Gene expression systems for probiotic microorganisms

Abstract

Provided herein are recombinant microorganisms expressing a subject polypeptide. The microorganism may comprise an expression construct comprising a flagellin promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide. The flagellin promoter sequence may comprise a genetic modification that reduces the inhibition of translation by CsrA. The microorganism may also comprise a genetic modification that reduces the inhibition of SigD transcription initiation by FlgM. The target polypeptide may be an aldehyde dehydrogenase. Such a microorganism may be used to treat alcohol hangovers.

Description

[0001] Statement Regarding Federally Funded Research

[0002] none.

[0003] Citation of Related Applications

[0004] This application claims the benefit of the priority dates of U.S. Provisional Application No. 62 / 558,346, filed September 13, 2017, and U.S. Application No. 16 / 048,147, filed July 27, 2018, the entire contents of which are incorporated herein by reference in their entirety.

[0005] Sequence Listing

[0006] This application contains a sequence listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy created on June 21, 2018 is named 1642-001-US_SL.TXT and is 29,323 bytes in size.

[0007] background

[0008] When a person drinks alcohol, the main way to remove alcohol from the bloodstream is to be oxidized to acetaldehyde in the liver via alcohol dehydrogenase. Acetaldehyde is subsequently oxidized to acetic acid in the liver via acetaldehyde dehydrogenase. When alcohol is consumed in large quantities and / or quickly, highly toxic intermediate acetaldehyde can accumulate and be subsequently released back into the bloodstream, and the acetaldehyde in the bloodstream can act on the whole body due to its high solubility. Acetaldehyde is not only a known carcinogen, but its toxic effects are also the reason why many effects of alcohol hangovers are well studied and recorded. In fact, removing acetaldehyde has been shown to reduce hangover symptoms. PMID:16554376 (PubMedID). On the contrary, when the body is inhibited by chemical (e.g., using disulfiram) or genetic (e.g., single nucleotide polymorphism in the acetaldehyde dehydrogenase gene common in East Asian populations) oxidation of acetaldehyde into acetic acid (acetate), then extremely amplified hangover symptoms are experienced.

[0009] There have been several previous attempts to reduce, eliminate or prevent the effects of a hangover. Some have attempted to reduce the amount of ethanol absorbed or increase the rate at which ethanol is removed from the body, enzymatically or otherwise (Patent Publication US2009-0060894A1). However, these approaches have at least two potential drawbacks: (1) their method of action affects the drinker's blood alcohol content itself, which may be undesirable; and (2) the accelerated metabolism of ethanol to acetaldehyde can increase the body's exposure to acetaldehyde and exacerbate symptoms and / or simply induce hangover symptoms earlier rather than preventing them. In short, ethanol-centric strategies do not directly address the problem of acetaldehyde toxicity.

[0010] More directly, other groups have attempted to address acetaldehyde itself. U.S. Patent Publication No. 2013-0089535A1 uses an enzyme preparation in the oral cavity. Although there is evidence that alcohol drinking does increase acetaldehyde concentrations in saliva, it is unlikely that acetaldehyde removed from the oral cavity will have any significant effect on the systemic acetaldehyde toxicity that causes alcohol hangovers.

[0011] Sprince, H., et al. (Protective action of ascorbic acid and sulfur compounds against acetaldehyde toxicity: implications in alcoholism and smoking. Agents Actions, 1975. 5(2): p. 164-73) involved the use of small molecules to bind and remove acetaldehyde [1].

[0012] U.S. Patent Publication No. 2015-0087702A1 relates to the use of small molecules to increase the rate or expression of human enzymes to remove acetaldehyde.

[0013] Other groups have developed expression systems based on the flagellar regulatory region of Bacillus or other bacteria (US Pat. No. 7,888,064 B2, European Pat. No. 2,235,045 B1) or by specifically manipulating flgM and CsrA (Japanese Pat. No. 5,881,352 B2).

[0014] Liu, Y. et al. ("Heterologous Expression of Aldehyde Dehydrogenase in Lactococcus lactis for Acetaldehyde Detoxification at Low pH", Appl Biochem Biotechnol. 8 August 2017) involved the application of Lactococcus lactis with the Nisin Controlled Expression (NICE) system to express the aldehyde dehydrogenase gene (istALDH) to catalyze the oxidation of acetaldehyde at low pH. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The accompanying drawings, which are incorporated herein and constitute a part of the specification, illustrate exemplary embodiments and, together with the description, further serve to enable those skilled in the art to make and use these embodiments and other embodiments that will be apparent to those skilled in the art. The present invention will be described in more detail with reference to the following drawings, in which:

[0017] Figure 1It is shown that induction of aldehyde dehydrogenase AldB or AcoD results in rapid removal of acetaldehyde. The samples were incubated with 200 mM acetaldehyde at 37°C for 30 minutes. The samples were then filtered, diluted 1:10, and frozen. The thawed samples were then run on the HPLC and compared to the standard curve to calculate the remaining acetaldehyde concentration, and these values ​​are presented here. "Acetaldehyde 10 mM" refers to a 10 mM acetaldehyde standard that was run at the beginning of the HPLC run and then again at the end of the HPLC run to ensure that there was no random loss of acetaldehyde while on the machine.

[0018] Figure 2 A and 2B show that the expression of GFP under the control of the modified hag promoter is 5-10 times stronger than under the control of the pHyspank promoter. (A) Frozen stocks of Bacillus subtilis strain PY79 (negative control; "2 o'clock" position on the left panel), Bacillus subtilis expressing GFP under the pHyspank promoter with lacI repression removed ("11 o'clock" position on the right panel), and Bacillus subtilis expressing GFP under the modified hag promoter ("11 o'clock" position on the left panel and "2 o'clock" position on the right panel) were patched on LB and grown overnight. Green fluorescence was visualized with a blue LED flash and an orange filter. (B) Cultures of B. subtilis expressing GFP under the pHyspank promoter with lacI repression removed (lower dark gray line; “11 o’clock” on the right panel of (A)) and B. subtilis expressing GFP under the modified hag promoter (upper light gray line; “11 o’clock” on the left panel of (A)) were grown from individual colonies in LB broth for 7 h, and fluorescence and OD were acquired every 90 min starting at 2.5 h. 600 reading.

[0019] Figure 3The expression of GFP, AcoD and AldB in the precipitated cells from the culture, expressed as the presence of protein, is shown, and the cells were grown in LB for 4.5 hours, lysed and total protein was assessed by Coomassie staining on 8% SDS-PAGE gel. Lane 1 is a Bio-Rad Kaleidoscope protein standard ladder. Lanes 2 and 3 (respectively) are uninduced cultures and induced cultures of Bacillus subtilis expressing AldB under the pHyspank promoter. Lanes 4 and 5 (respectively) are uninduced cultures and induced cultures of Bacillus subtilis expressing AcoD under the pHyspank promoter. Lane 6 is a culture of Bacillus subtilis with flgM deleted but hag still intact (negative control for heterologous protein expression). Lane 7 is a culture of Bacillus subtilis expressing GFP (interested protein bands indicated by arrows) under the modified hag promoter. Lanes 8, 9, and 10 are cultures of Bacillus subtilis expressing n-terminally 6×-histidine-tagged AcoD (“6×-Histidine” disclosed as SEQ ID NO:22), untagged AcoD, and n-terminally 6×-histidine-tagged AldB (“6×-Histidine” disclosed as SEQ ID NO:22) (respectively; protein bands of interest are indicated by arrows) under a modified hag promoter.

[0020] Figure 4 The promoter structure for the hag gene is shown [SEQ ID NO:7]. Identified in the figure are: the promoter start position (indicated by an arrow and "-182"), the SigD RNA polymerase binding site (underlined and labeled "-10" and "-35"), the transcription start site (indicated by an arrow and "+1"), CsrA binding sites 1 and 2 (bracketed and labeled "CsrA BS1 / 2"), the residue targeted for G-to-A point mutation to prevent CsrA binding as discussed in the Methods (circled "g"), and the Shine-Dalgarno sequence (boxed). ATG (sequence capitalized) is the start codon for the hag protein or any heterologous polypeptide.

[0021] Figure 5 The predicted secondary structure of hag mRNA [SEQ ID No: 21] including the 5'-UTR is shown (fold prediction generated by RNA folding software from University of Vienna; citation: Gruber AR, Lorenz R, Bernhart SH, R, Hofacker IL. The Vienna RNA Websuite. Nucleic Acids Res. 2008). (A) Folded structure. (B) Magnified view of the mRNA region containing two CsrA binding sites. The "AGGA" motif in the stem-loop secondary structure loop of the two binding sites recognized by CsrA is marked with a thick black line. The secondary structure is critical, as it can be clearly observed that the two binding sites are adjacent. Therefore, modifications that affect the secondary structure in a way that would prevent the two sites from approaching can have a deleterious effect on CsrA binding, which may be equivalent to modifications to the binding sites or the "AGGA" recognition sequence itself.

[0022] Figure 6 A strategy for derepressing expression from the hag promoter is shown. Knockout of the FlgM gene ("X") prevents FlgM from inhibiting SigD activity. SigD activates (bold arrow) transcription of the hag promoter and the operably linked ALDH gene. Mutation of the csrA binding site on the hag promoter ("X") reduces inhibition of ribosome binding and translation of the ALDH gene. This results in robust expression of the ALDH protein (bold arrow).

[0023] Overview

[0024] In one aspect, a recombinant microorganism is disclosed herein, comprising: a) a polynucleotide comprising an expression construct, the expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide, wherein the flagellin gene promoter comprises one or more genetic modifications, the one or more genetic modifications reducing the repression of translation of mRNA transcribed from the flagellin gene promoter by CsrA; and b) a genetic modification of the flgM gene, the genetic modification of the flgM gene reducing the inhibition of SigD transcription initiation. In one embodiment, the recombinant microorganism constitutively expresses the polypeptide. In another embodiment, the microorganism is probiotic. In another embodiment, the microorganism belongs to a genus selected from the following: Bacillus, Bifidobacterium, Enterococcus, Escherichia, Lactobacillus, Leuconostoc, Pediococcus and Streptococcus. In another embodiment, the microorganism belongs to the genus Bacillus. In another embodiment, the microorganism is Bacillus subtilis (B.subtilis). In another embodiment, the flagellin gene promoter is a hag promoter. In another embodiment, the hag promoter comprises one or more genetic modifications, and the one or more genetic modifications reduce the repression of CsrA translation of mRNA transcribed from the flagellin gene promoter, wherein the genetic modification includes modification (e.g., nucleotide substitution, insertion or deletion) of the CsrA BS1 binding site and / or the CsrA BS2 binding site. In another embodiment, the one or more genetic modifications include one or more than one (e.g., two, three or four) genetic modifications to the CsrA BS1 recognition sequence AGGA, for example, modified to the sequence AGAA. In another embodiment, the one or more genetic modifications include one or more genetic modifications in the surrounding bases of the stem of the stem-loop secondary structure of BS1 formed in the 12 base pair BS1 binding site or on either side of the binding site. In another embodiment, the one or more genetic modifications include one or more (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12) genetic modifications in the BS1 binding site gcacaaggacgt (SEQ ID NO: 8). In another embodiment, the one or more genetic modifications disrupt the stem-loop structure of BS1 by eliminating complementarity that allows hydrogen bonding.In another embodiment, one or more genetic modifications include one or more genetic modifications in the sequence taagggcacaaggacgtgcctta (SEQ ID NO: 1) involved in hydrogen bonding, for example to eliminate one, two, three, four or more hydrogen bond pairs. In another embodiment, the modified BS1 has the nucleotide sequence GCACAAGAACGT (SEQ ID NO: 2). In another embodiment, one or more genetic modifications include one or more point mutations to the CsrABS2 binding site. In another embodiment, one or more genetic modifications include one or more (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13) genetic modifications in the surrounding bases of the stem of the stem-loop secondary structure of the formation BS2 ATTCAGGGAGGAA (SEQ ID NO: 9) in the 13 base pair BS2 binding site or on either side of the binding site. In another embodiment, one or more genetic modifications destroy the stem-loop structure of BS2 by eliminating complementarity that allows hydrogen bonding. In another embodiment, the modified BS2 has the nucleotide sequence ATTTAGGGAGGAA (SEQ ID NO: 3). In another embodiment, one or more genetic modifications to the BS2 binding site do not include changes in nucleotides in the Shine-Dalgarno sequence aggagga. In another embodiment, wherein the flagellin gene promoter is located in a bacterial chromosome or in a plasmid. In another embodiment, the subject polypeptide is an aldehyde dehydrogenase. In another embodiment, the aldehyde dehydrogenase is AcoD from Cupriavidus necator, and comprises an amino acid sequence identical or substantially identical to the following:.

[0025]

[0026] In another embodiment, the aldehyde dehydrogenase is a human aldehyde dehydrogenase, such as a human aldehyde dehydrogenase having an amino acid sequence that is identical or substantially identical to:

[0027]

[0028] In another embodiment, the genetic modification in the flgM gene comprises a total or partial deletion of the flgM gene. In another embodiment, the genetic modification in the flgM gene comprises a single mutation or a series of mutations in the sequence encoding the active site of flgM. In another embodiment, the genetic modification in the flgM gene destroys the secondary structure or tertiary structure, such as in one of the helices defining the secondary structure of FlgM. In another embodiment, the genetic modification in the flgM gene comprises changing the amino acid in the third helix or the fourth helix at the C-terminus of the FlgM protein, for example selected from I-58, K-62, I-65, G-68, D-73, A-78 of Bacillus subtilis FlgM. In another embodiment, the genetic modification in the flgM gene comprises changing one or more amino acids predicted to be involved in the binding of FlgM to SigD, such as selected from I-3, G-7, S-10, V-11, A-40, K-41, M43, 1-58, L-61, K-62, 1-65, Y-70, K-71, V-72, D-73, A-74, H-76, 1-77, A-78, N-80, M-81, 1-82, N-83, ​​F-84, Y-85 and K-86 of Bacillus subtilis FlgM.

[0029] In another aspect, a recombinant probiotic microorganism constitutively expressing an aldehyde dehydrogenase is disclosed herein. In one embodiment, the microorganism comprises: a) a polynucleotide comprising an expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide; and b) a genetic modification in the FlgM gene that reduces inhibition of SigD expression. In another embodiment, the flagellin gene promoter comprises one or more genetic modifications that reduce CsrA repression of translation of mRNA transcribed from the promoter.

[0030] In another aspect, disclosed herein is a polynucleotide comprising an expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide, wherein the flagellin gene promoter comprises one or more genetic modifications that reduce repression of translation of mRNA transcribed from the flagellin gene promoter by CsrA.

[0031] In another aspect, disclosed herein is a method of preparing a polypeptide, the method comprising culturing a recombinant microorganism as disclosed herein. In one embodiment, the method further comprises isolating the polypeptide.

[0032] On the other hand, a composition is disclosed herein, comprising a physiologically acceptable carrier and a recombinant probiotic microorganism, wherein the recombinant probiotic microorganism comprises: a) a polynucleotide comprising an expression construct, the expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide; and b) a genetic modification of the FlgM gene, the genetic modification of the FlgM gene reducing the inhibition of SigD transcription initiation. In one embodiment, the flagellin gene promoter comprises one or more genetic modifications, and the one or more genetic modifications reduce the repression of CsrA on the translation of mRNA transcribed from the flagellin gene promoter. In another embodiment, the subject polypeptide is an aldehyde dehydrogenase. In another embodiment, the physiologically acceptable carrier is selected from resistant starch, dietary fiber, carbohydrates, proteins and glycosylated proteins, water, capsule fillers and gummy materials.

[0033] In another aspect, disclosed herein is a unit dose of a composition as disclosed herein, the unit dose comprising about 10 4 About 10 12 colony-forming units of recombinant probiotic microorganisms.

[0034] In another aspect, disclosed herein is a method for preventing or treating alcohol hangover, the method comprising administering to a subject in need thereof an effective amount of a composition comprising a microorganism constitutively expressing an aldehyde dehydrogenase. In another embodiment, the composition is administered before, during, or after the subject has consumed alcohol.

[0035] In another aspect, disclosed herein is a method of metabolizing an analyte in the intestine or in the circulation in a subject, the method comprising administering to the subject an effective amount of a composition comprising a microorganism that constitutively expresses an enzyme that metabolizes the analyte.

[0036] In another aspect, disclosed herein is a method for producing a target compound, the method comprising: a) contacting a culture comprising a recombinant microorganism expressing a subject polypeptide as disclosed herein with an analyte, wherein the subject polypeptide is an enzyme with the analyte as a substrate, and b) culturing the microorganism, wherein the enzyme catalyzes the conversion of the analyte into the target compound. In one embodiment, the enzyme is selected from amylases, lipases, and proteases.

[0037] Detailed Description

[0038] I. Introduction

[0039] Disclosed herein is a microorganism, such as a bacterium, that has been genetically engineered to constitutively express acetaldehyde dehydrogenase. Acetaldehyde dehydrogenase (ALDH) is expressed intrinsically in bacterial cells and accesses its substrate, acetaldehyde, not by secretion of the enzyme, but by diffusion of acetaldehyde into the bacteria. Acetaldehyde is a highly soluble molecule and can diffuse passively across the cell membrane. This intrinsic localization of the enzyme provides a functional advantage over secretion because the interior of the bacterial cell is protected from the harsh and variable environment in the intestinal lumen, which is characterized by low pH, unfriendly bacteria and eukaryotic cells that seek to degrade free-floating proteins for defense or nutritional purposes, high competition for enzyme cofactors such as NAD, and extracellular proteases.

[0040] The flagellar regulatory machinery of Bacillus subtilis is well suited to achieve constitutive and robust expression of ALDH. Bacillus subtilis regulates motility through a complex system of several positive and negative regulators [2]. The basic strategy of this system is to remove the negative regulator of the highly expressed flagellar protein gene (called hag).

[0041] The gene encoding the flagellar subunit of the Bacillus subtilis flagellin is hag, and therefore, under the right conditions, hundreds of thousands of copies are produced in a single bacterium using both a robust transcriptional promoter and a ribosome binding site [3, 4].

[0042] Transcription is mediated by the sigma factor SigD, which is repressed by the FlgM protein [5]. The loss of flgM greatly enhances the constitutive expression and activity of SigD and thus leads to higher and more constitutive transcription of the flagellar operon and in particular the hag gene.

[0043] Translation of the hag gene is achieved through a highly robust ribosome binding site that binds to a protein called CsrA and is subject to post-transcriptional repression [6]. However, a single point mutation in the CsrA binding site abolishes its binding and results in constitutive translation of the Hag protein [7].

[0044] Using a combination of deleting the flgM gene and making a single point mutation in the CsrA binding site, extremely high levels of Hag protein can be constitutively achieved during the life cycle of Bacillus subtilis. Similarly, if the hag gene is replaced with a heterologous gene encoding a protein of interest, the gene can be constitutively transcribed and translated at high levels. Thus, by replacing the hag gene with a gene encoding ALDH, and then deleting the flgM gene and making a single point mutation at the CsrA binding site of the hag promoter, robust and constitutive expression of our ALDH was achieved in Bacillus subtilis.

[0045] Thus, in certain embodiments, the microorganisms provided herein include a combination of a point mutation in the binding site of CsrA and a flgM deletion. By performing these two mutations, the utility of any SigD-based or flagellin promoter system is greatly increased by removing repression and making expression constitutive. Without wishing to be limited by theory, it is believed that this is different from a simple CsrA deletion because CsrA is a pluripotent regulator in many bacterial species [8], and its deletion may have many other potential undesirable phenotypic effects on cells. By performing point mutations only in the binding site, the mutations specifically and uniquely eliminate CsrA repression of the hag promoter without removing CsrA repression from any other targets that CsrA may have.

[0046] This strategy can be used for constitutive expression of any desired polypeptide. This includes other enzymes that metabolize target analytes in the intestine of an individual or produce target molecules in an industrial process.

[0047] II. Definitions

[0048] As used herein, the term "probiotic microorganism" or "probiotic" refers to a microorganism or bacteria that confers a health or wellness benefit to the host when administered in an effective amount.

[0049] As used herein, the term "recombinant microorganism" or "recombinant bacterium" refers to a microorganism or bacterium comprising a polynucleotide containing attached nucleotide sequences that are not normally attached to each other in nature.

[0050] Terms used to describe sequence relationships between two or more nucleotide sequences or amino acid sequences include "reference sequence," "selected from," "comparison window," "identical," "percentage of sequence identity," "substantially identical," "complementary," and "substantially complementary."

[0051] A "reference sequence" is a defined sequence used as a basis for sequence comparison, and may be a subset of a larger sequence, such as a subset of a complete cDNA, protein, or gene sequence.

[0052] Because two polynucleotides or polypeptides can each contain (1) a sequence that is similar between the two polynucleotides (i.e., only a portion of the complete polynucleotide or polypeptide sequence), and (2) a sequence that is different between the two polynucleotides, sequence comparisons between two (or more) polynucleotides or polypeptides are often performed by comparing the sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.

[0053] "Comparison window" refers to the conceptual segment (segment) of at least 12 continuous nucleotides or 4 continuous amino acid residues compared with the reference sequence, usually. The comparison window often has a length of at least 15 nucleotides or at least 25 nucleotides or at least 5 amino acids or at least 8 amino acids. For the best comparison of two sequences, the comparison window can include about 20% or less addition or deletion (that is, room) compared with the reference sequence (it does not include addition or deletion). The best comparison of the sequence for aligning the comparison window can be carried out by the computerization of the algorithm (GAP, BESTFIT, FASTA and TFASTA in Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, WI) or by inspection, and select the best comparison (that is, obtaining the highest homology percentage on the comparison window) produced by any one of the multiplex method.

[0054] A subject nucleotide or amino acid sequence and a reference sequence are "identical" if the two sequences are identical when aligned over the length of the nucleotide or amino acid sequences for maximum correspondence.

[0055] Therefore, the "percentage of sequence identity" between two sequences is calculated as follows: compare the two optimally aligned sequences over the comparison window, determine the number of positions at which the identical nucleotide or amino acid occurs in the two sequences to obtain the number of matched positions, divide the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiply the result by 100 to obtain the percentage of sequence identity.

[0056] Unless otherwise indicated, the comparison window for comparing two sequences is the length of the shorter sequence.

[0057] Methods are also described in: Natl. Acad. Sci. USA 85:2444; Higgins & Sharp (1988) Gene 73:237-244; Higgins & Sharp, CABIOS 5:151-153 (1989); Corpet et al. (1988) Nucleic Acids Research 16:10881-90; Huang et al. (1992) Computer Applications in the Biosciences 8:155-65; and Pearson et al. (1994) Methods in Molecular Biology 24:307-31. Alignment is also usually performed by inspection and manual alignment.

[0058] A subject nucleotide sequence or amino acid sequence is "substantially identical" to a reference sequence if it has at least 70% sequence identity over the comparison window. Thus, sequences having at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to a reference sequence are also "substantially identical." Of course, two sequences that are identical to each other are also "substantially identical."

[0059] In certain embodiments, the subject polynucleotide specifically hybridizes to a reference polynucleotide. "Specifically hybridizes to" or "specifically hybridizes to" or "selectively hybridizes to" refers to the binding, duplexing or hybridization of the sequence preferentially to a specific nucleotide sequence under stringent conditions when the nucleic acid molecule is present in a complex mixture (e.g., total cellular) DNA or RNA.

[0060] The term "stringent conditions" refers to conditions under which a probe will hybridize preferentially to its target subsequence, and to a lesser extent to other sequences or not at all. In the context of nucleic acid hybridization experiments such as DNA hybridization and RNA hybridization, "stringent hybridization" and "stringent hybridization wash conditions" are sequence dependent and are different under different environmental parameters. An extensive guide to nucleic acid hybridization is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York.

[0061] Generally, highly stringent hybridization and washing conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the Tm for a specific probe.

[0062] For hybridization of complementary nucleic acids with more than 100 complementary residues on filters in Southern or Northern blots, an example of stringent hybridization conditions is 50% formalin with 1 mg of heparin at 42°C, and hybridization is performed overnight. An example of highly stringent washing conditions is 0.15M NaCl at 72°C for about 15 minutes. An example of stringent washing conditions is washing at 65°C, 0.2×SSC for 15 minutes (see, Sambrook et al., description of SSC buffer). Typically, a low stringency wash is performed before a high stringency wash to remove background probe signals. For example, for a duplex of more than 100 nucleotides, an exemplary moderate stringency wash is at 45°C, 1×SSC for 15 minutes. For example, for a duplex of more than 100 nucleotides, an exemplary low stringency wash is at 40°C, 4-6×SSC for 15 minutes. Typically, a signal-to-noise ratio of 2× (or higher) observed for an unrelated probe in a particular hybridization assay indicates that specific hybridization has been detected.

[0063] As used herein, the term "transcription regulatory sequence" refers to a first nucleotide sequence that regulates the transcription of a second nucleotide sequence to which it is operably linked.

[0064] "Promoter" is a transcriptional regulatory sequence that is at least sufficient to start the transcription of the nucleotide sequence in (promote) DNA into an RNA transcript. The transcript transcribed from the promoter generally includes a sequence downstream of the transcription start site from the promoter, and a downstream sequence encoding an amino acid sequence in the case of mRNA. Promoters are the most fully characterized transcriptional regulatory sequences because they are immediately adjacent to the upstream of the transcription start site and the position is predictable. Promoters include sequences that regulate the recognition, binding and transcription initiation activity of RNA polymerase. These sequences can be cis-acting, or can respond to trans-acting factors. Depending on the nature of regulation, a promoter can be constitutive or regulated. Promoters are generally described as having two separated sections: a core region and an extended promoter region.

[0065] The core promoter includes sequences sufficient for RNA polymerase recognition, binding and transcription initiation. The core promoter includes a transcription initiation site, RNA polymerase binding site and other universal transcription binding sites, and is the place where the pre-initiation complex is formed and the universal transcription machinery is assembled. The pre-initiation complex is usually within 50 nucleotides (nt) of the transcription start site (TSS).

[0066] The core promoter also includes sequences for the ribosome binding site that is necessary for translation of the mRNA into a polypeptide.

[0067] The extended promoter region includes the so-called proximal promoter, which extends to about 250 nucleotides (i.e., -250nt) upstream of the transcription start site. It includes major regulatory elements, such as specific transcription factor binding sites. It has been found that many genes have transcription regulatory elements that are located more upstream. In particular, the fragments of most transcription regulatory elements including genes can extend to up to 700nt or more upstream of the transcription start site. (See, e.g., US2007-0161031.) In some genes, transcription regulatory sequences have been found to be thousands of nucleotides upstream of the transcription start site.

[0068] As used herein, a nucleotide sequence is "operably linked" to a transcriptional regulatory sequence when the transcriptional regulatory sequence functions in a cell to regulate transcription of the nucleotide sequence. This includes initiating transcription of the nucleotide sequence through interaction between a polymerase and a promoter.

[0069] As used herein, a first nucleotide sequence is "heterologous" to a second nucleotide sequence if the first nucleotide sequence is not operably linked to the second nucleotide sequence in nature. By extension, a polypeptide is "heterologous" to an expression control sequence if the polypeptide is encoded by a nucleotide sequence that is heterologous to a promoter.

[0070] As used herein, the term "homologue" refers to any naturally occurring gene from another genus or species different from the defined genus or species, or a different gene in the same strain or species that encodes a protein with nearly identical folding and function. Studies have shown that proteins with at least 30% amino acid identity to the gene or protein in question have such properties between microorganisms (reference: PMID 23352839). In addition, the term "homologue" extends to genes that encode proteins with less than 30% identity to the gene or protein in question, but have been identified as homologues of the gene or protein in peer-reviewed scientific journals.

[0071] As used herein, the term "ortholog" refers to any homolog that occurs in another genus or species than the genus or species in question.

[0072] As used herein, the term "paralog" refers to any homolog that occurs in the same strain or species as the strain or species in question, usually as a result of gene duplication.

[0073] As used herein, the term "allelic variant" refers to a naturally occurring variation in a gene.

[0074] As used herein, the term "artificial variant" refers to a gene or protein that contains one or more genetic modifications to a naturally occurring gene or protein while retaining the native function.

[0075] As used herein, the term "mutation" refers to a change in a nucleotide sequence or an amino acid sequence. A mutation may include a substitution of one or more nucleotides (single nucleotide substitutions are referred to as "SNVs" or "point mutations"), one or more nucleotide additions, or one or more nucleotide deletions, and, if present, changes in the amino acid sequence caused by these nucleotide changes.

[0076] As used herein, a "derivative" of a bacterial strain is any genetically distinct form of that strain.

[0077] As used herein, the term "subject" when used in reference to an individual refers to an individual animal, such as a human.

[0078] As used herein, the terms "therapy", "treatment", "therapeutic intervention" and "improvement" refer to any activity that causes a decrease in the severity of symptoms. The terms "treatment" and "prevention" are not intended to be absolute terms. Treatment and prevention can refer to any delayed onset, improved symptoms, reduced symptom severity, improved patient survival, increased survival time or survival rate, etc. The effect of treatment can be compared with an individual or pool of individuals who have not received treatment, or with the same patient at different times before or during treatment. In some aspects, the severity of the disease is reduced by at least 10% compared to, for example, an individual before administration or to a control individual who has not been treated. In some aspects, the severity of the condition is reduced by at least 25%, 50%, 75%, 80% or 90%, or in some cases, is no longer detectable using standard diagnostic techniques.

[0079] As used herein, the term "probiotic composition" refers to a composition comprising a probiotic microorganism and a physiologically acceptable carrier. Typically, a probiotic composition confers a health or wellness benefit to a host subject to which it is administered.

[0080] As used herein, the term "physiologically acceptable" refers to a carrier that is compatible with the other ingredients of the composition and can be safely administered to a subject. Probiotic compositions and techniques for their preparation and use are known to those skilled in the art in light of the present disclosure. For a detailed list of suitable pharmaceutical compositions and techniques for their administration, reference may be made to textbooks such as Remington's Pharmaceutical Sciences, 17th ed. 1985; Brunton et al., "Goodman and Gilman's The Pharmacological Basis of Therapeutics," McGraw-Hill, 2005; University of the Sciences in Philadelphia (eds.), "Remington: The Science and Practice of Pharmacy," Lippincott Williams & Wilkins, 2005; and University of the Sciences in Philadelphia (eds.), "Remington: The Principles of Pharmacy Practice," Lippincott Williams & Wilkins, 2008.

[0081] The probiotic composition can be a liquid preparation or a solid preparation. When the probiotic composition is a solid preparation, it can be formulated into tablets, sucking tablets, chewable tablets, capsules, pouches, powders, granules, coated granules, coated tablets, enteric-coated tablets, enteric-coated capsules, melting strips or films. When the probiotic composition is a liquid preparation, it can be formulated into an oral solution, suspension, emulsion or syrup. The composition may further comprise a carrier material independently selected from but not limited to the group consisting of: resistant starch, dietary fiber, carbohydrates, proteins and glycosylated proteins.

[0082] The terms "effective amount" and "effective dose" refer to the amount of an agent that is effective in ameliorating a disorder or condition. For example, for a given parameter, an effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100% of the therapeutic effect. Efficacy can also be expressed as a "fold" increase or decrease. For example, an effective amount can have an effect that exceeds any of a control by at least 1.2 times, 1.5 times, 2 times, 5 times, or more.

[0083] The effective amount of the agent is determined based on the intended target. The term "unit dose" refers to physically dispersed units suitable for use in a subject, each unit containing a predetermined amount of the composition, the predetermined amount being calculated to produce the desired response associated with its administration, i.e., the appropriate route and treatment regimen. The amount to be administered depends on the subject to be treated, the subject's state, and the desired protection, depending on both the number of treatments and the unit dose. The exact amount of the composition also depends on the practitioner's judgment and is unique to each individual.

[0084] The terms "dose" and "dosage" are used interchangeably herein. Dose refers to the amount of active ingredient given to an individual per administration. For the present invention, dose may refer to the number of bacteria, such as the amount of colony forming units (CFU). The dose will vary according to many factors, including frequency of administration; size and tolerance of the individual; severity of the condition; risk of side effects; route of administration. Those skilled in the art will recognize that the dose may be modified according to the above factors or based on the progress of the treatment. The term "dosage form" refers to the specific form of the drug and depends on the route of administration. For example, the dosage form may be a liquid, such as a beverage for oral drinking.

[0085] III. Expression constructs

[0086] Contemplated herein are methods of reducing one or both of inhibition of transcription from the flagellin promoter and inhibition of translation of mRNA transcripts initiated by the flagellin promoter.

[0087] Certain polynucleotides disclosed herein comprise an expression construct comprising a flagellin gene transcriptional regulatory sequence, such as a promoter, operably linked to a heterologous nucleotide sequence encoding a subject polypeptide, i.e., a polypeptide to be expressed. In certain embodiments, the hag promoter comprises a genetic alteration such that, after mRNA is transcribed from the hag promoter, inhibition of mRNA translation by CsrA is repressed.

[0088] A. Flagellin gene transcription regulatory sequence

[0089] Many bacteria have flagellin gene homologs. This gene has many names, some examples of which are: hag in Bacillus subtilis; fliC in Escherichia coli, Bacillus thuringiensis, and several Lactobacillus species; and flaA or flaB / C / D / E / F in Legionella species, Vibrio species, and Campylobacter species, etc.

[0090] In one embodiment, the flagellin gene promoter is the hag gene promoter. A flagellin homolog is hag in Bacillus, such as Bacillus subtilis. In another embodiment, the flagellin gene promoter is native to the microorganism in which the subject protein is to be expressed. For example, this may be the case when the expression construct is located in a bacterial chromosome.

[0091] As used herein, the term "Hag" (or "hag" or "hag") refers to the protein annotated as "Hag" in Bacillus subtilis (or a gene encoding such a protein) or any homolog in the same or other genus, species or strain, which is a structural subunit more generally known as "flagellin" for assembling flagella. In other genera, species and strains, it has several other names. It is defined in Bacillus subtilis according to the following sequence:

[0092]

[0093] As used herein, the term "hag promoter" refers to naturally occurring flagellin gene promoters homologous to Bacillus and promoters having substantially identical sequences thereto or specifically hybridizing thereto. In Bacillus subtilis, the hag promoter is contained in a 273 base pair sequence 5' of the start codon of the hag gene. It has the following nucleotide sequence:

[0094]

[0095] [SEQ ID NO:7] (wherein "ATG" represents the start codon of hag). It is expected that the bold sequence starting from TTAA (underlined) to the start codon ATG is sufficient to initiate gene expression.

[0096] In particular, the hag promoter contains a SigD recognition sequence defined by a "ttaa" sequence (underlined), which is a -35 SigD RNA polymerase binding site, and a "tccgatat" sequence (underlined), which is a -10 SigD RNA polymerase binding site. In addition, hag has two CsrA binding sites defined by the sequences "gcacaaggacgt" [SEQ ID NO:8] (high affinity binding site 1, or "BS1") (underlined) and "attcagggaggaa" [SEQ ID NO:9] (low affinity binding site 2, or "BS2") (underlined). The hag promoter is also defined by the Shine-Dalgarno sequence "agggagga". The overall structure of the hag promoter is shown in Figure 4 Medium picture.

[0097] As used herein, the term "CsrA" ("Carbon storage regulator A") refers to the protein annotated as "CsrA" in Bacillus subtilis (or a gene encoding such a protein), - or any homolog or interspecific ortholog in another genus or species, or an intraspecific homolog in the same species. CsrA is homologously called RsmA in some species. The CsrA protein binds to a stem-loop RNA motif with the consensus sequence AGGA in the loop, thereby inhibiting the translation of nucleotide sequences incorporated into mRNA containing the consensus sequence into polypeptides. CsrA can directly inhibit the expression of mRNA transcribed from the hag promoter by binding to the RNA and preventing translation, or indirectly by binding to another RNA encoding a protein that otherwise regulates flagellar expression. CsrA is defined in Bacillus subtilis according to the following sequence:

[0098]

[0099] In certain embodiments, the expression constructs of the present disclosure comprise a genetic modification in the flagellin gene promoter that, after transcription from the promoter into a transcript such as mRNA, represses the inhibition of mRNA translation by CsrA. The present disclosure contemplates several genetic modifications to the flagellin gene promoter, and in particular to the hag promoter, to achieve this result. In some embodiments, genetically modifying hag to inhibit the repression of translation by CsrA may include altering the stem-loop structure of one or both of BS1 or BS2. In some embodiments, the genetic modification is the insertion or deletion of one or more nucleotides.

[0100] The genetic modification can be one or more point mutations that bind to the CsrA BS1 binding site. BS1 can be modified by changing one or more than one (e.g., two, three or four) nucleotides in the CsrA recognition sequence AGGA. For example, the AGGA binding motif of BS1 can be modified to AGAA. Alternatively, the genetic modification can include one or more mutations in the surrounding bases of the stem of the stem-loop secondary structure of BS1 in the 12 base pair BS1 binding site or on either side of the binding site. This includes, for example, modification of one or more than one (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12) nucleotides in the BS1 binding site gcacaaggacgt (SEQ ID NO: 8). Alternatively, the genetic change can destroy the stem-loop structure of BS1 by eliminating the complementarity that allows hydrogen bonding. Such changes can be used as sequences involved in hydrogen bonding taagg gcacaaggacgtOne or more than one mutation in gcctta[SEQ ID NO:1] is performed, for example, to eliminate one, two, three, four or more hydrogen bond pairs. In one embodiment, the modified BS1 has the nucleotide sequence GCACAAGAACGT[SEQ ID NO:2].

[0101] Genetic modification can be one or more point mutations combined with CsrABS2 binding site. This includes one or more (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13) mutations in the surrounding bases of the stem of the stem-loop secondary structure of BS2 formed in the 13 base pairs BS2 binding site or on either side of the binding site. This also includes the genetic changes that destroy the stem-loop structure of BS2 by eliminating the complementarity that allows hydrogen bonding. For example, the modified BS2 can have the nucleotide sequence ATTTAGGGAGGAA [SEQ ID NO: 3]. In certain embodiments, the modification does not include the changes of nucleotides in the Shine-Dalgarno sequence agggagga.

[0102] It will be appreciated that the genetic modification is selected to allow the mRNA to retain ribosome binding activity and permit translation while inhibiting CsrA binding.

[0103] The heterologous nucleotide sequence is heterologous to the flagellin promoter. That is, the heterologous nucleotide sequence is a sequence that is not normally under the control of the hag promoter in nature, and typically encodes a polypeptide whose expression is not under the control of the flagellin promoter. The subject polypeptide can be any polypeptide that is desired to be expressed. In certain embodiments, the polypeptide is an aldehyde dehydrogenase.

[0104] B. Subject Peptide

[0105] The heterologous nucleotide sequence can be placed in operable connection with the flagellin promoter by any method known in the art. For example, the heterologous nucleotide sequence can be integrated into the bacterial chromosome. Alternatively, the heterologous nucleotide sequence can be attached to the flagellin promoter in the plasmid introduced into the microorganism. The heterologous nucleotide sequence can be targeted to the hag promoter by, for example, homologous recombination, as described in, for example, PMID:4994568. Another useful method includes transposon technology. The transposon can target the specific sequence in the chromosome, and insert and attach the nucleotide sequence there. The material for transposon integration is available from, for example, Lucigen (Middleton, WI) commercializing the EZ-Tn5 transposase.

[0106] The polypeptide that is the object of expression ("subject polypeptide") can be any desired polypeptide. Such polypeptides can be those that are desired to be constitutively expressed for the purpose of obtaining a large amount of polypeptides. The polypeptide can be a biopharmaceutical, a food protein such as albumin, or an enzyme in a biochemical pathway such as α-galactosidase A. In certain embodiments, the polypeptide is an enzyme that metabolizes an analyte that may be found in the intestine of an animal. Such an analyte can be found therein by ingestion, by production by a microbiome, by production by a subject, or by diffusion or active transport across the intestinal membrane. Such polypeptides include, for example: peptidases, such as dipeptidyl peptidase IV; and lipases, such as human pancreatic lipase.

[0107] In one embodiment, the polypeptide is an aldehyde dehydrogenase. As used herein, the term "aldehyde dehydrogenase" or "ALDH" refers to any enzyme known or predicted to use acetaldehyde as a substrate and catalyze it into different products. This is most commonly an enzyme known or predicted to function as catalyzing the oxidation of aldehydes. Generally, this refers to enzymes classified EC 1.2.1.-, which use NAD (P) as a cofactor to catalyze the oxidation of aldehydes to carboxylic acids. It includes enzymes that oxidize acetaldehyde to acetate / acetic acid (e.g., EC 1.2.1.3, 1.2.1.4, and 1.2.1.5), and acetylases that convert coenzyme A to acetyl-CoA (e.g., EC 1.2.1.10). It also refers to enzymes that use other defined receptors, including (but not limited to): enzymes that use quinones (e.g., classified EC 1.2.5.-), or enzymes that use other unknown receptors (e.g., classified EC 1.2.99.-).

[0108] In certain embodiments, the aldehyde dehydrogenase is a human aldehyde dehydrogenase (e.g., ALDH2) or a non-human aldehyde dehydrogenase (e.g., AcoD or AldB). The aldehyde dehydrogenase may be a bacterial aldehyde dehydrogenase, and the microorganism expressing the aldehyde dehydrogenase is a bacterium. The aldehyde dehydrogenase may be native to the microorganism in which the gene is to be expressed.

[0109] The subject polypeptide is expressed by placing the nucleotide sequence encoding the polypeptide under the transcriptional control of the flagellin promoter described herein. Nucleotide sequences encoding many genes can be found in publicly available databases such as NCBI, uniprot, KEGG, BRENDA, etc. The polynucleotides encoding the amino acid sequences of these polypeptides can be connected to the promoter by methods well known in the field of molecular biology. In one embodiment, the subject polypeptide is not lacZ.

[0110] IV. Destruction of the repressor of sigma factor

[0111] Sigma factors, such as SigD and its homologues, initiate flagellin synthesis. FlgM and its homologues act as repressors of sigma factor activity. The present disclosure provides for derepression of sigma factor activity by disrupting sigma factor repressors such as FlgM.

[0112] As used herein, the term "FlgM" refers to a protein annotated as "FlgM" in Bacillus subtilis (or a gene encoding such a protein), or any homolog in another genus or species, that inhibits the sigma factor responsible for recruiting RNA polymerase to late flagellar genes for transcription. This inhibited sigma factor is called SigD in Bacillus subtilis, FliA in Escherichia coli, or potentially other names such as σ28 in other genera and species where the sigma factor has homologs. In Bacillus subtilis, FlgM is defined according to the following sequence:

[0113]

[0114] As used herein, the term "SigD" refers to the sigma factor (or the gene encoding it) that is responsible, among other things, for recruiting RNA polymerase to the late flagellar genes for transcription in Bacillus subtilis. "SigD" also refers to homologs in other species, such as FliA in E. coli, or the broader extension of sigma-28 in several species. SigD is defined in Bacillus subtilis according to the following sequence:

[0115]

[0116] FlgM binds to SigD via several residues, most of which are located in the 4th helix at the C-terminus of the FlgM protein. The target for inactivation will be mutations of highly conserved residues corresponding to I-58, K-62, I-65, G-68, D-73, A-78 in the 3rd and 4th helices of Bacillus subtilis FlgM. More generally, any one or combination of the 26 residues directly involved in binding to SigD (as identified in PMID: 15068809) can be mutated to potentially produce a protein with reduced activity or inactivity. Alternatively, any mutation or combination of mutations that destroys the secondary structure or tertiary structure, particularly the 4 helices that define the secondary structure, can potentially successfully reduce or weaken the ability of FlgM to inhibit SigD.

[0117] In some embodiments, the recombinant microorganism comprises a genetic modification that reduces the ability of FlgM to inhibit SigD activity. In particular, one such genetic modification is a partial or complete deletion of the FlgM gene to reduce or eliminate its biological activity. The partial deletion may include a deletion of the gene portion encoding at least 25% of the C-terminus of the protein.

[0118] Other genetic modifications include, for example, frameshift mutations that produce an inactive FlgM protein, or disruption of the FlgM promoter. Alternatively, FlgM can be rendered inactive by point mutations that render FlgM functionally inactive or otherwise inhibit the ability of FlgM to bind to SigD or otherwise repress SigD. Indirectly, FlgM can be disrupted by rendering it insensitive to activators such as ComK or DegU, or by rendering it overly sensitive to repressors such as ScoC or proteases Epr and Wpr.

[0119] V. Recombinant Microorganisms

[0120] The recombinant microorganism contemplated for use herein comprises an expression system comprising at least one expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polynucleotide for expression, the flagellin gene promoter being genetically modified to reduce inhibition of translation by CsrA; and optionally, the FlgM gene being genetically modified to reduce repression of SigD expression.

[0121] Recombinant microorganisms are generally probiotic microorganisms that are safe for ingestion by animals, such as humans. Probiotic microorganisms include, but are not limited to, Bacillus, Bifidobacterium, Enterococcus, Escherichia coli, Lactobacillus, Leuconostoc, Pediococcus, and Streptococcus. Specifically, the disclosure contemplates the use of bacteria of the genus Bacillus, and more specifically Bacillus subtilis. Microorganisms can be obtained from any classical source, including, for example, the American Type Culture Collection (ATCC) or the Bacillus Genetic Stock Center (BGSC).

[0122] In certain embodiments, the microorganism is not a eukaryotic organism. For example, the microorganism is not a eukaryotic organism used for alcoholic beverage fermentation, such as Saccharomyces.

[0123] VI. Probiotic Compositions

[0124] Also provided herein are compositions comprising probiotic microorganisms. The compositions comprise a recombinant microorganism as provided herein in a physiologically acceptable carrier.

[0125] In certain embodiments, the probiotic composition is provided in a unit dose. A unit dose will typically have 10 4 to 10 12The total volume of the dosage can be between about 0.05 mL and 500 mL, for example, between about 0.5 mL and about 50 mL or between about 2.5 mL and 15 mL.

[0126] VII. How to use

[0127] Also provided herein are methods of using the recombinant microorganisms and probiotic compositions to metabolize a target analyte and / or provide a health or wellness benefit to a host.

[0128] The host can be any animal. This includes, for example, mammals, such as primates, such as humans. The mammal can belong to any class, such as artiodactyla, carnivora, cetacean, chiroptera, dermoptera, edentata, hyracoidae, hyrax, insectivore, lagomorpha, marsupial, monotremata, perissodactyla, ungulate, pholidata, and pinnipedia.

[0129] The host may ingest the probiotic composition of the present disclosure in an amount effective to produce the desired result. The desired result may be the metabolism of a target analyte in the intestine of the host. In this case, the subject polypeptide may be an enzyme that processes the analyte. Specifically, the present disclosure contemplates the metabolism of acetaldehyde, a product of ethanol metabolism that is the cause of alcohol hangovers.

[0130] As used herein, the term "alcohol hangover" refers to a condition caused by the consumption of alcohol and is characterized by one or more of the following: dehydration, poor sleep, grogginess, nausea, vomiting, headache, malaise, dry mouth, sensitivity to light and sound, sweating, muscle pain, diarrhea, stomach pain, gastrointestinal discomfort, dizziness, anxiety, depression, irritability, and increased acetaldehyde levels in the body.

[0131] Prevention or treatment of alcohol hangover, such as relief, can include administering a probiotic composition of the present disclosure to a subject before, during, or after drinking alcohol. The composition can be ingested up to any one of 24 hours, 18 hours, 12 hours, 11 hours, 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, 2 hours, or 1 hour before starting to drink alcohol. The probiotic composition can be administered during drinking alcohol. The probiotic composition can be administered up to any one of 12 hours, 11 hours, 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, 2 hours, or 1 hour after drinking alcohol, or at any time when the subject develops symptoms of alcohol hangover.

[0132] The composition can be administered to the intestine (e.g., stomach or intestine) of an individual by oral drinking or by anus. Live microorganisms can be administered to an individual instead of dead microorganisms. The microorganisms can be provided in a different composition than an alcoholic beverage, i.e., can be taken separately from an alcoholic beverage. For example, this can be the case where the composition is administered before drinking alcohol.

[0133] The effective dose of the probiotic may depend on the extent of the symptoms of alcohol hangover. Generally, the dose of the recombinant bacteria will vary depending on factors such as the subject's age, weight, height, sex, general medical condition, and previous medical history. In a specific embodiment, about 10 4 CFU is about 10 12 CFU, 10 5 CFU to 10 11 CFU, 10 6 CFU to 10 10 CFU, 10 8 CFU to 10 10 CFU or 10 8 CFU to 10 12 Bacteria in the range of CFU ("colony forming units") of microorganisms may be desired.

[0134] In another embodiment, the microorganism disclosed herein is used to produce a desired composition. The method for producing such a composition can include cultivating a recombinant microorganism that constitutively expresses an enzyme that converts a target analyte into a desired composition or produces an intermediate in a desired composition. In this case, the target analyte is added to the microbial culture and incubated for a sufficient time to produce an enzymatic product. Example

[0135] Example 1

[0136] method:

[0137] Strains, plasmids, and culture media

[0138] Bacillus subtilis from the Bacillus Genetic Collection strain PY79 (strain 1A747) was used for all manipulations. All Bacillus subtilis strains used here were derivative strains of PY79.

[0139] Unless otherwise stated, bacteria were grown in LB medium (1% tryptone, 0.5% yeast extract, 0.5% sodium chloride, [1.5% agar if solid medium]). For MLS tolerance selection, 1 μg / mL erythromycin and 25 μg / mL lincomycin were used. For transformation experiments, bacteria were grown in modified competent (MC) medium (100 mM phosphate buffer, 2% glucose, 3 mM trisodium citrate, 22 mg / L ammonium ferric citrate, 0.1% casein hydrolysate, 0.16% glutamic acid, 3 mM magnesium sulfate).

[0140] The plasmid used for genetic modification was pMiniMAD[9].

[0141] The plasmid used for IPTG-inducible expression under the pHyspank promoter was pDR111

[10] . 1 mM IPTG was used for all inductions.

[0142] flgM deletion

[0143] Constructed in vitro Transcription A double-stranded DNA molecule containing approximately 800 base pairs 5' and 3' of the flgM gene from Bacillus subtilis PY79, together with the first 15 base pairs and the last 15 base pairs of the coding sequence of flgM separated by the Pstl restriction endonuclease recognition sequence (see the full sequence in Table 1). pMiniMAD was then linearized using primers ZP24 and ZP25 (Table 1). The resulting PCR product and the ΔflgM sequence were then ligated together using Gibson assembly

[11] to generate pMiniMADΔflgM. The resulting plasmid was transformed into Escherichia coli via thermal transformation. The plasmid was miniprepped using a commercially available kit and used as a source of DNA for the following deletions:

[0144] i. A single colony of PY79 was inoculated into 2 mL of MC medium in a 15 mL test tube.

[0145] ii. Grow the culture at 37°C with shaking at 275 rpm for 4.5 hours or approximately 1 hour after exiting exponential growth

[0146] iii. Transfer 400 μL of the culture to a new 15 mL tube and add 1 μg of the miniprep plasmid (described above)

[0147] iv. Return the culture and DNA to the shaker at 37°C for 1.5 hours

[0148] v. Plate on LB agar with 1 μg / mL erythromycin and 25 μg / mL lincomycin

[0149] vi. Incubate overnight at 37°C

[0150] vii. Screen isolated colonies for mutant alleles via PCR using primers ZP77 and ZP78, and inoculate positive colonies in 3 mL of LB broth without antibiotics

[0151] viii. Grow overnight at room temperature with shaking at 275 rpm

[0152] ix. 10 μL of the overnight culture on LB without antibiotics was streaked and grown overnight at 37°C. Due to the lack of antibiotic selection, the plasmid can be lost during the overnight replication. The observed stability of this plasmid is about 90%, with about 1 in 10 colonies losing the plasmid at this stage.

[0153] x. Streak isolated colonies in duplicate on LB with and without antibiotics (1 μg / mL erythromycin and 25 μg / mL lincomycin) and grow overnight at 37°C

[0154] xi. Antibiotic sensitive colony PCR screening using primers ZP77 and ZP78 to identify strains with mutant alleles

[0155] Table 1: Primers and constructed genes / alleles

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162] Replacement of hag with acoD, aldB or GFP gene

[0163] Double-stranded DNA encoding GFP or aldehyde dehydrogenase AcoD (from Cupriavidus necator) and AldB (from Escherichia coli) flanked by 800 base pairs 5' and 3' of the hag gene was constructed (see Table 1 for sequences). In addition, the CsrA binding site was disrupted by specifying that each construct had a single point mutation in the 5' flanking hag homolog just 38 base pairs 5' of the GFP / AcoD / AldB coding sequence, changing the naturally occurring "G" to an "A" (the "A" mutation is highlighted in these sequences in Table 2). These were ligated into the pMiniMAD plasmid linearized with ZP24 and ZP25 via Gibson assembly. The resulting plasmid was transformed into Escherichia coli via thermal transformation. The plasmid was microprepared using a commercially available kit and used as a DNA source for chromosome modification following the same protocol as the flgM deletion.

[0164] GFP assay to quantify promoter strength

[0165] The strains to be tested were struck out on LB plates and grown overnight at 37°C. A single colony from the overnight growth was inoculated into 3 mL of LB and 1 mM IPTG was added to induce a strain of Bacillus subtilis with GFP under the IPTG-inducible pHyspank promoter. The strains were grown at 37°C with shaking at 275 rpm for 7 hours. The culture was continued at 2.5 hours, 4 hours, 5.5 hours and 7.5 hours. Hour Get time points. Take 200 μL of culture from each tube and spin down at 13,000 × g for 2 minutes, and then resuspend the pellet in 200 μL of PBS to get time points. These resuspensions are then divided equally into the wells of costar black 96-well plates and read on a fluorometer (excitation 485nm; emission 535nm). After the fluorescence reading, take 100 μL of each well and read the absorbance at 600nm on a spectrophotometer to normalize the fluorescence to the optical density of the culture.

[0166] For plate observation, frozen stocks were streaked in patches on LB plates and grown overnight at 37° C. Fluorescence was observed with a blue LED flash (480 nm wavelength) and an orange filter.

[0167] HPLC assay to quantify ALDH activity

[0168] Sample preparation: A single colony from an overnight growth on an LB plate at 37°C was inoculated into 4 mL of LB medium and grown at 37°C with shaking at 275 rpm for 1.75 h to an OD of 600The OD value was about 0.2 and then divided into two tubes of 2 mL each. For each strain, one tube was induced with 1 mM IPTG and the other tube was left uninduced as a control. Five hours after induction (total growth of 6.75 hours), the OD value was evaluated. 600 (OD of all strains 600 The cells were then spun down at 20,000 × G for 10 minutes at 4 ° C, and 150 μL of the resulting supernatant was added to 1350 μL of PBS (so if there is no acetaldehyde loss, the final concentration should now be 20 mM). These diluted supernatants were then frozen in 1.5 mL microcentrifuge tubes at -20 ° C.

[0169] Standard preparation: 168 μL of acetaldehyde was added to 1332 μL of PBS to make a 2M stock solution and frozen at -20°C. Samples for preparing the standard curve for HPLC were freshly prepared on the day of the experiment, and final concentrations of 1 mM, 2.5 mM, 5 mM, 10 mM and 20 mM standards were obtained by diluting the 2 M stock solution into PBS. Each standard was prepared in duplicate, one set was run before the sample, and one set was run after the sample. All standards and samples were then loaded into HPLC vials, which were filled to the neck to limit the head space. Samples, but not standards, were filtered through a 0.2 μm filter to remove any residual bacteria when loaded into the HPLC vials.

[0170] The samples were run on a Shimadzu system with an Aminex HPX-87H column. The samples were run at a flow rate of 0.6 mL / min and eluted isocratically with 0.005 M sulfuric acid mobile phase at 50°C (column temperature). The samples were detected via refractive index.

[0171] Qualitative analysis of AcoD expression (Coomassie staining)

[0172] Will FromA single colony grown overnight on an LB plate at 37°C was inoculated into 2.5 mL of LB medium (for strains with pHyspank promoter, + 1 mM IPTG), and grown at 37°C with 275 rpm shaking for 4.5 hours. 1.5 mL of each culture was spun down at 13,000 × G for 2 minutes, and the pellet was resuspended in 50 μL of lysis buffer (20 mM TRIS, 10 mM EDTA, 0.1% lysozyme, 0.01% RNase A, 0.002% DNase I and Roche EDTA-free cOmplete protease inhibitor mixed tablets, diluted according to manufacturer's instructions). The sample was then incubated in lysis buffer in a 37°C water bath for 30 minutes. 50 μL of 2 × laemmli buffer was then added to the sample, and the sample was incubated on a thermal cycler at 100°C for 5 minutes. The samples were then spun down at 13,000×G for 2 minutes and 10 μL were loaded onto an 8% SDS-PAGE gel and run for 1 hour at 140 V. The gel was then rinsed 6 times with ddH2O for 5 minutes each with shaking. The gel was then incubated overnight with shaking in Coomassie Brilliant Blue dye at room temperature.

[0173] result:

[0174] Heterologous expression of the ALDH gene in Bacillus subtilis induces physiologically relevant rates relevantrates) of acetaldehyde decomposition.

[0175] To evaluate the ability of Bacillus subtilis to heterologously express a functional acetaldehyde dehydrogenase, a strain encoding the acetaldehyde dehydrogenase gene under the control of the IPTG-inducible pHyspank promoter was constructed. After reviewing the literature, two different acetaldehyde dehydrogenases were selected. The selection criteria were: characterized enzyme kinetics and high specificity for acetaldehyde; bacterial origin; from non-pathogenic bacteria; soluble protein product (i.e., not membrane-bound); and known amino acid sequence. After conducting such a search, several candidates were identified and two were selected as best meeting these criteria. The first is AcoD, encoded by the acoD gene from Cupriavidus necrotus

[12] , which has an experimentally determined Km for acetaldehyde of approximately 4 μM and uses NAD as its cofactor for oxidizing acetaldehyde to acetic acid. The second is AldB, encoded by the aldB gene of Escherichia coli

[13] , which has an experimentally determined Km of approximately 2.5 μM and a Vmax of 2 U / mg, and uses NADP as its cofactor.

[0176] Bacillus subtilis with acoD under the control of the pHyspank promoter and Bacillus subtilis with aldB under the control of the pHyspank promoter were grown with and without IPTG induction and then incubated with 200 mM IPTG for 30 minutes at room temperature. The samples were then filtered to remove all bacteria and frozen at -20°C.

[0177] The samples were thawed and diluted 1:10 in PBS, and the standards were prepared fresh on the day of the HPLC assay. All samples were then run on the HPLC to quantify the amount of acetaldehyde. In addition to running two sets of standards (one at the beginning of the run and one at the end of the run), a single preparation of a 10 mM standard of acetaldehyde was run at the beginning and end of the run (i.e., the same tube was run twice) to control for any potential evaporation or other random losses of acetaldehyde during the HPLC run, as the tubes would be running on the machine for several hours, and it was desirable to ensure that samples run later in the sequence would not erroneously appear lower. A standard curve was generated for each standard sample based on the area under the curve, and the best fit line had an R of >0.99 2 The equation of this line was then used to generate the concentration of each sample. The results of this assay are presented in Figure 1 There was essentially no difference between the two runs of the acetaldehyde standard, indicating that there was no significant random loss of acetaldehyde from the samples during the runs. In addition, the samples with uninduced bacteria had acetaldehyde levels that corresponded well to the 20 mM standard, demonstrating that uninduced bacteria are unable to effectively remove acetaldehyde through naturally occurring mechanisms.

[0178] However, when AldB or AcoD were induced, samples showed a decrease in acetaldehyde concentrations of about 4 mM and about 8 mM (respectively), indicating that induction of the protein resulted in the removal of acetaldehyde.

[0179] The combination of flqM deletion and CSrA binding site point mutation results in robust and constitutive heterologous expression via the hag promoter Protein expression.

[0180] The flagellar protein encoded by the hag gene in Bacillus subtilis is expressed at very high levels when the cell determines that motility is beneficial. However, because the production of flagella is very nutrient and energy expensive for the cell, it has several mechanisms to repress the production of Hag at times in its life cycle when motility would be inappropriate.

[0181] FlgM is known to bind to and repress the sigma factor SigD, which activates transcription of hag. Therefore, deletion of flgM should remove transcriptional repression and result in high levels of constitutive expression. Translation of hag into protein is further repressed post-transcriptionally by CsrA, which binds to hag transcripts at the ribosome binding site, thereby competitively inhibiting ribosomal translation. A single point mutation in this binding site precludes CsrA binding, but not ribosomal binding, thereby allowing constitutive translation of hag transcripts.

[0182] To test the hypothesis that removal of these two critical repression mechanisms would result in stable and constitutive expression of heterologous proteins, flgM was deleted, a single point mutation was made in the CsrA binding site, and the hag gene was replaced with the expression reporter GFP. The fluorescence of this strain on the plate was compared to that of a strain expressing GFP via the derepressed pHyspank promoter (lacI was deleted from this construct to ensure constitutive expression, and the ΔlacI strain was shown to have similar GFP expression levels as a strain with intact lacI and induced with 1 mM IPTG [data not shown]). When plated simultaneously, the two different isolates of the modified hag expression system were quantitatively much brighter than the pHyspank expression system ( Figure 2 a).

[0183] However, to see if expression was indeed constitutive and to quantify the differences between the two expression systems, broth growth and fluorescence time courses were acquired. Strains were grown in LB and OD was assessed at 2.5 h of growth and then every 90 min thereafter until 7 h. 600 and fluorescence ( Figure 2 b) In fact, after 2.5 hours, in the modified hag expression system, normalized to OD 600 The fluorescence of 10 μM was approximately 4-fold higher than in the pHyspank expression system. This increased to approximately 10-fold higher within 4 hours and remained approximately 10-fold higher over the 7 hours evaluated.

[0184] Using derepressed hag Promoter, Produces higher levels of AcoD than produced by pHyspank .

[0185] To ensure robust and constitutive expression via the hag promoter we modified it not to be specific to GFP but could be used for other heterologous proteins includeAldehyde dehydrogenase expression, two different aldehyde dehydrogenase genes were inserted into the hag locus of two different strains: acoD from Cupriavidus necrotus and aldB from Escherichia coli. These strains were then cultured in broth medium along with strains expressing acoD and aldB via the pHyspank promoter and a strain expressing GFP via a modified hag promoter as a positive control. The bacteria were pelleted and lysed, and the lysates were run on an SDS-PAGE gel and total protein was stained using Coomassie. As expected, there was a clear band for GFP ( Figure 3 In addition, his-tagged AcoD, untagged AcoD, and his-tagged AldB showed the same bright band when expressed via the modified hag promoter ( Figure 3 ). However, there were only faint bands of the expected size for AcoD and AldB under induced pHyspank control. Despite this apparently low level of expression, it is known from HPLC experiments that this level is sufficient to remove acetaldehyde at physiologically relevant rates. Therefore, since Coomassie staining demonstrated the presence of quantitatively significantly more protein produced via the modified hag promoter, it is reasonable to expect that this expression system will produce at least as robust acetaldehyde removal rates, if not more.

[0186] discuss:

[0187] Enzymatic approaches are rapidly replacing small molecules and becoming the standard in the pharmaceutical world, largely due to their superior potency, versatility, and specificity. Evidence of this can be observed in the fact that in 2017, the biopharmaceutical market was valued at over $200 billion and is set to double in the next seven years. Furthermore, eight of the top 10 best-selling drugs in 2016 were biologics.

[0188] However, the current process of making biopharmaceuticals is long, expensive, and often done with a mindset similar to that used to make small molecule drugs. In order to make this powerful class of drugs available for a wider range of uses, a step change in approach is necessary. The present invention aims to provide a cost-effective, orally deliverable enzyme therapy for alcohol hangover.

[0189] like Figure 1 As demonstrated in , intracellular expression of two different heterologous proteins results in significant removal of acetaldehyde. Indeed, if one assumes that a night of heavy drinking results in colonic acetaldehyde levels of approximately 150 μM

[14] and that there is approximately 15 L of extracellular fluid in a 72 kg human body, then the same amount of bacteria can remove 150 μM of acetaldehyde from 15 L in roughly 3 hours. While this is of course a “back-of-the-envelop” calculation, it is at least reasonable to assume that these are relatively representative of physiologically relevant rates.

[0190] Furthermore, the no bacteria control demonstrated that the drop was not due to simple evaporation or some other removal method, and the uninduced control demonstrated that the removal was specific to the expression of ALDH and not some intrinsic function of the bacteria. Furthermore, re-reading of the same 20 mM standard tube at the beginning and end of the run demonstrated that any drop was not due to evaporation during the HPLC run. Furthermore, the removal of acetaldehyde was dependent on the induction of aldehyde dehydrogenase, indicating that the bacteria themselves do not naturally remove acetaldehyde, but require a heterologously expressed acetaldehyde dehydrogenase.

[0191] By removing the FlgM and CsrA repressions, rapid and robust constitutive expression of GFP was achieved throughout the growth cycle of our strain. The fact that these levels are 5-10 times higher than those using the academic gold standard pHyspank promoter expressed in Bacillus subtilis demonstrates the utility of the expression system. It is also important to note that the fluorescence / OD 600 ratio The continued increase throughout the growth curve indicates that fluorescence increases faster than OD, meaning that each cell continues to produce more GFP. This is consistent with the hypothesis that the flgM deletion and CsrA binding site mutations cause constitutive and robust expression. If expression is not constitutive throughout the growth curve, then fluorescence and OD 600 The ratio will eventually stabilize or decrease, even if the absolute fluorescence continues to rise.

[0192] Furthermore, demonstration of physiologically relevant rates of acetaldehyde removal was accomplished using the pHyspank promoter, indicating that our system produces more protein using the edited pHag promoter and should even more fully exceed the necessary acetaldehyde removal rates. In fact, qualitative comparison of the band density of AcoD in Coomassie gels ( Figure 2 b) Demonstrates much more robust protein bands, indicating much superior protein expression.

[0193] In summary, a novel system for removing acetaldehyde from the body has been developed that is different from any other strategy described or implemented to date. It includes edible bacteria engineered to constitutively express heterologous proteins for the purpose of directly removing acetaldehyde enzymatically. It uses a heterologous protein expression strategy that utilizes a robust flagellin promoter that is enhanced by removing the flagellin promoter's repressor.

[0194] Example 2

[0195] The subject ingested an aqueous suspension of 1E9 CFU of a spore preparation of Bacillus subtilis with the following modifications: FlgM deletion, mutation in BS1 as described herein, and the hag gene was replaced with AcoD as described herein. Next, the person ingested six cans of alcoholic beverages (12 ounces of 5% ethanol) over the next three hours and then went to sleep. Typically, this amount of alcohol causes the person to have an alcohol hangover, which is characterized by: weakness, severe headache, nausea, malaise, sensitivity to light and sound, dizziness, and irritability. These symptoms usually appear within 8 hours of the person sleeping and last for 12 hours thereafter. However, the person woke up 8 hours later and his or her body had not formed any excess acetaldehyde due to the metabolism of the ethanol consumed the night before. Therefore, while he or she had mild weakness and a slight headache due to dehydration, the person had greatly reduced or no other symptoms associated with a hangover.

[0196] Exemplary embodiments

[0197] 1. A method for preventing or treating alcohol hangover, the method comprising administering to the intestine of a subject in need thereof an effective amount of a composition comprising a recombinant bacterium recombinantly engineered to constitutively express an aldehyde dehydrogenase.

[0198] 2. The method of embodiment 1, wherein the recombinant bacterium comprises:

[0199] a) a polynucleotide comprising an expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding an aldehyde dehydrogenase, wherein the flagellin gene promoter comprises one or more genetic modifications that reduce CsrA repression of translation of mRNA transcribed from the flagellin gene promoter; and b) a genetic modification of a sigma factor repressor, wherein the modification reduces inhibition of sigma factor transcription initiation from the flagellin gene promoter.

[0200] 3. The method of embodiment 2, wherein the bacterium belongs to a genus selected from the group consisting of Bacillus, Bifidobacterium, Enterococcus, Escherichia, Lactobacillus, Leuconostoc, Pediococcus, and Streptococcus.

[0201] 4. The method of embodiment 2, wherein (1) the bacterium belongs to the genus Bacillus, (2) the flagellin gene promoter is a modified Bacillus hag promoter, the hag promoter comprising one or more genetic modifications of the CsrA BS1 binding site and / or the CsrA BS2 binding site, (3) the sigma factor is SigD, and (4) the SigD repressor is FlgM.

[0202] 5. A method as described in embodiment 4, wherein the hag promoter comprises one or more genetic modifications in the 12 base pair BS1 binding site or in the surrounding bases of the stem forming the stem-loop secondary structure of BS1 on either side of the binding site.

[0203] 6. The method of embodiment 4, wherein the hag promoter comprises a modification of the CsrA BS1 recognition sequence AGGA.

[0204] 7. The method of embodiment 4, wherein the hag promoter comprises the nucleotide sequence GCACAAGAACGT [SEQ ID NO: 2].

[0205] 8. The method of embodiment 4, wherein the one or more genetic modifications comprise one or more point mutations to the CsrABS2 binding site.

[0206] 9. The method of embodiment 4, wherein the hag promoter comprises one or more genetic modifications that disrupt the stem-loop structure of BS2 by eliminating complementarity that allows hydrogen bonding.

[0207] 10. The method of embodiment 4, wherein the hag promoter comprises a modification of the BS2 binding site, wherein the modification comprises the nucleotide sequence ATTTAGGGAGGAA [SEQ ID NO: 3].

[0208] 11. The method of embodiment 1, wherein the aldehyde dehydrogenase is a bacterial aldehyde dehydrogenase.

[0209] 12. The method of embodiment 4, wherein the aldehyde dehydrogenase is selected from (1) AcoD from Cupriavidus necrotus and (2) AldB from Escherichia coli.

[0210] 13. The method of embodiment 4, wherein the genetic modification in the flgM gene comprises a complete or partial deletion of the flgM gene.

[0211] 14. The method of embodiment 4, wherein the genetic modification in the flgM gene disrupts the secondary structure or the tertiary structure.

[0212] 15. The method of embodiment 4, wherein the expression construct is located in a bacterial chromosome.

[0213] 16. The method of embodiment 1, comprising administering the composition to the subject during alcohol consumption.

[0214] 17. The method of embodiment 1, comprising administering the composition to the subject up to 24 hours before starting to consume alcohol.

[0215] 18. The method of embodiment 1, wherein the composition is administered orally.

[0216] 19. The method of embodiment 1, wherein the composition further comprises a physiologically acceptable carrier selected from the group consisting of resistant starch, dietary fiber, carbohydrates, protein and glycosylated protein, water, capsule fillers, and gelatinous substances.

[0217] 20. The method of embodiment 1, wherein the composition comprises about 10 4 About 10 12 colony forming units of the recombinant bacteria.

[0218] 21. A recombinant microorganism comprising: a) a polynucleotide comprising an expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide, wherein the flagellin gene promoter comprises one or more genetic modifications that reduce repression of translation of mRNA transcribed from the flagellin gene promoter by CsrA; and b) a genetic modification of the flgM gene that reduces inhibition of SigD transcription initiation.

[0219] 22. The recombinant microorganism of embodiment 21, wherein the recombinant microorganism constitutively expresses the polypeptide.

[0220] 23. The recombinant microorganism of embodiment 21, wherein the microorganism is probiotic.

[0221] 24. The recombinant microorganism of embodiment 21, wherein the microorganism belongs to a genus selected from the group consisting of Bacillus, Bifidobacterium, Enterococcus, Escherichia, Lactobacillus, Leuconostoc, Pediococcus, and Streptococcus.

[0222] 25. The recombinant microorganism of embodiment 21, wherein the microorganism belongs to the genus Bacillus.

[0223] 26. The recombinant microorganism of embodiment 21, wherein the microorganism is Bacillus subtilis.

[0224] 27. The recombinant microorganism of any one of the preceding embodiments, wherein the flagellin gene promoter is the hag promoter.

[0225] 28. A recombinant microorganism as described in embodiment 27, wherein the hag promoter comprises one or more genetic modifications that reduce CsrA repression of translation of mRNA transcribed from the flagellin gene promoter, wherein the genetic modification includes modification (e.g., nucleotide substitution, insertion or deletion) of the CsrA BS1 binding site and / or the CsrA BS2 binding site.

[0226] 29. The recombinant microorganism of embodiment 28, wherein the one or more genetic modifications include one or more than one (eg, two, three, or four) genetic modifications to the CsrA BS1 recognition sequence AGGA, for example, to the sequence AGAA.

[0227] 30. A recombinant microorganism as described in embodiment 28, wherein the one or more genetic modifications include one or more genetic modifications in the 12 base pair BS1 binding site or in the surrounding bases of the stem that form the stem-loop secondary structure of BS1 on either side of the binding site.

[0228] 31. A recombinant microorganism as described in embodiment 28, wherein the one or more genetic modifications include one or more (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12) genetic modifications of the BS1 binding site gcacaaggacgt.

[0229] 32. The recombinant microorganism of embodiment 28, wherein the one or more genetic modifications disrupt the stem-loop structure of BS1 by eliminating complementarity that allows hydrogen bonding.

[0230] 33. A recombinant microorganism as described in embodiment 28, wherein the one or more genetic modifications include one or more genetic modifications in the sequence taagggcacaaggacgtgcctta [SEQ ID NO: 1] that participate in hydrogen bonding, for example, to eliminate one, two, three, four or more hydrogen bond pairs.

[0231] 34. The recombinant microorganism of embodiment 28, wherein the modified BS1 has the nucleotide sequence GCACAAGAACGT [SEQ ID NO: 2].

[0232] 35. The recombinant microorganism of embodiment 28, wherein the one or more genetic modifications comprise one or more point mutations to the CsrA BS2 binding site.

[0233] 36. A recombinant microorganism as described in embodiment 28, wherein the one or more genetic modifications include one or more (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13) genetic modifications in the 13 base pair BS2 binding site or in the surrounding bases of the stem that form the stem-loop secondary structure of BS2 on either side of the binding site.

[0234] 37. The recombinant microorganism of embodiment 28, wherein the one or more genetic modifications disrupt the stem-loop structure of BS2 by eliminating complementarity that allows hydrogen bonding.

[0235] 38. The recombinant microorganism of embodiment 28, wherein the modified BS2 has the nucleotide sequence ATTTAGGGAGGAA [SEQ ID NO: 3].

[0236] 39. The recombinant microorganism of embodiment 28, wherein the one or more genetic modifications to the BS2 binding site do not include changes to nucleotides in the Shine-Dalgarno sequence agggagga.

[0237] 40. The recombinant microorganism of any one of the preceding embodiments, wherein the flagellin gene promoter is located in a bacterial chromosome or in a plasmid.

[0238] 41. The recombinant microorganism of any of the preceding embodiments, wherein the subject polypeptide is an aldehyde dehydrogenase.

[0239] 42. The recombinant microorganism of embodiment 41, wherein the aldehyde dehydrogenase is AcoD from Cupriavidus necrotus and comprises an amino acid sequence that is identical or substantially identical to:

[0240]

[0241] 43. The recombinant microorganism of embodiment 41, wherein the aldehyde dehydrogenase is a human aldehyde dehydrogenase, such as a human aldehyde dehydrogenase having an amino acid sequence identical or substantially identical to:

[0242]

[0243] 44. The recombinant microorganism of embodiment 21, wherein the genetic modification in the flgM gene comprises a complete or partial deletion of the flgM gene.

[0244] 45. The recombinant microorganism of embodiment 21, wherein the genetic modification in the flgM gene comprises a single mutation or a series of mutations in the sequence encoding the active site of flgM.

[0245] 46. ​​A recombinant microorganism as described in embodiment 21, wherein the genetic modification in the flgM gene disrupts secondary structure or tertiary structure, such as in one of the helices that define the secondary structure of FlgM.

[0246] 47. A recombinant microorganism as described in embodiment 21, wherein the genetic modification in the flgM gene comprises changing an amino acid in the third helix or the fourth helix at the C-terminus of the FlgM protein, for example, selected from I-58, K-62, I-65, G-68, D-73, A-78 of Bacillus subtilis FlgM.

[0247] 48. A recombinant microorganism as described in embodiment 21, wherein the genetic modification in the flgM gene comprises changing one or more amino acids predicted to be involved in the binding of FlgM to SigD, such as I-3, G-7, S-10, V-11, A-40, K-41, M43, I-58, L-61, K-62, I-65, Y-70, K-71, V-72, D-73, A-74, H-76, I-77, A-78, N-80, M-81, I-82, N-83, ​​F-84, Y-85 and K-86 of Bacillus subtilis FlgM.

[0248] 49. A recombinant probiotic microorganism constitutively expressing aldehyde dehydrogenase.

[0249] 50. The recombinant probiotic microorganism of embodiment 49, wherein the microorganism comprises: a) a polynucleotide comprising an expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide; and b) a genetic modification in the FlgM gene that reduces inhibition of SigD expression.

[0250] 51. The recombinant probiotic microorganism of embodiment 50, wherein the flagellin gene promoter comprises one or more genetic modifications that reduce repression of translation of mRNA transcribed from the promoter by CsrA.

[0251] 52. A polynucleotide comprising an expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide, wherein the flagellin gene promoter comprises one or more genetic modifications that reduce CsrA repression of translation of mRNA transcribed from the flagellin gene promoter.

[0252] 53. A method for preparing a polypeptide, the method comprising culturing the recombinant microorganism of embodiment 21 or embodiment 49.

[0253] 54. The method of embodiment 53, further comprising isolating the polypeptide.

[0254] 55. A composition comprising a physiologically acceptable carrier and a recombinant probiotic microorganism, wherein the recombinant probiotic microorganism comprises: a) a polynucleotide comprising an expression construct comprising a flagellin gene promoter operably linked to a heterologous nucleotide sequence encoding a subject polypeptide; and b) a genetic modification of a FlgM gene that reduces inhibition of SigD transcription initiation.

[0255] 56. The composition of embodiment 55, wherein the flagellin gene promoter comprises one or more genetic modifications that reduce repression of translation of mRNA transcribed from the flagellin gene promoter by CsrA.

[0256] 57. The composition of embodiment 55, wherein the subject polypeptide is an aldehyde dehydrogenase.

[0257] 58. The composition of embodiment 55, wherein the physiologically acceptable carrier is selected from the group consisting of resistant starch, dietary fiber, carbohydrates, proteins and glycosylated proteins, water, capsule fillers and gelatinous substances.

[0258] 59. A unit dose of the composition of embodiment 55, comprising about 10 4 About 10 12 The recombinant probiotic microorganism contains colony-forming units.

[0259] 60. A method of metabolizing an analyte in the intestine or in the circulation in a subject, the method comprising administering to the subject an effective amount of a composition comprising a microorganism that constitutively expresses an enzyme that metabolizes the analyte.

[0260] 61. A method for producing a target compound, the method comprising: a) contacting a culture comprising a recombinant microorganism as described in embodiment 1 with an analyte, wherein the subject polypeptide is an enzyme with the analyte as a substrate, and b) culturing the microorganism, wherein the enzyme catalyzes the conversion of the analyte into the target compound.

[0261] 62. The method of embodiment 61, wherein the enzyme is selected from the group consisting of amylase, lipase and protease.

[0262] References

[0263] 1.Sprince,H.,et al.,Protective action ofascorbic acid and sulfurcompounds

[0264] against acetaldehyde toxicity:implications in alcoholism andsmoking.Agents Actions.1975.5(2):p.164-73.

[0265] 2.Mukherjee,S.and D.B.Kearns,The structure and regulation offiagellin Bacillus subtilis.Annu Rev Genet,2014.48:p.319-40.

[0266] 3.Guttenplan,S.B.,S.Shaw,and D.B.Kearns,The cell biologyofperitrichousflagellin Bacillus subtilis.Mol Microbiol,2013.87(1):p.211-29.

[0267] 4.Macnab,R.M.,Genetics and biogenesis ofbacterial flagella.Annu RevGenet,1992.26:p.131-58.

[0268] 5.Caramori,T.,et al.,Role of FlgM in sigma D-dependent geneexpression in Bacillus subtilis.J Bacteriol,1996.178(11):p.3113-8.

[0269] 6.Yakhnin,H.,et al.,CsrA of Bacillus subtilis regulates translationinitiation of the gene encoding the flagellin protein(hag)by blockingribosome binding.Mol Microbiol,2007.64(6):p.1605-20.

[0270] 7.Mukherjee,S.,et al.,CsrA-FliW interaction governs flagellinhomeostasis and a checkpoint on fiagellar morphogenesis in Bacillussubtilis.Mol Microbiol,2011.82(2):p.447—61.

[0271] 8.Vakulskas,C.A.,et al.,Regulation of bacterial virulence by Csr(Rsm)systems.Microbiol Mol Biol Rev,2015.79(2):p.193-224.

[0272] 9.Chen,R.,et al.,Role of the sigmaD-dependent autolysins in Bacillussubtilis population heterogeneity.J Bacteriol,2009.191(18):p.5775-84.

[0273] 10.Ben-Yehuda,S.,D.Z.Rudner,and R.Losick,RacA,a bacterial proteinthat anchors chromosomes to the cefi poles.Science,2003.299(5606):p.532-6.

[0274] 11.Gibson,D.G.,et al.,Enzymatic assembly of DNA molecules up toseveral hundred kilobases.Nat Methods,2009.6(5):p.343-5.

[0275] 12.Jendrossek, D., A.Steinbuchel, and HGSchlegel, Three different proteins exhibiting NAD-dependent acetaldehyde dehydrogenase activity from Alcaligenes eutrophus. Eur J Biochem, 1987.167(3): p.541-8.

[0276] 13. Ho, KK and H. We Jner, Isolation and characterization of an aldehydehydrogenase encoded by the aldB gene of Escherichia coIi. J Bacteriol, 2005.187(3): p.1067-73.

[0277] 14.Salaspuro, M., Microbial metabolism of ethanol and acetaldehyde and clinical consequences. Addict Biol, 1997.2(1): p.35-46.

[0278] As used throughout this application, the terms "may / might" are used in a permissive sense (i.e., meaning having the potential to), rather than in a mandatory sense (i.e., meaning must). The terms "include," "including," and "includes," etc., mean including, but not limited to. As used throughout this application, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to "an element" includes a combination of two or more elements, even though other terms and phrases, such as "one or more," are used with respect to one or more elements. Unless otherwise indicated, the term "or" is non-exclusive, i.e., includes both "and" and "or."

[0279] Although embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the present disclosure be limited to the specific examples provided in this specification. Although the present disclosure has been described with reference to the above-mentioned specification, the description and illustration of the embodiments herein are not meant to be understood in a restrictive sense. Without departing from the present disclosure, those skilled in the art will now think of many variations, changes and replacements. In addition, it should be understood that all aspects of the present disclosure are not limited to the specific depictions, configurations or relative proportions depending on various conditions and variables set forth herein. It should be understood that a variety of alternatives of the embodiments of the present disclosure described herein can be adopted when practicing the present disclosure. It is therefore contemplated that the present disclosure should also encompass any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the present disclosure, and thus encompass methods and structures and their equivalents within the scope of these claims.

Claims

1. Use of a recombinant bacterium for preparing a composition for treating or preventing alcohol hangover, wherein when the composition is used, the recombinant bacterium is administered to a subject in need thereof, wherein the recombinant bacterium is a B. subtilis species and comprises a heterologous nucleic acid sequence encoding an expression product, wherein the heterologous nucleic acid sequence encoding the expression product is operably linked to a flagellin gene promoter, wherein the flagellin gene promoter is a Bacillus subtilis hag promoter, wherein the expression product is acetaldehyde dehydrogenase (ALDH) which oxidizes acetaldehyde to acetic acid, wherein the protein encoding gene promoter comprises a mutation in the CsrA binding site of SEQ ID NO: 1 (taagggcacaagg acgtgcctta) and requires SigD for expression, wherein the mutation in the CsrA binding site eliminates one or more hydrogen bonds involved in the complementarity of forming the stem loop, and wherein the recombinant bacterium comprises a mutation of an endogenous flgM gene, and the mutation of the endogenous flgM gene reduces the inhibition of SigD by FlgM, so that SigD is expressed in the recombinant bacterium and acts on the flagellin gene promoter, so that the heterologous nucleic acid sequence is constitutively expressed and the expression product is constitutively produced, The mutation of the endogenous flgM gene includes the complete or partial deletion of the endogenous flgM gene.

2. Use of a recombinant bacterium for the preparation of a composition for treating or preventing a condition caused by drinking alcohol, the condition being selected from the group consisting of nausea, malaise, sensitivity to light and sound, dizziness and irritability, wherein when the composition is used, the recombinant bacterium is administered to a subject in need thereof, wherein the recombinant bacterium is a B. subtilis species and comprises a heterologous nucleic acid sequence encoding an expression product, wherein the heterologous nucleic acid sequence encoding the expression product is operably linked to a flagellin gene promoter, wherein the flagellin gene promoter is a Bacillus subtilis hag promoter, wherein the expression product is acetaldehyde dehydrogenase (ALDH) which oxidizes acetaldehyde to acetic acid, wherein the protein encoding gene promoter comprises a mutation in the CsrA binding site of SEQ ID NO: 1 (taagggcacaagg acgtgcctta) and requires SigD for expression, wherein the mutation in the CsrA binding site eliminates one or more hydrogen bonds involved in the complementarity of forming the stem loop, and wherein the recombinant bacterium comprises a mutation of an endogenous flgM gene, and the mutation of the endogenous flgM gene reduces the inhibition of SigD by FlgM, so that SigD is expressed in the recombinant bacterium and acts on the flagellin gene promoter, so that the heterologous nucleic acid sequence is constitutively expressed and the expression product is constitutively produced, The mutation of the endogenous flgM gene includes the complete or partial deletion of the endogenous flgM gene.

3. The use of claim 1 or claim 2, wherein when the composition is used, the recombinant bacterium is administered to a subject who has consumed alcohol within a previous period of time, wherein the previous period of time is a period of 24 hours, 12 hours, 6 hours, 3 hours or 1 hour.

4. The use of claim 1 or claim 2, wherein when the composition is used, the recombinant bacterium is administered to a subject suffering from one or more symptoms of alcohol hangover.

5. The use of claim 1 or claim 2, wherein when the composition is used, the recombinant bacterium is administered to a subject who has not consumed alcohol.

6. The use of claim 1 or claim 2, wherein when the composition is used, the recombinant bacterium is administered to a subject who has not consumed alcohol within a previous period of time, wherein the previous period of time is a period of 24 hours, 12 hours, 6 hours, 3 hours or 1 hour.

7. The use of claim 1 or claim 2, wherein the subject drinks alcohol during a period of time after administration of the recombinant bacteria, wherein the period of time after is a period of 24 hours, 12 hours, 6 hours, 3 hours or 1 hour.

8. The method of claim 1 or claim 2, wherein when the composition is used, one or more symptoms of alcohol hangover in the subject are prevented.

9. The use according to claim 1 or claim 2, wherein the enzyme encoded by the heterologous nucleic acid sequence contained in the recombinant bacterium consists of the ALDH enzyme.

10. The use of claim 1 or claim 2, wherein administration of the recombinant bacterium does not affect the blood alcohol content of the subject.

11. The use of claim 1 or claim 2, wherein the administration comprises oral administration of a composition comprising the recombinant bacteria.

12. The use of claim 1 or claim 2, wherein the administration comprises administering 10 4 to 10 12 colony forming units of the recombinant bacteria.

13. The use of claim 1 or claim 2, wherein when the composition is used, the acetaldehyde concentration in the intestine of the human is reduced.

14. Use of a recombinant bacterium for preparing a composition for delivering an expression product encoded by a heterologous nucleic acid sequence to the intestine of a subject, wherein the recombinant bacterium is a Bacillus subtilis species, and when the composition is used, the recombinant bacterium is administered to a subject in need thereof, wherein the recombinant bacterium comprises the heterologous nucleic acid sequence encoding the expression product, the heterologous nucleic acid sequence is operably linked to a flagellin gene promoter, and the flagellin gene promoter is a Bacillus subtilis hag promoter, wherein the flagellin gene promoter comprises a mutation in the CsrA binding site of SEQ ID NO: 1 (taagggcacaagg acgtgcctta) and requires SigD for expression, wherein the mutation in the CsrA binding site eliminates one or more hydrogen bonds involved in the complementarity of forming the stem loop, and wherein the recombinant bacterium comprises a mutation of the flgM gene, and the mutation of the flgM gene reduces the inhibition of FlgM on SigD, so that SigD is expressed in the recombinant bacterium and acts on the flagellin gene promoter so that the heterologous nucleic acid sequence is constitutively expressed and the expression product is constitutively produced, The mutation of the endogenous flgM gene includes the complete or partial deletion of the endogenous flgM gene.

15. The use according to any one of claims 1, 2 or 14, wherein the recombinant bacterium is a spore-forming bacterium and / or is in the form of spores.

16. The use according to claim 14, wherein the mutation in the CsrA binding site does not disrupt the Shine-Dalgarno sequence of the Bacillus subtilis hag promoter.

17. The use of any one of claims 1, 2 or 14, wherein the mutation of the endogenous flgM gene comprises a mutation in the sequence encoding the active site of flgM.

18. The use of any one of claims 1, 2 or 14, wherein the mutation of the endogenous flgM gene comprises a mutation in a sequence encoding an amino acid involved in the binding of FlgM to SigD.

19. The use according to any one of claims 1, 2 or 14, wherein the mutation of the endogenous flgM gene changes the sequence of amino acids in the third helix or the fourth helix of FlgM encoding the C-terminus of the FlgM protein.

20. The use of any one of claims 1, 2 or 14, wherein the recombinant bacterium is a Bacillus subtilis species and the mutation in the endogenous flgM gene alters the sequence encoding amino acids selected from I-58, K-62, I-65, G-68, D-73 and A-78 of SEQ ID NO:

11.

21. The use of any one of claims 1, 2 or 14, wherein the recombinant bacterium is a Bacillus subtilis species and the mutation in the endogenous flgM gene alters a sequence encoding an amino acid selected from the group consisting of I-3, G-7, S-10, V-11, A-40, K-41, M43, 1-58, L-61, K-62, 1-65, Y-70, K-71, V-72, D-73, A-74, H-76, 1-77, A-78, N-80, M-81, 1-82, N-83, ​​F-84, Y-85 and K-86 of SEQ ID NO:

11.

22. The use of any one of claims 1, 2 or 14, wherein the mutation of the endogenous flgM gene reduces or eliminates FlgM biological activity.

23. The method of any one of claims 1, 2 or 14, wherein the recombinant bacteria constitutively expresses the expression product.

24. The use of any one of claims 1, 2 or 14, wherein the preparation of the recombinant bacteria is characterized in that the expression product is expressed in the preparation at a level determined to be at least 4 times greater than the level observed under comparable conditions when the expression product is expressed under the control of the pHyspank promoter.

25. A recombinant Bacillus subtilis, wherein the recombinant bacterium comprises a heterologous nucleic acid sequence encoding an expression product, wherein the heterologous nucleic acid sequence encoding the expression product is operably linked to a flagellin gene promoter, wherein the flagellin gene promoter is a Bacillus subtilis hag promoter, wherein the expression product is acetaldehyde dehydrogenase (ALDH) which oxidizes acetaldehyde to acetic acid, wherein the protein encoding gene promoter comprises a mutation in the CsrA binding site of SEQ ID NO: 1 (taagggcacaagg acgtgcctta) and requires SigD for expression, wherein the mutation in the CsrA binding site eliminates one or more hydrogen bonds involved in the complementarity of forming the stem loop, and wherein the recombinant bacterium comprises a mutation of the flgM gene, and the mutation of the flgM gene reduces the inhibition of FlgM on SigD, so that SigD is expressed in the recombinant bacterium and acts on the flagellin gene promoter, so that the heterologous nucleic acid sequence is constitutively expressed and the expression product is constitutively produced, The mutation of the endogenous flgM gene includes the complete or partial deletion of the endogenous flgM gene.

26. A recombinant Bacillus subtilis, wherein the recombinant Bacillus subtilis constitutively expresses an expression product encoded by a heterologous nucleic acid sequence, wherein the heterologous nucleic acid sequence encoding the expression product is operably linked to a flagellin gene promoter, wherein the flagellin gene promoter is a Bacillus subtilis hag promoter, wherein the expression product is acetaldehyde dehydrogenase (ALDH) which oxidizes acetaldehyde to acetic acid, wherein the protein encoding gene promoter comprises a mutation in the CsrA binding site of SEQ ID NO: 1 (taagggcacaagg acgtgcctta) and requires SigD for expression, wherein the mutation in the CsrA binding site eliminates one or more hydrogen bonds involved in the complementarity of forming the stem loop, and wherein the recombinant bacterium comprises a mutation of an endogenous flgM gene, and the mutation of the endogenous flgM gene reduces the inhibition of SigD by FlgM, so that SigD is expressed in the recombinant bacterium and acts on the flagellin gene promoter, so that the heterologous nucleic acid sequence is constitutively expressed and the expression product is constitutively produced, The mutation of the endogenous flgM gene includes the complete or partial deletion of the endogenous flgM gene.

27. The recombinant bacterium of claim 25 or 26, wherein the enzyme encoded by the heterologous nucleic acid sequence comprised by the recombinant bacterium consists of the ALDH enzyme.

28. A recombinant Bacillus subtilis, wherein the recombinant Bacillus subtilis comprises a heterologous nucleic acid sequence encoding an expression product, wherein the heterologous nucleic acid sequence is operably linked to a flagellin gene promoter, wherein the flagellin gene promoter is a Bacillus subtilis hag promoter, wherein the protein encoding gene promoter comprises a mutation in the CsrA binding site of SEQ ID NO: 1 (taagggcacaagg acgtgcctta) and requires SigD for expression, wherein the mutation in the CsrA binding site eliminates one or more hydrogen bonds involved in the complementarity of forming the stem loop, and wherein the recombinant bacterium comprises a mutation of an endogenous flgM gene, and the mutation of the endogenous flgM gene reduces the inhibition of SigD by FlgM, so that SigD is expressed in the recombinant bacterium and acts on the flagellin gene promoter, so that the heterologous nucleic acid sequence is constitutively expressed and the expression product is constitutively produced, The mutation of the endogenous flgM gene includes the complete or partial deletion of the endogenous flgM gene.

29. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the recombinant bacterium is a spore-forming bacterium and / or is in the form of spores.

30. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the mutation in the CsrA binding site does not disrupt the Shine-Dalgarno sequence of the Bacillus subtilis hag promoter.

31. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the mutation in the endogenous flgM gene comprises a mutation in the sequence encoding the active site of flgM.

32. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the mutation in the endogenous flgM gene comprises a mutation in a sequence encoding an amino acid involved in binding of FlgM to SigD.

33. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the mutation in the endogenous flgM gene changes the sequence of amino acids in the third helix or the fourth helix of FlgM encoding the C-terminus of the FlgM protein.

34. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the recombinant bacterium is a Bacillus subtilis species and the mutation in the endogenous flgM gene alters the sequence encoding an amino acid selected from I-58, K-62, I-65, G-68, D-73 and A-78 of SEQ ID NO:

11.

35. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the recombinant bacterium is a Bacillus subtilis species and the mutation in the endogenous flgM gene alters a sequence encoding an amino acid selected from the group consisting of I-3, G-7, S-10, V-11, A-40, K-41, M43, 1-58, L-61, K-62, 1-65, Y-70, K-71, V-72, D-73, A-74, H-76, 1-77, A-78, N-80, M-81, 1-82, N-83, ​​F-84, Y-85 and K-86 of SEQ ID NO:

11.

36. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the mutation of the endogenous flgM gene reduces or eliminates FlgM biological activity.

37. The recombinant bacterium of any one of claims 25, 26 or 28, wherein the recombinant bacterium constitutively expresses the expression product.

38. A preparation of recombinant bacteria as described in any one of claims 25, 26 or 28, characterized in that the expression product is expressed in the preparation at a level determined to be at least 4 times greater than the level observed under comparable conditions when the expression product is expressed under the control of the pHyspank promoter.

39. A composition comprising the recombinant bacterium of any one of claims 25-28.

40. The composition of claim 39, wherein the composition is configured for oral administration.

41. The composition of claim 39, wherein the composition comprises 10 4 Up to 10 12 colony forming units of the recombinant bacteria.

42. The composition of claim 39, wherein the composition comprises a physiologically acceptable carrier.

43. The composition of claim 42, wherein the physiologically acceptable carrier is selected from the group consisting of resistant starch, dietary fiber, carbohydrates, proteins, glycosylated proteins, water, capsule fillers, and gelatinous substances.

44. A bacterial cell culture comprising the recombinant bacterium of any one of claims 25, 26 or 28.

Images