microorganism with an increased L-tryptophan production capacity may have an increased L-tryptophan production capacity of about 1% or more, specifically, about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 15% or more, about 16% or more, about 17% or more, or about 18% or more (the upper limit is not particularly restricted, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, or about 20% or less), compared to the L-tryptophan production capacity of a parent microorganism (parental strain) before modification or of an unmodified microorganism, but not limited to that,provided that it has an increased value compared to the production capacity of a parent microorganism (parental strain) before modification or of an unmodified microorganism. In another example, the microorganism with an increased L-tryptophan production capacity may have an increased L-tryptophan production capacity of approximately 1.1 times or more, approximately 1.15 times or more, approximately 1.16 times or more, approximately 1.17 times or more, Petition 870250080732, dated 09 / 09 / 2025, page 66 / 98 49 / 73 more, or about 1.18 times or more (the upper limit is not particularly restricted, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, about 1.4 times or less, about 1.3 times or less, or about 1.2 times or less), compared to that of a parent microorganism (parental strain) before modification or an unmodified microorganism, but not limited to that.
[00110] In one example, the microorganism with the ability to produce L-tryptophan can be a prokaryotic cell or a eukaryotic cell, but it can specifically be a prokaryotic cell. The prokaryotic cell can include, for example, a microorganism belonging to the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium, the genus Pseudomonas, the genus Leptospira, the genus Salmonella, the genus Brevibacteria, the genus Hypomononas, the genus Chromobacterium, the genus Norcardia, or fungi or yeasts, but is not limited to these. Specifically, it can be a microorganism belonging to the genus Escherichia, the genus Corynebacterium, the genus Leptospira, and yeasts. More specifically, it can be a microorganism belonging to the genus Corynebacterium. Petition 870250080732, dated 09 / 09 / 2025, page 67 / 98 50 / 73
[00111] As the microorganism according to any of the embodiments described above, the microorganism of the present description may be a microorganism of the genus Corynebacterium.
[00112] In an example, the microorganism of the present description may be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens.
[00113] Specifically, the microorganism described herein may be a microorganism of the genus Corynebacterium, more specifically, Corynebacterium glutamicum, but is not limited to this.
[00114] Meanwhile, the microorganism of the genus Corynebacterium with an L-tryptophan production capacity of the present description may include all of the following: a naturally occurring wild-type microorganism itself; a microorganism of the genus Corynebacterium in which the activity of a gene associated with the L-tryptophan production mechanism is increased or decreased, thus having an enhanced L-tryptophan production capacity; or a Petition 870250080732, dated 09 / 09 / 2025, pages 68 / 98 51 / 73 microorganism of the genus Corynebacterium in which the activity of a foreign gene is introduced or increased, thus having an enhanced capacity for L-tryptophan production.
[00115] Another aspect of the present description provides a method for the production of L-tryptophan, including culturing microorganisms of the genus Corynebacterium with an L-tryptophan-producing capacity, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced into a medium.
[00116] In the method described herein, the microorganism can be cultivated using any culture conditions and cultivation methods known in the art. Such a cultivation process can be easily adjusted for use by those skilled in the art according to the microorganism to be selected.
[00117] The L-tryptophan produced by the culture described herein can be released into the medium or remain in the cells.
[00118] In one embodiment, the method for producing L-tryptophan of the present description may further include a step for preparing the microorganism of the present description, a step for preparing a medium for culturing the strain, or a combination thereof (regardless of the order, in any order), for example, before the step of Petition 870250080732, dated 09 / 09 / 2025, page 69 / 98 52 / 73 culture.
[00119] The method for producing L-tryptophan described herein may also include a step for recovering the desired substance, specifically L-tryptophan, from the microorganism being cultured, a culture product of the microorganism, a fermented product of the microorganism, or the culture medium. The recovery step may also be included after the culture step.
[00120] In the recovery step, the desired L-tryptophan can be collected using the microorganism culture method of the present description, for example, using a suitable method known in the art according to a batch culture, continuous culture or fed-batch culture method. For example, methods such as centrifugation, filtration, treatment with a protein crystallization precipitant (salting method), extraction, ultrasonic disruption, ultrafiltration, dialysis, various types of chromatography, such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, etc., HPLC or a combination thereof can be used, and the desired substance, specifically L-tryptophan, can be recovered from the medium or from microorganisms using suitable methods known in the art.
[00121] In addition, the method for producing L Petition 870250080732, dated 09 / 09 / 2025, pp. 70 / 98 The 53 / 73 tryptophan of the present description may further include a purification step, which may be carried out using an appropriate method known in the art. In one example, when the method for producing L-tryptophan of the present description includes both a recovery step and a purification step, the recovery step and the purification step may be carried out continuously or intermittently, regardless of the order or simultaneously, or may be integrated into one step, but the method is not limited to this.
[00122] In the method described herein, the introduction of pyruvate phosphate dikinase, and L-tryptophan etc. are as described in other respects above.
[00123] Yet another aspect of the present description provides a composition for the production of L-tryptophan, including: a microorganism of the genus Corynebacterium with an L-tryptophan production capacity, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced; a culture product of the microorganism; a fermented product of the microorganism; or a combination of two or more of the same.
[00124] The composition of the present description may also include any suitable excipient commonly used in compositions for the production of L-tryptophan, and such Petition 870250080732, dated 09 / 09 / 2025, page 71 / 98 54 / 73 excipients may include, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers or isotonic agents, etc., but are not limited to these.
[00125] In one embodiment, each component present in the composition of the present description may be contained in a microbiologically effective amount, or in an amount that may be appropriately present in the composition for production.
[00126] In the composition of the present description, the introduction of pyruvate phosphate dikinase, and L-tryptophan etc. are as described in other aspects above.
[00127] Yet another aspect of the present description provides for the use of a microorganism of the genus Corynebacterium with an L-tryptophan production capacity, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced, in the production of L-tryptophan.
[00128] In the use of the present description, the introduction of pyruvate phosphate dikinase, and L-tryptophan etc. are as described in other respects above. Method for carrying out the invention
[00129] Hereafter, the present description will be described in detail by means of Examples. However, these Examples are merely preferred Examples given for purposes Petition 870250080732, dated 09 / 09 / 2025, page 72 / 98 55 / 73 are illustrative and, therefore, the scope of this description is not intended to be limited to or by these Examples. Meanwhile, technical features not described in this document may be sufficiently understood and easily realized by those skilled in the art in the technical field of this description or in a similar technical field. Example 1: Screening and Selection of Phosphoenolpyruvate Synthase (ppsA) and Pyruvate Phosphate Dikinase (ppdK) Genes
[00130] In order to select phosphoenolpyruvate synthase or pyruvate and pyruvate phosphate dikinase with high gluconeogenesis activity, methanogenic acetic acid bacteria-derived organisms that use carbon sources consisting of 1 to 3 carbons were searched based on the results of a literature search. Among them, four types of microorganisms expected to possess phosphoenolpyruvate synthase or pyruvate and pyruvate phosphate dikinase were selected, as shown in Table 1 below, considering the biosafety levels applicable to the producing strains and availability. [Table 1] Order Strain Protein Registry Number Genome Registry Number Biosafety Level 1 Komagataeibacter xylinus WP_007399515.1 NZ_CP024644.1 1 Petition 870250080732, dated 09 / 09 / 2025, page 73 / 98 56 / 73 2 Acetobacter pasteurianus subsp. ASC06387.1 NZ_CP021922.1 1 3 Strain Methanosarcina acetivorans C2A WP_011023333.1 NZ_AE010299.1 1 4 Escherichia coli WP 000069375.1 NZ CP084899.1 1 5 Corynebacterium glutamicum ATCC13869 WP_011013725.1 NZ_CP016335.1 1 Example 2. Preparation of L-tryptophan-producing microorganisms introduced with foreign pyruvate phosphate dikinase. Example 2-1. Plasmid Preparation for Gene Insertion
[00131] A plasmid was prepared to introduce genes for pyruvate phosphate dikinase or phosphoenolpyruvate synthase into the transposon gene region within the Corynebacterium glutamicum chromosome by homologous recombination.
[00132] Specifically, PCR was performed based on chromosomal DNA from Corynebacterium glutamicum ATCC13869 as a template, using a primer pair with SEQ ID NOS: 11 and 12 and a primer pair with SEQ ID NOS: 13 and 14 to obtain the respective fragments. DNA Solg™ Pfu-X polymerase was used for PCR, and PCR was performed under denaturation conditions at 95 °C for 4 minutes, followed by 27 cycles of denaturation at 95 °C for 30 seconds, annealing at 60 °C for 30 seconds, and polymerization at 72 °C for 50 seconds, and then polymerization at 72 °C for 5 minutes. The primer sequences used are shown in Table 2. Petition 870250080732, dated 09 / 09 / 2025, p. 74 / 98 57 / 73 [Table 2] SEQ ID NO: Sequence Name (5'^ 3') SEQ ID NO: 11 HR1 F AATTCGAGCTCGGTACCCGATGGAACTACGAGACTG SEQ ID NO: 12 HR1 R TGACAATCACCGCATCCagtactGGATATTCGAGACAGCTT SEQ ID NO: 13 HR2 F GCTGTCTCGAATATCCagtactGGATGCGGTGATTGTCAG SEQ ID NO: 14 HR2 R GGTCGACTCTAGAGGATCCCCTAACCACGACGACTGCAA
[00133] The two PCR-amplified fragments and the pDCM2 vector (Korean Patent 10-2278000) for transformation cleaved by the Smal restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2-^Tn. Example 2-2. Preparation of a Microorganism of the Genus Corynebacterium Introduced with Pyruvate Phosphate Dikinase Derived from Komagataeibacter Xylinus
[00134] In order to introduce the ppdK gene (NZ_CP024644.1, SEQ ID NO: 2) encoding pyruvate phosphate dikinase derived from Komagataeibacter xylinus (K.xylinus) into Corynebacterium glutamicum, first, PCR was performed based on the K.xylinus ppdK gene (SEQ ID NO: 2) synthesized using the Gene-Synthesis service of Bionix Co. Ltd. as a template, using a primer pair SEQ ID NOS: 15 and 16 to amplify the ppdK gene.
[00135] SolgTMPfu-X DNA polymerase was used as the polymerase and PCR was performed under conditions of Petition 870250080732, dated 09 / 09 / 2025, p. 75 / 98 58 / 73 PCR amplification of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 1 minute and then polymerization at 72 °C for 5 minutes. [Table 3] SEQ ID NO: Name Sequence (5'^3') SEQ ID NO: 15 ppdK(K.xy) -F cgaaaggaaacactcATGACCAAATGGGTTTACAGC SEQ ID NO: 16 ppdK(K.xy) -R AATCACCGCATCCagtTCAGGCCGGGCTGGC
[00136] In addition, in order to obtain the Pcj7 promoter, PCR was performed based on p117-cj7-gfp (US 7662943 B2) as a template using primers with SEQ ID NO: 17 and SEQ ID NO: 18. SolgTMPfu-X DNA polymerase (SolGent co.) was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 30 seconds and then polymerization at 72 °C for 5 minutes. [Table 4] SEQ ID NO: Name Sequence (5'^3') SEQ ID NO: 17 Pcj7-F TCTCGAATATCCagtagaaacatcccagcgctact SEQ ID NO: 18 Pcj7(K.xy)-R AACCCATTTGGTCATgagtgtttcctttcgttggg
[00137] Subsequently, the thus amplified ppdK gene from K.xylinus, the Pcj7 promoter region, and the pDCM2-^Tn prepared in Example 2-1 were cleaved by restriction enzyme. Petition 870250080732, dated 09 / 09 / 2025, pp. 76 / 98 59 / 73 Seal were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2-^Tn:: Pcj7ppdK(K.xy). Cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles, followed by incubation at 50 °C for 1 hour.
[00138] The pDCM2-^Tn:: Pcj7-ppdK(K.xy) vector thus prepared was transformed into the CM05-9157 strain (Korean Patent 10-2278000), which is a tryptophan-producing strain, by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545) and then subjected to a secondary cross to obtain a strain in which a single copy of the Pcj7ppdK (K.xy) gene was inserted between the transposon genes on the chromosome. The resulting strain was identified by genome sequencing and a PCR method using primers with SEQ ID NO: 19 and SEQ ID NO: 20, which can, respectively, amplify the external region of the upstream and downstream region of the position where the gene was inserted. [Table 5] SEQ ID NO: Name Sequence (5'^3') SEQ ID NO: 19 Confirm-Pcj7ppsA / ppdK-F AACAACACCACATCTACATC SEQ ID NO: 20 Confirm-Pcj7ppsA / ppdK-R CAGCCTTTTCCAGCACCA Petition 870250080732, dated 09 / 09 / 2025, pp. 77 / 98 60 / 73
[00139] The strain thus obtained was named CM05-9157 :: Pcj7-ppdK(K.xy). Example 2-3. Preparation of a Microorganism of the Genus Corynebacterium Introduced with Pyruvate Phosphate Dikinase Derived from Acetobacter pasteurianus subsp.
[00140] In order to introduce the gene (NZ_CP021922.1, SEQ ID NO: 4) encoding pyruvate phosphate dikinase derived from Acetobacter pasteurianus subsp. (SEQ ID NO: 3) into Corynebacterium glutamicum, first, PCR was performed based on the ppdK gene from Acetobacter pasteurianus subsp. (SEQ ID NO: 4) synthesized using the Gene Synthesis service by Bionix Co., Ltd. as a template, using a primer pair SEQ ID NOS: 21 and 22 to amplify the ppdK gene.
[00141] SolgTMPfu-X DNA polymerase was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 1 minute and then polymerization at 72 °C for 5 minutes. [Table 6] SEQ ID NO: Name Sequence (5'^3') SEQ ID NO: 21 ppdK(A.pa)-F cgaaaggaaacactcATGCGCAATCTCCTCGGC SEQ ID NO: 22 ppdK(A.pa)-R GCTGACAATCACCGCATCCagtTCAGGCTTTTACGGCCTTG Petition 870250080732, dated 09 / 09 / 2025, p. 78 / 98 61 / 73
[00142] In addition, in order to obtain the Pcj7 promoter, PCR was performed based on p117-cj7-gfp (US 7662943 B2) as a template using primers with SEQ ID NO: 17 and SEQ ID NO: 23. SolgTMPfu-X DNA polymerase (SolGent co.) was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 30 seconds and then polymerization at 72 °C for 5 minutes. [Table 7] SEQ ID NO: Sequence Name (5'^ 3') SEQ ID NO: 23 Pcj7(A.pa)-R GAGGAGATTGCGCATgagtgtttccttttcgttggg
[00143] Subsequently, the thus amplified ppdK gene from Acetobacter pasteurianus subsp., the Pcj7 promoter region, and the pDCM2-^Tn prepared in Example 2-1 cleaved by the restriction enzyme ScaI were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2△Tn::Pcj7-ppdK(A.pa). Cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles, followed by incubation. Petition 870250080732, dated 09 / 09 / 2025, p. 79 / 98 62 / 73 at 50 °C for 1 hour.
[00144] Subsequently, the pDCM2-^Tn:: Pcj7ppdK(A.pa) vector thus prepared was transformed into the CM059157 strain (Korean Patent 10-2278000), which is a tryptophan-producing strain, by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545) and then subjected to a secondary cross to obtain a strain in which a single copy of the Pcj7-ppdK (A.pa) gene was inserted between the transposon genes on the chromosome. The resulting strain was identified by genome sequencing and a PCR method using primers with SEQ ID NO: 19 and SEQ ID NO: 20, which can, respectively, amplify the external region of the upstream and downstream regions of the position where the gene was inserted.
[00145] The strain thus obtained was named CM05-9157 :: Pcj7-ppdK(A.pa). Example 2-4. Preparation of a Microorganism of the Genus Corynebacterium Introduced with Pyruvate Phosphate Dikinase Derived from Methanosarcina acetivorans Strain C2A
[00146] In order to introduce the gene (NZ_AE010299.1, SEQ ID NO: 6) encoding pyruvate phosphate dikinase derived from the Methanosarcina acetivorans C2A strain (SEQ ID NO: 5) into Corynebacterium glutamicum, first, PCR was performed based on the ppdK gene from the Methanosarcina acetivorans C2A strain (SEQ ID NO: 6) synthesized using service Petition 870250080732, dated 09 / 09 / 2025, pp. 80 / 98 63 / 73 of Gene Synthesis by Bionix Co., Ltd. as a model, using a primer pair SEQ ID NOS: 24 and 25 to amplify the ppdK gene.
[00147] SolgTMPfu-X DNA polymerase was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 1 minute and then polymerization at 72 °C for 5 minutes. [Table 8] SEQ ID NO: Name Sequence (5'^3') SEQ ID NO: 24 ppdK(M.ac) -F acgaaaggaaacactcATGCCTGGAGATAAAAACAAATACATC SEQ ID NO: 25 ppdK(M.ac) -R AATCACCGCATCCagtTCAGAGCTCCTTTTCAGTTTC
[00148] In addition, in order to obtain the Pcj7 promoter, PCR was performed based on p117-cj7-gfp (US 7662943 B2) as a template using primers with SEQ ID NO: 17 and SEQ ID NO: 26. SolgTMPfu-X DNA polymerase (SolGent co.) was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 30 seconds and then polymerization at 72 °C for 5 minutes. [Table 9] Petition 870250080732, dated 09 / 09 / 2025, p. 81 / 98 64 / 73 SEQ ID NO: Sequence Name (5'^ 3') SEQ ID NO: 26 Pcj7(M.ac)-R TTTATCTCCAGGCATgagtgtttccttttcgttggg
[00149] Subsequently, the ppdK gene thus amplified from the Methanosarcina acetivorans C2A strain, the Pcj7 promoter region, and the pDCM2-^Tn prepared in Example 2-1 cleaved by the restriction enzyme ScaI were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2△Tn:: Pcj7-ppdK(M.ac). Cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles, followed by incubation at 50 °C for 1 hour.
[00150] Subsequently, the pDCM2-^Tn:: Pcj7ppdK(M.ac) vector thus prepared was transformed into the CM059157 strain (Korean Patent 10-2278000), which is a tryptophan-producing strain, by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545) and then subjected to a secondary cross to obtain a strain in which a single copy of the Pcj7-ppdK (M.ac) gene was inserted between the transposon genes on the chromosome. The resulting strain was identified by genome sequencing and a PCR method using primers with SEQ ID NO: 19 and SEQ ID NO: 20, which can, respectively, amplify the external region of the upstream and downstream regions of the position where the gene Petition 870250080732, dated 09 / 09 / 2025, pp. 82 / 98 65 / 73 was inserted.
[00151] The strain thus obtained was named CM05-9157 :: Pcj7-ppdK(M.ac). Example 2-5. Preparation of a Microorganism of the Genus Corynebacterium Introduced with Pyruvate Phosphate Dikinase Derived from Escherichia coli
[00152] In order to introduce ppsA (NZ_CP084899.1, SEQ ID NO: 8) which encodes phosphoenolpyruvate synthase derived from Escherichia coli (SEQ ID NO: 7), which is an ortholog of the ppdk gene, into Corynebacterium glutamicum, first, PCR was performed based on Escherichia coli W3110 chromosomal DNA as a template, using a primer pair SEQ ID NOS: 27 and 28 to amplify the ppsA gene.
[00153] SolgTMPfu-X DNA polymerase was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 1 minute and then polymerization at 72 °C for 5 minutes. [Table 10] SEQ ID NO: Name Sequence (5'^3') SEQ ID NO: 27 ppsA(E.co)-F aacgaaaggaaacactcATGTCCAACAATGGCTCG SEQ ID NO: 28 ppsA(E.co)-R AATCACCGCATCCagtTTATTTCTTCAGTTCAGCCAGG Petition 870250080732, dated 09 / 09 / 2025, p. 83 / 98 66 / 73
[00154] In addition, in order to obtain the Pcj7 promoter, PCR was performed based on p117-cj7-gfp (US 7662943 B2) as a template using primers with SEQ ID NO: 17 and SEQ ID NO: 29. SolgTMPfu-X DNA polymerase (SolGent co.) was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 30 seconds and then polymerization at 72 °C for 5 minutes. [Table 11] SEQ ID NO: Sequence Name (5'^ 3') SEQ ID NO: 29 Pcj7(E.co)-R GCCATTGTTGGACATgagtgtttcctttcgttggg
[00155] Subsequently, the thus amplified ppsA gene from Escherichia coli, the Pcj7 promoter region, and pDCM2△Tn prepared in Example 2-1 cleaved by the restriction enzyme ScaI were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2-ATn::Pcj7ppsA(E.co). Cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles, followed by incubation at 50 °C for 1 hour.
[00156] Subsequently, the pDCM2-ATn vector:: Pcj7 Petition 870250080732, dated 09 / 09 / 2025, p. 84 / 98 The 67 / 73 ppsA(E.co) strain thus prepared was transformed into the CM059157 strain (Korean Patent 10-2278000), a tryptophan-producing strain, by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545) and then subjected to a secondary cross to obtain a strain in which a single copy of the Pcj7-ppsA(E.co) gene was inserted between the transposon genes on the chromosome. The resulting strain was identified by genome sequencing and a PCR method using primers with SEQ ID NO: 19 and SEQ ID NO: 20, which can, respectively, amplify the external region upstream and downstream of the position where the gene was inserted.
[00157] The strain thus obtained was named CM05-9157 :: Pcj7-ppsA(E.co). Example 2-6. Preparation of a Microorganism of the Genus Corynebacterium Introduced with Pyruvate Phosphate Dikinase Derived from Corynebacterium glutamicum ATCC13869
[00158] In order to introduce ppsA (NZ_CP016335.1, SEQ ID NO: 10) which encodes phosphoenolpyruvate synthase derived from Corynebacterium glutamicum ATCC13869 (SEQ ID NO: 9), which is an ortholog of the ppdk gene, into Corynebacterium glutamicum, first, PCR was performed based on chromosomal DNA from Corynebacterium glutamicum ATCC13869 as a template, using a primer pair of SEQ ID NOS: 30 and 31 to amplify the ppsA gene. Petition 870250080732, dated 09 / 09 / 2025, pp. 85 / 98 68 / 73
[00159] SolgTMPfu-X DNA polymerase was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 1 minute and then polymerization at 72 °C for 5 minutes. [Table 12] SEQ ID NO: Name Sequence (5'^3') SEQ ID NO: 30 ppsA(C.gl)-F caacgaaaggaaacactcATGACCAACAGTTTGAACATCC SEQ ID NO: 31 ppsA(C.gl)-R ACAATCACCGCATCCagtTTACTTCGTGCCGGTCATTG
[00160] In addition, in order to obtain the Pcj7 promoter, PCR was performed based on p117-cj7-gfp (US 7662943 B2) as a template using primers with SEQ ID NO: 17 and SEQ ID NO: 32. SolgTMPfu-X DNA polymerase (SolGent co.) was used as the polymerase and PCR was performed under PCR amplification conditions of denaturation at 95 °C for 2 minutes, followed by 27 cycles of denaturation at 95 °C for 20 seconds, annealing at 60 °C for 40 seconds and polymerization at 72 °C for 30 seconds and then polymerization at 72 °C for 5 minutes. [Table 13] SEQ ID NO: Sequence Name (5'^ 3') SEQ ID NO: 32 Pcj7(C.gl)-R CAAACTGTTGGTCATgagtgtttccttttcgttggg
[00161] Subsequently, the gene thus amplified Petition 870250080732, dated 09 / 09 / 2025, pp. 86 / 98 69 / 73 ppsA of Corynebacterium glutamicum ATCC13869, the Pcj7 promoter region, and the pDCM2-^Tn prepared in Example 2-1 cleaved by the restriction enzyme ScaI were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2-^Tn:: Pcj7-ppsA(C.gl). Cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles, followed by incubation at 50 °C for 1 hour.
[00162] Subsequently, the pDCM2-^Tn:: Pcj7ppsA(C.gl) vector thus prepared was transformed into the CM059157 strain (Korean Patent 10-2278000), which is a tryptophan-producing strain, by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545) and then subjected to a secondary cross to obtain a strain in which a single copy of the Pcj7-ppsA(C.gl) gene was inserted between the transposon genes on the chromosome. The resulting strain was identified by genome sequencing and a PCR method using primers with SEQ ID NO: 19 and SEQ ID NO: 20, which can, respectively, amplify the external region upstream and downstream of the position where the gene was inserted.
[00163] The strain thus obtained was named CM05-9157 :: Pcj7-ppsA(C.gl). Petition 870250080732, dated 09 / 09 / 2025, pages 87 / 98 70 / 73 Example 3. Evaluation of the L-Tryptophan Production Capacity of L-Tryptophan-Producing Microorganisms Introduced with Foreign Pyruvate Phosphate Dikinase or Orthologs thereof
[00164] In order to confirm the L-tryptophan production capacity of the strains CM05-9157:: Pcj7-ppdK (K.xy), CM05-9157:: Pcj7-ppdK (A.pa), CM05-9157:: Pcj7-ppdK (M.ac) and CM05-9157:: Pcj7-ppsA (E.co) prepared in Examples 2-2, 2-3, 2-4 and 2-5, respectively, the parental strain CM05-9157, which was not introduced with a foreign gene, and the strains CM05-9157:: Pcj7-ppsA (C.gl) prepared in Example 2-6, the strains were cultured and evaluated as follows.
[00165] Each strain was inoculated into a 250 mL deflector flask containing 25 mL of the following seed medium and cultured with shaking at 200 rpm at 30 °C for 20 hours. Then, 1 mL of the seed culture solution was inoculated into a 250 mL deflector flask containing 25 mL of the following production medium and cultured with shaking at 200 rpm at 30 °C for 24 hours. After culture, the amount of L-tryptophan production was measured by HPLC. The compositions of the seed medium and the production medium are as follows, and the concentration of L-tryptophan in the culture medium for each strain tested is shown in Table 14 below. Petition 870250080732, dated 09 / 09 / 2025, pages 88 / 98 71 / 73
[00166] < Seed medium (pH 7.0)> glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 100 μg, thiamine HCl 1,000 pg, calcium pantothenate 2,000 pg, nicotinamide 2,000 μg (per liter of distilled water).
[00167] < Production medium (pH 7.0)> glucose 30 g, (NH4)2SO4 15 g, MgSO4 7H2O 1.2 g, KH2PO4 1 g, yeast extract 5 g, biotin 900 pg, thiamine HCl 4,500 pg, calcium pantothenate 4,500 pg, CaCO3 30 g (per liter of distilled water). [Table 14] OD562 Tryptophan Production Quantity (g / L) Tryptophan Yield (*100 g / g, %) CM05-9157 56.5 1.88 6.37 CM05-9157 :: Pcj7ppsA(C.gl) 56.3 1.89 6.38 CM05-9157 :: Pcj7ppsA(E.co) 56.1 1.9 6.40 CM05-9157 :: Pcj7ppdK(A.pa) 56.8 1.85 6.34 CM05-9157 :: Pcj7ppdK(K.xy) 52.1 2.35 7.52 CM05-9157 :: Pcj7ppdK(M.ac) 57.8 1.64 5.51
[00168] As a result, as shown in Table 14 above, it was confirmed that the amount of tryptophan production of the CM05-9157::Pcj7-ppsA (C.gl) strain introduced with the phosphoenolpyruvate synthase gene derived from Corynebacterium glutamicum was 1.89 g / L, which was almost the same as the amount of tryptophan production of the parental strain, CM05-9157. Petition 870250080732, dated 09 / 09 / 2025, pages 89 / 98 72 / 73
[00169] Furthermore, among the pyruvate phosphate dikinase genes or the phosphoenolpyruvate synthase genes, which are orthologs of the same, derived from various microorganisms, it was confirmed that only the strain CM05-9157:: Pcj7-ppdK (K.xy) introduced with the pyruvate phosphate dikinase gene derived from Komagataeibacter xylinus produced 2.35 g / L of final L-tryptophan in the flask culture, increasing the L-tryptophan production capacity by about 18% compared to the parental strain, CM05-9157 and / or the strain CM059157:: Pcj7-ppsA (C.gl).
[00170] In contrast, it was confirmed that the three types of strains (CM05-9157:: Pcj7-ppdK (A.pa), CM05-9157:: Pcj7ppdK (M.ac) and CM05-9157:: Pcj7-ppsA (E.co)) introduced with the foreign phosphoenolpyruvate synthase or pyruvate phosphate dikinase derived from other than Komagataeibacter xylinus showed a slight decrease in tryptophan production compared to the control group, CM05-9157, or the increase in tryptophan production was relatively insignificant.
[00171] These results imply that the ability to produce L-tryptophan could only be specifically increased when specific pyruvate phosphate dikinase genes derived from Komagataeibacter xylinus were introduced into microorganisms of the genus Corynebacterium.
[00172] Based on the above, someone versed in the technique to Petition 870250080732, dated 09 / 09 / 2025, pages 90 / 98 73 / 73 to which the present description pertains will be able to understand that the present description may be incorporated into other specific forms without modifying the technical concepts or essential characteristics of the present description. In this respect, the exemplary embodiments described in this document are for illustrative purposes only and should not be interpreted as limiting the scope of the present description. On the contrary, the present description is intended to cover not only the exemplary embodiments, but also various alternatives, modifications, equivalents and other embodiments that may be included within the spirit and scope of the present description, as defined by the appended claims. Petition 870250080732, dated 09 / 09 / 2025, pages 91 / 98
Claims
1 / 3 CLAIMS 1. Microorganism of the genus Corynebacterium, characterized by the fact that it has a capacity to produce L-tryptophan, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced.
2. Microorganism, according to claim 1, characterized in that the pyruvate phosphate dikinase derived from Komagataeibacter xylinus comprises an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence with at least 90% identity to SEQ ID NO:
1.
3. Microorganism, according to claim 1, characterized in that the pyruvate phosphate dikinase derived from Komagataeibacter xylinus is encoded by a ppdK gene.
4. Microorganism, according to claim 1, characterized in that the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
5. Microorganism, according to any one of claims 1 to 4, characterized in that the microorganism of the genus Corynebacterium has an increased capacity for L-tryptophan production compared to an unmodified microorganism.
6. Method for producing L-tryptophan, characterized Petition 870250080732, dated 09 / 09 / 2025, page 92 / 98 2 / 3 by the fact that it comprises culturing a microorganism of the genus Corynebacterium with an L-tryptophan production capacity, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced into a medium.
7. A method according to claim 6, characterized in that it further comprises recovering L-tryptophan from the microorganism being cultured, a culture product of the microorganism, a fermented product of the microorganism, or the culture medium.
8. Composition for the production of L-tryptophan, characterized in that it comprises: a microorganism of the genus Corynebacterium with the capacity to produce L-tryptophan, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced; a culture product of the microorganism; a fermented product of the microorganism; or a combination of two or more of the same.
9. Use of a composition, characterized in that it comprises a microorganism of the genus Corynebacterium with the capacity to produce L-tryptophan, into which pyruvate phosphate dikinase derived from Komagataeibacter xylinus or a polynucleotide encoding the same is introduced; a culture product of the microorganism; a fermented product of the microorganism; or a combination of two or more of the same, for the production of L-tryptophan.