Isothermal amplification and detection technique based on crisper-strand displacement

Abstract

The application discloses an isothermal amplification and detection technology based on CRISPR-chain substitution. The isothermal amplification kit based on CRISPR-chain substitution comprises chain substitution isothermal amplification reagents, and the kit further comprises wild-type Cas9 and / or nuclease-deficient Cas9 nickase, an sgRNA pair for specifically recognizing the upstream and downstream of a target DNA sequence, and an amplification primer pair for chain substitution isothermal amplification reaction, wherein the primer pair is complementary to a single-stranded region exposed after the Cas9-sgRNA complex is combined with the target gene. The technology is simple in operation, strong in anti-interference capability, and accurate and reliable in detection result.

Description

TECHNICAL FIELD

[0001] The present application relates to a nucleic acid amplification technology and a detection technology based on the same, in particular to an isothermal amplification and detection technology based on CRISPR-strand displacement. BACKGROUND

[0002] Nucleic acid molecules are considered important biomarkers based on their biological properties. The detection of nucleic acid molecules has a wide range of applications in medical diagnosis and treatment, food safety, public health and social security, etc. Generally, in the process of nucleic acid detection, the concentration of target nucleic acid molecules in the sample to be detected is extremely low, while the concentration of non-target nucleic acid molecules is relatively high. Therefore, specific amplification of target nucleic acid molecules in the sample to be detected is a common method to improve the sensitivity and accuracy of nucleic acid detection reactions.

[0003] At present, the most commonly used method for specific amplification of target nucleic acid (DNA) fragments in the sample to be detected is PCR amplification technology, which is also the most effective and direct method. However, PCR technology still has many limitations that are difficult to overcome, such as: 1) high requirement for template DNA purity; 2) sensitive to reaction conditions, while actual samples to be detected often contain components that inhibit PCR reaction; 3) amplification reaction needs to go through multiple temperature changes, and the reaction time is relatively long; 4) the equipment required for detection and the equipment for result analysis are costly, and can only be completed in the laboratory; and 5) the cost of reagents required for detection is high, and the operation requires professional training, which consumes a lot of manpower and material resources. At the same time, in the actual detection of medical diagnosis and treatment, food safety, etc., it is necessary to carry out on-site detection and obtain the detection results of target nucleic acid molecules in a short time as much as possible. Therefore, the nucleic acid detection method based on PCR technology cannot meet the needs of practical application, and new low-cost, high-efficiency and rapid nucleic acid detection methods will therefore have broad application potential.

[0004] In view of the above problems, researchers have developed a series of isothermal amplification technologies for nucleic acid to solve the many problems faced by PCR amplification technology. For the detection of DNA, a polymerase with strand displacement function (such as Klenow Fragment, Bst, Isothermal in vitro amplification of DNA by a restriction enzyme / DNA polymerase system, Walker GT et al., Proc. Natl. Acad. Sci. U.S.A., 1992, 89(1): 392-396; Loop-mediated isothermal amplification of DNA, Notomi T et al., Nucleic Acids Res., 2000, 28(12): e63; Rolling replication of short DNA circles, Fire A et al., Proc. Natl. Acad. Sci. U.S.A., 1995, 92(10): 4641-4645; Helicase-dependent isothermal DNA amplification, Vincent M et al., EMBO Rep., 2004, 5(8): 795-800; DNA detection using recombination proteins, Piepenburg O et al., PLoS Biol., 2006, 4(7): e204).

[0005] For RNA samples, the RNA is usually first reverse transcribed into DNA by reverse transcriptase, and then the DNA is used as a template for isothermal amplification (such as NASBA and SMART technologies) (Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication, Guatelli JC et al., Proc. Natl. Acad. Sci. U.S.A., 1990, 87(5): 1874-1878; Specific detection of DNA and RNA targets using a novel isothermal nucleic acid amplification assay based on the formation of a three-way junction structure, Wharam D et al., Nucleic Acids Res., 2001, 29(11): e54).

[0006] Isothermal amplification techniques do not rely on temperature changes or thermal cycling processes to complete nucleic acid amplification during the reaction process, so the amplification time can be significantly shortened, and the instrument cost of the amplification reaction can be reduced. At the same time, since most isothermal amplification systems are not sensitive to common PCR reaction inhibitors, the sample pretreatment process can be further simplified, further reducing the corresponding operation difficulty and complexity. These characteristics make isothermal amplification technology widely used in aspects such as infectious disease detection, food pathogenic bacteria detection, genetically modified crop detection, and gradually developed into mature commercial kits. However, most of the current commercial isothermal amplification technologies still have some defects that have not been overcome, for example, complex primer design (such as LAMP technology), and inability to distinguish single nucleotide differences in nucleic acid sequences. Therefore, new rapid, efficient, and high-sensitivity nucleic acid detection methods have important application value.

[0007] CRISPR (Clustered Regularly Interspersed Short Palindromic Repeats) is a gene system used by bacteria to defend against viral attacks / avoid mammalian immune response. Cas9 protein is the effector protein of CRISPR system, which is an RNA-guided double-stranded DNA binding protein, the first unified factor known, and can specifically and accurately locate and edit almost any double-stranded DNA sequence in the genome. The application of CRISPR-Cas9 technology is currently mainly concentrated in the two aspects of gene editing and gene therapy. Based on the characteristics of low cost, simple system, high efficiency, high specificity and high sensitivity, the technology should have the same wide application prospect in the field of nucleic acid detection.

[0008] The use of CRISPR technology to detect target nucleic acid molecules has recently begun to be reported. CN105177110A discloses an in vitro method for detecting target nucleic acid based on Cas9 fusion protein. In the presence of target nucleic acid sequence, a pair of Cas9 fusion proteins specifically bind to the target sequence to generate a detectable fluorescence signal. It is reported that CRISPR effector protein Cas13a is used to specifically detect the nucleic acid product amplified by RPA technology (Nucleic acid detection with CRISPR-Cas13a / C2c2, Gootenberg JS et al., Science, 2017, 356(6336):438-442). However, these technologies are based on existing isothermal amplification technology to amplify target DNA molecules, and then use CRISPR technology for detection. The method of specific amplification of target nucleic acid based on CRISPR technology has not been reported. SUMMARY

[0009] The purpose of the present application is to provide a CRISPR-chain displacement-based isothermal amplification kit and method.

[0010] The technical solution adopted by the present application is:

[0011] A CRISPR-chain displacement-based isothermal amplification kit, comprising a chain displacement isothermal amplification reagent, the kit further comprising a wild-type Cas9 and / or a nuclease-deficient Cas9 nickase, a pair of sgRNAs specifically recognizing the upstream and downstream of the target DNA sequence, and a pair of amplification primers for chain displacement isothermal amplification reaction, which are complementary to the single-stranded region exposed after the Cas9-sgRNA complex binds to the target gene.

[0012] As a further improvement of the isothermal amplification kit, the nuclease-deficient Cas9 nickase is a HNH nuclease-deficient Cas9 nickase.

[0013] As a further improvement of the isothermal amplification kit, the recognition sites of the sgRNA pair are respectively 10-30 nucleotide sequences at the 3' end of the upstream CCN sequence and 10-30 nucleotide sequences at the 5' end of the downstream NGG sequence on the target sequence.

[0014] As a further improvement of the isothermal amplification kit, the distance between the recognition sites of the sgRNA pair is 100-1000 bp, preferably 100-250 bp, and the 5' end of the recognition site is taken as the starting point of CCN, and the 3' end of the target sequence is taken as the ending point of NGG.

[0015] As a further improvement of the isothermal amplification kit, the DNA primer of the strand displacement isothermal amplification reagent has the following characteristics: the 5' end of the primer contains a nickase recognition site, and the enzyme cutting site of the site is on its complementary strand; the middle section of the primer is complementary to at least 10 consecutive nucleotides of the strand on which the NGG sequence of the target DNA region recognized by the Cas-sgRNA complex is located.

[0016] As a further improvement of the isothermal amplification kit, the 3' end of the DNA primer of the strand displacement isothermal amplification reagent contains a 1-10 nucleotide sequence complementary to the nucleotide of the strand on which the NGG sequence is located.

[0017] A nucleic acid detection kit based on CRISPR-strand displacement, comprising the above-mentioned isothermal amplification kit, and a nucleic acid quantitative analysis reagent.

[0018] The nucleic acid quantitative analysis reagent is selected from specific molecular beacon molecules.

[0019] An isothermal amplification method based on CRISPR-strand displacement, comprising the following steps:

[0020] 1) Obtain the nucleic acid of the sample to be tested;

[0021] 2) Use the reagents contained in the above-mentioned isothermal amplification kit to amplify the nucleic acid sample to be tested.

[0022] An isothermal amplification detection method based on CRISPR-strand displacement, comprising the following steps:

[0023] 1) Obtain the nucleic acid of the sample to be tested;

[0024] 2) Use the reagents contained in the above-mentioned isothermal amplification kit to amplify the nucleic acid sample to be tested;

[0025] 3) Analyze the amplification product to determine the detection result.

[0026] The beneficial effects of this invention are:

[0027] 1) The technology of this invention mainly utilizes the characteristic of the CRISPR-Cas9 system to specifically recognize any DNA sequence with a -NGG sequence at the 3' end. Its key feature is that it can precisely locate almost any target fragment in the genome, and the complex construction is very simple. Theoretically, a -NGG sequence appears once every 8 bases in a DNA segment to be detected. Therefore, the design of upstream and downstream DNA target sequences (i.e., Cas9-sgRNA complex recognition sites) is widely distributed in practical detection. Furthermore, since the targeting effect of the Cas9-sgRNA complex depends entirely on the 20-base region at the 5' end of the sgRNA molecule, constructing Cas9-sgRNA complexes targeting upstream and downstream DNA target sequences is very simple.

[0028] 2) The CRISPR-Cas9 system utilized in this invention exhibits rapid and highly specific recognition of target DNA. It has been demonstrated that the dissociation constant of the CRISPR-Cas9 system for target DNA recognition and binding is within 10-1. -9 -10 -10 With a reaction time on the order of M, completed within 5-10 minutes, similar to most antibodies, the isothermal amplification system of this invention reacts rapidly and possesses extremely high specificity. Furthermore, the primer pairs used for the isothermal amplification reaction cannot induce an isothermal amplification reaction before the DNA to be detected is completely cleaved in the CRISPR-Cas9 system; this characteristic further enhances the specificity of the isothermal amplification system of this invention.

[0029] 3) The technology of this invention allows for the detection of RNA, single-stranded DNA, and double-stranded DNA at the same temperature (preferably 37°C) without relying on annealing or temperature variation steps. For RNA detection, only reverse transcription of RNA using primers targeting the target RNA is required, followed by synthesis of complementary DNA from the transcribed cDNA to form double-stranded DNA, which is then amplified isothermally for detection. For single-stranded DNA detection, only complementary strand synthesis using primers targeting the target DNA is required for isothermal amplification and detection.

[0030] 4) The technical reaction conditions of this invention are simple and the amplification efficiency is high. Because it does not depend on the initial annealing step and only requires maintaining the same temperature throughout the detection process, the isothermal amplification system of this invention does not require complex temperature-changing equipment, making the detection reaction simple and controllable, and the detection cost low. Simultaneously, by combining with chain substitution reactions, the isothermal amplification system of this invention can detect extremely low amounts of target DNA (10⁻⁶) within 1-2 hours. -16 M) Complete 10 6 -10 9 Amplification by a factor of two.

[0031] 5) The technology of the present application, the CRISPR-Cas9 system and the strand displacement reaction system are not sensitive to traditional PCR reaction inhibitors, and the isothermal amplification system of the present application has good anti-interference property to various impurity components. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 is a schematic diagram of the strand displacement amplification reaction mechanism based on the CRISPR-Cas9 system;

[0033] Figure 2 is an electrophoresis detection result of specific detection of short DNA templates by the strand displacement amplification reaction based on the CRISPR-Cas9 system;

[0034] Figure 3 is an electrophoresis detection result of specific detection of small fragment DNA in human genome by the strand displacement amplification reaction based on the CRISPR-Cas9 system;

[0035] Figure 4 is a real-time fluorescence detection result of specific detection of short DNA templates by the strand displacement amplification reaction based on the CRISPR-Cas9 system;

[0036] Figure 5 is an electrophoresis detection result of specific detection of small fragment DNA in human genome by the strand displacement amplification reaction based on the CRISPR-Cas9 system in a high-pollution background. DETAILED DESCRIPTION

[0037] The technical mechanism of the present application will be described in detail below. Figure 1 The technical mechanism of the present application will be described in detail below.

[0038] The strand displacement amplification reaction based on the CRISPR-Cas9 system is functionally divided into three independent reaction steps, i.e. Cas9-sgRNA complex specifically binds to DNA target sequence pair (Cas9 binding reaction), amplification primer binds to the single-stranded region exposed after the region of DNA target sequence bound by Cas9-sgRNA complex (primer binding reaction), and the bound amplification primer realizes exponential isothermal amplification under the action of isothermal amplification enzyme (strand displacement isothermal amplification reaction).

[0039] (I) Cas9 binding reaction

[0040] The step provides a binding site and an amplification reaction starting site for the detection primer by introducing a Cas9-sgRNA complex that specifically recognizes a pair of DNA target sequences into the system to be detected. Since the binding and recognition reaction of the Cas9-sgRNA complex and its DNA target sequence is similar to most antibody-antigen binding reactions, it has the characteristics of rapid reaction, high specificity, etc., so that the isothermal amplification system of the present application has rapid reaction and high specificity. At the same time, since the present application introduces two upstream and downstream DNA target sequences as the prerequisite for the amplification starting reaction, the potential single off-target recognition reaction cannot further cause the downstream strand displacement amplification reaction, which further improves the specificity of the isothermal amplification system of the present application. The specific method is to introduce a certain concentration of Cas9-sgRNA complex pair (10 nM-200 nM) into the sample to be detected under certain ion concentration (NaCl or KCl, 50-300 mM) and pH range (pH 6-8.5) conditions, and incubate at a certain temperature (room temperature-45°C) for 15 minutes, which can complete the binding and recognition reaction for the pair of DNA target sequences. The advantage is that the recognition reaction of the Cas9-sgRNA complex pair to the DNA target sequence has lower requirements for the reaction conditions, and can be quickly completed under a wide range of ion concentration, pH, and temperature conditions.

[0041] (ii) Primer binding reaction

[0042] This step provides the action site for the next exponential isothermal amplification reaction by introducing a specific primer pair into the above reaction system. Previous research work has found that after the Cas9-sgRNA complex specifically binds to the DNA target sequence, it separates the non-template strand from the template strand of the double-stranded target DNA and exposes it to the surrounding solution environment. This feature provides a binding site for the amplification primer. By designing a pair of primers that specifically bind to the DNA target sequence exposed to the solution, and introducing a nicking enzyme action site at the 5' end region of the primer pair, an initiation action site is provided for the next strand displacement reaction. The single-stranded region specifically binds to the primer to form a 5' overhang of the primer. The advantages of this design are: first, for the Cas9-sgRNA complex off-target recognition reaction, due to the difference in DNA sequence from the target DNA sequence, the primer usually cannot complementarily bind to the single-stranded DNA exposed by the off-target reaction, thus cannot effectively cause the downstream strand displacement amplification reaction; second, the downstream strand displacement exponential amplification reaction requires the Cas9-sgRNA complex to recognize the upstream and downstream DNA target sequences of the DNA to be detected, further improving the specificity of the isothermal amplification system of the present application; third, the binding reaction of the primer pair with the exposed single-stranded DNA region is rapid and does not require temperature change, improving the efficiency of the isothermal amplification system of the present application. The specific method is to add a small amount of high-concentration amplification primer pair (final concentration 50-200 nM) to the reaction system after the Cas9 binding reaction is completed, and incubate at a specific temperature (room temperature-45°C) for a short time (10 seconds-10 minutes), which can complete the primer binding reaction.

[0043] (III) Strand displacement isothermal amplification reaction

[0044] This step realizes the exponential amplification of the region between the upstream and downstream DNA target sequences by introducing strand displacement isothermal amplification enzymes into the above reaction system. After introducing the strand displacement isothermal amplification enzymes, they first fill the 5' overhang formed by the binding of the exposed single-stranded DNA region and the primer through strand extension reaction. The newly formed double-stranded region provides an action site for the nicking enzyme due to the presence of the nicking enzyme recognition site on the primer. Under the dual action of the nicking enzyme and the strand displacement amplification enzyme, the region between the upstream and downstream DNA target sequences is exponentially amplified. The specific method is to add an equal volume of strand displacement isothermal amplification enzymes (final concentration: Klenow Fragment exo-: 0.1-0.5 U / μL, Nb. BbvCI nicking enzyme: 0.01-0.2 U / μL; dNTPs: 100-300 nM; SSB: 500 nM-2 μM; BSA: 0.1-0.3 mg / μL; and other ion concentrations, pH, etc. as described above) to the reaction system after primer binding, and incubate at a specific temperature (room temperature-45°C, preferably 37°C) (60-120 minutes), which can complete the amplification reaction.

[0045] On the basis of amplification, further (four) detection reactions can be carried out.

[0046] This step is to detect the amplified product by conventional detection methods or reagents such as traditional non-denaturing PAGE (non-denaturing polyacrylamide gel electrophoresis) or real-time fluorescence PCR instrument.

[0047] An isothermal amplification kit based on CRISPR-chain substitution includes a chain substitution isothermal amplification reagent, and the kit also includes a wild-type Cas9 and / or a nuclease-deficient Cas9 nickase, a pair of sgRNAs that specifically recognize the upstream and downstream of the target DNA sequence, and a pair of amplification primers for chain substitution isothermal amplification reaction, which are complementary to the single-stranded region exposed after the Cas9-sgRNA complex binds to the target gene.

[0048] As a further improvement of the above-mentioned isothermal amplification kit, the nuclease-deficient Cas9 nickase is a HNH nuclease-deficient Cas9 nickase.

[0049] The wild-type Cas9 and / or HNH nuclease-deficient Cas9 nickase is an effector protein of the type II CRISPR system, and its sources include but are not limited to Streptococcus pyogenes, Streptococcus thermophilus, Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, Francisella novicida, and Acidothermus cellulolyticus. Specific wild-type Cas9 and / or HNH nuclease-deficient Cas9 nickase includes but is not limited to Genbank ACCESSION ID: WP_010922251, WP_059257345, WP_053019794, WP_014574210, WP_002684945, A0Q5Y3, ABK53723.

[0050] As a further improvement of the isothermal amplification kit, the recognition sites of the sgRNA pair are 10-30 nucleotides of the 3' end of the CCN sequence upstream of the target sequence and 10-30 nucleotides of the 5' end of the NGG sequence downstream of the target sequence. In particular, the sgRNA pair contains a 5' end T7 promoter, a sgRNA recognition site, and an 80 nucleotide crRNA and trancrRNA fusion region, facilitating in vitro transcription by T7 RNA polymerase, and obtaining purified sgRNA by gel purification and ethanol precipitation.

[0051] As a further improvement of the isothermal amplification kit, the distance between the recognition sites of the sgRNA pair is 100-1000 bp, preferably 100-250 bp, and the 5' end of the recognition site is CCN, and the 3' end of the target sequence is NGG.

[0052] As a further improvement of the isothermal amplification kit, the DNA primer of the strand displacement isothermal amplification reagent has the following characteristics: the 5' end of the primer contains a nicking enzyme recognition site, and the enzyme cutting site of the site is on its complementary strand; the middle segment of the primer is complementary to at least 10 consecutive nucleotides of the strand containing the NGG sequence recognized by the Cas-sgRNA complex.

[0053] As a further improvement of the isothermal amplification kit, the 3' end of the DNA primer of the strand displacement isothermal amplification reagent contains a 1-10 nucleotide sequence complementary to the nucleotides of the strand containing the NGG sequence.

[0054] As a further improvement of the isothermal amplification kit, the wild type Cas9 and / or HNH nuclease-deficient Cas9 nicking enzyme is mixed with the synthetic sgRNA pair at a molar concentration of 1:2, respectively. Preferably, the concentration of Cas9 is 100 nM, and the concentration of sgRNA is 200 nM. Further, the concentration of Cas9 protein, sgRNA, and primer is 1:2:4, and more preferably, the concentrations are 25 nM, 50 nM, and 200 nM, respectively.

[0055] Further, the final concentration of the reaction buffer is: 10-30 mM TrisHCl (pH 8.0), 50-150 mM KCl, 1-5 mM MgCl2, 0.1 %-1 % (v / v) Tween20. The amount of each component of the isothermal amplification enzyme mixture in a 10 μL reaction system is: 0.1-0.5 U Nb.BbvCI, 1-5 U Klenow Fragment (exo - ), 2-5 mM dNTPs, 2-5 μM single-strand binding protein TP32, 0.1 mg / mL BSA.

[0056] A nucleic acid detection kit based on CRISPR-chain substitution, comprising the isothermal amplification kit described above, and a nucleic acid quantitative analysis reagent.

[0057] As a further improvement of the nucleic acid detection kit described above, the nucleic acid quantitative analysis reagent is selected from specific molecular beacon molecules.

[0058] An isothermal amplification method based on CRISPR-chain substitution, comprising the following steps:

[0059] 1) Obtain the nucleic acid of the sample to be tested;

[0060] 2) Use the reagents contained in the isothermal amplification kit described above to amplify the nucleic acid sample to be tested.

[0061] An isothermal amplification detection method based on CRISPR-chain substitution, comprising the following steps:

[0062] 1) Obtain the nucleic acid of the sample to be tested;

[0063] 2) Use the reagents contained in the isothermal amplification kit described above to amplify the nucleic acid sample to be tested;

[0064] 3) Analyze the amplification product to determine the detection result.

[0065] The sample can be a sample of various sources, including but not limited to human samples such as blood, saliva, respiratory secretions, urine, tears, sweat, hair, skin swabs, oral swabs, tumor tissues, normal tissues, etc.; or animal samples such as animal tissues, hair, blood, secretions, etc.; or plant samples such as plant leaves, rhizomes, seeds, flowers, etc.; or environmental samples such as groundwater, surface water, seawater, industrial and agricultural wastewater, soil, air, etc.; or samples from food, drinking water, feed, etc.

[0066] When the nucleic acid sequence in the sample is RNA, it can be further subjected to reverse transcription treatment, and then subjected to corresponding amplification.

[0067] The detection means of the amplification reaction product includes but is not limited to traditional agarose electrophoresis, PAGE electrophoresis, capillary electrophoresis, or by adding 50-400 μM of molecular beacon molecules specific to the amplification detection region in the reaction system and performing real-time fluorescence detection.

[0068] The application will be further described in conjunction with specific examples. It should be understood that these examples are only used to illustrate the application and not to limit the scope of the application. In addition, it should be understood that after reading the content taught by the application, those skilled in the art can make various modifications or modifications to the application, and these equivalent forms also belong to the protection scope of the application.

[0069] Example 1. Specific amplification of short target DNA duplex by the chain displacement amplification reaction based on the CRISPR-Cas9 system and detection by traditional PAGE technique

[0070] A pair of sgRNAs were designed and synthesized by in vitro transcription for a short DNA duplex (450 bp), which specifically recognized the upstream CCAGTGCAAGTGCAGGTGCCAGA (SEQ ID NO: 1) (wherein the 5' end CCA is the complementary sequence of PAM sequence NGG) and the downstream GGCCCAGACTGAGCACGTGATGG (SEQ ID NO: 2) (wherein the 3' end TGG is the PAM sequence) of the short DNA duplex, respectively. The sgRNAs recognizing the upstream and downstream sequences were named as sgRNA-UPS and sgRNA-DNS, respectively.

[0071] sgRNA-UPS: GUGCAAGUGCAGGUGCCAGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 3)

[0072] sgRNA-DNS: GGCCCAGACUGAGCACGUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 4)

[0073] The single-stranded target DNA sequences exposed by the binding sites of the above sgRNAs were named as UPS-ISO and DNS-ISO, respectively, as the chain displacement isothermal amplification DNA primer pairs.

[0074] UPS-ISO: TAGATCGGTAAGGATAGCGCTGAGGGCAAGTGCAGGTGCCAGAACATTTCTCTATCGAT (SEQ ID NO: 5)

[0075] DNS-ISO: TAGATCGGTAAGGATAGCGCTGAGGACGTGCTCAGTCTGGGCCTCGAGC (SEQ ID NO: 6).

[0076] The concentration of the short DNA double-stranded mother liquor to be detected is 223 ng / μL, and the molar concentration is 1 μM. The short DNA double-stranded solution to be detected is prepared in a gradient dilution manner of 1:10, and the concentration is 500 nM-5 aM. The ion concentration of the diluted solution is 50-300 mM (NaCl or KCl), the Tween20 concentration is 0.1%-0.5%, the BSA concentration is 0.1-0.3 mg / μL, and the pH range is pH 6-8.5.

[0077] The specific experimental steps are as follows:

[0078] 1) Under certain ion concentration (NaCl or KCl, 50-300 mM) and pH range (pH 6-8.5) conditions, the sgRNA-UPS recognizing the upstream DNA target sequence and the sgRNA-DNS recognizing the downstream DNA target sequence are respectively incubated with wild-type Cas9 and / or HNH nuclease-deficient Cas9 nickase at a molar concentration ratio of 1:2 at a specific temperature (room temperature-45°C, preferably 37°C) for 15 minutes to prepare a Cas9-sgRNA protein nucleic acid complex with targeting activity; in this step, the concentration of sgRNA is 20 nM-400 nM, and the concentration of wild-type Cas9 and / or HNH nuclease-deficient Cas9 nickase is 10 nM-200 nM;

[0079] 2) The Cas9-sgRNA protein nucleic acid complex specifically recognizing the upstream and downstream DNA target sequences after incubation is mixed at a volume ratio of 1:1; 1 μL of the mixed Cas9-sgRNA protein nucleic acid complex is added to 10 μL of the short DNA double-stranded solution to be detected with different concentrations (500 nM-5 aM); and the recognition reaction of the Cas9-sgRNA protein nucleic acid complex and the upstream and downstream DNA target sequences in the short DNA double-stranded solution to be detected is completed at a specific temperature (room temperature-45°C, preferably 37°C) for 15 minutes;

[0080] 3) 2 μL of upstream and downstream amplification primers (UPS-ISO and DNS-ISO concentrations are 50 nM-2 μM, respectively) of a certain concentration are added to the reaction system after the recognition is completed, and the binding reaction of the amplification primers and the single-stranded region exposed by the Cas9-sgRNA complex combined with the upstream and downstream DNA target sequence regions is completed at a specific temperature (room temperature-45°C, preferably 37°C) for 5 minutes;

[0081] 4) Add equal volume of chain displacement isothermal amplification reaction enzymes (final concentration: Klenow Fragment exo-: 0.1-0.5 U / μL, Nb.BbvCI nicking enzyme: 0.01-0.2 U / μL; dNTPs: 100-300 nM; SSB: 500 nM-2 μM; BSA: 0.1-0.3 mg / μL; and other ion concentrations, pH, etc. as described above) and incubate at a specific temperature (room temperature-45°C, preferably 37°C) (60-120 minutes) to complete the amplification reaction;

[0082] 5) Add equal volume of EvaGreen fluorescent dye to the amplified reaction system, 36% glycerol solution to the amplified reaction system, and 6% non-denaturing PAGE gel to the amplified reaction system, and run electrophoresis under the condition of 1xTBE, 150 V for 20 minutes; after the completion of electrophoresis, the non-denaturing PAGE gel is detected quantitatively by a fluorescent gel imager.

[0083] The experimental results show that Figure 2 ), the chain displacement amplification reaction based on the CRISPR-Cas9 system of the present application can amplify a short DNA double strand to be detected as low as 50 aM to a level (>5 ng) that can be detected by traditional non-denaturing PAGE in 1.5 hours, i.e. more than 10 8 times of amplification. To verify the specificity of the present application, the amplification result is not affected after adding more than 10 ng / μL of non-template interfering DNA in the above amplification reaction. At the same time, the detection sample with a short DNA double strand concentration of 500 fM but without Cas9 protein in the system has no any detectable amplification band, further verifying the role of Cas9 protein in the present amplification system.

[0084] Example 2. Specific amplification of short target fragments in human genomic DNA using the chain displacement amplification reaction based on the CRISPR-Cas9 system of the present application, and detection by traditional PAGE technology

[0085] First, genomic DNA is extracted from human embryonic kidney cells (HEK293) by a commercial kit. The extracted human genomic DNA is gradient diluted to 2.5 ng / μL. In the detection sample, the concentration of human genomic DNA is about 692.4 aM. In the detection, plasmid DNA (pEGFP-C2) or mouse genomic DNA solution samples are used as negative controls. The concentration of plasmid DNA (pEGFP-C2) or mouse genomic DNA in the negative control is 30 ng / μL.

[0086] Using the same method as in Example 1, a pair of sgRNAs specifically recognizing the target DNA sequences upstream and downstream of a specific region in the human genome were designed and synthesized. To verify the repeatability of the chain displacement amplification reaction based on the CRISPR-Cas9 system of the present application, we designed 3 pairs of sgRNAs, and isothermal detection was carried out at 3 different sites in the human genome. The 3 sites to be detected are as follows:

[0087] Site 1 Human chromosome 9: nucleotide sequence 110330835 to 110331009 Site 2 Human chromosome 9: nucleotide sequence 110331126 to 110331334 Site 3 Human chromosome 12: nucleotide sequence 13983991 to 13984189

[0088] For the sgRNA pair for site 1, the upstream CCTAAGGTTGAGGCCAGTTGCAA (SEQ ID NO: 7) (wherein the 5' end CCT is the complement sequence of the PAM sequence NGG) and the downstream CTTGTAGCTACGCCTGTGATGGG (SEQ ID NO: 8) (wherein the 3' end GGG is the PAM sequence) of the short DNA double strand were specifically recognized, respectively. The sgRNAs recognizing the upstream and downstream sequences were named h-sgRNA1-UPS and h-sgRNA1-DNS, respectively.

[0089] h-sgRNA1-UPS: AAGGUUGAGGCCAGUUGCAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 9)

[0090] h-sgRNA1-DNS: CUUGUAGCUACGCCUGUGAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 10)

[0091] The single-stranded target DNA sequences exposed by the binding sites of the above sgRNAs were named h1-UPS-ISO and h1-DNS-ISO, respectively, as the chain displacement isothermal amplification DNA primer pair of the binding site.

[0092] h1-UPS-ISO: TAGATCGGTAAGGATAGCGCTGAGGGGTTGAGGCCAGTTGCAAAGACAATTGACATGT (SEQ ID NO: 11)

[0093] h1-DNS-ISO: TAGATCGGTAAGGATAGCGCTGAGGCACAGGCGTAGCTACAAGATTAGTTTTGAGAC (SEQ ID NO: 12)

[0094] The sgRNA pair targeting site 2 specifically recognize CCTTGGAGAGTTTTAAGCAAGGG (SEQ ID NO: 13) (wherein the 5' end CCT is the complement of PAM sequence NGG) and GGCCCAGACTGAGCACGTGATGG (SEQ ID NO: 14) (wherein the 3' end TGG is the PAM sequence) on the short DNA duplex upstream and downstream, respectively. The sgRNAs recognizing the upstream and downstream sequences are named h-sgRNA2-UPS and h-sgRNA2-DNS, respectively.

[0095] h-sgRNA2-UPS: UGGAGAGUUUUAAGCAAGGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 15)

[0096] h-sgRNA2-DNS: GGCCCAGACUGAGCACGUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 16)

[0097] The single-stranded target DNA sequences exposed by the binding sites of the above sgRNAs are named h2-UPS-ISO and h2-DNS-ISO, respectively, for the chain substitution isothermal amplification DNA primer pair of the binding sites.

[0098] h2-UPS-ISO: TAGATCGGTAAGGATAGCGCTGAGGGAGAGTTTTAAGCAAGGGCTGATGTGGGCTGC (SEQ ID NO: 17)

[0099] h2-DNS-ISO: TAGATCGGTAAGGATAGCGCTGAGGACGTGCTCAGTCTGGGCCCCAAGGATT (SEQ ID NO: 18)

[0100] The sgRNA pair targeting site 3 specifically recognizes the upstream CCACCCGGGGTACCACGGAGAGA (SEQ ID NO: 19) (wherein the 5' end CCA is the complement of the PAM sequence NGG) and the downstream GGAGAACAGCACTCCGCTCTGGG (SEQ ID NO: 20) (wherein the 3' end GGG is the PAM sequence) of the short DNA double strand, respectively. The sgRNAs recognizing the upstream and downstream sequences are named h-sgRNA3-UPS and h-sgRNA3-DNS, respectively.

[0101] h-sgRNA3-UPS: UCUCUCCGUGGUACCCCGGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 21)

[0102] h-sgRNA3-DNS: GGAGAACAGCACUCCGCUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 22)

[0103] The target DNA sequence single strand exposed by the binding site of the above sgRNA is named h3-UPS-ISO and h3-DNS-ISO, respectively.

[0104] h3-UPS-ISO: TAGATCGGTAAGGATAGCGCTGAGGCGGGGTACCACGGAGAGATGGTGGAAATCAT (SEQ ID NO: 23)

[0105] h3-DNS-ISO: TAGATCGGTAAGGATAGCGCTGAGGAGCGGAGTGCTGTTCTCCCAAGTTCTGGTTG (SEQ ID NO: 24).

[0106] The specific experimental steps are as follows:

[0107] 1. Under the same conditions, the steps 1-3 in Example 1, respectively, prepare the Cas9-sgRNA protein nucleic acid complex with targeting activity, complete the recognition reaction of the Cas9-sgRNA protein nucleic acid complex with the upstream and downstream DNA target sequences in the short DNA double strand to be detected, and the primer binding reaction.

[0108] 2. Add equal volume of optimized strand displacement isothermal amplification reaction enzymes (final concentration: Klenow Fragment exo-: 0.4-2 U / μL, Nb.BbvCI nicking enzyme: 0.05-1 U / μL; dNTPs: 100-300 nM; SSB: 1 μM-4 μM; BSA: 0.1-0.3 mg / μL; and other ion concentrations, pH, etc. as described above) and incubate (60-120 minutes) at a specific temperature (room temperature-45°C, preferably 37°C) to complete the amplification reaction.

[0109] 3. Add equal volume of EvaGreen fluorescent dye to the amplified reaction system in a ratio of 20:1, and add 36% glycerol aqueous solution in a ratio of 6:1, and use 6% non-denaturing PAGE gel to electrophorese under the condition of 1xTBE, 150V for 20 minutes. The non-denaturing PAGE gel after electrophoresis is quantitatively detected by a fluorescent gel imager.

[0110] The experimental results show that Figure 3 The strand displacement amplification reaction based on the CRISPR-Cas9 system of the present application can specifically amplify the target fragment to a level (>5 ng) that can be detected by traditional non-denaturing PAGE in 1.5 hours in a human genome sample as low as 670 aM-67 aM, i.e. more than 10 8 times of amplification. At the same time, no target band is amplified in samples without Cas9 protein, or with plasmid DNA (pEGFP-C2) or mouse genomic DNA as interfering DNA.

[0111] Example 3. Specific amplification of short target DNA double strands by the strand displacement amplification reaction based on the CRISPR-Cas9 system of the present application, and detection by RT-PCR technology (real-time fluorescent PCR).

[0112] Using the same method as in Example 1, a short DNA double strand (450 bp) is specifically amplified and detected by the sgRNA pair sgRNA-UPS and sgRNA-DNS in Example 1.

[0113] The specific experimental steps are as follows:

[0114] 1. Under the same conditions, the Cas9-sgRNA protein nucleic acid complex with targeting activity is prepared according to Steps 1-3 in Example 1, the recognition reaction of the Cas9-sgRNA protein nucleic acid complex with the upstream and downstream DNA target sequences in the short DNA double strand to be detected is completed, and the primer binding reaction is completed.

[0115] 2. Add equal volume of optimized strand displacement isothermal amplification reaction enzymes (final concentration: Klenow Fragment exo-: 0.4-2 U / μL, Nb.BbvCI nicking enzyme: 0.05-1 U / μL; dNTPs: 100-300 nM; SSB: 1 μM-4 μM; BSA: 0.1-0.3 mg / μL; and other ion concentrations, pH, etc. as described above) and molecular beacon (MB: FAM-CCGCGACTGCCTGCGTGAGATTCTCGCACGCGG-Dabcyl (SEQ ID NO: 25), 100 nM-400 nM) designed for the region to be amplified, and incubate at a specific temperature (room temperature-45°C, preferably 37°C) (60-120 minutes) to complete the amplification reaction.

[0116] The experimental results show that Figure 4 The CRISPR-Cas9 system-based strand displacement amplification reaction of the present application combined with molecular beacon and real-time fluorescence detection can detect as low as 1 aM of target DNA sample in 1.5 hours.

[0117] Example 4. Specific detection of small fragments of human genome in a high-pollutant background using the CRISPR-Cas9 system-based strand displacement amplification reaction of the present application and detection by traditional PAGE technology.

[0118] Specific amplification and detection of specific regions in human genome using sgRNA in Example 2, h-sgRNA2-UPS and h-sgRNA2-DNS.

[0119] The specific experimental steps are as follows:

[0120] Step 1 in Example 1, under the same conditions, to prepare Cas9-sgRNA protein nucleic acid complex with targeting activity.

[0121] 1) Mix 1:1 the mammalian cell ultrasonic crude cleavage product (i.e. the product after sufficient ultrasonic disruption of 100,000 cells / mL of PBS solution) in different concentrations of short DNA double-stranded solution to be detected. Mix 1:1 the Cas9-sgRNA protein nucleic acid complex that specifically recognizes the upstream and downstream DNA target sequences after incubation. Add 1 μL of the mixed Cas9-sgRNA protein nucleic acid complex to 10 μL of different concentrations (500 nM-5 aM) of short DNA double-stranded solution to be detected. Incubate at a specific temperature (room temperature-45°C, preferably 37°C) for 20 minutes to complete the recognition reaction of Cas9-sgRNA protein nucleic acid complex with the upstream and downstream DNA target sequences in the short DNA double-stranded solution to be detected.

[0122] 2) The same as steps 3-5 in example 1, the binding reaction of primers to the single-stranded region exposed by the binding of Cas9-sgRNA complex to the target sequence region of upstream and downstream DNA, primer binding reaction, and final PAGE detection.

[0123] The experimental results show that Figure 5 , a large amount of impurities (contaminants) after cell disruption has no effect on the efficiency and specificity of the chain displacement amplification reaction based on the CRISPR-Cas9 system of the present application. SEQUENCE LISTING <110> Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences <120> Isothermal amplification and detection technology based on CRISPR-chain displacement <130> <160> 25 <170> PatentIn version 3.5 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <400> 1 ccagtgcaag tgcaggtgcc aga 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <400> 2 ggcccagact gagcacgtga tgg 23 <210> 3 <211> 97 <212> RNA <213> Artificial Sequence <400> 3 gugcaagugc aggugccaga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97 <210> 4 <211> 97 <212> RNA <213> Artificial Sequence <400> 4 ggcccagacu gagcacguga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97 <210> 5 <211> 59 <212> DNA <213> Artificial Sequence <400> 5 tagatcggta aggatagcgc tgagggcaag tgcaggtgcc agaacatttc tctatcgat 59 <210> 6 <211> 49 <212> DNA <213> Artificial Sequence <400> 6 tagatcggta aggatagcgc tgaggacgtg ctcagtctgg gcctcgagc 49 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <400> 7 cctaaggttg aggccagttg caa 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <400> 8 cttgtagcta cgcctgtgat ggg 23 <210> 9 <211> 97 <212> RNA <213> Artificial Sequence <400> 9 aagguugagg ccaguugcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 97. cguuaucaac uugaaaaagu ggcaccgagu cggugcu <210> 10 <211> 97 <212> RNA <213> The snowstorm <400> 10 60. snow cgccugugau snow snow snow snow snow snow snow snow 97. cguuaucaac uugaaaaagu ggcaccgagu cggugcu <210> 11 <211> 58 <212> DNA <213> The snowstorm <400> 11 tagcggta aggatagcgc tgaggggttg aggccagttg caaagacaat tgacatgt <210> 12 <211> 57 <212> DNA <213> The snowstorm <400> 12 tagcggta aggatagcgc tgaggcacag gcgtagctac aagattagtt ttgagac <210> 13 <211> 23 <212> DNA <213> The snowstorm <400> 13 ccttggagag ttttaagcaa ggg <210> 14 <211> 23 <212> DNA <213> The snowstorm <400> 14 ggcccagact ggccgtga tgg <210> 15 <211> 97 <212> RNA <213> Artificial Sequence <400> 15 uggagaguuu uaagcaaggg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97 <210> 16 <211> 97 <212> RNA <213> Artificial Sequence <400> 16 ggcccagacu gagcacguga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97 <210> 17 <211> 57 <212> DNA <213> Artificial Sequence <400> 17 tagatcggta aggatagcgc tgagggagag ttttaagcaa gggctgatgt gggctgc 57 <210> 18 <211> 52 <212> DNA <213> Artificial Sequence <400> 18 tagatcggta aggatagcgc tgaggacgtg ctcagtctgg gccccaagga tt 52 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <400> 19 ccacccgggg taccacggag aga 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <400> 20 ggagaacagc actccgctct ggg 23 <210> 21 <211> 97 <212> RNA <213> Artificial Sequence <400> 21 ucucuccgug guaccccggg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97 <210> 22 <211> 97 <212> RNA <213> Artificial Sequence <400> 22 ggagaacagc acuccgcucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97 <210> 23 <211> 56 <212> DNA <213> Artificial Sequence <400> 23 tagatcggta aggatagcgc tgaggcgggg taccacggag agatggtgga aatcat 56 <210> 24 <211> 56 <212> DNA <213> Artificial Sequence <400> 24 tagatcggta aggatagcgc tgaggagcgg agtgctgttc tcccaagttc tggttg 56 <210> 25 <211> 33 <212> DNA <213> Artificial Sequence <400> 25 ccgcgactgc ctgcgtgaga ttctcgcacg cgg 33

Claims

1. A CRISPR-chain displacement-based isothermal amplification kit comprising a chain displacement isothermal amplification reagent, characterized by: The kit further comprises a nuclease-deficient Cas9 nickase, a sgRNA pair specifically recognizing upstream and downstream of the target DNA sequence, an amplification primer pair for strand displacement isothermal amplification reaction, which is complementary to the single-stranded region exposed after the Cas9-sgRNA complex binds to the target gene; The recognition sites of the sgRNA pair are 10-30 nucleotide sequences upstream of the 3' end of the CCN sequence and 10-30 nucleotide sequences downstream of the 5' end of the NGG sequence of the target sequence, respectively; The nuclease-deficient Cas9 nickase is a HNH nuclease-deficient Cas9 nickase; The amplification primer pair for strand displacement isothermal amplification reaction has the following characteristics: the 5' end of the primer contains a nickase recognition site, and the enzyme cutting site of the site is on the complementary strand; the middle section of the primer is complementary to at least 10 consecutive nucleotides of the strand where the NGG sequence of the target DNA region recognized by the Cas-sgRNA complex is located; The 3' end of the amplification primer pair for strand displacement isothermal amplification reaction contains a 1-10 nucleotide sequence complementary to the nucleotide of the strand where the NGG sequence is located.

2. The isothermal amplification kit according to claim 1, characterized by: The distance between the recognition sites of the sgRNA pair is 100-1000 bp, and the 5' end of the recognition site is CCN, and the 3' end of the target sequence is NGG.

3. The isothermal amplification kit according to claim 1, characterized by The distance between the recognition sites of the sgRNA pair is 100-250 bp.

4. A CRISPR-strand displacement based nucleic acid detection kit, characterized by: The kit for isothermal amplification according to any one of claims 1-3, and a nucleic acid quantitative analysis reagent.

5. The nucleic acid detection kit according to claim 4, characterized in that: The nucleic acid quantitative analysis reagent is selected from specific molecular beacon molecules.

6. A CRISPR-strand displacement-based isothermal amplification method, comprising the following steps: 1) obtaining nucleic acids of a sample to be tested; 2) using the reagents contained in the isothermal amplification kit according to any one of claims 1-3 to amplify the nucleic acid sample to be tested: 21) preparing a Cas9-sgRNA protein nucleic acid complex with targeting activity; 22) completing the recognition reaction of the Cas9-sgRNA protein nucleic acid complex and the upstream and downstream DNA target sequences in the short DNA double strand to be detected; 23) completing the binding reaction of the amplification primer and the single-stranded region exposed after the Cas9-sgRNA complex binds to the upstream and downstream DNA target sequence region; 24) adding an equal volume of strand displacement isothermal amplification reaction enzymes, incubating at room temperature-45°C for 60-120 minutes to complete the amplification reaction.

7. A CRISPR-strand displacement-based isothermal amplification detection method, comprising the following steps: 1) obtaining nucleic acids of a sample to be tested; 2) using the reagents contained in the isothermal amplification kit according to any one of claims 1-3 to amplify the nucleic acid sample to be tested: 21) preparing a Cas9-sgRNA protein nucleic acid complex with targeting activity; 22) completing the recognition reaction of the Cas9-sgRNA protein nucleic acid complex and the upstream and downstream DNA target sequences in the short DNA double strand to be detected; 23) completing the binding reaction of the amplification primer and the single-stranded region exposed after the Cas9-sgRNA complex binds to the upstream and downstream DNA target sequence region; 24) adding an equal volume of strand displacement isothermal amplification reaction enzymes, incubating at room temperature-45°C for 60-120 minutes to complete the amplification reaction. 24) Add equal volume of enzyme into the chain displacement isothermal amplification reaction, incubate at room temperature ~ 45℃ for 60 ~ 120 minutes to complete the amplification reaction; 3) Analyze the amplification product to determine the detection result.

Images