Methods for modifying the specificity of plant noncoding RNA molecules for silencing gene expression

Abstract

The present invention discloses a method for modifying a gene in a plant cell that encodes or is processed into a non-coding RNA molecule that does not have RNA silencing activity, the method comprising introducing a DNA editing agent into the plant cell, the DNA editing agent conferring a silencing specificity of the non-coding RNA molecule to a target RNA of interest. The present invention also discloses a method for modifying a gene in a plant cell that encodes or is processed into an RNA silencing molecule, the method comprising introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting the silencing specificity of the non-coding RNA molecule to a target RNA of interest. The present invention also discloses a plant cell, a plant seed, a plant, and a method for producing a plant.

Description

[0001] Technical field and background technology

[0002] In some embodiments, the present invention relates to modifying genes that encode or are processed into non-coding RNA molecules (including RNA silencing molecules), and particularly, but not exclusively, to using the same genes to silence the expression of endogenous or exogenous target genes of interest in plants.

[0003] RNA silencing or RNA interference (RNAi) is an endogenous co-transcriptional or post-transcriptional genetic regulatory mechanism by which RNA molecules inhibit gene expression or translation, usually mediated by non-coding RNA molecules, including microRNA (miRNA), small interfering RNA (siRNA), trans-acting RNA (ta-siRNA), piwi-interacting RNA (piRNA), antisense RNA, etc. In recent years, other non-coding RNAs have been considered to have RNA silencing activity, including transfer RNA (tRNA), small nuclear RNA (snoRNA), small nucleolar RNA (snoRNA), and repeats-derived RNA. These typical and atypical RNA silencing molecules differ in their substrates, biogenesis, effector proteins, and target downregulation patterns.

[0004] In addition, Argonaute proteins complex with small RNAs to form the core of the RNA induced silencing complex (RISC), an RNA interference (RNAi) effector complex. The Argonaute superfamily is divided into two branches, called Ago and Piwi. Ago proteins (e.g., Ago1 and Ago2) are usually complexed with miRNAs and siRNAs, while Piwi proteins (e.g., Piwi, Ago3, and Aubergine (Aub)) are usually complexed with piRNAs.

[0005] Small interfering RNA (siRNA) is a double-stranded RNA molecule of 20 to 25 nucleotides (nt) in length that interferes with the expression of a specific gene with a complementary nucleotide sequence by degrading its transcript during or after transcription, resulting in no translation.

[0006] MicroRNAs (miRNAs) are small endogenous non-coding RNAs (ncRNAs) with a length of 20 to 24 nt that originate from long self-complementary precursors. Mature miRNAs regulate gene expression in two ways: (i) by inhibiting translation or (ii) by degrading coding mRNAs through complete or near-complete complementarity with the target transcript. Most plant target mRNAs contain a single miRNA complementary site, which results in the cleavage and degradation of the target mRNA by the RNA silencing molecule and RNA decay mechanisms.

[0007] Piwi interacting RNA (piRNA) is a small non-coding RNA that is the product of a long single-stranded precursor molecule and can be produced without a cleavage step. The length of piRNA is usually 26 to 31nt, and most of them are antisense. piRNA forms RNA protein complexes by interacting with Piwi proteins. Antisense piRNA is usually loaded into Piwi or Aub.

[0008] Trans-acting siRNA (tasiRNA) is a class of small interfering RNA (siRNA) that inhibits gene expression by post-transcriptional gene silencing. Their biogenesis is triggered by the binding of miRNA to tasiRNA precursors, which recruit RNA-dependent RNA polymerase (RNA-dependent RNA-polymerase, RdRp) to synthesize dsRNA from the tasiRNA precursor template. Next, such dsRNA is processed into "staged" interval mature tasiRNA of about 21 nucleotides by DICER-LIKE 4 (DCL4).

[0009] Recent advances in genome editing technologies have made it possible to change DNA sequences in living cells. By editing only a few nucleotides out of the billions of nucleotides in plant cells, these new technologies may be the most effective way to make crops grow better in harsh climates (crop performance and abiotic stress) and enhance resistance to biotic stresses (insects, viruses, bacteria, beetles, nematodes, etc.). The methods of using genome editing technologies (e.g., CRISPR / Cas9) to achieve resistance to pests are limited: plant susceptible genes are knocked out (e.g., the well-known MLO gene) by introducing stop codons, frame shifts, insertions, deletions, etc.; or resistance genes (e.g., R genes) are upregulated by modifying regulatory elements (e.g., promoters, microRNA binding sites, etc.). However, methods specifically targeting pathogens are limited to transgenic CRISPR applications.

[0010] Previous work on genome editing of RNA molecules in various organisms (e.g., mice, humans, shrimp, plants) has focused on knocking out miRNA activity or altering its binding site in the target RNA, such as:

[0011] Zhao et al. (Zhao et al., Scientific Reports, 2014, 4:3943) provided a miRNA inhibition strategy using the CRISPR system in mouse cells. Zhao used a specifically designed gRNA to cut a miRNA gene at a single site through Cas9, resulting in knockdown of the miRNA in mouse cells.

[0012] Jiang et al. (Jiang et al., RNA Biology, 2014, 11(10):1243-9) used CRISPR / Cas9 to deplete human miR-93 from a population by targeting the 5' region in HeLa cells. Various small insertions and deletions (indels) were induced in the target region containing the Drosha processing site (i.e., the location where Drosha (a double-stranded RNA-specific RNase III enzyme) binds, cleaves, and thereby processes the primary miRNA (pri-miRNA) into pre-miRNA in the nucleus of a host cell) and the seed sequence (i.e., the conserved heptametrical sequence, which is essential for the binding of miRNA to mRNA and is usually located at positions 2 to 7 of the 5' end of the miRNA). According to Jiang et al., even a single nucleotide deletion can completely knock out the target miRNA with high specificity.

[0013] Regarding plant genome editing, Bortesi and Fischer (Bortesi and Fischer, Biotechnology Advances, 2015, 33:41-52) discussed the use of CRISPR-Cas9 technology in plants compared to ZFNs and TALENs, and Basak and Nithin (Basak and Nithin, Front Plant Sci., 2015, 6:1001) demonstrated the use of CRISPR-Cas9 technology to knock out protein-coding genes in typical plants (e.g., Arabidopsis and tobacco) and crops (e.g., wheat, corn, and rice).

[0014] In addition to disrupting miRNA activity or target binding sites, gene silencing methods that utilize artificial microRNA (amiRNA)-mediated gene silencing of endogenous and exogenous target genes have also been used (Tiwari et al., Plant Mol Biol., 2014, 86: 1). Similar to microRNAs, amiRNAs are single-stranded, approximately 21 nt long, and are designed by replacing mature double-stranded miRNA sequences within pre-miRNAs (Tiwari et al., 2014). These amiRNAs are introduced as a transgene into an artificial expression cassette (comprising a promoter, terminator, etc.) (Carbonell et al., Plant Physiology, 2014, pp. 113.234989), processed by small RNA biogenesis and silencing mechanisms, and downregulate target expression. According to Schwab et al. (Schwab et al., The Plant Cell, 2006, Vol. 18, 1121-1133), amiRNAs are active when expressed under tissue-specific or inducible promoters and can be used for specific gene silencing in plants, especially when several related but not identical target genes need to be downregulated.

[0015] Senis et al. (Senis et al., Nucleic Acids Research, 2017, Vol. 45(1): e3) disclosed engineering a promoter-less antiviral amiRNA into an endogenous miRNA locus. Specifically, Senis et al. inserted an amiRNA precursor transgene (hairpin pri-amiRNA) into the vicinity of a naturally occurring miRNA gene (e.g., miR122) by homology-directed DNA recombination induced by sequence-specific nucleases (e.g., Cas9 or TALEN). This method uses promoter-less and terminator-less amiRNA by utilizing transcriptionally active DNA expressing a natural miRNA (miR122), that is, the endogenous promoter and terminator drive and regulate the transcription of the inserted amiRNA transgene.

[0016] A variety of DNA-free methods for introducing RNA and / or proteins into cells have been described previously. For example, RNA transfection using electroporation and lipofection is described in U.S. Patent Application No. 20160289675. Cho describes direct delivery of Cas9 / gRNA ribonucleoprotein (RNP) complexes to cells by microinjection of Cas9 protein and gRNA complexes (Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins", Genetics, 2013, 195: 1177-1180). Kim described the delivery of Cas9 protein / gRNA complexes by electroporation (Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins", Genome Res., 2014, 24: 1012-1019). Zuris reported the delivery of Cas9 protein-associated gRNA complexes by liposomes (Zuris et al., "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo", Nat Biotechnol., 2014, doi: 10.1038 / nbt.3081). Summary of the invention

[0017] According to one aspect of some embodiments of the present invention, a method for modifying a gene in a plant cell that encodes or is processed into a non-coding RNA molecule that does not have RNA silencing activity is provided, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent conferring a silencing specificity to a target RNA of interest to the non-coding RNA molecule, thereby modifying the gene that encodes or is processed into the non-coding RNA molecule.

[0018] According to one aspect of some embodiments of the present invention, a method for modifying a gene in a plant cell that encodes or is processed into a non-coding RNA molecule that does not have RNA silencing activity is provided, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent conferring a silencing specificity to a target RNA of interest to the non-coding RNA molecule.

[0019] According to one aspect of some embodiments of the present invention, a method for modifying a gene in a plant cell that encodes or is processed into an RNA silencing molecule targeting a target RNA is provided, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting a silencing specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.

[0020] According to one aspect of some embodiments of the present invention, a method for modifying a gene in a plant cell that encodes or is processed into an RNA silencing molecule targeting a target RNA is provided, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting a silencing specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different.

[0021] According to an aspect of some embodiments of the present invention, a plant cell is provided. The plant cell is produced by the method according to some embodiments of the present invention.

[0022] According to an aspect of some embodiments of the present invention, there is provided a plant, comprising the plant cell of some embodiments of the present invention.

[0023] According to one aspect of some embodiments of the present invention, there is provided a method for producing a plant having reduced expression of a target gene, the method comprising: (a) breeding the plants of some embodiments of the present invention; and (b) selecting a plurality of progeny plants having reduced expression of the target RNA of interest or the second target RNA, or selecting progeny including a silencing specificity in the non-coding RNA molecule for a target RNA of interest, and the plurality of progeny plants or the progeny do not include the DNA editing agent, thereby producing the plant having reduced expression of a target gene.

[0024] According to one aspect of some embodiments of the present invention, a method for producing a plant with improved stress tolerance, increased yield, improved growth rate or improved yield quality is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to stress, has reduced yield, reduced growth rate or reduced yield quality, thereby producing the plant.

[0025] According to one aspect of some embodiments of the present invention, a method for producing a pathogen-resistant or pathogen-resistant plant is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to the pathogen, thereby producing the pathogen-resistant or pathogen-resistant plant.

[0026] According to one aspect of some embodiments of the present invention, a method for producing a pathogen-resistant or pathogen-resistant plant is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the pathogen, thereby producing the pathogen-resistant or pathogen-resistant plant.

[0027] According to one aspect of some embodiments of the present invention, a method for producing a pest-resistant or pest-resistant plant is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the pest, thereby producing the pest-resistant or pest-resistant plant.

[0028] According to one aspect of some embodiments of the present invention, a method for producing a pest-tolerant or pest-resistant plant is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to the pest, thereby producing the pest-tolerant or pest-resistant plant.

[0029] According to one aspect of some embodiments of the present invention, a method for producing a herbicide-resistant plant is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or processed into an RNA silencing molecule in a plant cell as described in some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to the herbicide, thereby producing the herbicide-resistant plant.

[0030] According to an aspect of some embodiments of the present invention, there is provided a plant produced by the method according to some embodiments of the present invention.

[0031] According to an aspect of some embodiments of the present invention, there is provided a seed, wherein the seed is from the plant according to some embodiments of the present invention.

[0032] According to some embodiments of the invention, the gene encoding or processed into the non-coding RNA molecule is endogenous to the plant cell.

[0033] According to some embodiments of the invention, the gene encoding the RNA silencing molecule is endogenous to the plant cell.

[0034] According to some embodiments of the present invention, the modification of the gene encoding or processed into the non-coding RNA molecule comprises: conferring upon the non-coding RNA molecule at least 45% complementarity to the target RNA of interest.

[0035] According to some embodiments of the present invention, the modification of the gene encoding the RNA silencing molecule comprises: conferring upon the RNA silencing molecule at least 45% complementarity to the second target RNA.

[0036] According to some embodiments of the invention, the silencing specificity of the non-coding RNA molecule is determined by measuring an RNA or protein level of the target RNA of interest.

[0037] According to some embodiments of the invention, the silencing specificity of the RNA silencing molecule is determined by measuring an RNA level of the second target RNA.

[0038] According to some embodiments of the present invention, the silencing specificity of the non-coding RNA molecule or the RNA silencing molecule is determined phenotypically.

[0039] According to some embodiments of the present invention, phenotypically determined is achieved by determining at least one plant phenotype selected from the group consisting of leaf color, flower color, growth rate, plant size, crop yield, fruit trait, biotic stress tolerance, and abiotic stress tolerance.

[0040] According to some embodiments of the present invention, the silencing specificity of the non-coding RNA molecule is determined by genotype.

[0041] According to some embodiments of the invention, the plant phenotype is determined prior to a plant genotype.

[0042] According to some embodiments of the invention, the plant genotype is determined prior to a plant phenotype.

[0043] According to some embodiments of the present invention, the non-coding RNA molecule or the RNA silencing molecule is processed from a precursor.

[0044] According to some embodiments of the present invention, the non-coding RNA molecule or the RNA silencing molecule is an RNA interference (RNAi) molecule.

[0045] According to some embodiments of the present invention, the RNA interference (RNAi) molecule is selected from the group consisting of a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a micro RNA (miRNA), a Piwi interacting RNA (piRNA) and a trans-acting siRNA (tasiRNA).

[0046] According to some embodiments of the present invention, the non-coding RNA molecule is selected from the group consisting of a small nuclear RNA (snRNA), a small nucleolar RNA (snoRNA), a long non-coding RNA (lncRNA), a ribosomal RNA (rRNA), a transfer RNA (tRNA), a repeat-derived RNA and a transposable element RNA.

[0047] According to some embodiments of the present invention, the RNA molecule or the RNAi molecule is designed such that a sequence of the RNAi molecule is modified to retain structural originality and to facilitate recognition by multiple cellular RNAi factors.

[0048] According to some embodiments of the present invention, the modification of the gene is achieved by a modification selected from the group consisting of a deletion, an insertion, a single mutation and a combination thereof.

[0049] According to some embodiments of the invention, the modification is in a stem region of the non-coding RNA molecule or the RNA silencing molecule.

[0050] According to some embodiments of the present invention, the modification is in a loop region of the non-coding RNA molecule or the RNA silencing molecule.

[0051] According to some embodiments of the invention, the modification is in an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

[0052] According to some embodiments of the invention, the modification is in a stem region and a loop region of the non-coding RNA molecule or the RNA silencing molecule.

[0053] According to some embodiments of the invention, the modification is in a stem region, a loop region and an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

[0054] According to some embodiments of the invention, the modification is an insertion.

[0055] According to some embodiments of the invention, the modification is a deletion.

[0056] According to some embodiments of the invention, the modification is a point mutation.

[0057] According to some embodiments of the invention, the modification comprises a modification of at most 200 nucleotides.

[0058] According to some embodiments of the present invention, the method further comprises: introducing a plurality of donor oligonucleotides into the plant cell.

[0059] According to some embodiments of the invention, the DNA editing agent comprises at least one gRNA operably linked to a plant-expressible promoter.

[0060] According to some embodiments of the invention, the DNA editing agent does not include an endonuclease.

[0061] According to some embodiments of the present invention, the DNA editing agent comprises an endonuclease.

[0062] According to some embodiments of the present invention, the DNA editing agent is a DNA editing system, and the DNA editing system is selected from the group consisting of a large range of nucleases, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) and CRISPR.

[0063] According to some embodiments of the present invention, the endonuclease comprises Cas9.

[0064] According to some embodiments of the invention, the DNA editing agent is applied to the cell in the form of DNA, RNA or RNP.

[0065] According to some embodiments of the invention, the DNA editing agent is linked to a reporter for monitoring expression in a plant cell.

[0066] According to some embodiments of the invention, the reporter is a fluorescent protein.

[0067] According to some embodiments of the invention, the target RNA of interest or the second target RNA is endogenous to the plant cell.

[0068] According to some embodiments of the invention, the target RNA of interest or the second target RNA is exogenous to the plant cell.

[0069] According to some embodiments of the invention, the plant cell is a protoplast.

[0070] According to some embodiments of the invention, the breeding comprises hybridization or selfing.

[0071] According to some embodiments of the invention, the plant is non-genetically modified (non-GMO).

[0072] According to some embodiments of the present invention, the plant is selected from the group consisting of a crop, a flowering plant and a tree.

[0073] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In the event of a conflict, the patent specification and its definition shall prevail. In addition, materials, methods and embodiments are illustrative only and are not intended to necessarily limit the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Some embodiments of the present invention are described herein by way of example only with reference to the accompanying drawings. Now with specific reference to the accompanying drawings, it should be understood that the details shown are by way of example and for the purpose of illustrative discussion of embodiments of the present invention. Therefore, it is apparent that the description in conjunction with the accompanying drawings will enable those skilled in the art to clearly understand how to implement embodiments of the present invention.

[0075] In the drawings:

[0076] Figure 1Flow chart of an embodiment of Genome Editing Induced Gene Silencing (GEiGS) replacing endogenous miRNA with siRNA targeting the PDS gene, thereby inducing gene silencing of the endogenous PDS gene. To introduce the modification, a 2-component system is being used. First, a CRISPR / CAS9 system generates a shear in a selected locus in a vector containing GFP by designed specific guide RNAs to promote homologous DNA repair (HDR) in the site. Secondly, a donor sequence (with the desired modification of the miRNA sequence) is introduced as a template for the HDR to target the newly assigned genes. This system is being used in protoplast transformation, enriched by FACS (due to the GFP signal in the CRISPR / CAS9 vector), recovered and regenerated into multiple plants.

[0077] Figures 2A to 2C The photo shows that silencing of the PDS gene causes photobleaching. Figures 2A to 2B ) and Arabidopsis ( Figure 2C ) plants caused the silencing of the PDS gene in N. benthamiana ( Figure 2B ) and Arabidopsis thaliana ( Figure 2C , right). The photo was taken after 3.5 weeks of PDS silencing.

[0078] Figures 3A to 3D is a photograph of GEiGS knocking down GFP expression levels in Arabidopsis. Protoplasts edited with GEiGS to express GFP siRNA ( Figures 3C to 3D ) compared to the control group ( Figures 3A to 3B ). It is noteworthy that GEiGS protoplasts or plants were silenced to express GFP protein.

[0079] Figure 4Flow chart of an embodiment of GEiGS replacing endogenous miRNA with siRNA targeting GFP, generating GFP-resistant Arabidopsis plants with active RNAi. To introduce the modification, a CRISPR / CAS9 system generates a shear in a selected locus in a vector containing RFP by designed multiple specific guide RNAs to promote homologous DNA repair (HDR) in the site. Secondly, a donor (DONOR) sequence (with the desired modification of the miRNA sequence) is introduced as a template for the HDR to target the GFP gene. This system is being used in GFP-expressing protoplasts, enrichment of putative modifications by FACS (due to the RFP signal in the CRISPR / CAS9 vector) is being performed and recovered, and the GFP signal intensity of the regenerated plants is being analyzed.

[0080] Figure 5 Flow chart of one embodiment of GEiGS replacing endogenous miRNA with siRNA targeting GFP, using GEiGS directed RNAi to generate GFP-resistant Arabidopsis plants. Notably, GEiGS plants silence GFP expression after plant transformation. RFP is being used for cell enrichment with transiently present CRISPR / CAS9 vectors.

[0081] Figure 6 is a flow chart of an example of GEiGS replacing endogenous miRNA with siRNA targeting GFP, resulting in plants resistant to viral infection, such as TMV infection (ie, foreign gene). RFP is being used to enrich for cells with transiently present CRISPR / CAS9 vectors.

[0082] Figure 7 is a photograph of lodging banana plants suffering from Toppling Disease caused by burrowing nematode (Radopholus similis).

[0083] Figure 8 Table showing the occurrence of Radopholus similis and Pratylenchus coffeae on different crops in the Tay Nguyen region.

[0084] Fig. 91 is a flow chart of an embodiment of a computational pipeline for generating multiple GEiGS templates. The computational GEiGS pipeline uses biological metadata and can automatically generate multiple GEiGS DNA donor templates for minimally editing multiple endogenous non-coding RNA genes (e.g., multiple miRNA genes) to result in a novel gain of function, i.e., redirecting their silencing ability to the expression of a target gene of interest.

[0085] Fig.10 is a flow chart showing one embodiment of the design of pest-resistant plants targeting any desired exogenous pest gene.GEiGS that replace endogenous miRNAs with siRNAs targeting pathogen / pest essential genes produce plants resistant to pathogen / pest infection.

[0086] Fig.11 is a flow chart showing one embodiment of the major stages required to design RNA silencing molecules with minimally edited miRNA gene bases.

[0087] Figures 12A to 12G The primary transcripts of miR-390 and modified miR-390 structures and targeted sequences are shown. The secondary structure representation of the primary transcript of miR390 and its modified forms - ( Fig. 12A ) wild type; ( Figures 12B to 12C ) a modified form of targeted GFP; ( Figures 12D to 12E ) targeting a modified form of AtPDS3; ( Figures 12F to 12G ) targeting a modified form of AtADH1. The mature miRNA / siRNA is outlined in red and exhibits structural conservation by design. The region targeted by the CRISPR / CAS9 system is outlined in purple, and the NGG sequence is marked in yellow ( Fig. 12A ).

[0088] Figures 13A to 13G The primary transcripts of miR-173 and modified miR-173 structures and targeted sequences are shown. The secondary structure representation of the primary transcript of miR173 and its modified forms - ( Fig.13A ) wild type; ( Figures 13B to 13C ) a modified form of targeted GFP; ( Figures 13D to 13E ) targeting a modified form of AtPDS3; ( Figures 13F to 13G ) targeting a modified form of AtADH1. The mature miRNA / siRNA is outlined in red and exhibits structural conservation by design. The region targeted by the CRISPR / CAS9 system is outlined in purple, and the NGG sequence is highlighted in yellow ( Fig.13A ).

[0089] Fig.13H Embodiment examples of multiple GEiGS oligonucleotide designs are shown, wherein the precursor structure does not work in biogenesis, and therefore does not need to be maintained. The design is based on Brassica rapa bnTAS3B tasiRNA. From top to bottom: wild-type tasiRNA, GEiGS design with minimal sequence variation, and GEiGS design with maximum sequence variation. The selection of non-coding RNA precursors that produce mature small RNA molecules is highlighted in green. The sequence differences between GEiGS oligonucleotides and wild-type sequences are highlighted in red. It is noteworthy that, unlike miRNA and tRNA, tasiRNA biogenesis does not depend on the precursor secondary structure.

[0090] Figures 14A to 14D Gene targeting by miR-173 and its modified forms is shown. ( Fig.14A ) Wild-type miR-173 targets the TAS1c transcript (red) through sequence complementarity of the mature miRNA to a sequence in the gene. New modified miRNAs (SWAP 1, 2, 3, 4, 9, and 10) were designed to target ( Fig. 14B )GFP、( Fig. 14C )AtPDS3 and ( Fig.14D )AtADH1. Modified nucleotides from the wt sequence are written in lower case.

[0091] Figures 15A to 15D Gene targeting by miR-390 and its modified forms is shown. ( Fig.15A ) Wild-type miR-390 targets TAS3 transcripts (red) through sequence complementarity of the mature miRNA to a sequence in the gene. New modified miRNAs (SWAP 5, 6, 7, 8, 11, and 12) are designed to target ( Fig. 15B )GFP、( Fig. 15C )AtPDS3 and ( Fig.15D )AtADH1. Modified nucleotides from the wt sequence are written in lower case.

[0092] Fig.16PDS3 phenotype / genotype is shown: bleached phenotype plants were selected and genotyped by internal amplicon PCR followed by restriction analysis with BtsaI (NEB) to verify the presence of the donor relative to the wild-type sequence. Run 1: treated plants with no donor restriction; Runs 2 to 4: PDS3 treated plants with donor restriction; Run 5: unrestricted positive plasmid donor control; Run 6: no template water control; Run 7: restricted positive plasmid donor; Run 8: plants bombarded with restricted negative donor; Run 9: restricted untreated control plants. The amplicon was subsequently amplified by external PCR and sequenced to verify the insertion.

[0093] Fig.17 ADH1 phenotype / genotype is shown: plants were selected for resistance to allyl alcohol and genotyped by internal amplicon PCR followed by restriction digestion by BccI (NEB) to verify the presence of the donor. Run 1: restricted allyl alcohol sensitive control plants; Runs 2 to 4: allyl alcohol resistant plants restricted with donor; Run 5: unrestricted positive plasmid donor control; Run 6: no template control; Run 7: restricted positive plasmid donor; Run 8: plants bombarded with restricted nonspecific donor; Run 9: restricted non-allyl alcohol treated control.

[0094] Fig.18 is a graph showing gene expression analysis in plants modified with miR-173 targeting the AtPDS3 transcript. Analysis of AtPDS3 expression was performed by qRT-PCR in regenerations bombarded with GEiGS#4 and SWAP3 compared to plants bombarded with GEiGS#5 and SWAP1 and 2 (GFP). Notably, the average observed gene expression level was reduced by 82% when miR-173 was modified to target AtPDS3 compared to control plants (error bars show SD; p-value calculated based on Ct values ​​<0.01).

[0095] Fig.19 is a graph showing gene expression analysis in plants modified with miR-390 targeting the AtPDS3 transcript. Analysis of AtADH1 expression was performed by qRT-PCR in regenerations bombarded with GEiGS#1 and SWAP11 compared to plants bombarded with GEiGS#5 and SWAP1 and 2 (GFP). Notably, the average observed gene expression level was reduced by 82% when miR-390 was modified to target AtADH1 compared to control plants (error bars show SD; p-value calculated based on Ct values ​​< 0.01). DETAILED DESCRIPTION

[0096] In some embodiments, the present invention relates to modifying genes that encode or are processed into non-coding RNA molecules (including RNA silencing molecules), and particularly, but not exclusively, to using the same genes to silence the expression of endogenous or exogenous target genes of interest in plants.

[0097] The principles and operation of the present invention may be better understood with reference to the several drawings and accompanying descriptions.

[0098] Before explaining at least one embodiment of the present invention in detail, it should be understood that the application of the present invention is not necessarily limited to the details set forth in the following description or illustrated by the multiple examples. The present invention can have other embodiments or can be practiced or implemented in various ways. In addition, it should be understood that the wording and terminology used herein are for illustrative purposes and should not be regarded as limiting.

[0099] Previous work on genome editing of multiple RNA molecules in various organisms (e.g., mice, humans, plants) has focused on the use of transgenes to disrupt miRNA activity or multiple target binding sites. Genome editing in plants has further focused on the use of CRISPR-Cas9 technology, ZFNs, and TALENs for knocking out multiple genes or multiple insertions in a variety of typical plants. In addition, gene silencing using artificial microRNA transgenes to silence multiple endogenous and exogenous target genes in a variety of plants has also been described (Molnar A et al., Plant J., 2009, 58(1): 165 to 74, doi: 10.1111 / j.1365-313X.2008.03767.x, Epub 2009 Jan 19; Borges and Martienssen, Nature Reviews Molecular Cell Biology|AOP, published online on Nov 4, 2015; doi: 10.1038 / nrm4085). The multiple artificial miRNA transgenes are introduced into multiple plant cells within an artificial expression cassette (comprising a promoter, terminator, selection marker, etc.), and target expression is downregulated.

[0100] While putting the present invention into practice, the inventors have designed a gene editing technology that is designed for multiple non-coding RNA molecules (e.g., endogenous) to target and interfere with a non-natural target gene of interest (endogenous or exogenous to the plant cell). The gene editing technology described herein does not implement multiple classical molecular genetic and transgenic tools including multiple expression cassettes (with a promoter, terminator, selection marker).

[0101] As shown below and in the Examples section that follows, the inventors have designed a Genome Editing Induced Gene Silencing (GEiGS) platform that is capable of utilizing multiple endogenous non-coding RNA molecules of a plant cell (comprising, for example, multiple RNA silencing molecules (e.g., siRNA, miRNA, piRNA, tasiRNA, tRNA, rRNA, antisense RNA, snRNA, snoRNA, etc.)) and modifying them to target and downregulate any RNA target of interest (see Figure 1 Using GEiGS, the present method is able to screen multiple potential non-coding RNA molecules, edit multiple nucleotides in these endogenous RNA molecules, and thereby redirect their specificity to effectively and specifically target and down-regulate any RNA of interest (including endogenous and / or exogenous RNAs encoded by multiple pathogens and multiple pests (see Fig. 9 In summary, GEiGS can be used as a novel non-transgenic technology for improving crop yield, crop growth rate, crop quality, and protecting crops from stress, pathogens, pests, and herbicides.

[0102] Therefore, according to one aspect of the present invention, a method for modifying a gene in a plant cell that encodes or is processed into a non-coding RNA molecule that does not have RNA silencing activity is provided, the method comprising introducing a DNA editing agent into the plant cell, wherein the DNA editing agent imparts a silencing specificity to a target RNA of interest to the non-coding RNA molecule, thereby modifying the gene that encodes or is processed into the non-coding RNA molecule.

[0103] According to another aspect of the present invention, a method for modifying a gene in a plant cell that encodes or is processed into an RNA silencing molecule targeting a target RNA is provided, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting the specificity of the RNA silencing molecule to target a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.

[0104] The term "plant" as used herein includes multiple whole plants, a grafted plant, ancestors and progeny of the multiple plants, and multiple plant parts, including multiple seeds, multiple seedlings, multiple stems, multiple roots (including multiple tubers), multiple rhizomes, multiple scions, and multiple plant cells, tissues, and organs. The plant can be in any form, including multiple suspension cultures, multiple embryos, multiple meristems, multiple calli, multiple leaves, multiple gametophytes, multiple sporophytes, multiple pollens, and multiple microspores. Plants that may be useful in the methods of the invention include all plants belonging to the superfamily Viridiplantee, in particular monocotyledonous and dicotyledonous plants selected from the group consisting of fodder or leguminous plants, ornamental plants, food crops, trees or shrubs selected from the group consisting of Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp., Areca catechu, Astelia fragrans, Astragalus cicer), Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp., Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp.), Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneasterserotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetaria, Davallia divaricata, Desmodium spp., Dicksonia squarosa, Dibeteropogon amplectens, Dioclea spp., Dolichos spp., Dorycnium rectum, Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana, Eragrestis spp., Erythrina spp., Eucalypfus spp., Euclea schimperi, Eulalia vi / losa, Pagopyrum spp., Feijoa sellowlana, Fragaria spp., Flemingia spp., Freycinetia banksli, Geranium thunbergii, GinAgo biloba), Glycine javanica, Gliricidia spp., Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp.), Hemaffhia altissima, Heteropogon contoffus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hypeffhelia dissolute, Indigo incamata, Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus spp., Macrotyloma axillare, Malus spp., Manihotesculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum, banana, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophoruma fricanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp., Pisum sativam, Podocarpus totara, Pogonarthria fleckii), Pogonaffhria squarrosa, Populus spp.), Prosopis cineraria, Douglas fir (Pseudotsuga menziesii), Pterolobium stellatum, Pyrus communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum), Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburusalopecuroides, Stylosanthos humilis, Tadehagi spp., Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vicia spp.), grapes (Vitis vinifera), Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrots, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, straw, beet, sugar cane, sunflower, tomato, squash tea, tree. Alternatively, algae and other non-viridiplantae can be used in the methods of some embodiments of the present invention. .

[0105] According to a specific embodiment, the plant is a crop, a flowering plant or a tree.

[0106] According to a specific embodiment, the plant is a woody plant species, for example, Actinidia chinensis (Actinidiaceae), Manihotesculenta (Euphorbiaceae), Firiodendron tulipifera (Magnoliaceae), Populus (Salicaceae), Santalum album (Santalaceae), Ulmus (Ulmaceae) and different species of Rosaceae (apple, plum, pear) and Rutaceae (citrus, lemon), gymnosperms (e.g., Picea abies), glauca and Pinus taeda), forest trees (e.g., Betulaceae, Fagaceae, gymnosperms, and tropical trees), fruit trees, shrubs or herbs (e.g., banana, cocoa, coconut, coffee, date, grape, and tea), and oil palm.

[0107] According to a specific embodiment, the plant is a tropical crop, for example, coffee, macadamia, banana, pineapple, taro, papaya, mango, barley, beans, cassava, chickpeas, cocoa (chocolate), cowpea, maize (corn), millet, rice, sorghum, sugarcane, sweet potato, tobacco, taro, tea, yam.

[0108] "Grain," "seed," or "bean" refers to a reproductive unit of a flowering plant that is capable of developing into another such plant. As used herein, the various terms are used synonymously and interchangeably.

[0109] According to a specific embodiment, the plant is a plant cell, for example, a plant cell in an embryonic cell suspension.

[0110] According to a specific embodiment, the plant is a protoplast.

[0111] The protoplasts are derived from any plant tissue, for example, fruit, flowers, roots, leaves, embryos, embryo cell suspensions, callus tissue or seedling tissue.

[0112] As used herein, the term "non-coding RNA molecule" refers to an RNA sequence that is not translated into an amino acid sequence and does not encode a protein.

[0113] According to one embodiment, the non-coding RNA molecule is generally subject to the RNA silencing processing mechanism or activity. However, some changes of multiple nucleotides (e.g., for miRNAs up to 24 nucleotides) are also contemplated herein, which may cause a processing mechanism leading to RNA interference or translation inhibition.

[0114] According to a specific embodiment, the non-coding RNA molecule is endogenous to the cell (naturally occurring, e.g., native). It should be understood that the non-coding RNA molecule may also be exogenous to the cell (i.e., externally added and not naturally occurring in the cell).

[0115] According to some embodiments, the non-coding RNA molecule comprises an intrinsic translational repression activity.

[0116] According to some embodiments, the non-coding RNA molecule comprises an intrinsic RNAi activity.

[0117] According to some embodiments, the non-coding RNA molecule does not include an intrinsic translation inhibition activity or an intrinsic RNAi activity (ie, the non-coding RNA molecule does not have an RNA silencing activity).

[0118] According to one embodiment of the present invention, the non-coding RNA molecule is specific for a target RNA (e.g., a natural target RNA) and does not cross-inhibit or silence a second target RNA or a target RNA of interest, unless designed to do so (as described below), and exhibits 100% or less global homology with the target gene, for example, less than 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% global homology; as determined at the RNA or protein level by RT-PCR, immunoblotting, immunohistochemistry and / or flow cytometry, sequencing or any other detection method.

[0119] According to one embodiment, the non-coding RNA molecule is an RNA silencing or RNA interference (RNAi) molecule.

[0120] The term "RNA silencing" or RNAi refers to a cellular regulatory mechanism in which multiple noncoding RNA molecules (the "RNA silencing molecules" or "RNAi molecules") mediate co-transcriptional or post-transcriptional repression of gene expression or translation in a sequence-specific manner.

[0121] According to one embodiment, the RNA silencing molecule is capable of mediating RNA inhibition during transcription (co-transcriptional gene silencing).

[0122] According to one embodiment, co-transcriptional gene silencing comprises epigenetic silencing (eg, a chromatic state that prevents expression of a functional gene).

[0123] According to one embodiment, the RNA silencing molecule is capable of mediating RNA inhibition after transcription (post-transcriptional gene silencing).

[0124] Post-transcriptional gene silencing (PTGS) generally refers to a process (usually occurring in the cytoplasm) in which multiple messenger RNA (mRNA) molecules are degraded or cleaved, reducing their activity by preventing translation. For example, and as discussed in detail below, a guide strand of an RNA silencing molecule pairs with a complementary sequence in an mRNA molecule and induces cleavage by, for example, Argonaute 2 (Ago2).

[0125] Co-transcriptional gene silencing generally refers to the inactivation of gene activity (i.e., transcriptional inhibition), and usually occurs in the cell nucleus. This gene activity inhibition is mediated by multiple epigenetic-related factors, such as methyltransferases, which methylate target DNA and histones. Therefore, in co-transcriptional gene silencing, the binding of a small RNA to a target RNA (small RNA-transcript interaction) destroys the stability of the target nascent transcript and recruits multiple DNA and histone modifying enzymes (i.e., multiple epigenetic factors), thereby inducing chromatin remodeling to a structure that inhibits gene activity and transcription. In addition, in co-transcriptional gene silencing, multiple long non-coding RNA scaffolds associated with chromatin may recruit multiple chromatin modification complexes independently of multiple small RNAs. These co-transcriptional silencing mechanisms form multiple RNA surveillance systems that detect and silence inappropriate transcriptional events and provide a memory of these events through multiple self-reinforcing epigenetic loops (as described in D. Hoch and D. Moazed, RNA-mediated epigenetic regulation of gene expression, Nat Rev Genet., 2015, 16(2): 71-84).

[0126] According to one embodiment of the present invention, the RNAi biogenesis / processing mechanism produces the RNA silencing molecule.

[0127] According to one embodiment of the present invention, the RNAi biogenesis / processing mechanism produces the RNA silencing molecule, but the specific target has not yet been identified.

[0128] According to one embodiment, the non-coding RNA molecule has the ability to induce RNA interference (RNAi).

[0129] The following is a detailed description of non-coding RNA molecules comprising an intrinsic RNAi activity (eg, RNA silencing molecules) that can be used according to certain embodiments of the invention.

[0130] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a precursor.

[0131] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a single-stranded RNA (ssRNA) precursor.

[0132] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a single-stranded RNA precursor with a double-stranded structure.

[0133] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a dsRNA precursor (eg, including complete and incomplete base pairing).

[0134] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from an unstructured RNA precursor.

[0135] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a protein-coding RNA precursor.

[0136] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a non-coding RNA precursor.

[0137] According to one embodiment, the dsRNA may be derived from two different complementary RNAs, or from a single RNA that folds upon itself to form the dsRNA.

[0138] Based on complete and incomplete paired RNA (i.e. double-stranded RNA; dsRNA), siRNA and shRNA - the presence of multiple long dsRNAs in multiple cells stimulates the activity of a ribonuclease III enzyme (called dicer). Dicer (also known as endoribonuclease Dicer or helicase with RNase motif) is an enzyme commonly referred to as Dicer-like (DCL) protein in multiple plants. Different plants have different numbers of DCL genes, so, for example, the Arabidopsis genome typically has four DCL genes, rice has eight DCL genes, and the maize genome has five DCL genes. Dicer is involved in the process of processing the dsRNA into multiple short fragments of dsRNA (called short interfering RNA (siRNA)). The length of the siRNA derived from dicer activity is generally about 21 to about 23 nucleotides and includes about 19 base pair duplexes with two 3' nucleotide overhangs.

[0139] Thus, some embodiments of the invention contemplate modifying a gene encoding a dsRNA to redirect a silencing specificity (including silencing activity) toward a second target RNA (ie, the target of interest).

[0140] According to one embodiment, a plurality of dsRNA precursors longer than 21 bp are used. Various studies have shown that long dsRNA can be used to silence gene expression without inducing stress response or causing significant off-target effects-see, for example (Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13: 3803 to 3810; Bhargava A et al., Brain Res. Protoc., 2004, 13: 115 to 125; Diallo M. et al., Oligonucleotides, 2003, 13: 381 to 392; Paddison PJ et al., Proc. Natl Acad. Sci. USA, 2002,; 99: 1443 to 1448; Tran N. et al., FEBS Lett., 2004, 573: 127 to 134).

[0141] The term "siRNA" refers to a small inhibitory RNA duplex (usually between 18 and 30 base pairs) that induces the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21-mers with a central 19 bp duplex region and symmetrical 2-base 3'-overhangs at the ends, although recently chemically synthesized RNA duplexes of 25 to 30 bases long have been described that are 100-fold more potent than 21-mers at the same position. The observed increased potency obtained by using longer RNAs to trigger RNAi is suggested to be caused by providing Dicer with a substrate (27-mers) rather than a product (21-mers), which increases the speed or efficiency of the siRNA duplexes entering RISC.

[0142] It has been found that the position (but not the composition) of the 3'-overhang affects the potency of an siRNA, and that asymmetric duplexes with a 3'-overhang on the antisense strand are generally more potent than asymmetric duplexes with the 3'-overhang on the sense strand (Rose et al., 2005).

[0143] Multiple strands of a double-stranded interfering RNA (e.g., siRNA) can be connected to form a hairpin or stem-loop structure (e.g., an shRNA). Therefore, as described above, the RNA silencing molecule of some embodiments of the present invention can also be a short hairpin RNA (shRNA).

[0144] As used herein, the term short hairpin RNA ("shRNA") refers to an RNA molecule having a stem-loop structure, including a first and second region of complementary sequence, the degree of complementarity and the orientation of the multiple regions are sufficient to allow base pairing to occur between the multiple regions, the first and second regions are connected by a loop region, and the loop is caused by the lack of base pairing between multiple nucleotides (or multiple nucleotide analogs) in the loop region. The number of multiple nucleotides in the loop is between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11, and some of the multiple nucleotides in the loop can participate in base pairing interactions with other nucleotides in the loop. Examples of multiple oligonucleotide sequences that can be used to form the loop include 5'-CAAGAGA-3' and 5'-UUACAA-3' (International Patent Application Nos. WO2013126963 and WO2014107763). Those skilled in the art will appreciate that the single-stranded oligonucleotides thus produced form a stem-loop or hairpin structure, including a double-stranded region that can interact with the RNAi mechanism.

[0145] The RNA silencing molecules of some embodiments of the present invention are not necessarily limited to those containing only RNA, but further include a plurality of chemically modified nucleotides and non-nucleotides.

[0146] The present invention contemplates various types of siRNAs, including trans-acting siRNA (Ta-siRNA), repeat-associated siRNA (Ra-siRNA), and natural-antisense transcript-derived siRNA (Nat-siRNA).

[0147] According to one embodiment, the silencing RNA comprises "piRNA", which is a type of Piwi-interacting RNA with a length of about 26 and 31 nucleotides. Multiple piRNAs typically form multiple RNA-protein complexes by interacting with multiple Piwi proteins, i.e., multiple antisense piRNAs are typically loaded into multiple Piwi proteins (e.g., Piwi, Ago3, and Aubin (Aub)).

[0148] miRNA - According to another embodiment, the RNA silencing molecule can be a miRNA.

[0149] The terms "microRNA", "miRNA" and "miR" are synonymous and refer to a collection of multiple non-coding single-stranded RNA molecules of approximately 19 to 24 nucleotides in length that regulate gene expression. MiRNAs are widely present in various organisms (e.g., insects, mammals, plants, nematodes) and have been shown to play a role in development, homeostasis, and disease etiology.

[0150] Initially, the pre-miRNA exists in the form of a long, non-completely double-stranded stem-loop RNA, which is further processed by Dicer into a siRNA-like duplex, including a mature guide strand (miRNA) and a fragment of similar size (called a passenger strand (miRNA*)). The miRNA and miRNA* can be derived from the opposite arms of the pri-miRNA and pre-miRNA. Multiple miRNA* sequences can be found in the library of cloned miRNAs, but the occurrence rate is usually lower than that of miRNAs.

[0151] Although initially present as a double-stranded species with the miRNA*, the miRNA eventually becomes incorporated into a ribonucleoprotein complex as a single-stranded RNA, called the RNA-induced silencing complex (RISC). Various proteins can form the RISC, which can lead to variability in the specificity for the miRNA / miRNA* duplex, the binding site of the target gene, the activity of the miRNA (inhibition or activation), and which strand of the miRNA / miRNA* duplex is loaded into the RISC.

[0152] When the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the miRNA* is removed and degraded. The strand of the miRNA:miRNA* duplex loaded into the RISC is the strand that is not tightly paired at the 5' end. In the case where both ends of the miRNA:miRNA* have approximately equal 5' pairing, both the miRNA and the miRNA* may have gene silencing activity.

[0153] The RISC identifies multiple target nucleic acids based on the high degree of complementarity between the miRNA and the mRNA, particularly through nucleotides 2 to 8 of the miRNA (referred to as the "seed sequence").

[0154] Many studies have focused on the base pairing requirements between miRNA and its mRNA target for effective translational repression (reviewed by Bartel (2004, Cell, 116-281)). Several computational studies analyzing the binding of miRNAs across the genome have shown a specific role for bases 2 to 8 at the 5' end of the miRNA (also known as the "seed sequence") in target binding, but found that the role of the first nucleotide, which is usually "A", was also recognized (Lewis et al., 2005, Cell, 120-15). Similarly, Krek et al. used nucleotides 1 to 7 or 2 to 8 to identify and validate multiple targets (2005, Nat Genet., 37-495). The multiple target sites in the mRNA can be in the 5'UTR, 3'UTR or coding region. Interestingly, multiple miRNAs can regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA binding sites in most genetically recognized targets may indicate that the synergistic action of multiple RISCs provides the most effective translational repression.

[0155] miRNAs may direct the RISC to downregulate gene expression through one of two mechanisms: mRNA cleavage or translation inhibition. If the mRNA has a certain degree of complementarity with the miRNA, the miRNA can specify the cleavage of the mRNA. When a miRNA directs cleavage, the cut is usually between the multiple nucleotides paired with residues 10 and 11 of the miRNA. Alternatively, if the miRNA does not have the necessary degree of complementarity with the miRNA, the miRNA can inhibit translation. Translation inhibition may be more common in animals because animals have a lower degree of complementarity between the miRNA and the binding site.

[0156] It should be noted that there may be variability in the 5' and 3' ends of any pair of miRNA and miRNA*. This variability may be due to variability in the enzymatic processing of Drosha and Dicer relative to the cleavage site. The variability at the 5' and 3' ends of miRNA and miRNA* may also be due to mismatches in the multiple stem structures of the pri-miRNA and pre-miRNA. The mismatch of the multiple stem chains may cause a large number of different hairpin structures. The variability in the multiple stem structures may also cause variability in multiple products cut by Drosha and Dicer.

[0157] It will be appreciated that the pre-miRNA sequence may comprise 45 to 90, 60 to 80 or 60 to 70 nucleotides, and the pri-miRNA sequence may comprise 45 to 30,000, 50 to 25,000, 100 to 20,000, 1,000 to 1,500 or 80 to 100 nucleotides.

[0158] According to one embodiment, the miRNA comprises miR-390a (as shown in SEQ ID NO: 28).

[0159] According to one embodiment, the miRNA comprises miR-173 (as shown in SEQ ID NO: 29).

[0160] Antisense - Antisense is a single-stranded RNA designed to prevent or inhibit the expression of a gene by specifically hybridizing to its mRNA. Downregulation of a target RNA can be achieved using an antisense polynucleotide that is capable of specifically hybridizing to an mRNA transcript encoding the target RNA.

[0161] As mentioned above, the non-coding RNA molecule may not include a typical (intrinsic) RNAi activity (e.g., it is not a typical RNA silencing molecule, or its target has not yet been identified). Such a non-coding RNA molecule includes the following:

[0162] According to one embodiment, the non-coding RNA molecule is a transfer RNA (tRNA). The term "tRNA" refers to an RNA molecule that is a physical link between the nucleotide sequences of multiple nucleic acids and the amino acid sequences of multiple proteins, formerly known as soluble RNA or sRNA. The length of tRNA is usually about 76 to 90 nucleotides.

[0163] According to one embodiment, the non-coding RNA molecule is a ribosomal RNA (rRNA). The term "rRNA" refers to the RNA component of the ribosome, i.e., the small ribosomal subunit or the large ribosomal subunit.

[0164] According to one embodiment, the non-coding RNA molecule is a small nuclear RNA (snRNA or U-RNA). The term "sRNA" or "U-RNA" refers to a plurality of small RNA molecules found in multiple splicing specks and multiple Cajal bodies in the nucleus of multiple eukaryotic cells. The length of snRNA is usually about 150 nucleotides.

[0165] According to one embodiment, the non-coding RNA molecule is a small nucleolar RNA (snoRNA). The term "snoRNA" refers to a plurality of small RNA molecule classes that primarily guide chemical modification of other RNAs (e.g., rRNA, tRNA, and snRNA). SnoRNAs are generally divided into two categories: C / D box snoRNAs are generally about 70 to 120 nucleotides in length and are associated with methylation; and H / ACA box snoRNAs are generally about 100 to 200 nucleotides in length and are associated with pseudouridylation.

[0166] Similar to snoRNAs are scaRNAs (i.e., small Cajal body RNA genes), which play a similar role in RNA maturation as snoRNAs, but their targets are spliceosomal snRNAs, and they perform site-specific modifications on spliceosomal snRNA precursors (in the Cajal bodies of the nucleus).

[0167] According to one embodiment, the non-coding RNA molecule is an extracellular RNA (exRNA). The term "exRNA" refers to RNA species that exist outside the cells in which they are transcribed (e.g., exosomal RNA).

[0168] According to one embodiment, the non-coding RNA molecule is a long non-coding RNA (lncRNA). The term "lncRNA" or "long ncRNA" refers to a non-protein coding transcript that is usually longer than 200 nucleotides.

[0169] According to one embodiment, non-limiting examples of multiple non-coding RNA molecules include, but are not limited to, microRNA (miRNA), piwi-interacting RNA (piRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), trans-acting siRNA (tasiRNA), small nuclear RNA (snRNA or URNA), small nucleolar RNA (snoRNA), small Cajal RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), extracellular RNA (exRNA), repeat-derived RNA, transposable element RNA, and long non-coding RNA (lncRNA).

[0170] According to one embodiment, non-limiting examples of multiple RNAi molecules include, but are not limited to, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), Piwi interacting RNA (piRNA), and trans-acting siRNA (tasiRNA).

[0171] As described above, the methods of some embodiments of the present invention are used to redirect a silencing activity and / or specificity of the non-coding RNA molecule (or, if the non-coding RNA molecule does not have an inherent ability to silence an RNA molecule, to produce a silencing activity and / or specificity) to a second target RNA or to a target RNA of interest.

[0172] According to one embodiment, said target RNA and said second target RNA are different.

[0173] According to one embodiment, a method for modifying a gene encoding or processed into an RNA silencing molecule in a plant cell includes introducing a DNA editing agent into the plant cell, wherein the DNA editing agent redirects a silencing activity and / or specificity of the RNA silencing molecule to a second target RNA, wherein the target RNA and the second target RNA are different, thereby modifying the gene encoding the RNA silencing molecule.

[0174] As used herein, the term "redirecting a silencing specificity" refers to reprogramming the original specificity of the non-coding RNA (e.g., RNA silencing molecule) to a non-natural target of the non-coding RNA (e.g., RNA silencing molecule). Thus, the original specificity of the non-coding RNA is eliminated (i.e., loss of function), and the new specificity is directed to an RNA target different from the natural target (i.e., RNA of interest), i.e., gain of function. It should be understood that gain of function occurs only when the non-coding RNA has no silencing activity.

[0175] As used herein, the term "target RNA" refers to an RNA sequence that is naturally bound by a non-coding RNA molecule. Therefore, those skilled in the art consider the target RNA to be a substrate of the non-coding RNA.

[0176] As used herein, the term "second target RNA" refers to an RNA sequence (coding or non-coding) that is not naturally bound by a non-coding RNA molecule. Therefore, the second target RNA is not a natural substrate of the non-coding RNA.

[0177] As used herein, the term "target RNA of interest" refers to an RNA sequence (coding or non-coding) that is silenced by a designed non-coding RNA molecule.

[0178] As used herein, the phrase "silencing a target gene" refers to the absence or observable reduction in the level of mRNA and / or protein products from the target gene (e.g., due to co-transcriptional and / or post-transcriptional gene silencing). Thus, the silencing of a target gene can be reduced by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% compared to a target gene not targeted by the designed non-coding RNA molecule of the present invention.

[0179] The outcome of silencing can be confirmed by examining various external properties of a plant cell or whole plant or other organism from which the designed non-coding RNA molecule was extracted or by various biochemical techniques (as described below).

[0180] It should be understood that the designed non-coding RNA molecules of some embodiments of the present invention may have some off-target specific effects, provided that they do not affect agriculturally valuable traits (e.g., biomass, yield, etc.).

[0181] According to one embodiment, the second target RNA or target RNA of interest is endogenous to the plant cell. Exemplary endogenous second target RNA or target RNA of interest include, but are not limited to, a gene product with sensitivity to stress, infection, herbicide, or a gene product associated with plant growth rate, crop yield, as further discussed below.

[0182] According to one embodiment, the second target RNA or target RNA of interest is exogenous (also referred to herein as heterologous) to the plant cell. In this case, the second target RNA or target RNA of interest is a gene product that is not a natural part of the plant genome. Exemplary exogenous second target RNAs include, but are not limited to, a gene product of a plant pathogen, such as, but not limited to, an insect, a virus, a bacterium, a fungus, a nematode, as further discussed below. An exogenous target RNA (coding or non-coding) can include a nucleic acid sequence that shares sequence identity with an endogenous RNA sequence of the plant (e.g., can be partially homologous to an endogenous nucleic acid sequence).

[0183] The specific binding of an endogenous non-coding RNA molecule to a target RNA can be determined by a computational algorithm (e.g., BLAST), and can be identified by methods including, for example, Northern blot, in situ hybridization, QuantiGene Plex analysis, etc.

[0184] The term "complementarity" or "complementary" refers to the hybridization of the non-coding RNA molecule (or at least a portion in the form of the processed small RNA, or at least one strand of a double-stranded polynucleotide or a portion thereof, or a portion of a single-stranded polynucleotide) with the target RNA or a fragment thereof under physiological conditions to achieve regulation, action or inhibition of the target gene. For example, in some embodiments, when 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 In some embodiments, a non-coding RNA molecule has 100% sequence identity, or at least about 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity when compared to a sequence of 5, 70, 80, 90, 100, 150, 200, 300, 400, 500 or more consecutive nucleotides.

[0185] As used herein, a non-coding RNA molecule or processed small RNA form thereof is said to exhibit "complete complementarity" when every nucleotide of one of the multiple sequences read from 5' to 3' is complementary to every nucleotide of another sequence read from 3' to 5'. A nucleotide sequence that is completely complementary to a reference nucleotide sequence will exhibit a sequence that is identical to the reverse complement of the reference nucleotide sequence.

[0186] Methods for determining sequence complementarity are well known in the art, and include, but are not limited to, a number of bioinformatics tools (eg, BLAST, multiple sequence alignment) that are well known in the art.

[0187] According to one embodiment, if the non-coding RNA molecule is a siRNA or is processed into a siRNA, the complementarity to its target sequence is in the range of 90 to 100% (eg, 100%).

[0188] According to one embodiment, if the non-coding RNA molecule is a miRNA or a piRNA, or is processed into a miRNA or a piRNA, the complementarity with its target sequence is in the range of 33 to 100%.

[0189] According to one embodiment, if the non-coding RNA molecule is a miRNA, the seed sequence complementarity to its target sequence (ie, from nucleotides 2 to 8 of the 5') is in the range of 85 to 100% (eg, 100%).

[0190] According to one embodiment, the non-coding RNA can be further processed into a small RNA form (e.g., pre-miRNA is processed into a mature miRNA). In this case, homology is measured based on the processed small RNA form (e.g., the mature miRNA sequence).

[0191] As used herein, the term "small RNA form" refers to the mature small RNA that is capable of hybridizing with a target RNA (or a fragment thereof). According to one embodiment, the small RNA form has a silencing activity.

[0192] According to one embodiment, the complementarity with the target sequence is at least about 33% of the processed small RNA form (e.g., 33% of 21 to 28 nt). Thus, for example, if the non-coding RNA molecule is a miRNA, 33% of the mature miRNA sequence (e.g., 21 nt) includes seed complementarity (e.g., 7 nt of the 21 nt).

[0193] According to one embodiment, the complementarity with the target sequence is at least about 45% of the processed small RNA form (e.g., 45% of 21 to 28 nt). Thus, for example, if the non-coding RNA molecule is a miRNA, 45% of the mature miRNA sequence (e.g., 21 nt) includes seed complementarity (e.g., 9 to 10 nt of the 21 nt).

[0194] According to one embodiment, the non-coding RNA molecule (i.e., before modification) is typically selected to have about 10%, 20%, 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or up to 99% complementarity to the sequence of the second target RNA or target RNA of interest.

[0195] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 99% complementarity to said sequence of said second target RNA or target RNA of interest.

[0196] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 98% complementarity to the sequence of the second target RNA or target RNA of interest.

[0197] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 97% complementarity to the sequence of the second target RNA or target RNA of interest.

[0198] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 96% complementarity to the sequence of the second target RNA or target RNA of interest.

[0199] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 95% complementarity to said sequence of said second target RNA or target RNA of interest.

[0200] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 94% complementarity to the sequence of the second target RNA or target RNA of interest.

[0201] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 93% complementarity to the sequence of the second target RNA or target RNA of interest.

[0202] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 92% complementarity to the sequence of the second target RNA or target RNA of interest.

[0203] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 91% complementarity to the sequence of the second target RNA or target RNA of interest.

[0204] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 90% complementarity to the sequence of the second target RNA or target RNA of interest.

[0205] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 85% complementarity to the sequence of the second target RNA or target RNA of interest.

[0206] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 50% complementarity to said sequence of said second target RNA or target RNA of interest.

[0207] According to a specific embodiment, the non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 33% complementarity to the sequence of the second target RNA or target RNA of interest.

[0208] According to one embodiment, the non-coding RNA molecule (e.g., RNA silencing molecule) is designed to include at least about 33%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% complementarity to the sequence of the second target RNA or target RNA of interest.

[0209] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to include at least 33% complementarity to the second target RNA or target RNA of interest (eg, 85 to 100% seed match).

[0210] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to include at least 40% complementarity to the second target RNA or target RNA of interest.

[0211] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 45% complementarity to the second target RNA or target RNA of interest.

[0212] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 50% complementarity to the second target RNA or target RNA of interest.

[0213] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 45% complementarity to the second target RNA or target RNA of interest.

[0214] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to include at least 60% complementarity to the second target RNA or target RNA of interest.

[0215] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 70% complementarity to the second target RNA or target RNA of interest.

[0216] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 80% complementarity to the second target RNA or target RNA of interest.

[0217] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 85% complementarity to the second target RNA or target RNA of interest.

[0218] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 90% complementarity to the second target RNA or target RNA of interest.

[0219] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 91% complementarity to the second target RNA or target RNA of interest.

[0220] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 92% complementarity to the second target RNA or target RNA of interest.

[0221] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 93% complementarity to the second target RNA or target RNA of interest.

[0222] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 94% complementarity to the second target RNA or target RNA of interest.

[0223] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 95% complementarity to the second target RNA or target RNA of interest.

[0224] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 96% complementarity to the second target RNA or target RNA of interest.

[0225] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 97% complementarity to the second target RNA or target RNA of interest.

[0226] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 98% complementarity to the second target RNA or target RNA of interest.

[0227] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 99% complementarity to the second target RNA or target RNA of interest.

[0228] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to include 100% complementarity to the second target RNA or target RNA of interest.

[0229] In order to induce the silencing activity and / or specificity of a non-coding RNA molecule or redirect the silencing activity and / or specificity of a non-coding RNA molecule (e.g., RNA silencing molecule) to a second target RNA or a target RNA of interest, a DNA editing agent is used to modify the gene encoding a non-coding RNA molecule (e.g., RNA silencing molecule).

[0230] The following is a description of various non-limiting examples of methods and DNA editing agents for introducing multiple nucleic acid changes into a gene encoding a non-coding RNA molecule (e.g., an RNA silencing molecule), as well as reagents for implementing the methods and DNA editing agents that can be used according to various specific embodiments of the present disclosure.

[0231] Genome editing using engineered nucleases - This approach refers to a reverse genetics approach that typically uses artificial engineered nucleases to cut and generate specific double-stranded breaks (DSBs) at the desired location(s) in the genome, which are then repaired by multiple cellular endogenous processes, such as homologous recombination (HR) or non-homologous end-joining (NHEJ). NHEJ directly joins the multiple DNA ends with a double-strand break (DSB) (with or without minimal end modifications), while HR uses a homologous donor sequence as a template (i.e., sister chromatids formed during S phase) for regeneration / replication of the missing DNA sequence at the break site. In order to introduce multiple specific nucleotide modifications into the genomic DNA, a donor DNA repair template (exogenously provided single-stranded or double-stranded DNA) containing the desired sequence must be present during HR.

[0232] Genome editing cannot be performed using traditional restriction endonucleases because most restriction enzymes recognize a few base pairs on the DNA as their targets, and these sequences are typically found in many locations in the genome, resulting in multiple cuts that are not limited to a desired location. To overcome this challenge and generate multiple site-specific single-strand or double-strand breaks (DSBs), several different classes of nucleases have been discovered and bioengineered to date. These include meganucleases, zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs), and CRISPR / Cas9 systems.

[0233] Meganucleases - Meganucleases are generally divided into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by multiple structural motifs that affect catalytic activity and recognition sequences. For example, multiple members of the LAGLIDADG family are characterized by having one or two copies of a preserved LAGLIDADG motif. These four meganuclease families are largely distinguished from each other in terms of multiple preserved structural elements as well as DNA recognition sequence specificity and catalytic activity. Meganucleases are commonly found in microbial species and have the unique property of having multiple very long recognition sequences (>14 bp), thus making them naturally very specific for cutting at a desired position.

[0234] This can be used to create multiple site-specific double-strand breaks (DSBs) in genome editing. Those skilled in the art can use these naturally occurring meganucleases, but the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutagenesis and high-throughput screening methods have been used to generate multiple meganuclease variants that recognize multiple unique sequences. For example, various meganucleases have been fused to generate multiple hybrid enzymes that recognize a new sequence.

[0235] Alternatively, multiple DNA-interacting amino acids of the meganuclease can be altered to design sequence-specific meganucleases (e.g., see U.S. Pat. No. 8,021,867). Meganucleases can be designed using methods such as those described in Certo, MT et al. (Nature Methods, 2012, 9:073-975), U.S. Pat. Nos. 8,304,222, 8,021,867, 8,119,381, 8,124,369, 8,129,134, 8,133,697, 8,143,015, 8,143,016, 8,148,098, or 8,163,514, each of which is incorporated herein by reference in its entirety. Alternatively, commercially available technologies (e.g., Precision Biosciences' directional nuclease editor) can be used to design meganucleases. TM (Directed Nuclease Editor TM ) genome editing technology) to obtain meganucleases with site-specific cleavage characteristics.

[0236] ZFNs and TALENs - Two different engineered nucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both been shown to efficiently generate multiple targeted double-strand breaks (DSBs) (Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).

[0237] Basically, ZFN and TALEN restriction endonuclease technology utilizes a non-specific DNA cutting enzyme that is connected to a specific DNA binding domain (a series of multiple zinc finger domains or multiple TALE repeat sequences, respectively). Typically, a restriction enzyme whose DNA recognition site and cleavage site are separated from each other is selected. The cleavage portion is separated and then connected to a DNA binding domain, thereby producing an endonuclease with very high specificity for a desired sequence. An exemplary restriction enzyme with this property is Fok1. In addition, the advantage of Fok1 is that dimerization is required to have nuclease activity, which means that as each nuclease partner recognizes a unique DNA sequence, the specificity will increase significantly. In order to enhance this effect, multiple Fok1 nucleases have been engineered that can only act as multiple heterodimers and have increased catalytic activity. The heterodimer acts on the nuclease to avoid the possibility of unwanted homodimer activity, thereby increasing the specificity of the double-strand break (DSB).

[0238] Therefore, for example, in order to target a specific site, multiple ZFNs and multiple TALENs are constructed as multiple nuclease pairs, each molecule in the pair is designed to bind to multiple adjacent sequences at the target site. After transient expression in multiple cells, the multiple nucleases bind to their multiple target sites, and the multiple FokI domains heterodimerize to produce a double-strand break (DSB). Repairing these double-strand breaks (DSB) by the non-homologous end joining (NHEJ) approach usually results in multiple small deletions or multiple small sequence insertions (Indels). Since each repair performed by NHEJ is unique, an allele series (allelic series) with a series of multiple different insertions or deletions can be produced at the target site using a single nuclease pair.

[0239] In general, in gene editing, NHEJ is relatively accurate (about 85% of DSBs in human cells are repaired by NHEJ within about 30 minutes from detection). Incorrect NHEJ is dependent because when the repair is accurate, the nuclease will continue to cut until the repair product is mutated and the recognition / cleavage site / PAM motif disappears / mutates, or the transiently introduced nuclease is no longer present.

[0240] Deletions typically range in length from a few base pairs to several hundred base pairs, but larger deletions have been successfully generated in cell culture by using two nuclease pairs simultaneously (Carlson et al., 2012; Lee et al., 2010). In addition, when a DNA fragment with homology to the targeted region is introduced in conjunction with the nuclease pair, the double-strand break (DSB) can be repaired by homologous recombination (HR) to generate multiple specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).

[0241] Although the multiple nuclease parts of multiple ZFNs and multiple TALENs have similar properties, the difference between these engineered nucleases lies in their DNA recognition peptides. ZFN relies on Cys2-His2 zinc fingers, while TALEN relies on TALEs. These DNA recognition peptide domains of both have a characteristic that they naturally exist in the combination of their proteins. Multiple Cys2-His2 zinc fingers are usually present in multiple repeat sequences with a spacing of 3bp and in multiple different combinations of multiple nucleic acid interaction proteins. On the other hand, multiple TALEs are present in multiple repeat sequences with a one-to-one recognition rate between the multiple amino acids and the multiple recognized nucleotide pairs. Since both zinc fingers and TALEs occur in a repeated pattern, different combinations can be tried to create a variety of sequence specificities. A variety of methods for making site-specific zinc finger endonucleases include, for example, modular assembly (where multiple zinc fingers associated with a triplet sequence are linked in a row to cover the desired sequence), OPEN (low stringency selection of multiple peptide domains against multiple triplet nucleotides followed by high stringency selection of multiple peptide combinations against the final target in multiple bacterial systems), and bacterial one-hybrid screening of multiple zinc finger libraries. ZFNs can also be obtained from, for example, Sangamo Biosciences TM (Richmond, CA) Commercial Design and Acquisition.

[0242] Methods for designing and obtaining TALENs are described, for example, in Reyon et al. (Nature Biotechnology, 2012 May; 30(5):460-5), Miller et al. (Nat Biotechnol., 2011, 29:143-148), Cermak et al. (Nucleic Acids Research, 2011, 39(12):e82), and Zhang et al. (Nature Biotechnology, 2011, 29(2):149-53). A recently developed web-based program (called Mojo Hand) introduced by the Mayo Clinic is used to design multiple TAL and TALEN constructs for genome editing applications (accessible through www(dot)talendesign(dot)org). ZFNs can also be obtained from, for example, Sangamo Biosciences TM (Richmond, CA) Commercial Design and Acquisition.

[0243] The T-GEE system (Target Gene's Genome Editing Engine) - provides a programmable nucleoprotein molecular complex, which contains a polypeptide portion and a specificity conferring nucleic acid (SCNA), which is assembled in vivo in a target cell and can interact with a predetermined target nucleic acid sequence. The programmable nucleoprotein molecular complex can specifically modify and / or edit a target site within the target nucleic acid sequence and / or modify the function of the target nucleic acid sequence. The nucleoprotein composition includes (a) a polynucleotide molecule for encoding a chimeric polypeptide and includes (i) a functional domain capable of modifying the target site, and (ii) a linker domain capable of interacting with the specificity conferring nucleic acid; and (b) a specificity conferring nucleic acid (SCNA), which includes (i) a nucleotide sequence complementary to the region of the target nucleic acid on both sides of the target site, and (ii) a recognition region capable of specifically attaching to the linker domain of the polypeptide. The composition has high specificity and the ability of the molecular complex to bind to the target nucleic acid by conferring base pairing of a specific nucleic acid to a target nucleic acid, and can accurately, reliably and cost-effectively modify a predetermined nucleic acid sequence target. The composition has low genotoxicity, modular assembly, uses a single platform without customization, can be used independently outside a dedicated core facility, and has a short development cycle and low cost.

[0244] CRISPR-Cas system and all its variants (also referred to herein as "CRISPR") - Many bacteria and archea contain an endogenous RNA-based adaptive immune system that can degrade multiple nucleic acids from invading multiple phages and multiple plasmids. These systems consist of multiple clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that produce multiple RNA components and CRISPR-related (Cas) multiple genes (encoding multiple protein components). The multiple CRISPR RNAs (crRNAs) contain very short homology to the DNA of multiple specific viruses and plasmids, and guide the Cas nuclease to degrade multiple nucleic acids complementary to the corresponding pathogens. Studies of the type II CRISPR / Cas system of Streptococcus pyogenes indicate that three components form an RNA / protein complex and together are sufficient for sequence-specific nuclease activity: the Cas9 nuclease, a crRNA with 20 base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al., Science, 2012, 337:816-821).

[0245] It was further demonstrated that a synthetic chimeric guide RNA (gRNA) consisting of a fusion between crRNA and tracrRNA can direct Cas9 in vitro to shear multiple DNA targets complementary to the crRNA. It was also demonstrated that co-transient expression of Cas9 with multiple synthetic gRNAs can be used to generate targeted multiple double-strand breaks (DSBs) in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a, b; Jinek et al., 2013; Mali et al., 2013).

[0246] The CRISPR / Cas system for genome editing contains two different components: a gRNA and an endonuclease, e.g., Cas9.

[0247] The gRNA (also referred to herein as short guide RNA (sgRNA)) is typically a 20-nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA (linking the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA / Cas9 complex is recruited to the target sequence by base pairing between the gRNA sequence and the complementary genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct protospacer adjacent motif (PAM) sequence immediately following the target sequence. The binding of the gRNA / Cas9 complex positions the Cas9 on the genomic target sequence so that the Cas9 can cut both strands of the DNA, resulting in a double-strand break (DSB). Like ZFNs and TALENs, the double-strand breaks (DSBs) generated by CRISPR / Cas can undergo homologous recombination or NHEJ and are susceptible to specific sequence modifications during DNA repair.

[0248] The Cas9 nuclease has two functional domains: RuvC and HNH, each of which cuts a different DNA strand. When both of these domains are active, the Cas9 will cause multiple double-strand breaks (DSBs) in the genomic DNA.

[0249] A significant advantage of CRISPR / Cas is that the high efficiency of this system is combined with the ability to easily produce multiple synthetic gRNAs. This creates a system that can be easily modified to target multiple modifications at different genomic sites and / or target multiple different modifications at the same site. In addition, protocols have been established that can target multiple genes simultaneously. Most cells carrying the mutations have multiple biallelic mutations in the multiple targeted genes.

[0250] However, apparent flexibility in the base-pairing interaction between the gRNA sequence and the genomic DNA target sequence allows imperfect matches to the target sequence to be cleaved by Cas9.

[0251] Modified forms of the Cas9 enzyme containing a single inactive catalytic domain (RuvC- or HNH-) are called "nickases". With only one active nuclease domain, the Cas9 nickase only cuts one strand of the target DNA, creating a single-strand break or "nick". A single-strand break or nick is mostly repaired by single-strand break repair mechanisms involving proteins such as, but not limited to, PARP (sensor) and the XRCC1 / LIG III complex (ligation). If a single-strand break (SSB) is generated on naturally occurring SSBs by topoisomerase I poisons or by drug-trapping RARP1, these may persist and when the cell enters S phase and the replication fork encounters such SSBs, they will become single-ended DSBs that can only be repaired by HR. However, two proximal, opposite strand nicks introduced by a Cas9 nickase are considered a double-strand break, often in what is referred to as a "double nick" CRISPR system. A double nick, essentially a non-parallel DSB, can be repaired by HR or NHEJ like other DSBs, depending on the desired effect on the gene target and the presence of a donor sequence and the cell cycle phase (HR is less abundant and can only occur during the S and G2 phases of the cell cycle). Therefore, if specificity and reduced off-target effects are critical, using the Cas9 nickase to generate a double nick (by designing two gRNAs and multiple target sequences in close proximity and on multiple opposing strands of the genomic DNA) will reduce off-target effects, as either gRNA alone will cause a nick that is unlikely to alter the genomic DNA, even though such events are not impossible.

[0252] A modified form of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9 or dCas9) has no nuclease activity but is still able to bind to DNA based on gRNA specificity. The dCas9 can be used as a platform for multiple DNA transcription regulators to activate or inhibit gene expression by fusing the inactive enzyme to known multiple regulatory domains. For example, the binding of dCas9 alone to a target sequence in genomic DNA interferes with gene transcription.

[0253] There are many publicly available tools that can help select and / or design multiple target sequences, as well as bioinformatically determined lists of multiple unique gRNAs for different genes in different species, such as, but not limited to, Target Finder from Feng Zhang's lab, Target Finder from Michael Boutros' lab (E-CRISP), RGEN Tools: Cas-OFFinder, CasFinder: A Flexible Algorithm for Identifying Specific Cas9 Targets in the Genome, and CRISPR Optimal Target Finder.

[0254] To use the CRISPR system, both the gRNA and a Cas endonuclease (e.g., Cas9) should be expressed or present in a target cell (e.g., as a ribonucleoprotein complex). The insertion vector can contain two cassettes on a single plasmid, or the multiple cassettes are expressed by two separate plasmids. Multiple CRISPR plasmids are commercially available, for example, the px330 plasmid from Addgene (75 Sidney St, Suite 550A. Cambridge, MA 02139). Svitashev et al. (2015, Plant Physiology, 169(2):931-945), Kumar and Jain (2015, J Exp Bot, 66:47-57) and in U.S. Patent Application Publication No. 20150082478 disclose at least the use of clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) guide RNA technology and a Cas endonuclease to modify plant genomes, the contents of which are incorporated herein by reference in their entirety. Cas endonucleases that can be used for DNA editing via gRNA include, but are not limited to, Cas9, Cpf1 (Zetsche et al., 2015, Cell, 163(3):759-71), C2c1, C2c2, and C2c3 (Shmakov et al., Mol Cell., 2015 Nov 5;60(3):385-97).

[0255] According to a specific embodiment, the CRISPR comprises a short guide RNA (sgRNA) comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 4 or SEQ ID NOs: 235 to 366.

[0256] The "hit and run" or "in-out" strategy of gene targeting involves a two-step recombination procedure. In the first step, an insertion vector containing a dual positive / negative selection marker cassette is used to introduce the desired sequence changes. The insertion vector contains a single continuous region of homology to the targeted locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at a site within the homology region, introduced into the multiple cells, and positively selected to isolate homologous recombination-mediated events. The DNA carrying the homologous sequence can be provided in the form of a plasmid, single-stranded or double-stranded oligonucleotide. These homologous recombinants contain a local duplication separated by an intermediate vector sequence including the selection cassette. In the second step, multiple targeted clones are negatively selected to identify multiple cells that have lost the selection cassette by intrachromosomal recombination between the repeated sequences. The local recombination event removes the duplication and, depending on the recombination site, the allele retains the introduced mutation or reverts to wild type. The end result is the introduction of the desired modification without retaining any exogenous sequence.

[0257] "Double-replacement" or "tag and exchange" strategy: involves a two-step selection procedure, similar to the hit and run approach to gene targeting, but requires the use of two different target constructs. In the first step, a standard targeting vector with 3' and 5' homology arms is used to insert a dual positive / negative selection cassette near the location where the mutation is to be introduced. After introduction of the system components into the cells and positive selection, HR-mediated events can be identified. Next, a second targeting vector containing a region of homology to the desired mutation is introduced into multiple targeted clones, and negative selection is performed to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation while eliminating unwanted exogenous sequences.

[0258] According to a specific embodiment, the DNA editing agent includes a DNA targeting module (e.g., gRNA).

[0259] According to a specific embodiment, the DNA editing agent does not include an endonuclease.

[0260] According to a specific embodiment, the DNA editing agent includes a nuclease (e.g., an endonuclease) and a DNA targeting module (e.g., gRNA).

[0261] According to a specific embodiment, the DNA editing agent is a CRISPR / Cas, for example, gRNA and Cas9.

[0262] According to a specific embodiment, the DNA editing agent is TALEN.

[0263] According to a specific embodiment, the DNA editing agent is ZEN.

[0264] According to a specific embodiment, the DNA editing agent is a nuclease.

[0265] According to one embodiment, the DNA editing agent is linked to a reporter for monitoring expression in a plant cell.

[0266] According to one embodiment, the reporter is a fluorescent reporter protein.

[0267] The term "a fluorescent protein" refers to a polypeptide that fluoresces and is typically detected by flow cytometry, microscopy or any fluorescent imaging system, and can therefore be used as a basis for selecting cells expressing this protein.

[0268] Examples of fluorescent proteins that can be used as reporters are, but are not limited to, green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent proteins (e.g., dsRed, mCherry, RFP). A non-limiting list of fluorescent or other reporters includes proteins detected by luminescence (e.g., luciferase) or colorimetric assays (e.g., GUS). According to a specific embodiment, the fluorescent reporter is a red fluorescent protein (e.g., dsRed, mCherry, RFP) or GFP.

[0269] A review of the multiple new classes and multiple applications of various fluorescent proteins can be found in Trends in Biochemical Sciences (Rodriguez, Erik A.; Campbell, Robert E.; Lin, John Y.; Lin, Michael Z.; Miyawaki, Atsushi; Palmer, Amy E.; Shu, Xiaokun; Zhang, Jin; Tsien, Roger Y., "The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins," Trends in Biochemical Sciences, doi: 10.1016 / j.tibs.2016.09.010).

[0270] According to another embodiment, the reporter is an endogenous gene of a plant. An exemplary reporter is the phytoene desaturase gene (PDS3), which encodes one of the important enzymes in the carotenoid biosynthetic pathway, whose silencing produces an albino / bleached phenotype. Thus, plants with reduced PDS3 expression exhibit reduced chlorophyll levels, up to complete albinism and dwarfism. Other genes that can be used according to the present teachings include, but are not limited to, genes involved in crop protection. Exemplary genes are described in Table 1B below.

[0271] According to another embodiment, the reporter is an antibiotic selection marker. Examples of multiple antibiotic selection markers that can be used as multiple reporters are, but are not limited to, neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). Other multiple marker genes that can be used according to the present teachings include, but are not limited to, gentamycin acetyltransferase (accC3) resistance and bleomycin and phleomycin resistance genes.

[0272] It is understood that the enzyme NPTII inactivates many aminoglycoside antibiotics by phosphorylation, for example, kanamycin, neomycin, geneticin (or G418) and paromomycin. Among them, kanamycin, neomycin and paromomycin are used in many plant species.

[0273] According to another embodiment, the reporter is a toxic selection marker. An exemplary toxic selection marker that can be used as a reporter is, but is not limited to, allyl alcohol selection using an alcohol dehydrogenase (ADH1) gene. ADH1 includes a group of dehydrogenases that catalyze the mutual conversion between multiple alcohols and multiple aldehydes or multiple ketones and the simultaneous reduction of NAD+ or NADP+, decomposing multiple alcoholic toxic substances in multiple tissues. Multiple plants with reduced ADH1 expression show increased tolerance to allyl alcohol. Therefore, multiple plants with reduced ADH1 are resistant to the toxic effects of allyl alcohol.

[0274] Regardless of the DNA editing agent used, the method of the present invention is used so that the gene encoding the non-coding RNA molecule (e.g., RNA silencing molecule) is modified by at least one of a deletion, an insertion, or a point mutation.

[0275] According to one embodiment, the modification is in a structured region of the non-coding RNA molecule or the RNA silencing molecule.

[0276] According to one embodiment, the modification is in a stem region of the non-coding RNA molecule or the RNA silencing molecule.

[0277] According to one embodiment, the modification is in a loop region of the non-coding RNA molecule or the RNA silencing molecule.

[0278] According to one embodiment, the modification is in a stem region and a loop region of the non-coding RNA molecule or the RNA silencing molecule.

[0279] According to one embodiment, the modification is in an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

[0280] According to one embodiment, the modification is in a stem region, a loop region and an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

[0281] According to a specific embodiment, the modifications include modifications of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to natural non-coding RNA molecules, e.g., RNA silencing molecules).

[0282] According to one embodiment, the modification comprises modifications of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0283] According to one embodiment, the modification can be a continuous nucleic acid sequence (e.g., at least 5, 10, 20, 30, 40, 50, 100, 150, 200 bases).

[0284] According to one embodiment, the modification may be in a non-contiguous manner, for example, throughout a 20, 50, 100, 150, 200, 500, 1000 nucleic acid sequence.

[0285] According to a specific embodiment, the modification comprises modification of up to 200 nucleotides.

[0286] According to a specific embodiment, the modification comprises modification of up to 150 nucleotides.

[0287] According to a specific embodiment, the modification comprises modification of up to 100 nucleotides.

[0288] According to a specific embodiment, the modification comprises modification of up to 50 nucleotides.

[0289] According to a specific embodiment, the modification comprises modification of up to 25 nucleotides.

[0290] According to a specific embodiment, the modification comprises modification of up to 20 nucleotides.

[0291] According to a specific embodiment, the modification comprises modification of up to 15 nucleotides.

[0292] According to a specific embodiment, the modification comprises modification of at most 10 nucleotides.

[0293] According to a specific embodiment, the modification comprises modification of up to 5 nucleotides.

[0294] According to one embodiment, said modification depends on said structure of said RNA silencing molecule.

[0295] Therefore, when the RNA silencing molecule contains a non-essential structure (i.e., a secondary structure of the RNA silencing molecule does not play a role in its proper biogenesis and / or function), or is pure dsRNA (i.e., the RNA silencing molecule has a complete or almost complete dsRNA), some modifications (e.g., 20 to 30 nucleotides, e.g., 1 to 10 nucleotides, e.g., 5 nucleotides) are introduced to redirect the silencing specificity of the RNA silencing molecule.

[0296] According to another embodiment, when the RNA silencing molecule has an essential structure (i.e., the proper biogenesis and / or activity of the RNA silencing molecule depends on its secondary structure), multiple larger modifications (e.g., 10 to 200 nucleotides, for example, 50 to 150 nucleotides, for example, more than 30 nucleotides and not more than 200 nucleotides, 30 to 200 nucleotides, 35 to 200 nucleotides, 35 to 150 nucleotides, 35 to 100 nucleotides) are introduced to redirect the silencing specificity of the RNA silencing molecule.

[0297] According to one embodiment, the modification is such that the recognition / cleavage site / PAM motif of the RNA silencing molecule is modified to eliminate the original PAM recognition site.

[0298] According to a specific embodiment, the modification is in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acids in a PAM motif.

[0299] According to one embodiment, the modification comprises an insertion.

[0300] According to a specific embodiment, the insertion comprises an insertion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0301] According to one embodiment, the insertion comprises an insertion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0302] According to a specific embodiment, the insertion comprises an insertion of at most 200 nucleotides.

[0303] According to a specific embodiment, the insertion comprises an insertion of at most 150 nucleotides.

[0304] According to a specific embodiment, the insertion comprises an insertion of at most 100 nucleotides.

[0305] According to a specific embodiment, the insertion comprises an insertion of at most 50 nucleotides.

[0306] According to a specific embodiment, the insertion comprises an insertion of at most 25 nucleotides.

[0307] According to a specific embodiment, the insertion comprises an insertion of at most 20 nucleotides.

[0308] According to a specific embodiment, the insertion comprises an insertion of at most 15 nucleotides.

[0309] According to a specific embodiment, the insertion comprises an insertion of at most 10 nucleotides.

[0310] According to a specific embodiment, the insertion comprises an insertion of at most 5 nucleotides.

[0311] According to one embodiment, the modification comprises a deletion.

[0312] According to a specific embodiment, the deletion includes a deletion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0313] According to one embodiment, the deletion comprises a deletion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0314] According to a specific embodiment, the deletion comprises a deletion of at most 200 nucleotides.

[0315] According to a specific embodiment, the deletion comprises a deletion of at most 150 nucleotides.

[0316] According to a specific embodiment, the deletion comprises a deletion of at most 100 nucleotides.

[0317] According to a specific embodiment, the deletion comprises a deletion of at most 50 nucleotides.

[0318] According to a specific embodiment, the deletion comprises a deletion of at most 25 nucleotides.

[0319] According to a specific embodiment, the deletion comprises a deletion of at most 20 nucleotides.

[0320] According to a specific embodiment, the deletion comprises a deletion of at most 15 nucleotides.

[0321] According to a specific embodiment, the deletion comprises a deletion of at most 10 nucleotides.

[0322] According to a specific embodiment, the deletion comprises a deletion of at most 5 nucleotides.

[0323] According to one embodiment, the modification comprises a point mutation.

[0324] According to a specific embodiment, the point mutations include point mutations of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to natural non-coding RNA molecules, for example, RNA silencing molecules).

[0325] According to one embodiment, the point mutations include point mutations of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0326] According to a specific embodiment, the point mutation comprises a point mutation of at most 200 nucleotides.

[0327] According to a specific embodiment, the point mutation comprises a point mutation of at most 150 nucleotides.

[0328] According to a specific embodiment, the point mutation comprises a point mutation of at most 100 nucleotides.

[0329] According to a specific embodiment, the point mutation comprises a point mutation of at most 50 nucleotides.

[0330] According to a specific embodiment, the point mutation comprises a point mutation of at most 25 nucleotides.

[0331] According to a specific embodiment, the point mutation comprises a point mutation of at most 20 nucleotides.

[0332] According to a specific embodiment, the point mutation comprises a point mutation of at most 15 nucleotides.

[0333] According to a specific embodiment, the point mutation comprises a point mutation of at most 10 nucleotides.

[0334] According to a specific embodiment, the point mutation comprises a point mutation of at most 5 nucleotides.

[0335] According to one embodiment, the modification comprises a combination of any one of a deletion, an insertion and / or a point mutation.

[0336] According to one embodiment, the modification comprises a nucleotide replacement (eg, nucleotide swapping).

[0337] According to a specific embodiment, the exchange comprises exchanging about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0338] According to one embodiment, the nucleotide exchange comprises nucleotide replacement of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0339] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 200 nucleotides.

[0340] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 150 nucleotides.

[0341] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 100 nucleotides.

[0342] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 50 nucleotides.

[0343] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 25 nucleotides.

[0344] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 20 nucleotides.

[0345] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 15 nucleotides.

[0346] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 10 nucleotides.

[0347] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 5 nucleotides.

[0348] According to one embodiment, the gene encoding the non-coding RNA molecule (eg, RNA silencing molecule) is modified by exchanging a sequence of an endogenous RNA silencing molecule (eg, miRNA) with a selected RNA silencing sequence (eg, siRNA).

[0349] According to a specific embodiment, the sequence of an siRNA for gene exchange of an endogenous RNA silencing molecule (eg, miRNA) comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5-12 or SEQ ID NOs: 103-234.

[0350] According to one embodiment, the guide strand of the non-coding RNA molecule (e.g., RNA silencing molecule, e.g., multiple miRNA precursors (pri / pre-miRNA) or multiple siRNA precursors (dsRNA)) is modified to retain structural originality and maintain the same base pairing profile.

[0351] According to one embodiment, the passenger strand of the non-coding RNA molecule (e.g., an RNA silencing molecule, e.g., multiple miRNA precursors (pri / pre-miRNA) or multiple siRNA precursors (dsRNA)) is modified to retain structural originality and maintain the same base pairing profile.

[0352] As used herein, the term "structural originality" refers to the secondary RNA structure (i.e., base pairing shape). Maintaining the originality of the structure is very important for the correct and efficient biogenesis / processing of the non-coding RNA (e.g., RNA silencing molecules, e.g., siRNA or miRNA), which is structure-dependent rather than purely sequence-dependent.

[0353] According to one embodiment, the non-coding RNA (e.g., RNA silencing molecule) is modified in the guide strand (silencing strand) so that it has about 50 to 100% complementarity with the target RNA (as described above), while the passenger strand is modified to retain the original (unmodified) non-coding RNA structure.

[0354] According to one embodiment, the non-coding RNA (eg, RNA silencing molecule) is modified such that the seed sequence (eg, for miRNA nucleotides 2 to 8 from the 5' end) is complementary to the target sequence.

[0355] According to a specific embodiment, the RNA silencing molecule (ie, RNAi molecule) is designed such that a sequence of the RNAi molecule is modified to retain structural originality and to be recognized by cellular RNAi processing and multiple executing factors.

[0356] According to a specific embodiment, the non-coding RNA molecule (ie, rRNA, tRNA, lncRNA, snoRNA, etc.) is designed so that a sequence of the RNAi molecule is modified to be recognized by cellular RNAi processing and multiple execution factors.

[0357] The DNA editing agents of the present invention can be introduced into multiple plant cells using multiple DNA delivery methods (e.g., via multiple expression vectors) or using multiple DNA-free methods.

[0358] According to one embodiment, the gRNA (or any other DNA recognition module used, depending on the DNA editing system used) can be provided to the cell as RNA.

[0359] Thus, it should be understood that the present technology involves the use of multiple transient DNA or DNA-free methods to introduce the DNA editing agent, for example, RNA transfection (e.g., mRNA+gRNA transfection) or ribonucleoprotein (RNP) transfection (e.g., protein-RNA complex transfection, e.g., Cas9 / gRNA ribonucleoprotein (RNP) complex transfection).

[0360] For example, Cas9 can be introduced as a DNA expression plasmid, an in vitro transcript (ie, RNA), or as a recombinant protein bound to the RNA portion in a ribonucleoprotein particle (RNP). gRNA can be delivered, for example, as a DNA plasmid or an in vitro transcript (ie, RNA).

[0361] According to the present teachings, any method known in the art for RNA or RNP transfection can be used, such as, but not limited to, microinjection (as described by Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins," Genetics, 2013, 195: 1177-1180, incorporated herein by reference), electroporation (as described by Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins," Genome Res., 2014, 24: 1012-1019, incorporated herein by reference), or lipid-mediated transfection, for example, using liposomes (as described by Zuris et al., "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo", Nat Biotechnol., 2014, doi: 10.1038 / nbt.3081, incorporated herein by reference). Other multiple methods of RNA transfection are described in U.S. Patent Application No. 20160289675, the entire contents of which are incorporated herein by reference.

[0362] An advantage of the multiple RNA transfection method of the present invention is that RNA transfection is essentially transient and vector-free. An RNA transgene can be delivered to a cell as a minimal expression cassette and expressed therein without the need for any other sequences (e.g., multiple viral sequences).

[0363] According to one embodiment, the DNA editing agent of the present invention is introduced into the plant cell using multiple expression vectors.

[0364] The "expression vector" (also referred to herein as "a nucleic acid construct", "vector" or "construct") of some embodiments of the present invention comprises a plurality of additional sequences that provide the vector with suitability for replication in prokaryotes, eukaryotes or preferably both (e.g., a shuttle vector).

[0365] A plurality of constructs useful in the methods according to some embodiments of the present invention can be constructed using recombinant DNA techniques well known to those skilled in the art. The plurality of nucleic acid sequences can be inserted into a plurality of vectors, which can be commercially available, suitable for conversion into a plurality of plants and suitable for transiently expressing the gene of interest in a plurality of transformed cells. The genetic construct can be an expression vector, wherein the nucleic acid sequence is operably linked to one or more regulatory sequences, thereby allowing expression in the plurality of plant cells.

[0366] According to one embodiment, in order to express a functional DNA editing agent, in the case where the cleaving module (nuclease) is not a component of the DNA recognition unit, the expression vector can be used to encode the cleaving module and the DNA recognition unit (e.g., gRNA in the case of CRISPR / Cas).

[0367] Alternatively, the shearing module (nuclease) and the DNA recognition unit (e.g., gRNA) can be cloned into multiple separate expression vectors. In this case, at least two different expression vectors must be transformed into the same plant cell.

[0368] Alternatively, when a nuclease is not used (ie, not applied to the cells from an exogenous source), a single expression vector can be used to clone and express the DNA recognition element (eg, gRNA).

[0369] Typical expression vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator, and optionally a polyadenylation signal.

[0370] According to one embodiment, the DNA editing agent includes a nucleic acid agent encoding at least one DNA recognition unit (e.g., gRNA), which is operatively linked to a cis-acting regulatory element (e.g., a promoter) that is active in multiple plant cells.

[0371] According to one embodiment, the nuclease (e.g., endonuclease) and the DNA recognition unit (e.g., gRNA) are encoded from the same expression vector. Such a vector may include a single cis-acting regulatory element (e.g., promoter) active in multiple plant cells for expression of both the nuclease and the DNA recognition unit. Alternatively, the nuclease and the DNA recognition unit may each be operably linked to a cis-acting regulatory element (e.g., promoter) active in multiple plant cells.

[0372] According to one embodiment, the nuclease (e.g., endonuclease) and the DNA recognition unit (e.g., gRNA) are encoded from different expression vectors, wherein each expression vector is operably linked to a cis-acting regulatory element (e.g., promoter) that is active in multiple plant cells.

[0373] As used herein, the phrase "plant expressible" or "active in multiple plant cells" refers to a promoter sequence, including any other regulatory elements added thereto or contained therein, which is at least capable of inducing, conferring, activating or enhancing expression in a plant cell, tissue or organ, preferably a monocotyledonous or dicotyledonous plant cell, tissue or organ.

[0374] The plant promoter used can be a constitutive promoter, a tissue-specific promoter, an inducible promoter, a chimeric promoter or a developmentally regulated promoter.

[0375] Examples of preferred promoters useful for the methods of some embodiments of the invention are shown in Tables I, II, III, and IV.

[0376] Table I: Various exemplary constitutive promoters useful in practicing some embodiments of the invention

[0377]

[0378]

[0379] Table II: Various exemplary seed-preferred promoters useful in practicing some embodiments of the invention

[0380]

[0381]

[0382] Table III: Various exemplary flower-specific promoters useful in practicing the present invention

[0383]

[0384] Table IV: Various alternative rice promoters useful in practicing the present invention

[0385]

[0386]

[0387]

[0388] The inducible promoter is a promoter that is induced in a specific plant tissue by a developmental stage or by a specific stimulus (e.g., multiple stress conditions, including, for example, light, temperature, chemicals, drought, high salt, osmotic shock, oxidant conditions, or in the case of pathogenicity), and includes but is not limited to the light-inducible promoter from the pea rbcS gene, the promoter from the alfalfa rbcS gene, multiple promoters active in drought DRE, MYC and MYB; multiple promoters active in high salt and osmotic stress INT, INPS, prxEa, Ha hsp17.7G4 and RD21, and multiple promoters active under pathogenic stress hsr203J and str246C.

[0389] According to one embodiment, the promoter is a pathogen-inducible promoter. These promoters direct the expression of multiple genes in multiple plants after infection with a pathogen (e.g., bacteria, fungi, viruses, nematodes, and insects). Such promoters include promoters from multiple pathogenesis-related proteins (PR proteins) that are induced after infection by a pathogen; for example, multiple PR proteins, multiple SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et al., 1983, Neth. J. Plant Pathol., 89: 245-254; Uknes et al., 1992, Plant Cell, 4: 645-656; and Van Loon, 1985, Plant Mol. Virol., 4: 111-116.

[0390] According to one embodiment, when more than one promoter is used in the expression vector, the multiple promoters are identical (eg, all identical, at least two identical).

[0391] According to one embodiment, when more than one promoter is used in the expression vector, the multiple promoters are different (eg, at least two are different, all are different).

[0392] According to one embodiment, the promoter in the expression vector includes but is not limited to CaMV 35S, 2xCaMV 35S, CaMV 19S, ubiquitin, AtU626 or TaU6.

[0393] According to a specific embodiment, the promoter in the expression vector comprises a 35S promoter.

[0394] According to a specific embodiment, the promoter in the expression vector includes a U6 promoter.

[0395] Expression vectors may also include multiple transcription and translation initiation sequences, multiple transcription and translation termination sequences, and optionally a polyadenylation signal.

[0396] According to a specific embodiment, the expression vector comprises a termination sequence, such as but not limited to, a G7 termination sequence, an AtuNos termination sequence or a CaMV-35S termination sequence.

[0397] Plant cells can be stably or transiently transformed with the nucleic acid constructs of some embodiments of the invention. In stable transformation, the nucleic acid molecule of some embodiments of the invention is integrated into the plant genome, thus representing a stable and heritable trait. In transient transformation, the nucleic acid molecule is expressed by the transformed cells but is not integrated into the genome, thus representing a transient trait.

[0398] There are many methods for introducing multiple foreign genes into monocotyledonous and dicotyledonous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol., 1991, 42: 205-225; Shimamoto et al., Nature, 1989, 338: 274-276).

[0399] There are two main approaches to stably integrate foreign DNA into plant genomic DNA:

[0400] (i) Agrobacterium-mediated gene transfer: Klee et al., 1987, Annu. Rev. Plant Physiol., 38: 467-486; Klee and Rogers, in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, Schell, J. and Vasil, L. K., eds., Academic Publishers, San Diego, California, 1989, pp. 2-25; Gatenby, in Plant Biotechnology, Kung, S. and Arntzen, C. J., eds., Butterworth Publishers, Boston, Massachusetts, 1989, pp. 93-112.

[0401] (ii) Direct DNA uptake: Paszkowski et al., Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, Schell, J. and Vasil, LK, eds., Academic Publishers, San Diego, CA, 1989, pp. 52-68; including methods for direct DNA uptake into protoplasts, Toriyama, K. et al., 1988, Bio / Technology, 6: 1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al., Plant Cell Rep., 1988, 7: 379-384. Fromm et al., Nature, 1986, 319: 791-793.DNA is introduced into plant cells or tissues by particle bombardment: Klein et al., Bio / Technology, 1988, 6:559-563; McCabe et al., Bio / Technology, 1988, 6:923-926; Sanford, Physiol. Plant, 1990, 79:206-209; by using a micropipette system: Neuhaus et al., Theor. Appl. Genet., 1987, 75:30-36; Neuhaus and Spangenberg, Physiol. Plant, 1990, 79:213-217; U.S. Pat. No. 5,464,765: glass fibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissue), or by incubating DNA directly with germinating pollen, DeWet et al., Experimental Manipulation of Ovule Tissue, Chapman, GP, Mantell, SH, and Daniels, W., eds., Longman, London, 1985, pp. 197-209; and Ohta, Proc. Natl. Acad. Sci., USA, 1986, 83: 715-719.

[0402] The Agrobacterium system comprises the use of multiple plasmid vectors containing multiple DNA fragments defined in the plant genomic DNA. Multiple inoculation methods of the plant tissue vary according to multiple plant species and the Agrobacterium delivery system. A widely used method is the leaf disc method, which can be performed with any tissue explant, which provides a good source for starting the differentiation of the whole plant. Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht, 1988, pp. 1 to 9. A secondary method is to use the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is particularly effective in creating transgenic dicotyledons.

[0403] According to one embodiment, an Agrobacterium-free expression method is used to introduce multiple exogenous genes into multiple plant cells. According to one embodiment, the Agrobacterium-free expression method is transient. According to a specific embodiment, a bombardment method is used to introduce multiple exogenous genes into multiple plant cells. According to another specific embodiment, bombardment of plant roots is used to introduce multiple exogenous genes into multiple plant cells. An exemplary bombardment method that can be used according to some embodiments of the present invention is discussed in the Examples section below.

[0404] In addition, according to the teachings of some embodiments of the present invention, various cloning kits or gene synthesis may be used.

[0405] According to one embodiment, the nucleic acid construct is a binary vector. Examples of binary vectors are pBIN19, pBI101, pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen or pPZP (Hajukiewicz, P. et al., Plant Mol. Biol., 25, 989, 1994, and Hellens et al., Trends in Plant Science, 5, 446, 2000).

[0406] Examples of other vectors used in other DNA delivery methods (e.g., transfection, electroporation, bombardment, viral inoculation as described below) are: pGE-sgRNA (Zhang et al., Nat. Comms., 2016, 7: 12697), pJIT163-Ubi-Cas9 (Wang et al., Nat. Biotechnol., 2004, 32, 947-951), pICH47742:2x35S-5'UTR-hCas9(STOP)-NOST (Belhan et al., Plant Methods, 2013, 11;9(1):39), pAHC25 (Christensen, AH and PH Quail, 1996, Ubiquitin promoter-based vectors for high-level expression of selectable and / or screenable marker genes in monocots in monocotyledonous plants), Transgenic Research, 5: 213-218), pHBT-sGFP(S65T)-NOS (Sheen et al., Protein phosphatase activity is required for light-induced gene expression in maize, EMBO J., 12(9), 3497-3505, 1993).

[0407] According to one embodiment, the method of some embodiments of the present invention further comprises introducing a plurality of donor oligonucleotides into the plant cell.

[0408] According to one embodiment, when the modification is an insertion, the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.

[0409] According to one embodiment, when the modification is a deletion, the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.

[0410] According to one embodiment, when the modification is a deletion and an insertion (eg, an exchange), the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.

[0411] According to one embodiment, when the modification is a point mutation, the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.

[0412] As used herein, the term "donor oligonucleotides" or "donor oligonucleotides" refers to exogenous nucleotides, i.e., introduced from the outside into the plant cell to produce a precise change in the genome. According to one embodiment, the donor oligonucleotides are synthetic.

[0413] According to one embodiment, the plurality of donor oligonucleotides is a plurality of RNA oligonucleotides.

[0414] According to one embodiment, the plurality of donor oligonucleotides is a plurality of DNA oligonucleotides.

[0415] According to one embodiment, the plurality of donor oligonucleotides is a plurality of synthetic oligonucleotides.

[0416] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of single-stranded donor oligonucleotides (ssODNs).

[0417] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded donor oligonucleotides (dsODNs).

[0418] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded DNAs (dsDNAs).

[0419] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded DNA-RNA duplexes (DNA-RNA duplexes).

[0420] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded DNA-RNA hybrids.

[0421] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of single-stranded DNA-RNA hybrids.

[0422] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of single-stranded DNAs (ssDNAs).

[0423] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded RNA (dsRNA).

[0424] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of single-stranded RNA (ssRNA).

[0425] According to one embodiment, said plurality of donor oligonucleotides comprises said DNA or RNA sequence for exchange (as described above).

[0426] According to one embodiment, the plurality of donor oligonucleotides are provided in the form of a non-expression vector or oligonucleotides.

[0427] According to one embodiment, the plurality of donor oligonucleotides comprises a DNA donor plasmid (eg, a circular or linear plasmid).

[0428] According to one embodiment, the plurality of donor oligonucleotides comprises about 50 to 5000, about 100 to 5000, about 250 to 5000, about 500 to 5000, about 750 to 5000, about 1000 to 5000, about 1500 to 5000, about 2000 to 5000, about 2500 to 5000, about 3000 to 5000, about 4000 to 5000, about 5 .... 4000, about 100 to 4000, about 250 to 4000, about 500 to 4000, about 750 to 4000, about 1000 to 4000, about 1500 to 4000, about 2000 to 4000, about 2500 to 4000, about 3000 to 4000, about 50 to 3000, about 100 to 3000, about 250 to 3000, about 500 to 300 0, about 750 to 3000, about 1000 to 3000, about 1500 to 3000, about 2000 to 3000, about 50 to 2000, about 100 to 2000, about 250 to 2000, about 500 to 2000, about 750 to 2000, about 1000 to 2000, about 1500 to 2000, about 50 to 1000, about 100 to 1000, about between 250 and 1000, about 500 and 1000, about 750 and 1000, about 50 and 750, about 150 and 750, about 250 and 750, about 500 and 750, about 50 and 500, about 150 and 500, about 200 and 500, about 250 and 500, about 350 and 500, about 50 and 250, about 150 and 250, or about 200 to 250 nucleotides.

[0429] According to a specific embodiment, the plurality of donor oligonucleotides comprising the ssODN (eg, ssDNA or ssRNA) comprises about 200 to 500 nucleotides.

[0430] According to a specific embodiment, the plurality of donor oligonucleotides comprising the dsODN (eg, dsDNA or dsRNA) comprises about 250 to 5000 nucleotides.

[0431] According to one embodiment, for gene exchange of an endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA), the expression vector, ssODN (e.g., ssDNA or ssRNA) or dsODN (e.g., dsDNA or dsRNA) does not need to be expressed in a plant cell and can serve as a non-expression template. According to a specific embodiment, in this case, if provided in a DNA form, only the DNA editing agent (e.g., multiple Cas9 / sgRNA modules) need to be expressed.

[0432] According to some embodiments, for gene editing of an endogenous non-coding RNA molecule (e.g., an RNA silencing molecule) without the use of a nuclease, the DNA editing agent (e.g., gRNA) can be introduced into the eukaryotic cell with or without, for example, an oligonucleotide donor DNA or RNA (as described herein).

[0433] According to one embodiment, a plurality of donor oligonucleotides are introduced into the plant cell using any of the methods described above (eg, using the expression vector or RNP transfection).

[0434] According to one embodiment, the gRNA and the plurality of DNA donor oligonucleotides are co-introduced into the plant cell (eg, by bombardment). It should be understood that any other factors (eg, nucleases) may be co-introduced therewith.

[0435] According to one embodiment, the gRNA is introduced into the plant cell before the multiple DNA donor oligonucleotides (e.g., within a few minutes or hours). It should be understood that any other factors (e.g., nucleases) can be introduced before, at the same time, or after the gRNA or the multiple DNA donor oligonucleotides.

[0436] According to one embodiment, the gRNA is introduced into the plant cell after the multiple DNA donor oligonucleotides (e.g., within a few minutes or hours). It should be understood that any other factors (e.g., nucleases) can be introduced before, simultaneously or after the gRNA or the multiple DNA donor oligonucleotides.

[0437] According to one embodiment, a composition is provided, which includes at least one gRNA and multiple DNA donor oligonucleotides for genome editing.

[0438] According to one embodiment, a composition is provided that includes at least one gRNA for genome editing, a nuclease (e.g., an endonuclease), and a plurality of DNA donor oligonucleotides.

[0439] There are a variety of methods to transfer DNA directly into plant cells, and the skilled artisan will know which method to choose. In electroporation, the protoplasts are briefly exposed to a strong electric field. In microinjection, the DNA is mechanically injected directly into the cells using a very small micropipette. In microparticle bombardment, the DNA is adsorbed onto microparticles, e.g., magnesium sulfate crystals or gold or tungsten microparticles, and the microparticles are physically accelerated into protoplasts, cells, or plant tissues.

[0440] Thus, in various embodiments of the present invention, delivery of multiple nucleic acids can be introduced into a plant cell by any method known to those skilled in the art, including, but not limited to: by transformation of multiple protoplasts (see, for example, U.S. Pat. No. 5,508,184); by desiccation / inhibition-mediated DNA uptake (see, for example, Potrykus et al., 1985, Mol. Gen. Genet., 199: 183-8); by electroporation (see, for example, U.S. Pat. No. 5,384,253); by agitation with multiple silicon carbide fibers (see, for example, U.S. Pat. Nos. 5,302,523 and 5,464,765); by Agrobacterium-mediated transformation (see, for example, U.S. Pat. Nos. 5,5 63,055, 5,591,616, 5,693,512, 5,824,877, 5,981,840 and 6,384,301); by accelerating multiple DNA-coated particles (see, for example, U.S. Pat. Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861 and 6,403,865), and by multiple nanoparticles, multiple nanocarriers and multiple cell penetrating peptides (WO201126644A2; WO2009046384A1; WO2008148223A1).

[0441] Other transfection methods include the use of multiple transfection reagents (e.g., Lipofectin, ThermoFisher), multiple dendrimers (Kukowska-Latallo, JF et al., 1996, Proc. Natl. Acad. Sci. USA, 93, 4897-1902), multiple cell penetrating peptides ( et al., 2005, Internalisation of cell-penetrating peptides into tobacco protoplasts, Biochimica et Biophysica Acta, 1669(2): 101-7) or multiple polyamines (Zhang and Vinogradov, 2010, Short biodegradable polyamines for gene delivery and transfection of brain capillary endothelial cells, J Control Release, 143(3): 359-366).

[0442] According to a specific embodiment, the method of introducing DNA into a plurality of plant cells (e.g., a plurality of protoplasts) comprises polyethylene glycol (PEG)-mediated DNA uptake. For more details, see Karesch et al. (1991, Plant Cell Rep., 9: 575-578); Mathur et al. (1995, Plant Cell Rep., 14: 221-226); Negrutiu et al. (1987, Plant Cell Mol. Biol., 8: 363-373). The plurality of plant cells (e.g., a plurality of protoplasts) are then cultured under conditions that allow them to grow multiple cell walls, begin to divide to form a callus, develop multiple shoots and multiple roots, and regenerate the entire plant.

[0443] After stable transformation, plant propagation is performed. The most common method of plant propagation is through seeds. However, the disadvantage of regeneration through seed propagation is that there is a lack of uniformity in the crop due to heterozygosity, because multiple seeds are produced by multiple plants according to multiple genetic variations governed by Mendel's rules. Basically, each seed is genetically different, and each has its own specific traits. Therefore, it is preferred to produce transformed plants so that the regenerated plants have the same traits and characteristics as the parent transgenic plants. Therefore, it is preferred to regenerate the transformed plants through micropropagation, which provides a rapid and consistent reproduction of genetically identical transformed plants.

[0444] Micropropagation is the process of growing multiple new generations of plants from a single piece of tissue excised from a selected parent plant or variety. This process allows for the mass propagation of multiple plants with desired traits. Multiple newly produced plants are genetically identical to the original plant and have all the characteristics of the original plant. Micropropagation (or cloning) can produce high-quality plant material in large quantities in a short period of time and provides a rapid propagation of multiple selected varieties while retaining the characteristics of the original transgenic or transformed plant. The advantages of multiple cloned plants are the speed of plant propagation and the quality and uniformity of the multiple produced plants.

[0445] Micropropagation is a multi-stage procedure that requires changing culture media or growth conditions between multiple stages. Therefore, the micropropagation process includes four basic stages: the first stage, initial tissue culture; the second stage, tissue culture propagation; the third stage, differentiation and plant formation; and the fourth stage, greenhouse culture and hardening. During the first stage (initial tissue culture), the tissue culture is established and proven to be non-contamination. During the second stage, the initial tissue culture is propagated until a sufficient number of tissue samples are produced to meet production goals. During the third stage, the multiple tissue samples grown in the second stage are separated and grown into multiple individual plants. During the fourth stage, multiple transformed plants are transferred to a greenhouse for hardening, where the plant's tolerance to light gradually increases so that it can grow in a natural environment.

[0446] Although stable transformation is presently preferred, some embodiments of the invention also contemplate transient transformation of multiple leaf cells, multiple meristematic cells, or the entire plant.

[0447] Transient transformation can be achieved by any of the direct DNA transfer methods described above or by viral infection using a variety of modified plant viruses.

[0448] Several viruses that have been shown to be useful for transformation of various plant hosts include CaMV, TMV, TRV, and BV. Transformation of various plants using various plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Laid-Open Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al. (Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, NY, pp. 172-189, 1988). Pseudovirus particles for expressing foreign DNA in many hosts including plants are described in WO 87 / 06261.

[0449] The construction of multiple plant RNA viruses for introducing and expressing multiple non-viral exogenous nucleic acid sequences in multiple plants was demonstrated by the above references and by Dawson, WO et al. (Virology, 1989, 172: 285-292; Takamatsu et al. (EMBO J., 1987, 6: 307-311); French et al. (Science, 1986, 231: 1294-1297); and Takamatsu et al. (FEBS Letters, 1990, 269: 73-76).

[0450] When the virus is a DNA virus, the virus itself can be appropriately modified. Alternatively, the virus can first be cloned into a bacterial plasmid to facilitate the construction of the desired viral vector with the exogenous DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA and then replicated by the bacteria. Transcription and translation of this DNA will produce coat proteins that will encapsidate the viral DNA. If the virus is an RNA virus, the virus is usually cloned as an eDNA and inserted into a plasmid. The plasmid is then used to make all the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid, and translating the multiple viral genes to produce the (multiple) coat proteins that encapsidate the viral RNA.

[0451] The construction of multiple plant RNA viruses for introducing and expressing multiple non-viral exogenous nucleic acid sequences (eg, sequences included in the constructs of some embodiments of the present invention) in multiple plants is demonstrated by the above references and in U.S. Pat. No. 5,828,514.

[0452] In one embodiment, a plant viral nucleic acid is provided, wherein the natural coat protein coding sequence has been deleted from a viral nucleic acid, a non-natural plant viral coat protein coding sequence and a non-natural promoter (preferably a subgenomic promoter of the non-natural viral coat protein coding sequence) have been inserted, which can express and package the recombinant plant viral nucleic acid in the plant host and ensure that the host is infected by a system of the recombinant plant viral nucleic acid. Alternatively, the coat protein gene can be inactivated by inserting the non-natural nucleic acid sequence therein, thereby producing a protein. The recombinant plant viral nucleic acid may contain one or more other non-natural subgenomic promoters. Each non-natural subgenomic promoter is capable of transcribing or expressing multiple adjacent genes or nucleic acid sequences in the plant host, and cannot recombine with each other or with multiple natural subgenomic promoters. If more than one nucleic acid sequence is included, multiple non-natural (exogenous) nucleic acid sequences can be inserted near the natural plant viral subgenomic promoter or the natural plant viral subgenomic and a non-natural plant viral subgenomic promoter. The multiple non-natural nucleic acid sequences are transcribed or expressed in the host plant under the control of the subgenomic promoter to produce multiple desired products.

[0453] In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment, except that the native coat protein coding sequence is placed adjacent to one of the plurality of non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.

[0454] In a third embodiment, a recombinant plant viral nucleic acid is provided, wherein the native coat protein gene is adjacent to its subgenomic promoter, and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The multiple inserted non-native subgenomic promoters are capable of transcribing or expressing multiple adjacent genes in a plant host and are incapable of recombining with each other or with multiple native subgenomic promoters. Multiple non-native nucleic acid sequences can be inserted near the multiple non-native subgenomic plant viral promoters such that the multiple sequences are transcribed or expressed in the host plant under the control of the multiple subgenomic promoters to produce multiple desired products.

[0455] In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment, except that the native coat protein encoding sequence is replaced by a non-native coat protein encoding sequence.

[0456] The multiple viral vectors are encoded by the recombinant plant viral nucleic acid and embedded by the multiple coat proteins to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect multiple suitable host plants. The recombinant plant viral nucleic acid can replicate in the host, propagate systemically in the host, and transcribe or express (multiple) exogenous genes (isolated nucleic acids) in the host to produce the desired protein.

[0457] In addition to the above, the nucleic acid molecules of some embodiments of the present invention can also be introduced into a chlorophyll genome, thereby enabling the expression of chlorophyll.

[0458] The technology of introducing multiple exogenous nucleic acid sequences into the genome of the chlorophyll is known. This technology includes the following multiple steps. First, multiple plant cells are chemically treated to reduce the number of chlorophyll per cell to about one. Then, the exogenous nucleic acid is introduced into the multiple cells by particle bombardment, with the purpose of introducing at least one exogenous nucleic acid molecule into the multiple chlorophylls. The exogenous nucleic acid is selected so that it is integrated into the genome of the chlorophyll by homologous recombination, and the homologous recombination is easily affected by multiple enzymes inherent to the chlorophyll. For this reason, the exogenous nucleic acid, in addition to comprising a gene of interest, also comprises at least one nucleic acid fragment (stretch) derived from the genome of the chlorophyll. In addition, the exogenous nucleic acid comprises a selectable marker, which determines by multiple sequential selection steps that all or substantially all copies of the multiple chlorophyll genomes after such selection will contain the exogenous nucleic acid. More details related to this technology can be found in U.S. Patent Nos. 4,945,050 and 5,693,507, which are incorporated herein by reference. Therefore, a polypeptide can be produced by the protein expression system of the chlorophyll and integrated into the inner membrane of the chlorophyll.

[0459] Regardless of the transformation / infection method employed, the present teachings further provide for selecting for a plurality of transformed cells that comprise a genome editing event.

[0460] According to a specific embodiment, selection is performed so that only cells that include a successful and accurate modification (e.g., exchange, insertion, deletion, point mutation) in the specific locus are selected. Thus, cells that include any event that includes a modification (e.g., an insertion, deletion, point mutation) in an unintended locus are not selected.

[0461] According to one embodiment, selection of multiple modified cells can be performed at the phenotypic level by detecting a molecular event, by detecting a fluorescent reporter, or by growing in the presence of a selection agent (e.g., an antibiotic).

[0462] According to one embodiment, the selection of multiple modified cells is performed by analyzing the biogenesis and occurrence of newly edited non-coding RNA molecules (e.g., the presence of new miRNA forms, the presence of newly edited siRNAs, piRNAs, tasiRNAs, etc.).

[0463] According to one embodiment, selection of a plurality of modified cells is performed by analyzing the silencing activity and / or specificity of the non-coding RNA molecule (e.g., RNA silencing molecule) against a second target RNA or a target RNA of interest (by verifying at least one phenotype encoding the target RNA in the plant or organism), such as plant leaf coloration, e.g., partial or complete loss of chlorophyll in leaves and other organs (bleaching), presence / absence of necrotic patterns (nacrotic patterns), flower color, fruit traits (e.g., shelf life, firmness, and flavor), growth rate, plant size (e.g., dwarfing), crop yield, biotic stress tolerance (e.g., disease resistance, nematode mortality, beetle egg laying rate or other resistance phenotypes associated with bacteria, viruses, fungi, parasites, insects, weeds, and cultivated or native plants), abiotic stress tolerance (e.g., heat / cold tolerance, drought tolerance, salt tolerance, hydroxyl tolerance, or nutrient (e.g., phosphorus (P)) deficiency tolerance).

[0464] According to one embodiment, the silencing specificity of the non-coding RNA molecule is determined genotypically, for example, by the expression or lack of expression of a gene.

[0465] According to one embodiment, the silencing specificity of the non-coding RNA molecule is determined phenotypically.

[0466] According to one embodiment, a phenotype of the plant is determined prior to a genotype.

[0467] According to one embodiment, a genotype of the plant is determined prior to a phenotype.

[0468] According to one embodiment, the selection of a plurality of modified cells is performed by analyzing the silencing activity and / or specificity of the non-coding RNA molecule (e.g., RNA silencing molecule) against a second target RNA or a target RNA of interest (by measuring an RNA level of the second target RNA or a target RNA of interest). This can be performed using any method known in the art, for example, by Northern blot, nuclease protection assay, in situ hybridization, or quantitative RT-PCR.

[0469] According to one embodiment, selection of multiple modified cells is performed by analyzing multiple plant cells or multiple clones comprising the DNA editing event, which is also referred to herein as a "mutation" or "editing", depending on the type of editing sought, for example, insertion, deletion, insertion-deletion (Indel), inversion, substitution, and combinations thereof.

[0470] Methods for detecting sequence changes are well known in the art and include, but are not limited to, DNA and RNA sequencing (e.g., next generation sequencing), electrophoresis, an enzyme-based mismatch detection assay, and a hybridization assay, such as PCR, RT-PCR, RNase protection, in situ hybridization, primer extension, Southern blotting, Northern blotting, and dot blot analysis. Various methods for detecting single nucleotide polymorphisms (SNPs) may also be used, such as PCR-based T7 endonuclease, Hetroduplex and Sanger sequencing, or PCR followed by restriction digest to detect the presence or absence of unique restriction site(s).

[0471] Another method of verifying the presence of a DNA editing event (eg, an insertion or deletion (Indel)) includes a mismatch cleavage assay, which utilizes a structure-selective enzyme (eg, an endonuclease) that recognizes and cleaves mismatched DNA.

[0472] According to one embodiment, multiple transformed cells are selected by flow cytometry (FACS), and the flow cytometry selects multiple transformed cells that exhibit fluorescence (emitted by the fluorescent reporter). After FACS sorting, multiple transformed plant cell populations selected positively are collected, which display the fluorescent marker, and an aliquot can be used to test DNA editing events as described above.

[0473] In the case of using antibiotic selection markers, after transformation, multiple plant cell clones are cultured in the presence of selection (e.g., antibiotics) until they develop into multiple colonies (colony), i.e., multiple clones and multiple micro-calli (micro-calli). As described above, a portion of the cells of the callus are then analyzed (verified) for the DNA editing event.

[0474] Therefore, according to one embodiment of the present invention, the method further comprises verifying the complementarity of the endogenous non-coding RNA molecule (eg, RNA silencing molecule) to the second target RNA in the plurality of transformed cells.

[0475] As described above, after modification of the gene encoding the non-coding RNA molecule (e.g., RNA silencing molecule), the non-coding RNA molecule (e.g., RNA silencing molecule) has at least about 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% complementarity to the sequence of the second target RNA or target RNA of interest.

[0476] The specific binding of the designed non-coding RNA molecule to a target RNA of interest can be determined by any method known in the art, for example, by a computational algorithm (e.g., BLAST), and verified by a variety of methods including, for example, Northern blot, in situ hybridization, QuantiGene Plex assay, etc.

[0477] It should be understood that for the DNA editing event, multiple positive clones can be homozygous or heterozygous. In the case of a heterozygous cell, the cell (e.g., when diploid) can include a copy of a modified gene and a copy of a non-modified gene of the non-coding RNA molecule (e.g., RNA silencing molecule). The technician will select the clone for further culture / regeneration according to the intended use.

[0478] According to one embodiment, when a transient method is required, multiple clones that show the presence of the desired DNA editing event are further analyzed and selected for the lack of a DNA editing agent (i.e., the loss of multiple DNA sequences encoding the DNA editing agent). For example, this can be performed by analyzing the loss of expression of the DNA editing agent (e.g., on the mRNA, protein), such as by fluorescence detection of GFP or q-PCR, HPLC.

[0479] According to one embodiment, when a transient method is required, the plurality of cells can be analyzed for the lack of a nucleic acid construct as described herein or a portion thereof, for example, a nucleic acid sequence encoding the DNA editing agent. This can be confirmed by fluorescence microscopy, q-PCR, FACS, or any other method (e.g., Southern blot, PCR, sequencing, HPLC).

[0480] According to one embodiment, the plants are hybridized as described below to obtain a plant lacking the DNA editing agent (e.g., endonuclease).

[0481] Multiple positive clones can be stored (eg, cryopreserved).

[0482] Alternatively, plant cells (e.g., protoplasts) can be regenerated into whole plants by first growing into a group of plant cells that develop into a callus and then regenerating shoots from the callus using plant tissue culture methods (callogenesis). The growth of protoplasts into callus and the regeneration of shoots require an appropriate balance of plant growth regulators in the tissue culture medium, which must be customized for each plant species.

[0483] Multiple protoplasts can also be used for plant breeding using a technique called protoplast fusion. Multiple protoplasts from different species are fused by inducing the use of an electric field or a polyethylene glycol solution. This technique can be used to produce somatic hybrids in tissue culture.

[0484] The method of protoplast regeneration is well known in the art. Several factors can affect protoplast separation, cultivation and regeneration, i.e., the genotype, the donor tissue and pre-treatment thereof, enzyme treatment for protoplast separation, protoplast culture method, culture, culture medium and physical environment. For a comprehensive review, see Maheshwari et al. (1986, Differentiation of Protoplasts and of Transformed Plant Cells: 3 to 36, Springer-Verlag, Berlin).

[0485] Further breeding and selection of the plurality of regenerated plants may be performed as deemed appropriate by the skilled artisan.

[0486] Therefore, various embodiments of the present invention further relate to various plants, various plant cells, and various processed products of plants, which include the non-coding RNA molecules (e.g., RNA silencing molecules) capable of silencing a second target RNA produced according to the present teachings.

[0487] According to one aspect of the present invention, a method for producing a plant with reduced expression of a target gene is provided, the method comprising: (a) breeding the plants according to some embodiments of the present invention; and (b) selecting a plurality of progeny plants having reduced expression of the target RNA of interest or the second target RNA, or selecting progeny including a silencing specificity in the non-coding RNA molecule for a target RNA of interest, and the plurality of progeny plants or the progeny do not include the DNA editing agent, thereby producing the plant with reduced expression of a target gene.

[0488] According to one embodiment, breeding comprises crossing or selfing.

[0489] The term "hybridization" as used herein refers to the fertilization of multiple female plants (or multiple gametes) by multiple male plants (or multiple gametes). The term "gamete" refers to a haploid reproductive cell (egg or sperm) produced in multiple plants and participating in sexual reproduction by mitosis from a gametophyte, during which two gametes of the opposite sex fuse to form a diploid zygote. The term generally includes a pollen (including the sperm cell) and an ovule (including the ovum). Therefore, "hybridization" generally refers to the fertilization of multiple ovules of an individual with pollen from another individual, while "selfing" refers to the fertilization of multiple ovules of an individual with pollen from the same individual. Hybridization is widely used in plant breeding and results in the mixing of genomic information between the two plants, which hybridize a chromosome from the mother and a chromosome from the father. This will result in a genetically novel combination of multiple inherited traits.

[0490] As described above, the plants can be hybridized to obtain a plant that is free of multiple undesirable factors, such as DNA editing agents (eg, endonucleases).

[0491] According to one embodiment, a method for producing a plant with improved stress tolerance, increased yield, improved growth rate or improved yield quality is provided, the method comprising: according to the method of some embodiments of the present invention, modifying a gene encoding or processed into a non-coding RNA molecule or processed into an RNA silencing molecule in a plant cell, wherein the target RNA of interest is a gene of the plant that is sensitive to stress, has reduced yield, reduced growth rate or reduced yield quality, thereby producing the plant.

[0492] As used herein, the phrase "stress tolerance" refers to the ability of a plant to withstand a biotic or abiotic stress without experiencing a substantial change in metabolism, growth, productivity and / or viability.

[0493] As used herein, the phrase "abiotic stress" refers to the exposure of a plant, plant cell, etc. to a non-living ("abiotic") physical or chemical agent that has an adverse effect on the metabolism, growth, development, reproduction, or survival (collectively, "growth") of the plant. An abiotic stress can be imposed on a plant, for example, due to an environmental factor such as water (e.g., flooding, drought, or dehydration), anaerobic conditions (e.g., a low level of oxygen or high levels of CO), or a combination of factors. 2 ), various abnormal osmotic conditions (e.g., osmotic stress), salinity, or temperature (e.g., hot / heat, cold, freezing or frost), exposure to various pollutants (e.g., heavy metal toxicity), anaerobic growth (anaerobiosis), nutrient deficiency (e.g., nitrogen deficiency or nitrogen limitation), atmospheric pollution or ultraviolet radiation.

[0494] As used herein, the phrase "biotic stress" refers to the exposure of a plant, plant cell, etc., to a living ("biotic") organism that has an adverse effect on the metabolism, growth, development, reproduction, or survival (collectively, "growth") of the plant. Biotic stress can be caused by, for example, bacteria, viruses, fungi, parasites, beneficial and harmful insects, weeds, and cultivated or natural plants.

[0495] As used herein, the phrase "yield" or "plant yield" refers to increased plant growth (growth rate), increased crop growth, increased biomass and / or increased plant product yield (including grains, fruits, seeds, etc.).

[0496] According to one embodiment, in order to produce a plant with improved stress tolerance, increased yield, improved growth rate or improved yield quality, the non-coding RNA molecule is designed to target an RNA of interest, which is a gene of the plant that is sensitive to stress, has reduced yield, reduced growth rate or reduced yield quality.

[0497] According to one embodiment, multiple exemplary susceptible plant genes to be targeted (e.g., knocked out) include, but are not limited to, multiple susceptible S genes, for example, those located at a genetic locus called MLO (Mildew Locus O).

[0498] According to one embodiment, the multiple plants produced by the present method have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% increased stress tolerance, increased yield, improved yield quality, and increased growth rate compared to multiple plants not produced by the present method.

[0499] According to the present invention, any method known in the art for evaluating improved stress tolerance can be used. A plurality of exemplary methods for evaluating improved stress tolerance include, but are not limited to, downregulation of PagSAP1 for increased salt stress tolerance in poplar (Trees, 2018, 32: 823; www.doi(dot)org / 10.1007 / s00468-018-1675-2), and enhanced drought tolerance in tomatoes by downregulating SlbZIP38 (Pan Y et al., Genes, 2017, 8, 402; doi: 0.3390 / genes8120402, incorporated herein by reference), as described by Yoon, SK, Bae, EK, Lee, H. et al.

[0500] According to the present invention, any method known in the art for evaluating increased yield can be used. A number of exemplary methods for evaluating increased yield include, but are not limited to, reduced DST expression in rice as described by Ar-Rafi Md. Faisal et al. (AJPS, Vol. 8, No. 9, August 2017, DOI: 10.4236 / ajps.2017.89149); and downregulation of BnFTA in rapeseed (canola) results in increased yield as described by Wang Y et al. (Mol Plant., January 2009; 2(1): 191 to 200; doi: 10.1093 / mp / ssn088), both of which are incorporated herein by reference.

[0501] According to the present invention, any method known in the art for evaluating the growth rate of improvement can be used. Multiple exemplary methods for evaluating the growth rate of improvement include, but are not limited to, as described by Marcelo de Freitas Lima et al., the expression of BIG BROTHER or GA2-oxidase in Arabidopsis is reduced, resulting in increased growth and biomass (Biotechnology Research and Innovation, 2017, 1, 14 to 25), which is incorporated herein by reference.

[0502] According to the present invention, any method known in the art for evaluating improved yield quality can be used. A number of exemplary methods for evaluating improved yield quality include, but are not limited to, as described by Yeh S_Y et al., downregulation of OsCKX2 in rice leads to more tillers, more grains, and heavier grains (Rice, New York, 2015; 8: 36); and as described by VermaSR and Dwivedi UN, reducing OMT levels in many plants, thereby changing the accumulation of lignin and increasing the digestibility of industrial materials (South African Journal of Botany, Vol. 91, March 2014, pp. 107-125), both of which are incorporated herein by reference.

[0503] According to one embodiment, the method further enables the production of a plant comprising increased sweetness, increased sugar content, increased flavor, improved ripening control, increased water stress tolerance, increased heat stress tolerance, and increased salt tolerance. Those skilled in the art will know how to select a plurality of target RNA sequences for modification using the methods described herein.

[0504] According to one embodiment, a method for producing a pathogen-resistant or pathogen-resistant plant is provided, the method comprising: according to the method of some embodiments of the present invention, modifying a gene in a plant cell that encodes or is processed into a non-coding RNA molecule or is processed into an RNA silencing molecule, wherein the target RNA of interest is a gene of the plant that is sensitive to the pathogen, thereby producing the pathogen-resistant or pathogen-resistant plant.

[0505] According to one embodiment, a method for producing a pathogen-resistant or pathogen-resistant plant is provided, the method comprising: according to the method of some embodiments of the present invention, modifying a gene that encodes or is processed into a non-coding RNA molecule or is processed into an RNA silencing molecule in a plant cell, wherein the target RNA of interest is a gene of the pathogen, thereby producing the pathogen-resistant or pathogen-resistant plant.

[0506] According to one embodiment, a method for producing a pest-tolerant or pest-resistant plant is provided, the method comprising: according to the method of some embodiments of the present invention, modifying a gene that encodes or is processed into a non-coding RNA molecule or is processed into an RNA silencing molecule in a plant cell, wherein the target RNA of interest is a gene of the pest, thereby producing the pest-tolerant or pest-resistant plant.

[0507] As used herein, the term "pathogen" refers to an organism that negatively affects plants by colonizing, damaging, attacking or infecting the plants. Thus, a pathogen can affect the growth, development, reproduction, harvest or yield of a plant. This includes organisms that transmit disease and / or damage the host and / or compete for host nutrients. Various plant pathogens include, but are not limited to, fungi, oomycetes, bacteria, viruses, viroids, virus-like organisms, phytoplasmas, protozoa, nematodes, insects, and parasitic plants.

[0508] Various non-limiting examples of pathogens include, but are not limited to, roundheaded borers (e.g., long horned borers); psyllids (e.g., red gum lerppsyllid (Glycaspis brimblecombei), blue gum psyllid, spotted gum lerppsyllid, lemon gum lep psyllid); tortoise beetles; snout beetles; leaf beetles; honey fungus; bronze worms (Thaumastocoris peregrinus); sessile gall wasps (Cynipidae) (e.g., Leptocybe invasa, Ophelimus maskelli and Selitrichodes globules); Foliage-feeding caterpillars (e.g., Omnivorous looper and Orange tortrix); Glassy-winged sharpshooter; and Whitefly (e.g., Giant whitefly). Other non-limiting examples of pathogens include aphids (e.g., Chaitophorus spp., Cloudywinged cottonwood, and Periphyllus spp.)); Armored scale (e.g., Oystershell scale and San Jose scale); Carpenterworm; Clearwing moth borer (e.g., American hornet moth and Western poplar clearwing); Flatheaded borer (e.g., Bronze birch borer and Bronze poplar borer); Foliage-feeding caterpillar (e.g., Fall webworm, Fruit-tree leafroller, Redhumped caterpillar, Satin moth caterpillar, Spiny elm caterpillar, Tent caterpillar, etc.); caterpillar, Tussock moths, and Western tiger swallowtail); Foliage miner (e.g., Poplar shield bearer); Gall and blistermites (e.g., Cottonwood gall mite); Gall aphids (e.g., Poplar petiolegall aphid); Glassy-winged sharpshooter; Leaf beetle and flea beetle; Mealybug; Poplar and willow borer; Roundhead borer; Sawfly; Soft scale (e.g., Black scale, Brown softscale, Cottony maple scale and European fruitlecanium); Treehoppers (e.g., buffalo treehopper); and Truebugs (e.g., Lace bug and Lygus bug).

[0509] Other non-limiting examples of viral plant pathogens include, but are not limited to, species: Pea early-browning virus (PEBV), genus: Tobravirus. Species; species: Pepper ringspot virus (PepRSV), genus: Tobacco rattle virus; species: Watermelon mosaic virus (WMV), genus: Potyvirus and other viruses from Potyvirus; species: Tobacco mosaic virus (TMV), genus: Tobamovirus and other viruses from Tobacco mosaic virus; species: Potato virus X (PVX), genus: Potato virus and other viruses from Potato virus. Thus, the present teachings contemplate targeting RNA as well as DNA viruses (e.g., Gemini virus or Bigeminivirus). The Geminiviridae viruses that may be targeted include, but are not limited to, Abutilon mosaic bigeminivirus, Ageratum yellow vein bigeminivirus, Bean calicomosaic bigeminivirus, Bean golden mosaic bigeminivirus, Bhendi yellow vein mosaic bigeminivirus, Cassava African mosaic bigeminivirus, Cassava Indian mosaic bigeminivirus, Chino del tomaté bigeminivirus, Cotton leaf crumple bigeminivirus, Cotton leaf curl bigeminivirus, Croton yellow vein mosaic bigeminivirus, bigeminivirus, Dolichos yellow mosaic bigeminivirus, Euphorbia mosaic geminivirusmosaic bigeminivirus), Horsegram yellow mosaic bigeminivirus, Jatropha mosaic bigeminivirus, Lima bean golden mosaic bigeminivirus, Melon leaf curl bigeminivirus, Mung bean yellow mosaic bigeminivirus, Okra leaf-curl bigeminivirus, Pepperhausteco bigeminivirus, Pepper Texas bigeminivirus, Potato yellow mosaic bigeminivirus, Rhynchosia mosaic bigeminivirus, Serranogolden mosaic bigeminivirus, Squash leaf curl bigeminivirus, curlbigeminivirus), Tobacco leaf curl bigeminivirus, Tomato Australian leaf curl bigeminivirus, Tomato golden mosaic bigeminivirus, Tomato Indian leaf curl bigeminivirus, Tomato leaf crumple bigeminivirus, Tomato mottle bigeminivirus, Tomato yellow leaf curl bigeminivirus, Tomato yellow mosaic bigeminivirus, Watermelon chlorotic dwarf bigeminivirusstuntbigeminivirus) and Watermelon curly mottlebigeminivirus.

[0510] As used herein, the term "pest" refers to an organism that directly or indirectly harms the plant. A direct effect includes, for example, feeding on the leaves of the plant. Indirect effects include, for example, the transmission of a disease agent (e.g., a virus, bacteria, etc.) to the plant. In the latter case, the pest is a vector for the transmission of a pathogen. Exemplary pests include, but are not limited to, beetles, psyllids, insects, nematodes, snails.

[0511] According to one embodiment, the pathogen is a nematode. Exemplary nematodes include, but are not limited to, burrowing nematodes (Radopholus similis), Caenorhabditis elegans, Radopholus arabocoffeae, Pratylenchus coffeae, root-knot nematodes (Meloidogyne spp.), cyst nematodes (Heterodera spp. and Globodera spp.), root lesion nematodes (Pratylenchus spp.), sweet potato stem nematodes (Ditylenchus dipsaci), pine wilt nematodes (Pratylenchus spp.), and nematodes of various species. nematode) (Bursaphelenchus xylophilus), reniform nematode (Rotylenchulus reniformis), dagger nematode (Xiphinemaindex), pseudoroot knot nematode (Nacobbus aberrans), and leaf bud nematode (Aphelenchoides besseyi).

[0512] According to one embodiment, the pathogen is a fungus. Exemplary fungi include, but are not limited to, Fusarium oxysporum, Leptosphaeria maculans (and spring rape black leg disease (Phoma lingam)), Sclerotinia sclerotiorum, Pyricularia grisea, Gibberella fujikuroi, Fusarium moniliforme, Magnaporthe oryzae, Botrytis cinereal, Puccinia spp., Fusarium graminearum, Blumeria graminis, Mycosphaerella graminicola, Colletotrichum spp., Ustilago maydis, Melampsoralini, Phakopsora pachyrhizi, and Rhizoctonia solani.

[0513] According to one embodiment, in order to generate a plant that is resistant or tolerant to a pathogen, the non-coding RNA molecule is designed to target an RNA of interest, which is a plant gene that confers susceptibility to a pathogen.

[0514] According to one embodiment, an exemplary plant gene to be targeted includes, but is not limited to, the gene eIF4E that confers susceptibility to viral infection in cucumber.

[0515] According to one embodiment, in order to produce a plant resistant or tolerant to a pathogen, the non-coding RNA molecule is designed to target an RNA of interest, which is a gene of the pathogen.

[0516] The plurality of plant or pathogen target genes can be determined using any method known in the art (eg, by routine bioinformatics analysis).

[0517] According to one embodiment, the nematode pathogen gene includes the Radopholus similis gene Calreticulin 13 (CRT) or collagen 5 (col-5).

[0518] According to one embodiment, the fungal pathogen genes include the Fusarium oxysporum genes FOW2, FRP1, and OPR.

[0519] According to one embodiment, the pathogen genes include, for example, vacuolar ATPase (vATPase), dvssj1 and dvssj2, α-tubulin, and snf7.

[0520] According to a specific embodiment, when the plant is a Brassica napus (rapeseed), the target RNA of interest includes, but is not limited to, a gene of Leptosphaeria maculans (and Phoma lingam) (e.g., causing and spring rape stem canker) (e.g., as described in GenBank Accession No.: AM933613.1); a gene of a Flea beetle (Phyllotreta vittula or Chrysomelidae, e.g., as described in GenBank Accession No.: KT959245.1); or a gene of Sclerotinia sclerotiorum (e.g., causing Sclerotinia stem rot) (e.g., as described in GenBank Accession No.: NW_001820833.1).

[0521] According to a specific embodiment, when the plant is a Citrus fruit (Citrus) x tea tree (sinensis) (Orange), the target RNA of interest includes but is not limited to a gene of Citrus Canker (CCK) (e.g., as described in GenBank Accession No.: AE008925); a gene of Candidatus Liberibacterspp. (e.g., causing Citrus greening disease) (e.g., as described in GenBank Accession No.: CP001677.5); or a gene of Armillaria root rot (e.g., as described in GenBank Accession No.: KY389267.1).

[0522] According to a specific embodiment, when the plant is an African oil palm (Elaeis guineensis) (Oil palm), the target RNA of interest includes but is not limited to, a gene of Ganoderma spp. (e.g., causing Basal stem rot (BSR), also known as Ganoderma butt rot (e.g., as described in GenBank Accession No.: U56128.1); a gene of Nettle Caterpillar, or a gene of any one of Fusarium spp., Phytophthora infestans, Rhizoctonia solani (e.g., causing root rot).

[0523] According to a specific embodiment, when the plant is a woodland strawberry (Fragaria vesca) (Wild strawberry), the target RNA of interest includes but is not limited to, a gene of Verticillium dahlia (e.g., causing Verticillium Wilt) (e.g., as described in GenBank Accession No.: DS572713.1); a gene of Fusarium oxysporum f.sp.fragariae (e.g., causing Fusarium wilt) (e.g., as described in GenBank Accession No.: KR855868.1).

[0524] According to a specific embodiment, when the plant is a Glycine max (Soybean), the target RNA of interest includes, but is not limited to, a gene of P. pachyrhizi (e.g., causing Soybean rust, also known as Asian rust) (e.g., as described in GenBank Accession No.: DQ026061.1); a gene of Soybean Aphid (e.g., as described in GenBank Accession No.: KJ451424.1); a gene of Soybean Dwarf Virus (SbDV) (e.g., as described in GenBank Accession No.: NC_003056.1); or a gene of Green Stink Bug (Acrosternum hilare) (e.g., as described in GenBank Accession No.: NW_020110722.1).

[0525] According to a specific embodiment, when the plant is Gossypium raimondii (cotton), the target RNA of interest includes, but is not limited to, a gene of Fusarium oxysporum f. sp. vasinfectum (e.g., causing Fusarium wilt) (e.g., as described in GenBank Accession No.: JN416614.1); a gene of Soybean Aphid (e.g., as described in GenBank Accession No.: KJ451424.1); or a gene of Pink bollworm (Pectinophora agos sypiella) (e.g., as described in GenBank Accession No.: KU550964.1).

[0526] According to a specific embodiment, when the plant is an Oryza sativa (Rice), the target RNA of interest includes, but is not limited to, a gene of Pyricularia grisea (e.g., causing Rice Blast) (e.g., as described in GenBank Accession No. AF027979.1); a gene of Gibberella fujikuroi (Fusarium moniliforme) (e.g., causing Rice Bakanae Disease) (e.g., as described in GenBank Accession No. AY862192.1); or a stem borer: for example, Scirpophaga incertulas Walker-Yellow Stem Borer, S. innota Walker-white yellow stem borer, Chilosuppressalis Walker-striped stem borer, Sesamia inferens Walker-pink yellow stem borer (e.g., as described in GenBank Accession No.: KF290773.1).

[0527] According to a specific embodiment, when the plant is a Solanum lycopersicum (Tomato), the target RNA of interest includes, but is not limited to, a gene of Phytophthora infestans (e.g., causing late blight) (e.g., as described in GenBank Accession No.: AY855210.1); a gene of the whitefly Bemisia tabaci (e.g., Gennadius, e.g., as described in GenBank Accession No.: KX390870.1); or a gene of Tomato yellow leafcurl geminivirus (TYLCV) (e.g., as described in GenBank Accession No. LN846610.1).

[0528] According to a specific embodiment, when the plant is a potato (Solanum tuberosum) (potato), the target RNA of interest includes, but is not limited to, a gene of Phytophthora infestans (e.g., causing Late Blight) (e.g., as described in GenBank Accession No. AY050538.3); a gene of Erwinia spp. (e.g., causing Blackleg and Soft Rot) (e.g., as described in GenBank Accession No. CP001654.1); or a gene of Cyst Nematodes (e.g., Globodera Pallida and G. rostochiensis) (e.g., as described in GenBank Accession No. KF963519.1).

[0529] According to a specific embodiment, when the plant is a Theobroma cacao (Cacao), the target RNA of interest includes, but is not limited to, a gene of a basidiomycete (Moniliophthora aroreri) (e.g., causing Frosty Pod Rot) (e.g., as described in GenBank Accession No. LATX01001521.1); a gene of Moniliophthora perniciosa (e.g., causing Witches' Broom disease); or a gene of a blind bug, such as Distantiella theobroma and Sahlbergella singularis, Helopeltis spp., Monalonion specie.

[0530] According to a specific embodiment, when the plant is a Vitis vinifera (Grape or Grapevine), the target RNA of interest includes, but is not limited to, a gene of closterovirus GVA (e.g., causing Rugose wood disease) (e.g., as described in GenBank Accession No. AF007415.2); a gene of Grapevine leafroll virus (e.g., as described in GenBank Accession No. FJ436234.1); a gene of Grapevine fanleafdegeneration disease virus (GFLV) (e.g., as described in GenBank Accession No. NC_003203.1); or a gene of Grapevine fleck disease (GFkV) (e.g., as described in GenBank Accession No. NC_003347.1).

[0531] According to a specific embodiment, when the plant is a Zea mays (Maize, also known as corn), the target RNA of interest includes, but is not limited to, a gene of Fall Armyworm (e.g., Spodoptera frugiperda) (e.g., as described in GenBank Accession No. AJ488181.3); a gene of European corn borer (e.g., as described in GenBank Accession No. GU329524.1); or a gene of Northern and western corn rootworms (e.g., as described in GenBank Accession No. NM_001039403.1).

[0532] According to a specific embodiment, when the plant is a sugarcane, the target RNA of interest includes but is not limited to a gene of an internode borer (e.g., Chilo Saccharifagus Indicus), a gene of Xanthomonas Albileneans (e.g., causing Leaf Scald), or a gene of Sugarcane Yellow Leaf Virus (SCYLV).

[0533] According to a specific embodiment, when the plant is wheat, the target RNA of interest includes but is not limited to a gene of Puccinia striiformis (eg, causing stripe rust), or a gene of Aphid.

[0534] According to a specific embodiment, when the plant is barley, the target RNA of interest includes but is not limited to a gene of Puccinia hordei (e.g., causing leaf rust), a gene of Puccinia striiformis f.sp. Hordei (e.g., causing stripe rust), or a gene of Aphid.

[0535] According to a specific embodiment, when the plant is a sunflower, the target RNA of interest includes, but is not limited to, a gene of Puccinia helianthi (e.g., causing Rust disease); a gene of Boerema macdonaldii (e.g., causing Phoma black stem); a gene of Seed weevil (e.g., red and gray), e.g., Smicronyx fulvus (red), Smicronyx sordidus (gray); or a gene of Sclerotinia sclerotiorum (e.g., causing Sclerotinia stalk and head rot disease).

[0536] According to a specific embodiment, when the plant is a rubber plant, the target RNA of interest includes but is not limited to, a gene of Microcyclus ulei (e.g., causing South American leaf blight (SALB)); a gene of Rigidoporus microporus (e.g., causing White root disease); a gene of Ganodermapseudoferreum (e.g., causing Red root disease).

[0537] According to a specific embodiment, when the plant is an apple plant, the target RNA of interest includes but is not limited to a gene of Neonectria ditissima (e.g., causing Apple Canker); a gene of Podosphaera leucotricha (e.g., causing Apple Powdery Mildew); or a gene of Venturia inaequalis (e.g., causing Apple Scab).

[0538] Table 1B below provides multiple exemplary endogenous non-coding RNA molecules that can be modified to target the RNA of interest (e.g., a gene of a pathogen), multiple exemplary gRNA sequences (i.e., a DNA editing agent) that can be used to modify the multiple endogenous non-coding RNA molecules, and multiple exemplary nucleotide sequences for redirecting a silencing specificity of the endogenous non-coding RNA molecule to the target RNA of interest.

[0539]

[0540]

[0541]

[0542]

[0543]

[0544]

[0545]

[0546]

[0547]

[0548]

[0549]

[0550]

[0551]

[0552]

[0553]

[0554]

[0555]

[0556]

[0557]

[0558]

[0559]

[0560] According to one embodiment, the multiple plants produced by the present method are compared to multiple plants not produced by the present method (i.e., compared to multiple wild-type plants), and the resistance or tolerance to multiple pathogens is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% increased.

[0561] According to the present invention, any method known in the art for assessing tolerance or resistance of a plant to a pathogen may be used. Exemplary methods include, but are not limited to, reducing MYB46 expression in Arabidopsis leads to enhanced resistance to Botrytis cinereal as described by Ramírez V1, García-Andrade J, Vera P. (Plant Signal Behav., 2011 Jun; 6(6): 911-3, Epub: 2011 Jun 1); or downregulation of HCT in alfalfa promotes activation of defense responses in plants as described by Gallego-Giraldo L. et al. (New Phytologist, 2011, 190: 627-639, doi: 10.1111 / j.1469-8137.2010.03621.x), both of which are incorporated herein by reference.

[0562] According to one embodiment, a method for producing a herbicide-resistant plant is provided, the method comprising: according to the method of some embodiments of the present invention, modifying a gene in a plant cell that encodes or is processed into a non-coding RNA molecule or is processed into an RNA silencing molecule, wherein the target RNA of interest is a gene of the plant that is sensitive to the herbicide, thereby producing the herbicide-resistant plant.

[0563] According to one embodiment, the pathways targeted by the herbicides are located within plastids (eg, within the chlorophyll).

[0564] Therefore, to generate multiple herbicide-resistant plants, the non-coding RNA molecules are designed to target an RNA of interest, including but not limited to, the chlorophyll gene psbA (which encodes photosynthetic quinone-binding membrane protein QB, the target of the herbicide atrazine) and the gene for EPSP synthase (a nuclear protein, however, its overexpression or accumulation in the chlorophyll makes the plant resistant to the herbicide glyphosate because it increases the transcription rate of EPSPs and reduces the turnover rate of the enzyme).

[0565] According to one embodiment, the plurality of plants produced by the present method have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% increased resistance to herbicides compared to the plurality of plants not produced by the present method.

[0566] According to one embodiment, a plant produced according to the method of some embodiments of the present invention is provided.

[0567] According to one embodiment, the plant is non-genetically modified (non-GMO).

[0568] According to one embodiment, a seed of the plant produced according to the method of some embodiments of the present invention is provided.

[0569] Designing GEiGS with minimal nucleotide modifications / editing in the endogenous non-coding RNA can be achieved using in silico methods based on bioinformatics tools well known to the skilled person.

[0570] According to one embodiment, this method is achieved as follows:

[0571] The following information should be provided: (a) the target sequence ("target") for silencing by gene editing induced gene silencing (GEiGS); (b) whether the GEiGS (i.e., the non-coding RNA with modified silencing activity and / or specificity) is selected to be ubiquitously expressed (e.g., constitutively expressed) or specifically expressed (e.g., expressed in a particular tissue, developmental stage, stress, heat / cold shock, etc.).

[0572] This information is submitted to a publicly or internally available miRNA dataset (e.g., small RNA sequencing, multiple genome sequences, multiple microarrays, etc.) to screen (i.e., select) only multiple relevant miRNAs that meet the input criteria: multiple miRNAs expressed according to the above requirements (multiple), for example, miRbase (Kozommara and Griffiths-Jones, 2014), tasRNAdb (Zhang Changqing et al., 2013), and mirEx 2.0 (Zielezinski, Andrzej et al., "mirEX 2.0-an Integrated Environmentfor Expression Profiling of Plant microRNAs", BMC Plant Biology, 15, 2015: 144, PMC. Web. September 15, 2018).

[0573] Using publicly available tools, a list of effective multiple target-specific siRNA sequences can be generated. The multiple miRNAs can be compared with the effective multiple siRNA sequences, and the most homologous multiple miRNAs can be selected. Multiple screened miRNAs may have a similar sequence in the same direction as the effective multiple siRNAs.

[0574] Modify multiple naturally mature miRNA sequences to have high homology with multiple target-specific and effective siRNAs, thereby completely matching the sequence of the target. This modification can occur in a mature miRNA strand with the highest target homology (for example, it can be the original miRNA guide strand or passenger strand). This 100% complementarity with the target can convert the miRNA sequence into an siRNA.

[0575] Minimal GE can be achieved by screening multiple miRNA sequences that have naturally high homology (reverse complement) to the target.

[0576] Based on the multiple genomic DNA sequences flanking the modified miRNA precursor sequence (pre-miRNA), the multiple primary modified miRNA genes are used to generate multiple ssDNA oligonucleotides (e.g., 200 to 500nt ssDNA length) and multiple dsDNA fragments (e.g., only 250 to 5000nt dsDNA fragments or cloned in multiple plasmids). The guide strand (silent strand) sequence of the modified miRNA can be designed to be 100% complementary to the target.

[0577] The sequences of other miRNA gene regions were modified to preserve the original (unmodified) miRNA precursor and mature structures by maintaining the same base pairing profile.

[0578] Multiple sgRNAs are designed to specifically target the original unmodified miRNA gene (specific to the genomic miRNA locus) rather than targeting the modified form (ie, the multiple oligonucleotide / fragment sequences).

[0579] The comparative restriction enzyme sites between the modified miRNA and the original miRNA gene are analyzed and multiple differential restriction sites are summarized. This detection system is based on PCR followed by restriction enzyme digestion and gel electrophoresis.

[0580] Validation was performed as discussed in detail above.

[0581] When the endogenous non-coding RNA (e.g., miRNA) includes a naturally high homology (e.g., 60 to 90%) with the target, bioinformatics methods are used to examine the targeting of the non-coding RNA to other multiple targets (e.g., "off target effect") to obtain specific silencing of the target of interest.

[0582] The endogenous non-coding RNA (eg, miRNA) is minimally modified to enhance its potency in silencing the target of interest.

[0583] Validate the GEiGS results of multiple major minimally edited miRNA genes to generate multiple candidate refined minimally edited miRNAs. An experimentally valid major GEiGS result (the multiple major minimally edited miRNA genes) is considered to be (multiple) miRNAs with a guide strand or passenger strand modified to match the target 100%.

[0584] Generate multiple guide chain or passenger chain sequences, which gradually return to the original sequence (such as Fig.11 ).

[0585] The seed sequence is maintained in such a way that there are at least 5 matches among the seven seed nucleotides (from nucleotides 2 to 8 at the 5' end).

[0586] Various candidate "refined minimally edited miRNA genes" were tested for their target silencing efficiency. The genes GE-mediated knock-in were selected to provide the highest silencing with the least miRNA sequence modification.

[0587] Testing of multiple refined minimally edited miRNA candidates for potential "off-target effects." An important prediction of "off-target effects" influenced the final evaluation of the multiple refined minimally edited miRNA genes.

[0588] Based on experimental validation, multiple less refined minimally edited miRNA gene candidates were tested.

[0589] As used herein, the term "about" refers to ± 10%.

[0590] The terms "comprises," "comprising," "includes," "including," "having" and their conjugations mean "including but not limited to."

[0591] The term "consisting of" means "including and limited to."

[0592] The term "consisting essentially of" means that the composition, method or structure may include other ingredients, steps and / or parts as long as the other ingredients, steps and / or parts do not materially change the basic and novel characteristics of the claimed composition, method or structure.

[0593] As used herein, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0594] Throughout this application, different embodiments of the present invention may be presented in range form. It should be understood that the description in range form is only for convenience and brevity and should not be interpreted as an unchangeable limitation of the scope of the present invention. Therefore, the description of the range should be considered to specifically disclose all possible sub-ranges and each numerical value of the range. For example, the description of a range such as 1 to 6 should be considered to specifically disclose sub-ranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, and each number of the range, such as 1, 2, 3, 4, 5 and 6. It is applicable regardless of the width of the range.

[0595] Whenever a numerical range is specified herein, it is intended to include any stated numerical value (fractional or integer) within the specified range. The phrases "range between" a first indicated number and a second indicated number and "range from" a first indicated number "to" a second indicated number "are used interchangeably herein to include the first indicated number and the second indicated number and all fractions and integers therebetween.

[0596] The term "method" as used herein refers to ways, means, techniques and procedures for accomplishing a given task, including but not limited to those known to practitioners in the chemical, pharmacological, biological, biochemical and medical fields or readily developed by them from known ways, means, techniques and procedures.

[0597] The term "treating" as used herein includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating the clinical and aesthetic symptoms of a condition, or substantially preventing the appearance of clinical or aesthetic symptoms of a condition.

[0598] It should be understood that certain features of the invention described in the context of separate embodiments for the sake of clarity may also be provided in combination in a single embodiment. Conversely, different features of the invention described in the context of a single embodiment for the sake of brevity may also be provided separately or in any suitable subcombination or applicable to any other described embodiment of the invention. Certain features described in the context of different embodiments are not considered essential features of the described embodiment unless the embodiment is ineffective without the described elements.

[0599] In the following examples, experimental support is provided for various embodiments and aspects of the present invention as described above and as claimed in the appended claims section.

[0600] It should be understood that any sequence identification number (SEQ ID NO) disclosed in this application can refer to a DNA sequence or an RNA sequence, depending on the context in which the SEQ ID NO is mentioned, even if the SEQ ID NO is expressed in only a DNA sequence format or an RNA sequence format. For example, SEQ ID NOs: 1 to 4 are expressed in a DNA sequence format (e.g., T represents thymine), but it can refer to a DNA sequence corresponding to a gRNA nucleic acid sequence, or to the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, although certain sequences are expressed in an RNA sequence format (e.g., U represents uracil), depending on the actual type of molecule, it can refer to the sequence of an RNA molecule including a dsRNA, or it can refer to the sequence of a DNA molecule corresponding to the indicated RNA sequence. In any case, DNA and RNA molecules having the disclosed sequences together with any substituents are contemplated.

[0601] Examples

[0602] Reference is now made to the following examples, which together with the above descriptions illustrate the invention in a non limiting fashion.

[0603] In general, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are fully explained in the literature. See, for example, "Molecular Cloning: A Laboratory Manual", Sambrook et al., 1989; "Current Protocols in Molecular Biology", Volumes I to III, Ausubel, RM, ed., 1994; Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland, 1989; Perbal, "A Practical Guide to Molecular Cloning", John Wiley and Sons, New York, 1988; Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (ed.) "Genome Analysis: A Laboratory Manual Series", Volumes 1 to 4, Cold Spring Harbor Laboratory Press (Cold Spring Harbor Laboratory Press, 1994). "Cell Biology: A Laboratory Handbook", Vols. I to III, Cellis, JE ed., 1994; "Culture of Animal Cells-A Manual of Basic Technique", Freshney, Wiley-Liss, New York, 1994, 3rd edition; "Current Protocols in Immunology", Vols. I to III, Coligan JE ed., 1994; Stites et al. (eds.), "Basic and Clinical Immunology" (8th edition), Appleton and Lange, Norwalk, CT, 1994; Mishell and Shiigi (eds.), "Selected Methods in Cellular Immunology", WH Freeman and Co., New York, 1980; available immunoassays are described extensively in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932, 3,839,153, 3,850,752, 3,850,578, 3,853,987, 3,867,517, 3,879,262, 3,901,654, 3,935,074, 3,984,533, 3,996,345, 4,034,074, 4,098,876, 4,879,219, 5,011,771, and 5,281,521, "Oligonucleotide Synthesis", Gait, MJ, ed., 1984; "Nucleic Acid Hybridization", Hames, BD and Higgins, ed. SJ ed., 1985; "Transcription and Translation", Hames, BD and Higgins SJ ed., 1984; "Animal Cell Culture", Freshney, RI ed., 1986; "Immobilized Cells and Enzymes", IRL Press, 1986; "A Practical Guide to Molecular Cloning", Perbal, B., 1984 and "Methods in Enzymology", Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA, 1990; Marshak et al., "Strategies for Protein Purification and Characterization-A Laboratory Course Manual", CSHL Press, 1996; all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout the document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

[0604] General Materials and Experimental Procedures

[0605] Arabidopsis cell culture

[0606] Arabidopsis thaliana (ecotype Landsberg-erecta) cell cultures were maintained in 100 mL of liquid growth medium (4.4 g / L serum-free medium (Murashige and Skoog, MS) salts with vitamins (Duchefa, Haarlem, The Netherlands), 30 g / L sucrose, 0.5 mg / L 1-naphthaleneacetic acid (NAA) and 0.5 mg / L 6-benzylaminoipurine (BAP)) at 25°C with a 16-hour photoperiod and gentle agitation (100 rpm). 6 ml of culture medium was transferred to fresh medium every week.

[0607] Plant Growth

[0608] Arabidopsis thaliana (ecotype Colombia-0) seedlings were surface sterilized and grown on plates containing MS medium (supplemented with 0.8 g / L agar) at 20°C with a 16-hour photoperiod.

[0609] Stable transformation of Arabidopsis cell culture

[0610] Agrobacterium carrying the pK7WGF2 plasmid was grown in LB medium (supplemented with 100 mg / L spectinomycin) (at 28°C) to an OD of 0.8. The bacteria were collected by centrifugation and resuspended in the same amount of plant cell culture medium. Four days after transfer to fresh medium, 4 ml of Arabidopsis cells were cultured with 0.1 ml of Agrobacterium suspension in a Petri dish (at 20°C, in the dark, with gentle stirring (130 rpm)). After 48 hours, the cells were collected by centrifugation and washed 5 times with cell culture medium to remove most of the bacteria. Finally, the cells were resuspended in 2 ml of cell culture medium and plated on a Petri dish (containing cell culture medium supplemented with 0.4% Phytagel, 500 mg / L timen, and 50 mg / L kanamycin). The plates were stored at 25°C in the dark until callus formation was observed, usually after 2 or 3 weeks.

[0611] Banana embryogenic calli:

[0612] Banana embryonic callus is developed from an initial explant (e.g., immature male flower or shoot tip) as described by Ma (Ma SS, Proceedings of Symposium on Tissue culture of horticultural crops, Taipei, Taiwan, March 8-9, 1988, pp. 181-188) and Schoofs (Schoofs H., The origin of embryogenic cells in Musa, PhD thesis, University of Leuven, Belgium, 1997). Embryonic cell suspensions are induced from newly developed highly embryogenic callus in liquid culture medium. 80% of the culture medium is renewed every 12 to 14 days until the induced cell suspension is fully established (6 to 9 months).

[0613] Coffee embryonic calli:

[0614] Coffee embryo callus was obtained as previously described (Etienne, H., Protocol for somatic embryogenesis in woody plants, 2005, Springer, pp. 167-1795). Briefly, multiple young leaves were surface sterilized and cut into 1 cm 2 Multiple explants were placed in half-strength semisolid MS medium (supplemented with 2.26 μM 2,4-dichlorophenoxyacetic acid (2,4-dichlorophenoxyacetic acid, 2,4-D), 4.92 μM indole-3-butyric acid (IBA) and 9.84 μM isopentenyladenine (iP)) for 1 month. Multiple explants were then transferred to half-strength semisolid MS medium (containing 4.52 μM 2,4-D and 17.76 μM 6-benzoic acid purine (6-benzylaminopurin, 6-BAP)) for 6 to 8 months until embryonic callus was regenerated. Embryonic callus was maintained on MS medium (supplemented with 5 μM 6-BAP).

[0615] Cell suspension cultures were generated from embryonic callus as previously described (Acuna, JR and M. de Pena, Plant Cell Reports, 1991, 10(6): 345-348). Embryonic callus (30 g / l) was placed in liquid MS medium (supplemented with 13.32 μM 6-BAP). The flask was placed in a shaking incubator (110 rpm) at 28°C. The cell suspension was subcultured / passaged every 2 to 4 weeks until fully established. Cell suspension cultures were maintained in liquid MS medium containing 4.44 μM 6-BAP.

[0616] Computational pipeline to generate GEiGS templates

[0617] The computational GEiGS pipeline utilizes biological metadata and can automatically generate multiple GEiGS DNA templates for minimally editing multiple non-coding RNA genes (e.g., multiple miRNA genes) to acquire a new function, namely redirecting their silencing ability to the target sequence of interest.

[0618] like Fig. 9 As shown in , the pipeline starts with filling in and submitting inputs: (a) silencing target sequences by GEiGS; (b) gene editing the host organism and expressing the GEiGS; (c) you can choose whether to express the GEiGS universally. If specific GEiGS expression is required, you can choose from several options (expression specific to a specific tissue, developmental stage, stress, heat / cold shock, etc.).

[0619] After all necessary inputs are submitted, the computational process will start by searching and screening only multiple related miRNAs that meet the input criteria between multiple miRNA data sets (e.g., small RNA sequencing, microarrays, etc.). Next, multiple mature miRNA sequences selected are compared with the target sequence, and miRNAs with the highest level of complementarity are screened. These natural target complementary mature miRNA sequences are then modified so that they fully match the sequence of the target. Then, multiple mature miRNA sequences of the modification are run through an algorithm for predicting siRNA efficacy, and the top 20 with the highest silencing scores are screened out. These final modified miRNA genes are then used to produce 200 to 500nt ssDNA or 250 to 5000nt dsDNA sequences, as shown below.

[0620] 200 to 500nt ssDNA oligonucleotides and 250 to 5000nt dsDNA fragments were designed based on the genomic DNA sequences flanking the modified miRNA. The pre-miRNA sequence was located in the center of the oligonucleotide. The guide strand (silencing) sequence of the modified miRNA was 100% complementary to the target. However, the sequence of the modified passenger miRNA strand was further modified to retain the original (unmodified) miRNA structure, maintaining the same base pairing profile.

[0621] Next, multiple differential sgRNAs were designed to specifically target the original unmodified miRNA gene, rather than the modified exchange form. Finally, comparative restriction enzyme site analysis was performed between the modified miRNA gene and the original miRNA gene, and multiple differential restriction sites were summarized.

[0622] Thus, the pipeline output contains:

[0623] (a) 200 to 500 nt ssDNA oligonucleotides or 250 to 5000 nt dsDNA fragment sequences of minimally modified miRNAs.

[0624] (b) 2 to 3 differential sgRNAs that specifically target the original miRNA gene but not the modified miRNA gene.

[0625] (c) A list of multiple differential restriction enzyme cleavage sites between the modified miRNA gene and the original miRNA gene.

[0626] Target Gene

[0627] Phytoene desaturase gene (PDS)

[0628] Basic principle:

[0629] PDS is an essential gene in the chlorophyll biosynthesis pathway, and loss of PDS function in plants results in an albino phenotype (Fan et al., Sci Rep, 2015, 5: 12217). When used as a target gene for genome editing (GE) strategies or RNAi, plants being edited are easily identified by partial or complete loss of chlorophyll (bleaching) in leaves or other organs.

[0630] method:

[0631] Multiple miRNAs are selected that have a ubiquitous expression profile (depending on the application, multiple miRNAs can be selected that have an expression profile that is specific to a particular tissue, developmental stage, temperature, stress, etc.).

[0632] Multiple miRNAs were modified into siRNAs targeting the PDS gene from Arabidopsis thaliana (see Table 1A below). After transfection and FACS sorting (RFP / GFP was used to identify positive Cas9 / sgRNA transfection events), multiple primary colonies (or calli) were transferred to solid regeneration medium (half-strength MS + B5 vitamins, 20 g / l sucrose, 0.8% agar) until shoots regenerated. The loss of pigmentation in these shoots indicated a loss of function of the PDS gene and the correct GE. No albinism phenotype was observed in control plants transfected with an oligonucleotide carrying a random sequence.

[0633] Green fluorescent protein (GFP) gene

[0634] Rationale

[0635] GFP is a protein consisting of 238 amino acid residues (26.9 kDa) that exhibits bright green fluorescence when exposed to light in the blue to ultraviolet range. Although many other marine organisms also have similar green fluorescent proteins, GFP traditionally refers to the protein first isolated from the jellyfish Aequorea victoria. The GFP from the Victoria jellyfish has a major excitation peak at a wavelength of 395 nm and a minor excitation peak at 475 nm. Its emission peak is at 509 nm, which is in the lower green part of the visible spectrum. The fluorescence quantum yield (quantum yield, QY) of GFP is 0.79. The GFP from sea pansy (Renilla reniformis) has a single major excitation peak at 498 nm. GFP is an excellent tool in many biological fields because it can form an internal chromophore without any other auxiliary cofactors, gene products or enzymes / substrates except molecular oxygen.

[0636] method:

[0637] Multiple miRNAs are selected that have a ubiquitous expression profile (depending on the application, multiple miRNAs can be selected that have an expression profile that is specific to a particular tissue, developmental stage, temperature, stress, etc.).

[0638] Multiple miRNAs are modified to siRNAs targeting the GFP gene (see Table 1A below). FACS sorting is performed after transfection to separate multiple protoplasts (mCherry is used to identify positive Cas9 / sgRNA transfection events) without or with low GFP signals. In the control group (oligonucleotides with non-target siRNA sequences), all protoplasts express mCherry and GFP. Next, the candidate successful GE protoplasts (mCherry positive and GFP negative) are regenerated into multiple plants for further analysis. Multiple protoplasts are also qualitatively recorded under a microscope. In order to perform quantitative analysis and ratio analysis, FACS analysis was used.

[0639] Table 1A: Target gene IDs

[0640]

[0641] siRNA design

[0642] Multiple target-specific siRNAs were designed using publicly available siRNA designers, such as the "BLOCK-iT TM RNAi Designer (BLOCK-iT TM RNAi Designer) and Invivogen’s “Find siRNA sequences”.

[0643] sgRNA design

[0644] As previously described by Park et al. (Bioinformatics, 2015, 31(24): 4014-4016), multiple sgRNAs were designed to target the multiple endogenous miRNA genes using the publicly available sgRNA designer. Two sgRNAs were designed for each cassette, but only a single sgRNA was expressed per cell to initiate gene exchange. The sgRNAs corresponded to the modified pre-miRNA sequences after exchange.

[0645] To maximize the chances of efficient sgRNA selection, two different publicly available algorithms (CRISPER design: www(dot)crispr(dot)mit(dot)edu:8079 / and CHOPCHOP: www(dot)chopchop(dot)cbu(dot)uib(dot)no / ) were used, and the highest scoring sgRNAs were selected from each algorithm.

[0646] Exchange ssDNA oligonucleotide design

[0647] A 400b ssDNA oligonucleotide was designed based on the genomic DNA sequence of the miRNA gene. The pre-miRNA sequence was located in the center of the oligonucleotide. Next, the multiple double-stranded siRNA sequences were exchanged with the multiple mature miRNA sequences to keep the guide (silencing) siRNA strand 100% complementary to the target. The sequence of the passenger siRNA strand was modified to retain the original miRNA structure, maintaining the same base pairing profile.

[0648] Exchange plasmid DNA design

[0649] A 4000bp dsDNA fragment was designed based on the genomic DNA sequence of the miRNA gene. The pre-miRNA sequence was located at the center of the dsDNA fragment. Next, the multiple double-stranded siRNA sequences were exchanged with the multiple mature miRNA sequences so that the guide (silencing) siRNA strand remained 100% complementary to the target. The sequence of the passenger siRNA strand was modified to retain the original miRNA structure and maintain the same base pairing profile. Finally, the fragment was cloned into a standard vector (e.g., pBluescript).

[0650] Long plasmid for exchange:

[0651] Plasmid-1: GEiGS_mir173_si-GFP_1 (SEQ ID NO: 31)

[0652] Plasmid-2: GEiGS_mir173_si-GFP_2 (SEQ ID NO: 32)

[0653] Plasmid-3: GEiGS_mir173_si-PDS_1 (SEQ ID NO: 33)

[0654] Plasmid-4: GEiGS_mir173_si-PDS_2 (SEQ ID NO: 34)

[0655] Plasmid-5: GEiGS_mir390a_si-GFP_1 (SEQ ID NO: 35)

[0656] Plasmid-6: GEiGS_mir390a_si-GFP_2 (SEQ ID NO: 36)

[0657] Plasmid-7: GEiGS_mir390a_si-PDS_1 (SEQ ID NO: 37)

[0658] Plasmid-8: GEiGS_mir390a_si-PDS_2 (SEQ ID NO: 38)

[0659] sgRNA sequence:

[0660] Arabidopsis mir-390A:

[0661] 1.CTATCCATCCTGAGTTTCATTGG (SEQ ID NO: 1);

[0662] 2.AAGAATCTGTAAAGCTCAGGAGG (SEQ ID NO: 2);

[0663] Arabidopsis mir-173:

[0664] 1.CTTGCAGAGAGAAATCACAGTGG (SEQ ID NO: 3);

[0665] 2.GCTTACACAGAGAATCACAGAGG (SEQ ID NO: 4);

[0666] List of exchanged endogenous miRNAs:

[0667] 1. Arabidopsis mir-390A

[0668] 2. Arabidopsis mir-173

[0669] ssDNA oligonucleotides for gene exchange:

[0670] Oligonucleotide-1: GEiGS_mir173_si-GFP_1 (5'→3') (SEQ ID NO: 5)

[0671] Oligonucleotide-2: GEiGS_mir173_si-GFP_2 (5'→3') (SEQ ID NO: 6)

[0672] Oligonucleotide-3: GEiGS_mir173_si-PDS_1 (5'→3') (SEQ ID NO: 7)

[0673] Oligonucleotide-4: GEiGS_mir173_si-PDS_2 (5'→3') (SEQ ID NO: 8)

[0674] Oligonucleotide-5: GEiGS_mir390a_si-GFP_1 (5'→3') (SEQ ID NO: 9)

[0675] Oligonucleotide-6: GEiGS_mir390a_si-GFP_2 (5'→3') (SEQ ID NO: 10)

[0676] Oligonucleotide-7: GEiGS_mir390a_si-PDS_1 (5'→3') (SEQ ID NO: 11)

[0677] Oligonucleotide-8: GEiGS_mir390a_si-PDS_2 (5'→3') (SEQ ID NO: 12)

[0678] sgRNA cloning

[0679] The transfection plasmid used is composed of 4 modules, including:

[0680] (1) mCherry driven by the CsVMV promoter (terminated by a G7 terminator sequence);

[0681] (2) 2x 35S::hCas9-35S-ter, i.e. hCas9 driven by the 35S promoter (terminated by the AtuNos terminator sequence)

[0682] (3) AtU6-26 and / or U6 synthetic promoter driving sgRNA of guide 1;

[0683] Plasmid design

[0684] For transient expression, a plasmid containing 3 transcription units was used. The first transcription unit contained the CsVMV promoter driving mCherry expression and the G7 terminator. The next transcription unit consisted of the 2x-35S promoter driving Cas9 expression and the 35S terminator. The third contained the Arabidopsis thaliana U6 promoter expressing sgRNAs to target multiple miRNA genes (each vector contained a single sgRNA).

[0685] Design and cloning of CRISPR / CAS9 to target miR-173 and miR-390 and introduction of SWAP to target GFP, AtPDS3, and AtADH1

[0686] The present inventors have designed changes in the mature miR-173 and miR-390 sequences to target GFP, AtPDS3 or AtADH1 in their genomic context by generating small RNAs that are reverse complementary to the multiple target genes, such as Figures 12A to 12G and Figures 13A to 13G In addition, in order to maintain the secondary structure of the miRNA precursor transcript, the pri-miRNA is further modified, such as Figures 12A to 12G, 13A to 13G, 14A to 14D and 15A to 15D and shown in Table 2 (see below). These fragments are cloned into multiple PUC plasmids and named as donors (DONORs), and the multiple DNA fragments are called SWAP. For the sequence of modified miR-173-SWAP1 and SWAP2 targeting GFP, SWAP3 and SWAP4 targeting AtPDS3, and SWAP9 and SWAP10 targeting AtADH1 (see Table 2 below). For the sequence of modified miR-390-SWAP5 and SWAP6 targeting GFP, SWAP7 and SWAP8 targeting AtPDS3, and SWAP11 and SWAP12 targeting AtADH1 (see Table 2 below).

[0687] Guide RNAs targeting miR-173 and miR-390 were introduced into the CRISPR / CAS9 vector system to generate a DNA shear in the desired miRNA locus. They were co-introduced into the plants with the donor (DONOR) vectors via a gene bombardment protocol to introduce the desired modifications via homologous DNA repair (HDR). These guide RNAs are detailed in Table 2 below and are Fig. 12A and 13A Shown in.

[0688] Table 2: Sequences and oligonucleotides used in the experiments

[0689]

[0690]

[0691]

[0692]

[0693]

[0694] Protoplast isolation

[0695] Plant materials (e.g., leaves, callus, cell suspensions) were incubated in an enzyme digestion solution (1% cellulase, 0.5% macrozyme, 0.5% driselase, 0.4 M mannitol, 154 mM NaCl, 20 mM KCl, 20 mM MES pH 5.6, 10 mM CaCl 2 ) incubated at room temperature with gentle shaking for 4 to 24 hours to isolate protoplasts. After enzyme digestion, the remaining plant material was washed with W5 solution (154 mM NaCl, 125 mM CaCl2 , 5 mM KCl, 2 mM MES pH 5.6) and the protoplast suspension was filtered through a 40 μm filter. After centrifugation at 80 g for 3 minutes at room temperature, the protoplasts were resuspended in 2 ml W5 buffer and precipitated by gravity in ice. The final protoplast pellet was resuspended in 2 ml MMg (0.4 M mannitol, 15 mM MgCl 2 The cells were then plated in 4 mM MES (pH 5.6) and the protoplast concentration was determined using a hemacytometer. Protoplast viability was estimated using Trypan Blue staining.

[0696] Polyethylene glycol (PEG)-mediated plasmid transfection

[0697] PEG transfection of protoplasts was achieved using a modified version of the strategy reported by Wang (Wang et al., Scientia Horticulturae, 2015, 191: 82-89). Protoplasts were resuspended in MMg solution (density 2×10 6 Up to 5×10 6 Protoplasts / ml). 100 to 200 μl of the protoplast suspension was added to a test tube containing the plasmid. The ratio of plasmid:protoplasts has a great influence on transformation efficiency, so a range of plasmid concentrations in the protoplast suspension was determined (5 to 300 μg / μl). PEG solution (100 to 200 μl) was added to the mixture and incubated at 23°C for various lengths of time ranging from 10 to 60 minutes. The concentration of PEG4000 was optimized and determined at 200 to 400 mM mannitol, 100 to 500 mM CaCl 2 The range of 20 to 80% PEG 4000 in the solution. The protoplasts were then washed in W5 and centrifuged at 80 g for 3 minutes, then resuspended in 1 ml W5 and incubated in the dark at 23° C. After 24 to 72 hours of incubation, fluorescence was detected by microscopy.

[0698] FACS sorting of fluorescent protein expressing cells

[0699] 24 to 72 hours after plasmid / RNA delivery, cells were collected using a flow cytometer and sorted for fluorescent protein expression to enrich for multiple cells expressing mCherry / editing agents as previously described (Chiang et al., Sci Rep, 2016, 6: 24356). This enrichment step allows bypassing antibiotic selection and only collecting cells that transiently express the fluorescent protein, Cas9, and the sgRNA. These cells can be further tested for editing of the target gene by HR to produce successful exchange events and corresponding loss of gene expression.

[0700] Bombardment and plant regeneration

[0701] Arabidopsis root preparation:

[0702] Multiple Arabidopsis thaliana (cv. Col-0) seeds sterilized with chlorine were sown on MS minus sucrose plates, vernalised for 3 days in the dark at 4°C, and then germinated vertically under constant light at 25°C. After 2 weeks, the roots were cut into 1 cm root segments and placed on Callus Induction Media (CIM: 1 / 2 MS (containing B5 vitamins), 2% glucose, pH 5.7, 0.8% agar, 2mg / l IAA, 0.5mg / l 2,4-D, 0.05mg / l kinetin) plates. After 6 days of incubation at 25°C in the dark, the root segments were transferred to filter paper discs and placed on CIMM plates (1 / 2 MS (without vitamins), 2% glucose, 0.4M mannitol, pH 5.7 and 0.8% agar) for 4 to 6 hours in preparation for bombardment.

[0703] bombardment

[0704] Multiple plasmid constructs were introduced into the root tissue via PDS-1000 / He particle delivery (Bio-Rad; PDS-1000 / He system #1652257), a procedure that required several preparative steps as outlined below.

[0705] Gold reserve preparation

[0706] 40 mg of 0.6 μm gold (Bio-Rad; Cat: 1652262) was mixed with 1 ml of 100% ethanol, pulse centrifuged to pellet, and the ethanol removed. This washing procedure was repeated two additional times.

[0707] After washing, the pellet was resuspended in 1 ml sterile distilled water and dispensed into 1.5 ml tubes (50 μl aliquot working volume).

[0708] Magnetic bead preparation

[0709] In short, do the following:

[0710] A single tube had enough gold to bombard 2 trays of Arabidopsis roots (2 shots per tray), therefore, each tube was divided between 4 (1,100 psi) Biolistic Rupture disks (Bio-Rad; Cat: 1652329).

[0711] Bombardment requires multiple plates of the same sample; to maintain sample consistency and minimize overall preparation work, combine tubes and adjust DNA and CaCl accordingly. 2 / volume of spermidine mixture.

[0712] The following protocol summarizes the process for preparing one test tube of gold and should be adjusted depending on the number of test tubes of gold being used.

[0713] All subsequent processes were performed in an Eppendorf thermomixer at 4°C.

[0714] Multiple plasmid DNA samples were prepared, each tube containing 11 μg of DNA added at a concentration of 1000 ng / μl.

[0715] (1) Add 493 μl ddHO 2 O was added to 1 aliquot (7 μl) of spermidine (Sigma-Aldrich; S0266) to a final concentration of 0.1 M spermidine. 1250 μl of 2.5 M CaCl 2 Add to the spermidine mixture, vortexed and place on ice.

[0716] (2) Place a test tube of pre-prepared gold in the thermomixer and rotate at a speed of 1400 rpm.

[0717] (3) Add 11 μl of DNA to the tube, vortex and place back on the rotating thermomixer.

[0718] (4) To bind DNA / gold particles, 70 μl spermidine CaCl 2 The mixture was added to each test tube (in the Thermomixer).

[0719] (5) Vortex the tubes vigorously for 15 to 30 seconds and place on ice for about 70 to 80 seconds.

[0720] (6) The mixture was centrifuged at 7000 rpm for 1 minute, and the supernatant was removed and placed on ice.

[0721] (7) Add 500 μl of 100% ethanol to each tube and resuspend the pellet by pipetting and vortexing.

[0722] (8) Centrifuge the multiple test tubes at 7000 rpm for 1 minute.

[0723] (9) Remove the supernatant, resuspend the pellet in 50 μl of 100% ethanol, and store on ice.

[0724] Macro carrier preparation

[0725] The following operations are performed in a laminar flow cabinet:

[0726] (1) Sterilize and dry multiple macrocarriers (Bio-Rad; 1652335), multiple stopping screens (Bio-Rad; 1652336), and multiple macrocarrier disk racks.

[0727] (2) Laying the plurality of macro carriers flat into the plurality of macro carrier disk racks.

[0728] (3) Vortex the multiple DNA-coated gold mixtures and dispense (5 μl) onto the center of each gene gun rupture disk.

[0729] Allow the ethanol to evaporate.

[0730] PDS-1000 (Helium Particle Delivery System)

[0731] In short, do the following:

[0732] Adjust the helium tank regulator to an incoming pressure of at least 1300 psi. Create a vacuum by pressing the vac / vent / hold switch and holding the fire switch for 3 seconds. This ensures that the helium is vented into the piping system.

[0733] Multiple 1100 psi rupture disks were placed in isopropyl alcohol and mixed to remove static electricity.

[0734] (1) Place a rupture disk into the disk retaining cap.

[0735] (2) Construct a microcarrier launch assembly (with a stop screen and a gold-containing microcarrier).

[0736] (3) Place a Petri dish with a cover of Arabidopsis root callus at 6cm below the transmitting assembly.

[0737] (4) Set the vacuum pressure to 27 inches of mercury and open the helium valve (approximately 1100 psi).

[0738] (5) Release the vacuum; remove the microcarrier launch assembly and the rupture disk fixing cover.

[0739] (6) Bombardment on the same tissue (i.e., bombardment on each plate twice).

[0740] (7) The bombarded roots were then placed on CIM plates in the dark at 25°C for another 24 hours.

[0741] Co-bombardment

[0742] When bombarding multiple combinations of multiple GEiGS plasmids, 5 μg (1000 ng / μl) of the sgRNA plasmid was mixed with 8.5 μg (1000 ng / μl) of the exchange plasmid, and 11 μl of this mixture was added to the sample. If more GEiGS plasmids were bombarded simultaneously, the concentration ratio of the multiple sgRNA plasmids to the multiple exchange plasmids used was 1:1.7, and 11 μg (1000 ng / μl) of this mixture was added to the sample. If multiple plasmids not related to the GEiGS exchange were co-bombarded, they were mixed in equal proportions and 11 μg (1000 ng / μl) of the mixture was added to each sample.

[0743] Plant regeneration

[0744] For shoot regeneration, a modified protocol from Valvekens et al. (Valvekens, D. et al., Proc Natl Acad Sci, USA, 1988, 85(15): 5536-5540) was followed. The bombarded roots were placed on Shoot Induction Media (SIM) plates containing 1 / 2 MS (containing B5 vitamins), 2% glucose, pH 5.7, 0.8% agar, 5 mg / l 2iP, 0.15 mg / l IAA. The plates were left in a cycle of 16 hours in the light at 25°C and 8 hours in the dark at 23°C. After 10 days, the plates were transferred to MS plates (containing 3% sucrose, 0.8% agar) for 1 week and then transferred to fresh similar plates. Once the plants were regenerated, they were cut from the roots and placed on MS plates (containing 3% sucrose, 0.8% agar) until analysis.

[0745] Colony formation and plant regeneration

[0746] Part of the plurality of fluorescent protein-positive cells were sampled and used for DNA extraction and genome editing (GE) testing, and part of them were plated in liquid culture medium at high dilutions to allow colony formation for 28 to 35 days. Multiple colonies were selected, grown and divided into two aliquots. One aliquot was used for DNA extraction and genome editing (GE) testing and CRISPR DNA-free testing (see below), while the other aliquots were kept in culture until their status was verified. Only those that were clearly shown to be GE and CRISPR DNA-free were screened forward. Multiple colonies grew in culture medium for about 6 to 10 weeks. Multiple original colonies (or calli) were subcultured into regeneration medium (e.g., half-strength MS+B5 vitamins, 20g / l sucrose). The regenerated multiple plants were placed on a solidified medium (0.8% agar) at a low light intensity of 28°C. After 2 months, multiple plants were transferred to soil and placed in a greenhouse with 80 to 100% humidity.

[0747] Virus inoculation and DNA delivery to Arabidopsis seedlings

[0748] Juice from Arabidopsis leaves infected with the TuMV infectious clone p35S::TuMV-GFP (0.1 mg / ml) was used for mechanical inoculation.

[0749] Plant propagation

[0750] Multiple clones sequenced and predicted to have lost expression of the multiple target genes and found to be devoid of the CRISPR system DNA / RNA will be propagated in large numbers and in parallel to differentiate multiple seedlings, from which functional assays are performed to test the desired traits.

[0751] Phenotypic analysis

[0752] As described above, for example by observing the pigmentation, florescence or morphology depending on the target gene.

[0753] Allyl alcohol selection

[0754] In order to select multiple plants containing allyl alcohol, 10 days after bombardment, multiple roots are placed on SIM medium. Multiple roots are immersed in 30mM allyl alcohol (Sigma-Aldrich, the United States) for 2 hours. Then the multiple roots are washed 3 times with MS medium and placed on multiple MS plates (containing 3% sucrose, 0.8% agar). The regeneration process is carried out as previously described.

[0755] Genotyping

[0756] Multiple tissue samples were processed and multiple amplicons were amplified according to the manufacturer's recommendations. MyTaq Plant-PCR Kit (BioLine BIO 25056) was used for shorter internal amplifications, while Phil Plant Direct PCR Kit (PhirePlant Direct PCR Kit) (Thermo Scientific; F-130WH) was used for longer external amplifications. Multiple oligonucleotides used for these amplifications are detailed in Table 2 above. Different modifications in the miRNA loci were determined by different enzyme cutting patterns of the multiple amplicons, as shown below:

[0757] For the modification of miR-390 - the length of the internal amplicon was 978 base pairs, while for the external amplification, it was 2629 base pairs. To identify swap 7, a fragment of 636 base pairs was obtained by digestion with NlaIII, while in the wt form, it was sheared into 420 and 216 long fragments. To identify swap 8, a fragment of 293 and 339 base pairs was obtained by digestion with Hpy188I, while in the wt form, this site was not present and a fragment of 632 was obtained. To identify swaps 11 and 12, a fragment of 662 base pairs was obtained by digestion with BccI, while in the wt form, it was sheared into 147 and 417 long fragments.

[0758] For the modification of miR-173 - the length of the internal amplicon was 574 base pairs, while for the nested external amplicon it was 466 base pairs. To identify exchange 3, digestion with BslI resulted in fragments of 217 and 249 base pairs in the external amplicon and 317 and 149 base pairs in the internal amplicon. In the wt version, this site was absent and resulted in a fragment of 466 in the external amplicon and a fragment of 574 in the internal reaction. To identify exchange 4, digestion with BtsαI resulted in fragments of 212 and 254 base pairs in the external amplicon and 212 and 362 base pairs in the internal amplicon. In the wt version, this site was absent and resulted in a fragment of 466 in the external amplicon and a fragment of 574 in the internal reaction. For identification of exchange 9, digestion with NlaIII resulted in fragments of 317 and 149 base pairs in the outer amplicon and 317 and 244 base pairs in the inner amplicon. In the wt version, this site was absent and resulted in a fragment of 466 in the outer amplicon and 561 in the inner reaction. For identification of exchange 10, digestion with NlaIII resulted in fragments of 375 and 91 base pairs in the outer amplicon and 375 and 186 base pairs in the inner amplicon. In the wt version, this site was absent and resulted in a fragment of 466 in the outer amplicon and 561 in the inner reaction.

[0759] DNA and RNA isolation

[0760] Multiple samples were collected into liquid nitrogen and stored at -80°C until processing. Tissue grinding was performed in multiple test tubes placed in dry ice using a plastic tissue grinder pestle (Tissue Grinder Pestle) (Axygen, USA). DNA and total RNA were isolated from the ground tissue using an RNA / DNA purification kit (cat.48700; Norgen Biotek Corp., Canada) according to the manufacturer's instructions. In the case of a low 260 / 230 ratio (<1.6) of the RNA fraction, the isolated RNA was precipitated overnight at -20°C with 1 μl of glycogen (cat.10814010; Invitrogen, USA) 10% V / V sodium acetate, 3M pH5.5 (cat.AM9740, Invitrogen, USA) and 3 volumes of ethanol. The solution was centrifuged at maximum speed for 30 minutes at 4°C. The cells were then washed twice with 70% ethanol, air-dried for 15 minutes, and resuspended in nuclease-free water (cat. 10977035; Invitrogen, USA).

[0761] Reverse transcription (RT) and quantitative real-time PCR (qRT-PCR)

[0762] According to the manufacturer's manual (AMPD1; Sigma-Aldrich, USA), 1 μg of isolated total RNA was treated with DNase I. The sample was reverse transcribed according to the instruction manual of High-Capacity cDNA Reverse Transcription Kit (cat. 4368814; Applied Biosystems, USA).

[0763] For gene expression, the cells were expressed in CFX96 Touch TM Real-time PCR detection system (BioRad, USA) and Green JumpStart TM Taq ReadyMix TM Quantitative real-time PCR (qRT-PCR) analysis was performed on a Sigma-Aldrich (S4438, USA) and analyzed using the Bio-Rad CFX manager program (version 3.1). For the analysis of AtADH1 (AT1G77120), the following primer set was used: forward GTTGAGAGTGTTGGAGAAGGAG (SEQ ID NO: 367) and reverse CTCGGTGTTGATCCTGAGAAG (SEQ ID NO: 368); for the analysis of AtPDS3 (AT4G14210), the following primer set was used: forward GTACTGCTGGTCCTTTGCAG (SEQ ID NO: 369) and reverse AGGAGCACTACGGAAGGATG (SEQ ID NO: 370); for the endogenous calibration gene, the 18S ribosomal RNA gene (NC_037304) was used - forward ACACCCTGGGAATTGGTTT (SEQ ID NO: 371) and reverse GTATGCGCCAATAAGACCAC (SEQ ID NO: 372).

[0764] Example 1A

[0765] Genome editing-induced gene silencing (GEiGS)

[0766] In order to design multiple GEiGS oligonucleotides, multiple template non-coding RNA molecules (multiple precursors) need to be processed and multiple small silencing RNA molecules (multiple matures) are derived. Two sources of multiple precursors and their corresponding mature sequences are used to generate multiple GEiGS oligonucleotides. For multiple miRNAs, multiple sequences are obtained from the miRBase database (Kozomara, A. and Griffiths-Jones, S., Nucleic Acids Res, 2014, 42: D68, ). Multiple tasiRNA precursors and multiple mature forms were obtained from the tasiRNAdb database (Zhang, C. et al., Bioinformatics, 2014, 30: 1045, ).

[0767] Multiple silencing targets were selected in various host organisms (see Table 1B above). The siRNArules software (Holen, T., RNA, 2006, 12: 1620, ) design multiple siRNAs for these targets. Each of these siRNA molecules is used to replace the multiple mature sequences present in each precursor, thereby generating multiple "naive" GEiGS oligonucleotides. The structures of these inexperienced sequences are adjusted to be as close as possible to the structure of the wild-type precursor using the Vienna RNA Package v2.6 (Lorenz, R. et al., Vienna RNA Package 2.0, Algorithms for Molecular Biology, 2011, 6: 26). After adjusting the structure, the number of multiple sequences and the changes in secondary structure between the wild-type oligonucleotide and the modified oligonucleotide are calculated. These calculations are essential for identifying multiple potentially functional GEiGS oligonucleotides, which require minimal sequence changes relative to the wild type.

[0768] The CasOT software (Xiao, A. et al., Bioinformatics, 2014, 30: 1180, ) generate multiple CRISPR / cas9 small guide RNAs (sgRNAs) for the multiple wild-type precursors (see Table 1B above). Select multiple sgRNAs, wherein the modification used to generate the GEiGS oligonucleotide affects the PAM region of the sgRNA, making it ineffective for the modified oligonucleotide.

[0769] Example 1B

[0770] Gene Silencing of Endogenous Plant Genes - PDS

[0771] To establish a high-throughput screen to quantitatively assess endogenous gene silencing using genome editing-induced gene silencing (GEiGS), the inventors considered several potential visual markers. The inventors chose to focus on multiple genes involved in pigment accumulation, for example, the gene encoding phytoene desaturase (PDS). PDS silencing can lead to photobleaching ( Figure 2B ), which enables its use as a reliable seedling screening as proof-of-concept (POC) after gene editing. Figures 2A to 2C A representative experiment of PDS silencing on N. benthamiana and Arabidopsis plants is shown. Plants show the characteristic photobleaching phenotype observed in plants with low amounts of carotenoids.

[0772] In the POC experiment, the steps for selecting multiple siRNAs are as follows:

[0773] In order to initiate the RNAi mechanism against the PDS gene in Arabidopsis or Nicotiana benthamiana using the GEiGS application, it is necessary to identify effective 21 to 24 bp siRNAs targeting PDS. To find multiple active siRNA sequences, two approaches were used: (1) Screening the literature: Since PDS silencing is a well-known assay in many plants, the inventors are identifying multiple well-characterized short siRNA sequences in different plants that may match 100% with the gene in Arabidopsis or Nicotiana benthamiana. (2) There are many published algorithms that are being used to predict which siRNA will initiate gene silencing for a specific gene. Since the multiple predictions of these algorithms are not 100%, the inventors only used sequences that were the results of at least two different algorithms.

[0774] In order to use multiple siRNA sequences that silence the PDS gene, the inventors are using the CRISPR / Cas9 system to exchange them with a known endogenous non-coding RNA gene sequence (e.g., changing a miRNA sequence, changing a long dsRNA sequence, generating antisense RNA, changing tRNA, etc.). There are many databases of characterized non-coding RNAs, such as miRNAs; the inventors are selecting several known endogenous non-coding RNAs of Arabidopsis or Nicotiana benthamiana, for example, multiple miRNAs with different expression patterns (e.g., low constitutive expression, high expression, stress-induced, etc.). For example, in order to exchange the endogenous miRNA sequence with the siRNA targeting the PDS gene, the inventors are using the HR method (Homologous Recombination). Using HR, two options can be considered: using a donor ssDNA oligonucleotide sequence of approximately 250 to 500 nt, which for example contains the modified miRNA sequence in the middle, or using plasmids carrying 1 Kb to 4 Kb inserts that are almost 100% identical to the miRNA nearby in the plant genome, except for 2 x 21 bp of the miRNA and the *miRNA is changed to the siRNA of the PDS (500 to 2000 bp upstream and downstream of the siRNA, e.g. Figure 1 ). The transfection contains the following multiple constructs: a CRISPR:Cas9 / GFP sensor for tracking and enriching multiple positive transformed cells, multiple gRNAs that guide the Cas9 to create a double-strand break (DSB) (repaired by HR depending on the insertion vector / oligonucleotide). The insertion vector / oligonucleotide contains two consecutive homology regions surrounding the targeted locus, and the multiple regions are replaced (i.e., miRNA) and modified to carry the mutation of interest (i.e., siRNA). If a plasmid is used, the targeted construct includes or does not include multiple restriction enzymes-recognition sites and is used as a template for a homologous recombination, ending with the replacement of the miRNA with the selected siRNA. After transfection into multiple protoplasts, FACS is used to enrich for Cas9 / sgRNA transfection events, multiple protoplasts are regenerated into multiple plants, and multiple bleached seedlings are screened and scored (see Figure 1). As a control group, multiple protoplasts are transfected with an oligonucleotide carrying a random non-PDS targeting sequence. The multiple positively edited plants are expected to produce multiple siRNA sequences targeting PDS, so the PDS gene is silenced and the seedlings are seen as white compared to the control group without gRNA. It should be noted that after the exchange, the edited miRNA will still be processed as miRNA because the original base pairing shape is retained. However, the newly edited processed miRNA has a high complementarity with the target (e.g., 100%), so in fact the newly edited small RNA will act as siRNA.

[0775] Example 2

[0776] Gene silencing of an “endogenous” transgene - GFP

[0777] Another quick and reliable way to check the efficiency of GEiGS is by silencing a transgene that is also a marker gene, such as GFP (green fluorescent protein). There are several simple methods to assess the effectiveness of the GFP silencing in the cells, such as FACS analysis, PCR, and microscopy. To illustrate the POC of GFP silencing using GEiGS, the inventors are using a transgenic Arabidopsis or tobacco line that stably expresses GFP. Protoplasts from multiple GFP-expressing plants are used with the GEiGS method to modify endogenous non-coding RNAs, such as miRNAs as siRNAs, effectively to initiate the RNA silencing mechanism targeting the GFP gene. As shown in Figure 3, the multiple positively edited plants are expected to silence GFP expression. In addition, GFP silencing in multiple plants is well characterized, and there are many available short RNA sequences (siRNAs) that can be used to initiate GFP silencing. Therefore, in order to perform gene exchange, the inventors are using multiple publicly available tools to produce siRNAs specific for GFP, or are using multiple known siRNA molecules available from the literature.

[0778] In order to use multiple siRNA sequences that will silence the GFP gene, the inventors use the CRISPR / Cas9 system to exchange them with a known endogenous non-coding RNA (e.g., miRNA gene sequence), (e.g., change a miRNA sequence, change a long dsRNA sequence, generate antisense RNA, change tRNA, etc.). There are many databases of characterized non-coding RNAs, for example, multiple miRNAs, and the inventors are selecting several known Arabidopsis or Nicotiana benthamiana non-coding RNAs, for example, multiple miRNAs with different expression patterns (e.g., low constitutive expression, high expression, stress-induced, etc.). For example, in order to exchange the endogenous miRNA sequence with siRNA, the inventors are using the HR method. In HR, two options can be considered: using a donor oligonucleotide sequence of about 250 to 500 nt, which for example contains the siRNA sequence in the middle, or using plasmids expressing 1 Kb to 4 Kb inserts that are almost 100% identical to the miRNA nearby in the plant genome, except for 2 x 21 bp of the miRNA and the *miRNA is changed to the siRNA for the GFP (500 to 2000 bp upstream and downstream of the siRNA, see Figure 1 ). The transfection comprises the following multiple constructs: a CRISPR:Cas9 / RFP sensor for tracking and enriching multiple positive transformed cells (e.g., using FACS analysis), multiple gRNAs that guide the Cas9 to create a DSB (repaired by HR depending on the insertion vector / oligonucleotide). The insertion vector contains two consecutive homology regions surrounding the targeted locus, and the multiple regions are replaced (i.e., miRNA) and modified to carry the mutation of interest (i.e., siRNA). The targeted construct includes or does not include multiple restriction enzyme recognition sites and is used as a template for a homologous recombination, ending with the replacement of the miRNA by the selected siRNA. After transfection into multiple protoplasts, FACS is used to enrich for positive transfection events (using the red fluorescent protein (RFP) marker), and the GFP silencing of the enriched multiple protoplasts is scored under a microscope ( Figure 4 ). The multiple positively edited protoplasts are expected to produce multiple siRNA sequences targeting GFP, and therefore, the GFP expression of the transgene is expected to be silenced compared to the control protoplasts. GFP is a faster method than PDS because the last two steps of recovery and regeneration are not required and scoring can be performed at the multiple protoplast / cell level.

[0779] Example 3

[0780] Gene Silencing of Exogenous Transgenes - GFP in Arabidopsis

[0781] In addition to the previous example of GFP silencing, another method to demonstrate the efficiency of GEiGS is by silencing a marker gene similar to GFP (green fluorescent protein) in a transient GFP conversion assay. In this example, multiple first plant cells (e.g., Arabidopsis) are treated with GEiGS to express multiple small siRNA molecules targeting GFP (the method of using siGFP is discussed in Example 2 above). Then, control protoplasts (e.g., GEiGS-PDS) and protoplasts edited with GEiGS (expressing siGFP) are transfected with a plasmid expressing two markers (sensors) GFP+RFP respectively. Multiple protoplasts that only express RFP but not GFP in the GEiGS treatment are the result of GFP silencing due to siGFP expression (e.g., Figure 5 ).

[0782] Example 4

[0783] Plants immune to viral infection, silencing of exogenous viral genes (using GFP as a marker)

[0784] To demonstrate that GEiGS is a reliable method for plant immunity with the ability to knock out multiple exogenous genes, the inventors provided an example of silencing a viral gene. There are many viruses that can infect different plant species and can be used in the current POC: TuMV, CMV, TMV, etc.

[0785] Turnip mosaic virus (TuMV) is a non-persistently transmitted disease of cruciferous crops in many parts of the world. The TuMV genome is a single-stranded, positive-sense RNA molecule of approximately 10,000 nt (Accession No.: NC_002509). TuMV has the same typical potato virus Y gene organization as previously discussed by Urcuqui-Inchima et al. (Urcuqui-Inchima et al., Virus Res., 2001, 74: 157 to 175). The symptoms of TuMV are widespread, yellow, circular and irregularly area spots. The oldest leaves usually turn bright yellow everywhere. The leaves (lamina) are often necrotic. TuMV-GFP and suppression-deficient TuMV-AS9-GFP are widely used to expose antiviral silencing activity in Arabidopsis. Multiple wild-type plants were immune to TuMV-AS9-GFP, but immunity was effectively suppressed by loss of DCL2 and DCL4, suggesting that TuMV generally masks the effects of an siRNA-dependent antiviral response (Hernan Garcia-Ruiz et al., The Plant Cell, 2010, 22: 481-496).

[0786] Cucumber mosaic virus (CMV) is a plant pathogenic virus of the Bromoviridae family. It is a type member of the plant virus genus Cucumovirus. The virus is distributed worldwide and has a very wide host range. In fact, it is known for having the widest host range of any known plant virus. It can be transmitted mechanically from plant to plant through sap and by aphids in a stylet-borne manner. The virus was first discovered in cucumbers (Cucumis is ativus) showing mosaic symptoms in 1934, hence the name cucumber mosaic. An expression vector based on CMV expression was developed that utilizes the mutant 3a MP for CP-independent cell-to-cell movement. This new vector (Fujiki et al., Virology, 2008, 381(1):136-142) was integrated into an Agrobacterium binary vector and delivered to multiple plants by agroinfiltration. The results showed that this novel CMV-based expression vector has broad application prospects for recombinant protein production.

[0787] Tobacco mosaic virus (TMV) is a single-stranded RNA virus that usually infects solanaceous plants, a family of plants that includes many species such as petunia, tomatoes, and tobacco. The virus forms a mosaic pattern of brown spots on the surface of multiple leaves. The virus does not usually cause the plant to die, but it may seriously hinder its growth. In hot and dry weather, lower leaves may suffer from "mosaic burn", and large areas of leaves will die. The virus cannot enter multiple plants on its own. Multiple plants are usually infected through multiple plant wounds after human treatment or through contaminated equipment. Once in the plant, the virus releases its genetic code (RNA). The plant is confused by this code, mistakenly thinking it is its own, and begins to produce multiple viral proteins. Virus-based expression systems in plants are particularly attractive relative to alternative transient expression systems because of their high level of gene proliferation and the ability to simultaneously achieve high expression levels in a short period of time while minimizing damage to host activities. TMV is one of the most extensively studied plant viruses and has therefore become a natural choice for vector development. TMV-based vectors result in recombinant protein yields as high as 80% of total soluble protein. Agrobacterium infection is an inexpensive and reproducible method, making it a preferred method for delivering viral expression vectors to plant tissues as part of the T-DNA of a binary vector carried by Agrobacterium tumefaciens.

[0788] The inventors used TuMV-GFP for infection of Arabidopsis or TMV-GFP for various tobacco plants. In order to produce multiple plants resistant to viral infection, the inventors used an engineered virus that expresses GFP after plant infection. Using this virus will allow the use of the same constructs as described in Example 3 above. The difference is that now the GFP is expressed by the viral infection. Control plants infected with viral GFP (CMV or TMV) showed expression of GFP under a microscope ( Figure 6 ), however, multiple GEiGS plants engineered to express siRNA GFP showed expectedly reduced levels of GFP ( Figure 6). Therefore, the generation of multiple GEiGS plants without GFP expression after infection with viral-GFP will demonstrate that RNAi silencing of exogenous genes has been achieved, and GEiGS is an effective method to immunize multiple plants against viruses and other potential pathogens. There are several simple methods to evaluate the effectiveness of the GFP silencing in the cells, for example, using FACS analysis, PCR and microscopy. GFP silencing in multiple plants is well characterized, and there are many available short RNA sequences (siRNA) that are active in initiating GFP silencing. Therefore, to perform gene exchange, the inventors used several known siRNA molecules available from the literature.

[0789] In order to use multiple siRNA sequences that will silence the GFP gene, the inventors use the CRISPR / Cas9 system to exchange them with a known endogenous non-coding RNA (e.g., miRNA gene sequence), (as described above, there are many other options for introducing these siRNA sequences, such as changing multiple long dsRNA sequences, generating antisense RNA, changing tRNA, etc.). There are many databases of characterized endogenous non-coding RNAs, such as multiple miRNAs, and the inventors are selecting several known Arabidopsis or Nicotiana benthamiana non-coding RNAs, such as multiple miRNAs with different expression patterns (e.g., low constitutive expression, high expression, stress-induced, etc.). For example, in order to exchange the endogenous miRNA sequence with siRNA, the inventors are using the HR method. In HR, two options can be considered: using a donor oligonucleotide sequence of about 250 to 500 nt, which for example contains the siRNA sequence in the middle, or using plasmids expressing 1 Kb to 4 Kb inserts, which are almost 100% identical to the miRNA nearby in the plant genome, except for 2x21 bp of the miRNA and the *miRNA is changed to the siRNA of the GFP (500 to 2000 bp upstream and downstream of the siRNA, see Figure 1). The transfection comprises the following multiple constructs: a CRISPR:Cas9 / RFP sensor for tracking and enriching multiple positive transformed cells (e.g., using FACS analysis), multiple gRNAs that guide the Cas9 to create a DSB (repaired by HR depending on the insertion vector / oligonucleotide). The insertion vector contains two consecutive homology regions surrounding the targeted locus, and the multiple regions are replaced (i.e., miRNA) and modified to carry the mutation of interest (i.e., siRNA). The targeted construct includes or does not include multiple restriction enzyme recognition sites and is used as a template for a homologous recombination, ending with the replacement of the miRNA by the selected siRNA. After transfection into multiple protoplasts, FACS is used to enrich for positive transfection events, multiple protoplasts are regenerated into multiple plants, and multiple plants are infected with the virus by mechanical inoculation. GFP silencing of multiple plants is scored under a microscope (e.g., Figure 6 The multiple positively edited protoplasts carrying GEiGS are expected to produce multiple siRNA sequences targeting GFP, and thus, the viral GFP gene expression is expected to be silenced compared to the control unedited plants.

[0790] Example 5

[0791] Nematode-resistant banana plants

[0792] The damage done by nematodes to banana productivity is enormous, with up to 50% of yield losses in untreated soils. The problem is exacerbated in traditional banana plantations, where monocropping is a common practice. The banning of nematicides such as methyl bromide around the world has exacerbated the problem and left farmers with inadequate and unreliable alternatives. The banana burrowing nematode (Radopholus similis) (the burrowing nematode) is the most economically important nematode parasite in bananas worldwide. Infection with the burrowing nematode causes toppling disease in bananas, yellows disease in peppers, and spreading decline in citrus. These diseases are the result of burrowing nematode infection destroying root tissue, leaving multiple plants with little ability to support or absorb water and transfer nutrients. The burrowing nematode is one of the most regulated nematode plant pests due to the damage it causes to citrus, ornamentals, and other agricultural industries worldwide. Figure 7 ).

[0793] RNA interference (RNAi) has become an extremely useful gene silencing tool for functional analysis in a variety of organisms, especially the free-living nematode Caenorhabditis elegans. An increasing number of studies describe its use in plant-parasitic nematodes. When multiple nematodes absorb multiple double-stranded RNAs (dsRNAs) or short interfering RNAs (siRNAs) that elicit a systemic RNAi response, genes expressed in multiple cell types are silenced. Extensive siRNA studies in C. elegans have shown that the successful prevention of the nematode from completing its life cycle is due to multiple silenced genes expressed early in embryonic development. In the banana nematode, these candidate genes may be calreticulin 13 (CRT) or the gene collagen 5 (col-5). CRT is a Ca2 + The multifunctional protein combined plays a key role in parasitism, immune evasion, reproduction and pathogenesis of many animal parasites and plant nematodes. Therefore, CRT is a promising target for controlling the banana nematode. Col-5 belongs to the multiple collagen genes of nematodes, which are used to encode proteins with multiple functions. Among them, their most abundant product is cuticular collagen, which contains about 80% of the protein in the nematode cuticle. So far, it has been found that the structure of these collagens is very similar in free-living and parasitic nematode species, and the multiple genes used to encode them seem to constitute a large multigene family, whose expression is developmentally regulated.

[0794] By using GEiGS, the inventors have created banana plants expressing siRNA molecules that are delivered from their roots to nematodes when feeding, subsequently inducing silencing of nematode genes. Silencing of genes that are essential in the life cycle inhibits nematode reproduction and eliminates damage caused by nematodes. The inventors are altering some banana endogenous non-coding RNAs, for example, miRNA sequences with short sequences from the CRT or col-5 genes. GEiGS is used in banana protoplasts, which are regenerated into plants that are then screened for resistance with different nematodes.

[0795] Example 6

[0796] Resistance of banana plants to Fusarium oxysporum

[0797] The genus Fusarium contains several fungal species, which are widely distributed in soil and organic substrates around the world. Fusarium oxysporum is one of the most relevant species in this genus and is the causative agent of root rot, damping-off and wilt disease in more than 100 plant species, including a variety of economically important horticultural crops, flowers, trees and some field crops (e.g., cabbage, banana and cotton). Fusarium oxysporum is a devastating pathogen that causes a large amount of yield losses in a variety of crops, so it is crucial to develop sustainable and environmentally friendly methods to improve crop resistance. Fusarium oxysporum consists of more than 120 special forms of pathogenic strains determined by its main host plants. All Fusarium oxysporum strains are saprophytic, able to grow and survive for a long time on organic matter in the soil, and are therefore difficult to control. Its pathogenic life cycle begins spore germination after identifying a suitable host. Once hyphae are formed, the pathogen enters its host by directly penetrating the multiple roots and colonizes in the xylem by producing microconidia that cause mycelium formation. The host vasculature is blocked by colonization and toxin production by the pathogen, causing multiple characteristic disease symptoms, including vascular yellowing, vein clearing, chlorosis, and necrosis, leaf shedding and wilting in the veins and leaves. After the plant dies, the fungus forms spores on the surface of decaying leaves. Fusarium oxysporum is most common in tropical and subtropical regions, and its geographic range is expected to expand due to climate change. Due to the large host range and persistence in the soil, the current control methods for Fusarium wilt are very limited, and crop rotation is ineffective. The treatment of Fusarium wilt is mainly carried out through cultural customs and farm hygiene, which can only reduce the spread of inoculum, and soil sterilization can only be carried out in greenhouses. Soil fumigation using broad-spectrum biocides (eg, methyl bromide) is expensive and has many environmental hazards.

[0798] Hu z. has used host-delivered RNA interference technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus F. oxysporum f. sp. Conglutinans (Hu et al., Front Chem., 2015, 20(3): 1). The expression of multiple double-stranded RNA (dsRNA) molecules targeting multiple fungal pathogen genes was achieved in many transgenic Arabidopsis lines. Fusarium oxysporum infection of the multiple transgenic lines showed significantly reduced mRNA levels in all three targeted genes, with an average reduction of 75%, 83% and 72% for FOW2, FRP1 and OPR, respectively. Silencing of multiple pathogen genes had a significant positive effect on the ability of the transgenic lines to resist infection. All transgenic lines showed enhanced resistance to Fusarium oxysporum and delayed the development of disease symptoms, especially the FRP1 and OPR lines. After fungal infection, the survival rate of the multiple transgenic lines was higher than that of the control wild-type line plants, which consistently showed a survival rate of 10%, while the FOW2 line showed a survival rate of 25%; the survival rate of the FRP1 line was 30 to 50%, and the survival rate of the OPR was between 45% and 70%. The down-regulation was specific to the multiple targeted genes, and there were no unexpected effects in multiple related genes (Hu Z., 2015, supra). The results show that in fungi, both long dsRNA and short dsRNA are internalized and induce RNAi to silence multiple target genes.

[0799] The inventors are using GEiGS to generate banana plants resistant to Fusarium oxysporum by altering a small amount of endogenous non-coding RNAs (e.g., miRNA sequences to specifically target the fungal genes, e.g., FOW2, FRP1, and OPR). Edited protoplasts were regenerated into plants and challenged with Fusarium oxysporum in a controlled environment, verifying that the resistant plants expressed the relevant siRNAs.

[0800] Example 7

[0801] Coffee tree resistance to nematodes

[0802] Coffee is a species of flowering plant whose seeds, known as coffee beans, are used to make a variety of coffee beverages and products. It is a member of the Rubiaceae family. They are shrubs or small trees native to tropical and southern Africa and tropical Asia. Coffee is considered one of the most valuable and widely traded commodity crops in the world and is an important export product for several countries including Central and South America, the Caribbean, and Africa. The continuous decline in coffee production has been attributed to biological and socio-economic limitations. Among the less studied biological limiting factors are nematodes.

[0803] Plant parasitic nematodes are considered a serious limitation to coffee production worldwide, especially in Vietnam ( Figure 8 ). The dominant and most important species are the Arabica coffee borer (Radopholus arabocoffeae) and the coffee root rot nematode (Pratylenchus coffeae). These two species are responsible for the mortality of plants younger than 5 years old. Traditionally, the main method of controlling coffee root rot nematodes is by chemical means, but there is no specific control strategy for the Arabica coffee borer nematode.

[0804] The inventors are using the GEiGS strategy (as described in Example 5 above) to create Coffea canephora (Robusta) trees expressing siRNA molecules that are delivered from their roots to nematodes while feeding, subsequently inducing silencing of nematode genes. Silencing of genes that are continuously essential in the life cycle inhibits nematode reproduction and eliminates damage caused by nematodes. Therefore, the inventors are altering some endogenous non-coding RNAs, for example, miRNA sequence RNAs with short sequences from the nematode genes. GEiGS is used on coffee protoplasts, which are regenerated into plants, which are then screened for resistance with different nematodes.

[0805] Example 8

[0806] Generation of plants with modified endogenous miRNAs to target different genes

[0807] Minimal modifications in the genomic locus of a miRNA (in its recognition sequence) which will mature into a miRNA can lead to a new system for regulating new genes in a non-transgenic manner. Therefore, an Agrobacterium-free transient expression method was used to introduce these modifications by bombarding Arabidopsis roots and further analyzing their regeneration. The inventors have chosen to target two genes in Arabidopsis plants, PDS3 and ADH1.

[0808] Carotenoids play an important role in many physiological processes in various plants, and silencing of the phytoene dehydrogenase gene (PDS3), which encodes one of the important enzymes in the carotenoid biosynthesis pathway, produces an albino / bleached phenotype. Thus, plants with reduced PDS3 expression exhibit reduced chlorophyll levels, up to complete albinism and dwarfism.

[0809] Alcohol dehydrogenase (ADH1) comprises a group of dehydrogenases that catalyze the interconversion between multiple alcohols and multiple aldehydes or multiple ketones while reducing NAD+ or NADP+. The main metabolic purpose of this enzyme is to decompose alcoholic toxic substances in multiple tissues. Multiple plants with reduced ADH1 expression show increased tolerance to allyl alcohol. Therefore, plants with reduced ADH1 are resistant to the toxic effects of allyl alcohol, so their regeneration is carried out by allyl alcohol selection.

[0810] Two established miRNAs were selected for modification, namely miR-173 and miR-390, which have previously been shown to be expressed throughout plant development (Zielezinski A et al., BMC Plant Biology, 2015, 15:144). To introduce the modifications, a two-component system was used. First, the CRISPR / CAS9 system was used to modify the target gene by designing multiple specific guide RNAs ( Fig. 12A and 13A ; and Table 2 above) to generate a shear in the miR-173 and miR-390 loci to promote homologous DNA repair (HDR) in the loci. Secondly, a donor sequence (with the required modifications of the miRNA sequence) was introduced as a template for the HDR to target the newly assigned multiple genes ( Figures 12A to 12G , 13A to 13G, 14A to 14D and 15A to 15D; Table 2 above). In addition, since the secondary structure of the primary transcript of the miRNA (pri-miRNA) is important for the correct biogenesis and activity of the mature miRNA, further modifications were introduced into the complementary strand in the pri-miRNA and analyzed in mFOLD (www(dot)unafold(dot)rna(dot)Albany(dot)edu) for structural protection ( Figures 12A to 12G In total, two guides were designed for each miRNA locus, and two different donor sequences (modified miRNA sequences) were designed for each gene ( Figures 14A to 14D and 15A to 15D, and Table 2 above).

[0811] Example 9

[0812] Bombardment and plant regeneration

[0813] Multiple GEiGS constructs were bombarded into multiple pre-prepared roots (as discussed in detail in the Materials and Experimental Procedures section above) and regenerated. Multiple plants were screened by the bleaching phenotype of multiple PDS3 transformants and the survival of multiple ADH1 transformants under allyl alcohol treatment. To verify the exchange compared to no exchange (i.e., retention of wild type), these plants were then screened by insertion of multiple specific primers spanning the modified region, followed by restriction enzyme digestion ( Fig.16 ).

[0814] Example 10

[0815] Genotypic validation of phenotypic selection

[0816] As described above, a proof-of-concept (POC) of the gene editing system was established using the well-known phenotypic traits, phytoene dehydrogenase (PDS3) and alcohol dehydrogenase (ADH1) as multiple targets.

[0817] As mentioned above, multiple plants with reduced ADH1 expression show increased tolerance to allyl alcohol. Therefore, the bombarded plants (modified miRNA is to target ADH1) were regenerated in a culture medium containing 30mM allyl alcohol, and the regeneration rate was compared with that of the control group plants. Compared with 51 control group plants on the allyl alcohol culture medium, 118 GEiGS#3+SWAP11 allyl alcohol selected plants survived (data not shown). In the selected GEiGS#3+SWAP11, 5 were shown to contain the donor (data not shown). In the plants processed by the multiple donors, regenerating a large amount of plants may also be due to the transient expression in the bombardment process.

[0818] Therefore, the bleaching phenotype ( Fig.16 ) and allyl alcohol selection ( Fig.17 ) for PDS3 and ADH1 selection, providing an ideal method for genotyping selection of transformed plants.

[0819] The 4 kb exchange region was evaluated primarily by differentiation of specific amplicons from multiple internal primers and the original wild type (insertion of the variant by restriction endonuclease digestion).

[0820] ADH1( Fig.17 ) shows that when compared to restrictive and non-restrictive donor plasmids, allyl alcohol selected plants have a comparative genotype with the expected restriction pattern of the donor. PDS3 ( Fig.16) shows a comparison of the phenotypes of multiple bombardment samples with and without donors and their respective differential restriction endonuclease digestion patterns when compared to restrictive and non-restrictive donor plasmids. These results provide a clear association of the PDS3 albino / bleached phenotype with the expected restriction pattern. External PCR was then performed, combining specific internal and external primers (external to and specific to the genomic region) within the exchange region to perform the exchange (data not shown). To assess the presence of heterozygous, homozygous or donor exchanges, further verification of the exchange was obtained by Sanger sequencing of the multiple PCR amplicons (data not shown).

[0821] Example 11

[0822] Modified miRNAs reduce the expression of their novel target genes

[0823] To verify the potential of the modified miRNAs in the GEiGS system to downregulate the expression of their newly designated targets, gene expression analysis was performed using qRT-PCR (quantitative real-time PCR). RNA was extracted and reverse transcribed from the positively identified regenerated plants and compared to regenerated plants, processed in parallel but without the introduction of the relevant modified constructs. In the case of miR-173 modified to target PDS3 (GEiGS#4+SWAP4), an average reduction of 83% ( Fig.18 Similar changes in gene expression were observed in plants modified with miR-390 to target ADH1 (GEiGS#3+SWAP11), accounting for 82% of the levels in control plants ( Fig.19 ). Taken together, these results demonstrate the multiple gene editing methods of modifying multiple endogenous miRNAs to successfully target multiple new genes and reduce their expression by replacing the target recognition sequence in the miRNA transcripts in the endogenous loci.

[0824] Although the present invention has been described in conjunction with specific embodiments of the present invention, it is apparent that many substitutions, modifications and variations will be apparent to those skilled in the art. Therefore, it is intended to cover all such substitutions, modifications and variations that fall within the spirit and broad scope of the appended claims.

[0825] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety, to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, the citation or identification of any reference in this application should not be construed as an admission that the reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. Sequence Listing <110> Tropical Biosciences UK Ltd Ayr, Maori Aaron, Galenti Christina, Pinocchio Angela, Chaparro, Garcia Offill, Mel <120> Methods for modifying the specificity of plant noncoding RNA molecules for silencing gene expression <130> 74277 <150> Great Britain 1715113.5 <151> 2017-09-19 <150> Great Britain 1715116.8 <151> 2017-09-19 <150> Great Britain 1719516.5 <151> 2017-11-23 <160> 417 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Arabidopsis thaliana <400> 1 ctatccatcc tgagtttcat tgg 23 <210> 2 <211> twenty three <212> DNA <213> Arabidopsis thaliana <400> 2 aagaatctgt aaagctcagg agg 23 <210> 3 <211> twenty three <212> DNA <213> Arabidopsis thaliana <400> 3 cttgcagaga gaaatcacag tgg 23 <210> 4 <211> 23 <212> DNA <213> Arabidopsis thaliana <400> 4 gcttacacag agaatcacag agg <210> 5 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Oligo-1: GEiGS_mir173_si-GFP_1 <400> 5 gcataaaaaa gtcaacaaaa cttaaagcgg cggtctcatc gtaatctcag cccaataccc 120. tattttcctc tcccctatat aaatactttc ttcttctact gatcttcttc tcacaaataa acccaatat atcaatctac tgtgttggtg attachment tagtcgtgc tgcttcatgt ggagtggtca aaaaagttgt agttttctta aagtctcttt cctctccaca tagcaggac gagttagag cttgctccct aaacttatct ctctgatgat ttaatgttag agatcttcgt aaatctatgt gtttgataga tctgatgcgt tttttgagtt gatgatttga ttattttca ctggaagta tctcattagg gtaacgataa tgttttatgg <210> 6 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Oligo-2: GEiGS_mir173_si-GFP_2 <400> 6 gcataaaaaa gtcaacaaaa cttaaagcgg cggtctcatc gtaatctcag cccaataccc 120. tattttcctc tcccctatat aaatactttc ttcttctact gatcttcttc tcacaaataa acccaatat atcaatctac tgtgttggtg attachment tagttgtact ccagcttgtg ccagtggtca aaaaagttgt agttttctta aagtctcttt cctctggcaa agctgcagta caactaagag cttgctccct aaacttatct ctctgatgat ttaatgttag agatcttcgt aaatctatgt gtttgataga tctgatgcgt tttttgagtt gatgatttga ttattttca ctggaagta tctcattagg gtaacgataa tgttttatgg <210> 7 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Oligo-3: GEiGS_mir173_si-PDS_1 <400> 7 gcataaaaaa gtcaacaaaa cttaaagcgg cggtctcatc gtaatctcag cccaataccc 120. tattttcctc tcccctatat aaatactttc ttcttctact gatcttcttc tcacaaataa acccaatat atcaatctac tgtgttggtg attachment ttatccacac aaactacctg caagtggtca aaaaagttgt agttttctta aagtctcttt cctcttgcag tagttagtgt ggataaagag cttgctccct aaacttatct ctctgatgat ttaatgttag agatcttcgt aaatctatgt gtttgataga tctgatgcgt tttttgagtt gatgatttga ttattttca ctggaagta tctcattagg gtaacgataa tgttttatgg <210> 8 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Oligo-4: GEiGS_mir173_si-PDS_2 <400> 8 gcataaaaaa gtcaacaaaa cttaaagcgg cggtctcatc gtaatctcag cccaataccc 120. tattttcctc tcccctatat aaatactttc ttcttctact gatcttcttc tcacaaataa acccaatat attack tgtgttggtg attack ttgacaatcc agccaatcca gcagtggtca aaaaagttgt agttttctta aagtctcttt cctctgctga ttggcaggat 240 300. tgtcaaagag cttgctccct aaacttatct ctctgatgat ttaatgttag agatcttcgt aaatctatgt gtttgataga tctgatgcgt tttttgagtt gatgatttga ttattttca ctggaagta tctcattagg gtaacgataa tgttttatgg <210> 9 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Oligo-5: GEiGS_mir390a_si-GFP_1 <400> 9 agggagatg acgtgtgttc cttcgaaccc gagttttgtt cgtctaaa tagcaccttc tcttctcctt cttcctcact tccatctttt tagcttcact atctctctat aatcggtttt 120 atctttctct aagtcacaac ccaaaaaaac aaagtagaga agaatctgta aagtcgtgct gcttcatgtg gatgatgatc acattcgtta tctatttttt ccacatgaag aagcacgact 300. tgattggctc ttcttactac aatgaaaaag gccgaggcaa aacgcctaaa atcacttgag 360. aatcaattct ttttactgtc catttaagct atcttttata aacgtgtctt attttcttc tcttttgttt aaactaaa actatagtat tttgtctaaa <210> 10 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Oligo-6: GEiGS_mir390a_si-GFP_2 <400> 10 agaggagatg acgtgtgttc cttcgaaccc gagttttgtt cgtctataaa tagcaccttc 60 tcttctcctt cttcctcact tccatctttt tagcttcact atctctctat aatcggtttt 120 atctttctct aagtcacaac ccaaaaaac aaagtagaga agaatctgta agttgtactc 180 cagcttgtgc catgatgatc acattcgtta tctatttttt ggcacaagct tgagtacaac 240 tgattggctc ttcttactac aatgaaaaag gccgaggcaa aacgcctaaa atcacttgag 300 aatcaattct ttttactgtc catttaagct atcttttata aacgtgtctt atttctatc 360 tctttgtgt aaactaagaa actatagtat tttgtctaaa 400 <210> 11 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Oligo-7: GEiGS_mir390a_si-PDS_1 <400> 11 agaggagatg acgtgtgttc cttcgaaccc gagttttgtt cgtctataaa tagcaccttc 60 tcttctcctt cttcctcact tccatctttt tagcttcact atctctctat aatcggtttt 120 atctttctct aagtcacaac ccaaaaaac aaagtagaga agaatctgta tatccacaca 180 aactacctgc aatgatgatc acattcgtta tctatttttt tgcaggtagt gtgtgtggat 240 agattggctc ttcttactac aatgaaaaag gccgaggcaa aacgcctaaa atcacttgag 300 aatcaattct ttttactgtc catttaagct atcttttata aacgtgtctt atttctatc 360 tctttgtgt aaactaagaa actatagtat tttgtctaaa 400 <210> 12 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Oligo-8: GEiGS_mir390a_si-PDS_2 <400> 12 agaggagatg acgtgtgttc cttcgaaccc gagttttgtt cgtctataaa tagcaccttc 60 tcttctcctt cttcctcact tccatcttt tagcttcact atctctctat aatcggtttt 120 atctttctct aagtcacaac ccaaaaaac aaagtagaga agaatctgta tgacaatcca 180 gccaatccag catgatgatc acattcgtta tctatttttt gctggattgg atggattgtc 240 agattggctc ttcttactac aatgaaaaag gccgaggcaa aacgcctaaa atcacttgag 300 aatcaattct ttttactgtc catttaagct atcttttata aacgtgtctt attttctatc 360 tcttttgttt aaactaagaa actatagtat tttgtctaaa 400 <210> 13 <211> 1005 <212> DNA <213> Artificial sequence <220> <223> CaMV-35S-promoter nucleic acid sequence <400> 13 tttggagagg acaggcttct tgagatcctt caacaattac caacaacaac aaacaacaaa 60 caacattaca attactattt acaattacag tcgactctag aggatccatg gtgagcaagg 120 gcgaggagct gttcaccggg gtggtgccca tcctggtcga gctggacggc gacgtaaacg 180 gccacaagtt cagcgtgaga ggcgagggcg agggcgatgc caccaacggc aagctgaccc 240 tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc 300 tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag cacgacttct 360 tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catctctttc aaggacgacg 420 gcacttacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg aaccgcatcg 480 agctgaaggg catcgacttc aaggaggacg gcaacatcct ggggcacaag ctggagtaca 540 acttcaacag ccacaacgtc tatatcactg ccgacaagca gaagaacggc atcaaggcca 600 acttcaagat ccgccacaac gttgaggacg gcagcgtgca gctcgccgac cactaccagc 660 agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac ctgagcaccc 720 agtccgttct gagcaaagac cccaacgaga agcgcgatca catggtcctg ctggagttcg 780 tgaccgccgc cgggatcact ctcggcatgg acgagctgta caagtaaagc ggccgcccgg 840 ctgcagatcg ttcaaacatt tggcaataaa gtttcttaag attgaatcct gttgccggtc 900 ttgcgatgat tatcatataa tttctgttga attacgttaa gcatgtaata attaacatgt 960 aatgcatgac gttatttatg agatgggttt ttatgattag agtcc 1005 <210> 14 <211> 855 <212> DNA <213> Artificial sequence <220> <223> NOS terminator nucleic acid sequence <400> 14 gctcgtccat gccgagagtg atcccggcgg cggtcacgaa ctccagcagg accatgtgat 60 cgcgcttctc gttggggtct ttgctcagaa cggactgggt gctcaggtag tggttgtcgg 120 gcagcagcac ggggccgtcg ccgatggggg tgttctgctg gtagtggtcg gcgagctgca 180 cgctgccgtc ctcaacgttg tggcggatct tgaagttggc cttgatgccg ttcttctgct 240 tgtcggcagt gatatagacg ttgtggctgt tgaagttgta ctccagcttg tgccccagga 300 tgttgccgtc ctccttgaag tcgatgccct tcagctcgat gcggttcacc agggtgtcgc 360 cctcgaactt cacctcggcg cgggtcttgt aagtgccgtc gtccttgaaa gagatggtgc 420 gctcctggac gtagccttcg ggcatggcgg acttgaagaa gtcgtgctgc ttcatgtggt 480 cggggtagcg gctgaagcac tgcacgccgt aggtcagggt ggtcacgagg gtgggccagg 540 gcacgggcag cttgccggtg gtgcagatga acttcagggt cagcttgccg ttggtggcat 600 cgccctcgcc ctcgcctctc acgctgaact tgtggccgtt tacgtcgccg tccagctcga 660 ccaggatggg caccaccccg gtgaacagct cctcgccctt gctcaccatg gatcctctag 720 agtcgactgt aattgtaaat agtaattgta atgttgtttg ttgtttgttg ttgttggtaa 780 ttgttgaagg atctcaagaa gcctgtcctc tccaaatgaa atgaacttcc ttatatagag 840 gaagggtctt gcgaa 855 <210> 15 <211> 215 <212> DNA <213> Artificial sequence <220> <223> CaMV-35S terminator nucleic acid sequence <400> 15 cgctctgtca tcgttacaat caacatgcta ccctccgcga gatcatccgt gtttcaaacc 60 cggcagctta gttgccgttc ttccgaatag catcggtaac atgagcaaag tctgccgcct 120 tacaacggct ctcccgctga cgccgtcccg gactgatggg ctgcctgtat cgagtggtga 180 ttttgtgccg agctgccggt cggggagctg ttggc 215 <210> 16 <211> 216 <212> DNA <213> Artificial sequence <220> <223> G7-ter nucleic acid sequence <400> 16 gatcccccgt cgacagctag ctatatcatc aatttatgta ttacacataa tatcgcactc 60 agtctttcat ctacggcaat gtaccagctg atataatcag ttattgaaat atttctgaat 120 ttaaacttgc atcaataaat ttatgttttt gcttggacta taatacctga cttgttattt 180 tatcaataaa tatttaaact atatttcttt caagat 216 <210> 17 <211> 516 <212> DNA <213> Artificial sequence <220> <223> CsVMV promoter nucleic acid sequence <400> 17 ccagaaggta attatccaag atgtagcatc aagaatccaa tgtttacggg aaaaactatg 60 gaagtattat gtaagctcag caagaagcag atcaatatgc ggcacatatg caacctatgt 120 tcaaaaatga agaatgtaca gatacaagat cctatactgc cagaatacga agaagaatac 180 gtagaaattg aaaaagaaga accaggcgaa gaaaagaatc ttgatgacgt aagcactgac 240 gacaacaatg aaaagaagaa gataaggtcg gtgattgtga aagagacata gaggacacat 300 gtaaggtgga aaatgtaagg gcggaaagta accttatcac aaaggaatct tatcccccac 360 tacttatcct tttatatttt tccgtgtcat ttttgccctt gagttttcct atataaggaa 420 ccaagttcgg catttgtgaa aacaagaaaa aatttggtgt aagctatttt ctttgaagta 480 ctgaggatac aacttcagag aaatttgtaa gtttgt 516 <210> 18 <211> 636 <212> DNA <213> Arabidopsis thaliana <400> 18 gtcgacgagt cagtaataaa cggcgtcaaa gtggttgcag ccggcacaca cgagtcgtgt 60 tttcaactc aaagcacaaa tactttcct caacctaaaa ataaggcaat tagccaaaaa 120 caactttgcg tgtaaacaac gctcaataca cgtgtcattt tattattagc tattgcttca 180 ccgccttagc tttctcgtga cctagtcgtc ctcgtctttt cttcttcttc ttctataaaa 240 caatacccaa agagctcttc ttcttcacaa ttcagatttc aatttctcaa aatcttaaaa 300 actttctctc aattctctt accgtgatca aggtaaattt ctgtgttcct tattctctca 360 aaatcttcga ttttgttttc gttcgatccc aatttcgtat atgttctttg gtttagattc 420 tgttaatctt agatcgaaga cgatttctg ggtttgatcg ttagatatca tcttaattct 480 cgattagggt ttcatagata tcatccgatt tgttcaaata atttgagttt tgtcgaataa 540 ttactcttcg atttgtgatt tctatctaga tctggtgtta gtttctagtt tgtgcgatcg 600 aatttgtaga ttaatctgag tttttctgat taacag 636 <210> 19 <211> 4140 <212> DNA <213> Artificial sequence <220> <223> pco_Cas9_NLS nucleic acid sequence <400> 19 atggataaga agtactctat cggactcgat atcggaacta actctgtggg atgggctgtg 60 atcaccgatg agtacaaggt gccatctaag aagttcaagg ttctcggaaa caccgatagg 120 cactctatca agaaaaacct tatcggtgct ctcctcttcg attctggtga aactgctgag 180 gctaccagac tcaagagaac cgctagaaga aggtacacca gaagaaagaa caggatctgc 240 tacctccaag agatcttctc taacgagatg gctaaagtgg atgattcatt cttccacagg 300 ctcgaagagt cattcctcgt ggaagaagat aagaagcacg agaggcaccc tatcttcgga 360 aacatcgttg atgaggtggc ataccacgag aagtacccta ctatctacca cctcagaaag 420 aagctcgttg attctactga taaggctgat ctcaggctca tctacctcgc tctcgctcac 480 atgatcaagt tcagaggaca cttcctcatc gagggtgatc tcaaccctga taactctgat 540 gtggataagt tgttcatcca gctcgtgcag acctacaacc agctttcga agagaaccct 600 atcaacgctt caggtgtgga tgctaaggct atcctctctg ctaggctctc taagtcaaga 660 aggcttgaga acctcattgc tcagctccct ggtgagaaga agaacggact tttcggaaac 720 ttgatcgctc tctctcgg actcacccct aacttcaagt ctaacttcga tctcgctgag 780 gatgcaaagc tccagctctc aaaggatacc tacgatgatg atctcgataa cctcctcgct 840 cagatcggag atcagtacgc tgatttgttc ctcgctgcta agaacctctc tgatgctatc 900 ctcctcagtg atatcctcag agtgaacacc gagatcacca aggctccact ctcagcttct 960 atgatcaaga gatacgatga gcaccaccag gatctcacac ttctcaaggc tcttgttaga 1020 cagcagctcc cagagaagta caaagagatt ttcttcgatc agtctaagaa cggatacgct 1080 ggttacatcg atggtggtgc atctcaagaa gagttctaca agttcatcaa gcctatcctc 1140 gagaagatgg atgaaccga ggaactcctc gtgaagctca atagagagga tcttctcaga 1200 aagcagagga ccttcgataa cggatctatc cctcatcaga tccacctcgg agagttgcac 1260 gctatcctta gaaggcaaga ggatttctac ccattcctca aggataacag ggaaaagatt gagaagattc tcaccttcag aatcccttac tacgtgggac ctctcgctag aggaaactca agattcgctt ggatgaccag aaagtctgag gaaccatca ccccttgga cttcgaagag gtggtggata agggtgctag tgctcagtct ttcatcgaga ggatgaccaa cttcgataag aaccttccaa acgagaaggt gctccctaag cactctttgc tctacgagta cttcaccgtg tacaacgagt tgaccaaggt tagtacgtg accgaggga tgaggaagcc tgcttttttg tcaggtgagc aaaagaggc tatcgttgat ctcttgttca agaccaacag aaaggtgacc gtgaagcagc tcaaagagga ttacttcaag aaaatcgagt gcttcgattc agttgagatt 1740. tctggtgttg aggataggtt caacgcatct ctcggaacct accacgatct cctcaagatc attaggata aggatttctt ggataacgag gaaacgagg atatcttgga ggatatcgtt cttaccctca ccctctttga agatagagag atgattgaag aaaggctcaa gacctacgct catctcttcg atgataaggt gatgaagcag ttgaagagaa gaagatacac tggttgggga aggctctcaa gaaagctcat taacggaatc aggataagc agtctggaaa gacaatcctt 2040 gatttcctca agtctgatgg attcgctaac agaaacttca tgcagctcat ccacgatgat 2100 tctctcacct ttaaagagga tatccagaag gctcaggttt caggacaggg tgatagtctc 2160 catgagcata tcgctaacct cgctggatct cctgcaatca agaagggaat cctccagact 2220 gtgaaggttg tggatgagtt ggtgaaggtg atgggaaggc ataagcctga gaacatcgtg 2280 atcgaaatgg ctagagagaa ccagaccact cagaagggac agaagaactc tagggaaagg 2340 atgaagagga tcgaggaagg tatcaaagag cttggatctc agatcctcaa agagcaccct 2400 gttgagaaca ctcagctcca gaatgagaag ctctacctct actacctcca gaacggaagg 2460 gatatgtatg tggatcaaga gttggatatc aacaggctct ctgattacga tgttgatcat 2520 atcgtgccac agtcattctt gaaggatgat tctatcgata acaaggtgct caccaggtct 2580 gataagaaca ggggtaagag tgataacgtg ccaagtgaag aggttgtgaa gaaaatgaag 2640 aactattgga ggcagctcct caacgctaag ctcatcactc agagaaagtt cgataacttg 2700 actaaggctg agagggggagg actctctgaa ttggataagg caggattcat caagaggcag 2760 2820 accaagtacg atgagaacga taagttgatc agggaagga aggttatcac cctcaagtca 2880 aagctcgtgt ctgatttcag aaaggatttc caattctaca aggtgaggga aatcaacaac 2940 taccaccacg ctcacgatgc ttaccttaac gctgttgttg gaaccgctct catcaagaag 3000 tatcctaagc tcgagtcaga gttcgtgtac ggtgattaca aggtgtacga tgtgaggaag 3060 atgatcgcta agtctgagca agagatcgga aaggctaccg ctaagtattt cttctactct 3120 aacatcatga atttcttcaa gaccgagatt accctcgcta acggtgagat cagaaagagg 3180 ccactcatcg agaaacgg tgaaacaggt gagatcgtgt gggataaggg aagggatttc 3240 gctaccgtta gaaaggtgct ctctatgcca caggtgaaca tcgttaagaa aaccgaggtg 3300 3360 gctaggaga aggattggga ccctaagaaa tacggtggtt tcgattctcc taccgtggct 3420 tactctgttc tcgttgtggc taaggttgag aagggaaaga gtaagaagct caagtctgtt 3480 aaggaacttc tcggaatcac tatcatggaa aggtcatctt tcgagaagaa cccaatcgat 3540 ttcctcgagg ctaagggata caaagaggtt aagaaggatc tcatcatcaa gctcccaaag 3600 tactcactct tcgaactcga gaacggtaga aagaggatgc tcgcttctgc tggtgagctt 3660 caaaagggaa acgagcttgc tctcccatct aagtacgtta actttcttta cctcgcttct 3720 cactacgaga agttgaaggg atctccagaa gataacgagc agaagcaact ttcgttgag 3780 cagcacaagc actacttgga tgagatcatc gagcagatct ctgagttctc taaaagggtg 3840 atcctcgctg atgcaaacct cgataaggtg ttgtctgctt acaacaagca cagagataag 3900 cctatcaggg aacaggcaga gaacatcatc catctcttca cccttaccaa cctcggtgct 3960 cctgctgctt tcaagtactt cgatacaacc atcgatagga agagatacac ctctaccaaa 4020 gaagtgctcg atgctaccct catccatcag tctatcactg gactctacga gactaggatc 4080 gatctctcac agctcggtgg tgattcaagg gctgatccta agaagaagag gaaggtttga 4140 <210> 20 <211> 263 <212> DNA <213> Artificial sequence <220> <223> AtuNos ter nucleic acid sequence <400> 20 gtcaagcaga tcgttcaaac atttggcaat aaagtttctt aagattgaat cctgttgccg 60 gtcttgcgat gattatcata taatttctgt tgaattacgt taagcatgta ataattaaca 120 tgtaatgcat gacgttattt atgagatggg tttttatgat tagagtcccg caattataca 180 tttaatacgc gatagaaaac aaaatatagc gcgcaaacta ggataaatta tcgcgcgcgg 240 tgtcatctat gttactagat cga 263 <210> 21 <211> 1147 <212> DNA <213> Artificial sequence <220> <223> Synthetic construct clone eGFP-OsP5SM_E / R eGFP (eGFP) gene <400> 21 atgtctagag tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat cctggtcgag 60 ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc 120 acctacggca agctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg 180 cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta ccccgaccac 240 atgaagcagc acgacttctt caagtccgcc atgcccgaag gctacgtcca ggaggtagat 300 ttatgcatcc tcttgtcatg agaagtcgaa ttgttcccat tctgtgtgtt gcagctacag 360 atggagatac atagagatac tcgtggattt tgcttagtgt tgagttttgt tctggttgtg 420 aactaaaagt ttatacattt gcaggaaata aatagccttt tgtttaaatc aaaaggtctt 480 acctatgtta gtgtgaagca ttggatccca aagaactcca aaatgcgatg aggcatattt 540 aatcttgtct ggactagtaa caggttggga tgaccacctg tgaagctcca acaggattgc 600 ctcctcacgc aatgtttgag gtctgatgtt caatagcttg ttttgtttca ctttgctttg 660 gactttcttt tcgccaatga gctatgtttc tgatggtttt cactcttttg gtgtgtagag 720 aaccatcttc ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg 780 cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacac 840 ctggggcaca agctggagta caactacaac agccacaacg tctatatcat ggccgacaag 900 cagaagaagg catcaaggtg aacttcaaga tccgccacaa catcgaggac ggcagcgtgc 960 agctcgccga ccactacagc agaacacccc catcggcgac ggccccgtgc tgctgcccga 1020 caaccactac ctgagcaccc agtccgccct gagcaaagac cccaacgaga agcgcgatca 1080 catggtcctg ctggagttcg tgaccgccgc cgggatcact ctcggcatgg acgagctgta 1140 caagtaa 1147 <210> 22 <211> 2074 <212> DNA <213> Arabidopsis thaliana <400> 22 caattatgtg ttaaagatac aaacttttgt ctgatttgct tccaccggtt tcacctaaga 60 tactcaattt tcttactttt tgtgtgtttt gtaattctaa ttcttttata gcttcaattt 120 ttagattcat tgaagcagtt gtgagttaag ttggagaaaa tggttgtgtt tgggaatgtt 180 tctgcggcga atttgcctta tcaaaacggg tttttggagg cactttcatc tggaggttgt 240 gaactaatgg gacatagctt tagggttccc acttctcaag cgcttaagac aagaacaagg 300 aggaggagta ctgctggtcc tttgcaggta gtttgtgtgg atattccaag gccagagcta 360 gagaacactg tcaatttctt ggaagctgct agtttatctg catccttccg tagtgctcct 420 cgtcctgcta agcctttgaa agttgtaatt gctggtgctg gattggctgg attgtcaact 480 gcaaagtacc tggctgatgc aggccacaaa cctctgttgc ttgaagcaag agatgttctt 540 ggtggaaaga tagctgcatg gaaggatgaa gatggggact ggtatgagac tggtttacat 600 attttcttcg gtgcttatcc gaatgtgcag aatttatttg gagaacttgg gatcaatgat 660 cggttgcagt ggaaggaaca ctccatgatt tttgctatgc caagtaaacc tggagaattt 720 agtagatttg acttcccaga tgtcctacca gcacccttaa atggtatttg ggctattttg 780 cggaacaacg agatgctgac atggccagag aaaataaagt ttgctattgg acttttgcca 840 gccatggtcg gcggtcaggc ttatgttgag gcccaagatg gtttatcagt caaagaatgg 900 atggaaaagc agggagtacc tgagcgcgtg accgacgagg tgtttattgc catgtcaaag 960 gcgctaaact ttataaaccc tgatgaactg tcaatgcaat gcattttgat agctttgaac 1020 cggtttctt aggaaaaaca tggttccaag atggcattct tggatggtaa tcctccggaa 1080 aggctttgta tgccagttagt ggatcatatt cgatcactag gtgggggaagt gcaacttaat 1140 tctaggataa agaaattga gctcaatgac gatggcacgg ttaagagttt cttactcact 1200 aatggaagca ctgtcgaagg agacgcttat gtgtttgccg ctccagtcga tatcctgaag 1260 1320 ggagtaccag ttattaatgt tcatatatgg tttgatcgaa aactagaa cacatatgat 1380 cacctactct ttagcagaag taaccttctg agcgtgtatg ccgacatgtc cttaacttgt 1440 aaaggaatatt acgatcctaa ccggtcaatg ctggagctag tatttgcacc agcagaggaa 1500 tggatatcac ggactgattc tgacatcata gatgcaacaa tgaaagaact tgagaaactc 1560 ttccctgatg aaatctcagc tgaccaaagc aaagctaaaa ttctgaagta ccatgtcgtt 1620 aagactccaa gatctgtgta caagaccatc ccaaactgtg aaccatgtcg tcctctacaa 1680 agatcaccta ttgaaggatt ctacttagct ggagattaca caaaacagaa gtacttagct 1740 tccatggaag gcgctgtcct ctctgcaaa ttctgctc agtctattgt tcaggattac 1800 gagctactgg ctgcgtctgg accaagaag tgtcggagg cacagtatc atcatcatga 1860 gagaggaca aaacttaaag atgatttgct tgtaagcatt attatttgtg tataaatctc 1920 attgcaatcc aaacttaacc ttactctt cagtaaatga atctcacaga tttgacatct 1980 cacgtttctg tcaattttat aatttttaaa aagtaattac tgtcgacctt ttgtaatcat 2040 agtgatttat cattatgtct ctctttttaa aacc 2074 <210> 23 <211> 1419 <212> DNA <213> Arabidopsis thaliana <400> 23 ggagcatctt cattcttaag attgaat attctcaa aggcccctgg gatctgaaa 60 gaagagaagc aggccattt atatgggaa gaacaatagt atttcttata taggcccatt 120 taagttgaaa acatcttca aaagtcccac atcgcttaga taagaaacg aagctgagtt 180 tatatacagc tagagtcgaa gtagtgattg tgagacggat atcaatacgc aaaccgccctc 240 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggttccc gactggaaag 300 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt 360 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca 420 catactagag aaagaggaga aatactagat ggcttcctcc gaggacgtta tcaaagagtt 480 catgcgtttc aaagttcgta tggaaggttc cgttaacggt cacgagttcg aaatcgaagg 540 tgaaggtgaa ggtcgtccgt acgaaggtac ccagaccgct aaactgaaag ttaccaaagg 600 tggtccgctg ccgttcgctt gggacatcct gtccccgcag ttccagtacg gttccaaagc 660 ttacgttaaa cacccggctg acatcccgga ctacctgaaa ctgtccttcc cggaaggttt 720 caaatgggaa cgtgttatga acttcgagga cggtggtgtt gttaccgtta cccaggactc 780 ctccctgcaa gacggtgagt tcatctacaa agttaaactg cgtggtacca acttcccgtc 840 cgacggtccg gttatgcaga aaaaaaccat gggttgggaa gcttccaccg aacgtatgta 900 cccggaggac ggtgctctga aaggtgaaat caaaatgcgt ctgaaactga aagacggtgg 960 tcactacgac gctgaagtta aaaccaccta catggctaaa aaaccggttc agctgccggg 1020 tgcttacaaa accgacatca aactggacat cacctcccac aacgaggact acaccatcgt 1080 tgaacagtac gaacgtgctg aaggtcgtca ctccaccggt gcttaataac gctgatagtg 1140 ctagtgtaga tcgctactag agccaggcat caaataaaac gaaaggctca gtcgaaagac 1200 tgggcctttc gttttatctg ttgtttgtcg gtgaacgctc tctactagag tcacactggc 1260 tcaccttcgg gtgggccttt ctgcgtttat acgtctcagt tttagagcta gaaatagcaa 1320 gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 1380 tctagaccca gctttcttgt acaaagttgg cattacgct 1419 <210> 24 <211> 1286 <212> DNA <213> Artificial sequence <220> <223> U6III-synthetic pol 3 promoter for sgRNA expression <400> 24 ggagtatgat caaaagtccc acatcgatca ggtgatatat agcagcttag tttatataat 60 gatagagtcg acatagcgat tgggagacgc aatacgcaaa ccgcctctcc ccgcgcgttg 120 gccgattcat taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg 180 caacgcaatt aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct 240 tccggctcgt atgttgtgtg gaattgtgag cggataacaa tttcacacat actagagaaa 300 gaggagaaat actagatggc ttcctccgag gacgttatca aagagttcat gcgtttcaaa 360 gttcgtatgg aaggttccgt taacggtcac gagttcgaaa tcgaaggtga aggtgaaggt 420 cgtccgtacg aaggtaccca gaccgctaaa ctgaaagtta ccaaaggtgg tccgctgccg 480 ttcgcttggg acatcctgtc cccgcagttc cagtacggtt ccaaagctta cgttaaacac 540 ccggctgaca tcccggacta cctgaaactg tccttcccgg aaggtttcaa atgggaacgt 600 gttatgaact tcgaggacgg tggtgttgtt accgttaccc aggactcctc cctgcaagac 660 ggtgagttca tctacaaagt taaactgcgt ggtaccaact tcccgtccga cggtccggtt 720 atgcagaaaa aaaccatggg ttgggaagct tccaccgaac gtatgtaccc ggaggacggt 780 gctctgaaag gtgaaatcaa aatgcgtctg aaactgaaag acggtggtca ctacgacgct 840 gaagttaaaa ccacctacat ggctaaaaaa ccggttcagc tgccgggtgc ttacaaaacc 900 gacatcaaac tggacatcac ctcccacaac gaggactaca ccatcgttga acagtacgaa 960 cgtgctgaag gtcgtcactc caccggtgct tataacgct gatagtgcta gtgtagatcg 1020 ctactagagc caggcatcaa ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt 1080 ttatctgttg tttgcggtg aacgctctct actagagtca cactggctca cttcgggtg 1140 ggcctttctg cgtttatacg tctccgtttt agagctagaa atagcaagtt aaaataaggc 1200 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg cttttttct agacccagct 1260 ttcttgtaca aagttggcat tacgct 1286 <210> 25 <211> 2074 <212> DNA <213> Arabidopsis thaliana <400> 25 caattatgtg ttaaagatac aaacttttgt ctgatttgct tccaccggtt tcacctaaga 60 tactcaattt tcttactttt tgtgtgtttt gtaattctaa ttcttttata gcttcaattt 120 ttagattcat tgaagcagtt gtgagttaag ttggagaaaa tggttgtgtt tgggaatgtt 180 tctgcggcga atttgcctta tcaaaacggg tttttggagg cactttcatc tggaggttgt 240 gaactaatgg gacatagctt tagggttccc acttctcaag cgcttaagac aagaacaagg 300 aggaggagta ctgctggtcc tttgcaggta gtttgtgtgg atattccaag gccagagcta 360 gagaacactg tcaatttctt ggaagctgct agtttatctg catccttccg tagtgctcct 420 cgtcctgcta agcctttgaa agttgtaatt gctggtgctg gattggctgg attgtcaact...

Claims

1. A method for modifying a gene encoding or processed into a microRNA (miRNA) for a target RNA in a plant cell, characterized in that: The method comprises: introducing a DNA editing agent and a donor oligonucleotide comprising a desired modification into the plant cell, wherein the donor oligonucleotide is used as a repair template to produce the desired modification in the gene, wherein the desired modification redirects the silencing specificity of the miRNA to a second target RNA, wherein the target RNA and the second target RNA are different, thereby modifying the gene encoding the miRNA, wherein the DNA editing agent comprises a nuclease and at least one gRNA.

2. The method according to claim 1, characterized in that: The gene encoding the miRNA is endogenous to the plant cell.

3. The method according to claim 1 or 2, characterized in that: The modifying of the gene encoding the miRNA comprises: conferring at least 45% complementarity to the miRNA with respect to the second target RNA.

4. The method according to claim 1 or 2, characterized in that: The silencing specificity of the miRNA is determined by measuring the RNA level of the second target RNA.

5. The method according to claim 1 or 2, characterized in that: The silencing specificity of the miRNA is determined phenotypically.

6. The method according to claim 5, characterized in that: The phenotypical determination is achieved by determining at least one plant phenotype selected from the group consisting of leaf color, flower color, growth rate, plant size, crop yield, fruit traits, biotic stress tolerance and abiotic stress tolerance of the plant.

7. The method according to claim 1 or 2, characterized in that: The silencing specificity of the miRNA is determined genotypically.

8. The method according to claim 7, characterized in that: Plant phenotype is determined before plant genotype.

9. The method according to claim 7, characterized in that: Plant genotype is determined before plant phenotype.

10. The method according to claim 1 or 2, characterized in that: The modification of the gene is achieved by a modification selected from the group consisting of deletion, insertion, point mutation and a combination thereof.

11. The method according to claim 10, characterized in that: The modification is in the stem region of the miRNA.

12. The method according to claim 10, characterized in that: The modifications are in the loop regions of the miRNA.

13. The method according to claim 10, characterized in that: The modifications are in unstructured regions of the miRNA.

14. The method according to claim 10, characterized in that: The modifications are in the stem region as well as the loop region of the miRNA.

15. The method according to claim 10, characterized in that: The modifications are in the stem, loop and unstructured regions of the miRNA.

16. The method of claim 10, wherein: The modification includes a modification of up to 200 nucleotides.

17. The method according to claim 1 or 2, characterized in that: The at least one gRNA is operably linked to a plant-expressible promoter.

18. The method according to claim 1 or 2, characterized in that: The DNA editing agent is a DNA editing system selected from the group consisting of a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) and CRISPR.

19. The method of claim 18, wherein: The endonuclease includes Cas9.

20. The method according to claim 1 or 2, characterized in that: The DNA editing agent is applied to the cell in the form of DNA, RNA or RNP.

21. The method according to claim 1 or 2, characterized in that: The DNA editing agent is linked to a reporter for monitoring expression in plant cells.

22. The method of claim 21, wherein: The reporter is a fluorescent protein.

23. The method according to claim 1 or 2, characterized in that: The second target RNA is exogenous to the plant cell.

24. The method according to claim 1 or 2, characterized in that: The plant cell is a protoplast.

25. A method for producing a plant with reduced expression of a target gene, characterized in that: The method comprises: (a) breeding a plant comprising a plant cell produced by the method according to claim 1 or 2, wherein the plant cell comprises a desired modification in the gene, the modification redirecting the silencing specificity of the miRNA to a second target RNA; and (b) selecting a plurality of progeny plants having reduced expression of the second target RNA, wherein the plurality of progeny plants do not include the DNA editing agent, Thereby producing said plants having reduced expression of the target gene.

26. The method of claim 25, wherein: The breeding includes crossing or selfing.

27. A method for producing plants with improved stress tolerance, increased yield, improved growth rate or improved yield quality, characterized in that: The method comprises: modifying a gene encoding or processed into a miRNA in a plant cell according to claim 1 or 2, wherein the second target RNA is a gene of the plant that confers sensitivity to stress, reduced yield, reduced growth rate or reduced yield quality, thereby producing the plant.

28. A method for producing a plant that is tolerant or resistant to a pathogen, characterized in that: The method comprises: according to claim 1 or 2, modifying a gene encoding or processed into a miRNA in a plant cell, wherein the second target RNA is a gene of the plant that confers sensitivity to the pathogen, thereby producing the pathogen-resistant or pathogen-resistant plant.

29. A method for producing pathogen-tolerant or pathogen-resistant plants, characterized in that: The method comprises: according to claim 1 or 2, modifying a gene encoding or processed into a miRNA in a plant cell, wherein the second target RNA is a gene of the pathogen, thereby producing the pathogen-resistant or pathogen-resistant plant.

30. A method for producing pest-tolerant or pest-resistant plants, characterized in that: The method comprises: according to claim 1 or 2, modifying a gene encoding or processed into a miRNA in a plant cell, wherein the second target RNA is a gene of the pest, thereby producing the pest-tolerant or pest-resistant plant.

31. A method for producing pest-tolerant or pest-resistant plants, characterized in that: The method comprises: according to claim 1 or 2, modifying a gene encoding or processed into a miRNA in a plant cell, wherein the second target NRA is a gene of the plant that confers sensitivity to the pest, thereby producing the pest-tolerant or pest-resistant plant.

32. A method for producing herbicide-resistant plants, characterized in that: The method comprises: modifying a gene encoding or processed into a miRNA in a plant cell according to claim 1 or 2, wherein the second target RNA is a gene of the plant that confers sensitivity to the herbicide, thereby producing the herbicide-resistant plant.

33. A non-regenerable plant cell produced according to the method of claim 1 or 2.

34. The method of claim 1 or 2, wherein following introduction of a DNA editing agent and a donor oligonucleotide comprising a desired modification into the plant cell, the plant cell is heterozygous for the desired modification.

Images