Herbicide-tolerant cotton event pDAB4468.19.10.3

Abstract

This application provides a herbicide-tolerant cotton event pDAB4468.19.10.3, which includes genes encoding AAD-12 and PAT, providing herbicide tolerance to cotton crops containing this event, and implementing a method for crop protection.

Description

[0001] This application is a divisional application of patent application No. 201380016110.0 (PCT application No. PCT / US2013 / 022663), filed on January 23, 2013, entitled "Herbicide-resistant cotton event pDAB4468.19.10.3".

[0002] Priority Statement

[0003] This patent application claims the benefit of U.S. Provisional Patent Application Series No. 61 / 589,594, filed on January 23, 2012. background

[0004] When expressed in transgenic plants, the gene encoding AAD-12 (aryloxyalkanoate dioxygenase-12) confers industrial-level tolerance to phenoxyacetic acid herbicides, 2,4-D and MCPA, and pyridyloxyacetic acid herbicides, chlorpyrifos and flufenoxuron. When expressed in transgenic plants, the gene encoding PAT (phosphinothricin acetyltransferase) introduces tolerance to the phosphinothricin herbicide glufosinate. PAT has been successfully expressed in cotton and used as a selectable marker for the production of transgenic crops and for introducing commercial-level tolerance to the herbicide glufosinate in transgenic plants.

[0005] It is known that transgene expression in plants is influenced by its location within the plant gene, which may be due to the structure of chromatin (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site (Weising et al., Ann. Rev. Genet. 22: 421-477, 1988). Meanwhile, the presence of transgenes at different sites in the genome can affect the overall plant phenotype in different ways. For this reason, it is often necessary to screen a large number of transgene events to identify specific transgene events characterized by optimal expression of the introduced gene of interest. For example, it has been observed in plants and other organisms that the expression level of the introduced gene can vary considerably across different events. Differences in spatial or temporal expression patterns may also exist, such as the relative expression of the transgene in various plant tissues, which may not conform to the patterns expected based on the transcriptional regulatory elements present in the introduced gene construct. For this reason, hundreds to thousands of different events are typically generated and screened to obtain a single event with the transgene expression level and pattern desired for industrial purposes. Events exhibiting desired transgenic expression levels or patterns can be used to introduce transgenes into other genetic backgrounds via sexual outcrossing using conventional breeding methods. The offspring of such hybridization retain the transgenic expression characteristics of the original transformants. This strategy has been used to ensure reliable gene expression in several varieties already well-adapted to local growth conditions.

[0006] Ideally, the presence of a specific event should be detectable to determine whether the offspring of a sexually hybridized organism contain the genetically modified organism (GMO) of interest or a specific GMO population. Furthermore, the methods used to detect specific events would facilitate compliance, for example, with regulations requiring pre-market approval and labeling of foods or fibers derived from recombinant crops; or aid in environmental monitoring, monitoring field crop traits, or monitoring products derived from crop harvests; and ensure compliance with relevant regulations or contractual terms.

[0007] It is possible to detect the presence of transgenic events using any nucleic acid detection method known in the art, including but not limited to polymerase chain reaction (PCR) or DNA hybridization using nucleic acid probes. These detection methods generally focus on frequently used genetic elements, such as promoters, terminators, marker genes, etc., because coding regions are interchangeable for many DNA constructs. As a result, these methods cannot be used to distinguish between different events, especially those produced using the same or very similar DNA constructs, unless the DNA sequence of the flanking DNA adjacent to the inserted heterologous DNA is known. For example, U.S. Patent Application 2006 / 0070139 describes an event-specific PCR assay for the maize event DAS-59122-7. It is desirable to establish a simple and discriminative method for identifying the cotton event pDAB4468.19.10.3. public

[0008] Embodiments of the present invention relate to a novel herbicide-resistant transgenic cotton transformation event, designated cotton event pDAB4468.19.10.3, which includes aad-12 and pat as described herein, inserted into a specific site within the cotton cell genome. Representative cotton seeds have been deposited at the American Type Culture Collection (ATCC), with accession number indicated in paragraph

[0032] . The DNA of the cotton plant containing this event includes the junction / flanking sequences described herein that characterize the location of the inserted DNA within the cotton genome. SEQ ID NO: 1 and SEQ ID NO: 2 identify cotton event pDAB4468.19.10.3. More specifically, the sequences surrounding the junction at bp 1354 / 1355 of SEQ ID NO: 1 and the junction at bp 168 / 169 of SEQ ID NO: 2 identify cotton event pDAB4468.19.10.3. The following paragraph

[0013] describes instances of sequences containing these junctions, which are characteristic of the DNA of cotton plants containing the cotton event pDAB4468.19.10.3.

[0009] In one embodiment, the present invention provides a cotton plant or a portion thereof resistant to phenoxyacetic acid herbicides such as 2,4-D and MCPA. In another embodiment, the present invention provides a cotton plant or a portion thereof resistant to pyridyloxyacetic acid herbicides such as chlorpyrifos and fluroxypyr. In an additional embodiment, the present invention provides a cotton plant having a genome comprising one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; SEQ ID NO: 1 bp 1254-1455; SEQ ID NO: 1 bp 1154-1555; SEQ ID NO: 1 bp 1054-1655; SEQ ID NO: 2 bp 143-194; SEQ ID NO: 2 bp 118-219; SEQ ID NO: 2 bp 68-269; and SEQ ID NO: 2 bp 1-369, and their complements. In another embodiment, the present invention provides seeds of such plants.

[0010] In another embodiment, the present invention provides cotton plants or portions thereof tolerant to compounds that are converted into phenoxyacetic acid auxin herbicides such as 2,4-D and MCPA (e.g., 2,4-DB, MCPB, etc.). In a further embodiment, the present invention provides cotton plants or portions thereof tolerant to compounds that can be converted into pyridyloxyacetic acid herbicides such as chlorpyrifos and fluroxypyr (e.g., chlorpyrifos B, fluroxypyr B, etc.). The butyric acid portion present in phenoxyacetic acid auxins and pyridyloxyacetic acid herbicides can be converted into the phytotoxic form of the herbicide via β-oxidation. The butyric acid form of the herbicide is itself nonherbicidal. They are converted into their respective acidic forms within susceptible plants (e.g., cotton plants) via β-oxidation, and it is the acetic acid form of the herbicide that is phytotoxic. Plants that cannot undergo rapid β-oxidation are not harmed by butyric acid herbicides. However, plants capable of rapid β-oxidation and capable of converting butyric acid herbicides into acetic acid forms can subsequently be protected with AAD-12. Therefore, the present invention provides a cotton plant having a genome comprising one or more sequences selected from the group consisting of: bp 1329-1380 of SEQ ID NO: 1; bp 1304-1405 of SEQ ID NO: 1; bp 1254-1455 of SEQ ID NO: 1; bp 1154-1555 of SEQ ID NO: 1; bp 1054-1655 of SEQ ID NO: 1; bp 143-194 of SEQ ID NO: 2; bp 118-219 of SEQ ID NO: 2; bp 68-269 of SEQ ID NO: 2; and bp 1-369 of SEQ ID NO: 2, and their complements, which can identify the presence of cotton event pDAB4468.19.10.3. In another embodiment, the present invention provides seeds of such plants.

[0011] In another embodiment, the present invention provides a method for controlling weeds in cotton crops, comprising applying a phenoxyacetic acid herbicide, such as 2,4-D and MCPA, to the cotton crop, wherein the cotton crop comprises a cotton plant having a genome containing one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; SEQ ID NO: 1 bp 1254-1455; SEQ ID NO: 1 bp 1154-1555; SEQ ID NO: 1 bp 1054-1655; SEQ ID NO: 2 bp 143-194; SEQ ID NO: 2 bp 118-219; SEQ ID NO: 2 bp 68-269; and SEQ ID NO: 2 bp 1-369, and their complements, which are capable of identifying the presence of cotton event pDAB4468.19.10.3. In another embodiment, the present invention provides a method for controlling weeds in cotton crops, comprising applying a pyridyloxyacetic acid herbicide such as chlorpyrifos and fluroxypyr to the cotton crop, wherein the cotton crop comprises a cotton plant having a genome containing one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; SEQ ID NO: 1 bp 1254-1455; SEQ ID NO: 1 bp 1154-1555; SEQ ID NO: 1 bp 1054-1655; SEQ ID NO: 2 bp 143-194; SEQ ID NO: 2 bp 118-219; SEQ ID NO: 2 bp 68-269; and SEQ ID NO: 2 bp 1-369, and their complements, which are capable of identifying the presence of cotton event pDAB4468.19.10.3. The aad-12 gene present in cotton event pDAB4468.19.10.3 confers tolerance to phenoxyacetic acid herbicides and pyridyloxyacetic acid herbicides.

[0012] In another embodiment, the present invention provides a method for controlling weeds in cotton crops, comprising applying a glufosinate herbicide to the cotton crop, said cotton crop comprising a cotton plant having a genome containing one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; SEQ ID NO: 1 bp 1254-1455; SEQ ID NO: 1 bp 1154-1555; SEQ ID NO: 1 bp 1054-1655; SEQ ID NO: 2 bp 143-194; SEQ ID NO: 2 bp 118-219; SEQ ID NO: 2 bp 68-269; and SEQ ID NO: 2 bp 1-369, and their complements, which are capable of identifying the presence of cotton event pDAB4468.19.10.3. The pat gene present in cotton event pDAB4468.19.10.3 introduces tolerance to glufosinate herbicide.

[0013] In another embodiment, the present invention provides a method for detecting cotton event pDAB4468.19.10.3 in a sample containing cotton DNA, the method comprising:

[0014] (a) Contact the sample with a first primer and a second primer, the first primer being at least 10 bp in length and selectively binding to flanking sequences or their complements within bp 1-1354 of SEQ ID NO: 1, and the second primer being at least 10 bp in length and selectively binding to insert sequences or their complements within bp 1355-1672 of SEQ ID NO: 1; and

[0015] (b) Detect the amplicon generated between the primers; or

[0016] (c) Contact the sample with a first primer and a second primer, the first primer being at least 10 bp in length and selectively binding to the insert sequence or its complement within bp 1-168 of SEQ ID NO: 2, and the second primer being at least 10 bp in length and selectively binding to the flanking sequences or their complement within bp 169-2898 of SEQ ID NO: 2; and

[0017] (d) The amplicon generated between the primers is determined.

[0018] In another embodiment, the present invention provides a method for detecting cotton event pDAB4468.19.10.3, comprising:

[0019] (a) Contact the sample with a first primer and a second primer, wherein the first primer selectively binds to a flanking sequence selected from the group consisting of bp 1-1354 of SEQ ID NO: 1 and bp 169-2898 of SEQ ID NO: 2, and their complements, and the second primer selectively binds to SEQ ID NO: 3 or its complement;

[0020] (b) subjecting the sample to a polymerase chain reaction; and

[0021] (c) The amplicon generated between the primers is determined.

[0022] In another embodiment, the present invention provides a method for breeding cotton plants, comprising: hybridizing a first plant with a second cotton plant to produce a third cotton plant, the first plant comprising DNA containing one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; SEQ ID NO: 1 bp 1254-1455; SEQ ID NO: 1 bp 1154-1555; SEQ ID NO: 1 bp 1054-1655; SEQ ID NO: 2 bp 143-194; SEQ ID NO: 2 bp 118-219; SEQ ID NO: 2 bp 68-269; and SEQ ID NO: 2 bp 1-369, and their complements; determining the presence of DNA comprising one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; ... 1304-1405; 1254-1455 of SEQ ID NO: 1; 1154-1555 of SEQ ID NO: 1; 1054-1655 of SEQ ID NO: 1; 143-194 of SEQ ID NO: 2; 118-219 of SEQ ID NO: 2; 68-269 of SEQ ID NO: 2; and 1-369 of SEQ ID NO: 2, and their complements.

[0023] In another embodiment, the present invention provides an isolated DNA molecule capable of identifying cotton event pDAB4468.19.10.3. In addition to SEQ ID NOS: 1 and 2, these molecules also include molecules with a length of at least 50 bp including a polynucleotide sequence spanning the bp 1354 / 1355 junction of SEQ ID NO: 1, and molecules with a length of at least 50 bp including a polynucleotide sequence spanning the bp 168 / 169 junction of SEQ ID NO: 2. Examples include: bp1329-1380 of SEQ ID NO: 1; bp1304-1405 of SEQ ID NO: 1; bp1254-1455 of SEQ ID NO: 1; bp1154-1555 of SEQ ID NO: 1; bp1054-1655 of SEQ ID NO: 1; bp143-194 of SEQ ID NO: 2; bp118-219 of SEQ ID NO: 2; bp68-269 of SEQ ID NO: 2; and bp1-369 of SEQ ID NO: 2, and their complements.

[0024] In another embodiment, the present invention provides cotton fiber, grain, seed, seed oil, or seed meal containing cotton event pDAB4468.19.10.3, characterized in that the DNA of the cotton fiber, grain, seed, seed oil, or seed meal contains one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; SEQ ID NO: 1 bp 1254-1455; SEQ ID NO: 1 bp 1154-1555; SEQ ID NO: 1 bp 1054-1655; SEQ ID NO: 2 bp 143-194; SEQ ID NO: 2 bp 118-219; SEQ ID NO: 2 bp 68-269; and SEQ ID NO: 2 bp 1-369, and their complements.

[0025] Embodiments of the present invention also include cotton plant cells and plant parts containing cotton event pDAB4468.19.10.3, including, but not limited to, pollen, ovules, flowers, shoots, roots and leaves, as well as the nuclei of vegetative cells, pollen cells, seeds, seed oil and seed meal, and egg cells.

[0026] In some implementations, the cotton event pDAB4468.19.10.3 can be combined with other traits, including, for example, other herbicide tolerance genes and / or insect repressor proteins and transcriptional regulatory sequences (e.g., RNA interference, dsRNA, transcription factors, etc.). Additional traits can be added to the plant genome through plant breeding, re-transformation of transgenic plants containing the cotton event pDAB4468.19.10.3, or targeted integration mediated by homologous recombination.

[0027] Other implementations include cleaving the polynucleotide sequence containing the cotton event pDAB4468.19.10.3, including, for example, the pat gene expression cassette. Once the polynucleotide sequence is cleaved, the modified event can be retargeted to a specific chromosomal site where an additional polynucleotide sequence superimposed on the cotton event pDAB4468.19.10.3.

[0028] In one embodiment, the invention covers cotton chromosome target sites located on chromosome 3 of subgenome A, between the flanking sequences represented in SEQ ID NOS: 1 and 2.

[0029] In one embodiment, the present invention covers a method for producing transgenic cotton plants, comprising inserting a heterologous nucleic acid into chromosome 3 of subgenome A at a position between the genomic sequences represented in SEQ ID NO: 1 and 2, specifically between bp 1-1354 of SEQ ID NO: 1 and bp 169-2898 of SEQ ID NO: 2.

[0030] Furthermore, embodiments of the present invention also provide an assay for detecting the presence of a subject event in a sample (e.g., a sample of cotton fibers). This assay can be based on the DNA sequence of a recombinant construct inserted into the cotton genome, and on the genomic sequence flanking the insertion site. Kits and conditions for performing this assay are also provided.

[0031] Embodiments of the present invention also relate in part to the cloning and analysis of DNA sequences in boundary regions of transgenic cotton lines resulting from the insertion of T-DNA from pDAB4468. These sequences are unique. Based on the inserted and junction sequences, event-specific primers can be generated, and are actually generated. PCR analysis shows that these events can be identified by analyzing the PCR amplicon generated using these event-specific primer sets. Therefore, these and other related procedures can be used to uniquely identify cotton lines containing the events of the present invention.

[0032] One embodiment provides a method for controlling weeds in a cotton crop, comprising applying a phenoxyacetic acid herbicide to the cotton crop, said cotton crop comprising cotton plants containing DNA as described below, said DNA comprising sequences selected from the group consisting of: SEQ ID NO: 1, bp 1329-1380; SEQ ID NO: 1, bp 1304-1405; SEQ ID NO: 1, bp 1254-1455; SEQ ID NO: 1, bp 1154-1555; SEQ ID NO: 1, bp 1054-1655; SEQ ID NO: 2, bp 143-194; SEQ ID NO: 2, bp 118-219; SEQ ID NO: 2, bp 68-269; and SEQ ID NO: 2, bp 1-369. In a further aspect of this method, the phenoxyacetic acid herbicide is 2,4-D. In a further aspect of this method, the phenoxyacetic acid herbicide is MCPA.

[0033] One embodiment provides a method for controlling weeds in a cotton crop, comprising applying a pyridoxine herbicide to the cotton crop, said cotton crop comprising cotton plants containing DNA containing sequences selected from the group consisting of: SEQ ID NO: 1, bp 1329-1380; SEQ ID NO: 1, bp 1304-1405; SEQ ID NO: 1, bp 1254-1455; SEQ ID NO: 1, bp 1154-1555; SEQ ID NO: 1, bp 1054-1655; SEQ ID NO: 2, bp 143-194; SEQ ID NO: 2, bp 118-219; SEQ ID NO: 2, bp 68-269; and SEQ ID NO: 2, bp 1-369. In a further aspect of the method, the pyridoxine herbicide is chlorpyrifos. In a further aspect of the method, the phenoxyacetic acid herbicide is fluroxypyr.

[0034] One embodiment provides a method for controlling weeds in a cotton crop, comprising applying a glufosinate herbicide to the cotton crop, said cotton crop comprising cotton plants containing DNA as described below, said DNA comprising sequences selected from the group consisting of: SEQ ID NO: 1, bp 1329-1380; SEQ ID NO: 1, bp 1304-1405; SEQ ID NO: 1, bp 1254-1455; SEQ ID NO: 1, bp 1154-1555; SEQ ID NO: 1, bp 1054-1655; SEQ ID NO: 2, bp 143-194; SEQ ID NO: 2, bp 118-219; SEQ ID NO: 2, bp 68-269; and SEQ ID NO: 2, bp 1-369.

[0035] One embodiment provides an isolated DNA sequence comprising one or more sequences selected from the group consisting of: bp 1329-1380 of SEQ ID NO: 1; bp 1304-1405 of SEQ ID NO: 1; bp 1254-1455 of SEQ ID NO: 1; bp 1154-1555 of SEQ ID NO: 1; bp 1054-1655 of SEQ ID NO: 1; bp 143-194 of SEQ ID NO: 2; bp 118-219 of SEQ ID NO: 2; bp 68-269 of SEQ ID NO: 2; and bp 1-369 of SEQ ID NO: 2.

[0036] One embodiment provides a method for breeding cotton plants, comprising: crossing a first plant with a second cotton plant to produce a third cotton plant, the first plant comprising DNA containing one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; SEQ ID NO: 1 bp 1254-1455; SEQ ID NO: 1 bp 1154-1555; SEQ ID NO: 1 bp 1054-1655; SEQ ID NO: 2 bp 143-194; SEQ ID NO: 2 bp 118-219; SEQ ID NO: 2 bp 68-269; and SEQ ID NO: 2 bp 1-369, and their complements; and determining the presence of DNA containing one or more sequences selected from the group consisting of: SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; ... SEQ ID NO: 1, bp 1254-1455; SEQ ID NO: 1, bp 1154-1555; SEQ ID NO: 1, bp 1054-1655; SEQ ID NO: 2, bp 143-194; SEQ ID NO: 2, bp 118-219; SEQ ID NO: 2, bp 68-269; and SEQ ID NO: 2, bp 1-369, and their complements.

[0037] One embodiment provides an isolated DNA molecule comprising a junction sequence comprising at least one sequence selected from the group consisting of: bp 1329-1380 of SEQ ID NO: 1; bp 1304-1405 of SEQ ID NO: 1; bp 1254-1455 of SEQ ID NO: 1; bp 1154-1555 of SEQ ID NO: 1; bp 1054-1655 of SEQ ID NO: 1; bp 143-194 of SEQ ID NO: 2; bp 118-219 of SEQ ID NO: 2; bp 68-269 of SEQ ID NO: 2; bp 1-369 of SEQ ID NO: 2, and their complements.

[0038] One embodiment provides a cotton seed containing DNA sequences selected from the group consisting of: bp 1329-1380 of SEQ ID NO: 1; bp 1304-1405 of SEQ ID NO: 1; bp 1254-1455 of SEQ ID NO: 1; bp 1154-1555 of SEQ ID NO: 1; bp 1054-1655 of SEQ ID NO: 1; bp 143-194 of SEQ ID NO: 2; bp 118-219 of SEQ ID NO: 2; bp 68-269 of SEQ ID NO: 2; bp 1-369 of SEQ ID NO: 2, and their complements. A further embodiment provides a cotton seed containing the AAD-12 / PAT cotton event pDAB4468.19.10.3 in its genome, and a representative cotton seed thereof is deposited at the U.S. Center for Type Culture Collection (UCC) under accession number PTA-12457. A further embodiment provides a cotton plant produced by cultivating cotton seeds from either of these two embodiments. A further embodiment provides cotton seeds produced from this cotton plant, wherein the seeds contain the AAD-12 / PAT cotton event pDAB4468.19.10.3 in their genome, which is identical to the AAD-12 / PAT cotton event pDAB4468.19.10.3 present in cotton seeds deposited at the U.S. Center for Type Culture Collection with accession number PTA-12457. A further embodiment provides a portion of the cotton plant, wherein the portion is selected from the group consisting of pollen, ovules, flowers, bolls, buds, roots, and leaves, and the portion contains the event. A further embodiment provides a composition derived from the cotton plant or a portion thereof, wherein the composition is a commercial product selected from the group consisting of cottonseed meal, cotton fiber, and cottonseed oil.

[0039] In a further embodiment, the cotton plant comprises a DNA sequence having at least 95% sequence identity with residues 1,355-7,741 of SEQ ID NO: 21. One embodiment provides a progeny cotton plant of the plant described above, wherein the plant exhibits tolerance to phenoxyacetic acid, pyridyloxyacetic acid, and glufosinate herbicides, and said tolerance is due to said event or the expression of proteins encoded in said genome.

[0040] A further embodiment provides a cotton seed comprising a genome containing a DNA sequence as described below, said DNA sequence having at least 95% sequence identity with SEQ ID NO: 21. A further embodiment provides a plant produced by cultivating this cotton seed.

[0041] One embodiment provides a transgenic cotton plant or a portion thereof containing cotton event pDAB4468.19.10.3, wherein representative cotton seeds containing cotton event pDAB4468.19.10.3 have been deposited at the U.S. Center for Type Culture Collection, accession number PTA-12457.

[0042] More specifically, this application provides:

[0043] 1. A cotton seed comprising, in its genome, a DNA sequence selected from the group consisting of: residues 1329-1380 of SEQ ID NO: 1; residues 1304-1405 of SEQ ID NO: 1; residues 1254-1455 of SEQ ID NO: 1; residues 1154-1555 of SEQ ID NO: 1; residues 1054-1655 of SEQ ID NO: 1; residues 143-194 of SEQ ID NO: 2; residues 118-219 of SEQ ID NO: 2; residues 68-269 of SEQ ID NO: 2; and residues 1-369 of SEQ ID NO: 2; and their complements.

[0044] 2. A cotton seed containing the AAD-12 / PAT cotton event pDAB4468.19.10.3 in its genome, and a representative cotton seed of which is deposited at the U.S. Center for Type Culture Collection, accession number PTA-12457.

[0045] 3. A cotton plant produced by planting the seeds of item 1 or item 2.

[0046] 4. A cotton seed produced by the plant of item 3, wherein the seed contains the AAD-12 / PAT cotton event pDAB4468.19.10.3 in its genome, which is also present in cotton seeds deposited at the U.S. Center for Type Culture Collection with accession number PTA-12457.

[0047] 5. A portion of the cotton plant of item 3, wherein the portion is selected from pollen, ovules, flowers, bolls, buds, roots, and leaves, and the portion includes the event described.

[0048] 6. A composition derived from the cotton plant of item 3 or a portion of item 5, wherein the composition is a commercial product selected from the group consisting of cottonseed meal, cotton fiber, and cottonseed oil.

[0049] 7. The cotton plants that are descendants of the plant in item 3, wherein the plant exhibits tolerance to phenoxyacetic acid, pyridinoxyacetic acid and glufosinate herbicides, and the tolerance is due to the expression of proteins encoded in the event or the genome.

[0050] 8. The cotton plant of item 3, wherein the cotton plant comprises a DNA sequence having at least 95% sequence identity with residues 1,355-7,741 of SEQ ID NO: 21.

[0051] 9. A cotton seed comprising a genome containing a DNA sequence having at least 95% sequence identity with SEQ ID NO: 21.

[0052] 10. Plants produced by planting the seeds of item 9.

[0053] 11. A transgenic cotton plant or a part thereof comprising cotton event pDAB4468.19.10.3, wherein representative cotton seeds comprising cotton event pDAB4468.19.10.3 have been deposited at the U.S. Center for Type Culture Collection, accession number PTA-12457.

[0054] 12. An isolated DNA sequence comprising one or more sequences selected from the group consisting of: bp1329-1380 of SEQ ID NO: 1; bp1304-1405 of SEQ ID NO: 1; bp1254-1455 of SEQ ID NO: 1; bp1154-1555 of SEQ ID NO: 1; bp1054-1655 of SEQ ID NO: 1; bp143-194 of SEQ ID NO: 2; bp118-219 of SEQ ID NO: 2; bp68-269 of SEQ ID NO: 2; and bp1-369 of SEQ ID NO: 2.

[0055] 13. A method for breeding cotton plants, comprising:

[0056] A third cotton plant is produced by hybridization of a first plant and a second cotton plant. The first plant contains DNA containing one or more sequences selected from the group consisting of: bp 1329-1380 of SEQ ID NO: 1; bp 1304-1405 of SEQ ID NO: 1; bp 1254-1455 of SEQ ID NO: 1; bp 1154-1555 of SEQ ID NO: 1; bp 1054-1655 of SEQ ID NO: 1; bp 143-194 of SEQ ID NO: 2; bp 118-219 of SEQ ID NO: 2; bp 68-269 of SEQ ID NO: 2; and bp 1-369 of SEQ ID NO: 2, and their complements; and

[0057] The presence of DNA containing one or more sequences selected from the group consisting of SEQ ID NO: 1 bp 1329-1380; SEQ ID NO: 1 bp 1304-1405; SEQ ID NO: 1 bp 1254-1455; SEQ ID NO: 1 bp 1154-1555; SEQ ID NO: 1 bp 1054-1655; SEQ ID NO: 2 bp 143-194; SEQ ID NO: 2 bp 118-219; SEQ ID NO: 2 bp 68-269; and SEQ ID NO: 2 bp 1-369, and their complements, was determined in the third cotton plant.

[0058] 14. An isolated DNA molecule comprising a junction sequence containing at least one sequence selected from the group consisting of: bp 1329-1380 of SEQ ID NO: 1; bp 1304-1405 of SEQ ID NO: 1; bp 1254-1455 of SEQ ID NO: 1; bp 1154-1555 of SEQ ID NO: 1; bp 1054-1655 of SEQ ID NO: 1; bp 143-194 of SEQ ID NO: 2; bp 118-219 of SEQ ID NO: 2; bp 68-269 of SEQ ID NO: 2; and bp 1-369 of SEQ ID NO: 2, and their complements.

[0059] 15. A method for controlling weeds in a cotton crop, comprising applying a phenoxyacetic acid herbicide to the cotton crop, said cotton crop comprising a cotton plant containing DNA as described below, the DNA comprising sequences selected from the group consisting of: SEQ ID NO: 1, bp 1329-1380; SEQ ID NO: 1, bp 1304-1405; SEQ ID NO: 1, bp 1254-1455; SEQ ID NO: 1, bp 1154-1555; SEQ ID NO: 1, bp 1054-1655; SEQ ID NO: 2, bp 143-194; SEQ ID NO: 2, bp 118-219; SEQ ID NO: 2, bp 68-269; and SEQ ID NO: 2, bp 1-369.

[0060] 16. The method of item 15, wherein the phenoxyacetic acid herbicide is 2,4-D.

[0061] 17. The method of item 15, wherein the phenoxyacetic acid herbicide is MCPA.

[0062] 18. A method for controlling weeds in a cotton crop, comprising applying a pyridoxine herbicide to the cotton crop, said cotton crop comprising cotton plants containing DNA as described below, the DNA comprising sequences selected from the group consisting of: SEQ ID NO: 1, bp 1329-1380; SEQ ID NO: 1, bp 1304-1405; SEQ ID NO: 1, bp 1254-1455; SEQ ID NO: 1, bp 1154-1555; SEQ ID NO: 1, bp 1054-1655; SEQ ID NO: 2, bp 143-194; SEQ ID NO: 2, bp 118-219; SEQ ID NO: 2, bp 68-269; and SEQ ID NO: 2, bp 1-369.

[0063] 19. The method of item 18, wherein the pyridoxine herbicide is chlorpyrifos.

[0064] 20. The method of item 18, wherein the pyridoxine herbicide is fluroxypyr.

[0065] 21. A method for controlling weeds in a cotton crop, comprising applying a glufosinate herbicide to the cotton crop, said cotton crop comprising a cotton plant containing DNA containing sequences selected from the group consisting of: SEQ ID NO: 1, bp 1329-1380; SEQ ID NO: 1, bp 1304-1405; SEQ ID NO: 1, bp 1254-1455; SEQ ID NO: 1, bp 1154-1555; SEQ ID NO: 1, bp 1054-1655; SEQ ID NO: 2, bp 143-194; SEQ ID NO: 2, bp 118-219; SEQ ID NO: 2, bp 68-269; and SEQ ID NO: 2, bp 1-369.

[0066] Seed preservation

[0067] As part of this disclosure, at least 2,500 seeds of the cotton line containing cotton event pDAB4468.19.10.3 are deposited at the American Center for Type Culture Collection (ATCC) (10801 University Boulevard, Manassas, VA, 20110), and are freely available to the public (but protected by patent rights). This deposit, designated ATCC Registry No. PTA-12457, was deposited on January 23, 2012, in the name of Dow AgroSciences LLC. The implementation and maintenance of this deposit comply with the seed deposit provisions of the Budapest Treaty concerning patent proceedings.

[0068] Sequence Summary

[0069] SEQ ID NO: 1 is the 5' DNA flanking boundary sequence for cotton event pDAB4468.19.10.3. Nucleotides 1-1354 are the genomic sequence. Nucleotides 1355-1672 are the insertion sequence.

[0070] SEQ ID NO: 2 is the 3' DNA flanking boundary sequence for cotton event pDAB4468.19.10.3. Nucleotides 1-168 are the insertion sequence. Nucleotides 169-2898 are the genomic sequence.

[0071] SEQ ID NO: 3 is the T-strand DNA sequence of pDAB4468, which is annotated in Table 1 below.

[0072] SEQ ID NO: 4 is the oligonucleotide primer 3endG1 used to confirm the 3' boundary genomic DNA.

[0073] SEQ ID NO: 5 is the oligonucleotide primer 3endG2 used to confirm the 3' boundary genomic DNA.

[0074] SEQ ID NO: 6 is the oligonucleotide primer 3endG3 used to confirm the 3' boundary genomic DNA.

[0075] SEQ ID NO: 7 is the oligonucleotide primer 5endG1 used to confirm the 5' boundary genomic DNA.

[0076] SEQ ID NO: 8 is the oligonucleotide primer 5endG2 used to confirm the 5' boundary genomic DNA.

[0077] SEQ ID NO: 9 is the oligonucleotide primer 5endG3 used to confirm the 5' boundary genomic DNA.

[0078] SEQ ID NO: 10 is the oligonucleotide primer 5endT1 used to confirm the 5' boundary genomic DNA.

[0079] SEQ ID NO: 11 is the oligonucleotide primer 5endT2 used to confirm the 5' boundary genomic DNA.

[0080] SEQ ID NO: 12 is the oligonucleotide primer 5endT3 used to confirm the 5' boundary genomic DNA.

[0081] SEQ ID NO: 13 is the oligonucleotide primer 3endT1 used to confirm the 3' boundary genomic DNA.

[0082] SEQ ID NO: 14 is the oligonucleotide primer 3endT2 used to confirm the 3' boundary genomic DNA.

[0083] SEQ ID NO: 15 is the oligonucleotide primer 3endT3 used to confirm the 3' boundary genomic DNA.

[0084] SEQ ID NO: 16 is the oligonucleotide primer BACG6 used to confirm the 5' boundary genomic DNA.

[0085] SEQ ID NO: 17 is the oligonucleotide primer UbiRev used to confirm the 5' boundary genomic DNA.

[0086] SEQ ID NO: 18 is the oligonucleotide primer GHBACA6 used to confirm the 5' boundary genomic DNA.

[0087] SEQ ID NO: 19 is the oligonucleotide primer AAD3B1 used to confirm the 5' boundary genomic DNA.

[0088] SEQ ID NO: 20 is the oligonucleotide primer 5endPLs used to confirm the 5' boundary genomic DNA.

[0089] SEQ ID NO: 21 is the sequence of cotton event pDAB4468.19.10.3, which includes a 5' genome flanking sequence, a pDAB4468 T-strand insertion, and a 3' genome flanking sequence. Brief description of the attached diagram

[0090] Figure 1 This is a plasmid image of pDAB4468 containing the aad-12 and pat gene expression cassettes.

[0091] Figure 2 The primer positions for confirming the 5' and 3' boundary sequences of cotton event pDAB4468.19.10.3 were depicted.

[0092] Mode of implementing the present invention

[0093] Both ends of the cotton event pDAB4468.19.10.3 insertion have been sequenced and characterized. Event-specific assays have been developed. This event has been mapped into the cotton genome (chromosome 3 of subgenome A). This allows the event to be infiltrated into more superior lines. As mentioned in the "Background" section above, the introduction and integration of transgenes into the plant genome involves some random events (hence the term "event" for a given insertion to be expressed). That is, due to the numerous transformation techniques, such as Agrobacterium transformation, gene gun transformation (i.e., gene gun), and silicon carbide-mediated transformation (i.e., WHISKERS), it is impossible to predict where the transgene will be inserted into the genome. Therefore, identifying the flanking plant genomic DNA of the insert is important for identifying plants with a given insertion event. For example, PCR primers can be designed to generate PCR amplicones spanning the junction region between the insert and the host genome. These PCR amplicones can be used to identify unique or different types of insertion events.

[0094] This document provides definitions and examples to help describe embodiments of the invention and to guide those skilled in the art in practicing these embodiments. Unless otherwise stated, the terminology can be understood by those skilled in the art based on its conventional usage. The nomenclature of DNA bases is in accordance with 37 CFR §1.822.

[0095] As used herein, the term “offspring” refers to the offspring of any generation of parent plants containing the cotton event pDAB4468.19.10.3.

[0096] A transgenic “event” is generated by transforming plant cells with heterologous DNA—a nucleic acid construct containing the transgene of interest—to regenerate a plant population resulting from the insertion of the transgene into the plant genome, and by selecting a specific plant characterized by the insertion at a specific genomic location. The term “event” refers to the original transformant containing the heterologous DNA and its offspring. The term “event” also refers to offspring produced by sexual crossbreeding between a transformant and another variety containing genomic / transgenic DNA. Even after multiple backcrosses with a recurrent parent, the inserted transgenic DNA and the flanking genomic DNA (genomic / transgenic DNA) from the transformed parent remain at the same chromosomal location in the hybrid offspring. The term “event” also refers to DNA from the original transformant and its offspring containing the inserted DNA and flanking genomic sequences adjacent to the inserted DNA, which is expected to be transferred to offspring that receive the inserted DNA, including the transgene of interest, through sexual crossbreeding between a parental line containing the inserted DNA (e.g., the original transformant and its offspring produced by self-pollination) and a parental line not containing the inserted DNA.

[0097] A "junction sequence" or "boundary sequence" spans a junction between two sources: DNA inserted into the genome; and DNA from the natural cotton genome located flanking the insertion site. Identifying or detecting any one or the other junction sequences in the plant genetic material is sufficient to identify the event. DNA sequences spanning the insertion site in the cotton event described herein, and flanking DNA of similar length, are included. Specific examples of such identifying sequences are provided herein; however, other sequences overlapping the junctions of the insertions or the junctions of the insertions with the genome sequence can also be identified and can be used according to embodiments of the invention.

[0098] Embodiments of the present invention relate in part to event identification using the flanking, junction, and insert sequences. Related PCR primers and amplicones are also included in embodiments of the present invention. According to embodiments of the present invention, commercially available transgenic cotton lines or varieties derived from the proprietary transgenic cotton lines can be detected or identified using PCR analysis methods employing amplicones spanning the inserted DNA and its boundaries.

[0099] Flanking / junction sequences can identify the cotton event pDAB4468.19.10.3. Based on these sequences, event-specific primers were generated. PCR analysis showed that these cotton lines could be identified across different cotton genotypes by analyzing PCR amplicon generated using these event-specific primer sets. Therefore, these and other related procedures can be used to uniquely identify these cotton lines. The sequences identified in this paper are unique.

[0100] The detection techniques of this invention can be particularly used in conjunction with plant breeding to determine which offspring plants contain a given event after a parental plant containing an event of interest has been crossed with another plant line to introduce one or more additional traits of interest into the offspring. These PCR analysis methods are beneficial for cotton breeding programs and quality control, especially for commercially available transgenic cotton seeds. PCR detection kits for these transgenic cotton lines can now also be manufactured and used. This also facilitates product registration and product administration.

[0101] Furthermore, the flanking cotton / genome sequence can be used to specifically identify the genomic location of each insert. This information can be used to create molecular marker systems specific to each event. These can be used for rapid breeding strategies and establishing linkage data.

[0102] Furthermore, flanking sequence information can be used to study and characterize transgene integration processes, genomic integration site characteristics, event sorting, the stability of transgenes and their flanking sequences, and gene expression (especially involving gene silencing, transgene methylation patterns, position effects, and potential expression-related elements such as MARS [matrix-binding domain], etc.).

[0103] Based on all the contents of this disclosure, it should be clear that embodiments of the invention include seeds available based on the ATCC accession number shown in paragraph

[0032] . Embodiments of the invention also include herbicide-tolerant cotton plants grown from seeds deposited with the ATCC accession number shown in paragraph

[0032] . Embodiments of the invention also include portions of said plant, such as leaves, tissue samples, seeds produced by said plant, pollen, etc. (wherein these portions of the plant include aad-12 and pat, and SEQ ID NO: 1 and 2).

[0104] Furthermore, embodiments of the invention also include progeny and / or offspring plants grown from the preserved seeds, preferably herbicide-resistant cotton plants, wherein said plants have a genome containing detectable junction / flanking sequences as described herein. The term "cotton" as used herein refers to upland cotton (Gossypium hirsutum), including all varieties that can be bred from cotton plants.

[0105] The herbicide-tolerant cotton plants of the embodiments of the present invention can be bred as follows: First, a first sexual hybridization is performed between a first parent cotton plant and a second parent cotton plant, wherein the first parent cotton plant consists of cotton plants grown from seeds of any of the strains mentioned herein, thereby producing multiple first progeny plants; then, glufosinate-resistant first progeny plants are selected; these first progeny plants are self-pollinated, thereby producing multiple second progeny plants; then, glufosinate-resistant plants are selected from these second progeny plants. These steps may further include backcrossing the first or second progeny plants with the second or third parent cotton plant. Cotton crops containing cotton seeds of the embodiments of the present invention, or their progeny, can then be planted.

[0106] It should also be understood that two different transgenic plants can mate to produce offspring containing two independently segregating, additive foreign genes. Self-pollination of suitable offspring can produce plants homozygous for both additive foreign genes. Backcrossing with parental plants and crosscrossing with non-transgenic plants, as well as asexual reproduction, have also been conceived. Other breeding methods commonly used for different traits and crops are known in the art. Backcross breeding has been used for gene transfer to introduce easily inherited, highly heritable traits into desired homozygous cultivars that serve as recurrent parents. The source of the trait to be transferred is called the donor parent. The resulting plant is expected to possess the attributes of the recurrent parent (e.g., a cultivar) and the desired trait transferred from the donor parent. After the initial hybridization, individuals with the donor parent phenotype are selected and repeatedly crossed with the recurrent parent (backcrossing). The resulting plant is expected to possess the attributes of the recurrent parent (e.g., a cultivar) and the desired trait transferred from the donor parent.

[0107] Similarly, herbicide-tolerant cotton plants according to one embodiment of the present invention can be transformed with additional transgenes using methods known in the art. Transformation techniques such as Agrobacterium transformation, gene gun transformation (i.e., gene gun), and silicon carbide-mediated transformation (i.e., WHISKERS) can be used to introduce additional transgenes into the genome of cotton event pDAB4468.19.10.3. Selection and characterization of transgenic plants containing the newly inserted transgenes can be performed to identify plants containing stable integrates of novel transgenes other than the aad-12 and pat genes of the embodiments of the present invention.

[0108] The DNA molecules of the embodiments of the present invention can be used as molecular markers in molecular marker-assisted breeding (MAB) methods. The DNA molecules of the embodiments of the present invention can be used in methods for identifying genetically linked agronomically useful traits (e.g., AFLP markers, RFLP markers, RAPD markers, SNPs, and SSRs), as known in the art. MAB methods can be used to track herbicide tolerance traits in the offspring of crosses with cotton plants of the embodiments of the present invention (or their progeny and any other cotton cultivar or variety). These DNA molecules are markers of this trait, and herbicide tolerance traits can be tracked in cotton plants—at least one cotton line of the embodiments of the present invention or its progeny being a parent or ancestor in these plants—using MAB methods well known in the art. The methods of the embodiments of the present invention can be used to identify any cotton variety with a subject event.

[0109] The method of embodiments of the present invention includes a method for producing herbicide-resistant cotton plants, wherein the method includes breeding with plants according to one embodiment of the present invention. More specifically, the method may include hybridizing two plants according to embodiments of the present invention, or hybridizing one plant according to embodiments of the present invention with any other plant. A preferred method further includes screening the offspring of the hybrid by analyzing events and favorable varietal performance (e.g., yield) detectable according to embodiments of the present invention in the offspring of the hybrid. For example, embodiments of the present invention can be used to track thematic events by using breeding cycles with plants containing other desired traits (e.g., agronomic traits, disease tolerance or resistance, nematode tolerance or resistance, and maturity date). Plants containing thematic events and desired traits can be detected, identified, screened, and rapidly utilized, for example, in multiple rounds of breeding. Thematic events / traits can also be tracked by breeding in combination with other insect resistance traits and / or other herbicide resistance traits, and by methods according to embodiments of the present invention. The latter implementation involves plants containing a combination of the cry1F and cry1Ac genes, or a combination of genes encoding tolerance to the herbicide dicamba. The cry1F and cry1Ac genes confer tolerance to the soybean looper (Pseudoplusia includens), Anticarsia gemmatalis, Epinotia aporema, Omoides indicatus, Rachiplusia NU, Spodoptera frugiperda, Spodoptera cosmoides, Spodoptera eridania, Heliothisvirescens, Heliocoverpa zea, Spilosoma virginica, and Elasmopalpus lignosellus.

[0110] Therefore, embodiments of this aspect can be combined with traits encoding the following resistances: glyphosate resistance (e.g., EPSPS, GOX, GAT in resistant plants or bacteria), glufosinate resistance (e.g., dsm-2, bar), acetyllactone synthase (ALS) inhibitory herbicides (e.g., imidazolinones [such as imazalil], sulfonylureas, triazolylpyrimidine sulfanilines, pyrimidine thiobenzoates, and other chemicals [Csr1, SurA, etc.]), bromobenzonitrile resistance (e.g., Bxn), HPPD (4-hydroxyphenyl) resistance. Resistance to pyruvate-dioxygenase (PDO) enzyme inhibitors, resistance to phytoene desaturase (PDS) inhibitors, resistance to photosystem II herbicides (e.g., psbA), resistance to photosystem I herbicides, resistance to protoporphyrinogen oxidase IX (PPO) inhibitors (e.g., PPO-1), resistance to phenylurea herbicides (e.g., CYP76B1), dicamba degrading enzymes (see, for example, US20030135879), and other traits that can be combined individually or in multiple combinations to provide the ability to effectively control or prevent weed migration and / or resistance to any of the aforementioned types of herbicides.

[0111] Furthermore, cotton event pDAB4468.19.10.3 can be combined with one or more additional inputs (e.g., insect resistance, pathogen resistance, or stress tolerance) or outputs (e.g., increased yield, improved oil profile, enhanced fiber quality, etc.). Therefore, embodiments of the present invention can be used to provide a complete agronomic package for improving crop quality, enabling flexible and cost-effective control of any number of agricultural pests.

[0112] Methods for integrating polynucleotide sequences into specific chromosomal sites in plant cells via homologous recombination have been described in the art. For example, site-specific integration, as described in U.S. Patent Application Publication No. 2009 / 0111188A1, describes the introduction of donor polynucleotide sequences into chromosomal targets using recombinases or integrases. Furthermore, International Patent Application No. WO 2008 / 021207 describes zinc finger-mediated homologous recombination for integrating one or more donor polynucleotide sequences into specific locations in the genome. Recombinases, such as FLP / FRT described in U.S. Patent No. 6720475 or CRE / LOX described in U.S. Patent No. 5,658,772, can be used to integrate polynucleotide sequences into specific chromosomal sites. Finally, the use of a wide range of nucleases to target donor polynucleotides to specific chromosomal locations is described in Puchta et al., PNAS USA 93 (1996) pp. 5055-5060.

[0113] Other methods for site-specific integration in plant cells are generally known and applicable (Kumar et al., Trends in Plant Sci. 6(4)(2001) pp. 155-159). Furthermore, site-specific recombination systems identified in a variety of prokaryotic and lower eukaryotic microorganisms can be applied to plants. Examples of such systems include, but are not limited to, the R / RS recombinase system from the pSR1 plasmid of *Saccharomyces roximate* (Araki et al. (1985) J. Mol. Biol. 182: 191-203) and the Gin / gix system of bacteriophage Mu (Maeser and Kahlmann (1991) Mol. Gen. Genet. 230: 170-176).

[0114] In some embodiments of the invention, it is desirable to integrate or superimpose new transgenes near existing transgenic events. Transgene events selected based on a combination of unique characteristics (e.g., single insertion site, normal Mendelian segregation, and stable expression) and superior efficacy (including herbicide tolerance and agronomic performance within or across multiple environmental locations) can be considered preferred genomic sites. The newly integrated transgene should maintain the transgene expression characteristics of the existing transformant. Moreover, since the flanking sequences of the genome and the chromosomal location of the new integration event have been determined, developing assays for detecting and confirming the new integration event will not be a problem. Finally, the integration of new transgenes into specific chromosomal locations linked to existing transgenes will accelerate the introgression of transgenes into genes from other genetic backgrounds through sexual crossbreeding using conventional breeding methods.

[0115] In some embodiments of the invention, it is desirable to excise a polynucleotide sequence from the transgenic event. For example, transgenic excision as described in U.S. Patent Application Publication No. 2011 / 0191877 employs a zinc finger nuclease to remove a polynucleotide sequence comprising a gene expression cassette from a chromosomally integrated transgenic event. The removed polynucleotide sequence can be an optional marker. Once the polynucleotide sequence is excised and removed, the modified transgenic event can be retargeted by inserting a new polynucleotide sequence. Excision of the polynucleotide sequence and subsequent retargeting of the modified transgenic event can provide numerous benefits, such as the ability to reuse optional markers or overcome unintended alterations to the plant transcriptome due to the expression of a specific gene.

[0116] This document discloses a specific site on chromosome 3 of the A subgenome in the cotton genome, which is ideal for the insertion of heterologous nucleic acids. Therefore, embodiments of the present invention provide a method for introducing heterologous nucleic acids of interest into or near this pre-established target site. Embodiments of the present invention also include a cotton seed and / or cotton plant containing any heterologous nucleotide sequence inserted into or near the disclosed target site. One option for achieving such targeted integration is to cut out the pat expression cassette exemplified herein and / or replace it with a different insert. Targeted homologous recombination may be used, for example, according to embodiments of the present invention, but is not limited thereto.

[0117] As used herein, gene, event, or trait "superposition" refers to the combination of desired traits into a transgenic line. Plant breeders superimpose transgenic traits by crossing parents each possessing the desired trait and then identifying offspring that simultaneously possess those desired traits. Another way to superimpose genes is by simultaneously transferring two or more genes into the plant's cell nucleus during transformation. Yet another way to superimpose genes is by transforming the transgenic plant again with another gene of interest. For example, gene superposition can be used to combine two or more different traits, including, for example, two or more different insect traits, insect resistance traits and disease resistance traits, two or more herbicide resistance traits, and / or insect resistance traits and herbicide resistance traits. The use of optional markers based on the gene of interest can also be considered gene superposition.

[0118] Homologous recombination refers to the reaction between any pair of nucleotide sequences containing similar nucleotide sequences at corresponding positions, through which these two nucleotide sequences can interact (recombine) to form a new recombinant DNA sequence. The sites of similar nucleotide sequences are referred to as "homologous sequences" in this paper. Generally, the frequency of homologous recombination increases with the length of the homologous sequence. Therefore, although homologous recombination can occur between two not completely identical nucleotide sequences, the frequency (or efficiency) of recombination decreases as the difference between the two sequences increases. Recombination can be achieved with one homologous sequence on each donor and target molecule, resulting in a "single crossover" recombination product. Alternatively, two homologous sequences can be placed on each target and donor nucleotide sequence. Recombination between two homologous sequences on the donor and two homologous sequences on the target produces a "double crossover" recombination product. If the homologous sequences on the donor molecule are located flanking the sequence to be manipulated (e.g., the sequence of interest), double crossover recombination with the target molecule will produce a recombination product in which the sequence of interest replaces the DNA sequence originally located between the homologous sequences on the target molecule. The exchange of DNA sequences between the target and donor achieved through a double crossover recombination event is called "sequence substitution."

[0119] Preferred plants or seeds according to embodiments of the present invention contain in their genome the functional aad-12 and pat nucleotide sequences as identified herein, and at least 20-500 or more adjacent flanking nucleotides as identified herein, located on either side of the insert. Unless otherwise stated, the term "flanking sequence" refers to those identified relative to SEQ ID NO: 1 and 2. All or part of these flanking sequences can be expected to be transferred to offspring receiving the inserted DNA due to sexual hybridization of a parental line containing this event.

[0120] Embodiments of the present invention include tissue cultures of regenerable cells of a plant according to one embodiment of the invention. Furthermore, they include plants regenerated from such tissue cultures, particularly when said plants are able to express all the morphological and physiological characteristics of a model variety. Preferred plants of the embodiments of the invention possess all the physiological and morphological characteristics of plants grown from said preserved seeds. Embodiments of the invention further include progeny of such seeds and progeny of seeds possessing the quality traits of interest.

[0121] As used herein, a “strain” refers to a group of plants in which individuals exhibit little or no genetic variation with respect to at least one trait. These strains can be obtained through several generations of self-pollination and selection, or through asexual reproduction from a single parent using tissue or cell culture techniques.

[0122] As used here, the terms “cultivation” and “variety” are synonymous and refer to strains used in commercial production.

[0123] "Stability" or "stable" means that, relative to a given component, the component is maintained between generations, preferably at least three generations.

[0124] "Commercial utility" is defined as having good plant vigor and high fertility, enabling the crop to be produced by farmers using conventional planting equipment, and enabling the extraction of oil containing the said components from the seeds using conventional crushing and extraction equipment.

[0125] "Agronomically excellent" means that a variety, in addition to herbicide tolerance caused by the subject event, possesses desirable agronomic traits such as yield, maturity, and disease resistance. Any or all of these agronomic characteristics and data points can be used to identify such plants, whether as a single point or located at either end of a range of characteristics used to define such plants.

[0126] Those skilled in the art will recognize from this disclosure that preferred embodiments of the detection kit may include, for example, probes and / or primers targeting and / or containing “junction sequences” or “transition sequences” (flanking sequences of the cotton genome that are joined to the insert sequence). This includes, for example, polynucleotide probes, primers, and / or amplicones designed to identify one or both junction sequences (where the insert is joined to the flanking sequence). A common design is that one primer hybridizes to the flanking region and one primer hybridizes to the insert. These primers are typically at least ~15 residues long each. Using this setup, primers can be used to generate / amplify detectable amplicons that indicate the presence of an event according to embodiments of the invention. These primers can be used to generate amplicons that span (and include) the junction sequences as indicated above.

[0127] Primers that "touching down" in the flanking sequence are generally not designed to hybridize more than about 1200 bases beyond the junction. Therefore, a typical flanking primer would be designed to include at least 15 residues on either strand extending up to 1200 bases into the flanking sequence from the insert origin. That is, primers containing appropriately sized sequences from (or hybridizing to) base pairs 154-1672 of SEQ ID NO: 1 and / or base pairs 1-1369 of SEQ ID NO: 2 are within the scope of embodiments of the invention. Primers for the insert can be similarly designed anywhere on the insert, but base pairs 1-6287 of SEQ ID NO: 3 can be used non-exclusively for the design of such primers.

[0128] Those skilled in the art will also recognize that primers and probes can be designed to hybridize under a range of standard hybridization and / or PCR conditions, where the primers or probes are not perfectly complementary to the example sequences. That is, some degree of mismatch or degeneracy is tolerable. For example, for primers of about 20 nucleotides, typically one or two nucleotides do not need to bind to the opposite strand if the mismatched bases are internal or at the end of the primer relative to the amplicon. Various suitable hybridization conditions are provided below. Synthetic nucleotide analogs, such as inosine, can also be used in the probes. Peptide nucleic acid (PNA) probes, as well as DNA and RNA probes, can also be used. Importantly, these probes and primers are capable of identifying (uniquely identifying and distinguishing) the presence of events according to embodiments of the present invention.

[0129] It should be noted that PCR amplification can be error-prone, which may lead to, for example, minor sequencing errors. That is, unless otherwise stated, the sequences listed herein were determined by generating long amplicons from cotton genomic DNA, followed by cloning and sequencing of the amplicons. It is not uncommon to find subtle differences and minor variations among the multiple sequences generated and determined in this manner, given that multiple rounds of amplification are required to generate enough amplicons from the genomic DNA for sequencing. Those skilled in the art will recognize and note that any adjustments required due to these types of common sequencing errors or variations are within the scope of embodiments of this invention.

[0130] It should also be noted that deletions of certain genomic sequences are not uncommon, for example, when a sequence is inserted during the creation process. Therefore, some differences may also occur between the flanking sequences of this topic and, for example, the genomic sequences listed in GENBANK.

[0131] The accompanying drawings illustrate the components of the DNA sequence "insertion," which are discussed in more detail in the examples below. The DNA polynucleotide sequences of these components or fragments thereof can be used as DNA primers or probes for the methods of embodiments of the present invention.

[0132] In some embodiments of the invention, compositions and methods are provided for detecting the presence of transgenic / genomic insertion regions from cotton plants in plants and seeds. DNA sequences are provided that comprise the 5′ transgenic / genomic insertion region junction sequence (base pairs 1354 / 1355 of SEQ ID NO: 1) provided herein, a segment thereof, and complements of the example sequence and any segment thereof. DNA sequences are also provided that comprise the 3′ transgenic / genomic insertion region junction sequence (base pairs 168 / 169 of SEQ ID NO: 2) provided herein, a segment thereof, and complements of the example sequence and any segment thereof. The insertion region junction sequence spans a junction between heterologous DNA inserted into the genome and DNA from cotton cells located flanking the insertion site. These sequences may be able to identify a given event.

[0133] Based on these inserts and boundary sequences, event-specific primers can be generated. PCR analysis shows that cotton lines according to the embodiments of the present invention can be identified in different cotton genotypes by analyzing the PCR amplicon generated using these event-specific primer pairs. These and other related procedures can be used to uniquely identify these cotton lines. Therefore, PCR amplicon derived from such primer pairs are unique and can be used to identify these cotton lines.

[0134] In some embodiments, a DNA sequence containing an adjacent fragment of a novel transgenic / genomic insertion region is one aspect of the invention. This includes DNA sequences comprising a sufficiently long polynucleotide segment of the transgenic insertion sequence and a sufficiently long polynucleotide segment of a cotton genome sequence from one or more of the aforementioned cotton plants, and / or sequences that can be used as primer sequences to generate amplicon products capable of identifying one or more of these cotton plants.

[0135] The relevant embodiments involve DNA sequences comprising at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more adjacent nucleotides, or complementary nucleotides thereof, of the transgenic portion of the DNA sequence identified herein (e.g., SEQ ID NO: 1 and its segment), and flanking cotton DNA sequences of similar length from these sequences, or complementary nucleotides thereof. These sequences can be used as DNA primers in DNA amplification methods. Amplicons generated using these primers can identify any cotton events mentioned herein. Therefore, embodiments of the invention also include amplicons generated from such DNA primers.

[0136] Embodiments of the present invention also include methods for detecting the presence of DNA in a sample corresponding to the cotton event mentioned herein. These methods may include: (a) contacting a DNA-containing sample with a set of primers that, when used in a nucleic acid amplification reaction using DNA from said cotton event, produce an amplicon capable of identifying the event; (b) performing a nucleic acid amplification reaction to produce the amplicon; and (c) detecting the amplicon.

[0137] A further detection method according to an embodiment of the present invention includes a method for detecting the presence of DNA in a sample corresponding to the event, wherein the method includes: (a) contacting a sample containing DNA with a probe that hybridizes with DNA from the cotton event under strict hybridization conditions and does not hybridize with control cotton plants (DNA of non-interest at interest) under strict hybridization conditions; (b) placing the sample and the probe under strict hybridization conditions; and (c) detecting hybridization of the probe with the DNA.

[0138] In a further embodiment, the invention includes a method for producing cotton plants comprising cotton event pDAB4468.19.10.3 of one embodiment of the invention, wherein the method comprises the steps of: (a) sexually crossing a first parental cotton line (containing an expression cassette of one embodiment of the invention, which confers tolerance of the line to 2,4-D and glufosinate) with a second parental cotton line (lacking the aforementioned herbicide tolerance trait) to produce a plurality of progeny plants; and (b) selecting the progeny plants using molecular markers. These methods may optionally include the additional step of backcrossing the progeny plants with the second parental cotton line to produce true-breeding cotton plants containing the herbicide resistance trait.

[0139] According to another aspect of the invention, a method is provided for determining the zygosity of offspring hybridized with said event. The method may include contacting a sample containing cotton DNA with a primer set according to embodiments of the invention. The primers, when used to perform a nucleic acid amplification reaction with genomic DNA from said cotton event, can generate a first amplicon that identifies said cotton event. These methods further include performing a nucleic acid amplification reaction to generate the first amplicon; detecting the first amplicon; and contacting a sample containing cotton DNA with a second primer set (which, when used to perform a nucleic acid amplification reaction with genomic DNA from cotton plants, can generate a second amplicon containing an endogenous sequence of the natural cotton genome and not containing the polynucleotide sequence of said event); and performing a nucleic acid amplification reaction to generate the second amplicon. The method also includes detecting the second amplicon and comparing the first and second amplicons in the sample, wherein the presence of both amplicons indicates a zygosity of transgene insertion.

[0140] DNA detection kits can be developed using the compositions disclosed herein and methods known in the field of DNA detection. These kits can be used to identify a subject cotton event in a sample and can be applied to breeding methods for cotton plants containing that DNA. The kit contains a DNA sequence complementary to, for example, the amplicon disclosed herein, or a DNA sequence complementary to a DNA sequence complementary to the DNA contained in the transgenic genetic element of the subject event. These DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods. The kit may also contain reagents and materials necessary for performing the detection method.

[0141] A "probe" is an isolated nucleic acid molecule to which a conventional detectable marker or reporter molecule (e.g., a radioisotope, ligand, chemiluminescent agent, or enzyme) is attached. This probe is capable of hybridizing with the strand of a target nucleic acid, and in the embodiments of the present invention, with the strand of genomic DNA from one of the cotton events (whether from a cotton plant or from a sample containing DNA from that event). Probes according to embodiments of the present invention include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to the target DNA sequence and are capable of detecting the presence of that target DNA sequence.

[0142] "Primers" are isolated / synthesized nucleic acids that anneal to a target DNA strand through nucleic acid hybridization, thereby forming a hybrid between the primer and the target DNA strand, which is then extended along the target DNA strand by a polymerase, such as DNA polymerase. The primer pairs in this embodiment refer to their use for amplifying target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0143] The lengths of probes and primers are typically 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 4 4, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 1 83, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 21 4, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 33 4, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 3 92, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 1000, 2000, or 5000 polynucleotides or longer. These probes and primers specifically hybridize to the target sequence under strict hybridization conditions. Preferably, the probes and primers according to embodiments of the present invention have complete sequence similarity to the target sequence.Although it is possible to design probes that differ from the target sequence but retain the ability to hybridize with the target sequence using conventional methods,

[0144] Methods for preparing and using probes and primers are described, for example, in *Molecular Cloning: A Laboratory Manual*, 2nd edition, Volumes 1–3, edited by Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. PCR primer pairs can be generated from known sequences using, for example, computer programs designed for this purpose.

[0145] Primers and probes based on the flanking DNA and insert sequences disclosed herein can be used to confirm (and, if necessary, modify) the disclosed sequences by conventional methods, such as by recloning and sequencing these sequences.

[0146] The nucleic acid probes and primers of this invention hybridize with the target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from a transgenic event in a sample. Under certain conditions, nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules. As used herein, if two molecules can form antiparallel double-stranded nucleic acid structures, then the two nucleic acid molecules can be said to specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, then one nucleic acid molecule is called a “complement” of the other nucleic acid molecule. As used herein, when every nucleotide of one molecule is complementary to every nucleotide of another molecule, then the molecules can be said to exhibit “perfect complementarity.” Molecules exhibiting perfect complementarity typically hybridize with sufficient stability to allow them to remain annealed to each other under conventional “high stringency” conditions. Conventional high stringency conditions are described in Sambrook et al., 1989.

[0147] Two molecules are said to exhibit "minimum complementarity" if they can hybridize with each other and possess sufficient stability under at least conventional "low-tightness" conditions to allow them to remain annealed to each other. Conventional low-tightness conditions are described by Sambrook et al., 1989. Nucleic acid molecules only need to exhibit minimal sequence complementarity to form a stable double-stranded structure under the specific solvent and salt concentration used to be used as primers or probes.

[0148] The term "strict condition" or "strictness condition" is a functional definition of the hybridization of a nucleic acid probe with a target nucleic acid (i.e., with a specific nucleic acid sequence of interest), performed using a specific hybridization procedure discussed in Sambrook et al., 1989, 9.52–9.55. See also Sambrook et al., 1989, 9.47–9.52 and 9.56–9.58.

[0149] Depending on the intended application, different stringent conditions or polynucleotide sequence degeneracy of the probe or primer can be used to achieve varying degrees of hybridization selectivity to the target sequence. For applications requiring high selectivity, relatively stringent conditions are typically used to hybridize one polynucleotide sequence with a second polynucleotide sequence; for example, relatively low salt and / or high temperature conditions might be chosen, such as approximately 0.02 M to approximately 0.15 M NaCl and temperatures of approximately 50°C to approximately 70°C. Stringent conditions, for example, might involve washing the hybridization filter membrane at least twice with a high-stringency washing buffer (0.2 × SSC, 0.1% SDS, 65°C). Suitable stringent conditions for promoting DNA hybridization, such as 6.0 × sodium citrate / ammonium chloride (SSC) at approximately 45°C, followed by washing with 2.0 × SSC at 50°C, are known to those skilled in the art. For example, the salt concentration in the washing step can be selected from low stringency (approximately 2.0 × SSC, 50°C) to high stringency (approximately 0.2 × SSC, 50°C). Additionally, the temperature in the washing step can be increased from room temperature (approximately 22°C) under low-critical conditions to approximately 65°C under high-critical conditions. Both temperature and salt concentration can be varied, or the temperature or salt concentration can be kept constant while the other variable is changed. This selection of conditions tolerates small (if any) mismatches between the probe and the template or target strand. Detection of DNA sequences by hybridization is well known to those skilled in the art, and the teachings of U.S. Patent Nos. 4,965,188 and 5,176,995 are examples of hybridization analysis methods.

[0150] In a particularly preferred embodiment, the nucleic acid of one embodiment of the invention specifically hybridizes under high-strictness conditions with one or more primers (or amplicon or other sequences) exemplified or suggested herein, including their complements or fragments. In one aspect of the invention, the biomarker nucleic acid molecule of one embodiment of the invention has a nucleic acid sequence represented herein in one or more example sequences, or its complement and / or fragment.

[0151] In another aspect of the invention, the marker nucleic acid molecule of one embodiment of the invention has 80%-100% or 90% and 100% sequence identity with such a nucleic acid sequence. In a further aspect of the invention, the marker nucleic acid molecule of one embodiment of the invention has 95%-100% sequence identity with such a sequence. Such sequences can be used as markers in plant breeding methods to identify offspring of genetic hybridization. Hybridization of the probe with the target DNA molecule can be detected by any of many methods known to those skilled in the art; including but not limited to, fluorescent tags, radioactive tags, antibody-based tags, and chemiluminescent tags.

[0152] Regarding the amplification of target nucleic acid sequences using specific amplification primer pairs (e.g., by PCR), "strict conditions" are conditions that allow primer pairs to hybridize only with target nucleic acid sequences in a way that primers with the corresponding wild-type sequence (or its complement) will bind to the target nucleic acid sequence and preferably produce a unique amplicon.

[0153] The term "specificity to (target sequence)" means that, under strict hybridization conditions, the probe or primer hybridizes only with the target sequence in a sample containing the target sequence.

[0154] As used herein, "amplified DNA" or "amplifier" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a cotton plant resulting from sexual hybridization contains transgenic event genomic DNA from a cotton plant according to embodiments of the present invention, a nucleic acid amplification method can be used on DNA extracted from a cotton plant tissue sample. This method uses primer pairs comprising a primer from a flanking sequence in the plant genome adjacent to the insertion site of the inserted heterologous DNA, and a second primer from the inserted heterologous DNA, thereby generating an amplifier capable of identifying the presence of the event DNA. The length of the amplifier and the sequence it contains can also identify the event. The length of the amplicon can be varied, from being equal to the total length of the primer pair plus one nucleotide base pair, to being equal to the total length of the primer pair plus approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52. 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112 , 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 , 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208,209，210，211，212，213，214，215，216，217，218，219，220，221，222，223，224，225，226，227，228，229，230，231，232，233，234，235，236，237，238，239，240，241，242，243，244，245，246，247，248，249，250，251，252，253，254，255，256，257，258，259，260，261，262，263，264，265，266，267，268，269，270，271，272，273，274，275，276，277，278，279，280，281，282，283，284，285，286，287，288，289，290，291，292，293，294，295，296，297，298，299，300，301，302，303，304，305，306，307，308，309，310，311，312，313，314，315，316，317，318，319，320，321，322，323，324，325，326，327，328，329，330，331，332，333，334，335，336，337，338，339，340，341，342，343，344，345，346，347，348，349，350，351，352，353，354，355，356，357，358，359，360，361，362，363，364，365，366，367，368，369，370，371，372，373，374，375，376，377，378，379，380，381，382，383，384，385，386，387，388，389，390，391，392，393，394，395，396，397，398，399，400，401，402，403，404，405，406，407，408，409，410，411，412，413，414，415，416，417，418，419，420，421，422，423，424，425，426，427，428，429，430，431，432，433，434，435，436，437，438，439，440，441，442，443，444，445，446，447，448，449，450，451，452，453，454，455，456，457，458，459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, or 500, 750, 1000, 1250, 1500, 1750, 2000 or more nucleotide base pairs (plus or minus any of the increments listed above). Alternatively, primer pairs may be derived from flanking sequences on either side of the inserted DNA, resulting in an amplicon containing the entire inserted nucleotide sequence. Members of primer pairs derived from plant genome sequences may be located at a certain distance from the inserted DNA sequence. This distance can range from one nucleotide base pair to approximately twenty thousand nucleotide base pairs. The term "amplifier" is used to explicitly exclude primer dimers that may form during the thermal amplification reaction of DNA.

[0155] Nucleic acid amplification can be achieved by any of the various nucleic acid amplification methods known in the art, including polymerase chain reaction (PCR). Many amplification methods are known in the art and are described in particular in U.S. Patent Nos. 4,683,195 and 4,683,202. PCR amplification methods have been developed to amplify genomic DNA up to 22 kb. These methods, as well as other methods known in the field of DNA amplification, can be used to implement embodiments of the present invention. Sequences or flanking genomic sequences of heterologous transgenic DNA inserts from the subject cotton event can be validated (and, if necessary, corrected) by amplifying such sequences from the event using primers derived from the sequences provided herein, followed by standard DNA sequencing of the PCR amplicons or cloned DNA.

[0156] Amplicones generated by these methods can be detected using a variety of techniques. Agarose gel electrophoresis and ethidium bromide staining are well-known methods for detecting DNA amplicones. Another such method is genetic bit analysis, in which a DNA oligonucleotide is designed that overlaps with both the adjacent flanking genomic DNA sequence and the inserted DNA sequence. This oligonucleotide is immobilized in the wells of a microplate. After PCR is performed on the region of interest (using a primer from the inserted sequence and a primer from the adjacent flanking genomic sequence), the single-stranded PCR product can hybridize with the immobilized oligonucleotide and, using it as a template, perform a single-base extension reaction using DNA polymerase and a ddNTP-specific label targeting the expected next base. The binding product can be analyzed by quantifying the amount of fluorescence signal. The fluorescence signal indicates the presence of the inserted / flanking sequence due to successful amplification, hybridization, and single-base extension.

[0157] Another approach is pyrosequencing, as described in Winge (Innov.Pharma.Tech.00:18-24, 2000). In this method, oligonucleotides are designed to overlap with the junctions of adjacent genomic DNA and insert DNA. These oligonucleotides are designed to hybridize with single-stranded PCR products from the region of interest (one primer in the insert sequence and one primer in the flanking genomic sequence) and incubated in the presence of DNA polymerase, ATP, sulfatase, luciferase, adenosine triphosphate diphosphatase (apyrase), adenosine 5′ phosphoryl sulfate, and luciferin. dNTPs are added separately, incorporating an inductance that results in a light signal, which is then measured. The light signal indicates the presence of the transgene insert / flanking sequence due to successful amplification, hybridization, and single or multi-base extension.

[0158] Fluorescent polarization is another method that can be used to detect amplicon in embodiments of the present invention. According to this method, oligonucleotides are designed to overlap with genomic flanking and insert DNA junctions. These oligonucleotides are hybridized with single-stranded PCR products from the region of interest (one primer located in the insert DNA and one primer located in the flanking genomic sequence) and incubated in the presence of DNA polymerase and fluorescently labeled ddNTPs. Single-base extension results in the incorporation of ddNTPs. The incorporation of fluorescently labeled ddNTPs can be measured as a polarization change using a fluorometer. The polarization change indicates the presence of transgenic insert / flanking sequences due to successful amplification, hybridization, and single-base extension.

[0159] (PE Applied Biosystems, Foster City, Calif.) is a method for detecting and quantifying the presence of DNA sequences. Briefly, FRET oligonucleotide probes are designed to overlap with genomic flanking and insert DNA junctions. The FRET probes and PCR primers (one primer located in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. During specific amplification periods, the proofreading mechanism of the Taq DNA polymerase releases a fluorescent portion from the quenched portion of the FRET probe. The fluorescent signal indicates the presence of the flanking / transgenic insert sequence due to successful amplification and hybridization.

[0160] Molecular beacons have been described for the detection of polynucleotide sequences. Briefly, FRET oligonucleotide probes are designed to overlap with flanking genomic and insert DNA junctions. The unique structure of the FRET probe results in a secondary structure that keeps the fluorescent and quenched portions in close proximity. The FRET probe and PCR primers (one primer located in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe with the target sequence leads to the removal of the probe's secondary structure and spatial separation of the fluorescent and quenched portions. This results in a fluorescent signal. The fluorescent signal indicates the presence of the flanking genomic / transgenic insert due to successful amplification and hybridization.

[0161] Based on the disclosure of a highly suitable insertion site in the cotton genome, embodiments of the present invention further include cotton seeds and / or cotton plants containing at least one non-cotton event pDAB4468.19.10.3 insert in the region near the genomic location. An option is to replace the insert from the cotton event pDAB4468.19.10.3 exemplified herein with another different insert. Generally, targeted homologous recombination is employed in specific embodiments, for example. Such techniques are, for example, the subject of WO 03 / 080809A2 and the corresponding published U.S. application (US20030232410). Therefore, embodiments of the present invention include plants and plant cells containing a heterologous insert (in place of or together with multiple copies of the aad-12 or pat gene), flanked by either identifiable portions of all flanking sequences identified herein (bp1-1354 of SEQ ID NO: 1 and bp169-2898 of SEQ ID NO: 2). An extra copy (or multiple extra copies) of the aad-12 or pat gene can also be used as a target for insertion in this / these ways.

[0162] The following embodiments are included to illustrate procedures for carrying out embodiments of the invention and to demonstrate certain preferred embodiments of the invention. These embodiments should not be construed as limiting. Those skilled in the art will recognize that the techniques disclosed in the following embodiments are merely specific methods representing preferred modes of practice. However, those skilled in the art will understand, based on this disclosure, that many variations can be made to these specific embodiments without departing from the spirit and scope of the invention, while still obtaining the same or similar results. Unless otherwise stated, all percentages are by weight, and all solvent mixture ratios are by volume.

[0163] Unless otherwise specified, the following abbreviations shall be used.

[0164] bp base pairs

[0165] ℃ Celsius

[0166] DNA deoxyribonucleic acid

[0167] EDTA (ethylenediaminetetraacetic acid)

[0168] kb kilobase

[0169] μg micrograms

[0170] μL

[0171] mL

[0172] M is the molar mass.

[0173] PCR Polymerase Chain Reaction

[0174] PTU (Plant Transcription Unit or Expression Cascade)

[0175] SDS Sodium lauryl sulfate

[0176] SSC is a buffer solution containing a mixture of sodium chloride and sodium citrate, pH 7.0.

[0177] TBE is a buffer solution containing a mixture of Tirs base, boric acid, and EDTA, with a pH of 8.3. Example

[0178] Example 1: Transformation and selection of aad-12 and pat cotton event pDAB4468.19.10.3

[0179] Transgenic cotton (Gossypium hirsutum) carrying the cotton event pDAB4468.19.10.3 was generated through Agrobacterium-mediated transformation and selection using a medium containing glufosinate. Transformation of the cotton cultivar Coker 310 was initiated using the disarmed Agrobacterium strain EHA101 (Hood et al., 1993), which carries the binary vector pDAB4468. Figure 1 The vector contains the selectable marker pat and the gene of interest aad-12 in the T-strand DNA region. The DNA T-strand sequence of pDAB4468 is shown in SEQ ID NO: 3 and is annotated in Table 1 below.

[0180] Table 1: Gene elements located on pDAB4468

[0181]

[0182] Example 2: Characterization of AAD-12 protein from cotton event pDAB4468.19.10.3

[0183] The biochemical properties of the recombinant AAD-12 protein from transgenic cotton event pDAB4468.19.10.3 were characterized. The biochemical properties of the protein were characterized and AAD-12 protein expression was confirmed using quantitative enzyme-linked immunosorbent assay (ELISA).

[0184] The level of AAD-12 protein in cotton event pDAB4468.19.10.3 was determined. Cotton leaf tissue samples were isolated from the test plant and prepared for expression analysis. The samples were analyzed using a detergent containing Brij-56. TM AAD-12 protein was extracted from cotton plant tissues using Tris-HCl solution from Sigma-Aldrich (St. Louis, MO). The plant tissues were centrifuged; the aqueous supernatant was collected, diluted with an appropriate buffer as needed, and analyzed in sandwich mode using an AAD-12 ELISA kit (Beacon Diagnostics, East Falmouth, MA). The kit was used according to the manufacturer's recommended procedures.

[0185] Detection and analysis were performed to investigate the expression stability and heritability (between generations) and (between lineages within the same generation) of the cotton event pDAB4468.19.10.3. The expression of the AAD-12 protein in the cotton event pDAB4468.19.10.3 was stable (non-segregating) and constant across all lineages.

[0186] Vertical comparisons (between generations) of AAD-12 protein expression levels were determined in greenhouse-grown cotton plants (pDAB4468.19.10.3). Expression levels were consistent and stable across T3-T4 generations, with an average expression level of approximately 110-125 ng / cm³. 2 The isolated AAD-12 protein.

[0187] AAD-12 protein expression levels were compared between lineages of the same generation in field-grown cotton plants of the pDAB4468.19.10.3 event. Field expression levels were studied in several T4 generation cotton plants of the pDAB4468.19.10.3 event. The average protein expression levels were consistent and stable, approximately 50-150 ng / cm³. 2 The isolated AAD-12 protein.

[0188] Example 3: Cloning and characterization of the genomic flanking boundary region of cotton event pDAB4468.19.10.3

[0189] The genomic flanking boundary regions adjacent to the T-strand insert of cotton event pDAB4468.19.10.3 were isolated, cloned, and characterized. To characterize the boundary regions and describe the genomic insertion sites, the genomic flanking regions of cotton event pDAB4468.19.10.3 were isolated, comprising a 1,354 bp 5' genomic flanking boundary region sequence (SEQ ID NO: 1) and a 2,730 bp 3' genomic flanking boundary region sequence (SEQ ID NO: 2). The 5' genomic flanking boundary sequence was found to contain highly repetitive sequences, which posed technical difficulties in confirming the genomic sequence of the 5' genomic flanking boundary sequence. The 3' boundary sequence was confirmed using transgene-specific primers and genomic primers.

[0190] BLAST analysis of the genomic flanking boundary sequences of cotton event pDAB4468.19.10.3 was performed on the NCBI nucleotide database to confirm that these regions are of cotton origin. BLAST analysis of the 3′ flanking boundary showed that the sequence was aligned with a single BAC clone (Gossypium hirsutum MX008C17). Further BLAST searches indicated that cotton event pDAB4468.19.10.3 is located on chromosome 3 of the A subgenome of the cotton genome. In summary, characterization of the genomic flanking boundary sequences of cotton event pDAB4468.19.10.3 indicates the presence of a copy of the T-strand from pDAB4468 within the cotton genome.

[0191] Example 3.1: Confirmation of the cotton genome sequence

[0192] To confirm the sequence of the genomic insertion site of cotton event pDAB4468.19.10.3, polymerase chain reaction (PCR) was performed using different primer pairs. Figure 2 (See Tables 2 and 3). Genomic DNA from cotton event pDAB4468.19.10.3 and genomic DNA from other transgenic or non-transgenic cotton control lines were used as templates. The reaction was performed using LATaq. Reagent kit (TaKaRa, Japan).

[0193] Table 2: PCR primers and sequences used to analyze cotton event pDAB4468.19.10.3

[0194]

[0195]

[0196] Table 3: PCR conditions and reaction mixtures used to amplify the boundary region and event-specific sequences in cotton event pDAB4468.19.10.3

[0197]

[0198] PCR amplification and sequencing were performed on the 5′ genomic flanking boundary sequences. These reactions used aad-12 expression cassette-specific primers (e.g., 5endT1, 5endT2, and 5endT3) and primers designed based on the 5′ end boundary sequences of clones obtained from the cotton genome (e.g., 5endG1, 5endG2, and 5endG3) to amplify genomic DNA segments spanning the aad-12 gene and the 5′ genomic flanking boundary sequences. Similarly, to confirm the cloned 3′ genomic flanking boundary sequences, genomic DNA fragments spanning the pat gene and the 3′ genomic flanking boundary sequences were amplified using pat expression cassette-specific primers (e.g., 3endT1, 3endT2, and 3endT3) and primers designed based on the cloned 3′ end boundary sequences (e.g., 3endG1, 3endG2, and 3endG3). Using each primer pair (one primer located at the flanking boundary of cotton event pDAB4468.19.10.3 and one transgene-specific primer), DNA fragments of the expected size were amplified from the genomic DNA of cotton event pDAB4468.19.10.3. Control samples (other transgene cotton lines or non-transgene cotton, Coker 310 control) did not produce PCR amplicons using these primers. The PCR amplification products were subcloned into plasmids and sequenced. This data was used to determine the 5′ and 3′ genomic flanking boundary sequences adjacent to the T-strand insert of cotton event pDAB4468.19.10.3.

[0199] Example 4: Characterizing cotton events pDAB4468.19.10.3 using Southern imprinting.

[0200] Southern blot analysis was used to establish the integration pattern of the cotton event pDAB4468.19.10.3. The data from these experiments demonstrated the integration and integrity of the aad-12 and pat transgenes in the cotton genome. The cotton event pDAB4468.19.10.3 was characterized as a full-length, simple integration event containing a single copy of the aad-12 and pat expression cassettes from plasmid pDAB4468.

[0201] Southern blot data indicated that the T-strand fragment was inserted into the genome of the cotton event pDAB4468. Detailed Southern blot analysis was performed using probes specifically targeting the aad-12 and pat genes contained within the T-strand integration region of pDAB4468, and descriptive restriction endonucleases with cleavage sites in the plasmid, producing intraplasmid hybridization fragments or fragments crossing the plasmid-cotton genomic DNA junction (boundary fragments). The molecular weights of the combination of restriction endonucleases and probes visible from Southern hybridization were unique to this event, establishing an identification pattern for it. These analyses also indicated that the T-strand fragment of pDAB4468 had been inserted into the cotton genomic DNA without any rearrangement of the aad-12 or pat expression cassette.

[0202] Example 4.1: Cotton leaf sample collection and genomic DNA isolation

[0203] Genomic DNA was extracted from leaf tissues of individual cotton plants harvested from individuals bearing the cotton event pDAB4468.19.10.3. Additionally, gDNA was isolated from the conventional cotton plant Coker 310, which contains the representative genetic background of the cotton lines used for transformation and does not contain the aad-12 or pat genes. QIAGEN was used for the extraction. Mini PrepDNA Extraction (Qiagen, CA) Individual genomic DNA was extracted from freeze-dried leaf tissue using a modified manufacturer's protocol. Following extraction, Pico was used. Reagents (Invitrogen, Carlsbad, CA) used together The instrument (Invitrogen) performed quantitative analysis of the DNA using fluorescence spectroscopy. The DNA was then visualized on an agarose gel to confirm the presence of Pico. Analyze the values ​​and determine DNA quality.

[0204] Example 4.2: gDNA digestion and isolation

[0205] For Southern blotting characterization of cotton event pDAB4468.19.10.3, 10 μg of genomic DNA was digested. Genomic DNA from cotton event pDAB4468.19.10.3 and the non-transgenic cotton line Coker 310 was digested by adding approximately 10 units of selected restriction endonuclease / μg DNA and the corresponding reaction buffer to each DNA sample. Each sample was incubated overnight at approximately 37°C. Restriction endonucleases NsiI, NcoI, SbflI, SwaI, and NdeI (New England Biolabs, Ipswich, MA) were used individually for the digestion reaction. Additionally, a positive hybridization control sample was prepared by mixing plasmid DNA pDAB4468 with genomic DNA from the non-transgenic cotton variety Coker 310. The plasmid DNA / genomic DNA cocktail was digested using the same procedure and restriction endonucleases as the test samples. After incubating the digestion system overnight, the enzymatic digestion reaction was terminated by adding NaCl to a final concentration of 0.1 M. The digested DNA sample was precipitated with isopropanol. The precipitated DNA was centrifuged and resuspended in 15 μl of 3X loading buffer (0.01% bromophenol blue, 10.0 mM EDTA, 5.0% glycerol, 1.0 mM Tris, pH 7.5). The DNA sample and molecular weight markers were then electrophoresed on a 0.85% agarose gel at 45 V for approximately 18–22 hours using 0.4X TAE buffer (Fisher Scientific, Pittsburgh, PA) to achieve fragment separation. The gel was stained with ethidium bromide (Invitrogen, Carlsbad, CA) and the DNA was visualized under ultraviolet (UV) light.

[0206] Example 4.3: Southern blotting and membrane treatment

[0207] Southern blotting was performed essentially as described in Memelink, J., Swords, K., Harry J., Hoge, C., (1994) Southern, Northern, and Western Blot Analysis. Plant Mol. Biol. Manual F1: 1-23. In short, after electrophoretic separation and visualization of DNA fragments, the gel was denatured for 20 minutes with 1X denaturing solution (1.5M NaOH, 20mM EDTA), followed by washing with 1X neutralizing solution (1.5M NaPO4, pH 7.8) for at least 20 minutes. Using a wicking system, an overnight Southern transfer was performed on a nylon membrane with 1X transfer buffer (0.25M sodium pyrophosphate, pH 10). After transfer, the membrane was bound to DNA by heating at 65°C for 1 hour or by UV crosslinking, followed by a brief wash with 1X transfer buffer. This process produced a Southern blot membrane ready for hybridization.

[0208] Example 4.4: DNA probe labeling and hybridization

[0209] Use P 32 Radiolabeled probes detect DNA fragments bound to nylon membranes. The probes are generated using PCR-based methods, employing primers specifically targeting genetic elements, and following... Taq polymerase (Qiagen, CA) is generated using the standard manufacturer's procedure. Follow the manufacturer's instructions for READY TO GO LABELING. (Amersham, Piscataway, NJ), with P 32 50 ng of labeled probe DNA specifically targeting each gene element and 25 ng of 1 kb Plus molecular weight ladder (Invitrogen, Carlsbad, CA). Nucleotide manufactured by Amersham was used. Spin column and purify probe according to the manufacturer's experimental protocol.

[0210] Add P 32 Before radiolabeling the probe, the nylon membrane blot containing the fixed DNA was blocked for at least 2 hours at room temperature on a shaker with blocking buffer (2% SDS, 0.5% BSA, 1mM EDTA, 1mM o-phenanthroline), and then sealed with 10 ml Perfect HYB Plus. (Sigma-Aldrich, St. Louis, MO) Prehybridization was performed at 65°C in a hybridization oven for at least 1 hour. The purified labeled probe was denatured in a boiling water bath for 5 minutes, placed on ice for 5 minutes, then added to the blocked and prehybridized membrane, and incubated overnight in a hybridization oven at 65°C.

[0211] After probe hybridization, the probe solution is discarded into radioactive waste. The membranes are then imprinted in their original hybridization tubes using 1X Ribowash. TM Wash the membrane twice in a hybridization oven at 65°C for 15 minutes each time using a wash buffer (200 mM sodium phosphate, 50 mM sodium pyrophosphate, 10 mM EDTA, 2% SDS, pH 7.8). Discard each wash buffer into radioactive waste following standard operating procedures. Remove the membrane from the tube and place it on a clean rinse tray, then wash again at 65°C for an additional 15 minutes using a shaking incubator. Wrap the membrane in plastic film, place it in a film cassette, and expose it to a phoshort imager screen for 1–3 days. Use a BioRad Personal FX Phosphor. Image acquisition is performed following the instructions provided by the equipment and software.

[0212] Table 4 describes the probes used for hybridization. Fragment sizes on the Southern blot were determined using a 1Kb Plus DNA molecular weight ladder (Invitrogen, Carlsbad, CA).

[0213] Table 4: Probe lengths used in Southern analysis of cotton event pDAB4468.19.10.3

[0214] probe name Gene elements Length (bp) aad-12 aad-12 671 Pat pat 525 specR Anti-spectinomycin gene 750 OriRep Copy start point 852 trfA replication initiation protein trfA 1,119

[0215] Example 4.5: Southern Imprint Results

[0216] Table 5 presents the predicted fragment sizes of specific digests and probes based on known restriction enzyme sites of the aad-12 and pat gene expression cassettes, as well as the observed fragment sizes. The predicted fragment sizes are based on the pDAB4468 plasmid map, and the observed fragment sizes are approximate results from these analyses, and are based on the correspondence between the bands and the sizes indicated by the 1Kb Plus DNA molecular weight ladder.

[0217] Two types of fragments were identified from these digests and hybridizations: internal fragments, where the known enzyme sites are located on either side of the probe region and are completely contained within the insertion region of the aad-12 expression cassette, and boundary fragments, where one known enzyme site is located at one end of the probe region and the other is expected to be located within the cotton genome. The size of the boundary fragments varied for each event because, in most cases, the integration site of the DNA fragment is unique for each event. The boundary fragments provide a means of locating the relative positions of the restriction endonuclease sites to the integrated DNA and assessing the amount of DNA insert. Southern blot analysis of multiple generations of cotton lines containing the cotton event pDAB4468.19.10.3 yielded data indicating the insertion of a low-copy, complete aad-12 expression cassette from plasmid pDAB4468 into the cotton genome, resulting in the cotton event pDAB4468.19.10.3.

[0218] Restriction endonucleases NsiI and SwaI bind to and cleave unique restriction sites within plasmid pDAB4468. These enzymes were then used to characterize the aad-12 gene insert from the cotton event pDAB4468.19.10.3. Boundary fragments larger than 6.3 kb or larger than 4.3 kb were expected to hybridize with the probes after digestion (Table 5). Single aad-12 hybridization bands of approximately 7.0 kb and approximately 5.5 kb were observed when using NsiI and SwaI, respectively. Furthermore, the restriction endonuclease NcoI was used to characterize the aad-12 gene insert. The plasmid pDAB4468, used to generate the cotton event pDAB4468.19.10.3, contains a unique NcoI restriction site located in the expression cassette of plasmid pDAB4468, and two additional sites located in the “mainstream” region of plasmid pDAB4468. A boundary fragment larger than 2.8 kb was expected to hybridize with the probe after digestion (Table 5). A single aad-12 hybridization band of approximately 9.75 kb was observed. Hybridization of the probe with a band of this size indicates the presence of a single insertion site for the aad-12 gene in the cotton genome for cotton event pDAB4468.19.10.3. Three restriction endonuclease combinations, Nde, NsiI+NcoI, and NsiI+SbfI, were used to release fragments containing different regions of the aad-12 expression cassette and the pat expression cassette (Table 5). The NdeI restriction endonuclease includes the aad-12 expression cassette element from the Ubi10 promoter to the AtuORF23UTR terminator. After digestion with NdeI, a predicted fragment of 3.5 kb was observed on the blot probed with the aad-12 probe. Double digestion with NsiI and NcoI included both the aad-12 and pat expression cassette elements. Following double digestion, a 3.5 kb predicted fragment was observed on the blot probed with the aad-12 probe (Table 5). The double digestion products of NsiI and SbfI contained both aad-12 and pat expression cassette elements. Following double digestion, a 4.8 kb predicted fragment was observed on the blot probed with the aad-12 probe (Table 5).

[0219] Furthermore, hybridization bands were observed on blots probed with the pat probe and digested with the aforementioned restriction endonucleases (NsiI, NcoI, SwaI, NdeI, NsiI+NcoI, and NsiI+SbfI). The bands produced by the blots indicate the presence of the pat expression cassette in the cotton event pDAB4468.19.10.3. Table 5 lists the fragment sizes predicted from the plasmid map of pDAB4468 and the fragment sizes observed from Southern blots by pat probe. These results for the cotton event pDAB4468.19.10.3 indicate the insertion of a complete aad-12 expression cassette and pat expression cassette from plasmid pDAB4468 into the cotton genome of the cotton event pDAB4468.19.10.3.

[0220] Example 4.6: No main chain sequence exists

[0221] Southern blot analysis was also performed to verify the absence of the spectinomycin resistance gene (specR), the origin of replication (Ori Rep) element, and the replication initiation protein trfA (trfA element) in the cotton event pDAB4468.19.10.3. Following NsiI digestion and hybridization with a specR-specific probe, a band of approximately 12 kb predicted size was observed in the positive control sample (pDAB4468+Coker 310), but not in the negative control or the cotton event pDAB4468.19.10.3. Similarly, following NcoI digestion and hybridization with a mixture of OriRep-specific and trfA-specific probes, a band of approximately 7.25 kb predicted size was observed in the positive control sample (pDAB4468+Coker 310), but not in the negative control or the cotton event pDAB4468.19.10.3. These data indicate that spectinomycin resistance genes, Ori Rep elements, and replication initiation protein trfA are absent in cotton event pDAB4468.19.10.3.

[0222] Table 5: Hybrid fragments predicted and observed in Southern blot analysis. 1. Fragment sizes predicted based on pDAB4468 plasmid maps. 2. Observed fragment sizes are considered approximations from these analyses and are based on P. 32 - The size of the labeled DNA molecular weight fragment.

[0223]

[0224]

[0225]

[0226] Example 5: Tolerance to 2,4-D in field trials

[0227] In the 2010 planting season, the tolerance of cotton event pDAB4468.19.10.3 to post-germination application of the herbicide 2,4-D was studied in a field trial. Herbicide tolerance was assessed after a single post-germination application of 2,4-D to cotton event pDAB4468.19.10.3 at the 2-4 leaf stage. Application of 2,4-D to cotton at this developmental stage represents the application timing typically used by cotton growers to achieve satisfactory weed control.

[0228] Tolerance to 2,4-D was measured by assessing damage to cotton plants at 0–1 day (DAA), 7–8 day (DAA), 12–16 day (DAA), and 24–32 day (DAA) post-application. For the aforementioned 0–1 day time increments, measurements began 6–24 hours post-application. Damage was assessed by grading the percentage of visible damage using a linear percentage scale (1–100%), where 0% represents no visible herbicide damage and 100% represents plant death. The grading was a comprehensive score of any herbicidal symptoms, including epinasty, chlorosis, leaf necrosis, and plant death. Herbicidal symptoms present at 0–1 day (DAA) were predominantly epinasty, while those presenting at subsequent assessments were predominantly chlorosis and necrosis.

[0229] Field trials were conducted at 11 locations across typical cotton-producing regions of the United States: Alabama, Arkansas, California, Georgia, Louisiana, Mississippi, North Carolina, South Carolina, and Tennessee. The trial design consisted of four replicates per treatment. Each replicate was separated by a 10–15 foot (3.04 m–4.57 m) wide bare-soil alley. Each treatment plot was two rows 20 feet (6.09 m) long, with rows typically spaced 36–40 inches (91.44 cm–101.6 cm) apart. The experimental treatments were treated with 2,4-D-amine (Weedar 64). TM NuFarm, BurrRidge, IL) sprayed cotton at rates of 0, 1120, 2240, or 4480 g ae / ha (pDAB4468.19.10.3), with a final solution of 15 gallons (56.78 liters) per acre. Because treatment with 2,4-D at rates far below the minimum tested (1120 g ae / ha) is known to cause plant death, no non-converted cotton control was included in these experiments.

[0230] Table 6 provides the treatment averages for visible damage caused by post-germination application of 2,4-D. Except for a transient overshoot at 0–1 DAA, no agronomically significant herbicide damage was observed in these experiments. Treatment with 4480 g ae / ha of 2,4-D (which is >4X of the rate expected to achieve broad-spectrum weed control) resulted in almost no crop damage after a 7–8 DAA evaluation interval, demonstrating the strong tolerance of cotton event pDAB4468.19.10.3 to 2,4-D.

[0231] Table 6: Percentage of visible damage following application of 2,4-D after germination in cotton event pDAB4468.19.10.3

[0232] 2,4-D ratio (g ae / ha) 0-1DAA 7-8DAA 12-16DAA 24-32DAA 0 0.0 0.0 0.0 0.0 1120 3.6 1.4 0.6 0.0 2240 11.8 3.5 2.7 0.1 4480 19.4 11.0 5.9 0.6

[0233] Example 6: Tolerance to glufosinate in field trials

[0234] In a field trial during the 2010 planting season, the tolerance of cotton event pDAB4468.19.10.3 to post-germination application of glufosinate was investigated. Herbicide tolerance was assessed after a single post-germination application of glufosinate to the 6-8 leaf cotton event pDAB4468.19.10.3, representing the typical timing for glufosinate application to achieve satisfactory weed control.

[0235] Tolerance to glufosinate was measured by assessing cotton plants at 2–4 days (DAA), 7–9 DAA, 13–19 DAA, and 22–29 DAA post-application. Damage assessment was performed by grading the percentage of visible damage using a linear percentage scale (1–100%), where 0% indicates no visible herbicide damage and 100% represents plant death. The grading was a composite score including any herbicide symptoms such as chlorosis, leaf necrosis, growth arrest, and plant death. Herbicide symptoms (when present) were primarily chlorosis and necrosis.

[0236] Field trials were conducted at 11 locations across typical cotton-producing regions of the United States: Alabama, Arkansas, California, Georgia, Louisiana, Mississippi, North Carolina, South Carolina, and Tennessee. The trial design consisted of four replicates per treatment. Each replicate was separated by a 10–15 foot (3.04 m to 4.57 m) wide bare-soil path. Each treatment plot was two rows 20 feet (6.09 m) long, with rows typically spaced 36–40 inches (91.44 cm to 101.6 cm) apart. The experimental treatments were treated with phosmet (Ignite 280SL). TMThe Bayer Research Triangle (NC) conducted cotton spraying events pDAB4468.19.10.3 at rates of 0, 542, 1084, or 2168 g acid equivalents per hectare (g ae / ha), with a final solution of 15 gallons (56.78 liters) per acre. Because glufosinate treatment rates much lower than the lowest tested rate (542 g ae / ha) are expected to cause plant mortality, no non-converted cotton control treatments were included in these experiments.

[0237] Table 7 provides the treatment averages for visible damage caused by post-germination application of glufosinate. Except for transient chlorosis at 2–4 and 7–9 DAA in small plots treated with 2168 g ae / ha (>4 times the typical application rate), no agronomically significant herbicide damage was observed in these experiments. Treatment with 2168 g ae / ha (representing >4 times the rate expected to achieve broad-spectrum weed control) resulted in almost no crop damage beyond the 7–9 DAA assessment interval, demonstrating the strong tolerance of cotton event pDAB4468.19.10.3.

[0238] Table 7: Percentage of visible damage following post-germination application of glufosinate-ammonia in cotton event pDAB4468.19.10.3

[0239] glufosinate-ammonium ratio (g ae / ha) 2-4DAA 7-9DAA 13-19DAA 22-29DAA 0 0.0 0.0 0.0 0.0 542 2.7 1.9 0.1 0.0 1084 6.6 4.0 0.2 0.0 2168 13.5 10.0 2.3 0.3

[0240] Example 7: Tolerance to chlorpyrifos and fluroxypyr in greenhouse trials

[0241] The tolerance of cotton event pDAB4468.19.10.3 to post-germination application of the herbicides chlorpyrifos and fluroxypyr was investigated in a greenhouse trial. Herbicide tolerance was assessed after a single post-germination application of chlorpyrifos and fluroxypyr.

[0242] Seeds from cotton event pDAB4468.19.10.3 were heat-treated in a water bath at 82.5°C for 1 minute, then planted in Metro Mix 360 medium and grown in a greenhouse. The average temperature in the greenhouse was 27°C, with a photoperiod set to 16 hours of light and 8 hours of darkness, using maximum light intensity. Plants were allowed to grow to the 3-leaf stage for a non-randomized study, with each herbicide treated three times in triplicate. Plants were sprayed using a tracked sprayer, adjusted to apply 187 L / ha of Garlon 4. TM Dow AgroSciences, Indianapolis, IN) and Starane (a type of flue-cured tobacco) TMCommercial formulations (Dow AgroSciences, Indianapolis, IN) were used. Non-converted Coker 310 cotton cultivar was used as a negative control. Visible damage was assessed at 3 DAA (days after application) and 11 DAA, compared between each herbicide ratio. Damage was assessed visually and measured as an upper-leaning percentage of cotton plant leaves using a linear percentage scale (1–100%), where 0% indicated no visible herbicide damage and 100% represented plant death.

[0243] Up to 3DAA, the cotton event pDAB4468.19.10.3 demonstrated tolerance to fluroxypyr levels up to 280 g ae / ha (Table 8). Furthermore, the cotton event pDAB4468.19.10.3 demonstrated tolerance to chlorpyrifos (Table 8). At 3DAA, plants from the cotton event pDAB4468.19.10.3 showed moderate tolerance to chlorpyrifos, but by 11DAA, the plants had recovered from the initial high-side response and demonstrated strong tolerance compared to the non-transformed control. Thus, the study demonstrates that the cotton event pDAB4468.19.10.3 provides tolerance to the pyridoxine herbicides chlorpyrifos and fluroxypyr.

[0244] Table 8: Percentage of visible damage observed in cotton events pDAB4468.19.10.3 after post-germination application of herbicides chlorpyrifos and fluroxypyr.

[0245]

[0246] There was no significant difference in the mean values ​​of postscripts using the same letter (P = .05, Student-Newman-Keuls).

[0247] Example 8: Agronomic characterization of cotton event pDAB4468.19.10.3

[0248] In 2010, the agronomic characteristics of cotton event pDAB4468.19.10.3 were quantified in field trials conducted across different geographical locations throughout the cotton belt. These studies compared the agronomic performance of cotton event pDAB4468.19.10.3 (with and without the herbicides 2,4-D and glufosinate) with the non-GMO near-isoline control Coker 310. No agronomically significant unexpected differences were observed between cotton event pDAB4468.19.10.3 and the Coker 310 control. The results of these field trials indicate that cotton event pDAB4468.19.10.3 and the Coker 310 control are agronomically equivalent, and the presence of the T-chain insert from pDAB4468 did not alter the expected agronomic performance of cotton event pDAB4468.19.10.3. Furthermore, the agronomical properties of cotton event pDAB4468.19.10.3 were not altered by the application of the herbicides 2,4-D and glufosinate compared to cotton plants that were not treated with herbicides.

[0249] The assessment of agronomic characteristics included seedling vigor, % plant germination, flower bud formation, number of nodes above white flower (NAWF), and yield determination, evaluated using the criteria shown in Table 9. Harvested fibers were sent to the Fiber and Biopolymer Research Institute, Lubbock, Texas, for evaluation using a high-volume instrument (HVI).

[0250] Table 9: Agronomic characteristics assessed in yield trials

[0251]

[0252] Seeds from cotton event pDAB4468.19.10.3 and the near-isogenic control line Coker 310 were planted at a ratio of 80 seeds per 20-foot row with a row spacing of 34–38 inches (86.36 cm–96.52 cm). This planting design was replicated four times at each site. Each site was arranged according to a completely randomized plot design (CRBD) consisting of three unsprayed plots and four sprayed plots per replicate. Herbicides 2,4-D and glufosinate were sprayed on the plants using standard field application rates and the methods described above. Agronomic traits were measured and plants evaluated using the two central rows (rows 2 and 3). For all agronomic traits measured and statistically analyzed, the agronomic traits of cotton event pDAB4468.19.10.3 were comparable to those of the near-isogenic control line Coker 310. One exception identified was the "% plant germination" result in herbicide-sprayed plots of cotton event pDAB4468.19.10.3. However, the "% plant germination" data points were collected before any herbicide application, and the variation in this measurement can be attributed to environmental factors. No agronomically significant unexpected differences were observed between cotton event pDAB4468.19.10.3 and the Coker 310 control. These field trials demonstrate that cotton event pDAB4468.19.10.3 is agronomically equivalent to the Coker 310 control, and the presence of the T-chain insert from pDAB4468 did not alter the expected agronomic traits of cotton event pDAB4468.19.10.3. Furthermore, the application of herbicides 2,4-D and glufosinate did not alter the agronomic properties of cotton plants in event pDAB4468.19.10.3 compared to those not treated with herbicides.

[0253] Table 10: Statistical data of treated (herbicide sprayed) and untreated (no herbicide sprayed) events compared with near-isogenic control cotton plants.

[0254]

[0255]

[0256] Example 9: Full-length sequence of cotton event pDAB4468.19.10.3

[0257] SEQ ID NO: 21 provides the sequence of cotton event pDAB4468.19.10.3. This sequence contains a 5' genomic flanking sequence, a T-chain insert of pDAB4468, and a 3' genomic flanking sequence. For SEQ ID NO: 21, residues 1-1,354 are the 5' genomic flanking sequence, residues 1,355-7,741 are residues of the pDAB4468 T-chain insert, and residues 7,742-10,471 are the 3' flanking sequence. Therefore, the junction sequence or transition regarding the 5' end of the insert appears at residues 1,354 / 1,355 of SEQ ID NO: 21. The junction sequence or transition regarding the 3' end of the insert appears at residues 7,741 / 7,742 of SEQ ID NO: 21.

[0258] It should be noted that in subsequent generations of plants derived from the cotton event pDAB4468.19.10.3, the actual sequence of the T-strand insert from pDAB4468.19.10.3 may deviate slightly from SEQ ID NO: 21. Deletion or other alterations of the insert are not uncommon during gene introgression. Those skilled in the art will expect to find subtle and minor differences in the sequence in subsequent generations of plants derived from pDAB4468.19.10.3. Therefore, the relevant segments of the plasmid sequence provided herein may contain some minor variations in subsequent generations of plants derived from pDAB4468.19.10.3. Therefore, plants including those with polynucleotides having a certain range of identity with the subject insert sequence are also within the scope of embodiments of the invention. Polynucleotide sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequence of SEQ ID NO: 21 are within the scope of embodiments of the invention. The flanking sequence plus the insertion sequence can be confirmed by referring to the preserved seeds. Therefore, some differences may be identified between SEQ ID NO: 21 and the actual T-chain insertion in subsequent generations of plants derived from cotton event pDAB4468.19.10.3, which are within the scope of embodiments of the present invention.

[0259] Example 10: Tolerance to butyric acid in chlorpyrifos and fluroxypyr in greenhouse trials

[0260] In a greenhouse trial, the tolerance of cotton event pDAB4468.19.10.3 to post-germination application of herbicides containing butyrate groups—chlorpyrifos-B and fluroxypyr-B—was investigated. Herbicide tolerance was assessed after a single post-germination application of these two molecules.

[0261] Seeds from cotton event pDAB4468.19.10.3 were heat-treated in a water bath at 82.5°C for 1 minute, then planted in Metro Mix 360 medium and grown in a greenhouse. The greenhouse temperature was maintained at an average of 27°C, with a photoperiod set of 16 hours light and 8 hours dark, using maximum light intensity. Plants were allowed to grow to the 2-3 leaf stage, and non-randomized studies were conducted with each herbicide, performed three times with four replicates each. The pyridinyl oxyacetic acid herbicides flufenoxuron-B and chlorpyrifos-B, containing an additional butyrate fraction, were obtained and applied to cotton plants. The active ingredients were formulated in solutions of 97% acetone and 3% DMSO, respectively. Additionally, crop oil concentrate was added to a final concentration of 1.25%. Plants were sprayed using a tracked sprayer adjusted to apply 187 L / ha of the formulated technical material. A non-transformed Coker 310 cotton variety was used as a negative control. Visible damage was assessed at 6 HAA (hours after application), 1 DAA (days after application), 3 DAA, 6 DAA, and 14 DAA, and compared between each herbicide ratio. Damage was visually assessed as an upper-leaning percentage of cotton plant leaves using a linear percentage scale (1–100%), where 0% indicated no visible herbicide damage and 100% represented plant death.

[0262] The cotton event pDAB4468.19.10.3 provided tolerance to different concentrations of flufenoxuron-b and chlorpyrifos-b (Tables 11 and 12). At 6 HAA, cotton plants from event pDAB4468.19.10.3 showed moderate levels of tolerance to flufenoxuron-b and chlorpyrifos-b, but by 14 DAA, the plants had recovered from the initial high-side-response and provided strong tolerance compared to the non-transformed control. Thus, the study demonstrates that the cotton event pDAB4468.19.10.3 provides tolerance to the butyric acid forms of the pyridinoxyacetic acid herbicides flufenoxuron-b and chlorpyrifos-b.

[0263]

[0264] sequence list <110> Dow AgroSciences Cui, Yunxing King, Raina Kaiser, Tina Robinson, Andrew Pareddy, Dayakar Toledo, Sandra Braxton, Leon Anderson, David <120> Herbicide-resistant cotton event pDAB4468.19.10.3 <130> 70443 <160> twenty one <170> PatentIn version 3.5 <210> 1 <211> 1672 <212> DNA <213> Artificial sequence <220> <223> The 5' DNA flanking boundary sequence of cotton event pDAB4468.19.10.3. Nucleotides 1-1354 are the genomic sequence. Nucleotides 1355-1672 are insertion sequences. <400> 1 atttacccta gtcgggaagt ggtttcggga ccacaagacc gagtcgtaaa aataattact 60 tgctatattc tatgcttatt atgtgtgaac atgggtatgt ggaagtttca ctccctaatt 120 ttaccaattg catgagaaat tattaattgg gatcaatttg agacattgta aaaatatgat 180 agtctaattc aaatggtcaa ttagtgcatg taccaaaaag agtggttttg catgtcaaat 240 tgcccaaaag atgatgggtg gccggccaag gagtgataat gctccactca ttctaattta 300 aaatgtttcc ttggtgaaca aatgatggga ttaataatag aaaagggaac aaaaaaaaag 360 ggtgtcatac ttgccatcac ctagccgaaa aaccaagaaa aagaagggga taaaagaact 420 tgggggggg gattcggcca ttgcttgcct agggagagtg tttgatgttg tggcataaaa 480 540 ttgcaattgt tctaactaga ggaagaaggg gaagaagat tcggccaagg tggtccttta 600 gaccaaggta tgtttaatgt tgtcttagag atgcatgcat gttttaaata gcccatgttc 660 aaaccttgaa tcttgttgat aacatgagca atcggtcatg agaaagtgtt ggatggagct 720 ttcggttatg gtatgtgtga gaagaacttg attctttctt acctttaagt tttgatggat 780 840 attcatgttt atatatgtta tatgcaacga aaatggttga tgattttgga ggtgattagc 900 ttgaatcggc cacggtatat ccataaacac gatctatgct tgttatgtta ctcatggtta 960 aaacaattcg gctatgacat tcggccatgg atggttgtat tttttttgat gttgtttttg 1020 atgctttagg gcattgaggg ttgattatag atgaggtgag tttcttgatt taaaatttga 1080 tggatgttaa gctaattggg caaccaaagg ttcaatattt ttgttatgag gtcatatgtg 1140 catttcggcc atggtctttg cttgaatatg agatttgtaa tgtgattttc ctaaattgtc 1200 tatgaatttg gttgttgatt tcatggtaat ggtatattga atccatgaga atttagtaag 1260 gttgcattcg gcaacttact tgaaattaaa aatcgatgtc taagcttagg tgatttcgat 1320 gatgatatat gtgtatatac ataagtatat ttccagtcag catcatcaca ccaaaagtta 1380 ggcccgaata gtttgaaatt agaaagctcg caattgaggt ctacaggcca aattcgctct 1440 tagccgtaca atattactca ccggatccta accggtgtga tcatgggccg cgattaaaaa 1500 tctcaattat atttggtcta atttagtttg gtattgagta aaacaaattc gaaccaaacc 1560 aaaatataaa tatatagttt ttatatatat gcctttaaga ctttttatag aattttcttt 1620 aaaaaatatc tagaaatatt tgcgactctt ctggcatgta atatttcgtt aa 1672 <210> 2 <211> 2898 <212> DNA <213> Artificial sequence <220> <223> The 3' DNA flanking boundary sequence of cotton event pDAB4468.19.10.3. Nucleotides 1-168 are insertion sequences. Nucleotides 169-2898 are the genome sequence. <400> 2 gcacatagac accacatca tctcattgat gcttggtaat aattgtcatt agattgtttt 60 tatgcataga tgcactcgaa atcagccaat tttagacaag tatcaacgg atgtgacttc 120 agtacattaa aaacgtccgc aatgtgttat taagttgtct aagcgtcaa gaaaaggtta 180 tcgagtagcc gagttggaac cgtcttaccc aacacgaggt aagtcattaa gcatgtagtg 240 ggtgttattt taatggtca taatgtgtat gtattgatgc tgattggaat gaataaataat 300 acatatatat atatgcatgt acgtatgtga tgatgaaatt gttgaatgaa tgaaaagagg 360 taagatgtac tgagttgttg atctcggcac taaacatgcg ggataccat ttatgaccat 420 gagattggcg ctaagtgcgc gggattaat tgtacagcac taagtgtgcg attcgactat 480 gttgcactaa gtgtgcgaaa tggatatgat gcactaagtg tgcgaattga ccatgcggca 540 ctaagtgtgc gagatggact atgtggcact aagtgtgcga ttgattacg tagcactaag 600 tgtgcgattt gattacgtag cactaagtgt gcgagttgat tatatagcac tgagtgtgcg 660 ggctcaataa atattcgtga atcattacgg acactagtg tgcgacacta tgagtcgat 720 cgcggacagc ggatcgggta agtgttttga gtacatggct attatgtgct atgcttatac 780 ttggtgttga gctcggtaag ttcgaaccta tgtgacaaat atacttgaag tcacgtacat 840 aaaatttatc gtaggatggg tgaaaggccg tatagtcgtt tggttgtaac gaaaataat 900 cgatttacga aattgcttca atgtcctatt gatgagtata tagaatgtga atgcatgaat 960 tgatatgaaa ttgaattgat aagttggagg aactatggta tggttcggta tggatggagt 1020 aaattgtctc gttccatttt gtttcctctt gtgataatgt cgttgataga tggtagtgca 1080 ttgcttatga cttactgagt tataaactca ctcgatgttt ccttgtcacc cactataggt 1140 tgcttggact catctatttt tgcggggtcg ggccgtcatt gaagtcatca caccggatag 1200 caagttttgg tactttcttc ttagtgtgct tagagatca ttttggcatg tataagctag 1260 tacgttgtgt ttgaattatg gcatgtaaac tttaagccat gcgaaaatgg cacgaatgtt 1320 cgattgagtt ggatcaaggg taggcatgaa atggacatag ttactttcgt aacagatgct 1380 ggcggcagca gtgtcatgag attgaaaaat cactaaaaat agtaggagtg gaattaattg 1440 atgaataaat tatgtaatcg aagctcgatg agtctgcttt catgaggaag taacgaaatg 1500 atcatatggg fótatatta agagataatc agatttttgt gggacagggc cagaacggtt 1560 tctggattcc ctgctccgac tttggtaatt cattataaat taaccagaga taattagggg 1620 tcgtaccata tatgtacaga ttcctctcta agtctagttt tcatagaaac aaacggcaac 1680 agtattgaag ccccgtgcag ggagatatcc cagtcgtaat gggaaaaggt cagtgtagtc 1740 gacacctgca acttggggga ctttgactaa taaactgtaa taattggccc aaccaaaaaat 1800 tctagaaaaa aatacataga tgggcaaatg agtctagttt ctgggaaaaa ttacgaaact 1860 gattttcgag ttacgaaact caagatatga tttttaaagc ggctagtaca cagattgggc 1920 agtgtctgga aaataaattt tgtaaggggt taaagccaga taacacctcg tgttcgactc 1980 cggtgtcggt ttcgggttcg gggtgttaca ttttatggt atcagagcta tggtttagtc 2040 ggttctagga ctaccatagc acgtatgagt ctagctatac atgccataat gttaatgttt 2100 aaaagggtga tgacttctga cggttgaaat gtttttgtct tgattagtaa atggatcccg 2160 gtgaagaaag aaccctagcg gatgacgttg agagcgtagc ggctgctcct gcacaaggga 2220 cgccgcctgt tgaacctcag tcatctgcga ataatcaagg tgagggggct aaacaagcct 2280 tctttaccat gatgaatgag tgggtcgcgc agtatgcccg agccaacccg gctgtccaac 2340 aattcccaaa tttgaataat ccaccccaag agcctgtaat gccatcagtc gctgatcctg 2400 tgaggctgag taagccaccg gtagacttga ttaggaagcg tggggccgag gagttcaagg 2460 ccatagtaac tgatgatgcc gaaagggccg agttctggct tgataacacc attcgggtgc 2520 tcgatgaatt gtcatgcaca cccgatgaat gtctaaaatg tgctgtatct ttgttgcgag 2580 actcagccta ctattggtgg aggaccttga tttccatagt cccgaacgag cgagtaactt 2640 gggacttctt tcaaacgaaa ttccgaaaga aatttattag ccagcggttc attgatcaga 2700 agcgtaagga gttcttggaa ctcaagcaag gccgtatgac tgtatctgaa tacgaacatg 2760 aattcgtaag acttagtagg tatgcccggg agtgtgtagc tgatgaggtt gctatgtgca 2820 aaagatttga ggaaggattg aatgaagatt taaagctact aatgggtatt ttggaaataa 2880 aggaatttgt aacactag 2898 <210> 3 <211> 6387 <212> DNA <213> Artificial Sequence <220> <223> T-strand DNA sequence of PDAB4468 <400> 3 agtcagcatc atcacaccaa aagttaggcc cgaatagttt gaaattagaa agctcgcaat 60 tgaggtctac aggccaaatt cgctcttagc cgtacaatat tactcaccgg atcctaaccg 120 gtgtgatcat gggccgcgat taaaaatctc aattatattt ggtctaattt agtttggtat 180 tgagtaaaac aaattcgaac caaaccaaaa tataaatata tagtttttat atatatgcct 240 ttaagacttt ttatagaatt ttctttaaaa aatatctaga aatatttgcg actcttctgg 300 catgtaatat ttcgttaaat atgaagtgct ccatttttat taactttaaa taattggttg 360 tacgatcact ttcttatcaa gtgttactaa aatgcgtcaa tctctttgtt cttccatatt 420 catatgtcaa aacctatcaa aattcttata tatctttttc gaatttgaag tgaaatttcg 480 ataatttaaa attaaataga acatatcatt atttaggtat catattgatt tttatactta 540 attactaaat ttggttaact ttgaaagtgt acatcaacga aaaattagtc aaacgactaa 600 aataaataaa tatcatgtgt tattaagaaa attctcctat aagaatattt taatagatca 660 tatgtttgta aaaaaaatta attttacta acacatatat ttacttatca aaaatttgac 720 aaagtaagat taaataata ttcatctaac aaaaaaaaaa ccagaaaatg ctgaaaaccc 780 ggcaaaaccg aaccaatcca aaccgatata gttggtttgg tttgattttg atataaaccg 840 aaccaactcg gtccatttgc acccctaatc samaagctt taatatttca agatattatt 900 aagttaacgt tgtcaatatc ctggaaattt tgcaaaatga atcaagccta tatggctgta 960 atatgaattt aaaagcagct cgatgtggtg gtaatatgta atttacttga ttctaaaaaa 1020 atatcccaag tattaataat ttctgctagg aagaaggtta gctacgattt acagcaaagc 1080 cagaatacaa tgaaccataa agtgattgaa gctcgaaata tacgaaggaa caaatatttt 1140 taaaaaaata cgcaatgact tggaacaaaa gaaagtgata tatttttgt tcttaaacaa 1200 gcatcccctc taaagaatgg cagttttcct ttgcatgtaa ctattatgct cccttcgtta 1260 caaaaatttt ggactactat tgggaacttc ttctgaaaat agtggccacc gcttaattaa 1320 ggcgcgccat gcccgggcaa gcggccgcac aagttttgtac aaaaaagcag gctccgcggt 1380 gactgactga aaagcttgtc gacctgcagg tcaacggatc aggatattct tgtttaagat 1440 gttgaactct atggaggttt gtatgaactg atgatctagg accggataag ttcccttctt 1500 catagcgaac ttattcaaag aatgttttgt gtatcattct tgttacattg ttattaatga 1560 aaaaatatta ttggtcattg gactgaacac gagtgttaaa tatggaccag gccccaaata 1620 agatccattg atatatgaat taaataacaa gaataaatcg agtcaccaaa ccacttgcct 1680 ttttaacga gacttgttca ccaacttgat acaaaagtca ttatcctatg caaatcaata 1740 atcatacaaa aatatccaat aacactaaaa attaaaaga aatggataat ttcacaatat 1800 gttatacgat aaagaagtta cttttccaag aaattcactg attttataag cccacttgca 1860 ttagataaat ggcaaaaaaa aaaaaagg aaaagaaata aagcacgaag aattctagaa 1920 aatacgaaat acgcttcaat gcagtgggac ccacggttca attattgcca atttcagct 1980 ccaccgtata tttaaaaaat aaaacgataa tgctaaaaaa atataaatcg taacgatcgt 2040 taaatctcaa cggctggatc ttatgacgac cgttagaaat tgtggttgtc gacgagtcag 2100 tataaacgg cgtcaaagtg gttgcagccg gcacacacga gtcgtgttta tcaactcaaa 2160 gcacaaatac ttttcctcaa cctaaaaata aggcaattag ccaaaaacaa ctttgcgtgt 2220 aaacaacgct caatacacgt gtcattttat tattagctat tgcttcaccg ccttagcttt 2280 ctcgtgacct agtcgtcctc gtctttcttt cttctttctc tataaaacaa tacccaaagc 2340 ttcttcttca caattcagat ttcaatttct caaaatctta aaaactttct ctcaattctc 2400 tctaccgtga tcaaggtaaa tttctgtgtt cttattctc tcaaaatctt cgattttgtt 2460 ttcgttcgat cccaatttcg tatatgttct ttggtttaga ttctgttaat cttagatcga 2520 agacgattt ctgggtttga tcgttagata tcatcttaat tctcgattag ggtttcataa 2580 atatcatccg atttgttcaa ataatttgag ttttgtcgaa taattactct tcgatttgtg 2640 atttctatct agatctggtg ttagtttcta gtttgtgcga tcgaatttgt cgattaatct 2700 gagtttttct gattacaga gatctccatg gctcagacca ctctccaaat cacacccact ggtgccacct tgggtgccac agtcactggt gttcaccttg ccacacttga cgatgctggt 2820 ttcgctgccc tccatgcagc ctggcttcaa catgcactct tgatcttccc tgggcaacac ctcagcaatg accaacagat tacctttgct aaacgctttg gagcaattga gaggattggc ggaggtgaca ttgttgccat atccaatgtc aaggcagatg gcacagtgcg ccagcactct cctgctgagt gggatgacat gatgaaggtc attgtgggca acatggcctg gcacgccgac 3060 tcaacctaca tgccagtcat ggctcaagga gctgtgttca gcgcagaagt tgtcccagca gttgggggca gaacctgctt tgctgacatg agggcagcct acgatgccct tgatgaggca 3180. acccgtgctc ttgttcacca aaggtctgct cgtcactccc ttgtgtattc tcagagcaag 3240 ttgggacatg tccaacaggc cgggtcagcc tacataggtt atggcatgga caccactgca actcctctca gaccattggt caaggtgcat cctgagactg gaaggcccag cctcttgatc ggccgccatg cccatgccat ccctggcatg gatgcagctg aatcagagcg cttccttgaa 3420 ggacttgttg actgggcctg ccaggctccc agagtccatg ctcaccaatg ggctgctgga 3480 gatgtggttg tgtgggacaa ccgctgtttg ctccaccgtg ctgagccctg ggatttcaag 3540 ttgccacgtg tgatgtggca ctccagactc gctggacgcc cagaaactga gggtgctgcc 3600 ttggtttgag tagttagctt aatcacctag agctcggtca ccagcataat ttttattaat 3660 gtactaaatt actgttttgt taaatgcaat tttgctttct cgggatttta atatcaaaat 3720 ctatttagaa atacacaata ttttgttgca ggcttgctgg agaatcgatc tgctatcata 3780 aaaattacaa aaaaatttta tttgcctcaa ttattttagg attggtatta aggacgctta 3840 aattatttgt cgggtcacta cgcatcattg tgattgagaa gatcagcgat acgaaatatt 3900 cgtagtacta tcgataattt atttgaaaat tcataagaaa agcaaacgtt acatgaattg 3960 atgaaacaat acaaagacag ataaagccac gcacatttag gatattggcc gagattactg 4020 aatattgagt aagatcacgg aatttctgac aggagcatgt cttcaattca gcccaaatgg 4080 cagttgaaat actcaaaccg ccccatatgc aggagcggat cattcattgt ttgtttggtt 4140 gcctttgcca acatgggagt ccaaggttgc ggccgcgcgc cgacccagct ttcttgtaca 4200 aagtggttgc ggccgcttaa ttaaatttaa atgcccgggc gtttaaacgc ggccgcttaa 4260 ttaaggccgg cctgcagcaa acccagaagg taattatcca agatgtagca tcaagaatcc 4320 aatgtttacg ggaaaaacta tggaagtatt atgtaagctc agcaagaagc agatcaatat 4380 gcggcacata tgcaacctat gttcaaaat gaagaatgta cagatacaag atcctatact 4440 gccagaatac gaagaagaat acgtagaaat tgaaaaagaa gaaccaggcg aagaaaagaa 4500 tcttgaagac gtaagcactg acgacaacaa tgaaaagaag aagataaggt cggtgattgt 4560 gaaaagagaca tagaggacac atgtaaggtg gaaaatgtaa gggcggaaag taaccttatc 4620 acaaaggaat cttatccccc actacttatc cttttatatt tttccgtgtc atttttgccc 4680 ttgagttttc ctatataagg aaccaagttc ggcatttgtg aaaacaagaa aaaatttggt 4740 gtaagctatt ttctttgaag tactgaggat acaacttcag agaaatttgt aagtttgtag 4800 atctccatgt ctccggagag gagaccagtt gagattaggc cagctacagc agctgatatg 4860 gccgcggttt gtgatatcgt taaccattac attgagacgt ctacagtgaa ctttaggaca 4920 gagccacaaa caccacaaga gtggattgat gatctagaga ggttgcaaga tagataccct 4980 tggttggttg ctgaggttga gggtgttgtg gctggtattg cttacgctgg gccctggaag 5040 gctaggaacg cttacgattg gacagttgag agtactgttt acgtgtcaca taggcatcaa 5100 aggttgggcc taggatccac attgtacaca catttgctta agtctatgga ggcgcaaggt 5160 tttaagtctg tggttgctgt tataggcctt ccaaacgatc catctgttag gttgcatgag 5220 gctttgggat acacagcccg gggtacattg cgcgcagctg gatacaagca tggtggatgg 5280 catgatgttg gttttggca aagggatttt gagttgccag ctcctccaag gccagttagg 5340 ccagttaccc agatctgagg taccctgagc ttgagcttat gagcttatga gcttagagct 5400 cggatccact agtaacggcc gccagtgtgc tggaattcgc ccttgactag ataggcgcc 5460 agatcggcgg caatagcttc ttagcgccat cccgggttga tcctatctgt gttgaaatag 5520 ttgcggtggg caaggctctc tttcagaaag acaggcggcc aaaggaaccc aaggtgaggt 5580 gggctatggc tctcagttcc ttgtggaagc gcttggtcta aggtgcagag gtgttagcgg 5640 5700. 5700. 5700. 5700. 5700. 5700. 5700. 5700. 5700. 5700 tatgtattca tcactatat aatcagtgta ttccaatatg tactacgatt tccaatgtct ttattgtcgc cgtatgtaat cggcgtcaca aataatccc cggtgacttt cttttaatcc aggatgaaat aattgttat fathertttt gcgatttggt ccgttatagg aattgaagtg tgcttgcggt cgccaccact cccatttcat aatttcat gtatttgaaa aataaaatt tatggtattc aatttaaaca cgtatacttg taagaatga tatcttgaaa gaaatatagt ttaatattt attgataaaa taacaagtca ggtattatag tccaagcaaa aacataaatt 6120. 6120. 6120. 6120. 6120. 6120. 6120. 6120. 6120. 6120 gccgtagatg aaagactgag tgcgatatta tggtgtaata catagcggcc gggtttctag tcaccggtta ggatccgttt aaactcgagg ctagcgcatg cacatagaca cacacatcat ctcattgatg cttggtaata attgtcatta gattgttttt atgcatagat gcactcgaaa tcagccaatt ttagacaagt atcaaacgga tgtgacttca gtacattaaa aacgtccgca 6360 atgtgttatt aagttgtcta agcgtca 6387 <210> 4 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 3endG1 <400> 4 tcagagaatc ctaactgctt gcca 24 <210> 5 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 3endG2 <400> 5 ttggttgttg atttcatggt aatggt 26 <210> 6 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 3endG3 <400> 6 gagaatttag taaggttgca ttcggc 26 <210> 7 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 5endG1 <400> 7 cgcatgttta gtgccgagat caac 24 <210> 8 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 5endG2 <400> 8 acatagtgtc cgtaatgatt cacg 24 <210> 9 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 5endG3 <400> 9 gtgccgagat caacaactca gtac 24 <210> 10 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 5endT1 <400> 10 gtgttgccca gggaaga 17 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 5endT2 <400> 11 atgttgaagc caggctgc 18 <210> 12 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 5endT3 <400> 12 cacagaaatt taccttgatc acgg 24 <210> 13 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 3endT1 <400> 13 ccagaaggta attatccaag atgt 24 <210> 14 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 3endT2 <400> 14 gacagagcca caaacaccac aaga 24 <210> 15 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer 3endT3 <400> 15 agatcggcgg caatagcttc t 21 <210> 16 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer BACG6 <400> 16 agaagaaggg agtgaagcaa tcggtcat 28 <210> 17 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer UbiRev <400> 17 cggtcctaga tcatcagttc ataca 25 <210> 18 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer GHBACA6 <400> 18 ataggtgcct aatgtgacag cccaaa 26 <210> 19 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primer AAD3B1 <400> 19 cgtttagcaa aggtaatctg ttggtca 27 <210> 20 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotide primers 5endPLs <400> 20 ttaacgaaat attacatgcc agaagagtcg 30 <210> twenty one <211> 10471 <212> DNA <213> Artificial sequence <220> <223> The full-length sequence of the cotton event pDAB4468.19.10.3 <400> twenty one atttacccta gtcgggaagt ggtttcggga ccacaagacc gagtcgtaaa aataattact 60 tgctatattc tatgcttatt atgtgtgaac atgggtatgt ggaagtttca ctccctaatt 120 ttaccaattg catgagaaat tattaattgg gatcaatttg agacattgta aaaatatgat 180 agtctaattc aaatggtcaa ttagtgcatg taccaaaaag agtggttttg catgtcaaat 240 tgcccaaaag atgatgggtg gccggccaag gagtgataat gctccactca ttctaattta 300 aaatgtttcc ttggtgaaca aatgatggga ttaataatag aaaagggaac aaaaaaaag 360 ggtgtcatac ttgccatcac ctagccgaaa aaccaagaaa aagaagggga taaaagaact 420 tggggggggg gattcggcca ttgcttgcct agggagagtg tttgatgttg tggcataaaa 480 aatgagggag tttgaatgct taacaaggag ggaagaagga gtgttcatat tttctttctt 540 ttgcaattgt tctaactaga ggaagaaggg gaaacaagat tcggccaagg tggtccttta 600 gaccaaggta tgtttaatgt tgtcttagag atgcatgcat gttttaaata gcccatgttc 660 aaaccttgaa tcttgttgat aacatgagca atcggtcatg agaaagtgtt ggatggagct 720 ttcggttatg gtatgtgtga gaagaacttg attctttctt acctttaagt tttgatggat 780 caagaaaaca aaaggttgtt gatgaaagaa attaatgtat taagagatta tatgaaactt 840 attcatgttt atatatgtta tatgcaacga aaatggttga tgattttgga ggtgattagc 900 ttgaatcggc cacggtatat ccataacac gatctatgct tgttatgtta ctcatggtta aaacaattcg gctatgacat tcggccatgg atggttgtat tttttttgat gttgttttg atgctttagg gcattgaggg ttgattatag atgaggtgag tttcttgatt taaaatttga tggatgttaa gctaattggg caaccaaagg ttcaatattt ttgttatgag gtcatatgtg catttcggcc atggtctttg cttgaattg agatttgtaa tgtgattttc ctaaattgtc 1260. 1260. 1260. 1260. 1260. 1260. 1260. 1260. 1260 gttgcattcg gcaacttact tgaattaaa aatcgatgtc tagcttagg tgatttcgat gatgatatat gtgtatac father ttccagtcag catcatcaca ccaaaagtta ggcccgaata gtttgaaatt agaaagctcg caattgaggt ctacaggcca aattcgctct 1500. 1500. tagccgtaca attackcggatcct accggtgtga tcatgggccg cgattaaaaa tctcaattat atttggtcta atttagtttg gtattgagta aaacaaattc gaaccaaacc aaatataaa fatherttt ttatatatat gcctttaaga ctttttatag aattttcttt aaaaataatc tagaatatt tgcgactctt ctggcatgta atattcgtt aaatatgaag 1680 tgctccattt ttattaactt taaatattg gttgtacgat cacttctta tcaagtgtta 1740 ctaaaatgcg tcaatctct tgttctcca tattcatatg tcaaaccta tcaaattct 1800 Tatatacttt Tttcgaattt Gaagtgaat Ttcgaattt Taaaatttaa Tagacaat 1860 cattattag gtatcatatt gatttttata cttaattact aaatttggtt aactttgaaa 1920 gtgtacatca acgaaaaatt agtcaacga ctaaaataa taatatcat gtgttattaa 1980 gaaaattctc ctataagaat attttaatag atcatatgtt tgtaaaaaaa attaattttt 2040 actacacat atttactt atcaaaatt tgacaagta agattaat atattcatc 2100 taacaaaaaaaaaaccagaa atgctgaaa acccggcaa accgaaccaa tccaaccga 2160 tatagttggt ttggttgat ttgattaa accgaaccaa ctcggtccat ttgcacccct 2220 aatcatata gctttaatat ttcagatat tattagtta acgttgtcaa tattcctggaa 2280 attttgcaaa atgaatcaag cctatatggc tgtatatatga atttaaaagc agctcgatgt 2340 ggtgtata tgtaatttac ttgattctaa aaaaataatcc caagtattaa taatttctgc 2400 taggagag gttagctacg attacagca aagccagaat acatgaacc aataagtgat 2460 tgaagctcga atatacgaa ggacaata ttttaaaaa atacgcaat gacttggaac 2520 aaaagaaagt gatatatttt ttgttcttta acagcatcc cctctaaaga atggcagttt 2580 tcctttgcat gtaactatta tgctccctc gttacaaaa ttttggacta ctattgggaa 2640 cttcttctga aaatagtggc caccgcttaa ttaggcgcg ccatgcccgg gcaagcggcc 2700 gcacaagttt gtacaaaaaa gcaggctccg cggtgactga ctgaaaagct tgtcgacctg 2760 caggtcaacg gatcaggata ttctgttta agatgttgaa ctctatggag gtttgtatga 2820 actgatgatc taggaccgga taagttccct tctcatagc gaacttattc aagaatgtt 2880 ttgtgtatca ttctgttac attgttatta atgaaaaaat attattggtc attggactga 2940 acacgagtgt taaatatgga ccaggcccca aaagatcc attgatatat gattaata 3000 acaagaataa atcgagtcac cacacact gcctttttta acgagacttg ttcaccact 3060 tgatacaaaa gtcattatcc tatgcaatc aaatcata CAAAATATc caatacact 3120 aaaaattta aagaatgga taatttcaca atatgttata cgaataagaa gttactttc 3180 caaaaattc actgatttta taagcccact tgcattagat aaatggcaa aaaaaaaaaaaa 3240 aaggaaaga aaaagcac gagaatttct agaaatacg aaatacgctt caatgcagtg 3300 ggaccacgg ttcattatt gccaatttc agctccaccg tatattaa aataaaacg 3360 ataatgctaa aaaataata atcgtaacga tcgttaatc tcaacggctg gatcttatga 3420 cgaccgttag aaattgtggt tgtcgacgag tcagtaataa acggcgtcaa agtggttgca 3480 gccggcacac acgagtcgtg tttatcaact caaagcacaa atactttcc tcaacctaaa 3540 aaaggcaa ttagccaaaaaactttgc gtgtaaacaa cgctcaatac acgtgtcatt 3600 ttattag ctattgcttc accgccttag ctttctcgtg acctagtcgt cctcgtcttt 3660 tcttctctt cttcttaaa acaataccca aagctcttc ttcacaatc agatttcaat 3720 ttctcaaat cttaaaaact ttctcaat tctctacc gtgatcaag taatttctg 3780 tgttccttat tctctcaaaa tcttcgattt tgttttcgtt cgatcccaat ttcgtatatg 3840 ttctttggtt tagattctgt taatcttaga tcgaagacga ttttctgggt ttgatcgtta 3900 gatatcatct taattctcga ttagggtttc ataaatatca tccgatttgt tcaaataatt 3960 tgagttttgt cgaataatta ctcttcgatt tgtgatttct atctagatct ggtgttagtt 4020 tctagtttgt gcgatcgaat ttgtcgatta atctgagttt ttctgattaa cagagatctc 4080 catggctcag accactctcc aaatcacacc cactggtgcc accttgggtg ccacagtcac 4140 tggtgttcac cttgccacac ttgacgatgc tggtttcgct gccctccatg cagcctggct 4200 tcaacatgca ctcttgatct tccctgggca acacctcagc aatgaccaac agattacctt 4260 tgctaaacgc tttggagcaa ttgagaggat tggcggaggt gacattgttg ccatatccaa 4320 tgtcaaggca gatggcacag tgcgccagca ctctcctgct gagtgggatg acatgatgaa 4380 ggtcattgtg ggcaacatgg cctggcacgc cgactcaacc tacatgccag tcatggctca 4440 aggagctgtg ttcagcgcag aagttgtccc agcagttggg ggcagaacct gctttgctga 4500 catgagggca gcctacgatg cccttgatga ggcaacccgt gctcttgttc accaaaggtc 4560 tgctcgtcac tcccttgtgt attctcagag caagttggga catgtccaac aggccgggtc 4620 agcctacata ggttatggca tggacaccac tgcaactcct ctcagaccat tggtcaaggt 4680 gcatcctgag actggaaggc ccagcctctt gatcggccgc catgcccatg ccatccctgg 4740 catggatgca gctgaatcag agcgcttcct tgaaggactt gttgactggg cctgccaggc 4800 tcccagagtc catgctcacc aatgggctgc tggagatgtg gttgtgtggg acaaccgctg 4860 tttgctccac cgtgctgagc cctgggattt caagttgcca cgtgtgatgt ggcactccag 4920 actcgctgga cgcccagaaa ctgagggtgc tgccttggtt tgagtagtta gcttaatcac 4980 ctagagctcg gtcaccagca taatttttat taatgtacta aattactgtt ttgttaaatg 5040 caattttgct ttctcgggat tttaatatca aaatctattt agaaatacac aatattttgt 5100 tgcaggcttg ctggagaatc gatctgctat cataaaaatt acaaaaaaat tttatttgcc 5160 tcaattattt taggattggt attaaggacg cttaaattat ttgtcgggtc actacgcatc 5220 attgtgattg agagatcag cgatacgaaa tattcgtagt actatcgata atttatttga 5280 aaattcaata gaaagcaa cgttacatga attgatgaa caatacaag acataag 5340 cacgcacat taggattatt ggccgagatt actgaatatt gagtagatc acggaatttc 5400 tgacaggagc atgtcttcaa ttcagcccaa atggcagttg aaatactcaa accgccccat 5460 atgcaggagc ggatcattca ttgttgtttt gttgcttt gccacatgg ggtccaagg 5520 tgcggccgc gcgccgaccc agctcttg tacaaagtgg tgcggccgc ttaattaat 5580 ttaaatgccc gggcgtta acggcggccgc ttaatttagg ccggcctgca gcaaacccag 5640 aaggtatta tccagatgt agcatcaag atccaatgtt tacgggaaa actatggaag 5700 tattatgtaa gctcagcaag aagcagatca atatgcggca catatgcaac ctatgttcaa 5760 aaatgagaa tgtacagata caatccta tactgccaga atacgaagaa gatacgtag 5820 aaattgaaaa agagaacca ggcgaagaaa agatcttga agacgtaagc actgacgaca 5880 acaatgaaaa gagaata aggtcggtga ttgtgaaga gaatagagg acacatgtaa 5940 ggtggaaaat gtaagggcgg aaagtaacct tatcacaag gatcttatc cccactact 6000 tattcctttta tattttccg tgtcatttt gcccttgagt tattccttat aaggaaccaa 6060 gttcggcatt tgtgaaaaca agaaaaaatt tggtgtaagc tattttctt gaagtactga 6120 ggatacaact tcagagaaat ttgtaagttt gtagatctcc atgtctccgg agaggagacc 6180 agttgagatt aggccagcta cagcagctga tatggccgcg gtttgtgata tcgttaacca 6240 ttacattgag acgtctacag tgaactgag gagagcca storm storm agagtggat 6300 tgatgatcta gagaggttgc aagatagata cccttggttg gttgctgagg tgaggttgt 6360 tgtggctggt attgcttacg ctgggccctg gaagctagg aacgcttacg attggacagt 6420 tgagagtact gtttacgtgt cacataggca tcaaggttg ggcctaggt ccacattgta 6480 cacacatttg cttaagtcta tggaggcgca aggttttaag tctgtggttg ctgttatagg 6540 ccttccaaac gatccatctg ttaggttgca tgaggctttg ggatacacag cccggggtac 6600 attgcgcgca gctggataca agcatggtgg atggcatgat gttggttttt ggcaaaggga 6660 ttttgagttg ccagctcctc caaggccagt taggccagtt acccagatct gaggtaccct 6720 gagcttgagc ttatgagctt atgagcttag agctcggatc cactagtaac ggccgccagt 6780 gtgctggaat tcgcccttga ctagataggc gcccagatcg gcggcaatag cttcttagcg 6840 ccatcccggg ttgatcctat ctgtgttgaa atagttgcgg tgggcaaggc tctctttcag 6900 aaagacaggc ggccaaagga acccaaggtg aggtgggcta tggctctcag ttccttgtgg 6960 aagcgcttgg tctaaggtgc agaggtgtta gcgggatgaa gcaaaagtgt ccgattgtaa 7020 caagatatgt tgatcctacg taaggatatt aaagtatgta ttcatcacta atataatcag 7080 tgtattccaa tatgtactac gatttccaat gtctttattg tcgccgtatg taatcggcgt 7140 caaaataa tccccggtga ctttctttta atccaggatg aaataatatg ttattataat 7200 ttttgcgatt tggtccgtta taggaattga agtgtgcttg cggtcgccac cactcccatt 7260 tcataatttt acatgtattt gaaaaaaa aatttatggt attcaattta aacacgtata 7320 7380 gtcaggtatt atagtccaag caaaacata atttattga tgcaagttta aattcagaaa 7440 tattcaata actgattata tcagctggta cattgccgta gatgaagac tgagtgcgat 7500 attatggtgt atacatagc ggccggtttt ctagtcaccg gttaggatcc gtttaactc 7560 gaggctagcg catgcacata zgacacaca tcatctcatt gatgcttggt addaattgtc 7620 attagattgt tttgcat agatgcactc gaatcagcc aattttagac aagtatcaa 7680 cggatgtgac ttcagtacat taaaaacgtc cgcaatgtgt tattaagttg tctaagcgtc 7740 aaagaaaagg ttatcgagta gccgagttgg aaccgtctta cccaacacga ggtaagtcat 7800 taagcatgta gtggtgtta ttttaaatgg tcataatgtg tatgtattga tgctgattgg 7860 aatgaataaa tatacatata tatatatgca tgtacgtatg tgatgatgaa attgttgaat 7920 gatgaaag aggtagatg tactgagttg ttgatctcgg cactaaacat gcgggataac 7980 catttatgac catgagattg gcgctaagtg cgcgggatta aattgtacag cactaagtgt 8040 gcgattcgac tatgttgcac tagtgtgcg aaatgatat gatgcactaa gtgtgcgaat 8100 tgaccatgcg gcactaagtg tgcgagatgg actatgtggc actaagtgtg cgatttgatt 8160 acgtagcact aagtgtgcga tttgattacg tagcactaag tgtgcgagtt gattatatag 8220 cactgagtgt gcgggctcaa taaatattcg tgaatcatta cggacactat gtgtgcgaca 8280 ctattgagtc gatcgcggac agcggatcgg gtaagtgttt tgagtacatg gctattatgt 8340 gctatgctta tacttggtgt tgagctcggt aagttcgaac ctatgtgaca aatatacttg 8400 aagtcacgta cataaaattt atcgtaggat gggtgaaagg ccgtatagtc gtttggttgt 8460 aacgaaaata aatcgattta cgaaattgct tcaatgtcct attgatgagt atatagaatg 8520 tgaatgcatg aattgatatg aaattgaatt gataagttgg aggaactatg gtatggttcg 8580 gtatggatgg agtaaattgt ctcgttccat tttgtttcct cttgtgataa tgtcgttgat 8640 agatggtagt gcattgctta tgacttactg agttataaac tcactcgatg tttccttgtc 8700 acccactata ggttgcttgg actcatctat ttttgcgggg tcgggccgtc attgaagtca 8760 tcacaccgga tagcaagttt tggtactttc ttcttagtgt gcttagaaga tcattttggc 8820 atgtataagc tagtacgttg tgtttgaatt atggcatgta aactttaagc catgcgaaaa 8880 tggcacgaat gttcgattga gttggatcaa gggtaggcat gaaatggaca tagttacttt 8940 cgtaacagat gctggcggca gcagtgtcat gagattgaaa aatcactaaa aatagtagga 9000 gtggaattaa ttgatgaata aattatgtaa tcgaagctcg atgagtctgc tttcatgagg 9060 aagtaacgaa atgatcatat gggcagtata ttaagagata atcagatttt tgtgggacag 9120 ggccagaacg gtttctggat tccctgctcc gactttggta attcattata aattaaccag 9180 agataattag gggtcgtacc atatatgtac agattcctct ctaagtctag ttttcataga 9240 aacaaacggc aacagtattg aagccccgtg cagggagata tcccagtcgt aatgggaaaa 9300 ggtcagtgta gtcgacacct gcaacttggg ggactttgac taataaactg taataattgg 9360 cccaaccaaa aattctagaa aaaaatacat agatgggcaa atgagtctag tttctgggaa 9420 aaattacgaa actgattttc gagttacgaa actcaagata tgatttttaa agcggctagt 9480 acacagattg ggcagtgtct ggaaaataaa ttttgtaagg ggttaaagcc agataacacc 9540 tcgtgttcga ctccggtgtc ggtttcgggt tcggggtgtt acattttatt ggtatcagag 9600 ctatggttta gtcggttcta ggactaccat agcacgtatg agtctagcta tacatgccat 9660 aatgttaatg tttaaaaggg tgatgacttc tgacggttga aatgtttttg tcttgattag 9720 taaatggatc ccggtgaaga aagaacccta gcggatgacg ttgagagcgt agcggctgct 9780 cctgcacaag ggacgccgcc tgttgaacct cagtcatctg cgaataatca aggtgagggg 9840 gctaaacaag ccttctttac catgatgaat gagtgggtcg cgcagtatgc ccgagccaac 9900 ccggctgtcc aacaattccc aaatttgaat aatccacccc aagagcctgt aatgccatca 9960 gtcgctgatc ctgtgaggct gagtaagcca ccggtagact tgattaggaa gcgtggggcc 10020 gaggagttca aggccatagt aactgatgat gccgaaaggg ccgagttctg gcttgataac 10080 accattcggg tgctcgatga attgtcatgc acacccgatg aatgtctaaa atgtgctgta 10140 tctttgttgc gagactcagc ctactattgg tggaggacct tgatttccat agtcccgaac 10200 gagcgagtaa cttgggactt ctttcaaacg aaattccgaa agaaatttat tagccagcgg 10260 ttcattgatc agaagcgtaa ggagttcttg gaactcaagc aaggccgtat gactgtatct 10320 gaatacgaac atgaattcgt aagacttagt aggtatgccc gggagtgtgt agctgatgag 10380 gttgctatgt gcaaaagatt tgaggaagga ttgaatgaag atttaaagct actaatgggt 10440 attttggaaa taaaggaatt tgtaacacta g 10471 1

Claims

1. A method for controlling weeds in a cotton crop, said cotton crop comprising a cotton plant having genomic DNA containing bp 1329–1380 of SEQ ID NO:1 and bp 143–194 of SEQ ID NO:2; said method comprising applying to said cotton crop... (i) phenoxyacetic acid or pyridoxine herbicides and (ii) glufosinate, The genomic DNA of the cotton plant contained AAD-12 / PAT cotton event pDAB4468.19.10.3, and a representative cotton seed of the plant was deposited at the U.S. Center for Type Culture Collection with accession number PTA-12457.

2. The method of claim 1, wherein the phenoxyacetic acid or pyridoxine herbicide is 2,4-D.

3. The method of claim 2, wherein 2,4-D is applied at a ratio between 1120 g ae / ha and 4480 g ae / ha.

4. The method of claim 1, wherein the phenoxyacetic acid or pyridoxyacetic acid herbicide is MCPA.

5. The method of claim 1, wherein the phenoxyacetic acid or pyridoxine herbicide is chlorpyrifos or chlorpyrifos-b.

6. The method of claim 5, wherein the phenoxyacetic acid or pyridoxine herbicide is applied at a ratio between 140 g ae / ha and 560 g ae / ha of chlorpyrifos, or between 140 g ai / ha and 560 g ai / ha of chlorpyrifos-b.

7. The method of claim 1, wherein the phenoxyacetic acid or pyridoxine herbicide is fluroxypyr or fluroxypyr-b.

8. The method of claim 7, wherein the phenoxyacetic acid or pyridoxine herbicide is applied at a ratio between 70 g ae / ha and 280 g ae / ha of flumethrin, or between 140 g ai / ha and 560 g ai / ha of flumethrin-b.

9. The method of any one of claims 1-8, wherein glufosinate is applied at a ratio between 542 g ae / ha and 2168 g ae / ha.

Images