Compositions and methods for immuno-oncology

Abstract

The present invention relates to genome editing systems, reagents and methods for use in immuno-oncology.

Description

[0001] Related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 263,169, filed December 4, 2015, U.S. Provisional Patent No. 62 / 316,784, filed April 1, 2016, and U.S. Provisional Patent No. 62 / 394,290, filed September 14, 2016. The entire contents of these applications are incorporated herein by reference.

[0003] background

[0004] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) evolved in bacteria as an adaptive immune system to defend against viral attacks. When exposed to viruses, short fragments of viral DNA are integrated into the CRISPR locus of the bacterial genome. RNA is transcribed from the portion of the CRISPR locus containing the viral sequence. This RNA, containing a sequence complementary to the viral genome, mediates the guidance of the Cas9 protein to the sequence in the viral genome. The Cas9 protein cuts the viral target and thereby silences it.

[0005] Recently, the CRISPR / Cas system has been modified for genome editing in eukaryotic cells. The introduction of site-specific single-strand breaks (SSBs) or double-strand breaks (DSBs) allows the target sequence to be altered, for example, by nonhomologous end joining (NHEJ) or homology-directed repair (HDR).

[0006] Summary of the Invention

[0007] The invention described herein relates to compositions and methods for use in immuno-oncology, for example, cells modified at a specific target sequence in their genome, including, for example, by introducing a CRISPR system comprising a gRNA molecule that directs the target sequence, and methods for producing and using the same. For example, the present disclosure relates to gRNA molecules, CRISPR systems, cells, and methods that can be used for genome editing of cells (e.g., T cells, e.g., T cells further engineered to express a chimeric antigen receptor) and for treating diseases such as cancer.

[0008] In a first aspect, the invention provides a gRNA molecule comprising tracr and crRNA, wherein the crRNA comprises a guide domain that is complementary to a target sequence of an allogeneic T cell target selected from B2M, CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, TRBC2, HLA-A, HLA-B, HLA-C, DCK, CD52, FKBP1A, CIITA, NLRC5, RFXANK, RFX5, RFXAP, or NR3C1. In embodiments of the gRNA molecule:

[0009] 2(a) the allogeneic T cell target is B2M, and the targeting domain comprises any one of SEQ ID NO: 1 to SEQ ID NO: 83 or SEQ ID NO: 5492 to SEQ ID NO: 5527;

[0010] 2(b) the allogeneic T cell target is TRAC, and the targeting domain comprises any one of SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965;

[0011] 2(c) the allogeneic T cell target is TRBC1, and the targeting domain comprises any one of SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097;

[0012] 2(d) the allogeneic T cell target is TRBC2, and the targeting domain comprises any one of SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226;

[0013] 2(e) the allogeneic T cell target is CD247, and the targeting domain comprises any one of SEQ ID NO: 84 to SEQ ID NO: 392;

[0014] 2(f) the allogeneic T cell target is CD3D, and the targeting domain comprises any one of SEQ ID NO:393 to SEQ ID NO:532 or SEQ ID NO:10780 to SEQ ID NO:10794;

[0015] 2(g) the allogeneic T cell target is CD3E, and the targeting domain comprises any one of SEQ ID NO: 533 to SEQ ID NO: 839 or SEQ ID NO: 10677 to SEQ ID NO: 10764;

[0016] 2(h) the allogeneic T cell target is CD3ζ, and the targeting domain comprises any one of SEQ ID NO:840 to SEQ ID NO:968 or SEQ ID NO:10765 to SEQ ID NO:10779;

[0017] 2(i) the allogeneic T cell target is HLA-A, and the targeting domain comprises any one of SEQ ID NO:969 to SEQ ID NO:1345;

[0018] 2(j) the allogeneic T cell target is HLA-B, and the targeting domain comprises any one of SEQ ID NO: 1346 to SEQ ID NO: 1698;

[0019] 2(k) the allogeneic T cell target is HLA-C, and the targeting domain comprises any one of SEQ ID NO: 1699 to SEQ ID NO: 2068;

[0020] 2(1) the allogeneic T cell target is DCK, and the targeting domain comprises any one of SEQ ID NO: 5278 to SEQ ID NO: 5491;

[0021] 2(m) the allogeneic T cell target is CD52, and the targeting domain comprises any one of SEQ ID NO: 6227 to SEQ ID NO: 6324;

[0022] 2(n) the allogeneic T cell target is FKBP1A, and the targeting domain comprises any one of SEQ ID NO: 6325 to SEQ ID NO: 6583 or SEQ ID NO: 6662 to SEQ ID NO: 6749;

[0023] 2(o) the allogeneic T cell target is NR3C1, and the targeting domain comprises any one of SEQ ID NO: 2069 to SEQ ID NO: 2941;

[0024] 2(p) the allogeneic T cell target is CIITA, and the targeting domain comprises any one of SEQ ID NO:6750 to SEQ ID NO:7716 or SEQ ID NO:7717 to SEQ ID NO:7804; or

[0025] 2(q) The allogeneic T cell target is NLRC5, and the targeting domain comprises any one of SEQ ID NO:8622 to SEQ ID NO:10089.

[0026] In embodiments of the gRNA molecule, the allogeneic T cell target is TRAC and the guide domain comprises SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, or SEQ ID NO: 5620, e.g., the guide domain comprises SEQ ID NO: 5569, SEQ ID NO: 5586, SEQ ID NO: 5587, SEQ ID NO: NO: 5592, SEQ ID NO: 5599 or SEQ ID NO: 5600, e.g., the targeting domain comprises SEQ ID NO: 5569, SEQ ID NO: 5587, SEQ ID NO: 5592 or SEQ ID NO: 5586, e.g., the targeting domain comprises SEQ ID NO: 5569.

[0027] In embodiments of the gRNA molecule, the allogeneic T cell target is TRBC2 and the guide domain comprises SEQ ID NO: 5719, SEQ ID NO: 5694, SEQ ID NO: 5706, SEQ ID NO: 5696, SEQ ID NO: 5711, SEQ ID NO: 5708, SEQ ID NO: 5709, SEQ ID NO: 5712, SEQ ID NO: 5703, SEQ ID NO: 5707, SEQ ID NO: 5687, SEQ ID NO: 5705, SEQ ID NO: 5713, SEQ ID NO: 5715, or SEQ ID NO: 5710.

[0028] In embodiments of the gRNA molecule, the allogeneic T cell target is B2M and the guide domain comprises SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 5499, SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO: 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO: 5517, SEQ ID NO: 5521, SEQ ID NO: 5520, SEQ ID NO: 5500, SEQ ID NO: 5494, SEQ ID NO: 5508, SEQ ID NO: 5514, or SEQ ID NO: 5492, e.g., the guide domain comprises SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5509.

[0029] In embodiments of the gRNA molecule, the allogeneic T cell target is CIITA and the guide domain comprises SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID NO: 7758, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 7770, SEQ ID NO: 7749, SEQ ID NO: 7754, SEQ ID NO: 7745, SEQ ID NO: 7785, SEQ ID NO: 7731, SEQ ID NO: 7772, SEQ ID NO: 7743, or SEQ ID NO: 7750, e.g., the guide domain comprises SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 7739, or SEQ ID NO: 7785.

[0030] In embodiments of the gRNA molecule, the allogeneic T cell target is CD3E and the guide domain comprises SEQ ID NO: 10729, SEQ ID NO: 10719, SEQ ID NO: 10764, SEQ ID NO: 10789, SEQ ID NO: 10701, SEQ ID NO: 10700, or SEQ ID NO: 10722.

[0031] In embodiments of the gRNA molecule, the allogeneic T cell target is FKBP1A and the guiding domain comprises SEQ ID NO: 6693, SEQ ID NO: 6705, SEQ ID NO: 6694, SEQ ID NO: 6708, or SEQ ID NO: 6699.

[0032] In a second aspect, the invention provides a gRNA molecule comprising tracr and crRNA, wherein the crRNA comprises a guide domain that is complementary to a target sequence of an inhibitory molecule, or a downstream effector that signals via an inhibitory molecule, selected from the group consisting of CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ or PTPN11.

[0033] In embodiments of the gRNA molecule:

[0034] 15(a) the inhibitory molecule is CD274 (PD-L1), and the targeting domain comprises any one of SEQ ID NO: 2942 to SEQ ID NO: 3270;

[0035] 15(b) the inhibitory molecule is HAVCR2 (TIM3), and the targeting domain comprises any one of SEQ ID NO: 3271 to SEQ ID NO: 3541;

[0036] 15(c) the inhibitory molecule is LAG3, and the targeting domain comprises any one of SEQ ID NO:3542 to SEQ ID NO:4032;

[0037] 15(d) the inhibitory molecule is PDCD1 (PD-1), and the targeting domain comprises any one of SEQ ID NO:4033 to SEQ ID NO:4589 or SEQ ID NO:5720 to SEQ ID NO:5815; or

[0038] 15(e) The downstream effector of signaling via the inhibitory molecule is PTPN1, and the targeting domain comprises any one of SEQ ID NO:4590 to SEQ ID NO:5277.

[0039] In embodiments of the gRNA molecule, the inhibitory molecule is PDCD1 and the guide domain comprises SEQ ID NO: 5743, SEQ ID NO: 5798, SEQ ID NO: 5748, SEQ ID NO: 5722, SEQ ID NO: 5800, SEQ ID NO: 5735, SEQ ID NO: 5724, SEQ ID NO: 5731, SEQ ID NO: 5725, SEQ ID NO: 5775, SEQ ID NO: 5766, SEQ ID NO: 5727, SEQ ID NO: 5744, SEQ ID NO: 5751, or SEQ ID NO: 5734, e.g., the guide domain comprises SEQ ID NO: 5775.

[0040] In embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, the guiding domain comprises 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), 24 (if present in the reference sequence), or 25 (if present in the reference sequence) contiguous nucleic acids of any of the recited guiding domain sequences. In other embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, the guiding domain consists of 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) contiguous nucleic acids of any of the recited guiding domain sequences. In embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, the 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids of any recited guide domain sequence are the 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids disposed 3' to the recited guide domain sequence. In other embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, the 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids of any recited guide domain sequence are the 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids disposed 5' to the recited guide domain sequence. In other embodiments of the gRNA molecule, including any of the foregoing aspects and embodiments, the 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) contiguous nucleic acids of any recited guide domain sequence do not include the 5' or 3' nucleic acids of the recited guide domain sequence.

[0041] In embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, the guiding domain consists of the recited guiding domain sequence.

[0042] The following general aspects of gRNA molecules can be combined, alone or in combination, with any gRNA comprising a guiding domain described herein, such as those listed in any of the foregoing aspects and embodiments.

[0043] In embodiments of the gRNA molecule, including any of the foregoing aspects and embodiments, a portion of the crRNA and a portion of the tracr hybridize to form a flagpole comprising SEQ ID NO: 6584 or SEQ ID NO: 6585. In other embodiments, the flagpole further comprises a first flagpole extension located 3' of the crRNA portion of the flagpole, wherein the first flagpole extension comprises SEQ ID NO: 6586. In other embodiments, the flagpole further comprises a second flagpole extension located 3' of the crRNA portion of the flagpole and, if present, the first flagpole extension, wherein the second flagpole extension comprises SEQ ID NO: 6587.

[0044] In embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, the tracr comprises, e.g., consists of:

[0045] (a) SEQ ID NO: 7820, optionally further comprising an additional 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides at the 3' end;

[0046] (b) SEQ ID NO: 6660; or

[0047] (c) SEQ ID NO: 6661. In such embodiments, the crRNA portion of the flagpole comprises SEQ ID NO: 6607 or SEQ ID NO: 6608.

[0048] In an embodiment of the gRNA molecule, including any of the aforementioned aspects and embodiments, the tracr comprises SEQ ID NO: 6589 or SEQ ID NO: 6590, and optionally, if a first flagpole extension is present, a first tracr extension portion disposed 5' of SEQ ID NO: 6589 or SEQ ID NO: 6590, said first tracr extension portion comprising SEQ ID NO: 6591.

[0049] In embodiments of the gRNA molecule, including any of the foregoing aspects and embodiments, the guide domain and tracr are provided on separate nucleic acid molecules.

[0050] In an embodiment of the gRNA molecule, including any of the aforementioned aspects and embodiments, the crRNA comprises (e.g., consists of) from 5' to 3' [the guide domain]-:

[0051] a) SEQ ID NO: 6584;

[0052] b) SEQ ID NO: 6585;

[0053] c) SEQ ID NO: 6605;

[0054] d) SEQ ID NO: 6606;

[0055] e) SEQ ID NO: 6607;

[0056] f) SEQ ID NO: 6608; or

[0057] g) SEQ ID NO:7806.

[0058] In an embodiment of the gRNA molecule, including any of the aforementioned aspects and embodiments, the tracr comprises (e.g., consists of) from 5' to 3':

[0059] a) SEQ ID NO: 6589;

[0060] b) SEQ ID NO: 6590;

[0061] c) SEQ ID NO: 6609;

[0062] d) SEQ ID NO: 6610;

[0063] e) SEQ ID NO: 6660;

[0064] f) SEQ ID NO: 6661;

[0065] g) SEQ ID NO: 7820;

[0066] h) SEQ ID NO: 7807;

[0067] i) SEQ ID NO: 7808;

[0068] j) SEQ ID NO: 7809;

[0069] k) Any one of a) to j) above, further comprising at least 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides at the 3' end, for example, 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides;

[0070] l) Any one of a) to k) above, further comprising at least 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides at the 3' end, for example, 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides; or

[0071] m) any one of a) to i) above, further comprising at least 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides at the 5' end (eg, at the 5' terminus), for example, 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides.

[0072] In preferred embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, the guiding domain and the tracr are provided on separate nucleic acid molecules, and the nucleic acid molecule comprising the guiding domain comprises SEQ ID NO: 6607, optionally provided immediately 3' of the guiding domain, and the nucleic acid molecule comprising the tracr comprises (e.g., consists of) SEQ ID NO: 6660.

[0073] In other embodiments, the gRNA molecule, including any of the foregoing aspects and embodiments, the guide domain and the tracr are disposed on a single nucleic acid molecule, and wherein the tracr is disposed 3' to the guide domain. In such embodiments, the gRNA molecule, including any of the foregoing aspects and embodiments, further comprises a loop disposed 3' to the guide domain and 5' to the tracr, e.g., comprising (e.g., consisting of) the loop of SEQ ID NO: 6588.

[0074] In an embodiment of the gRNA molecule, including any of the aforementioned aspects and embodiments, the gRNA molecule comprises (e.g., consists of) from 5' to 3' [the guiding domain]-:

[0075] (a) SEQ ID NO: 6601;

[0076] (b) SEQ ID NO: 6602;

[0077] (c) SEQ ID NO: 6603;

[0078] (d) SEQ ID NO: 6604;

[0079] (e) SEQ ID NO: 7811; or

[0080] (f) Any one of (a) to (e) above, further comprising 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides at the 3' end.

[0081] In a preferred embodiment of the gRNA molecule, including in any of the aforementioned aspects and embodiments, the guiding domain and the tracr are provided on a single nucleic acid molecule, and wherein the nucleic acid molecule comprises, e.g., consists of, the guiding domain and optionally SEQ ID NO: 6601 provided immediately 3' to the guiding domain.

[0082] In a preferred embodiment of the gRNA molecule, including in any of the aforementioned aspects and embodiments, the guiding domain and the tracr are provided on a single nucleic acid molecule, and wherein the nucleic acid molecule comprises, e.g., consists of, the guiding domain and optionally SEQ ID NO: 7811 provided immediately 3' to the guiding domain.

[0083] In an embodiment, the gRNA molecule consists of unmodified RNA nucleotides and nucleic acid bonds. In other embodiments, the gRNA molecule contains one or more modifications, such as those described herein. In an embodiment of the gRNA molecule, including any of the foregoing aspects and embodiments, one or optionally more than one nucleic acid molecule of the gRNA molecule comprises:

[0084] a) (e.g., three) phosphorothioate modifications at the 3' end of the nucleic acid molecule or molecules;

[0085] b) (e.g., three) phosphorothioate modifications at the 5' end of the nucleic acid molecule or molecules;

[0086] c) (e.g., three) 2'-O-methyl modifications at the 3' end of the nucleic acid molecule or molecules;

[0087] d) (e.g., three) 2'-O-methyl modifications at the 5' end of the nucleic acid molecule or molecules;

[0088] e) a 2'O-methyl modification at each of the 3' 4' end, the 3' end, and the 2' end of the nucleic acid molecule or molecule; or

[0089] f) any combination thereof.

[0090] In embodiments of the gRNA molecule, including any of the foregoing aspects and embodiments, when a CRISPR system comprising a gRNA molecule (e.g., as described herein) (e.g., an RNP as described herein, e.g., an RNP comprising a Cas9 molecule, e.g., as described herein) is introduced into a cell, an indel is formed at or near a target sequence that is complementary to the guide domain of the gRNA molecule. In embodiments, the indel is a frameshift mutation. In embodiments, the indel is a frameshift mutation. Figure 34A 、 Figure 34B 、 Figure 36 、 Figure 38 、 Figure 41 、 Figure 44 、 Figure 48 、 Figure 49 、 Figure 50 or Figure 53 The insertions / deletions listed in any of the figures.

[0091] In embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, when a CRISPR system comprising a gRNA molecule (e.g., as described herein) (e.g., an RNP described herein, e.g., an RNP comprising a Cas9 molecule, e.g., as described herein) is introduced into a cell population, indels are formed at or near a target sequence that is complementary to the guide domain of the gRNA molecule in at least about 40%, e.g., at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90%, e.g., at least about 95%, e.g., at least about 96%, e.g., at least about 97%, e.g., at least about 98%, e.g., at least about 99% of the cells in the population. In embodiments, an indel that is a frameshift mutation is formed at or near a target sequence that is complementary to the guide domain of the gRNA molecule in at least about 20%, e.g., at least about 30%, e.g., at least about 35%, e.g., at least about 40%, e.g., at least about 45%, e.g., at least about 50%, e.g., at least about 55%, e.g., at least about 60%, e.g., at least about 65%, e.g., at least about 70%, e.g., at least about 75%, e.g., at least about 80%, e.g., at least about 85%, e.g., at least about 90%, e.g., at least about 95%, e.g., at least about 99% of a cell population. In embodiments, an indel that is a frameshift mutation is formed at or near a target sequence that is complementary to the guide domain of the gRNA molecule in at least about 30%, e.g., at least about 40%, e.g., at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90%, e.g., at least about 95%, e.g., at least about 96%, e.g., at least about 97%, e.g., at least about 98%, e.g., at least about 99% of a cell population. Figure 34A 、 Figure 34B 、 Figure 36 、 Figure 38 、 Figure 41 、 Figure 44 、 Figure 48 、 Figure 49 、 Figure 50 or Figure 53 In embodiments, the five most frequently detected indels in the cell population include three or more, e.g., four, e.g., five Figure 34A 、 Figure 34B 、 Figure 36 、 Figure 38 、 Figure 41 、 Figure 44 、 Figure 48 、 Figure 49 、 Figure 50 or Figure 53 Any gRNA-associated indel listed in any of the Figures. Indels or indel patterns are measured and / or quantified, for example, by next generation sequencing (NGS).

[0092] In the embodiment of the gRNA molecule, including any one of the aforementioned aspects and embodiments, when a CRISPR system (e.g., RNP as described herein, e.g., RNP comprising a Cas9 molecule as described herein) comprising a gRNA molecule (e.g., as described herein) is introduced into a cell (or cell population) as described above, the expression of a gene comprising a target sequence complementary to the guide domain of the gRNA molecule is reduced or eliminated in the cell. In embodiments, the expression of the gene is reduced or eliminated in at least about 40% of the population, e.g., at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90%, e.g., at least about 95%, e.g., at least about 96%, e.g., at least about 97%, e.g., at least about 98%, e.g., at least about 99% of the cells. In embodiments, expression is reduced or eliminated by flow cytometry. In other embodiments, for example, in the case of FKBP1A, expression is reduced or eliminated by a functional assay (e.g., as described herein).

[0093] In embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, when a CRISPR system comprising a gRNA molecule (e.g., as described herein) (e.g., an RNP described herein, e.g., an RNP comprising a Cas9 molecule, e.g., as described herein) is introduced into a cell as described above, no off-target indels are formed in the cell, e.g., as detectable by next-generation sequencing and / or nucleotide insertion assays (e.g., as described herein).

[0094] In embodiments of the gRNA molecule, including any of the aforementioned aspects and embodiments, when a CRISPR system comprising a gRNA molecule (e.g., as described herein) (e.g., an RNP described herein, e.g., an RNP comprising a Cas9 molecule, e.g., as described herein) is introduced into a cell (or cell population) as described above, off-target indels are detected in no more than about 5%, e.g., no more than about 1%, e.g., no more than about 0.1%, e.g., no more than about 0.01% of the cells in the cell population, e.g., as detectable by next generation sequencing and / or a nucleotide insertion assay.

[0095] In any one of the aforementioned aspects and embodiments of the cell, the cell is (or cell colony includes) mammalian cell, primate cell or human cell, for example, it is human cell. In any one of the aforementioned aspects and embodiments of the cell, the cell is (or cell colony includes) immune effector cell, for example, T cell or NK cell, for example, it is T cell, for example, CD4+ T cell, CD8+ T cell, or its combination.

[0096] In any of the aforementioned aspects and embodiments referring to cells, the cell (or cell population) has been or will be engineered to express a chimeric antigen receptor (CAR). In embodiments, the CAR is:

[0097] (a) CD19 CAR; or

[0098] (b) BCMA CAR. In an embodiment:

[0099] (a) the CAR is a CD19 CAR comprising an antigen binding domain comprising any one of SEQ ID NO: 7883 to SEQ ID NO: 7898;

[0100] (b) the CAR is a CD19 CAR comprising SEQ ID NO: 7909 or SEQ ID NO: 7920;

[0101] (c) the CAR is a BCMA CAR comprising an antigen binding domain comprising any one of SEQ ID NO: 7939 to SEQ ID NO: 8112, e.g., an antigen binding domain comprising SEQ ID NO: 7949; or

[0102] (d) The CAR is a BCMA CAR comprising any one of SEQ ID NO: 8549 to SEQ ID NO: 8621, e.g., comprising SEQ ID NO: 8559.

[0103] In any of the aforementioned aspects and embodiments referring to cells, the cells are allogeneic with respect to the patient to whom they are administered. In other embodiments, the cells are autologous with respect to the patient to whom they are administered.

[0104] In another aspect, the present invention provides a composition comprising the first gRNA molecule of any one of the aforementioned aspects and embodiments, further comprising a Cas9 molecule. In embodiments, the Cas9 molecule comprises SEQ ID NO: 6611 or SEQ ID NO: 7821 to SEQ ID NO: 7831, for example, consisting thereof. In embodiments, the Cas9 molecule is an active or inactive Streptococcus pyogenes (S. pyogenes) Cas9. In preferred embodiments, the first gRNA molecule and the Cas9 molecule are present in a ribonucleoprotein complex (RNP).

[0105] In many aspects, composition can include more than one gRNA molecule, for example, more than one gRNA molecule, each of which is compounded with Cas9 molecules as described herein. For example, in embodiments, composition also includes the second gRNA molecule; The second gRNA molecule and the third gRNA molecule; Or the second gRNA molecule, the third gRNA molecule and the fourth gRNA molecule, wherein the second gRNA molecule, the third gRNA molecule (if present) and the fourth gRNA molecule (if present) are gRNA molecules as described herein, for example, any one of the aforementioned aspects and embodiments The gRNA molecule, and wherein each gRNA molecule of composition is complementary to different target sequences (that is, comprising different guide domains). In embodiments, the first gRNA molecule, the second gRNA molecule, the third gRNA molecule (if present) and the fourth gRNA molecule (if present) are complementary to the target sequence inside the same gene. In such embodiments, the first gRNA molecule, the second gRNA molecule, the third gRNA molecule (if present) and the fourth gRNA molecule (if present) are complementary to the target sequence of no more than 20,000 nucleotides, no more than 10,000 nucleotides, no more than 6,000, no more than 5,000 nucleotides, no more than 4,000, no more than 1,000 nucleotides, no more than 500 nucleotides, no more than 400 nucleotides, no more than 300 nucleotides, no more than 200 nucleotides, no more than 100 nucleotides, no more than 90 nucleotides, no more than 80 nucleotides, no more than 70 nucleotides, no more than 60 nucleotides, no more than 50 nucleotides, no more than 40 nucleotides, no more than 30 nucleotides, no more than 20 nucleotides or no more than 10 nucleotides. In other embodiments, the first gRNA molecule, the second gRNA molecule, the third gRNA molecule (if present) and the fourth gRNA molecule (if present) are complementary to the target sequence inside different genes or loci (e.g., different genes as described herein).

[0106] In embodiments, the first gRNA molecule is a gRNA molecule of any one of 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is a gRNA molecule of any one of 2(a), 2(i), 2(j), 2(k), or 2(q); and the third gRNA molecule is a gRNA molecule of any one of 15(a), 15(b), 15(c), 15(d), or 15(e). In embodiments, the first gRNA molecule is a gRNA molecule of any one of 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is a gRNA molecule of any one of 2(l), 2(m), 2(n), or 2(o); and the third gRNA molecule is a gRNA molecule of any one of 15(a), 15(b), 15(c), 15(d), or 15(e). In other embodiments, the first gRNA molecule is a gRNA molecule of any one of 2(b), 2(c), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is a gRNA molecule of any one of 2(l), 2(m), 2(n), or 2(o). In other embodiments, the first gRNA molecule is a gRNA molecule of any one of 2(b), 2(c), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is a gRNA molecule of any one of 2(a), 2(i), 2(j), or 2(k). In other embodiments, the first gRNA molecule is a gRNA molecule of any one of 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is a gRNA molecule of any one of 15(a), 15(b), 15(c), 15(d), or 15(e). In other embodiments, the first gRNA molecule is a gRNA molecule of any one of 15(a), 15(b), 15(c), 15(d), or 7(e); and the second gRNA molecule is a gRNA molecule of any one of 15(a), 15(b), 15(c), 15(d), or 15(e). In an embodiment of any of the foregoing embodiments, a third gRNA is present, and the third gRNA molecule is a gRNA molecule of any one of 15(a), 15(b), 15(c), 15(d), or 15(e). In an embodiment, the composition consists of two gRNA molecules of any one of the aforementioned gRNA molecule aspects and embodiments. In an embodiment, the composition consists of three gRNA molecules of any one of the aforementioned gRNA molecule aspects and embodiments.In an embodiment, the composition consists of a first gRNA molecule of any of the aforementioned aspects and embodiments and a second gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; wherein the guiding domain of the first gRNA molecule is the guiding domain of any one of 2(a), 2(i), 2(j) or 2(k); wherein the guiding domain of the second gRNA molecule is the guiding domain of any one of 2(b), 2(c), 2(d), 2(f), 2(g), 2(h) or 2(i).

[0107] In embodiments, the composition comprises two gRNA molecules, and the guiding domain of the first gRNA molecule comprises, e.g., consists of, SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 5499, SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO: 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO: 5517, SEQ ID NO: 5521, SEQ ID NO: 5520, SEQ ID NO: 5500, SEQ ID NO: 5494, SEQ ID NO: 5508, SEQ ID NO: 5514, or SEQ ID NO: 5492; and the guiding domain of the second gRNA molecule comprises, e.g., SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5587, SEQ ID NO: NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO:5591, SEQ ID NO:5610, SEQ ID NO:5608, SEQ ID NO:5617, SEQ ID NO:5619 or SEQ ID NO:5620, for example consisting thereof.

[0108] In embodiments, the composition comprises two gRNA molecules, and the guiding domain of the first gRNA molecule comprises, e.g., consists of, SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5509; and the guiding domain of the second gRNA molecule comprises, e.g., consists of, SEQ ID NO: 5569, SEQ ID NO: 5586, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ ID NO: 5599, or SEQ ID NO: 5600.

[0109] In an embodiment, the composition comprises two gRNA molecules, and the guiding domain of the first gRNA molecule comprises, e.g., consists of, SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5509; and the guiding domain of the second gRNA molecule comprises, e.g., consists of, SEQ ID NO: 5569.

[0110] In embodiments, the composition comprises two gRNA molecules, and the guiding domain of the first gRNA molecule comprises, e.g., consists of, SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5509; and the guiding domain of the second gRNA molecule comprises, e.g., consists of, SEQ ID NO: 10729, SEQ ID NO: 10719, SEQ ID NO: 10764, SEQ ID NO: 10789, SEQ ID NO: 10701, SEQ ID NO: 10700, or SEQ ID NO: 10722.

[0111] In an embodiment, including any of the aforementioned aspects and embodiments, the composition further comprises a third gRNA molecule described herein (e.g., in any of the aforementioned gRNA molecule aspects and embodiments), wherein the guiding domain of the third gRNA molecule is the guiding domain of any one of 2(n) or 2(q). In embodiments, the guide domain of the third gRNA molecule comprises, for example, consists of, SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID NO: 7758, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 7770, SEQ ID NO: 7749, SEQ ID NO: 7754, SEQ ID NO: 7745, SEQ ID NO: 7785, SEQ ID NO: 7731, SEQ ID NO: 7772, SEQ ID NO: 7743, or SEQ ID NO: 7750; for example, comprises (e.g., consists of) SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 7739, or SEQ ID NO: 7785.

[0112] In embodiments, including any of the aforementioned aspects and embodiments, the composition further comprises a fourth gRNA molecule described herein (e.g., in any of the aforementioned gRNA molecule aspects and embodiments), wherein the guiding domain of the fourth gRNA molecule is complementary to the target sequence of a target of a NK inhibitory molecule (e.g., LILRB1). In embodiments, the guiding domain of the fourth gRNA molecule comprises, e.g., consists of:

[0113] a) any one of SEQ ID NO: 10090 to SEQ ID NO: 10673;

[0114] b) 17, 18, 19, 20, 21, 22, 23 or 24 consecutive nucleotides, preferably 20 consecutive nucleotides, of any one of SEQ ID NO: 10090 to SEQ ID NO: 10673.

[0115] c) 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides, 5' of any one of SEQ ID NO: 10090 to SEQ ID NO: 10673; or

[0116] d) 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides, 3' of any one of SEQ ID NO: 10090 to SEQ ID NO: 10673.

[0117] In embodiments of the composition (including in any of the preceding aspects and embodiments), the guiding domain of the first gRNA molecule (as described herein), the guiding domain of the second gRNA molecule (as described herein), and, if present, the guiding domain of the third gRNA molecule (as described herein), comprises, e.g., consists of, the sequence of any one of:

[0118] a) Combinations A1 to A72 in Table 33;

[0119] b) Combinations B1 to B84 of Table 34;

[0120] c) Combinations C1 to C42 in Table 35;

[0121] d) Combinations D1 to D36 in Table 36;

[0122] e) Combinations E1 to E30 of Table 37; or

[0123] f) Combinations F1 to F60 of Table 38.

[0124] In any of the aforementioned aspects and embodiments, each of the gRNA molecules is in a ribonucleoprotein complex (RNP) with a Cas9 molecule described herein.

[0125] In embodiments, the gRNA molecule or composition is formulated in a culture medium suitable for electroporation.

[0126] In embodiments wherein each of the gRNA molecules is within an RNP with a Cas9 molecule described herein, each of the RNP complexes is at a concentration of less than about 10 uM, e.g., less than about 3 uM, e.g., less than about 1 uM, e.g., less than about 0.5 uM, e.g., less than about 0.3 uM, e.g., less than about 0.1 uM.

[0127] In embodiments, the composition further comprises a cell, e.g., a cell population, e.g., an immune effector cell, e.g., an immune effector cell expressing a CAR, e.g., as described herein.

[0128] In another aspect, the invention provides nucleic acid, the nucleic acid encoding the gRNA molecule of any one of the aforementioned gRNA molecule aspects or embodiments, or (for example, all) components of the composition of any one of the aforementioned composition aspects and embodiments. In embodiments, the nucleic acid comprises a promoter operatively connected to the sequence encoding the gRNA molecule. In embodiments, the promoter is a promoter recognized by RNA polymerase II or RNA polymerase III. In other embodiments, the promoter is a U6 promoter or a HI promoter. In embodiments, the nucleic acid also encodes a Cas9 molecule. In embodiments, the nucleic acid comprises a promoter operatively connected to the sequence encoding the Cas9 molecule, for example, an EF-1 promoter, a CMV IE gene promoter, an EF-1α promoter, an ubiquitin C promoter, or a phosphoglycerate kinase (PGK) promoter.

[0129] In another aspect, the invention provides a vector comprising the nucleic acid of any one of the aforementioned nucleic acid aspects and embodiments. In embodiments, the vector is selected from a lentiviral vector, an adenoviral vector, an adeno-associated virus (AAV) vector, a herpes simplex virus (HSV) vector, a plasmid, a minicircle, a nanoplasmid, and an RNA vector.

[0130] In another aspect, the invention provides a composition comprising a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments and a nucleic acid encoding a Cas9 molecule (e.g., as described herein).

[0131] In another aspect, the invention provides a composition comprising a nucleic acid encoding a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments and a Cas9 molecule (e.g., as described herein).

[0132] In the embodiment of any composition of the present invention, the composition further includes a template nucleic acid. In embodiments, the template nucleic acid includes nucleotides corresponding to the nucleotides of the target sequence of the gRNA molecule. In embodiments, the template nucleic acid includes nucleic acids encoding (e.g., as described herein) chimeric antigen receptor (CAR). In embodiments, CAR is (a) CD19 CAR such as described in WO2012 / 079000 or WO2014 / 153270; or (b) BCMA CAR such as described herein, for example, comprising SEQ ID NO: 8559 BCMA CAR. In embodiments, the template nucleic acid includes nucleic acids encoding NK inhibitory molecules such as described herein.

[0133] In another aspect, the present invention provides a method of changing a cell, e.g., changing its structure, e.g., its sequence, its target sequence, comprising contacting the cell with: a) a gRNA molecule of any one of the aforementioned gRNA molecule aspects and embodiments, e.g., more than one gRNA molecule, and a Cas9 molecule (e.g., as described herein); b) a gRNA molecule of any one of the aforementioned gRNA molecule aspects and embodiments, e.g., more than one gRNA molecule, and a nucleic acid encoding a Cas9 molecule (e.g., as described herein); c) a nucleic acid encoding any one of the aforementioned gRNA molecule aspects and embodiments. d) a nucleic acid encoding the gRNA molecule of any one of the aforementioned gRNA molecule aspects and embodiments, for example, more than one gRNA molecule, and a nucleic acid encoding, for example, a Cas9 molecule as described herein; e) any of a) to d) above and a template nucleic acid; f) any of a) to d) above and a nucleic acid comprising a sequence encoding a template nucleic acid; g) a composition of any one of the aforementioned composition aspects and embodiments; or h) a vector of any one of the aforementioned vector aspects and embodiments. In an embodiment, the gRNA molecule or the nucleic acid encoding the gRNA molecule and the Cas9 molecule or the nucleic acid encoding the Cas9 molecule are formulated in a single composition. In other embodiments, the gRNA molecule or the nucleic acid encoding the gRNA molecule and the Cas9 molecule or the nucleic acid encoding the Cas9 molecule are formulated in more than one composition. In an embodiment, more than one composition is delivered simultaneously or sequentially, for example, to a cell as described herein. In an embodiment, the cell is an animal cell, for example, a mammalian cell, a primate cell, or a human cell. In embodiments, cell is immune effector cell (for example, immune effector cell colony), for example, T cell or NK cell, for example, T cell, for example, CD4+ T cell, CD8+ T cell or its combination.In embodiments, cell has been or will be engineered to express (for example as described herein) chimeric antigen receptor (CAR).In embodiments, cell includes or will include (for example as described herein) chimeric antigen receptor (CAR).In embodiments, cell includes or will include nucleic acid encoding (for example as described herein) chimeric antigen receptor (CAR).In embodiments, CAR is (a) CD19 CAR;Or (b) BCMA CAR.In embodiments, CAR is CD19 CAR comprising antigen binding domains, and the antigen binding domains include SEQ ID NO:7883 to SEQ ID NO:Any one of 7898.In embodiments, CAR is CD19 CAR and includes SEQ ID NO:7908 to SEQ ID NO:Any one of 7920.In embodiments, the CAR is a BCMA CAR comprising an antigen binding domain comprising any one of SEQ ID NO: 7939 to SEQ ID NO: 8112. In embodiments, the CAR is a BCMA CAR and comprises any one of SEQ ID NO: 8549 to SEQ ID NO: 8621, e.g., comprising SEQ ID NO: 8559. In embodiments, the cells are allogeneic with respect to the patient to whom they are administered. In embodiments, the cells are isolated from a healthy human donor. In embodiments, the cells are autologous with respect to the patient to whom they are administered.

[0134] In another aspect, the present invention provides methods for changing by any one of the aforementioned methods and embodiments, for example, cells changed by the methods described herein. In another aspect, the present invention provides a first gRNA molecule comprising any one of the aforementioned gRNA molecules and embodiments, or the composition of any one of the aforementioned compositions and embodiments, the nucleic acid of any one of the aforementioned nucleic acids and embodiments, or the cell of the carrier of any one of the aforementioned vectors and embodiments. In embodiments, gRNA molecules, compositions, nucleic acids or carriers are introduced into the cells in vitro. In other embodiments, gRNA molecules, compositions, nucleic acids or carriers are introduced into the cells in vivo. In embodiments, cells are animal cells, for example, mammalian cells, primate cells or human cells. In embodiments, cells are immune effector cells (for example, immune effector cell colonies), for example, T cells or NK cells, for example, T cells, for example, CD4+ T cells, CD8+ T cells or combinations thereof. In embodiments, cells have been or will be engineered to express (for example, as described herein) chimeric antigen receptor (CAR). In embodiments, cells include or will include (for example, as described herein) chimeric antigen receptor (CAR). In embodiments, the cell comprises or will comprise a nucleic acid encoding a chimeric antigen receptor (CAR) (e.g., as described herein). In embodiments, CAR is (a) CD19 CAR; or (b) BCMA CAR. In embodiments, CAR is a CD19 CAR comprising an antigen binding domain comprising SEQ ID NO: 7883 to SEQ ID NO: 7898. In embodiments, CAR is a CD19 CAR and comprises SEQ ID NO: 7908 to SEQ ID NO: 7920. In embodiments, CAR is a BCMA CAR comprising an antigen binding domain comprising SEQ ID NO: 7939 to SEQ ID NO: 8112. In embodiments, CAR is a BCMA CAR and comprises SEQ ID NO: 8549 to SEQ ID NO: 8621, for example, comprising SEQ ID NO: 8559. In embodiments, the cell is allogeneic relative to the patient to whom the cell is to be administered. In embodiments, the cell is isolated from a healthy human donor. In embodiments, the cell is autologous to the patient to whom the cell is to be administered. In embodiments, the cell comprises, has comprised, or will comprise a second gRNA molecule according to any one of claims 1-60, or a nucleic acid encoding a second gRNA molecule according to any of the aforementioned gRNA molecule aspects and embodiments, wherein the first gRNA molecule and the second gRNA molecule comprise non-identical guide domains.In embodiments, the first gRNA molecule comprises a guiding domain that is complementary to a target sequence of an allogeneic T cell target (e.g., a guiding domain described in Tables 1, 3, 4, or 5), and the second gRNA molecule comprises a guiding domain that is complementary to a target sequence of an inhibitory molecule or a target sequence of a downstream effector that signals through an inhibitory molecule (e.g., comprising a guiding domain described in Table 2 or Table 6). In embodiments, the inhibitory molecule or downstream effector that signals via an inhibitory molecule is CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ or PTPN11. In embodiments, the first gRNA molecule comprises a guiding domain that is complementary to a target sequence of TRAC, TRBC1, TRBC2, CD247, CD3D, CD3E, or CD3G, and the second gRNA molecule comprises a guiding domain that is complementary to a target sequence of NLRC5, e.g., comprises a guiding domain comprising (e.g., consisting of) any one of SEQ ID NO: 8622 to SEQ ID NO: 10089. In embodiments, the first gRNA molecule comprises a guiding domain that is complementary to a target sequence of TRAC, TRBC1, TRBC2, CD247, CD3D, CD3E, or CD3G, and the second gRNA molecule comprises a guiding domain that is complementary to a target sequence of B2M, HLA-A, HLA-B, or HLA-C. In embodiments, the cell further comprises, has comprised, or will comprise a third gRNA molecule of any one of the aforementioned gRNA molecule aspects and embodiments, or a nucleic acid encoding the third gRNA molecule of any one of the aforementioned gRNA molecule aspects and embodiments, wherein the first gRNA molecule, the second gRNA molecule, and the third gRNA molecule comprise non-identical guiding domains. In embodiments, the third gRNA molecule comprises a guiding domain complementary to the target sequence of CIITA, RFXANK, RFX5, or RFXAP (e.g., CIITA), e.g., comprising a guiding domain comprising (e.g., consisting of) any one of SEQ ID NO: 7717 to SEQ ID NO: 7804, e.g., comprising a guiding domain comprising (e.g., consisting of) any one of SEQ ID NO: 7769, SEQ ID NO: 7771, or SEQ ID NO: 7785.In embodiments, the cell comprises three gRNA molecules, and the first gRNA molecule comprises a guiding domain complementary to the target sequence of TRAC; the second gRNA molecule comprises a guiding domain complementary to the target sequence of B2M; and the third gRNA molecule comprises a guiding domain complementary to the target sequence of CIITA. In embodiments, the cell comprises three gRNA molecules, and the first gRNA molecule comprises a guiding domain complementary to the target sequence of TRAC; the second gRNA molecule comprises a guiding domain complementary to the target sequence of NLRC5; and the third gRNA molecule comprises a guiding domain complementary to the target sequence of CIITA. In embodiments, the cell comprises two gRNA molecules, and the first gRNA molecule comprises a guiding domain complementary to the target sequence of TRAC, TRBC1, TRBC2, CD247, CD3D, CD3E, or CD3G, and the second gRNA molecule comprises a guiding domain complementary to the target sequence of NR3C1, DCK, CD52, or FKBP1A.

[0135] In embodiments of the cell comprising a gRNA molecule (e.g., more than one gRNA molecule described herein):

[0136] (1) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1 to SEQ ID NO: 83 and SEQ ID NO: 5492 to SEQ ID NO: 5527;

[0137] (2) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 969 to SEQ ID NO: 1345;

[0138] (3) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1346 to SEQ ID NO: 1698;

[0139] (4) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1699 to SEQ ID NO: 2068;

[0140] (5) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2069 to SEQ ID NO: 2941;

[0141] (6) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 5278 to SEQ ID NO: 5491;

[0142] (7) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6227 to SEQ ID NO: 6324;

[0143] (8) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6325 to SEQ ID NO: 6583;

[0144] (9) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1 to SEQ ID NO: 83 and SEQ ID NO: 5492 to SEQ ID NO: 5527;

[0145] (10) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 969 to SEQ ID NO: 1345;

[0146] (11) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1346 to SEQ ID NO: 1698;

[0147] (12) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1699 to SEQ ID NO: 2068;

[0148] (13) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2069 to SEQ ID NO: 2941;

[0149] (14) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 5278 to SEQ ID NO: 5491;

[0150] (15) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6227 to SEQ ID NO: 6324;

[0151] (16) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6325 to SEQ ID NO: 6583;

[0152] (17) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1 to SEQ ID NO: 83 and SEQ ID NO: 5492 to SEQ ID NO: 5527;

[0153] (18) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 969 to SEQ ID NO: 1345;

[0154] (19) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1346 to SEQ ID NO: 1698;

[0155] (20) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1699 to SEQ ID NO: 2068;

[0156] (21) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2069 to SEQ ID NO: 2941;

[0157] (22) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 5278 to SEQ ID NO: 5491;

[0158] (23) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6227 to SEQ ID NO: 6324;

[0159] (24) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6325 to SEQ ID NO: 6583;

[0160] (25) the first gRNA molecule comprises a guide domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83 and SEQ ID NO: 5492 to SEQ ID NO: 5527;

[0161] (26) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 969 to SEQ ID NO: 1345;

[0162] (27) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1346 to SEQ ID NO: 1698;

[0163] (28) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1699 to SEQ ID NO: 2068;

[0164] (29) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2069 to SEQ ID NO: 2941;

[0165] (30) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 5278 to SEQ ID NO: 5491;

[0166] (31) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6227 to SEQ ID NO: 6324;

[0167] (32) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6325 to SEQ ID NO: 6583;

[0168] (33) the first gRNA molecule comprises a guide domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83 and SEQ ID NO: 5492 to SEQ ID NO: 5527;

[0169] (34) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 969 to SEQ ID NO: 1345;

[0170] (35) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1346 to SEQ ID NO: 1698;

[0171] (36) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1699 to SEQ ID NO: 2068;

[0172] (37) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2069 to SEQ ID NO: 2941;

[0173] (38) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 5278 to SEQ ID NO: 5491;

[0174] (39) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6227 to SEQ ID NO: 6324;

[0175] (40) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6325 to SEQ ID NO: 6583;

[0176] (41) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1 to SEQ ID NO: 83 and SEQ ID NO: 5492 to SEQ ID NO: 5527;

[0177] (42) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 969 to SEQ ID NO: 1345;

[0178] (43) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1346 to SEQ ID NO: 1698;

[0179] (44) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1699 to SEQ ID NO: 2068;

[0180] (45) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2069 to SEQ ID NO: 2941;

[0181] (46) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 5278 to SEQ ID NO: 5491;

[0182] (47) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6227 to SEQ ID NO: 6324;

[0183] (48) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6325 to SEQ ID NO: 6583;

[0184] (49) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1 to SEQ ID NO: 83 and SEQ ID NO: 5492 to SEQ ID NO: 5527;

[0185] (50) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 969 to SEQ ID NO: 1345;

[0186] (51) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1346 to SEQ ID NO: 1698;

[0187] (52) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 1699 to SEQ ID NO: 2068;

[0188] (53) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2069 to SEQ ID NO: 2941;

[0189] (54) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 5278 to SEQ ID NO: 5491;

[0190] (55) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6227 to SEQ ID NO: 6324; or

[0191] (56) The first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 6325 to SEQ ID NO: 6583.

[0192] In embodiments, including any of the aforementioned cell aspects and embodiments, the cell further comprises a third gRNA molecule comprising a guide domain complementary to a target sequence of an inhibitory molecule or a downstream effector of signaling of a pathway inhibitory molecule, wherein the inhibitory molecule or the downstream effector of signaling of a pathway inhibitory molecule is CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC Class II, GAL9, adenosine and TGFβ or PTPN11, for example, the third gRNA molecule is a guide domain comprising any of 15(a) to 15(e).

[0193] In embodiments of the cell comprising a gRNA molecule (e.g., more than one gRNA molecule described herein):

[0194] (1) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2942 to SEQ ID NO: 3270;

[0195] (2) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3271 to SEQ ID NO: 3541;

[0196] (3) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3542 to SEQ ID NO: 4032;

[0197] (4) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815;

[0198] (5) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4590 to SEQ ID NO: 5277;

[0199] (6) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2942 to SEQ ID NO: 3270;

[0200] (7) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3271 to SEQ ID NO: 3541;

[0201] (8) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3542 to SEQ ID NO: 4032;

[0202] (9) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815;

[0203] (10) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4590 to SEQ ID NO: 5277;

[0204] (11) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2942 to SEQ ID NO: 3270;

[0205] (12) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3271 to SEQ ID NO: 3541;

[0206] (13) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3542 to SEQ ID NO: 4032;

[0207] (14) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815;

[0208] (15) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4590 to SEQ ID NO: 5277;

[0209] (16) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2942 to SEQ ID NO: 3270;

[0210] (17) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3271 to SEQ ID NO: 3541;

[0211] (18) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3542 to SEQ ID NO: 4032;

[0212] (19) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815;

[0213] (20) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4590 to SEQ ID NO: 5277;

[0214] (21) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2942 to SEQ ID NO: 3270;

[0215] (22) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3271 to SEQ ID NO: 3541;

[0216] (23) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3542 to SEQ ID NO: 4032;

[0217] (24) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815;

[0218] (25) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4590 to SEQ ID NO: 5277;

[0219] (26) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2942 to SEQ ID NO: 3270;

[0220] (27) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3271 to SEQ ID NO: 3541;

[0221] (28) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3542 to SEQ ID NO: 4032;

[0222] (29) the first gRNA molecule comprises a guide domain selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815;

[0223] (30) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 533 to SEQ ID NO: 839, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4590 to SEQ ID NO: 5277;

[0224] (31) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 2942 to SEQ ID NO: 3270;

[0225] (32) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3271 to SEQ ID NO: 3541;

[0226] (33) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 3542 to SEQ ID NO: 4032;

[0227] (34) the first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815; or

[0228] (35) The first gRNA molecule comprises a guide domain selected from SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a guide domain selected from SEQ ID NO: 4590 to SEQ ID NO: 5277.

[0229] In embodiments, the cell, the guiding domain of the first gRNA molecule, the guiding domain of the second gRNA molecule, and (if present) the guiding domain of the third gRNA molecule, comprise, e.g., consist of, the sequence of any of:

[0230] g) Combinations A1 to A72 of Table 33;

[0231] h) Combinations B1 to B84 of Table 34;

[0232] i) Combinations C1 to C42 in Table 35;

[0233] j) Combinations D1 to D36 of Table 36;

[0234] k) Combinations E1 to E30 in Table 37; or

[0235] l) Combinations F1 to F60 of Table 38.

[0236] In embodiments, the cell, the first gRNA molecule comprises a guiding domain comprising SEQ ID NO: 5569, SEQ ID NO: 5592, or SEQ ID NO: 5586, and the second gRNA molecule comprises a guiding domain comprising SEQ ID NO: 5775.

[0237] In any of the aforementioned cellular aspects and embodiments, the gene comprising a target sequence that is complementary to the guiding domain of the first gRNA molecule, and optionally the gene comprising a target sequence that is complementary to the guiding domain of the second gRNA molecule and / or the gene comprising a target sequence that is complementary to the guiding domain of the third gRNA molecule has been altered such that expression of a functional product of the gene comprising a target sequence that is complementary to the guiding domain of the first gRNA molecule, and optionally the gene comprising a target sequence that is complementary to the guiding domain of the second gRNA molecule and / or the gene comprising a target sequence that is complementary to the guiding domain of the third gRNA molecule has been reduced or eliminated.

[0238] In another aspect, the invention provides a method of providing anti-tumor immunity in a subject, the method comprising administering to the subject an effective amount of a cell as described herein, eg, a cell of any of the foregoing cell aspects and embodiments.

[0239] In another aspect, the invention provides a method of treating cancer in a subject, the method comprising administering to the subject an effective amount of a cell as described herein, eg, a cell of any of the foregoing cell aspects and embodiments.

[0240] In another aspect, the present invention provides a method for treating a subject having a disease associated with expression of a tumor antigen, e.g., a proliferative disease, a precancerous condition, a cancer, and a non-cancer related indication associated with expression of a tumor antigen, the method comprising administering to the subject an effective amount of a cell as described herein, e.g., a cell of any one of the aforementioned cell aspects and embodiments. In embodiments, the disease associated with expression of a tumor antigen is cancer or a non-cancer related indication. In embodiments, the disease is a cancer selected from the group consisting of colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, cancer of the endocrine system, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, solid tumors of childhood, bladder cancer, cancer of the kidney or ureter, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal vertebral tumors, brain stem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, combinations of said cancers, and metastases of said cancers. In embodiments, the cancer is a hematological cancer selected from the group consisting of chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoid leukemia (ALL), B-cell acute lymphoid leukemia (B-ALL), T-cell acute lymphoid leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom macroglobulinemia, and preleukemia.

[0241] In embodiments of any of the foregoing methods, the method further comprises administering a chemotherapeutic agent, e.g., cyclophosphamide, fludarabine, or cyclophosphamide and fludarabine. In embodiments of the method, the method comprises administering a lymphodepleting agent or immunosuppressant prior to administering to the subject an effective amount of a cell as described herein, e.g., a cell of any of the foregoing cell aspects and embodiments.

[0242] In another aspect, the present invention provides a method for preparing cells (e.g., a cell population) for immunotherapy, the method comprising: (a) regulating the cells by reducing or eliminating expression of components of a T cell receptor (TCR), e.g., introducing into the cells gRNA molecules (as described herein), e.g., more than one gRNA molecule of any one of 2b to 2h, e.g., gRNA molecules according to any one of claims 3, 4, 5, 10, 11 or 12, e.g., more than one gRNA molecule; (b) regulating the cells by reducing or eliminating expression of HLA (e.g., HLA-A, HLA-B and / or HLA-C) or B2M, e.g., introducing into the cells gRNA molecules (as described herein), e.g., more than one gRNA molecule of any one of 2a, 2i, 2j or 2k, e.g., more than one gRNA molecule, e.g., gRNA molecules according to any one of claims 6 or 7, e.g., more than one gRNA molecule; and (c) expanding the cells. In embodiments, the method further comprises regulating the cell by reducing or eliminating CIITA expression, e.g., introducing into the cell a gRNA molecule (as described herein) of 2p, e.g., more than one gRNA molecule, e.g., a gRNA molecule according to any one of claims 8 or 9, e.g., more than one gRNA molecule, wherein the regulating optionally occurs prior to the step of expanding the cell.

[0243] In another aspect, the present invention provides a method for preparing cells (e.g., a cell population) for immunotherapy, the method comprising: (a) regulating the cells by reducing or eliminating the expression of components of a T cell receptor (TCR), for example, by introducing into the cells any one of 2b to 2h (as described herein) gRNA molecules, for example, more than one gRNA molecules, for example, any one of claims 3, 4, 5, 10, 11 or 12 (as described herein) gRNA molecules, for example, more than one gRNA molecules; (b) regulating the cells by reducing or eliminating the expression of a target of an immunosuppressant, for example, by introducing into the cells any one of 2l, 2m, 2n or 2o (as described herein) gRNA molecules, for example, more than one gRNA molecules (as described herein), for example, any one of claim 13 (as described herein) gRNA molecules, for example, more than one gRNA molecules; and (c) expanding the cells.

[0244] In an embodiment of any of the foregoing methods of preparing cells, the method further comprises (d) regulating the cells by reducing or eliminating expression of a first inhibitory molecule or a downstream effector that signals via an inhibitory molecule, e.g., by introducing into the cells a gRNA molecule according to claim 14 or 15 (as described herein), e.g., more than one gRNA molecule, wherein the regulation optionally occurs prior to the step of expanding the cells.

[0245] In another aspect, the present invention provides a method for preparing cells (e.g., a cell population) for immunotherapy, the method comprising: (a) regulating the cells by reducing or eliminating the expression of a first inhibitory molecule or a downstream effector that signals via an inhibitory molecule, for example, by introducing into the cells a gRNA molecule according to claim 14 (as described herein), for example, more than one gRNA molecule, for example, a gRNA molecule according to any one of claims 15-17, for example, more than one gRNA molecule; and (c) expanding the cells.

[0246] In an embodiment of any of the foregoing methods for preparing cells, the method further comprises (e) regulating the cells by reducing or eliminating the expression of a second inhibitory molecule or a downstream effector that signals via an inhibitory molecule, for example, by introducing into the cells a gRNA molecule according to claim 14 or 15, for example, more than one gRNA molecule, wherein the first inhibitory molecule or the downstream effector that signals via an inhibitory molecule and the second inhibitory molecule or the downstream effector that signals via an inhibitory molecule are different.

[0247] In any one of the aforementioned methods for preparing cells, each gRNA molecule is introduced simultaneously or sequentially. In embodiments, the introduction of each gRNA molecule is sequential and separated by at least 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10 days.

[0248] In the embodiment of any one of the aforementioned methods for preparing cells, the method further comprises introducing into the cell a nucleic acid encoding (e.g., as described herein) a chimeric antigen receptor (CAR). In embodiments, the nucleic acid encoding CAR is arranged on a template nucleic acid. In embodiments, the nucleic acid encoding CAR is arranged on an RNA vector. In embodiments, the nucleic acid encoding CAR is arranged on a lentiviral vector.

[0249] In the embodiment of any one of the aforementioned methods for preparing cells, the method also includes separating cells that are TCR-negative. In embodiments, separation process produces cells that are greater than about 75%, for example, greater than about 80%, 85%, 90%, 91%, 92%, 93, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% of cells that are TCR-negative cell colonies. In embodiments, separation is the step of expressing negative cells for TCR including contacting cell colonies with compositions, which compositions include T cell receptor (TCR) component specificity, optionally with a solid support or a detectable marker, and separating cells that are not bound to the antibodies. In embodiments, cells are immune effector cells, for example, T cells or NK cells, for example, T cells. In embodiments, cells are allogeneic relative to subjects to be administered, for example, cells are separated from healthy donors, for example, without donors suffering from the condition associated with tumor antigen expression. In embodiments, cells are autologous relative to subjects to be administered. In embodiments of any of the aforementioned methods of preparing cells, steps (a) and / or (b) are performed ex vivo. In embodiments, step (c) is performed ex vivo. In embodiments, the expansion step (c) is performed for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days, or for a period of 2-15, 2-14, 2-13, 2-12, 2-11, 2-10, 3-10, 2-9, 3-9, 2-8, 3-8, 2-7, 3-7, 2-6, 3-6, 2-5, or 3-5 days.

[0250] In an embodiment of any of the aforementioned methods of preparing cells, the gRNA molecule is a gRNA molecule described herein, and the guiding domain of each gRNA molecule (e.g., used in combination) comprises, e.g., consists of, a sequence of any combination listed in Table 33, Table 34, Table 35, Table 36, Table 37, or Table 38. In an embodiment, the guiding domain of each gRNA molecule comprises, e.g., consists of, a sequence of any of the following:

[0251] a) Combination A1 to Combination A72 of Table 33, for example, combinations A1 to A4, combinations A5 to A8, combinations A37 to A40, or combinations A41 to A44;

[0252] b) Combinations B1 to B84 of Table 34;

[0253] c) Combinations C1 to C42 in Table 35;

[0254] d) combination D1 to combination D36 of Table 36, for example, combination D2, combination D4, combination D20 or combination D22;

[0255] e) combination E1 to combination E30 of Table 37, for example, combination E2, combination E4, combination E8 or combination E10; or

[0256] f) Combinations F1 to F60 of Table 38, for example, any one of combinations F1 to F4, combinations F5 to F8, combinations F13 to F16, or combinations F17 to F20.

[0257] In another aspect, the present invention provides a method for treating a subject in need, comprising administering a cell (e.g., a cell colony) prepared by a method for preparing a cell as described herein (e.g., a method for preparing any one of the aforementioned aspects and embodiments of a cell method). In embodiments, particularly in embodiments comprising a gRNA molecule bound to a target sequence of a target of an immunosuppressant, the method further comprises administering an immunosuppressant, e.g., rapamycin, a rapamycin analog, or an mTor inhibitor, e.g., RAD001. In embodiments, the subject suffers from a disease related to tumor antigen expression, e.g., a proliferative disease, precancerous condition, cancer, and non-cancer related indications related to tumor antigen expression, wherein the administration treats the disease related to tumor antigen expression. In embodiments, the disease related to tumor antigen expression is cancer or non-cancer related indications. In embodiments, the disease is a cancer selected from the group consisting of colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, cancer of the endocrine system, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, solid tumors of childhood, bladder cancer, cancer of the kidney or ureter, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal vertebral tumors, brain stem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, combinations of said cancers, and metastases of said cancers. In embodiments, the cancer is a hematological cancer selected from the group consisting of chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoid leukemia (ALL), B-cell acute lymphoid leukemia (B-ALL), T-cell acute lymphoid leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom macroglobulinemia, and preleukemia.

[0258] In another aspect, the present invention provides a method of treating a patient suffering from a disease, the method comprising:

[0259] (a) providing a cell population from an allogeneic donor;

[0260] (b) introducing into the cell a CRISPR system (e.g., a Streptococcus pyogenes Cas9 CRISPR system) comprising a first gRNA molecule (or a nucleic acid encoding the gRNA molecule), wherein the first gRNA molecule comprises a guide domain complementary to a target sequence in a gene selected from the group consisting of CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, and TRBC2;

[0261] (c) optionally, selecting cells in which expression of a functional TCR has been reduced or eliminated;

[0262] (d) transducing the cell with a nucleic acid encoding the CAR; and

[0263] (e) administering cells to patients in need thereof, e.g., patients with a disease associated with an antigen recognized by expression of a CAR. In embodiments, the first gRNA molecule for CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, or TRBC2 is a gRNA molecule of any one of 2(b)-2(h), e.g., a gRNA molecule of any one of claims 3, 4, 5, 10, 11, or 12.

[0264] In embodiments, the method of treating a patient having a disease further comprises introducing into the cell a CRISPR system (e.g., a Streptococcus pyogenes Cas9 CRISPR system) comprising a second gRNA molecule (or a nucleic acid encoding the gRNA molecule), wherein the second gRNA molecule comprises a guide domain complementary to a target sequence in a gene selected from B2M, HLA-A, HLA-B, or HLA-C. In embodiments, the second gRNA for B2M, HLA-A, HLA-B, or HLA-C is a gRNA molecule of any one of 2(a) or 2(i)-2(k), e.g., a gRNA molecule of any one of claims 6 or 7. In embodiments, the method further comprises introducing into the cell a CRISPR system (e.g., a Streptococcus pyogenes Cas9 CRISPR system) comprising a third gRNA molecule (or a nucleic acid encoding the gRNA molecule), wherein the third gRNA molecule comprises a guide domain complementary to a target sequence in a gene selected from CIITA, RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and HLA-DP. In embodiments, wherein the third gRNA molecule is the gRNA molecule of any one of 2(a) or 2(i)-2(k), e.g., the gRNA molecule of any one of claims 6 or 7.

[0265] In other embodiments, the method of treating a patient with a disease further comprises introducing into the cell a CRISPR system (e.g., a Streptococcus pyogenes Cas9 CRISPR system) comprising a second gRNA molecule (or a nucleic acid encoding the gRNA molecule), wherein the second gRNA molecule comprises a guide domain complementary to a target sequence in a gene selected from DCK, CD52, FKBP1A, or NR3C1. In embodiments, the second gRNA molecule for DCK, CD52, FKBP1A, or NR3C1 is the second gRNA molecule of any one of 2(l)-2(o), e.g., the second gRNA molecule of claim 13. In embodiments wherein the second gRNA is for DCK, the method further comprises administering to the patient a nucleoside analog-based drug, e.g., the nucleoside analog-based drug is cytarabine or gemcitabine. In embodiments wherein the second gRNA is for CD52, the method further comprises administering to the patient an anti-CD52 antibody or antigen-binding fragment thereof, e.g., the anti-CD52 antibody or antigen-binding fragment thereof is alemtuzumab. In embodiments where the second gRNA is directed against FKBP1A, the method further comprises administering to the patient FK506, cyclosporine, rapamycin or a rapamycin analog, or an mTor inhibitor such as RAD001. In embodiments where the second gRNA is directed against NR3C1, the method further comprises administering to the patient a corticosteroid, e.g., the corticosteroid is dexamethasone.

[0266] In embodiments of any of the aforementioned methods of treating a patient with a disease, the gRNA molecule is a gRNA molecule described herein, and the guiding domain of each gRNA molecule (e.g., used in combination) comprises, e.g., consists of, a sequence listed in any combination of Table 33, Table 34, Table 35, Table 36, Table 37, or Table 38. In embodiments, the guiding domain of each gRNA molecule comprises, e.g., consists of, a sequence of any of the following:

[0267] a) Combination A1 to Combination A72 of Table 33, for example, combinations A1 to A4, combinations A5 to A8, combinations A37 to A40, or combinations A41 to A44;

[0268] b) Combinations B1 to B84 of Table 34;

[0269] c) Combinations C1 to C42 in Table 35;

[0270] d) combination D1 to combination D36 of Table 36, for example, combination D2, combination D4, combination D20 or combination D22;

[0271] e) combination E1 to combination E30 of Table 37, for example, combination E2, combination E4, combination E8 or combination E10; or

[0272] f) Combinations F1 to F60 of Table 38, for example, any one of combinations F1 to F4, combinations F5 to F8, combinations F13 to F16, or combinations F17 to F20.

[0273] In embodiments of any of the foregoing methods of treating a patient having a disease, the method further comprises introducing into the cell a CRISPR system (e.g., a Streptococcus pyogenes Cas9 CRISPR system) comprising a fourth gRNA molecule (or a nucleic acid encoding said gRNA molecule), wherein the fourth gRNA molecule comprises a guide domain complementary to a target sequence selected from the group consisting of CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine and TGFβ or PTPN11, e.g., the fourth gRNA molecule is directed against CD274, HAVCR2, LAG3, PDCD1 or PTPN11, e.g., the gRNA molecule of any one of 15(a)-(e), e.g., the gRNA molecule of any one of claims 16-17.

[0274] In another aspect, the present invention provides a method of treating a patient suffering from a disease, the method comprising:

[0275] (a) providing a cell population (as described herein), e.g., immune effector cells;

[0276] (b) introducing into the cell population a CRISPR system (e.g., a Streptococcus pyogenes Cas9 CRISPR system) comprising a first gRNA molecule (or a nucleic acid encoding the gRNA molecule), wherein the first gRNA molecule comprises a guide domain complementary to a target sequence in a gene selected from the group consisting of CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, and TRBC2;

[0277] (c) introducing into the cell population a CRISPR system (e.g., a Streptococcus pyogenes Cas9 CRISPR system) comprising a second gRNA molecule (or a nucleic acid encoding the gRNA molecule), the second gRNA molecule comprising a guide domain complementary to a target sequence in a gene selected from the group consisting of B2M, HLA-A, HLA-B, and HLA-C;

[0278] (d) optionally, selecting cells in which expression of a functional TCR, a functional B2M, or both a functional TCR and a B2M has been reduced or eliminated;

[0279] (d) introducing a nucleic acid encoding a CAR into the cell population; and

[0280] (e) cell colony is administered to a patient in need, for example, a patient suffering from a disease associated with the antigen expression of CAR recognition. In an embodiment of the method, the method further comprises (f) introducing a CRISPR system (for example, Streptococcus pyogenes Cas9 CRISPR system) comprising a 3rd gRNA molecule (or nucleic acid encoding the gRNA molecule) to the cell colony, the 3rd gRNA molecule comprising a guide domain complementary to a target sequence in a gene selected from CIITA, RFXANK, RFX5 and RFXAP. In embodiments, the first gRNA molecule comprises a guide domain complementary to a target sequence in a gene selected from, e.g., TRAC, TRBC1, and TRBC2 (e.g., TRAC) described herein, e.g., comprising (e.g., consisting of) a gene selected from the group consisting of SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, and SEQ ID NO: 5620, e.g., a gene selected from the group consisting of SEQ ID NO: 5569, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, ID NO: 5587, SEQ ID NO: 5599, SEQ ID NO: 5600, and SEQ ID NO: 5586, e.g., a guiding domain selected from SEQ ID NO: 5569, SEQ ID NO: 5586, and SEQ ID NO: 5592. In other embodiments, the first gRNA molecule comprises a guiding domain that is complementary to a target sequence in a gene selected from, e.g., CD3E, CD3G, and CD3D described herein.In embodiments, the second gRNA molecule comprises a guide domain that is complementary to a target sequence selected from, e.g., a B2M gene described herein, e.g., comprising (e.g., consisting of) a guide domain selected from the group consisting of SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 5499, SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO: 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO: 5517, SEQ ID NO: 5521, SEQ ID NO: 5520, SEQ ID NO: 5500, SEQ ID NO: 5494, SEQ ID NO: 5508, SEQ ID NO: 5514, and SEQ ID NO: 5492, e.g., a guide domain selected from the group consisting of SEQ ID NO: 5496, SEQ ID NO: 5498, and SEQ ID NO: 5509. In an embodiment, the third gRNA molecule comprises a guiding domain complementary to a target sequence selected from a CIITA gene, e.g., as described herein, e.g., comprising (e.g., consisting of) a guiding domain selected from the group consisting of SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID NO: 7758, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 7770, SEQ ID NO: 7749, SEQ ID NO: 7754, SEQ ID NO: 7745, SEQ ID NO: 7785, SEQ ID NO: 7731, SEQ ID NO: 7772, SEQ ID NO: 7743, or SEQ ID NO: 7750, e.g., a guiding domain selected from the group consisting of SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 7739, or SEQ ID NO: 7785. In preferred embodiments, the guiding domain of each gRNA molecule (e.g., used in combination) comprises, e.g., consists of, a sequence of any combination listed in Table 33, Table 34, or Table 38. In an embodiment, the guiding domain of each gRNA molecule comprises, e.g., consists of, a sequence of any of the following:

[0281] a) Combination A1 to Combination A72 of Table 33, for example, combinations A1 to A4, combinations A5 to A8, combinations A37 to A40, or combinations A41 to A44;

[0282] b) Combinations B1 to B84 of Table 34; or

[0283] c) Combinations F1 to F60 of Table 38, for example, any one of combinations F1 to F4, combinations F5 to F8, combinations F13 to F16, or combinations F17 to F20.

[0284] In the embodiment of the method for treating a patient with a disease, the method also includes introducing into the cell a nucleic acid molecule encoding (e.g., as described herein) NK inhibitory molecules, for example, encoding HLA-G:B2M fusions, for example, encoding SEQ ID NO:10674 nucleic acid molecules. In the embodiment of the method for treating a patient with a disease, cell (or cell colony) is an immune effector cell (or immune effector cell colony), for example, T cell (or colony T cell). In embodiments, cell (or cell colony) is allogeneic relative to the patient, for example, separated from a healthy donor. In other embodiments, cell (or cell colony) is autologous relative to the patient. In embodiments, CAR is (e.g., as described herein) CD19 CAR, for example, comprising CD19 CAR of antigen binding domains, the antigen binding domains comprising SEQ ID NO:7883 to SEQ ID NO:Any one of 7898. In other embodiments, the CAR is a BCMA CAR, e.g., comprising an antigen recognition domain comprising any one of SEQ ID NO: 7939 to SEQ ID NO: 8112 or SEQ ID NO: 8155 to SEQ ID NO: 8166, e.g., comprising an antigen recognition domain comprising, e.g., consisting of, SEQ ID NO: 7949, e.g., comprising any one of SEQ ID NO: 8549 to SEQ ID NO: 8621, e.g., comprising, e.g., consisting of, SEQ ID NO: 8559.

[0285] In another aspect, the present invention provides modified cells having reduced or eliminated expression of the following relative to unmodified cells of the same type: a) T cell receptor components; b) B2M; and / or c) CIITA. In embodiments, the T cell receptor component is a TCR α chain or a TCR β chain, e.g., a TCR α chain. In other embodiments, the component of the TCR is CD3 δ, CD3 ε or CD3 γ, e.g., CD3 ε. In embodiments, the modified cell (or cell population) has reduced or eliminated expression of T cell receptor components B2M and CIITA.

[0286] In another aspect, the present invention provides modified cells, which comprise an insertion or deletion of a base pair (e.g., more than one base pair) at or near the following relative to unmodified cells of the same type: a) genes encoding T cell receptor components; b) B2M; and / or c) CIITA. In embodiments, each of the insertions or deletions is an insertion / deletion. In embodiments, each of the insertions or deletions is a frameshift mutation. In embodiments, the modified cells (or cell colonies) comprise an insertion or deletion of a base pair (e.g., more than one base pair) at or near the genes encoding T cell receptor components, B2M, and CIITA.

[0287] In another aspect, the invention provides a cell population comprising the modified cells of any of the aforementioned cell (e.g., modified cell) aspects and embodiments, wherein in at least about 30% of the cells, at least one of the insertions or deletions is a frameshift mutation, e.g., as measured by NGS.

[0288] In another aspect, the invention provides a cell comprising (e.g., a population of cells comprising a cell (e.g., more than one cell) comprising):

[0289] (a) a nucleic acid sequence, e.g., encoding a CAR, e.g., as described herein;

[0290] (b) optionally, a nucleic acid sequence encoding an NK inhibitory molecule, e.g., as described herein, e.g., a nucleic acid encoding an HLA-G or HLA-G:B2M fusion as described herein;

[0291] (c) an insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, such as TRAC) or its regulatory elements, e.g., an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, such as TRAC), e.g., comprising a guide domain listed in Table 1, Table 4, Table 5, Table 6e, Table 6f, or Table 6g;

[0292] (d) insertions / deletions at or near the sequence of a gene encoding B2M or its regulatory elements, for example, insertions / deletions at or near the target sequence of a gRNA comprising a guide domain for B2M, for example, comprising a guide domain listed in Table 1 or Table 3;

[0293] (e) optionally, an insertion / deletion at or near the sequence of a gene encoding CIITA or its regulatory elements, e.g., an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for CIITA, e.g., comprising a guide domain listed in Table 1 or Table 6c; and

[0294] (f) optionally, an insertion / deletion at or near the sequence of the gene encoding LILRB1 or its regulatory elements, e.g., an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for LILRB1, e.g., comprising a guide domain listed in Table 6d;

[0295] Wherein the cell (or cell population comprising the cell) expresses CAR and, optionally, NK inhibitory molecules, and shows reduced or eliminated expression and / or function of one or more of the following: i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E or CD3G, such as TRAC), ii) B2M, iii) CIITA and / or iv) LILRB1. In embodiments, the guide domain sequence of the gRNA molecule (as described herein) for components of TCR, B2M and CIITA includes, for example, a guide domain listed in any combination listed in Table 33, Table 34 or Table 38, for example, consisting of.

[0296] a) Combination A1 to Combination A72 of Table 33, for example, combinations A1 to A4, combinations A5 to A8, combinations A37 to A40, or combinations A41 to A44;

[0297] b) Combinations B1 to B84 of Table 34; or

[0298] c) Combinations F1 to F60 of Table 38, for example, any one of combinations F1 to F4, combinations F5 to F8, combinations F13 to F16, or combinations F17 to F20.

[0299] In another aspect, the invention provides a cell comprising (e.g., a population of cells comprising a cell (e.g., more than one cell) comprising):

[0300] (a) a nucleic acid sequence encoding a CAR, e.g., as described herein;

[0301] (b) optionally, a nucleic acid sequence encoding an NK inhibitory molecule (e.g., as described herein), e.g., a nucleic acid encoding HLA-G as described herein;

[0302] (c) an insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC) or its regulatory elements, e.g., an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), e.g., comprising a guide domain listed in Table 1, Table 4, Table 5, Table 6e, Table 6f, or Table 6g;

[0303] (d) an insertion / deletion at or near the sequence of the gene encoding NLRC5 or its regulatory elements, for example, an insertion / deletion at or near the target sequence of a gRNA comprising a targeting domain for NLRC5, for example, comprising a targeting domain listed in Table 1;

[0304] (e) optionally, an insertion / deletion at or near the sequence of a gene encoding CIITA or its regulatory elements, e.g., an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for CIITA, e.g., comprising a guide domain listed in Table 1 or Table 6c; and

[0305] (f) optionally, an insertion / deletion at or near the sequence of the gene encoding LILRB1 or its regulatory elements, e.g., an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for LILRB1, e.g., comprising a guide domain listed in Table 6d;

[0306] wherein the cell (or a cell population comprising one or more of said cells) expresses a CAR and, optionally, an NK inhibitory molecule, and exhibits reduced or abolished expression and / or function of one or more of: i) a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E or CD3G, such as TRAC), ii) B2M, iii) NLRC5 and / or iv) LILRB1.

[0307] In another aspect, the invention provides a cell comprising (e.g., a population of cells comprising a cell (e.g., more than one cell) comprising):

[0308] (a) a nucleic acid sequence encoding a CAR, e.g., as described herein;

[0309] (b) an insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC) or its regulatory elements, e.g., an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), e.g., comprising a guide domain listed in Table 1, Table 4, Table 5, Table 6e, Table 6f, or Table 6g; and

[0310] (c) an insertion / deletion at or near the sequence of the gene encoding FKBP1A or its regulatory elements, for example, an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for FKBP1A, for example, comprising a guide domain listed in Table 1 or Table 6b;

[0311] Wherein the cell (or a cell population comprising a cell (e.g., more than one cell), comprising) expresses CAR and shows reduced or eliminated expression and / or function of one or more of the following: i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E or CD3G, e.g., TRAC) and / or ii) FKBP12. In embodiments, the guide domain sequence of the gRNA molecule (as described herein) for components of the TCR component and FKBP1A includes, e.g., a guide domain listed in any combination listed in Table 35, Table 36, or Table 37, e.g., consisting thereof.

[0312] a) Combinations C1 to C42 in Table 35;

[0313] b) combination D1 to combination D36 of Table 36, for example, combination D2, combination D4, combination D20 or combination D22; or

[0314] c) Combination E1 to combination E30 of Table 37, for example, combination E2, combination E4, combination E8 or combination E10.

[0315] In another aspect, the invention provides a cell comprising (e.g., a population of cells comprising a cell (e.g., more than one cell) comprising):

[0316] (a) a nucleic acid sequence encoding a CAR, e.g., as described herein;

[0317] (b) a nucleic acid sequence encoding a rapamycin-resistant mTor (e.g., as described herein), e.g., a nucleic acid sequence encoding an mTor comprising an S2035 mutation (e.g., an S2035I mutation); and;

[0318] (c) an insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC) or its regulatory elements, e.g., an insertion / deletion at or near the target sequence of a gRNA comprising a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), e.g., comprising a guide domain listed in Table 1, Table 4, Table 5, Table 6e, Table 6f, or Table 6g;

[0319] wherein the cell (or a cell population comprising said cell, e.g., more than one said cell) expresses CAR and rapamycin-resistant mTor and exhibits reduced or abolished expression and / or function of a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC).

[0320] In embodiments comprising insertions / deletions at or near the genes encoding the TCR component, B2M, and CIITA, the guiding domain of the gRNA molecule for the TCR component, the guiding domain of the gRNA molecule for B2M, and the guiding domain of the gRNA molecule for CIIRA, respectively, comprises a) a guiding domain sequence for the gRNA molecules listed in any combination of A1 to A72 in Table 33; b) a guiding domain sequence for the gRNA molecules listed in any combination of F1 to F60 in Table 38; or c) a guiding domain sequence for each of the gRNA molecules listed in any combination of B1 to B84 in Table 34, e.g., consisting thereof.

[0321] In embodiments comprising insertions / deletions at or near the genes encoding the TCR component and FKBP1A, the guiding domain of the gRNA molecule for the TCR component and the guiding domain of the gRNA molecule for FKBP1A respectively comprise, e.g., consist of, a) a guiding domain sequence for the gRNA molecules listed in any combination of C1 to C42 in Table 35; b) a guiding domain sequence for the gRNA molecules listed in any combination of D1 to D36 in Table 36; or c) a guiding domain sequence for the gRNA molecules listed in any combination of E1 to E30 in Table 37.

[0322] In an embodiment of any of the cellular aspects and embodiments described above, each said indel is produced in said cell by introducing into said cell a gRNA molecule, e.g., more than one gRNA molecule (e.g., a CRISPR system comprising said gRNA molecule (e.g., each of said more than one gRNA molecule), e.g., more than one CRISPR system), each comprising a guide domain complementary to a target sequence at or near each said indel.

[0323] In another aspect, the invention provides a cell colony, wherein at least about 30%, for example, at least about 50%, for example, at least about 75%, for example, at least about 90% of the cells of the colony are cells of any of the aforementioned cell aspects or embodiments. In embodiments, in at least about 30% of the cells (e.g., in at least about 40%, for example, in at least about 50%, for example, in at least about 60%, for example, in at least about 70%, for example, in at least about 80%, for example, in at least about 90%, for example, in at least about 95%, for example, in at least about 99% of the cells), each of the insertions / deletions is a frameshift mutation. In embodiments, including in any of the aforementioned cell aspects and embodiments, the invention provides a cell (or cell colony) comprising Figure 34A 、 Figure 34B or Figure 49 In an embodiment, including any of the aforementioned cell aspects and embodiments, the invention provides a cell (or cell population) comprising Figure 36 or Figure 48 In an embodiment, including any of the aforementioned cell aspects and embodiments, the invention provides a cell (or cell population) comprising Figure 38 、 Figure 41 、 Figure 44 or Figure 50 In an embodiment, including any of the aforementioned cell aspects and embodiments, the invention provides a cell (or cell population) comprising Figure 53 The insertions / deletions listed in .

[0324] In another aspect, the present invention provides a cell colony comprising any one of the aforementioned cell aspects and embodiments. In embodiments, at least about 20% cells of a cell colony are cells of any one of the aforementioned cell aspects and embodiments. In embodiments, at least about 50% cells of a cell colony are cells of any one of the aforementioned cell aspects and embodiments. In embodiments, less than about 5% of a cell colony, for example, less than about 1%, for example, less than about 0.01% of a cell colony comprises off-target insertions / deletions. In embodiments, the cells of a cell colony are engineered to express a chimeric antigen receptor (CAR). In embodiments, CAR is (for example, as described herein) CD19 CAR, for example, comprising SEQ ID NO:7883 to SEQ ID NO:7898 The CD19 CAR of any one of the antigen binding domains, or comprising SEQ ID NO:7909 or SEQ ID NO:7920 sequences. In other embodiments, CAR is, for example, a BCMA CAR comprising an antigen recognition domain, the antigen recognition domain comprising SEQ ID NO: 7939 to SEQ ID NO: 8112 or SEQ ID NO: 8155 to SEQ ID NO: 8166, for example, comprising an antigen recognition domain, the antigen recognition domain comprising SEQ ID NO: 7949, for example, consisting thereof, for example, comprising SEQ ID NO: 8549 to SEQ ID NO: 8621, for example, comprising SEQ ID NO: 8559, for example, consisting thereof. In embodiments, the cell is an animal cell, for example, a mammalian cell, a primate cell or a human cell, for example, a human cell. In embodiments, the cell is an immune effector cell (for example, an immune effector cell colony), for example, a T cell or a NK cell, for example, a T cell, for example, a CD4+ T cell, a CD8+ T cell, or a combination thereof. In embodiments, the cell is allogeneic relative to the patient to be administered the cell, for example, the cell is separated from a healthy human subject. In other embodiments, the cells are autologous to the patient to whom they are administered.

[0325] In another aspect, the invention provides a method of treating a disease (e.g., cancer) in a patient in need thereof, the method comprising administering a cell of any of the aforementioned cell aspects and embodiments. In embodiments, particularly embodiments in which the expression or function of the target of the immunosuppressant has been reduced or eliminated, the method further comprises administering an immunosuppressant, e.g., RAD001.

[0326] In another aspect, the invention provides a gRNA molecule as described herein (e.g., in any of the aforementioned gRNA molecule aspects and embodiments), a composition as described herein (e.g., in any of the aforementioned composition aspects and embodiments), a nucleic acid as described herein (e.g., in any of the aforementioned nucleic acid aspects and embodiments), a vector as described herein (e.g., in any of the aforementioned vector aspects and embodiments), or a cell (or cell population) as described herein (e.g., in any of the aforementioned cell (e.g., modified cell) or cell population aspects and embodiments) for use as a medicament.

[0327] In another aspect, the invention provides use of a gRNA molecule as described herein (e.g., in any of the aforementioned gRNA molecule aspects and embodiments), a composition as described herein (e.g., in any of the aforementioned composition aspects and embodiments), a nucleic acid as described herein (e.g., in any of the aforementioned nucleic acid aspects and embodiments), a vector as described herein (e.g., in any of the aforementioned vector aspects and embodiments), or a cell (or cell population) as described herein (e.g., in any of the aforementioned cell (e.g., modified cell) or cell population aspects and embodiments) in the manufacture of a medicament.

[0328] In another aspect, the invention provides a gRNA molecule as described herein (e.g., in any of the aforementioned gRNA molecule aspects and embodiments), a composition as described herein (e.g., in any of the aforementioned composition aspects and embodiments), a nucleic acid as described herein (e.g., in any of the aforementioned nucleic acid aspects and embodiments), a vector as described herein (e.g., in any of the aforementioned vector aspects and embodiments), or a cell (or cell population) as described herein (e.g., in any of the aforementioned cell (e.g., modified cell) or cell population aspects and embodiments) for use in treating a disease.

[0329] In another aspect, the present invention provides a gRNA molecule as described herein (e.g., in any of the aforementioned gRNA molecule aspects and embodiments), a composition as described herein (e.g., in any of the aforementioned composition aspects and embodiments), a nucleic acid as described herein (e.g., in any of the aforementioned nucleic acid aspects and embodiments), a vector as described herein (e.g., in any of the aforementioned vector aspects and embodiments), or a cell (or cell population) as described herein (e.g., in any of the aforementioned cell (e.g., modified cell) or cell population aspects and embodiments) for use in treating a disease, wherein the disease is a disease associated with tumor antigen expression, e.g., a proliferative disease associated with tumor antigen expression, a precancerous condition, a cancer, and a non-cancer related indication.

[0330] In another aspect, the invention provides a gRNA molecule as described herein (e.g., in any of the aforementioned gRNA molecule aspects and embodiments), a composition as described herein (e.g., in any of the aforementioned composition aspects and embodiments), a nucleic acid as described herein (e.g., in any of the aforementioned nucleic acid aspects and embodiments), a vector as described herein (e.g., in any of the aforementioned vector aspects and embodiments), or a cell (or cell population) as described herein (e.g., in any of the aforementioned cell (e.g., modified cell) or cell population aspects and embodiments) for use in treating cancer, wherein the cancer is a hematological cancer selected from the group consisting of chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoid leukemia (ALL), B cell B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small-cell or large-cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom macroglobulinemia, and preleukemia.

[0331] In another aspect, the invention provides a gRNA molecule as described herein (e.g., in any of the aforementioned gRNA molecule aspects and embodiments), a composition as described herein (e.g., in any of the aforementioned composition aspects and embodiments), a nucleic acid as described herein (e.g., in any of the aforementioned nucleic acid aspects and embodiments), a vector as described herein (e.g., in any of the aforementioned vector aspects and embodiments), or a cell (or cell population) as described herein (e.g., in any of the aforementioned cell (e.g., modified cell) or cell population aspects and embodiments) for use in treating cancer, e.g., wherein the cancer is selected from mesothelioma, adenocarcinoma, glioblastoma, colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestinal cancer. , esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, solid tumors of childhood, bladder cancer, cancer of the kidney or ureter, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal vertebral tumors, brain stem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmental cancers, combinations of the aforementioned cancers, and metastatic lesions of the aforementioned cancers.

[0332] In addition to the specific features of the invention described above, the following general features of gRNA molecules, Cas9 molecules, and cells are contemplated to apply to any aspect and embodiment of the invention described herein, including those described above.

[0333] In any of the aspects and embodiments disclosed herein, a gRNA molecule (e.g., a gRNA molecule, or a combination of gRNA molecules, including a guide domain described herein) can comprise one or more of the following features:

[0334] In certain embodiments, the gRNA molecule (e.g., a gRNA molecule, or one or more gRNA molecules of a gRNA molecule combination, including a guide domain as described herein) is a dgRNA molecule, wherein the guide domain and tracr are provided on separate nucleic acid molecules. In embodiments, the crRNA comprises from 5' to 3' [guide domain]-:

[0335] a) SEQ ID NO: 6584;

[0336] b) SEQ ID NO: 6585;

[0337] c) SEQ ID NO: 6605;

[0338] d) SEQ ID NO: 6606;

[0339] e) SEQ ID NO: 6607;

[0340] f) SEQ ID NO: 6608; or

[0341] g) SEQ ID NO: 7806. In a preferred embodiment, the crRNA comprises from 5' to 3' [guide domain] - [SEQ ID NO: 6607]. In embodiments, tracr comprises more than 15, e.g., 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, or 80 or more nucleotides of the Streptococcus pyogenes tracr sequence (GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC). In embodiments, tracr additionally comprises 1 or more, e.g., 1, 2, 3, 4, 5, 6, or 7, e.g., preferably 4 or 7, U nucleotides at the 3' end. In preferred dgRNA embodiments, tracr comprises SEQ ID NO: 7820. In an embodiment, the tracr additionally comprises 1 or more, e.g., 1, 2, 3, 4, 5, 6 or 7, e.g., preferably 4 or 7, U nucleotides at the 3' end. In a preferred dgRNA embodiment, the tracr comprises, e.g., consists of, SEQ ID NO: 6660. In a preferred dgRNA embodiment, the crRNA comprises, e.g., consists of, [guide domain]-SEQ ID NO: 6607, and the tracr comprises, e.g., comprises, e.g., consists of, SEQ ID NO: 7820.

[0342] In other embodiments, the gRNA molecule (e.g., a gRNA molecule, or one or more gRNA molecules of a gRNA molecule combination, including a guide domain as described herein) is an sgRNA molecule, wherein the guide domain and tracr are provided on a single nucleic acid molecule. In embodiments, the sgRNA molecule comprises, e.g., consists of: [guide domain]-

[0343] (a) SEQ ID NO: 6601;

[0344] (b) SEQ ID NO: 6602;

[0345] (c) SEQ ID NO: 6603;

[0346] (d) SEQ ID NO: 6604; or

[0347] (e) Any of (a) to (d) above, further comprising 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides at the 3' end. In a preferred embodiment, the sgRNA molecule comprises [guiding domain]-SEQ ID NO: 6601. In a preferred embodiment, the sgRNA molecule comprises, for example, consists of, [guiding domain]-SEQ ID NO: 7811.

[0348] In embodiments, included in any one of the aforementioned aspects and embodiments, one or more nucleic acid molecules of gRNA molecules as described herein, for example, all nucleic acid molecules of gRNA molecules as described herein, do not contain changes to nucleotides or internucleotide bonds. In other embodiments, included in any one of the aforementioned aspects and embodiments, one or more nucleic acid molecules of gRNA molecules as described herein include one or more modifications to nucleotides or internucleotide bonds as described herein. In embodiments, the modification includes 2'O- methyl modifications. In embodiments, the modification includes phosphorothioate modifications. In embodiments, the modification includes 2'O- methyl modifications at 1,2,3 or more (e.g., 3) 3' nucleotides of the nucleic acid of the gRNA molecule. In embodiments, the modification includes 2'O- methyl modifications at the 4th, 3rd and 2nd to last 3' nucleotides of the nucleic acid of the gRNA molecule. In embodiments, the modification includes 2'O- methyl changes at 1,2,3 or more (e.g., 3) 5' nucleotides of the nucleic acid of the gRNA molecule. In an embodiment, the modification includes a 2'O-methyl modification at the 4th to last, 3rd to last, and 2nd to last 3' nucleotides of the nucleic acid of the gRNA molecule and a 2'O-methyl modification at 1, 2, 3 or more (e.g., 3) 5' nucleotides of the nucleic acid of the gRNA molecule. In an embodiment, the modification includes one or more, e.g., 1, 2, 3 or more, e.g., 3 phosphorothioate bonds at the 3' end of the nucleic acid molecule of the gRNA. In an embodiment, the modification includes one or more, e.g., 1, 2, 3 or more, e.g., 3 phosphorothioate bonds at the 5' end of the nucleic acid molecule of the gRNA. In an embodiment, the modification includes one or more, e.g., 1, 2, 3 or more, e.g., 3 phosphorothioate bonds at the 3' end of the nucleic acid molecule of the gRNA and at its 5' end. In an embodiment involving a dgRNA molecule, the molecule comprising tracr and the molecule comprising crRNA are modified as described herein. In other embodiments involving a dgRNA molecule, the molecule comprising tracr is unmodified and the molecule comprising crRNA is modified as described herein. In other embodiments involving dgRNA molecules, the crRNA-containing molecule is unmodified and the tracr-containing molecule is modified as described herein.

[0349] In aspects of the invention comprising more than one gRNA molecule, each gRNA molecule can independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In embodiments, all gRNA molecules of the combination described herein are dgRNA molecules. In embodiments, all gRNA molecules of the combination described herein are sgRNA molecules. In embodiments, one or more gRNA molecules of the combination described herein are dgRNA molecules, and one or more other gRNA molecules of the combination described herein are sgRNA molecules.

[0350] In embodiments, the gRNA molecule of the present invention is when introducing a cell as described herein, at or near the target sequence of the gRNA, an insertion / deletion gRNA molecule is produced. In embodiments, the gRNA molecule of the present invention is at least about 70% of the cell colony (such as cell as described herein) introducing the gRNA molecule, for example, at least about 80%, for example, at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about 97%, for example, at least about 98%, for example, at least about 99% or more in producing an insertion / deletion gRNA molecule. In embodiments, the insertion / deletion frequency is measured by, for example, NGS as described herein. In embodiments, the insertion / deletion or multiple insertions / deletions are or include frameshift mutations. In embodiments, the gRNA molecule of the present invention is at least about 30% of the cell colony introducing the gRNA molecule, for example, at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 75%, for example, at least about 80%, for example, at least about 85%, for example, at least about 90%, for example, at least about 95% or more such as described herein cells produce the gRNA molecule of insertion / deletion. In embodiments, by NGS such as described herein, frameshift mutation frequency is measured. In embodiments, the insertion / deletion, insertion / deletion frequency, frameshift mutation and / or frameshift mutation frequency are measured in cells (or colonies or cells) after gRNA molecule is introduced as RNP with Cas9 molecule as described herein. In embodiments, the insertion / deletion, insertion / deletion frequency, frameshift mutation and / or frameshift mutation frequency are measured in cells (or colonies or cells) after gRNA molecule is introduced by electroporation.

[0351] In embodiments, when the gRNA molecule of the present invention is introduced into a cell as described herein or a cell colony, the gRNA molecule of the frequency of insertion / deletion is produced at a frequency lower than at least 50 times, for example, at least 100 times, for example, at least 1000 times than the target sequence of the gRNA at or near the target site. In preferred embodiments, when introducing a cell as described herein or a cell colony, gRNA does not produce detectable insertion / deletion at any site of the target ...

[0352] In embodiments, the RNP or combination of RNPs is delivered to the cell by a single electroporation.In embodiments, the cells of the invention are subjected to only a single electroporation step.

[0353] In aspects and embodiments of the invention comprising a combination of gRNA molecules, each gRNA molecule of the combination can independently comprise any one of the aforementioned features.

[0354] In any of the aspects and embodiments disclosed herein, the Cas9 molecule may comprise one or more of the following features:

[0355] In various aspects, the Cas9 molecule is a Streptococcus pyogenes Cas9, e.g., a modified or unmodified Streptococcus pyogenes Cas9 molecule as described herein. In embodiments, the Cas9 molecule comprises SEQ ID NO: 6611. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7821, e.g., consisting thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7822, e.g., consisting thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7823, e.g., consisting thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7824, e.g., consisting thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7825, e.g., consisting thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7826, e.g., consisting thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7827, e.g., consisting thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7828, e.g., consisting thereof. In other embodiments, the Cas9 molecule comprises, for example, consists of, SEQ ID NO: 7829. In other embodiments, the Cas9 molecule comprises, for example, consists of, SEQ ID NO: 7830. In other embodiments, the Cas9 molecule comprises, for example, consists of, SEQ ID NO: 7831. Preferred Cas9 molecules are Cas9 molecules comprising, for example, consisting of, SEQ ID NO: 7821, SEQ ID NO: 7822, SEQ ID NO: 7825, and SEQ ID NO: 7828.

[0356] In aspects and embodiments comprising one or more RNP complexes (e.g., one or more RNP complexes comprising a Cas9 molecule as described herein), each of the RNP complexes is at a concentration of less than about 10 uM, e.g., less than about 3 uM, e.g., less than about 1 uM, e.g., less than about 0.5 uM, e.g., less than about 0.3 uM, e.g., less than about 0.1 uM. In embodiments, the concentration is the concentration of the RNP complex in a composition comprising, e.g., cells (e.g., cell colonies) as described herein into which RNPs are to be introduced, e.g., by electroporation. In embodiments, the matrix of the composition is suitable for electroporation.

[0357] In aspects and embodiments of the invention comprising a combination of gRNA molecules (e.g., a combination of RNPs comprising different gRNA molecules), each Cas9 molecule of the combination can independently comprise any one of the aforementioned features.

[0358] In any of the aspects and embodiments disclosed herein, the cells (e.g., a population of cells) may comprise one or more of the following characteristics:

[0359] In various aspects, cells (e.g., cell colonies) include one or more cells expressing T cell receptor (TCR) components with reduction or elimination. In embodiments, the expression of T cell receptor (TCR) components for reduction or elimination includes the expression of TRAC for reduction or elimination. In embodiments, the expression of T cell receptor (TCR) components for reduction or elimination includes the expression of TRBC1 for reduction or elimination. In embodiments, the expression of T cell receptor (TCR) components for reduction or elimination includes the expression of TRBC2 for reduction or elimination. In embodiments, the expression of T cell receptor (TCR) components for reduction or elimination includes the expression of CD3G for reduction or elimination. In embodiments, the expression of T cell receptor (TCR) components for reduction or elimination includes the expression of CD3D for reduction or elimination. In embodiments, the expression of T cell receptor (TCR) components for reduction or elimination includes the expression of CD3E for reduction or elimination. In embodiments, the reduction or elimination expression of the TCR components is to introduce one or more as described herein, e.g., one or two, e.g., a result of the gRNA molecules for the TCR components into the cell. In embodiments, cells comprise insertions / deletions as described herein, e.g., frameshift mutations, at or near the target sequence of the guide domain of the gRNA molecule for the TCR component. In embodiments, the cell colony comprises at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90% or more cells that show reduced or eliminated expression of TCR components (e.g., as described herein). In embodiments, the reduced or eliminated TCR component expression is measured, e.g., by flow cytometry as described herein.

[0360] In various aspects, (comprising alternatively or additionally reducing or eliminating TCR component expression) cell (for example, cell colony) comprises one or more cells with reduced or eliminated beta-2 microglobulin (B2M) expression. In embodiments, the reduction or elimination expression of the B2M is the result of introducing one or more, for example, one or two, for example, a gRNA molecule for B2M as described herein into the cell. In embodiments, the cell comprises an insertion / deletion as described herein, for example, a frameshift mutation, at or near the target sequence of the guide domain of the gRNA molecule for the B2M. In embodiments, the cell colony comprises at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90% or more showing B2M expression reduction or elimination (as described herein) cells. In embodiments, the B2M expression reduced or eliminated as described by, for example, flow cytometry as described herein is measured.

[0361] In various aspects, (comprising alternatively or additionally the TCR and / or B2M component expression of reduction or elimination) cells (e.g., cell colonies) include one or more cells with reduced or eliminated CIITA expression. In embodiments, the reduction or elimination expression of the CIITA is the result of introducing one or more, e.g., one or two, e.g., a gRNA molecule for the CIITA described herein into the cell. In embodiments, the cell comprises an insertion / deletion as described herein at or near the target sequence of the guide domain of the gRNA molecule for the CIITA, e.g., a frameshift mutation. In embodiments, the cell colony comprises at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90% or more cells showing CIITA expression reduction or elimination (as described herein). In embodiments, the B2M expression reduced or eliminated as measured by flow cytometry, e.g., as described herein.

[0362] In various aspects, (comprising alternatively or additionally reducing or eliminating TCR component expression) cells (e.g., cell colonies) include cells expressing one or more targets (e.g., FKBP1A) of immunosuppressants that are reduced or eliminated. In embodiments, the reduction or elimination of expression of the FKBP1A is the result of introducing one or more, e.g., one or two, e.g., a gRNA molecule for the FKBP1A described herein into the cells. In embodiments, the cells comprise insertions / deletions as described herein, e.g., frameshift mutations, at or near the target sequence of the guide domain of the gRNA molecule for the FKBP1A. In embodiments, the cell colony comprises at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90% or more cells showing reduction or elimination of FKBP1A expression (as described herein). In embodiments, the FKBP1A expression reduced or eliminated is measured by, e.g., flow cytometry as described herein.

[0363] In some aspects, it is necessary for cells to show that the expression of more than one gene is reduced or eliminated.In one aspect, cell shows the TCR components (for example, TRAC, TRBC1, TRBC2, CD3E, CD3G and / or CD3D) expression of reduction or elimination, the B2M expression of reduction or elimination and the CIITA expression of reduction or elimination.In embodiments, the expression of reduction or elimination is produced by introducing gRNA molecule combination to cell, wherein gRNA molecule combination is included in the guidance domain sequence listed in any one of combination A1 to A72.In embodiments, the expression of reduction or elimination is produced by introducing gRNA molecule combination to cell, wherein gRNA molecule combination is included in the guidance domain sequence listed in any one of combination B1 to B84.In embodiments, the target sequence of the guidance domain of the cell every kind of gRNA molecule listed in table 33, table 34 or table 38 (for example, the gRNA molecule in any one of combination A1 to A72, B1 to B84 or F1 to F60) or its vicinity comprises insertion / deletion, for example, frameshift mutation.

[0364] In some aspects, it is necessary for cells to show that the expression of more than one gene is reduced or eliminated. In one aspect, cells show that the TCR components (for example, TRAC, TRBC1, TRBC2, CD3E, CD3G and / or CD3D) that reduce or eliminate are expressed, and the target (for example, FKBP1A) of the immunosuppressant that reduces or eliminates is expressed. In embodiments, the expression reduced or eliminated is produced by introducing gRNA molecule combination to cells, wherein the gRNA molecule combination is included in the guidance domain sequence listed in any one of combination C1 to C42. In embodiments, the expression reduced or eliminated is produced by introducing gRNA molecule combination to cells, wherein the gRNA molecule combination is included in the guidance domain sequence listed in any one of combination D1 to D36. In embodiments, the cell comprises an insertion / deletion, e.g., a frameshift mutation, at or near the target sequence of the guide domain of each gRNA molecule listed in Table 35, Table 36, or Table 37 (e.g., a gRNA molecule in any one of combinations C1 to C42, D1 to D36, or E1 to E30).

[0365] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and B2M) (including embodiments where the expression or function of an additional target (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from the group consisting of SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7836 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7837 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7836 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7837 and SEQ ID NO: 10798, and the gRNA molecule targeting B2M is selected from the group consisting of SEQ ID NO: 7853, SEQ ID NO: 7854, SEQ ID NO: NO: 7855, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7856 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7857 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7856 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7857 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0366] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and B2M) (including embodiments where the expression or function of an additional target (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from the group consisting of SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7836 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7837 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7836 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7837 and SEQ ID NO: 10798, and the gRNA molecule targeting B2M is selected from the group consisting of SEQ ID NO: 7858, SEQ ID NO: 7859, SEQ ID NO: NO: 7860, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7861 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7862 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7861 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7862 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0367] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and B2M) (including embodiments where the expression or function of an additional target (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from the group consisting of SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7841 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7842 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7841 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7842 and SEQ ID NO: 10798, and the gRNA molecule targeting B2M is selected from the group consisting of SEQ ID NO: 7853, SEQ ID NO: 7854, SEQ ID NO: NO: 7855, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7856 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7857 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7856 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7857 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0368] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from the group consisting of SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7841 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7842 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7841 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7842 and SEQ ID NO: 10798, and the gRNA molecule targeting B2M is selected from the group consisting of SEQ ID NO: 7858, SEQ ID NO: 7859, SEQ ID NO: NO: 7860, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7861 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7862 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7861 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7862 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0369] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from the group consisting of SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7846 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7847 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7846 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7847 and SEQ ID NO: 10798, and the gRNA molecule targeting B2M is selected from the group consisting of SEQ ID NO: 7853, SEQ ID NO: 7854, SEQ ID NO: NO: 7855, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7856 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7857 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7856 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7857 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0370] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from the group consisting of SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7846 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7847 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7846 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7847 and SEQ ID NO: 10798, and the gRNA molecule targeting B2M is selected from the group consisting of SEQ ID NO: 7858, SEQ ID NO: 7859, SEQ ID NO: NO: 7860, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7861 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7862 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7861 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7862 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0371] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from the group consisting of SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7851 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7852 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7851 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7852 and SEQ ID NO: 10798, and the gRNA molecule targeting B2M is selected from the group consisting of SEQ ID NO: 7853, SEQ ID NO: 7854, SEQ ID NO: NO: 7855, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7856 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7857 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7856 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7857 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0372] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from the group consisting of SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7851 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7852 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7851 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7852 and SEQ ID NO: 10798, and the gRNA molecule targeting B2M is selected from the group consisting of SEQ ID NO: 7858, SEQ ID NO: 7859, SEQ ID NO: NO: 7860, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7861 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7862 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7861 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7862 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0373] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from the group consisting of SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7836 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7837 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7836 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7837 and SEQ ID NO: 10798, and the gRNA molecule targeting FKBP1A is selected from the group consisting of SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: NO: 7865, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7866 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7867 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7866 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7867 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0374] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from the group consisting of SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7836 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7837 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7836 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7837 and SEQ ID NO: 10798, and the gRNA molecule targeting FKBP1A is selected from the group consisting of SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: 7870, SEQ ID NO: 7871, SEQ ID NO: 7872, SEQ ID NO: 7873, SEQ ID NO: 7874, SEQ ID NO: 7875, SEQ ID NO: 7876, SEQ ID NO: 7877, SEQ ID NO: 7878, SEQ ID NO: 7879, SEQ ID NO: 7880, SEQ ID NO: 7881, SEQ ID NO: 7882, SEQ ID NO: 7883 NO: 7870, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7871 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7872 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7871 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7872 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0375] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from the group consisting of SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7841 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7842 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7841 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7842 and SEQ ID NO: 10798, and the gRNA molecule targeting FKBP1A is selected from the group consisting of SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: 7865, SEQ ID NO: 7866, SEQ ID NO: 7867, SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: 7870, SEQ ID NO: 7871, SEQ ID NO: 7872, SEQ ID NO: 7873, SEQ ID NO: 7874, SEQ ID NO: 7875 NO: 7865, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7866 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7867 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7866 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7867 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0376] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from the group consisting of SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7841 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7842 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7841 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7842 and SEQ ID NO: 10798, and the gRNA molecule targeting FKBP1A is selected from the group consisting of SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: NO: 7870, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7871 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7872 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7871 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7872 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0377] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from the group consisting of SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7846 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7847 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7846 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7847 and SEQ ID NO: 10798, and the gRNA molecule targeting FKBP1A is selected from the group consisting of SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: NO: 7865, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7866 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7867 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7866 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7867 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0378] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from the group consisting of SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7846 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7847 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7846 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7847 and SEQ ID NO: 10798, and the gRNA molecule targeting FKBP1A is selected from the group consisting of SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: 7870, SEQ ID NO: 7871, SEQ ID NO: 7872, SEQ ID NO: 7873, SEQ ID NO: 7874, SEQ ID NO: 7875 NO: 7870, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7871 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7872 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7871 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7872 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0379] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from the group consisting of SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7851 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7852 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7851 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7852 and SEQ ID NO: 10798, and the gRNA molecule targeting FKBP1A is selected from the group consisting of SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: NO: 7865, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7866 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7867 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7866 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7867 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0380] In preferred embodiments where it is intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from the group consisting of SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7851 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7852 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7851 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7852 and SEQ ID NO: 10798, and the gRNA molecule targeting FKBP1A is selected from the group consisting of SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: NO: 7870, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7871 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7872 and SEQ ID NO: 6660, a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7871 and SEQ ID NO: 10798, and a dgRNA comprising (e.g., consisting of) SEQ ID NO: 7872 and SEQ ID NO: 10798. As described herein, in any combination of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule (e.g., a Cas9 molecule described herein).

[0381] In one aspect, the cell shows a reduction or elimination of expression of only one TCR component (although it may show a reduction or elimination of expression of one or more other targets that are not TCR components). In embodiments, the cell comprises an indel at or near a target sequence within only a single gene (or its regulatory element) that is a TCR component (although the cell may comprise an indel at or near a target sequence within one or more additional genes (or their regulatory elements) that are not TCR components). Thus, in embodiments, the cell does not comprise an indel within more than one gene that is a TCR component. In embodiments, the cell does not comprise an indel within TRAC and within a gene encoding a second TCR component (e.g., TRBC1 or TRBC2).

[0382] In one aspect, the cell does not show expression of a gene that is reduced or eliminated, and the gene comprises an inhibitory molecule or a target sequence of a downstream effector of a signal transduction by an inhibitory molecule (but it can show that the expression of one or more other genes is reduced or eliminated). In embodiments, the cell does not comprise insertions / deletions at or near the target sequence in a gene (or its regulatory element) of an inhibitory molecule or a downstream effector of a signal transduction by an inhibitory molecule (but it can comprise insertions / deletions in one or more other genes (or its regulatory element)). In embodiments, the cell does not comprise insertions / deletions inside PDCD1 or its regulatory element.

[0383] In a number of aspects, the cell is an animal cell, for example, a mammalian cell, a primate cell or a human cell, for example, a human cell. In a number of aspects, the cell is an immune effector cell (for example, a cell colony comprising one or more immune effector cells), for example, a T cell or a NK cell, for example, a T cell, for example, a CD4+ T cell, a CD8+ T cell or a combination thereof.

[0384] In various aspects, the cells are autologous to the patient to whom they are administered. In other aspects, the cells are allogeneic to the patient to whom they are administered. In embodiments, the cells are allogeneic to the patient to whom they are administered and are induced pluripotent stem cells or cells derived therefrom. In embodiments, the cells are allogeneic to the patient to whom they are administered and are immune effector cells, e.g., T cells, isolated from a healthy human donor.

[0385] In various aspects, for example, by the methods described herein, in vitro regulation and / or change such as cells as described herein (or cell colonies), for example, cells expressing CAR as described herein. In various aspects, for example, by the methods described herein, in vitro regulation and / or change such as cells as described herein (or cell colonies), for example, cells expressing CAR as described herein. In various aspects, by the CRISPR system of the present invention, (included in the RNP complex with Cas9 molecules as described herein) gRNA molecules and / or compositions (for example, compositions comprising more than one gRNA molecules of the present invention) are introduced into cells such as described herein in vitro, for example, cells expressing CAR as described herein. In other aspects, by the CRISPR system of the present invention, (included in the RNP complex with Cas9 molecules as described herein) gRNA molecules and / or compositions (for example, compositions comprising more than one gRNA molecules of the present invention) are introduced into cells such as described herein in vivo, for example, cells expressing CAR as described herein.

[0386] In various aspects, as described herein, cells have been, have been or will be engineered to express a chimeric antigen receptor (CAR) (e.g., cells comprising, or will comprise a nucleic acid sequence encoding CAR). In embodiments, such as described herein, CAR recognizes an antigen selected from the group consisting of CD19, CD123, CD22, CD30, CD171, CS-1 (also known as CD2 subclass 1, CRACC, SLAMF7, CD319, and 19A24), C-type lectin-like molecule-1 (CLL-1 or CLECL1), CD33, epidermal growth factor receptor variant III (EGFRvIII), ganglioside G2 (GD2), ganglioside GD3 (aNeu5Ac (2-8) aNeu5Ac (2-3) bDGalp (1-4) bDGlcp (1-1) Cer), TNF receptor family member B cell maturation (BCMA), Tn antigen ((Tn Ag) or (GalNAcα-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); mesothelin; interleukin-11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); protease serine 21 (testis or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-β); stage-specific embryonic antigen-4 (SSEA-4); CD2 0; folate receptor alpha; receptor tyrosine-protein kinase ERBB2 (Her2 / neu); cell surface-associated mucin 1 (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostase; prostatic acid phosphatase (PAP); mutated elongation factor 2 (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor); carbonic anhydrase IX (CAIX); proteasome (proteasome, megalin factor) subunit type B 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein composed of the breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe);Ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); folate receptor β; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); tight junction protein 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5 member D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); globoH Hexose moiety of glycoceramide (GloboH); mammary gland differentiation antigen (NY-BR-1); urothelial differentiation-specific glycoprotein (uroplakin) 2 (UPK2); hepatitis A virus cellular receptor 1 (HAVCR1); adrenergic receptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex locus K9 (LY6K); olfactory receptor 51E2 (OR51E2); TCRγ alternative open reading frame protein (TARP); Wilm tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutants; prostate-specific protein (prostein); survival; telomerase; prostate cancer tumor antigen-1 (PCTA-1 or galectin 8), melanoma antigen recognized by T cells 1 (MelanA or MART1); rat sarcoma (Ras) mutants; human telomerase reverse transcriptase (hTERT ); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis protein (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyltransferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytic leukemia viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2);Cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like (BORIS or Brother of the Regulator of Imprinted Sites), squamous cell carcinoma antigen recognized by T cells 3 (SART3); paired box protein Pax-5 (PAX5); pre-acrosomal protein-binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchoring protein 4 (AKAP-4); synovial sarcoma X breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitin 1 (RU1); renal ubiquitin 2 (RU2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; mutant heat shock protein 70-2 (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of the IgA receptor (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A, member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12, member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); mucin-like hormone receptor-like 2 containing an EGF-like module (EMR2); lymphocyte antigen 75 (LY75); glycan-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0387] In embodiments, the CAR comprises an antigen recognition domain that binds to CD19, e.g., as described herein. In embodiments, the CAR comprises an anti-CD19 binding domain comprising, e.g., consisting of, SEQ ID NO: 7895. In embodiments, the CAR comprises an anti-CD19 binding domain comprising, e.g., consisting of, SEQ ID NO: 7884.

[0388] In embodiments, CAR comprises an antigen recognition domain that binds BCMA, e.g., as described herein. In embodiments, CAR comprises an anti-BCMA binding domain comprising, e.g., consisting of, SEQ ID NO: 7949.

[0389] In embodiments, the CAR comprises an antigen binding domain, a transmembrane domain, and an intracellular signaling domain. In embodiments, the transmembrane domain comprises a sequence of SEQ ID NO: 6644. In embodiments, the intracellular signaling domain comprises a primary signaling domain and / or a costimulatory signaling domain. In embodiments, the primary signaling domain comprises a sequence of SEQ ID NO: 6648 or SEQ ID NO: 6650, e.g., consisting thereof. In embodiments, the costimulatory signaling domain comprises a sequence of SEQ ID NO: 6646 or SEQ ID NO: 6636, e.g., consisting thereof, e.g., comprising a sequence of SEQ ID NO: 6646, e.g., consisting thereof. In other embodiments, the costimulatory signaling domain comprises a sequence from the intracellular signaling domain of CD28.

[0390] In embodiments, the CAR is a CD19 CAR and comprises, e.g., consists of, the sequence of SEQ ID NO: 7920. In embodiments, the CAR is a CD19 CAR and comprises, e.g., consists of, the sequence of SEQ ID NO: 7909. In embodiments, e.g., the cells described herein comprise a nucleic acid sequence encoding a CD19 CAR described herein, e.g., a CD19 CAR comprising the sequence of SEQ ID NO: 7920 or SEQ ID NO: 7909.

[0391] In embodiments, the CAR is a BCMA CAR and comprises, e.g., consists of, the sequence of SEQ ID NO: 8559. In embodiments, e.g., a cell described herein comprises a nucleic acid sequence encoding a BCMA CAR described herein, e.g., a BCMA CAR comprising SEQ ID NO: 8559. In embodiments, the nucleic acid sequence encoding the BCMA CAR comprises, e.g., consists of, SEQ ID NO: 8574.

[0392] In various aspects, for example, the cells of the present invention described herein (e.g., colony cells of the present invention) further contain nucleic acid sequences encoding NK inhibitory molecules. When the cell shows a reduction or elimination of expression of one or more major histocompatibility class I (MHC I) molecules (e.g., by reducing or eliminating expression of B2M, e.g., by methods described herein) and / or a reduction or elimination of expression of one or more major histocompatibility class II (MHC II) molecules (e.g., by reducing or eliminating expression of CIITA, e.g., by methods described herein), such cells are preferred. In embodiments, the NK inhibitory molecule is an HLA-G molecule, e.g., an HLA-G molecule that does not require B2M, e.g., HLA-G2, HLA-G3, HLA-G4. In other embodiments, the NK inhibitory molecule is an HLA-G:B2M fusion molecule. An exemplary HLA-G:B2M fusion molecule is SEQ ID NO: 10674. An exemplary nucleic acid sequence encoding the HLA-G:B2M fusion is SEQ ID NO: 10675.

[0393] In embodiments, the cells (eg, a population of cells) exhibit reduced or eliminated expression of a target of an NK inhibitory molecule, eg, reduced or eliminated expression of LILRB1.

[0394] In embodiments, the cells expressing CAR of the present invention (e.g., cells wherein the expression or function of one or more proteins has been reduced or eliminated, for example, by methods described herein), maintain the ability to proliferate in response to stimulation, for example, by binding CAR to its target antigen. In embodiments, proliferation occurs in vitro. In embodiments, proliferation occurs in vivo. In embodiments, proliferation occurs in vitro and in vivo. In embodiments, the proliferation level is substantially the same as that shown for the same cell type (e.g., cells expressing CAR of the same type), but the cell type has not yet reduced or eliminated the expression or function of one or more proteins, for example, by methods described herein. In embodiments, the proliferation level is at least 80%, at least 85%, at least 90%, at least 95% at least 98% or greater of the proliferation level shown for the same cell type (e.g., cells expressing CAR of the same type), but the cell type has not yet reduced or eliminated the expression or function of one or more proteins, for example, by methods described herein.

[0395] Unless otherwise limited, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein can be used for implementing or testing the present invention, suitable methods and materials are now described. All publications, patent applications, patents and other references mentioned herein are fully incorporated by reference. In addition, the materials, methods and examples are only illustrative and are not intended to be restrictive. Titles, subtitles or numbered or lettered elements, for example, (a), (b), (i) etc., are only displayed for ease of reading. Using the title or numbered or lettered elements in this document does not require that steps or elements be performed in alphabetical order and that the steps or elements are necessarily independent of each other. Other features, objects and advantages of the present invention will be apparent from this description and the accompanying drawings and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0396] Figure 1 : Cas9 editing of the B2M locus. Editing fraction detected by NGS in HEK-293 Cas9GFP 24 hours after lipofectamine delivery of crRNA targeting the B2M locus and trRNA. Each dot represents a different crRNA, while trRNA remains constant. Genomic coordinates are shown for the position on chromosome 15 (n=3).

[0397] Figure 2 : Histogram of TCR expression after editing with gRNA molecules containing guide domains against TCR-α as listed in Table 1. Shown is the % of mCherry+TCR- cells in Jurkat cells after 7 days using three different concentrations of lentivirus.

[0398] Figure 3 : Shown are the % TCR- primary T cells 6 and 12 days after introduction of lentivirus encoding the indicated gRNAs and Cas9 / mCherry. Data show the % of mCherry+TCR-edited cells.

[0399] Figure 4 : Shown are the % of PD1- primary T cells in the mCherry+ gated population 3 days after restimulation (with CD3 / CD28 beads) and 8 days after activation in cells transfected with lentivirus encoding the indicated gRNAs and Cas9 / mCherry.

[0400] Figure 5A and Figure 5B : Shows the expression histogram of TCR using TRAC-8 gRNA on day 7 of culture ( Figure 5A ) and the expression histogram of PD-1 using PD1-6 gRNA on day 8 of culture ( Figure 5B).

[0401] Figure 6 : Expression profiles of primary T cells engineered to express a CD19 CAR and treated with RNPs containing a gRNA targeting TCRα. Before enrichment, populations of cells that were CAR+ / - and TCR+ / - after 11 days of culture were shown. After enrichment, >98% of TCR- T cells were isolated using a CD3 microbead negative selection step.

[0402] Figure 7 : Shows the cytotoxic activity of CD19 CAR-transduced T cells against target-positive cell lines (Nalm6-luc) and target-negative cell lines (K562-luc). "T1" and "T8" refer to gRNAs TRAC-1 and TRAC-8, respectively. Shows the results of lentiviral- or RNP-introduced Cas9 / gRNA, and unsorted and TCR-sorted ("sorted") T cell populations.

[0403] Figure 8 Figure 2: Internal excision of the B2M gene using a CRISPR system containing two gRNA molecules. In each experiment, cells were exposed to a gRNA containing the guide domain of CR00442 and a second gRNA molecule, as indicated. The predicted excision product sizes are shown.

[0404] Figure 9 = Results of gRNA pair exposure to the B2M gene, with less than 100 expected excision products. * indicates the expected excision product was observed (green arrow); ? = the expected excision product could not be resolved from the assay. Yellow arrows indicate the wild-type fragment.

[0405] Figure 10 : Results of gRNA pair exposure to the B2M gene, with the expected excision product being ~4000 base pairs. Red* indicates the expected excision product observed (green box); purple* = less than 10% editing efficiency. The orange box shows the wild-type fragment.

[0406] Figure 11 : Results of gRNA pair exposure to the B2M gene, with the expected excision product being ~6000 base pairs. Red* indicates the expected excision product observed (green box); purple* = less than 10% editing efficiency. The orange box shows the wild-type fragment.

[0407] Figure 12 : Average (n≥3) editing effects of the CRISPR system with dgRNAs against TRAC as indicated in HEK cells (stable expression of Cas9) or primary human CD3+ T cells (dgRNA:Cas9 RNP delivered by electroporation). Also shown is the % of cells showing TCR loss as determined by flow cytometry using anti-TCRa / b antibodies.

[0408] Figure 13 : Average (n≥3) editing effects of the CRISPR system with dgRNAs against the coding regions of TRBC1 and TRBC2 as indicated in HEK cells (stable expression of Cas9). Also shown is the % of cells showing TCR loss as determined by flow cytometry using anti-TCR a / b antibodies.

[0409] Figure 14 Figure 3: Average (n≥3) editing effect of the CRISPR system with dgRNA against B2M as indicated in HEK cells (stable expression of Cas9), in CD34+ primary human hematopoietic stem cells, and % B2M loss as measured by flow cytometry in primary CD3+ T cells. NGS assays were performed 24 hours after the introduction of the CRISPR system into the indicated cells; flow cytometric analysis was performed 3-5 days after the introduction of the CRISPR system into CD3+ T cells.

[0410] Figure 15 : Editing effect of the CRISPR system containing the indicated gRNA molecules in primary human CD3+ T cells from three different donors as measured by TCR loss (flow cytometry). For each gRNA, left bar = donor #1; middle bar = donor #2; right bar = donor #3.

[0411] Figure 16 : Average (n≥3) editing effects of the CRISPR system with dgRNAs against PDCD1 as indicated in HEK cells (stable expressing Cas9) as measured by NGS and in primary human CD3+ cells (RNP electroporation) as measured by PD-1 loss (flow cytometry using an anti-PD-1 antibody).

[0412] Figure 17A : Flow cytometric expression of TCR and / or B2M after electroporation of gRNAs targeting TRAC and / or B2M at the indicated ratios.

[0413] Figure 17B : % of cells negative for both B2M and TCR at the indicated gRNA ratios.

[0414] Figure 17C : Editing of B2M or TCR as measured by flow cytometry.

[0415] Figure 17D : Cell viability 24 hours after electroporation.

[0416] Figure 18: % editing in primary CD3+ T cells as measured by NGS (yellow bars) or PD-1 loss by flow cytometry (using an anti-PD-1 antibody) using dgRNA containing a guide domain against PDCD1 (guide domain of the CRxxxx sequence shown). NGS sequencing was performed 24 hours after RNP delivery; flow cytometry was performed on day 5 after RNP delivery.

[0417] Figure 19 : % editing in primary CD3+ T cells as measured by flow cytometry (using an anti-PD-1 antibody) of PD-1 loss using dgRNAs containing guide domains against PDCD1 (guide domains of the indicated CRxxxx sequences) between three different donors (donor #4, leftmost bar; donor #5, middle bar; donor #6, rightmost bar) (n>=3). Systems with guide domains against some targets showed >50% loss of PD-1, with consistent results across multiple donors. gRNAs containing guide domains of CR00852, CR00828, CR00870, CR00848, CR00855, and CR00838 showed greater than 50% editing between at least two donors.

[0418] Figure 20 : % editing in primary CD3+ T cells as measured by B2M loss by flow cytometry using dgRNAs containing guide domains targeting B2M (guide domains of the indicated CRxxxx sequences) between three different donors (donor #1, leftmost bar; donor #4, middle bar; donor #5, rightmost bar) (n>=3). Systems with guide domains targeting some target sequences showed >40% B2M loss, with consistent results across multiple donors. gRNAs containing guide domains of CR00442, CR00444, and CR00455 showed greater than 40% editing between at least two donors.

[0419] Figure 21 : % editing as measured by NGS in HEK293 cells stably expressing Cas9 using dgRNAs containing guide domains against FKBP1A as indicated (N=3) (each unlabeled bar uses an odd-numbered guide domain of CRxxxx that falls between labeled values. For example, data for a dgRNA containing the guide domain of CR002073 are reported at the bar that falls between labeled CR002072 and CR002074).

[0420] Figure 22: % editing (N=3) and % frameshift editing (FS) as measured by NGS in HEK293 cells stably expressing Cas9 using dgRNAs containing guide domains against FKBP1A as indicated.

[0421] Figure 23 : % editing (N=3) and % frameshift editing (FS) as measured by NGS in HEK293 cells stably expressing Cas9 using dgRNAs containing guide domains against FKBP1A as indicated.

[0422] Figure 24 : % editing (N=3) and % frameshift editing (FS editing) in CD3+ T cells as measured by NGS using RNPs containing dgRNAs with the indicated guide domains against FKBP1A.

[0423] Figure 25 : % of CD3+ T cells that are B2M-, TCR- (as measured by anti-CD3 Ab) or B2M- / TCR- (double negative) as measured by FACS (day 4 after the first electroporation) after sequential or simultaneous electroporation of RNPs containing gRNAs to the target.

[0424] Figure 26 : % of CD3+ T cells that are B2M-, TCR- (as measured by anti-CD3 Ab), or B2M- / TCR- (double negative) as measured by NGS (48 hours after the first electroporation) after single electroporation, sequential electroporation, or simultaneous ("Simult") electroporation of RNPs containing gRNAs to targets (B2M and TRAC).

[0425] Figure 27 : Schematic diagram of preparation of gene-edited TCR- / B2M-BCMA CAR-transduced T cells.

[0426] Figure 28: Surface expression of TCR (using anti-CD3-PercpCy5.5) and B2M (using anti-B2M-APC) five days after (RNP) electroporation. T cells transduced with RNP containing gRNA for B2M are labeled "B2M"; T cells transduced with RNP containing gRNA for TRAC are labeled "TCR". T cells transduced with BCMA CAR are shown as "CAR". Untransduced cells are indicated as "UTD". Cells electroporated with Cas9 but without guide RNA are shown as "no guide". CD4 staining using anti-CD4-V450 is shown in the lower half of the figure to verify that the loss of CD3 staining is due to TCR loss and not due to T cell loss.

[0427] Figure 29 : Surface expression of TCR and B2M compared in total T cells from each population relative to CAR+ T cells. "CAR" indicates CAR transduction; "no guide" indicates Cas9 electroporation without gRNA; "B2M" indicates electroporation with RNPs containing B2M-specific gRNA; "TCR" indicates electroporation with RNPs containing TRAC-specific gRNA.

[0428] Figure 30 : CAR expression levels in cells electroporated with RNPs containing gRNAs specific for B2M (“B2M”) and TRAC (“TCR”) or electroporated with Cas9 but without gRNA (“no guide”).

[0429] Figure 31 :Evaluate T cell proliferation in response to tumor cell lines expressing high levels of BCMA (KMS11), low levels of BCMA (RPMI8226), or BCMA- (Nalm6). T cells were electroporated with cas9 without gRNA ("no guide") or with RNPs containing gRNAs for B2M and TRAC ("B2M+ TCR"); and / or transduced with a lentiviral vector encoding BCMA CAR ("BCMA CAR") or not transduced ("UTD"), as indicated.

[0430] Figure 32 : CAR+CD4+ and / or CD8+ T cell proliferation in response to tumor cell lines expressing high levels of BCMA (KMS11), low levels of BCMA (RPMI8226), or BCMA- (Nalm6). Cells were electroporated with cas9 without gRNA ("no guide") or with RNPs containing gRNAs for B2M and TRAC ("B2M+ TCR"); and / or transduced with a lentiviral vector encoding BCMA CAR ("BCMA CAR") or not transduced ("UTD"), as indicated.

[0431] Figure 33A and 33B: Evaluation of the effect of TRAC-targeting gRNAs on cell surface TCR expression. 33A shows loss of CD3 staining for RNPs containing guides CR000961 (961), CR000978 (978), CR000984 (984), CR000992 (992), CR000985 (985), CR000960 (gRNA1), and CR000979 (gRNA8). 33B shows loss of CD3 staining for RNPs containing guides CR000991 (991), CR000992 (992), CR000993 (993), and CR000978 (978). 991 and 992 are nearly superimposable.

[0432] Figure 33C : Shows the genome editing effect of the TRAC locus, which is produced by electroporating human primary T cells with RNPs containing the gRNA shown targeting the TRAC locus. The frequency of insertions or deletions (indel%) is indicated and the percentage of these edits that result in a frameshift of the coding sequence (frameshift editing%) is shown.

[0433] Figure 34A and Figure 34B : Detailed display of the top 5 most frequently observed sequence changes for each TRAC-targeting gRNA used to edit primary human T cells. Figure 34A and Figure 34B Results from two independent electroporation experiments. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are indicated by a "-"; insertions relative to the wt sequence are indicated by lowercase letters. Data for each experiment are the average of three replicate PCR products. Figures 34A to 34B SEQ ID NOs: 10845-10899 are disclosed in order of appearance, respectively.

[0434] Figure 35 : Evaluation of the effect of B2M-targeting gRNA on cell surface B2M expression. Guide numbers represent the CR00xxx identifiers of the guide domain.

[0435] Figure 36: Genome editing of the B2M locus, which is produced by electroporating human primary T cells with RNPs containing the gRNA shown targeting the B2M locus. The frequency of insertions or deletions (indels %) is indicated in the top panel and the percentage of these edits that result in frameshifts of the coding sequence (frameshift editing %) is shown. In the bottom panel, the top 10 most frequently observed sequence changes are shown in detail for each gRNA targeting B2M used to edit primary human T cells. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are shown by "-"; insertions relative to the wt sequence are shown by "lowercase letters". The data are the averages from three repeated PCR products. Figure 36 SEQ ID NOs: 10900-10919 are disclosed in order of appearance, respectively.

[0436] Figure 37 : % editing in primary human T cells at day 3 after electroporation (day 5 of cell culture) with RNPs containing the indicated dgRNAs against CIITA (numbering indicates the CRxxxxx identifier of the guide domain) at the indicated concentrations, as measured by flow cytometry using an anti-HLA-DR reagent.

[0437] Figure 38 :Show the genome editing effect of the CIITA locus, which is produced by electroporating human primary T cells with RNPs containing the gRNA shown targeting the CIITA locus. The frequency of insertions or deletions (indels %) is indicated and the percentage of these edits that result in frameshifting of the coding sequence (frameshift editing %) is shown. The top 5 most frequently observed sequence changes are shown in detail in the bottom panel. The unmodified bases of the wild type (wt) are shown in uppercase letters. Deletions relative to the wt sequence are shown by "-"; Insertions relative to the wt sequence are shown by "lowercase letters". The data are the averages from three repeated PCR products. Figure 38 SEQ ID NOs: 10920-10939 are disclosed in order of appearance, respectively.

[0438] Figure 39 Figure 3: Editing percentage on day 3 after electroporation of primary human T cells with RNPs containing the indicated dgRNAs against CIITA (numbering indicates the CR00xxxx identifier of the guide domain) at the indicated concentrations, as measured by flow cytometry using an anti-HLA-DR reagent. Editing percentage represents the expression of HLA-DR at the cell surface in cells electroporated with CIITA relative to expression in cells electroporated without a guide RNA.

[0439] Figure 40: Shown is the genome editing effect of CIITA locus, which is produced by electroporating human primary T cells using RNPs containing the gRNA shown targeting CIITA locus. Pointed out the frequency of insertion or deletion (insertion / deletion %) and show the percentage (frameshift editing %) of these edits that cause coding sequence frameshifting.

[0440] Figure 41 : The top 5 most frequently observed sequence changes (indels) for each CIITA-targeting gRNA used to edit primary human T cells. Data are the average of three replicate PCR products. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are shown by "-"; insertions relative to the wt sequence are shown by "lowercase letters." Figure 41 SEQ ID NOs: 10940-10974 are disclosed in order of appearance, respectively.

[0441] Figure 42 Figure 3: Editing percentage on day 3 after electroporation of primary human T cells with RNPs containing the indicated dgRNAs against CIITA (numbering indicates the CR00xxxx identifier of the guide domain) at the indicated concentrations, as measured by flow cytometry using an anti-HLA-DR reagent. Editing percentage represents the expression of HLA-DR at the cell surface in cells electroporated with CIITA relative to expression in cells electroporated without a guide RNA.

[0442] Figure 43 : Shown is the genome editing effect of CIITA locus, which is produced by electroporating human primary T cells using RNPs containing the gRNA shown targeting CIITA locus. Pointed out the frequency of insertion or deletion (insertion / deletion %) and show the percentage (frameshift editing %) of these edits that cause coding sequence frameshifting.

[0443] Figure 44 The top five most frequently observed sequence changes for each CIITA-targeting gRNA used to edit primary human T cells. Data are the average of three replicate PCR products. Wild-type (wt) unmodified bases are shown in uppercase. Deletions relative to the wt sequence are indicated by a "-"; insertions relative to the wt sequence are indicated by lowercase. Figure 44 SEQ ID NOs: 10975-11014 are disclosed in order of appearance, respectively.

[0444] Figure 45 : Schematic scheme for preparing primary human T cells edited at the B2M, TRAC and CIITA loci (triple-edited cells).

[0445] Figure 46: Editing of TRAC, B2M, and CIITA was evaluated by flow cytometry for cell surface expression of CD3ε, B2M, and HLA-DR, respectively. Cell surface expression was examined in cells that had been treated with a single targeting RNP (B2M 442 single, TRAC 961 single, or CIITA 991 single) or with three RNPs simultaneously (Triple 1, Triple 2, Triple 3, Triple 4; according to Figure 45 The cells were electroporated (see details in the table). Cells that were not electroporated are shown as "No EP". Cells electroporated with Cas9 but without guide RNA are shown as "No Guide".

[0446] Figure 47 : Genome editing effects of B2M, TRAC and CIITA loci by simultaneous electroporation of human primary T cells using 3 RNPs containing gRNA targeting B2M, TRAC and CIITA loci. The frequency of insertions or deletions (indel %) is indicated in brackets and the percentage of these edits resulting in a frameshift of the coding sequence is shown.

[0447] Figure 48 :Using different concentrations of Figure 45 Schematic diagram of each RNP, in the context of simultaneous editing of 3 loci (triple editing), for gRNA CR00442 targeting B2M, the top 10 most frequently observed sequence changes at the B2M locus in primary human T cells. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are shown by "-"; insertions relative to the wt sequence are shown by "lowercase letters". Data are the averages from three replicate PCR products. Figure 48 SEQ ID NOs: 11015-11054 are disclosed in order of appearance, respectively.

[0448] Figure 49 :Using different concentrations of Figure 45 Schematic diagram of the top 10 most frequently observed sequence changes at the TRAC locus in primary human T cells for gRNA CR000961 targeting TRAC, in the context of simultaneous editing of three loci (triple editing), for each RNP. Wild-type (wt) unmodified bases are shown in uppercase. Deletions relative to the wt sequence are shown by "-"; insertions relative to the wt sequence are shown by "lowercase." Data are averages from three replicate PCR products. Figure 49 SEQ ID NOs: 11055-11094 are disclosed in order of appearance, respectively.

[0449] Figure 50 :Using different concentrations of Figure 45Each RNP is shown in the schematic diagram, in the context of simultaneous editing of 3 loci (triple editing), for gRNA CR002991 targeting CIITA, the top 10 most frequently observed sequence changes at the CIITA locus in primary human T cells. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are shown by "-"; insertions relative to the wt sequence are shown by "lowercase letters". Data are the averages from three replicate PCR products. Figure 50 SEQ ID NOs: 11095-11134 are disclosed in order of appearance, respectively.

[0450] Figure 51 : Evaluation of editing efficiency by guide RNA format. Guide RNAs for TRAC (CR000961; upper panel) or B2M (CR00442; lower panel) were synthesized in a single or dual guide format with or without the indicated chemical modifications (PS or OMePS). RNPs were electroporated into primary human T cells at the indicated concentrations. By flow cytometry, the editing efficiency of the TRAC editing process was evaluated by analyzing cell surface staining for CD3ε (upper panel) and the editing efficiency of the B2M editing process was evaluated by analyzing cell surface staining for B2M protein (lower panel).

[0451] Figure 52 : Genome editing of the FKBP1A locus, resulting from electroporation of human primary T cells with RNPs containing the indicated gRNAs targeting FKBP1A. The frequency of insertions or deletions (indel%) is indicated and the percentage of these edits that result in a frameshift in the coding sequence is shown.

[0452] Figure 53 : Shown are the top 5 most frequently observed sequence changes for each gRNA targeting FKBP1A used to edit primary human T cells. Wild-type (wt) unmodified bases are shown in uppercase. Deletions relative to the wt sequence are shown by "-"; insertions relative to the wt sequence are shown by "lowercase." Data are the average of three replicate PCR products. Figure 53 SEQ ID NOs: 11135-11159 are disclosed in order of appearance, respectively.

[0453] Figure 54: T cells were edited with RNP containing gRNA or with negative controls: 442 (an unrelated guide targeting B2M, CR00442); Cas9 (Cas9 alone without trRNA or crRNA); trRNA (tracer RNA, but no crRNA or Cas9 protein); Cas9+trRNA (Cas9 and tracer RNA, but no crRNA); EP (electroporated cells only); no EP (cells only, no electroporation), wherein the gRNA contained a guide domain for FKBP1A (CR002086, CR002097, CR002122; shown as 2086, 2097, and 2112, respectively). After electroporation, cells were treated with 2.5 nM RAD001 (upper panel) or left untreated (lower panel) and the effect on mTOR pathway inhibition was evaluated by flow cytometry analysis of S6 phosphorylation (pS6). The Y-axis represents forward scatter (FSC) and the X-axis represents pS6 levels. Positive pS6 staining (shown in the gate trace) was determined by gating above the fluorescence level seen in the isotype antibody-stained control (not shown). Quantification of S6 phosphorylation from flow cytometry data is shown in the curves in the lower panel.

[0454] Figure 55A and Figure 55B :Edited CART cells produce cytokines in response to antigen exposure. Using the guide CR000961 targeting the TRAC locus and / or the guides CR002097 and CR002086 targeting the FKBP1A locus (as shown by cr961, 2097 and 2086, respectively), CART cells were gene edited. CART cells electroporated with RNPs without guide RNA were prepared as negative controls. CART cells expressing CART-CD19, CART-BCMA-10 or untransduced (UTD) (as shown) were mixed with the indicated cancer cells (KMS11 (BCMA positive), Nalm6 (CD19 positive) or RPMI8226 (BCMA positive)) at an effector / target ratio of 1: 1 or 1: 2.5 (as shown). Cell culture supernatants were collected and interferon gamma (Figure A) or IL-2 (Figure B) were measured.

[0455] Figure 56:The killing effect of edited CART cells on antigen-positive cancer cell lines. Using the guide CR000961 targeting the TRAC locus and / or the guide CR002097 and CR002086 targeting the FKBP1A locus (as shown by cr961, 2097 and 2086 respectively), CART cells are gene edited. CART cells electroporated with RNP without guide RNA were prepared as negative controls. CART cells expressing CART-CD19, CART-BCMA-10 or not transduced (UTD) (as shown) were mixed with the shown cancer cells (KMS11 (BCMA positive), Nalm6 (CD19 positive) or RPMI8226 (BCMA positive)) stably expressing luciferase reporters at an effector / target ratio of 1: 1. Luciferase signal was measured and cell killing was measured as the loss of luciferase activity.

[0456] Figure 57 :Edited CART cells proliferate in response to antigen exposure. Using the guide CR000961 targeting the TRAC locus and / or the guide CR002097 and CR002086 targeting the FKBP1A locus (as shown by 961, 2097 and 2086, respectively), CART cells are gene edited. CART cells electroporated with RNPs without guide RNA were prepared as negative controls. CART cells expressing CART-CD19 (labeled CD19 CAR), CART-BCMA-10 (labeled BCMA10CAR) or untransduced (UTD) CART cells (as shown) were mixed with the cancer cell lines (KMS11 (BCMA positive), Nalm6 (CD19 positive) or RPMI8226 (BCMA positive)) at an effector / target ratio of 1: 1. Proliferation was measured by counting the total number of CD4+ cells and CD8+ cells present in CAR+ relative to a fixed number of counting beads.

[0457] Figure 58: Sensitivity of CART cells of gene editing (TRAC and / or FKBP1A) relative to RAD001. CART cells expressing BCMA10 CAR (A), CD19 CAR (B) or no CAR (C; UTD) were prepared. Using the guide CR000961 targeting the TRAC locus and / or the guide CR002097 and CR002086 targeting the FKBP1A locus (as shown by 961, 2097 and 2086, respectively), CART cells or UTD cells were gene edited. CART cells electroporated with RNPs without guide RNA were prepared as negative controls. After RNP electroporation, cells were treated with 2.5nM RAD001 (upper half panel, shown as +RAD001) or not (lower half panel, shown as -RAD001) and the effect on mTOR pathway inhibition was evaluated by flow cytometry analysis of S6 phosphorylation (pS6). The Y-axis represents side scatter (SSC) and the X-axis represents the level of phosphorylated S6 protein (pS6). Positive pS6 staining was determined by gating above the fluorescence level seen in the isotype antibody-stained control (not shown), as shown in the lower right quadrant of the FACS plot. The percentage of cells containing phosphorylated S6 is shown in a histogram (upper panel) and by graph (lower panel).

[0458] Figure 59 Figure 3: Expression of the HLA-G / B2M fusion protein in SupT1 cells, as detected by HLA-G flow cytometry. The light gray histogram represents background fluorescence in the PE channel from untransduced cells. The dark gray histogram represents fluorescence in the PE channel from HLA-G / B2M-transduced cells.

[0459] Figure 60 Figure 3: Editing efficiency of different Cas9 variants at the targeted B2M locus in CD34+ hematopoietic stem cells, as assessed by NGS and flow cytometry. NLS = SV40 NLS; His6 (SEQ ID NO: 10795) or His8 (SEQ ID NO: 10796) refers to 6 or 8 histidine residues, respectively; TEV = tobacco etch virus cleavage site; Cas9 = wild-type Streptococcus pyogenes Cas9 - mutation or variant as indicated).

[0460] Figure 61 Figure 3: Editing efficiency of different Cas9 variants and a range of concentrations at the targeted B2M locus in primary human T cells, as measured by flow cytometry.

[0461] Figure 62: Editing efficiency of two different Cas9 variants at various concentrations in primary human T cells using two different gRNAs targeting B2M (left panel) or TRAC (right panel). Editing efficiency (% edited) was measured by flow cytometry by measuring loss of cell surface expression of B2M (left panel) or TCR (right panel).

[0462] Figure 63 Figure 3: Evaluation of off-target activity of the TRAC guide and B2M guide using a dsDNA oligo-insertion method in HEK-293 cells overexpressing Cas9. Detected on-target sites (triangles) and potential off-target sites (circles) are shown; the y-axis represents the frequency of detection. All gRNAs were tested in dgRNA format, with the guide domain indicated by the CRxxxxx identification code. Where indicated, each gRNA was modified such that the 5' trinucleotide and 3' trinucleotide bonds were phosphorothioate ("PS") bonds.

[0463] Figure 64 Off-target activity of guide RNAs targeting CIITA, FKBP1A, PDCD1, TRAC, and TRBC2 was evaluated using a dsDNA oligo-insertion assay in HEK-293 cells overexpressing Cas9. Detected on-target sites (triangles) and potential off-target sites (circles) are shown; the y-axis indicates detection frequency. All gRNAs were tested as dgRNAs, with the guide domain indicated by the CRxxxxx identification code.

[0464] Figure 65 : % editing in primary human CD3+ T cells as measured by loss of CD3 surface expression (as measured by flow cytometry) 72 hours after introduction of a CRISPR system targeting CD3δ (dgRNA containing the indicated guide domains). Each % CD3-negative cells is the mean (SD = standard deviation) of three independent experiments.

[0465] Figure 66 : % editing in primary human CD3+ T cells as measured by loss of CD3 surface expression (as measured by flow cytometry) 72 hours after introduction of a CRISPR system targeting CD3γ (dgRNA containing the indicated guide domains). Each CD3 negative cell % mean is the average of three independent experiments (SD = standard deviation).

[0466] definition

[0467] The term "CRISPR system", "Cas system" or "CRISPR / Cas system" refers to a group of molecules comprising RNA-guided nucleases or other effector molecules and gRNA molecules, which are necessary and sufficient to guide and achieve the modification of nucleic acids at target sequences by RNA-guided nucleases or other effector molecules. In one embodiment, the CRISPR system comprises gRNA and Cas protein, for example, Cas9 protein. Such systems comprising Cas9 or modified Cas9 molecules are referred to herein as "Cas9 systems" or "CRISPR / Cas9 systems". In one example, the gRNA molecules and Cas molecules can be compounded to form a ribonucleoprotein (RNP) complex.

[0468] The terms "guide RNA," "guide RNA molecule," "gRNA molecule," or "gRNA" are used interchangeably and refer to a set of nucleic acid molecules that facilitate the specific guidance of an RNA-guided nuclease or other effector molecule (generally in complex with a gRNA molecule) to a target sequence. In some embodiments, the guidance is achieved by hybridizing a portion of the gRNA to the DNA (e.g., via a gRNA guide domain) and by binding a portion of the gRNA molecule to the RNA-guided nuclease or other effector molecule (e.g., at least via a gRNA tracr). In an embodiment, the gRNA molecule consists of a single continuous polynucleotide molecule, referred to herein as a "single guide RNA" or "sgRNA," etc. In other embodiments, the gRNA molecule consists of multiple (typically two) polynucleotide molecules that are themselves capable of associating (generally by hybridization), referred to herein as a "dual guide RNA" or "dgRNA," etc. The gRNA molecule is described in more detail below, but it generally comprises a guide domain and a tracr. In an embodiment, the guide domain and tracr are provided on a single polynucleotide. In other embodiments, the guide domain and tracr are provided on separate polynucleotides.

[0469] As the term "guide domain" is used in connection with a gRNA, the term is the portion of the gRNA molecule that recognizes, e.g., is complementary to, a target sequence (e.g., within a nucleic acid of a cell, e.g., within a gene).

[0470] As the term "crRNA" is used in connection with a gRNA, the term refers to the portion of the gRNA molecule that comprises the guide domain and the region that interacts with tracr to form the flagpole region.

[0471] The term "target sequence" refers to a sequence of nucleic acid that is complementary to the gRNA guide domain, for example, completely complementary thereto. In embodiments, the target sequence is provided on genomic DNA. In one embodiment, the target sequence is adjacent to (on the same strand of DNA or its complementary strand) a protospacer adjacent motif (PAM) sequence recognized by a protein with nuclease or other effector activity, for example, a PAM sequence recognized by Cas9. In embodiments, the target sequence is a target sequence of an allogeneic T cell target. In embodiments, the target sequence is a target sequence of an inhibitory molecule. In embodiments, the target sequence is a target sequence of a downstream effector of an inhibitory molecule.

[0472] As used herein in connection with gRNA molecules, the term "flagpole" refers to the portion of the gRNA where the crRNA and tracr bind or hybridize to each other.

[0473] As used herein in connection with a gRNA molecule, the term "tracr" refers to the portion of the gRNA that binds to a nuclease or other effector molecule. In an embodiment, a tracr comprises a nucleic acid sequence that specifically binds to Cas9. In an embodiment, a tracr comprises a nucleic acid sequence that forms part of a flagpole.

[0474] The term "Cas9" or "Cas9 molecule" refers to the enzyme from the bacterial type II CRISPR / Cas system that is responsible for cleaving DNA. Cas9 also includes the wild-type protein as well as its functional and non-functional mutants.

[0475] When used in connection with nucleic acids, the term "complementary" refers to the pairing of bases A with T or U and G with C. The term complementarity refers to fully complementary nucleic acid molecules that form A with T or U and G with C pairing throughout the reference sequence, as well as molecules that are at least 80%, 85%, 90%, 95%, or 99% complementary.

[0476] As used in conjunction with homology-guided repair or homologous recombination, "template nucleic acid" refers to the nucleic acid to be inserted into the cleavage site for gene repair (insertion) by means of a CRISPR system donor sequence at the modification site. In one aspect, the template nucleic acid comprises a nucleic acid sequence encoding a chimeric antigen receptor (CAR) (e.g., as described herein). In one aspect, the template nucleic acid comprises a vector comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR) (e.g., as described herein).

[0477] As used herein, the term "indel" refers to a nucleic acid comprising one or more nucleotide insertions, one or more nucleotide deletions, or a combination of nucleotide insertions and deletions relative to a reference nucleic acid, which is produced after exposure to a composition comprising a gRNA molecule (e.g., a CRISPR system). Indels can be determined by nucleic acid sequencing, such as by NGS, after exposure to a composition comprising a gRNA molecule. With respect to indel sites, an indel is said to be "at or near a reference site" if it comprises at least one insertion or deletion within about 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides of a reference site (e.g., a site complementary to the guide domain of a gRNA molecule) or overlaps with part or all of the reference site (e.g., comprising at least one site complementary to the guide domain of a gRNA molecule (e.g., a gRNA molecule described herein) that is 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide overlap or an insertion or deletion within its range).

[0478] As used herein, the term "insertion / deletion pattern" refers to a group of insertions / deletions produced after exposure to a composition comprising a gRNA molecule. In one embodiment, by frequency of occurrence, the insertion / deletion pattern consists of the first three insertions / deletions. In one embodiment, by frequency of occurrence, the insertion / deletion pattern consists of the first five insertions / deletions. In one embodiment, the insertion / deletion pattern consists of the insertions / deletions present at a frequency of greater than about 5% relative to all sequencing reads. In one embodiment, the insertion / deletion pattern consists of the insertions / deletions present at a frequency of greater than about 10% relative to the total number of insertion / deletion sequencing reads (i.e., those reads not consisting of unmodified reference nucleic acid sequences). In one embodiment, the insertion / deletion pattern includes any 3 of the first five most frequently observed insertions / deletions. The insertion / deletion pattern can be determined, for example, by sequencing cells of a cell population exposed to a gRNA molecule.

[0479] As used herein, the term "off-target insertion / deletion" refers to an insertion / deletion at or near a site outside the target sequence of the guide domain of a gRNA molecule. Such sites may contain, for example, 1, 2, 3, 4, 5 or more mismatched nucleotides relative to the sequence of the guide domain of the gRNA. In an exemplary embodiment, such sites are detected using computer-predicted directional sequencing of off-target sites or by insertion methods known in the art.

[0480] The term "inhibitory molecule" refers to a molecule that causes or promotes inhibition of cell survival, activation, proliferation and / or function and a gene encoding the molecule and its associated regulatory elements, for example, a promoter, when activated. In embodiments, an inhibitory molecule is a molecule expressed on immune effector cells (for example, on T cells). The non-limiting example of an inhibitory molecule is PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, CEACAM (for example, CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine and TGFβ. It should be understood that when used in connection with a target sequence or gRNA molecule, the term inhibitory molecule refers to a gene (and its associated regulatory elements) encoding an inhibitory molecule protein. In one embodiment, the gene encoding the inhibitory molecule is CD274. In one embodiment, the gene encoding the inhibitory molecule is HAVCR2. In one embodiment, the gene encoding the inhibitory molecule is LAG3. In one embodiment, the gene encoding the inhibitory molecule is PDCD1.

[0481] The term "downstream effector that signals via an inhibitory molecule" refers to a molecule that mediates the inhibitory effect of an inhibitory molecule; and a gene encoding the molecule and its associated regulatory elements, e.g., a promoter. It should be understood that when used in conjunction with a target sequence or gRNA molecule, the term "downstream effector that signals via an inhibitory molecule" refers to a gene (and its associated regulatory elements) that encodes a downstream effector protein that signals via an inhibitory molecule. In one embodiment, the gene encoding a downstream effector that signals via an inhibitory molecule is PTPN11.

[0482] The terms "allogeneic T cell target" and "allogeneic T-cell target" are used interchangeably herein and refer to proteins that mediate or promote a host versus graft reaction, mediate or promote a graft versus host reaction, or are targets of immunosuppressive agents; and genes encoding such molecules and their associated regulatory elements, e.g., promoters. It should be understood that when used in connection with a target sequence or gRNA molecule, the term "allogeneic T cell target" refers to a gene (and its associated regulatory elements) encoding an allogeneic T cell target protein. Without being bound by theory, for example, by the methods and compositions disclosed herein, inhibition or elimination of one or more allogeneic T cell targets can improve the efficacy, survival, function, and / or viability of allogeneic cells (e.g., allogeneic T cells), for example, by reducing or eliminating adverse immunogenicity (e.g., host versus graft reaction or graft versus host reaction).

[0483] In a non-limiting example, the protein that mediates or promotes graft-versus-host reaction or host-versus-graft reaction is one or more components of a T cell receptor. In one embodiment, the component of the T cell receptor is a T cell receptor alpha, for example, a constant domain of TCR alpha. In one embodiment, the component of the T cell receptor is a T cell receptor beta chain, for example, a constant domain 1 or constant domain 2 of TCR beta. In one embodiment, the component of the T cell receptor is a T cell receptor delta chain. In one embodiment, the component of the T cell receptor is a T cell receptor epsilon chain. In one embodiment, the component of the T cell receptor is a T cell receptor zeta chain. In one embodiment, the component of the T cell receptor is a T cell receptor gamma chain. Therefore, in embodiments in which the protein encoded by the allogeneic T cell target is a TCR component, the gene encoding the allogeneic T cell target can be, for example, TRAC, TRBC1, TRBC2, CD3D, CD3E, CD3G or CD247 and combinations thereof.

[0484] In a non-limiting example, the protein that mediates or promotes a graft-versus-host reaction or a host-versus-graft reaction is an HLA protein or B2M. Examples of HLA proteins include HLA-A, HLA-B, and HLA-C. Thus, in embodiments in which the allogeneic T cell target protein is an HLA or B2M protein, the gene encoding the allogeneic T cell target can be, for example, HLA-A, HLA-B, HLA-C, or B2M, and combinations thereof. In other embodiments, the allogeneic T cell target protein is NLRC5, and the gene encoding the allogeneic T cell target can be, for example, NLRC5.

[0485] In a non-limiting example, the protein that mediates or promotes a graft-versus-host reaction or a host-versus-graft reaction is a major histocompatibility complex class II (MHC II) molecule (e.g., HLA-Dx (wherein x refers to the letter of the MHC II protein, e.g., HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and / or HLA-DP)), or a regulator of MHC II expression, and combinations thereof. One non-limiting example is CIITA (also referred to herein as C2TA). Thus, in embodiments in which the allogeneic T cell target protein is CIITA, the gene encoding the allogeneic T cell target can, for example, be CIITA. In another non-limiting example, the protein that mediates or promotes a graft-versus-host reaction or a host-versus-graft reaction is RFXANK. In another non-limiting example, the protein that mediates or promotes a graft-versus-host reaction or a host-versus-graft reaction is RFXAP. In another non-limiting example, the protein that mediates or promotes a graft-versus-host reaction or a host-versus-graft reaction is RFX5.

[0486] As used herein, the term "target of an immunosuppressant" refers to the molecular target of an immunosuppressant, such as a receptor or other protein (the terms "immunosuppressant" and "immunosuppressive drug" are used interchangeably herein in connection with a drug or the target of a drug). An immunosuppressant is a substance that suppresses immune function through one of several mechanisms of action. In other words, an immunosuppressant is an effect of a compound that exhibits the effect by weakening the degree of immune response and / or the ability to exhibit the effect. An example of an activity type exhibited by an immunosuppressant is the activity of eliminating T cells (e.g., activated T cells). Another example of an activity type exhibited by an immunosuppressant is the activity of reducing T cell activity or its activation level. As a non-limiting example, an immunosuppressant can be a calcineurin inhibitor, a target of rapamycin, an interleukin-2a-chain blocker, an inosine monophosphate dehydrogenase inhibitor, a dihydrogen acid reductase inhibitor, a corticosteroid, a cyclosporin, or an immunosuppressive antimetabolite. Classical cytotoxic immunosuppressants work by inhibiting DNA synthesis. Others can work by activating T cells or by inhibiting the activation of helper cells. As a limiting example, the target of the immunosuppressant can be a receptor of the immunosuppressant such as: deoxycytidine kinase, CD52, glucocorticoid receptor (GR), FKBP family gene members (e.g., FKBP12) and cyclophilin family gene members. In one embodiment, the target of the immunosuppressant is deoxycytidine kinase (DCK) and the immunosuppressant is a drug based on nucleoside analogs such as cytarabine (pyrimidine arabinoside) or gemcitabine. In one embodiment, the target of the immunosuppressant is GR, and the immunosuppressant is a corticosteroid such as dexamethasone. In one embodiment, the target of the immunosuppressant is CD52, and the immunosuppressant is an anti-CD52 antibody or an antigen-binding fragment thereof such as alemtuzumab In one embodiment, the target of the immunosuppressive agent is FKBP12, and the immunosuppressive agent is FK506 (or an analog or FKBP12 binding fragment thereof), cyclosporine, rapamycin or a rapamycin analog, or an mTor inhibitor such as RAD001. Thus, in embodiments where the allogeneic T cell target is the target of the immunosuppressive protein, the gene encoding the allogeneic T cell target can be, for example, NR3C1, FKBP1A, CD52, or DCK, and combinations thereof.

[0487] The term "rapamycin-resistant mTor" refers to an mTor protein (and a gene encoding the mTor protein) whose binding to FKBP12 is reduced or eliminated (including in the presence of rapamycin, FK506, rapamycin analogs, cyclosporin and / or other mTor inhibitors such as RAD001). In an exemplary embodiment, the rapamycin-resistant mTor comprises one or more mutations to the FRB domain. In an exemplary embodiment, the rapamycin-resistant mTor comprises a mutation to S2035, for example, consisting of it, for example, comprising an S2035I mutation, for example, consisting of it.

[0488] The terms "a" and "an" refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.

[0489] When referring to a measurable value such as an amount, a time duration, and the like, the term "about" is intended to encompass variations of ±20%, or in some cases ±10%, or in some cases ±5%, or in some cases ±1%, or in some cases ±0.1% from the specified value, as such variations are appropriate to carry out the disclosed methods.

[0490] The term "chimeric antigen receptor" or alternatively "CAR" refers to a group of polypeptides, generally two polypeptides in the simplest embodiment, when in immune effector cells, the polypeptide provides cells with specificity for target cells (generally cancer cells) and provides intracellular signal generation. In some embodiments, CAR comprises at least an extracellular antigen binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as "intracellular signaling domain"), the cytoplasmic signaling domain comprising a functional signaling domain derived from a stimulating molecule and / or a co-stimulatory molecule as defined below. In some aspects, the group of polypeptides is adjacent to each other. In some embodiments, the group of polypeptides includes a dimerization switch, wherein when a dimerization molecule is present, the dimerization switch can couple the polypeptides to each other, for example, the antigen binding domain can be coupled to the intracellular signaling domain. In one aspect, the stimulating molecule is a ζ chain associated with a T cell receptor complex. In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below. In one aspect, the costimulatory molecules are selected from the costimulatory molecules described herein, for example, 4 1BB (ie, CD137), CD27 and / or CD28. In one aspect, CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain, wherein the intracellular signaling domain comprises a functional signaling domain derived from a stimulatory molecule. In one aspect, CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain, wherein the intracellular signaling domain comprises a functional signaling domain derived from a costimulatory molecule and a functional signaling domain derived from a stimulatory molecule. In one aspect, CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain, wherein the intracellular signaling domain comprises two functional signaling domains derived from one or more costimulatory molecules and a functional signaling domain derived from a stimulatory molecule. In one aspect, CAR includes a chimeric fusion protein, the chimeric fusion protein includes an extracellular antigen binding domain, a transmembrane domain and an intracellular signal transduction domain, and the intracellular signal transduction domain includes at least two functional signal transduction domains derived from one or more costimulatory molecules and a functional signal transduction domain derived from stimulatory molecules. In one aspect, CAR includes an optional leader sequence at the amino terminus (N-ter) of the CAR fusion protein. In one aspect, CAR also includes a leader sequence at the N-terminus of the extracellular antigen binding domain, wherein the leader sequence is optionally cut from the antigen binding domain (e.g., scFv) during cell processing and CAR localization to the cell membrane.

[0491] A CAR comprising an antigen binding domain (e.g., scFv or TCR) targeting a specific tumor marker X (such as those described herein) is also referred to as an XCAR. For example, a CAR comprising an antigen binding domain targeting CD19 is also referred to as a CD19CAR. As another example, a CAR comprising an antigen binding domain targeting BCMA is also referred to as a BCMA CAR.

[0492] The term "signaling domain" refers to a functional portion of a protein that acts by transmitting information inside the cell to regulate cellular activity via defined signaling pathways, either by generating second messengers or by functioning as effectors in response to such messengers.

[0493] As used herein, the term "antibody" refers to a protein that specifically binds to an antigen or a polypeptide sequence derived from an immunoglobulin molecule that specifically binds to an antigen. Antibodies can be polyclonal or monoclonal, multi-chain or single-chain or intact immunoglobulins and can be derived from natural or recombinant sources. Antibodies can be tetramers of immunoglobulin molecules.

[0494] The term "antibody fragment" refers to at least one portion of an antibody that retains the ability to specifically interact with an epitope of an antigen (e.g., by binding, steric hindrance, stabilization / destabilization, spatial distribution). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), Fd fragments consisting of a VH domain and a CH1 domain, linear antibodies, single-domain antibodies such as sdAb (or VL or VH), camelid VHH domains, multispecific antibodies formed from antibody fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bond at the hinge region, and isolated CDRs or other epitope-binding fragments of antibodies. Antigen binding fragments can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NARs and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology, 23: 1126-1136, 2005). Antigen binding fragments can also be grafted onto polypeptide-based scaffolds such as fibronectin type III (Fn3) (see U.S. Patent No. 6,703,199, which describes fibronectin polypeptide minibodies).

[0495] The term "scFv" refers to a fusion protein comprising at least one antibody fragment comprising a light chain variable region and at least one antibody fragment comprising a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are continuously linked, for example, by means of a synthetic linker, for example, a flexible short polypeptide linker, and are capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless otherwise specified, as used herein, an scFv can have the VL variable region and the VH variable region in any order (e.g., relative to the N-terminus and C-terminus of the polypeptide), and the scFv can comprise VL-linker-VH or can comprise VH-linker-VL.

[0496] The portion of the CAR of the present invention comprising an antibody or its antibody fragment can exist in various forms, wherein the antigen binding domain is expressed as part of a continuous polypeptide chain, for example, including a single domain antibody fragment (sdAb), a single chain antibody (scFv), a humanized antibody, or a bispecific antibody (Harlow et al., 1999, cited in: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, cited in: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85: 5879-5883; Bird et al., 1988, Science 242: 423-426). In one aspect, the antigen binding domain of the CAR composition of the present invention comprises an antibody fragment. In another aspect, CAR comprises an antibody fragment constituting scFv. The precise amino acid sequence boundaries of a given CDR can be determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), "Sequences of Proteins of Immunological Interest", 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD ("Kabat" numbering scheme); Al-Lazikani et al., (1997) JMB 273, 927-948 ("Chothia" numbering scheme), or a combination thereof.

[0497] As used herein, the term "binding domain" or "antibody molecule" refers to a protein comprising at least one immunoglobulin variable domain sequence, for example, an immunoglobulin chain or a fragment thereof. The term "binding domain" or "antibody molecule" encompasses antibodies and antibody fragments. In one embodiment, the antibody molecule is a multispecific antibody molecule, for example, it comprises a plurality of immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of a plurality of immunoglobulin variable domain sequences has a binding specificity for a first epitope and a second immunoglobulin variable domain sequence of a plurality of immunoglobulin variable domain sequences has a binding specificity for a second epitope. In one embodiment, the multispecific antibody molecule is a bispecific antibody molecule. Bispecific antibodies are specific for no more than two antigens. A bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence having a binding specificity for a first epitope and a second immunoglobulin variable domain sequence having a binding specificity for a second epitope.

[0498] The portion of the CAR of the present invention comprising an antibody or its antibody fragment can exist in various forms, wherein the antigen binding domain is expressed as part of a continuous polypeptide chain, for example, including a single domain antibody fragment (sdAb), a single chain antibody (scFv), a humanized antibody, or a bispecific antibody (Harlow et al., 1999, cited in: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, cited in: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85: 5879-5883; Bird et al., 1988, Science 242: 423-426). In one aspect, the antigen binding domain of the CAR composition of the present invention comprises an antibody fragment. In another aspect, CAR comprises an antibody fragment constituting scFv.

[0499] The term "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in an antibody molecule in its naturally occurring conformation, which normally determines the class to which the antibody belongs.

[0500] The term "antibody light chain" refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (κ) light chains and lambda (λ) light chains refer to the two major antibody light chain isotypes.

[0501] The term "recombinant antibody" refers to an antibody produced using recombinant DNA technology, for example, an antibody expressed by a phage or yeast expression system. This term should also be interpreted as meaning an antibody that has been produced by synthesizing a DNA molecule encoding the antibody and expressing the antibody protein or a DNA molecule specifying the amino acid sequence of the antibody, wherein the DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequence technology available and well known in the art.

[0502] The term "antigen" or "Ag" refers to a molecule that stimulates an immune response. This immune response can involve the production of antibodies, the activation of specific immunocompetent cells, or both. It will be understood by those skilled in the art that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. In addition, antigens can be derived from recombinant DNA or genomic DNA. It will be understood by those skilled in the art that any DNA comprising a nucleotide sequence or partial nucleotide sequence encoding a protein thus encodes an "antigen" as the term is used herein, wherein the protein stimulates an immune response. In addition, it will be understood by those skilled in the art that an antigen need not be completely encoded by the full-length nucleotide sequence of a gene. It will be readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in a variety of combinations to encode polypeptides that stimulate the desired immune response. In addition, it will be understood by those skilled in the art that an antigen need not be completely encoded by a "gene". It will be apparent that an antigen can be generated, synthesized, or derived from a biological sample, or can be a macromolecule in addition to a polypeptide. Such a biological sample can include, but is not limited to, a tissue sample, a tumor sample, a cell, or a fluid having other biological components.

[0503] The term "anti-cancer effect" refers to a biological effect that can be demonstrated by various means, including but not limited to, for example, a reduction in tumor volume, a reduction in the number of cancer cells, a reduction in the number of metastases, an increase in life expectancy, a reduction in cancer cell proliferation, a reduction in cancer cell survival, or an improvement in various physiological symptoms associated with the cancer condition. An "anti-cancer effect" can also be demonstrated by the ability of peptides, polynucleotides, cells, and antibodies to prevent cancer from arising in the first place. The term "anti-tumor effect" refers to a biological effect that can be demonstrated by various means, including but not limited to, for example, a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in tumor cell proliferation, or a reduction in tumor cell survival.

[0504] The term "autologous" refers to any substance that is derived from the same individual into which it will later be reintroduced.

[0505] The term "allogeneic" refers to any substance derived from an animal of the same species as the individual into which the substance is introduced. Two or more individuals are allogeneic to one another when the genes at one or more loci are not identical. In some aspects, allogeneic substances from individuals of the same species may not be sufficiently genetically similar to interact antigenically.

[0506] The term "xenogeneic" refers to a transplant derived from an animal of a different species.

[0507] The term "cancer" refers to a disease characterized by the uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body through the bloodstream and lymphatic system. Examples of various cancers are described herein and include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, etc. The terms "tumor" and "cancer" are used interchangeably herein, for example, and both terms encompass solid tumors and liquid tumors, for example, diffuse or circulating tumors. As used herein, the terms "cancer" or "tumor" include pre-malignant and malignant cancers and tumors.

[0508] "Derived from," as the term is used herein, refers to a relationship between a first molecule and a second molecule. It generally refers to the structural similarity between the first molecule and the second molecule and does not imply or include any limitation on the process or source of the first molecule derived from the second molecule. For example, where the intracellular signaling domain is derived from a CD3 zeta molecule, the intracellular signaling domain retains sufficient CD3 zeta structure to have the desired function, i.e., the ability to generate a signal under appropriate conditions. It does not imply or include any limitation on a particular process for generating the intracellular signaling domain. For example, it does not mean that, in order to provide the intracellular signaling domain, one must start with the CD3 zeta sequence and delete unwanted sequences, or mutate them, to obtain the intracellular signaling domain.

[0509] The phrase "disease associated with expression of a tumor antigen as described herein" includes, but is not limited to, diseases associated with expression of a tumor antigen as described herein or conditions associated with cells expressing a tumor antigen as described herein, for example, including proliferative diseases such as cancer or malignancies or precancerous conditions such as myelodysplasia, myelodysplastic syndrome, or preleukemia; or non-cancer related indications associated with cells expressing a tumor antigen as described herein. In one aspect, the cancer associated with expression of a tumor antigen as described herein is a hematological cancer. In one aspect, the cancer associated with expression of a tumor antigen as described herein is a solid cancer. Other diseases associated with expression of a tumor antigen as described herein include, for example, but are not limited to, atypical and / or non-classical cancers, malignancies, precancerous conditions, or proliferative diseases associated with expression of a tumor antigen as described herein. Non-cancer related indications associated with expression of a tumor antigen as described herein include, for example, but are not limited to, autoimmune diseases, (e.g., lupus), inflammatory diseases (allergies and asthma), and transplantation. In some embodiments, the cell expressing the tumor antigen expresses or has at any time expressed an mRNA encoding the tumor antigen. In one embodiment, the cells expressing the tumor antigen produce the tumor antigen protein (e.g., wild type or mutant), and the tumor antigen protein can be present at normal levels or at reduced levels. In one embodiment, the cells expressing the tumor antigen produce a detectable level of the tumor antigen protein at one time point and subsequently produce substantially no detectable tumor antigen protein.

[0510] The term "conservative sequence modification" refers to amino acid modifications that do not significantly affect or change the binding characteristics of the antibody or antibody fragment containing the amino acid sequence. Such conservative modifications include amino acid replacements, additions, and deletions. Modifications can be introduced into the antibody or antibody fragment of the present invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid replacements are amino acid replacements in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the CAR of the present invention can be replaced with other amino acid residues from the same side chain family, and the changed CAR can be tested using the functional assays described herein.

[0511] The term "stimulation" refers to the primary response induced by the binding of a stimulatory molecule (e.g., a TCR / CD3 complex or CAR) to its cognate ligand (or a tumor antigen in the case of a CAR), which thereby mediates a signal transduction event, such as, but not limited to, signal transduction via a TCR / CD3 complex or signal transduction via the signaling domain of an appropriate NK receptor or CAR. Stimulation can mediate changes in the expression of certain molecules.

[0512] The term "stimulatory molecule" refers to a molecule expressed by an immune cell (e.g., T cell, NK cell, B cell) that provides a cytoplasmic signaling sequence that regulates the activation of immune cells in a stimulating manner relative to at least some aspects of the immune cell signaling pathway. In one aspect, the signal is a primary signal that, for example, triggers and causes mediation of T cell responses by binding to a peptide-loaded MHC molecule via a TCR / CD3 complex, including but not limited to proliferation, activation, differentiation, and the like. The primary cytoplasmic signaling sequence (also referred to as a "primary signaling domain") that acts in a stimulating manner can contain a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAMs containing cytoplasmic signaling sequences that are particularly useful in the present invention include but are not limited to those derived from CD3ζ, common FcRγ (FCER1G), FcγRIIa, FcRβ (FcεR1b), CD3γ, CD3δ, CD3ε, CD79a, CD79b, DAP10, and DAP12. In the specific CARs of the present invention, the intracellular signaling domain in any one or more CARS of the present invention comprises an intracellular signaling sequence, e.g., a primary signaling sequence of CD3-ζ. In the specific CARs of the present invention, the primary signaling sequence of CD3-ζ is a sequence provided as SEQ ID NO: 18 or an equivalent residue from a non-human species (e.g., mouse, rodent, monkey, ape, etc.). In the specific CARs of the present invention, the primary signaling sequence of CD3-ζ is a sequence provided in SEQ ID NO: 20 or an equivalent residue from a non-human species (e.g., mouse, rodent, monkey, ape, etc.).

[0513] The term "antigen presenting cell" or "APC" refers to an immune system cell such as an accessory cell (e.g., B cell, dendritic cell, etc.) that presents foreign antigens complexed with the major histocompatibility complex (MHC) on its surface. T cells can recognize these complexes using their T cell receptors (TCRs). APCs process antigens and present them to T cells.

[0514] As used herein, the term "intracellular signaling domain" refers to the intracellular portion of a molecule. The intracellular signaling domain generates a signal that promotes the immune effector function of cells containing CAR (e.g., CART cells). Examples of immune effector functions (e.g., in CART cells) include cytolytic activity and auxiliary activity, including secretion of cytokines.

[0515] In one embodiment, the intracellular signaling domain may comprise a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from molecules responsible for primary stimulation or antigen-dependent stimulation. In one embodiment, the intracellular signaling domain may comprise a costimulatory intracellular domain. Exemplary costimulatory intracellular signaling domains include those derived from molecules responsible for costimulatory signals or antigen-independent stimulation. For example, in the case of CART, the primary intracellular signaling domain may comprise a cytoplasmic sequence of a T cell receptor, and the costimulatory intracellular signaling domain may comprise a cytoplasmic sequence from an auxiliary receptor or a costimulatory molecule.

[0516] The primary intracellular signaling domain can comprise a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of primary cytoplasmic signaling sequences containing ITAMs include, but are not limited to, those derived from CD3ζ, common FcRγ (FCER1G), FcγRIIa, FcRβ (FcεR1b), CD3γ, CD3δ, CD3ε, CD79a, CD79b, DAP10, and DAP12.

[0517] The term "ζ" or alternatively "ζ chain", "CD3-ζ" or "TCR-ζ" is defined as the protein provided as GenBank Accession No. BAG36664.1 or the equivalent residues from non-human species (e.g., mouse, rodent, monkey, ape, etc.), and a "ζ stimulatory domain" or alternatively "CD3-ζ stimulatory domain" or "TCR-ζ stimulatory domain" is defined as the amino acid residues from the ζ chain cytoplasmic domain or a functional derivative thereof that are sufficient to functionally propagate the initial signal necessary for T cell activation. In one aspect, the cytoplasmic domain of ζ comprises residues 52 to residue 164 of GenBank Accession No. BAG36664.1 or the equivalent residues from non-human species (e.g., mouse, rodent, monkey, ape, etc.) that are functional orthologs thereof. In one aspect, a "ζ stimulatory domain" or "CD3-ζ stimulatory domain" is the sequence provided as SEQ ID NO: 18. In one aspect, the "zeta stimulatory domain" or "CD3-zeta stimulatory domain" is the sequence provided as SEQ ID NO:20.

[0518] The term "costimulatory molecule" refers to a T cell that specifically binds to a costimulatory ligand, thereby mediating the cognate binding partner of a costimulatory response (such as but not limited to proliferation) by T cells. Costimulatory molecules are cell surface molecules that contribute to an efficient immune response in addition to antigen receptors or their ligands. Costimulatory molecules include but are not limited to MHC class I molecules, BTLA and Toll ligand receptors, as well as OX40, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278) and 4-1BB (CD137). Other examples of such costimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA- 1. ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, CD19a and ligands that specifically bind to CD83.

[0519] Costimulatory intracellular signal transduction domain can be the intracellular part of costimulatory molecules.Costimulatory molecules can be presented in the following protein family:TNF receptor protein, immunoglobulin-like protein, cytokine receptor, integrin, signal transduction lymphocyte activation molecule (SLAM protein) and activating NK cell receptor.The example of this type of molecule includes CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, B7-H3 and the ligand specifically bound to CD83 etc.

[0520] The intracellular signaling domain may comprise the entire intracellular portion of the molecule from which it is derived or the entire native intracellular signaling domain or a functional fragment or derivative thereof.

[0521] The term "4-1BB" refers to a member of the TNFR superfamily having an amino acid sequence as provided in GenBank Accession No. AAA62478.2 or equivalent residues from non-human species (e.g., mice, rodents, monkeys, apes, etc.); and a "4-1BB costimulatory domain" is defined as amino acid residues 214-255 of GenBank Accession No. AAA62478.2 or equivalent residues from non-human species (e.g., mice, rodents, monkeys, apes, etc.). In one aspect, a "4-1BB costimulatory domain" is a sequence as provided in SEQ ID NO: 14 or equivalent residues from non-human species (e.g., mice, rodents, monkeys, apes, etc.).

[0522] As used herein, the term "immune effector cell" refers to a cell involved in an immune response, e.g., a cell involved in promoting an immune effector reaction. Examples of immune effector cells include T cells, e.g., α / β T cells and γ / δ T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.

[0523] As the term is used herein, "immune effector function or immune effector response" refers to, for example, a function or response of an immune effector cell that enhances or promotes immune attack on a target cell. For example, an immune effector function or response refers to a T cell or NK cell property that promotes killing of target cells or inhibits target cell growth or proliferation. In the case of T cells, primary stimulation and co-stimulation are examples of immune effector functions or responses.

[0524] The term "encoding" refers to the intrinsic properties and biological properties of a specific nucleotide sequence in a polynucleotide such as a gene, cDNA or mRNA that serves as a template for synthesizing other polymers and macromolecules with a defined nucleotide sequence (e.g., rRNA, tRNA and mRNA) or a defined amino acid sequence in a biological process. Therefore, if transcription and translation of the mRNA corresponding to the gene produce a certain protein in a cell or other biological system, the gene, cDNA or RNA encodes the protein. The coding strand whose nucleotide sequence is identical to the mRNA sequence and is usually provided in the sequence table and the non-coding strand used as a template for transcription of a gene or cDNA can both be referred to as encoding a protein or other product of the gene or cDNA.

[0525] Unless otherwise indicated, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. The phrase "nucleotide sequence encoding a protein or RNA" may also include introns to the extent that a nucleotide sequence encoding a protein may contain introns in some form.

[0526] The terms "effective amount" or "therapeutically effective amount" are used interchangeably herein and refer to an amount of a compound, formulation, material, or composition, as described herein, effective to achieve a particular biological result.

[0527] The term "endogenous" refers to any substance that originates from or is produced within an organism, cell, tissue, or system.

[0528] The term "exogenous" refers to any substance introduced from outside of or generated outside of an organism, cell, tissue, or system.

[0529] The term "expression" refers to the transcription and / or translation of a specific nucleotide sequence driven by a promoter.

[0530] The term "transfer vector" refers to a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides bound to ions or amphoteric compounds, plasmids, and viruses. Therefore, the term "transfer vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to further include non-plasmid and non-viral compounds that promote the transfer of nucleic acids into cells, for example, polylysine compounds, liposomes, etc. Examples of viral transfer vectors include but are not limited to adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc.

[0531] The term "expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector comprises sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate a recombinant polynucleotide.

[0532] The terms "homologous" or "identity" refer to the identity of the subunit sequences between two polymer molecules (e.g., between two nucleic acid molecules (e.g., two DNA molecules or two RNA molecules) or between two polypeptide molecules). When a subunit position in the two molecules is occupied by the same monomeric subunit, for example, if a position in each of the two DNA molecules is occupied by an adenine, then they are homologous or identical at that position. The identity between two sequences varies directly with the number of matching or homologous positions, for example, if half of the positions in the two sequences are homologous (e.g., five positions in a polymer of ten subunits in length), then the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10 positions) are matched or homologous, then the two sequences are 90% homologous.

[0533] "Humanized" forms of non-human (e.g., mouse) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) containing minimal sequences derived from non-human immunoglobulins. For the most part, humanized antibodies and antibody fragments thereof are these human immunoglobulins (acceptor antibodies or antibody fragments) in which residues from the complementary determining regions (CDRs) of the acceptor are replaced with residues from CDRs of non-human species (donor antibodies) such as mouse, rat, or rabbit with the desired specificity, affinity, and capacity. In some cases, the Fv framework region (FR) residues of the human immunoglobulin are replaced with corresponding non-human residues. In addition, humanized antibodies / antibody fragments may include residues that are neither in the acceptor antibody nor in the imported CDR or framework sequences. These modifications can further modify and optimize the performance of the antibody or antibody fragment. Typically, a humanized antibody or antibody fragment thereof will substantially comprise all of at least one, and generally two, variable domains, wherein all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or a significant portion of the FR regions are those of a human immunoglobulin sequence. The humanized antibody or antibody fragment may also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.

[0534] "Fully human" refers to an immunoglobulin, such as an antibody or antibody fragment, in which the entire molecule is of human origin or consists of the same amino acid sequence as the human form of the antibody or immunoglobulin.

[0535] The term "isolated" means altered or removed from its native state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its native state is "isolated." An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-native environment (e.g., a host cell).

[0536] The term "operably linked" or "transcriptionally controlled" refers to a functional connection between a regulatory sequence and a heterologous nucleic acid sequence that results in expression of the heterologous nucleic acid sequence. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences can be contiguous to each other and, for example, in the case of linking two protein coding regions, be in the same reading frame.

[0537] The term "parenteral" administration of the immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im) or intrasternal injection, intratumoral or infusion techniques.

[0538] The term "nucleic acid" or "polynucleotide" refers to a polymer of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and single-stranded or double-stranded forms thereof. Unless otherwise specified, the term includes nucleic acids containing known analogs of natural nucleotides that have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specified, a specific nucleic acid sequence also inherently includes variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences modified therefrom in a conservative manner, as well as sequences explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608, (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98, (1994)).

[0539] The terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids and there is no limit to the maximum number of amino acids that can constitute the sequence of a protein or peptide. A polypeptide includes any peptide or protein comprising two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to short chains, for example, which are also commonly referred to in the art as peptides, oligopeptides, and oligomers, and also to longer chains, which are generally referred to in the art as proteins, of which there are many types. "Polypeptide" includes, for example, biologically active fragments of a polypeptide, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides include natural peptides, recombinant peptides, or combinations thereof.

[0540] The term "promoter" refers to a DNA sequence recognized by the cellular synthetic machinery or introduced synthetic machinery and required for the specific transcription of a polynucleotide sequence.

[0541] The term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product to which the promoter / regulatory sequence is operably linked. In some cases, this sequence may be a core promoter sequence, and in other cases, this sequence may also contain enhancer sequences and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, be one that expresses the gene product in a tissue-specific manner.

[0542] The term "constitutive" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0543] The term "inducible" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell essentially only in the presence of an inducer corresponding to the promoter in the cell.

[0544] The term "tissue-specific" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene, causes the gene product to be produced in cells substantially only in cells of the tissue type corresponding to the promoter.

[0545] The term "cancer associated antigen" or "tumor antigen" refers interchangeably to a molecule (generally a protein, sugar, or lipid) that is expressed intact or as a fragment (e.g., MHC / peptide) on the surface of a cancer cell and can be used to preferentially direct a pharmacological substance to a cancer cell. In some embodiments, a tumor antigen is a marker expressed by both normal cells and cancer cells, e.g., a lineage marker, e.g., CD19 on a B cell. In some embodiments, a tumor antigen is a cell surface molecule that is overexpressed in cancer cells compared to normal cells, e.g., 1-fold overexpression, 2-fold overexpression, 3-fold or more overexpression compared to normal cells. In some embodiments, a tumor antigen is a cell surface molecule that is inappropriately synthesized in cancer cells, e.g., a molecule that contains deletions, additions, or mutations compared to molecules expressed on normal cells. In some embodiments, a tumor antigen will be expressed exclusively on the surface of a cancer cell, intact or as a fragment (e.g., MHC / peptide), and will not be synthesized or expressed on the surface of a normal cell. In some embodiments, the CAR of the present invention includes a CAR comprising an antigen binding domain (e.g., an antibody or antibody fragment) that is bound to a peptide presented by MHC. Typically, peptides derived from endogenous proteins fill the pockets of major histocompatibility complex (MHC) class I molecules and are recognized by T cell receptors (TCRs) on CD8+ T lymphocytes. MHC class I complexes are constitutively expressed by all nucleated cells. In cancer, virus-specific and / or tumor-specific peptide / MHC complexes represent unique class cell surface targets for immunotherapy. TCR-like antibodies targeting peptides derived from viral or tumor antigens in the context of human leukocyte antigen (HLA)-A1 or HLA-A2 have been described (see, e.g., Sastry et al., J Virol. 2011 85(5):1935-1942; Sergeeva et al., Blood, 2011 117(16):4262-4272; Verma et al., J Immunol 2010 184(4):2156-2165; Willemsen et al., Gene Ther 2001 8(21):1601-1608; Dao et al., Sci Transl Med 2013 5(176):176ra33; Tassev et al., Cancer Gene Ther 2012 19(2):84-100). For example, TCR-like antibodies can be identified by screening libraries, such as human scFv phage display libraries.

[0546] The terms "tumor-supporting antigen" or "cancer-supporting antigen" interchangeably refer to molecules (generally proteins, sugars, or lipids) expressed on the surface of cells that are not themselves cancerous but that support cancer cells, e.g., by promoting their growth or survival (e.g., immune cell resistance). Exemplary cells of this type include stromal cells and myeloid-derived suppressor cells (MDSCs). Tumor-supporting antigens themselves do not need to play a role in supporting tumor cells, as long as the antigen is present on cells that support cancer cells.

[0547] As used in the context of scFv, the term "flexible polypeptide linker" or "linker" refers to a peptide linker composed of amino acids such as glycine and / or serine residues, which is used alone or in combination to link the variable heavy chain region and the variable light chain region together. In one embodiment, the flexible polypeptide linker is a Gly / Ser linker and comprises the amino acid sequence (Gly-Gly-Gly-Ser)n, where n is a positive integer equal to or greater than 1. For example, n=1, n=2, n=3, n=4, n=5 and n=6, n=7, n=8, n=9 and n=10 (SEQ ID NO: 6592). In one embodiment, the flexible polypeptide linker includes, but is not limited to, (Gly4Ser)4 (SEQ ID NO: 6593) or (Gly4Ser)3 (SEQ ID NO: 6594). In another embodiment, the linker comprises multiple repeats of (Gly2Ser), (GlySer) or (Gly3Ser) (SEQ ID NO: 6595). Also included within the scope of the present invention are linkers described in WO 2012 / 138475, which is incorporated herein by reference.

[0548] As used herein in connection with messenger RNA (mRNA), a 5' cap (also referred to as an RNA cap, an RNA 7-methylguanosine cap, or an RNAm7G cap) is a modified guanine nucleotide that has been added to the "front end" or 5' end of a eukaryotic messenger RNA immediately after the start of transcription. The 5' cap consists of an end group connected to the first transcribed nucleotide. Its presence is crucial for ribosome recognition and protection from RNases. Cap addition is coupled to transcription and occurs in a co-transcriptional manner, so that each affects the other. Shortly after transcription is initiated, the 5' end of the mRNA being synthesized is constrained by a cap synthesis complex that is bound to an RNA polymerase. This enzymatic complex catalyzes the chemical reactions required for mRNA capping. The synthesis process proceeds as a multi-step biochemical reaction. The capping portion can be modified to regulate the function of the mRNA, such as its stability or translation efficiency.

[0549] As used herein, "in vitro transcribed RNA" refers to RNA, preferably mRNA, that has been synthesized in vitro. Typically, in vitro transcribed RNA is produced from an in vitro transcription vector. The in vitro transcription vector includes a template for producing in vitro transcribed RNA.

[0550] As used herein, "poly (A)" is a series of adenosines attached to an mRNA by polyadenylation. In preferred embodiments of transient expression constructs, the poly (A) number is between 50 and 5000 (SEQ ID NO: 6596), preferably greater than 64, more preferably greater than 100, and most preferably greater than 300 or 400. The poly (A) sequence can be modified chemically or enzymatically to modulate mRNA function such as localization, stability, or translation efficiency.

[0551] As used herein, "polyadenylation" refers to the covalent attachment of a polyadenylyl moiety or its modified variants to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' polyadenylic acid tail is a long sequence of adenine nucleotides (often several hundred) added to the pre-mRNA by the action of an enzyme (poly(A) polymerase). In higher eukaryotes, the poly(A) tail is added to transcripts containing a specific sequence (the polyadenylation signal). The poly(A) tail and the proteins bound to it help protect the mRNA from exonuclease degradation. Polyadenylation is also important for transcription termination, mRNA export from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after DNA is transcribed into RNA, but can also occur later in the cytoplasm. After transcription has terminated, the mRNA chain is cleaved by the action of an endonuclease complex bound to RNA polymerase. The cleavage site is typically characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA has been cleaved, an adenosine residue is added to the free 3' end at the cleavage site.

[0552] As used herein, "transient" refers to the expression of a non-integrated transgene for a period of hours, days, or weeks, wherein the period of expression is less than the period of time the gene would be expressed if it were integrated into the genome of the host cell or contained within a stable plasmid replicon.

[0553] As used herein, the terms "treatment," "therapy," and "treating" refer to the administration of one or more therapies (e.g., one or more therapeutic agents such as the CAR of the present invention) to reduce or improve the progression, severity, and / or duration of a proliferative disorder, or to improve one or more symptoms (preferably, one or more perceptible symptoms) of a proliferative disorder. In specific embodiments, "treatment," "therapy," and "treating" refer to improving at least one measurable physical parameter of a proliferative disorder that is not necessarily perceptible by the patient, such as tumor growth. In other embodiments, "treatment," "therapy," and "treating" refer to physically (e.g., by stabilizing perceptible symptoms), physiologically (e.g., by stabilizing body parameters), or both inhibiting the progression of a proliferative disorder. In other embodiments, "treatment," "therapy," and "treating" refer to a reduction or stabilization of tumor size or cancer cell count.

[0554] The term "signal transduction pathway" refers to the biochemical relationships between various signal transduction molecules that play a role in propagating a signal from one part of a cell to another. The phrase "cell surface receptor" includes molecules and molecular complexes that are capable of receiving a signal and transmitting the signal across the cell membrane.

[0555] The term "subject" is intended to include living organisms (eg, mammals, humans) in which an immune response can be elicited.

[0556] The term "substantially purified" cells refers to cells that are substantially free of other cell types. Substantially purified cells also refer to cells that have been separated from other cell types with which they are normally associated in their naturally occurring state. In some cases, a substantially purified cell population refers to a homogeneous cell population. In other cases, the term simply refers to cells that have been separated from the cells with which they are naturally associated in their naturally occurring state. In some aspects, the cells are cultured in vitro. In other aspects, the cells are not cultured in vitro.

[0557] As used herein, the term "therapeutic" means to treat. A therapeutic effect is achieved by reducing, inhibiting, alleviating or eradicating a disease state.

[0558] As used herein, the term "prevention" means the prophylactic or protective treatment of a disease or disease state.

[0559] In the context of the present invention, "tumor antigen" or "hyperproliferative disease antigen" or "antigen associated with a hyperproliferative disease" refers to an antigen that is common to a specific hyperproliferative disease. In certain aspects, the hyperproliferative disease antigen of the present invention is derived from a cancer, including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, leukemia, uterine cancer, cervical cancer, bladder cancer, kidney cancer and adenocarcinomas such as breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, etc.

[0560] The term "transfection" or "transformation" or "transduction" refers to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" cell is a cell that has been transfected, transformed, or transduced with exogenous nucleic acid. Cells include the primary subject cell and its progeny.

[0561] The term "specifically binds" refers to a molecule that recognizes and binds to a binding partner (eg, a protein or nucleic acid) present in a sample, but does not substantially recognize or bind other molecules in the sample.

[0562] As the term is used herein, "membrane anchor" or "membrane tethering domain" refers to a polypeptide or moiety, eg, a myristoyl group, sufficient to anchor an extracellular or intracellular domain to the plasma membrane.

[0563] The term "bioequivalent" refers to the amount of drug other than a reference compound (e.g., RAD001) required to produce an effect equivalent to that produced by a reference dose or reference amount of a reference compound (e.g., RAD001). In one embodiment, the effect is an mTOR inhibition level, for example, as measured by P70 S6 kinase inhibition, for example, as evaluated in an in vivo or in vitro assay, for example, as measured by an assay as described herein (e.g., Boulay assay). In one embodiment, the effect is a change in the ratio of PD-1 positive / PD-1 negative T cells, as measured by a cell sorting method. In one embodiment, the bioequivalent amount or dose of an mTOR inhibitor is an amount or dose that achieves the same P70 S6 kinase inhibition level as a reference dose or reference amount of a reference compound. In one embodiment, the bioequivalent amount or dose of an mTOR inhibitor is an amount or dose that achieves the same PD-1 positive / PD-1 negative T cell ratio change level as a reference dose or reference amount of a reference compound.

[0564] When used in connection with an mTOR inhibitor (e.g., an allosteric mTOR inhibitor, e.g., RAD001 or rapamycin, or a catalytic mTOR inhibitor), the term "immunoenhancing low dose" refers to a dose of an mTOR inhibitor that partially, but not completely, inhibits mTOR activity (e.g., as measured by inhibition of P70 S6 kinase activity). Methods for evaluating mTOR activity (e.g., by inhibition of P70 S6 kinase) are discussed herein. The dose is not sufficient to cause complete immunosuppression, but is sufficient to enhance the immune response. In one embodiment, the immunoenhancing low dose of an mTOR inhibitor results in a decrease in the number of PD-1 positive T cells and / or an increase in the number of PD-1 negative T cells, or an increase in the ratio of PD-1 negative T cells / PD-1 positive T cells. In one embodiment, the immunoenhancing low dose of an mTOR inhibitor results in an increase in the number of naive T cells. In one embodiment, the immunoenhancing low dose of an mTOR inhibitor results in one or more of the following:

[0565] Increased expression of one or more of the following markers: e.g., CD62Lhigh, CD127high, CD27+, and BCL2 on memory T cells (e.g., memory T cell precursors);

[0566] reduced expression of KLRG1 on memory T cells (e.g., memory T cell precursors); and

[0567] Increased number of memory T cell precursors, such as cells having any one or a combination of the following characteristics: CD62L high Increase, CD127 high Increase, CD27 + increased, KLRG1 decreased, and BCL2 increased;

[0568] wherein any of the changes described above occur, e.g., at least transiently, e.g., as compared to an untreated subject.

[0569] As used herein, "refractory" refers to a disease, e.g., cancer, that does not respond to treatment. In embodiments, a refractory cancer may resist treatment before or at the start of treatment. In other embodiments, a refractory cancer may become resistant during treatment. Refractory cancers are also referred to as drug-resistant cancers.

[0570] As used herein, "relapse" refers to the return of a disease (eg, cancer) or signs and symptoms of a disease (eg, cancer) after a period of improvement (eg, after previous treatment with a therapy (eg, cancer therapy)).

[0571] Range: Throughout this disclosure, aspects of the invention may be presented in a range format. It should be understood that descriptions in range format are for convenience and brevity purposes only and should not be interpreted as rigidly limiting the scope of the invention. Therefore, the description of a range should be considered to have all possible subranges disclosed specifically and the individual numerical values within that range. For example, a description of a range such as from 1 to 6 should be considered to have the following subranges disclosed specifically, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and the individual numerical values within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another example, a range (such as 95-99% identity) includes ranges with 95%, 96%, 97%, 98%, or 99% identity, and includes subranges such as 96-99%, 96-98%, 96-97%, 97-99%, 97-98%, and 98-99% identity. This applies regardless of the width of the range. Detailed Description of the Invention

[0573] GRNA molecules, compositions and methods described herein relate to genome editing using CRISPR / Cas systems (e.g., Cas9 systems) in eukaryotic cells. In particular, gRNA molecules, compositions and methods described herein relate to regulating the expression (or expression of its functional form) of target molecules, which affect the function of transplanted cells (e.g., cells for cancer immunotherapy). In one aspect, the transplanted cells are immune effector cells, e.g., NK cells or T cells. In one aspect, the cells are allogeneic cells. In one aspect, the cells have been, are being or will be engineered to express chimeric antigen receptors. Thus, provided herein are compositions and methods for altering (e.g., inhibiting or reducing) the expression and / or function (e.g., the level of expression of a functional form) of a gene product that can improve the efficacy (e.g., by reducing or eliminating adverse immunogenicity (e.g., host versus graft reaction or graft versus host reaction)), function, proliferation, stimulation, or survival of transplanted cells (e.g., transplanted immune effector cells, such as NK cells or T cells, such as T cells engineered to express a chimeric antigen receptor (CAR), such as allogeneic T cells expressing CAR for immunotherapy).

[0574] In many aspects, gene product is an allogeneic T cell target, such as T cell receptor components, for example, CD3ζ, CD3ε, CD3γ, CD3δ, T cell receptor (TCR) α or TCRβ;HLA molecules or beta-2 microglobulin (B2M), for example, HLA-A, HLA-B, HLA-C or B2M;CIITA molecules;Or immunosuppressants such as glucocorticoid receptor, deoxycytidine kinase, FKBP, CD52 or cyclophilin family member's target;And combinations thereof.Not limited by theory, it is believed that the level of allogeneic T cell target or the expression level of allogeneic T cell target gene product (for example, by changing gene) can be suppressed or eliminated by reducing or eliminating graft-versus-host reaction, host-versus-graft reaction or the transplanted cells will be made to resist immunosuppressant therapy, improve cell (for example, transplanted cell, for example, transplanted immune effector cell, for example, CART cell, for example, allogeneic CART cell) function.

[0575] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host versus graft reaction or graft versus host reaction)), survival, proliferation and / or efficacy of cells (e.g., T cells, e.g., CAR engineered T cells, e.g., CAR engineered allogeneic T cells) by changing T cell receptor (TCR) components (e.g., CD3ζ, CD3ε, CD3γ, CD3δ, T cell receptor (TCR) α, e.g., the constant region of TCRα or TCRβ), e.g., constant region 1 or constant region 2 genes of TCRβ. Without wishing to be bound by theory, it is believed that by eliminating T cell receptor recognition and responding to host tissue, the expression of functional T cell receptor components is reduced or absent, reducing or eliminating the presence of TCR on the cell surface, thereby reducing or preventing graft versus host disease. Therefore, this method can be used to produce "ready-made" T cells (Torikai et al., 2012 Blood 119, 5697-5705).

[0576] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host versus graft reaction or graft versus host reaction)), survival, proliferation and / or efficacy of cells (e.g., T cells, e.g., CAR-engineered T cells, e.g., CAR-engineered allogeneic T cells) by altering genes for components of the major histocompatibility complex (e.g., HLA proteins or B2Ms, e.g., HLA-A, HLA-B, HLA-C, or B2M (encoded by the B2M gene)) or genes for proteins (e.g., NLRC5) that regulate the expression of one or more components of the major histocompatibility complex. While not wishing to be bound by theory, it is believed that reduced or absent expression of mismatched (e.g., not matching the type of subject receiving the cell therapy) HLA proteins (or components) reduces or eliminates host versus graft disease by eliminating host T cell receptor recognition and response to mismatched (e.g., allogeneic) graft tissue. Thus, this method can be used to generate "ready-made" T cells.

[0577] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host versus graft reaction or graft versus host reaction)), survival, proliferation and / or efficacy of cells (e.g., T cells, e.g., CAR-engineered T cells, e.g., CAR-engineered allogeneic T cells) by altering genes for components of the major histocompatibility complex class II or genes for regulators of MHC class II expression (e.g., CIITA (encoded by the CIITA gene), RFXANK, RFX5 or RFXAP and combinations thereof, e.g., CIITA). While not wishing to be bound by theory, it is believed that reducing or eliminating the regulator (e.g., CIITA) expression of MHC class II expression will reduce or eliminate the expression of MHC class II molecules on allogeneic cells, thereby reducing or eliminating mispairing (e.g., not matching the type of the subject receiving cell therapy) MHC class II proteins (or components) expression, thereby for example by eliminating host T cell receptor recognition and responding to the graft tissue (e.g., allogeneic T cells, e.g., allogeneic CART cells) of mispairing as described herein, reducing or eliminating host versus graft disease. Therefore, this method can be used to produce "ready-made" T cells.

[0578] In one aspect, it may be beneficial to reduce or eliminate, for example, the expression of one or more MHC class I molecules and one or more MHC II molecules in T cells (for example, in allogeneic T cells, for example, such as allogeneic CART cells as described herein), to further reduce or eliminate the host-versus-graft disease reaction when administering cells. Therefore, in the embodiments of the cells and methods of the present invention, cells can be contacted with the compositions of the present invention (for example, compositions comprising gRNA and Cas9 molecules) comprising, for example, gRNA molecules for B2M as described herein (for example, such as, so contacted, so that the expression of one or more MHC class I molecules in the cell is reduced or eliminated) and contacted with the compositions of the present invention (for example, compositions comprising gRNA and Cas9 molecules) comprising, for example, gRNA molecules for CIITA as described herein (for example, such as, so contacted, so that the expression of one or more MHC II molecules is reduced or eliminated). In embodiments cells and methods of the invention, cells may also be contacted with a composition of the invention (e.g., a composition comprising a gRNA and a Cas9 molecule) comprising, for example, a gRNA molecule directed to a TCR component (e.g., to TRAC and / or TRBC) as described herein (e.g., such contact that expression of a T cell receptor (e.g., one or more TCR components) is reduced or eliminated). In one embodiment, the cells of the invention have reduced or eliminated TCR expression (e.g., as detected by flow cytometry), reduced or eliminated expression of one or more MHC class I molecules (e.g., as detected by flow cytometry), and reduced or eliminated expression of one or more MHC class II molecules (e.g., as detected by flow cytometry). In one embodiment, the cells of the invention have reduced or eliminated TRAC expression, reduced or eliminated B2M expression, and reduced or eliminated CIITA expression. In one embodiment, the cells of the invention have reduced or eliminated TRAC expression, reduced or eliminated NLRC5 expression, and reduced or eliminated CIITA expression. In embodiments, the reduced or eliminated expression is measured relative to similar cells that have not been treated with a composition of the invention or CRISPR system. In embodiments, cells are immune effector cells, e.g., T cells or NK cells, e.g., T cells as described herein. In embodiments, cells are T cells engineered to express chimeric antigen receptors (CARs) such as those described herein. In embodiments, CAR is BCMA CAR such as those described herein. In one embodiment, the present invention provides cells engineered to express BCMA CAR, e.g., immune effector cells, e.g., T cells or NK cells, e.g., T cells, and the cells are TCR- / B2M- / CIITA- or TCR- / NLRC5- / CIITA-. In embodiments, cells are human cells. In embodiments, cells are allogeneic relative to the subject to whom the cells are administered.In embodiments, reduced or eliminated TCR, B2M, NLRC5 and / or CIITA expression is achieved by introducing into the cell, e.g., a composition of the invention, a CRISPR system or a gRNA as described herein, or by a method as described herein.

[0579] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host versus graft reaction or graft versus host reaction)), survival, proliferation and / or efficacy of cells (e.g., T cells, e.g., CAR-engineered T cells, e.g., CAR-engineered allogeneic T cells) by altering the gene of the target of an immunosuppressant (e.g., glucocorticoid receptor (GR) (encoded by NR3C1)). Without being bound by theory, it is believed that the absence or reduction of functional GR expression on a cell therapy product allows the cell therapy product to function in the presence of an immunosuppressive drug, such as a corticosteroid such as dexamethasone, for example, when the immunosuppressive drug is being administered to reduce or eliminate host versus graft disease. Thus, this approach can be used to generate "off-the-shelf" T cells.

[0580] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (e.g., host versus graft reaction or graft versus host reaction)), survival, proliferation, and / or efficacy of cells (e.g., T cells, e.g., CAR-engineered T cells, e.g., CAR-engineered allogeneic T cells) by altering the gene of the target of an immunosuppressive agent (e.g., CD52 (encoded by CD52)). Without being bound by theory, it is believed that the absence or reduction of functional CD52 expression on a cell therapy product allows the cell therapy product to be administered in the presence of an immunosuppressive agent such as an anti-CD52 antibody or antigen-binding fragment thereof (e.g., alemtuzumab). ) is present, for example, when the immunosuppressive drug is being administered to reduce or eliminate host-versus-graft disease. Thus, this method can be used to generate "ready-made" T cells.

[0581] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host-versus-graft reaction or graft-versus-host reaction)), survival, proliferation and / or efficacy of cells (e.g., T cells, e.g., CAR-engineered T cells, e.g., CAR-engineered allogeneic T cells) by altering the gene of the target of an immunosuppressant (e.g., a FKBP family member, e.g., FKBP12 (encoded by FKBP1A)). Without being bound by theory, it is believed that the absence or reduction of functional FKBP12 expression on a cell therapy product allows the cell therapy product to function in the presence of an immunosuppressive drug such as FK506 (or an FKBP12 binding fragment or an analog thereof), cyclosporine, rapamycin or a rapamycin analog, or an mTor inhibitor such as RAD001, for example, when the immunosuppressive drug is being administered to reduce or eliminate host-versus-graft disease. Thus, this approach can be used to generate "off-the-shelf" T cells.

[0582] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host versus graft reaction or graft versus host reaction)), survival, proliferation and / or efficacy of cells (e.g., T cells, e.g., CAR-engineered T cells, e.g., CAR-engineered allogeneic T cells) by altering the gene of the target of an immunosuppressant (e.g., deoxycytidine kinase (encoded by DCK)). Without being bound by theory, it is believed that the absence or reduction of functional deoxycytidine kinase expression on a cell therapy product allows the cell therapy product to function in the presence of an immunosuppressive drug, such as a nucleoside analog-based drug, such as cytarabine (pyrimidine arabinoside) or gemcitabine, which is being administered, for example, to reduce or eliminate host versus graft disease or to treat cancer. Thus, this approach can be used to generate "off-the-shelf" T cells.

[0583] In various aspects, the gene product is an inhibitory molecule, e.g., an immune checkpoint protein, e.g., PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ. Without being bound by theory, it is believed that inhibiting or eliminating the level of inhibitory molecules or the expression level of inhibitory molecule gene products (e.g., by changing the gene) can improve the function of cells (e.g., transplanted cells, e.g., transplanted immune effector cells, e.g., CART cells, e.g., allogeneic CART cells) by reducing or eliminating the inhibitory effects mediated by the inhibitory molecules.

[0584] In one aspect, compositions and methods described herein can be used to reduce the influence of immunosuppressive factors on cells (e.g., CAR engineered T cells) by changing the gene of inhibitory molecules (e.g., PD1). Without wishing to be bound by theory, it is believed that the expression of programmed cell death 1 (PD-1) (encoded by PDCD1) is reduced or absent to eliminate the induction of suppressed or unresponsive states ("anergy").

[0585] In one aspect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR engineered T cells) by changing the genes of inhibitory molecules (e.g., Tim3). Without wishing to be bound by theory, it is believed that reduced or absent expression of Tim3 (encoded by HAVCR2) eliminates the induction of a suppressed or unresponsive state ("anergy").

[0586] In one aspect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR engineered T cells) by changing the genes of inhibitory molecules (e.g., CTLA4 genes). Without wishing to be bound by theory, it is believed that the expression of cytotoxic T lymphocyte-associated antigen 4 (encoded by CTLA4) is reduced or absent, eliminating the induction of a suppressed or unresponsive state ("anergy").

[0587] In one aspect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR engineered T cells) by altering the genes of inhibitory molecules (e.g., Lag3 genes). Without wishing to be bound by theory, it is believed that reduced or absent expression of lymphocyte activation gene 3 (Lag3) (encoded by LAG3) eliminates the induction of a suppressed or unresponsive state ("anergy").

[0588] In one aspect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR engineered T cells) by changing the genes of inhibitory molecules (e.g., PD-L1 genes). Without wishing to be bound by theory, it is believed that reduced or absent expression of programmed death ligand 1 (PD-L1, also known as CD274 and B7-H1) (encoded by CD274) eliminates the induction of suppressed or unresponsive states ("anergy").

[0589] In one aspect, compositions and methods described herein can be used to reduce the influence of immunosuppressive factors on cells (e.g., T cells of CAR engineering) by changing the gene (e.g., tyrosine-protein phosphatase non-receptor type 1 gene) of the downstream effector molecule of the inhibitory molecule. While not wishing to be bound by theory, it is believed that by affecting signal transduction by means of inhibitory molecules, the expression of functional tyrosine-protein phosphatase non-receptor type 1 (also referred to as protein tyrosine phosphatase 1B) (encoded by PTPN1) is reduced or absent, eliminating the induction of suppressed or unresponsive state ("anergy").

[0590] In various aspects, the compositions and methods described herein can be used in combination to generate cells, e.g., transplanted cells, e.g., allogeneic cells, e.g., immune effector cells, e.g., NK cells or T cells, e.g., CAR-engineered T cells, that have enhanced efficacy (e.g., by reducing or eliminating adverse immunogenicity (e.g., host versus graft reaction or graft versus host reaction)), survival, proliferation, and / or stimulation relative to unmodified cells.

[0591] In one embodiment, the compositions and methods described herein can be used to produce cells that have reduced or eliminated the level or expression level of functional TCR components and wherein the level or expression level of functional MHC has been reduced or eliminated. In one embodiment, the cells have reduced or eliminated TCRα and HLA-A levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRα and HLA-B levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRα and HLA-C levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRα and B2M levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRα and NLRC5 levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and HLA-A levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and HLA-B levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and HLA-C levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and B2M levels or expression levels. In one embodiment, the cells have reduced or eliminated levels or expression levels of TCRβ and NLRC5. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ζ and HLA-A. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ζ and HLA-B. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ζ and HLA-C. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ζ and B2M. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ζ and NLRC5. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ε and HLA-A. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ε and HLA-B. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ε and HLA-C. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ε and B2M. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3ε and NLRC5. In one embodiment, the cells have reduced or eliminated levels or expression of CD3γ and HLA-A. In one embodiment, the cells have reduced or eliminated levels or expression of CD3γ and HLA-B. In one embodiment, the cells have reduced or eliminated levels or expression of CD3γ and HLA-C. In one embodiment, the cells have reduced or eliminated levels or expression of CD3γ and B2M. In one embodiment, the cells have reduced or eliminated levels or expression of CD3γ and NLRC5.In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3δ and HLA-A. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3δ and HLA-B. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3δ and HLA-C. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3δ and B2M. In one embodiment, the cells have reduced or eliminated levels or expression levels of CD3δ and NLRC5. In any of the foregoing embodiments, the cells may have reduced or eliminated levels or expression levels of CIITA. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRAC, B2M, and CIITA. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRBC, B2M, and CIITA. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRAC, TRBC, B2M, and CIITA. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRAC, TRBC, B2M, and CIITA. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRAC, NLRC5, and CIITA. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRBC, NLRC5, and CIITA. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRAC, TRBC, NLRC5, and CIITA. In any of the foregoing embodiments, the cells may additionally have reduced or eliminated levels or expression levels of one or more inhibitory molecules or inhibitory molecule downstream effectors. In one aspect, the one or more inhibitory molecules include PD-1. In one aspect, the one or more inhibitory molecules include PD-L1. In one aspect, the one or more inhibitory molecules include Lag3. In one aspect, the one or more inhibitory molecules include Tim3. In one aspect, the one or more inhibitory molecules include CTLA4. In one aspect, the one or more inhibitory molecules include PTPN1. In one aspect, the one or more inhibitory molecules include PD-1 and PD-L1. In one aspect, the one or more inhibitory molecules include PD-1 and Lag3. In one aspect, the one or more inhibitory molecules include PD-1 and Tim3. In one aspect, the o...

Claims

1. A gRNA molecule comprising a tracr and a crRNA, wherein the crRNA comprises a guide domain that is complementary to a target sequence of B2M, wherein the guide domain and the tracr are arranged on a single nucleic acid molecule, and wherein the guide domain consists of SEQ ID NO: 5498.

2. The gRNA molecule of claim 1, wherein the gRNA molecule consists of SEQ ID NO: 7858 or SEQ ID NO: 7853.

3. The gRNA molecule according to claim 1, wherein the gRNA molecule comprises one or more nucleic acid molecules, wherein the nucleic acid molecules comprise: a) one or more phosphorothioate modifications at the 3' end of the nucleic acid molecule or molecules; b) one or more phosphorothioate modifications at the 5' end of the nucleic acid molecule or molecules; c) one or more 2'-O-methyl modifications at the 3' end of the nucleic acid molecule or molecules; d) one or more 2'-O-methyl modifications at the 5' end of the nucleic acid molecule or molecules; e) one or more 2'O-methyl modifications at each of the 4th to last residue, the 3rd to last residue, and the 2nd to last residue from the 3' end of the nucleic acid molecule or molecules; or f) any combination thereof.

4. A composition comprising a gRNA molecule according to claim 1, and further comprising a Cas9 molecule or a nucleic acid encoding a Cas9 molecule.

5. The composition of claim 4, wherein the Cas9 molecule consists of SEQ ID NO: 6611 or any one of SEQ ID NO: 7821 to SEQ ID NO: 7831.

6. The composition of claim 4, wherein the gRNA molecule and the Cas9 molecule are present in a ribonucleoprotein complex (RNP).

7. The composition of claim 4, further comprising a second gRNA molecule; a second gRNA molecule and a third gRNA molecule; or a second gRNA molecule, a third gRNA molecule, and a fourth gRNA molecule, wherein each gRNA molecule of the composition is complementary to a different target sequence.

8. The composition according to claim 4, further comprising a template nucleic acid.

9. The composition of claim 8, wherein the template nucleic acid comprises a nucleic acid encoding a chimeric antigen receptor (CAR).

10. The composition of claim 9, wherein CAR is: (a) CD19 CAR; (b) BCMACAR; (c) a CD20 CAR; (d) a CD22 CAR; (e) a CD123 CAR; (f) an EGFRvIIICAR; or (g) Mesothelin CAR.

11. The gRNA molecule according to any one of claims 1-3, or the composition according to any one of claims 4-10, formulated in a culture medium suitable for electroporation.

12. A nucleic acid comprising a sequence encoding a gRNA molecule according to any one of claims 1-2.

13. A vector comprising the nucleic acid according to claim 12.

14. An in vitro method for altering a target sequence in a cell, comprising contacting said cell in vitro with: a) one or more gRNA molecules and Cas9 molecules according to any one of claims 1 to 3; b) one or more gRNA molecules according to any one of claims 1 to 3 and nucleic acids encoding Cas9 molecules; c) nucleic acids encoding one or more gRNA molecules according to any one of claims 1 to 2 and Cas9 molecules; d) a nucleic acid encoding one or more gRNA molecules according to any one of claims 1 to 2 and a nucleic acid encoding a Cas9 molecule; e) any of a) to d) above and a template nucleic acid; f) any of a) to d) above and a nucleic acid encoding a template nucleic acid; g) any of a) to f) above, and one or more other gRNA molecules; or h) A composition according to any one of claims 4 to 10.

15. The method of claim 14, wherein the template nucleic acid comprises a nucleic acid encoding a chimeric antigen receptor (CAR).

16. The method of claim 15, wherein the CAR is: (a) CD19 CAR; (b) BCMACAR; (c) a CD20 CAR; (d) a CD22 CAR; (e) a CD123 CAR; (f) an EGFRvIIICAR; or (g) Mesothelin CAR.

17. The method of claim 14, wherein the cell is contacted with a gRNA molecule or a nucleic acid encoding a gRNA molecule and with a Cas9 molecule or a nucleic acid encoding a Cas9 molecule, reducing or eliminating expression of B2M in the cell, and wherein the method further comprises expanding the cell.

18. The method of claim 14, wherein the gRNA molecule or a nucleic acid encoding the gRNA molecule, the Cas9 molecule or a nucleic acid encoding the Cas9 molecule, and the template nucleic acid, if present, are introduced into the cell ex vivo.

19. The method of claim 14, wherein the gRNA molecule or nucleic acid encoding the gRNA molecule, the Cas9 molecule or nucleic acid encoding the Cas9 molecule, and the template nucleic acid, if present, are introduced into the cell by electroporation.

20. The method of claim 14, wherein the template nucleic acid is delivered to the cell via a vector, and wherein the vector is a lentiviral vector, an AAV vector, an AAV6 vector, an adenoviral vector, a plasmid, a minicircle, or a nanoplasmid.

21. The method of claim 14, wherein the gRNA molecule or a nucleic acid encoding a gRNA molecule and the Cas9 molecule or a nucleic acid encoding a Cas9 molecule are formulated in a single composition.

22. The method of claim 14, wherein the gRNA molecule or nucleic acid encoding the gRNA molecule and the Cas9 molecule or nucleic acid encoding the Cas9 molecule are formulated in more than one composition.

23. A cell comprising the gRNA molecule according to any one of claims 1-3.

24. A cell comprising the composition of any one of claims 4-10.

25. The cell of claim 24, wherein the cell has been engineered to express a chimeric antigen receptor (CAR).

26. The cell of claim 25, wherein the CAR is: (a) CD19 CAR; (b) BCMACAR; (c) a CD20 CAR; (d) a CD22 CAR; (e) a CD123 CAR; (f) an EGFRvIIICAR; or (g) Mesothelin CAR.

27. A cell comprising the nucleic acid of claim 12.

28. A cell comprising the vector of claim 13.

Images