Hybrid regulatory element

Abstract

The present invention relates to hybrid transcriptional regulatory elements driving gene expression, in particular hybrid promoters, which are designed by fusing at least two transcriptional regulatory elements with different tissue selectivities, such as two promoters that drive expression in different tissues in a tissue-selective manner.

Description

Technical Field

[0001] The present invention relates to hybrid transcriptional regulatory elements driving gene expression, in particular hybrid promoters, which are designed by fusing at least two transcriptional regulatory elements with different tissue selectivities, such as two promoters that drive expression in different tissues in a tissue-selective manner. Background Art

[0002] Gene therapy has the potential to provide sustained therapeutic correction of genetic diseases and is currently being tested in many clinical trials. However, for many diseases, insufficient expression of the transferred gene in the desired target tissue and anti-transferred gene immunity remain important obstacles to successful gene therapy. This is particularly important for the treatment of diseases caused by mutations in genes that are ubiquitously expressed or expressed in multiple tissues of the body, such as liver, muscle, and central nervous system (CNS). Examples of these diseases include: i. lysosomal storage diseases [(LSD), such as Pompe disease (PD), mucopolysaccharidosis type I to type VII (MPSI-VII), Sandhoff and Tay-Sachs disease]; ii. metabolic diseases [such as maple syrup urine disease (MSUD), methylmalonic acidemia (MMA), glycogen storage diseases type I and type III (GSDI, III), Niemann-Pick disease (NPC), Canavan disease, phenylketonuria (PKU)]; and iii. neuromuscular diseases [such as spinal muscular atrophy (SMA) and Friedreich's ataxia (FA)]. So far, the use of ubiquitous promoters that drive expression in different tissues is the only option for targeting transgene expression to multiple affected tissues including visceral organs, muscle, and CNS. Ubiquitous promoters are far from being ideal tools for in vivo AAV gene therapy, as they have been reported to promote liver genotoxicity in animal models due to their strong transactivation activity, which can lead to tumor formation (Chandler et al., JCI 2015; 125(2): 870–880) and are associated with ectopic nonphysiological gene expression. Recently, in preclinical studies, severe toxicity was reported in non-human primates and piglets treated with high doses of systemic delivery of AAV vectors containing the ubiquitous chicken β-actin promoter (Hinderer et al., Hum Gene Ther. 2018 Feb 12.).

[0003] In addition, many diseases are caused by genetic mutations that cause huge changes in protein products or the complete absence (null mutations). Treating these diseases by gene therapy can lead to the re-expression of wild-type proteins, which has a high risk of inducing harmful immune responses, which may prevent the therapeutic efficacy and even mediate the destruction of cells expressing the transgene. This is especially important for therapeutic protein products with high immunogenicity, such as: coagulation factor VIII [FVIII, causing hemophilia A (HA)], lysosomal enzyme α-L-iduronidase [IDUA (α enzyme-L iduronidase), causing MPSI] and acid-α-glucosidase [(GAA), causing Pompe disease] and muscle proteins [dystrophin, causing Duchenne muscular dystrophy (DMD), and α-sarcoglycan (SGCA), causing limb-girdle muscular dystrophy 2D (LGMD2D)], etc.

[0004] Pompe disease is a severe neuromuscular disorder caused by mutations in the lysosomal enzyme acid α-glucosidase (GAA), which causes pathological accumulation of glycogen in all tissues. Pompe disease is classified into two forms: infantile-onset Pompe disease (IOPD) that develops in the first year of life and late-onset Pompe disease (LOPD) that occurs later in childhood, adolescence, or adulthood [Kishnani et al., Am J Med Genet C Semin Med Genet. 2012]. For IOPD, therapeutic intervention in the first month of life is an important medical need. If untreated, IOPD leads to death in the first year of life, and late / ineffective treatment will not reverse late symptoms [Chien et al., Pediatr Neonatol. 2013Aug; 54 (4): 219-27]. Enzyme replacement therapy (ERT) using recombinant human GAA (rhGAA) can be used for PD. Although it is a life-saving treatment for IOPD subjects, ERT has limited efficacy in CNS and muscle groups that are difficult to take up rhGAA. In addition, ERT is hampered by immune responses induced by the therapeutic product (rhGAA), which prevent the therapeutic effect. Similar to ERT, AAV gene therapy faces the same limitations in clinical trials of Pompe disease (Corti et al., Hum Gene Ther Clin Dev. 2017 Dec; 28 (4): 208-218) and in preclinical studies in mouse models of the disease. Specifically: 1. After gene transfer to muscle using ubiquitous or muscle-selective promoters, a strong immune response to GAA was observed; 2. Limited biodistribution of GAA protein to affected tissues such as systemic muscle and nervous system was obtained. The GAA protein is in fact poorly secreted by cells naturally and cannot cross the blood-brain barrier (the size of circulating GAA protein is ~110Kda).

[0005] Therefore, there is still a need to provide sustained and widespread expression of therapeutic transgenic genes in multiple tissues of the body. In addition, there is still a need to provide sustained and widespread expression of transgenic genes in different target tissues, combined with the induction of immune tolerance to therapeutic proteins to obtain safe and effective gene therapy. Summary of the invention

[0006] The present invention provides a genetic engineering strategy for implementing novel multiple tissue-selective transcriptional regulatory elements designed by the present inventors for expressing a transgene of interest in a subject in need thereof.

[0007] Specifically, the present invention relates to a nucleic acid sequence that combines at least two different transcriptional regulatory elements fused together with different tissue-selective expression conditions. Depending on specific needs, such as the needs of a specific disease, this nucleic acid sequence can provide the expression of the transfer gene of interest in at least two tissues or in multiple tissues. When it is necessary to obtain immune tolerance by the immune system, one of the targeted tissues may be a tolerogenic tissue (e.g., liver). This multi-tissue selective genetic engineering strategy leads to improved gene expression efficiency compared to the classical strategy that focuses on the expression of the transfer gene in only one tissue. Therefore, the present invention is particularly advantageous in the context of gene therapy. In the present invention, the combination of multiple tissue-selective transcriptional regulatory elements (e.g., multiple tissue-selective promoters) has the advantage of driving high transfer gene expression in the desired tissue in a selective manner.

[0008] In addition, unlike ubiquitous promoters, the present invention prevents ectopic expression of transgenic genes in tissues that do not express the transgenic gene of interest or do not require expression of the transgenic gene of interest under physiological conditions. The combination of transcriptional regulatory elements disclosed herein also overcomes concerns about genotoxicity caused by ubiquitous promoters (Chandler et al., supra), and may also prevent possible toxicity reported recently in non-human primates in preclinical studies (Hinderer et al., supra).

[0009] The first aspect of the present invention relates to a nucleic acid sequence comprising:

[0010] (i) a first transcriptional regulatory element capable of driving or enhancing tissue-selective expression in a first tissue; and

[0011] (ii) a second transcriptional regulatory element capable of driving or enhancing tissue-selective expression in a second tissue;

[0012] wherein the first transcriptional regulatory element and the second transcriptional regulatory element are fused together; and

[0013] Wherein at least one of the first transcriptional regulatory element and the second transcriptional regulatory element is a tissue-selective promoter.

[0014] In certain embodiments, the first transcriptional regulatory element is a tissue selective promoter capable of driving tissue selective expression in a first tissue. In other embodiments, the second transcriptional regulatory element is also a tissue selective promoter.

[0015] In a specific embodiment, a transcriptional regulatory element is selected from a liver-selective promoter, a muscle-selective promoter and a neuron-selective promoter, in particular a liver-selective promoter. In a specific embodiment, when the transcriptional regulatory element is a liver-selective promoter, the transcriptional regulatory element is preferably selected from alpha-1 antitrypsin promoter (hAAT), a combination of ApoE enhancer and hAAT promoter, a thyroxine transporter promoter, an albumin promoter, a thyroxine-binding globulin (TBG) promoter and a LSP promoter. In another embodiment, when the transcriptional regulatory element is a muscle-selective promoter, the transcriptional regulatory element is preferably selected from the group consisting of spC5.12 promoter, MHCK7 promoter, E-syn promoter, muscle creatine kinase myosin light chain (MLC) promoter, myosin heavy chain (MHC) promoter, desmin promoter, cardiac troponin C promoter, troponin I promoter, myoD gene family promoter, α-actin promoter, β-actin promoter, γ-actin promoter, a muscle-selective promoter located in intron 1 of eye-type Pitx3, and CK6 promoter. In another embodiment, when the transcriptional regulatory element is a muscle-selective promoter, the transcriptional regulatory element is preferably selected from the group consisting of spC5.12 promoter, MHCK7 promoter, E-syn promoter, muscle creatine kinase myosin light chain (MLC) promoter, myosin heavy chain (MHC) promoter, cardiac troponin C promoter, troponin I promoter, myoD gene family promoter, α-actin promoter, β-actin promoter, γ-actin promoter, a muscle-selective promoter located in intron 1 of eye-type Pitx3, and CK6 promoter. In another specific embodiment, when the transcriptional regulatory element is a neuron-selective promoter, the transcriptional regulatory element is preferably selected from the group consisting of synapsin-1 (Syn) promoter, neuron-specific enolase (NSE) promoter, neurofilament light chain gene promoter, neuron-specific vgf gene promoter, synapsin-2 promoter, tyrosine hydroxylase promoter, dopamine β-hydroxylase promoter, hypoxanthine phosphoribosyltransferase promoter, low-affinity NGF receptor promoter, choline acetyltransferase promoter, calcitonin gene-related peptide (CGRP) promoter, Hb9 promoter, GFAP promoter, calcium binding protein 2 promoter, Mnx1 promoter, nestin promoter, parvalbumin promoter, somatostatin promoter and Plp1 promoter.

[0016] Furthermore, in another embodiment, the muscle selective promoter is selected from spC5.12, desmin and muscle creatine kinase (MCK) promoter, in particular selected from spC5.12 and muscle creatine kinase (MCK) promoter; and / or the neuron selective promoter is Syn promoter.

[0017] In yet another embodiment, the nucleic acid sequence is:

[0018] (i) a combination of the ApoE enhancer and the hAAT promoter, and (ii) the spC5.12 promoter; or

[0019] (i) a combination of the ApoE enhancer and the hAAT promoter, and (ii) the Syn promoter; or

[0020] (i) is the ApoE enhancer, and (ii) is the spC5.12 promoter.

[0021] According to another aspect, the present invention relates to an expression cassette comprising a nucleic acid sequence disclosed herein and a transgenic gene of interest. The transgenic gene of interest may more specifically be a therapeutic transgenic gene of interest. In a specific embodiment, the therapeutic transgenic gene of interest is acid alpha-glucosidase (GAA).

[0022] On the other hand, the present invention relates to a vector comprising an expression cassette disclosed herein. Specifically, the vector can be a viral vector. Representative viral vectors include, but are not limited to, adenoviral vectors, retroviral vectors, lentiviral vectors, and AAV vectors. In a specific embodiment, the viral vector is an AAV vector, such as an AAV vector comprising an AAV8 or AAV9 capsid.

[0023] The present invention also relates to an isolated cell transformed with a nucleic acid sequence, expression cassette or vector disclosed herein.

[0024] In addition, the present invention also relates to a pharmaceutical composition, which comprises the expression cassette, vector or cell according to the present invention. In this regard, the transgenic gene of interest contained in the expression cassette, vector or cell is a therapeutic transgenic gene.

[0025] Furthermore, the present invention also relates to an expression cassette, vector or cell disclosed herein for use as a medicament. In this regard, the transgene of interest contained in the expression cassette, vector or cell is a therapeutic transgene.

[0026] In another aspect, the present invention relates to an expression cassette, vector or cell disclosed herein for use in a method of treating a disorder by gene therapy through expression of a therapeutically transferred gene in a therapeutic tissue of interest. The present invention can be used to treat a large number of disorders. In a specific embodiment, the disorder is selected from:

[0027] Lysosomal storage diseases (LSDs), such as mucopolysaccharidosis types I to VII (MPSI-VII), Sandhoff disease, and Tay-Sachs;

[0028] Metabolic diseases such as maple syrup urine disease (MSUD), methylmalonic acidemia (MMA), glycogen storage disease types I and III (GSDI and III), Niemann-Pick disease (NPC), Canavan disease, phenylketonuria (PKU);

[0029] Neuromuscular disorders, such as muscular dystrophy (e.g. myotonic dystrophy (Steinert disease), Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, Emory-Dreyfuss muscular dystrophy), motor neuron disease (e.g. amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (infantile progressive spinal muscular atrophy (type 1, Werdnig-Hoffmann disease), intermediate spinal muscular atrophy (type 2), juvenile spinal muscular atrophy (type 3, Kugelberg-Welander disease), adult-onset spinal muscular atrophy (type 4)), spinal-bulbar muscular atrophy (Kennedy disease)), inflammatory myopathies (e.g. polymyositis dermatomyositis, inclusion body myositis), diseases of the muscle-nerve junction (e.g. severe myositis myasthenia, Lambert-Eaton syndrome, congenital myasthenic syndrome), diseases of the peripheral nerves (e.g. Charcot-Marie-Tooth disease, Friedrich's ataxia, Dejerine-Sottas disease), metabolic diseases of muscle (e.g. phosphorylase deficiency (McArdle disease), acid maltase deficiency (Pompe disease), phosphofructokinase deficiency (Tarui disease), debranching enzyme deficiency (Cori or Forbes disease), mitochondrial myopathy, carnitine deficiency, carnitine palmitoyltransferase deficiency, phosphoglycerate kinase deficiency, phosphoglycerate mutase deficiency, lactate dehydrogenase deficiency, myoadenylate deaminase deficiency), myopathies caused by endocrine abnormalities (e.g. hyperthyroid myopathy, hypothyroid myopathy) and other myopathies (e.g. myotonia congenita, paramyotonia congenita, central axonal disease, nematode myopathy, myotubular myopathy, periodic paralysis); and

[0030] Other myopathies, such as hemophilia A, MPSI, Alzheimer's disease, Parkinson's disease, Huntington's disease, Tourette syndrome, schizophrenia, Sly disease, Hunter disease, dementia, paranoia, obsessive-compulsive disorder, learning disabilities, ALS, Charcot-Marie-Tooth disease, Kennedy disease, glioblastoma, neuroblastoma, autism, Gaucher disease, Hurler disease, Krabbe disease, and behavioral changes (e.g., disturbances in sleep, perception, or cognition).

[0031] More specifically, the disorder may be selected from:

[0032] Lysosomal storage diseases (LSDs), such as mucopolysaccharidosis types I to VII (MPSI-VII), Sandhoff disease, and Tay-Sachs;

[0033] Metabolic diseases such as maple syrup urine disease (MSUD), methylmalonic acidemia (MMA), glycogen storage disease types I and III (GSDI and III), Niemann-Pick disease (NPC), Canavan disease, phenylketonuria (PKU);

[0034] Neuromuscular disorders, such as muscular dystrophy (e.g., myotonic dystrophy (Steinert disease), Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, Emory-Dreyfuss muscular dystrophy), motor neuron disease (e.g., amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (infantile progressive spinal muscular atrophy type 1, Werdnig-Hoffmann disease), intermediate spinal muscular atrophy (type 2), juvenile spinal muscular atrophy (type 3, Kugelberg-Welander disease), adult-onset spinal muscular atrophy (type 4)), spinal-bulbar muscular atrophy (Kennedy disease)), inflammatory myopathies (e.g., polymyositis dermatomyositis, inclusion body myositis), diseases of the muscle-nerve junction (e.g., myasthenia gravis, Lambert-Eaton syndrome, congenital myasthenic syndrome), diseases of the peripheral nerves (e.g., Charcot-Marie-Tooth disease, Friedrich's ataxia, Dejerine-Sottas disease).

[0035] In another specific embodiment, the disorder is a glycogen storage disease, particularly Pompe's disease, more particularly infantile-onset Pompe's disease or late-onset Pompe's disease, even more particularly infantile-onset Pompe's disease. Sequence Listing <110> GENETHON, etc. <120> Hybrid regulatory element <130> B2684PC00 <160> 25 <170> PatentIn version 3.5 <210> 1 <211> 358 <212> DNA <213> Artificial <220> <223> spC5.12 promoter <400> 1 caccgcggtg gcggccgtcc gccctcggca ccatcctcac gacacccaaa tatggcgacg 60 caccgcggtg gcggccgtcc gccctcggca ccatcctcac gacacccaaa tatggcgacg 60 ggtgaggaat ggtggggagt tatttttaga gcggtgagga aggtgggcag gcagcaggtg 120 ggtgaggaat ggtggggagt tatttttaga gcggtgagga aggtgggcag gcagcaggtg 120 ttggcgctct aaaaataact cccgggagtt atttttagag cggaggaatg gtggacaccc 180 ttggcgctct aaaaataact cccgggagtt atttttagag cggaggaatg gtggacaccc 180 aaatatggcg acggttcctc acccgtcgcc atatttgggt gtccgccctc ggccggggcc 240 aaatatggcg acggttcctc acccgtcgcc atatttgggt gtccgccctc ggccggggcc 240 gcattcctgg gggccgggcg gtgctcccgc ccgcctcgat aaaaggctcc ggggccggcg 300 gcattcctgg gggccgggcg gtgctcccgc ccgcctcgat aaaaggctcc ggggccggcg 300 gcggcccacg agctacccgg aggagcggga ggcgccaagc tctagaacta gtggatct 358 gcggcccacg agctacccgg aggagcggga ggcgccaagc tctagaacta gtggatct 358 <210> 2 <211> 397 <212> DNA <213> Artificial <220> <223> hAAT promoter <400> 2 gatcttgcta ccagtggaac agccactaag gattctgcag tgagagcaga gggccagcta 60 gatcttgcta ccagtggaac agccactaag gattctgcag tgagagcaga gggccagcta 60 agtggtactc tcccagagac tgtctgactc acgccacccc ctccaccttg gacacaggac 120 agtggtactc tcccagagac tgtctgactc acgccacccc ctccaccttg gacacaggac 120 gctgtggttt ctgagccagg tacaatgact cctttcggta agtgcagtgg aagctgtaca 180 gctgtggttt ctgagccagg tacaatgact cctttcggta agtgcagtgg aagctgtaca 180 ctgcccaggc aaagcgtccg ggcagcgtag gcgggcgact cagatcccag ccagtggact 240 ctgcccaggc aaagcgtccg ggcagcgtag gcgggcgact cagatcccag ccagtggact 240 tagcccctgt ttgctcctcc gataactggg gtgaccttgg ttaatattca ccagcagcct 300 cccccgttgc ccctctggat ccactgctta aatacggacg aggacagggc cctgtctcct 360 cagcttcagg caccaccact gacctgggac agtgaat 397 <210> 3 <211> 468 <212> DNA <213> Artificial <220> <223> hSYN promoter <400> 3 tgcagagggc cctgcgtatg agtgcaagtg ggttttagga ccaggatgag gcggggtggg 60 ggtgcctacc tgacgaccga ccccgaccca ctggacaagc acccaacccc cattccccaa 120 attgcgcatc ccctatcaga gagggggagg ggaaacagga tgcggcgagg cgcgtgcgca 180 ctgccagctt cagcaccgcg gacagtgcct tcgcccccgc ctggcggcgc gcgccaccgc 240 cgcctcagca ctgaaggcgc gctgacgtca ctcgccggtc ccccgcaaac tccccttccc 300 ggccaccttg gtcgcgtccg cgccgccgcc ggcccagccg gaccgcacca cgcgaggcgc 360 gagatagggg ggcacgggcg cgaccatctg cgctgcggcg ccggcgactc agcgctgcct 420 cagtctgcgg tgggcagcgg aggagtcgtg tcgtgcctga gagcgcag 468 <210> 4 <211> 321 <212> DNA <213> artificial <220> <223> ApoE enhancer <400> 4 aggctcagag gcacacagga gtttctgggc tcaccctgcc cccttccaac ccctcagttc 60 ccatcctcca gcagctgttt gtgtgctgcc tctgaagtcc acactgaaca aacttcagcc 120 tactcatgtc cctaaaatgg gcaaacattg caagcagcaa acagcaaaca cacagccctc 180 cctgcctgct gaccttggag ctggggcaga ggtcagagac ctctctgggc ccatgccacc 240 tccaacatcc actcgacccc ttggaatttc ggtggagagg agcagaggtt gtcctggcgt 300 ggtttaggta gtgtgagagg g 321 <210> 5 <211> 683 <212> DNA <213> artificial <220> <223> Enh.C5.12 <220> <221> misc_feature <222> (1)..(321) <223> ApoE enhancer <220> <221> misc_feature <222> (322)..(325) <223> linker <220> <221> misc_feature <222> (326)..(683) <223> spC5.12 promoter <400> 5 aggctcagag gcacacagga gtttctgggc tcaccctgcc cccttccaac ccctcagttc 60 ccatcctcca gcagctgttt gtgtgctgcc tctgaagtcc acactgaaca aacttcagcc 120 tactcatgtc cctaaaatgg gcaaacattg caagcagcaa acagcaaaca cacagccctc 180 cctgcctgct gaccttggag ctggggcaga ggtcagagac ctctctgggc ccatgccacc 240 tccaacatcc actcgacccc ttggaatttc ggtggagagg agcagaggtt gtcctggcgt 300 ggtttaggta gtgtgagagg ggtaccaccg cggtggcggc cgtccgccct cggcaccatc 360 ctcacgacac ccaaatatgg cgacgggtga ggaatggtgg ggagttattt ttagagcggt 420 gaggaaggtg ggcaggcagc aggtgttggc gctctaaaaa taactcccgg gagttatttt 480 tagagcggag gaatggtgga cacccaaata tggcgacggt tcctcacccg tcgccatatt 540 tgggtgtccg ccctcggccg gggccgcatt cctgggggcc gggcggtgct cccgcccgcc 600 tcgataaaag gctccggggc cggcggcggc ccacgagcta cccggaggag cgggaggcgc 660 caagctctag aactagtgga tct 683 <210> 6 <211> 1121 <212> DNA <213> Artificial <220> <223> LiMP <220> <221> misc_feature <222> (1)..(321) <223> ApoE enhancer <220> <221> misc_feature <222> (322)..(330) <223> Connector <220> <221> misc_feature <222> (331)..(727) <223> hAAT promoter <220> <221> misc_feature <222> (728)..(763) <223> Connector <220> <221> misc_feature <222> (764)..(1121) <223> spC5.12 promoter <400> 6 aggctcagag gcacacagga gtttctgggc tcaccctgcc cccttccaac ccctcagttc 60 ccatcctcca gcagctgttt gtgtgctgcc tctgaagtcc acactgaaca aacttcagcc 120 tactcatgtc cctaaaatgg gcaaacattg caagcagcaa acagcaaaca cacagccctc 180 cctgcctgct gaccttggag ctggggcaga ggtcagagac ctctctgggc ccatgccacc 240 tccacatcc actcgacccc ttggaatttc gtggagagg agcagaggtt gtcctggcgt 300 ggtttaggta gtgtgagagg ggtacccggg gatcttgcta ccagtggaac agccactaag 360 gattctgcag tgagagcaga gggccagcta agtggtactc tcccagagac tgtctgactc 420 acgccacccc ctccaccttg vakacaggac gctgtggttt ctgagccagg tacaatgact 480 cctttcggta agtgcagtgg aagctgtaca ctgcccaggc aaagcgtccg ggcagcgtag 540 gcgggcgact cagatcccag ccagtggact tagccctgt tgctcctcc gataactggg 600 gtgaccttgg ttaatattca ccagcagcct cccccgttgc cccctggat ccactgctta 660 atacggacg aggacagggc cctgtctcct cagcttcagg caccaccact gacctgggac 720 agtgaataga tcctgagaac ttcagggtga gtctatggga ccccaccgcg gtggcggccg 780 tccgccctcg gcaccatcct cacgacaccc aaatatggcg acgggtgagg aatggtgggg 840 agttatttt agagcggtga ggaggtggg caggcagcag gtgttggcgc tctaaaaata 900 actcccggga gttattttta gagcggagga atggtggaca cccaaatatg gcgacggttc 960 ctcacccgtc gccatatttg ggtgtccgcc ctcggccggg gccgcattcc tggggggccgg 1020 gcggtgctcc cgcccgcctc gataaaaggc tccggggccg gcggcggccc acgagctacc 1080 cggaggagcg ggaggcgcca agctctagaa ctagtggatc t 1121 <210> 7 <211> 1231 <212> DNA <213> Artificial <220> <223> LiNeuP <220> <221> misc_feature <222> (1)..(321) <223> ApoE enhancer <220> <221> misc_feature <222> (322)..(330) <223> Connector <220> <221> misc_feature <222> (331)..(727) <223> hAAT promoter <220> <221> misc_feature <222> (728)..(763) <223> Connector <220> <221> misc_feature <222> (764)..(1231) <223> hSYN promoter <400> 7 aggctcagag gcacacagga gttctgggc tcaccctgcc cccttccac ccctcagttc 60 ccatcctcca gcagctgttt gtgtgctgcc tctgaagtcc acactgaaca aacttcagcc 120 tactcatgtc cctaaaatgg gcaacattg caagcagcaa acagcaaca cacagccctc 180 cctgcctgct gaccttggag ctggggcaga ggtcagagac ctctctgggc ccatgccacc 240 tccacatcc actcgacccc ttggaatttc gtggagagg agcagaggtt gtcctggcgt 300 ggtttaggta gtgtgagagg ggtacccggg gatcttgcta ccagtggaac agccactaag 360 gattctgcag tgagagcaga gggccagcta agtggtactc tcccagagac tgtctgactc 420 acgccacccc ctccaccttg vakacaggac gctgtggttt ctgagccagg tacaatgact 480 cctttcggta agtgcagtgg aagctgtaca ctgcccaggc aaagcgtccg ggcagcgtag 540 gcgggcgact cagatcccag ccagtggact tagccctgt tgctcctcc gataactggg 600 gtgaccttgg ttaatattca ccagcagcct cccccgttgc cccctggat ccactgctta 660 atacggacg aggacagggc cctgtctcct cagcttcagg caccaccact gacctgggac 720 agtgaataga tcctgagaac ttcagggtga gtctatggga ccctgcagag ggccctgcgt 780 atgagtgcaa gtgggtttta ggaccaggat gaggcggggt gggggtgcct acctgacgac 840 cgaccccgac ccactggaca agcacccaac ccccattccc caaattgcgc atcccctatc 900 agagaggggg aggggaaaca ggatgcggcg aggcgcgtgc gcactgccag cttcagcacc 960 gcggacagtg ccttcgcccc cgcctggcgg cgcgcgccac cgccgcctca gcactgaagg 1020 cgcgctgacg tcactcgccg gtcccccgca aactcccctt cccggccacc ttggtcgcgt 1080 ccgcgccgcc gccggcccag ccggaccgca ccacgcgagg cgcgagatag gggggcacgg 1140 gcgcgaccat ctgcgctgcg gcgccggcga ctcagcgctg cctcagtctg cggtgggcag 1200 cggaggagtc gtgtcgtgcc tgagagcgca g 1231 <210> 8 <211> 23 <212> DNA <213> Artificial <220> <223> Primer <400> 8 tctagttgcc agccatctgt tgt 23 <210> 9 <211> 18 <212> DNA <213> Artificial <220> <223> Primers <400> 9 tgggagtggc accttcca 18 <210> 10 <211> twenty two <212> DNA <213> Artificial <220> <223> Primers <400> 10 agatacgccg gacattggac tg 22 <210> 11 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 11 gcacgcccag cagattgaac 20 <210> 12 <211> 19 <212> DNA <213> Artificial <220> <223> Probe <400> 12 gtgtggtcct cttgggagc 19 <210> 13 <211> 612 <212> DNA <213> Artificial <220> <223> E-Syn promoter <400> 13 cactacgggt ctaggctgcc catgtaagga ggcaaggcct ggggacaccc gagatgcctg 60 gttataatta acccccaacac ctgctgcccc ccccccccca acacctgctg cctgagcctg 120 agcggttacc ccaccccggt gcctgggtct taggctctgt acaccatgga ggagaagctc 180 gctctaaaaa taaccctgtc cctggtggcg cgccgagctc caccgcggtg gcggccgtcc 240 gccctcggca ccatcctcac gacacccaaa tatggcgacg ggtgaggaat ggtggggagt 300 tatttttaga gcggtgagga aggtgggcag gcagcaggtg ttggcgctct aaaaataact 360 cccgggagtt atttttagag cggaggaatg gtggacaccc aaatatggcc caaatatggc 420 gacggttcct cacccgtcgc catatttggg tgtccgccct cggccggggc cgcattcctg 480 ggggccgggc ggtgctcccg cccgcctcga taaaaggctc cggggccggc ggcggcccac 540 gagctacccg gaggagcggg aggcgccaag ctctagaact agtggatccc ccgggctgca 600 ggaattcgat at 612 <210> 14 <211> 925 <212> PRT <213> Artificial <220> <223> hGAA polypeptide (wt w / o sp) <400> 14 Gly His Ile Leu Leu His Asp Phe Leu Leu Val Pro Arg Glu Leu Ser 1 5 10 15 Gly Ser Ser Pro Val Leu Glu Glu Thr His Pro Ala His Gln Gln Gly 20 25 30 Ala Ser Arg Pro Gly Pro Arg Asp Ala Gln Ala His Pro Gly Arg Pro 35 40 45 Arg Ala Val Pro Thr Gln Cys Asp Val Pro Pro Asn Ser Arg Phe Asp 50 55 60 Cys Ala Pro Asp Lys Ala Ile Thr Gln Glu Gln Cys Glu Ala Arg Gly 65 70 75 80 Cys Cys Tyr Ile Pro Ala Lys Gln Gly Leu Gln Gly Ala Gln Met Gly 85 90 95 Gln Pro Trp Cys Phe Phe Pro Pro Ser Tyr Pro Ser Tyr Lys Leu Glu 100 105 110 Asn Leu Ser Ser Ser Glu Met Gly Tyr Thr Ala Thr Leu Thr Arg Thr 115 120 125 Thr Pro Thr Phe Phe Pro Lys Asp Ile Leu Thr Leu Arg Leu Asp Val 130 135 140 Met Met Glu Thr Glu Asn Arg Leu His Phe Thr Ile Lys Asp Pro Ala 145 150 155 160 Asn Arg Arg Tyr Glu Val Pro Leu Glu Thr Pro His Val His Ser Arg 165 170 175 Ala Pro Ser Pro Leu Tyr Ser Val Glu Phe Ser Glu Glu Pro Phe Gly 180 185 190 Val Ile Val Arg Arg Gln Leu Asp Gly Arg Val Leu Leu Asn Thr Thr 195 200 205 Val Ala Pro Leu Phe Phe Ala Asp Gln Phe Leu Gln Leu Ser Thr Ser 210 215 220 Leu Pro Ser Gln Tyr Ile Thr Gly Leu Ala Glu His Leu Ser Pro Leu 225 230 235 240 Met Leu Ser Thr Ser Trp Thr Arg Ile Thr Leu Trp Asn Arg Asp Leu 245 250 255 Ala Pro Thr Pro Gly Ala Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu 260 265 270 Ala Leu Glu Asp Gly Gly Ser Ala His Gly Val Phe Leu Leu Asn Ser 275 280 285 Asn Ala Met Asp Val Val Leu Gln Pro Ser Pro Ala Leu Ser Trp Arg 290 295 300 Ser Thr Gly Gly Ile Leu Asp Val Tyr Ile Phe Leu Gly Pro Glu Pro 305 310 315 320 Lys Ser Val Val Gln Gln Tyr Leu Asp Val Val Gly Tyr Pro Phe Met 325 330 335 Pro Pro Tyr Trp Gly Leu Gly Phe His Leu Cys Arg Trp Gly Tyr Ser 340 345 350 Ser Thr Ala Ile Thr Arg Gln Val Val Glu Asn Met Thr Arg Ala His 355 360 365 Phe Pro Leu Asp Val Gln Trp Asn Asp Leu Asp Tyr Met Asp Ser Arg 370 375 380 Arg Asp Phe Thr Phe Asn Lys Asp Gly Phe Arg Asp Phe Pro Ala Met 385 390 395 400 Val Gln Glu Leu His Gln Gly Gly Arg Arg Tyr Met Met Ile Val Asp 405 410 415 Pro Ala Ile Ser Ser Ser Gly Pro Ala Gly Ser Tyr Arg Pro Tyr Asp 420 425 430 Glu Gly Leu Arg Arg Gly Val Phe Ile Thr Asn Glu Thr Gly Gln Pro 435 440 445 Leu Ile Gly Lys Val Trp Pro Gly Ser Thr Ala Phe Pro Asp Phe Thr 450 455 460 Asn Pro Thr Ala Leu Ala Trp Trp Glu Asp Met Val Ala Glu Phe His 465 470 475 480 Asp Gln Val Pro Phe Asp Gly Met Trp Ile Asp Met Asn Glu Pro Ser 485 490 495 Asn Phe Ile Arg Gly Ser Glu Asp Gly Cys Pro Asn Asn Glu Leu Glu 500 505 510 Asn Pro Pro Tyr Val Pro Gly Val Val Gly Gly Thr Leu Gln Ala Ala 515 520 525 Thr Ile Cys Ala Ser Ser His Gln Phe Leu Ser Thr His Tyr Asn Leu 530 535 540 His Asn Leu Tyr Gly Leu Thr Glu Ala Ile Ala Ser His Arg Ala Leu 545 550 555 560 Val Lys Ala Arg Gly Thr Arg Pro Phe Val Ile Ser Arg Ser Thr Phe 565 570 575 Ala Gly His Gly Arg Tyr Ala Gly His Trp Thr Gly Asp Val Trp Ser 580 585 590 Ser Trp Glu Gln Leu Ala Ser Ser Val Pro Glu Ile Leu Gln Phe Asn 595 600 605 Leu Leu Gly Val Pro Leu Val Gly Ala Asp Val Cys Gly Phe Leu Gly 610 615 620 Asn Thr Ser Glu Glu Leu Cys Val Arg Trp Thr Gln Leu Gly Ala Phe 625 630 635 640 Tyr Pro Phe Met Arg Asn His Asn Ser Leu Leu Ser Leu Pro Gln Glu 645 650 655 Pro Tyr Ser Phe Ser Glu Pro Ala Gln Gln Ala Met Arg Lys Ala Leu 660 665 670 Thr Leu Arg Tyr Ala Leu Leu Pro His Leu Tyr Thr Leu Phe His Gln 675 680 685 Ala His Val Ala Gly Glu Thr Val Ala Arg Pro Leu Phe Leu Glu Phe 690 695 700 Pro Lys Asp Ser Ser Thr Trp Thr Val Asp His Gln Leu Leu Trp Gly 705 710 715 720 Glu Ala Leu Leu Ile Thr Pro Val Leu Gln Ala Gly Lys Ala Glu Val 725 730 735 Thr Gly Tyr Phe Pro Leu Gly Thr Trp Tyr Asp Leu Gln Thr Val Pro 740 745 750 Val Glu Ala Leu Gly Ser Leu Pro Pro Pro Pro Ala Ala Pro Arg Glu 755 760 765 Pro Ala Ile His Ser Glu Gly Gln Trp Val Thr Leu Pro Ala Pro Leu 770 775 780 Asp Thr Ile Asn Val His Leu Arg Ala Gly Tyr Ile Ile Pro Leu Gln 785 790 795 800 Gly Pro Gly Leu Thr Thr Thr Glu Ser Arg Gln Gln Pro Met Ala Leu 805 810 815 Ala Val Ala Leu Thr Lys Gly Gly Glu Ala Arg Gly Glu Leu Phe Trp 820 825 830 Asp Asp Gly Glu Ser Leu Glu Val Leu Glu Arg Gly Ala Tyr Thr Gln 835 840 845 Val Ile Phe Leu Ala Arg Asn Asn Thr Ile Val Asn Glu Leu Val Arg 850 855 860 Val Thr Ser Glu Gly Ala Gly Leu Gln Leu Gln Lys Val Thr Val Leu 865 870 875 880 Gly Val Ala Thr Ala Pro Gln Gln Val Leu Ser Asn Gly Val Pro Val 885 890 895 Ser Asn Phe Thr Tyr Ser Pro Asp Thr Lys Val Leu Asp Ile Cys Val 900 905 910 Ser Leu Leu Met Gly Glu Gln Phe Leu Val Ser Trp Cys 915 920 925 <210> 15 <211> 925 <212> PRT <213> Artificial <220> <223> Variant hGAAwt w / o sp <400> 15 Gly His Ile Leu Leu His Asp Phe Leu Leu Val Pro Arg Glu Leu Ser 1 5 10 15 Gly Ser Ser Pro Val Leu Glu Glu Thr His Pro Ala His Gln Gln Gly 20 25 30 Ala Ser Arg Pro Gly Pro Arg Asp Ala Gln Ala His Pro Gly Arg Pro 35 40 45 Arg Ala Val Pro Thr Gln Cys Asp Val Pro Pro Asn Ser Arg Phe Asp 50 55 60 Cys Ala Pro Asp Lys Ala Ile Thr Gln Glu Gln Cys Glu Ala Arg Gly 65 70 75 80 Cys Cys Tyr Ile Pro Ala Lys Gln Gly Leu Gln Gly Ala Gln Met Gly 85 90 95 Gln Pro Trp Cys Phe Phe Pro Pro Ser Tyr Pro Ser Tyr Lys Leu Glu 100 105 110 Asn Leu Ser Ser Ser Glu Met Gly Tyr Thr Ala Thr Leu Thr Arg Thr 115 120 125 Thr Pro Thr Phe Phe Pro Lys Asp Ile Leu Thr Leu Arg Leu Asp Val 130 135 140 Met Met Glu Thr Glu Asn Arg Leu His Phe Thr Ile Lys Asp Pro Ala 145 150 155 160 Asn Arg Arg Tyr Glu Val Pro Leu Glu Thr Pro Arg Val His Ser Arg 165 170 175 Ala Pro Ser Pro Leu Tyr Ser Val Glu Phe Ser Glu Glu Pro Phe Gly 180 185 190 Val Ile Val His Arg Gln Leu Asp Gly Arg Val Leu Leu Asn Thr Thr 195 200 205 Val Ala Pro Leu Phe Phe Ala Asp Gln Phe Leu Gln Leu Ser Thr Ser 210 215 220 Leu Pro Ser Gln Tyr Ile Thr Gly Leu Ala Glu His Leu Ser Pro Leu 225 230 235 240 Met Leu Ser Thr Ser Trp Thr Arg Ile Thr Leu Trp Asn Arg Asp Leu 245 250 255 Ala Pro Thr Pro Gly Ala Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu 260 265 270 Ala Leu Glu Asp Gly Gly Ser Ala His Gly Val Phe Leu Leu Asn Ser 275 280 285 Asn Ala Met Asp Val Val Leu Gln Pro Ser Pro Ala Leu Ser Trp Arg 290 295 300 Ser Thr Gly Gly Ile Leu Asp Val Tyr Ile Phe Leu Gly Pro Glu Pro 305 310 315 320 Lys Ser Val Val Gln Gln Tyr Leu Asp Val Val Gly Tyr Pro Phe Met 325 330 335 Pro Pro Tyr Trp Gly Leu Gly Phe His Leu Cys Arg Trp Gly Tyr Ser 340 345 350 Ser Thr Ala Ile Thr Arg Gln Val Val Glu Asn Met Thr Arg Ala His 355 360 365 Phe Pro Leu Asp Val Gln Trp Asn Asp Leu Asp Tyr Met Asp Ser Arg 370 375 380 Arg Asp Phe Thr Phe Asn Lys Asp Gly Phe Arg Asp Phe Pro Ala Met 385 390 395 400 Val Gln Glu Leu His Gln Gly Gly Arg Arg Tyr Met Met Ile Val Asp 405 410 415 Pro Ala Ile Ser Ser Ser Gly Pro Ala Gly Ser Tyr Arg Pro Tyr Asp 420 425 430 Glu Gly Leu Arg Arg Gly Val Phe Ile Thr Asn Glu Thr Gly Gln Pro 435 440 445 Leu Ile Gly Lys Val Trp Pro Gly Ser Thr Ala Phe Pro Asp Phe Thr 450 455 460 Asn Pro Thr Ala Leu Ala Trp Trp Glu Asp Met Val Ala Glu Phe His 465 470 475 480 Asp Gln Val Pro Phe Asp Gly Met Trp Ile Asp Met Asn Glu Pro Ser 485 490 495 Asn Phe Ile Arg Gly Ser Glu Asp Gly Cys Pro Asn Asn Glu Leu Glu 500 505 510 Asn Pro Pro Tyr Val Pro Gly Val Val Gly Gly Thr Leu Gln Ala Ala 515 520 525 Thr Ile Cys Ala Ser Ser His Gln Phe Leu Ser Thr His Tyr Asn Leu 530 535 540 His Asn Leu Tyr Gly Leu Thr Glu Ala Ile Ala Ser His Arg Ala Leu 545 550 555 560 Val Lys Ala Arg Gly Thr Arg Pro Phe Val Ile Ser Arg Ser Thr Phe 565 570 575 Ala Gly His Gly Arg Tyr Ala Gly His Trp Thr Gly Asp Val Trp Ser 580 585 590 Ser Trp Glu Gln Leu Ala Ser Ser Val Pro Glu Ile Leu Gln Phe Asn 595 600 605 Leu Leu Gly Val Pro Leu Val Gly Ala Asp Val Cys Gly Phe Leu Gly 610 615 620 Asn Thr Ser Glu Glu Leu Cys Val Arg Trp Thr Gln Leu Gly Ala Phe 625 630 635 640 Tyr Pro Phe Met Arg Asn His Asn Ser Leu Leu Ser Leu Pro Gln Glu 645 650 655 Pro Tyr Ser Phe Ser Glu Pro Ala Gln Gln Ala Met Arg Lys Ala Leu 660 665 670 Thr Leu Arg Tyr Ala Leu Leu Pro His Leu Tyr Thr Leu Phe His Gln 675 680 685 Ala His Val Ala Gly Glu Thr Val Ala Arg Pro Leu Phe Leu Glu Phe 690 695 700 Pro Lys Asp Ser Ser Thr Trp Thr Val Asp His Gln Leu Leu Trp Gly 705 710 715 720 Glu Ala Leu Leu Ile Thr Pro Val Leu Gln Ala Gly Lys Ala Glu Val 725 730 735 Thr Gly Tyr Phe Pro Leu Gly Thr Trp Tyr Asp Leu Gln Thr Val Pro 740 745 750 Ile Glu Ala Leu Gly Ser Leu Pro Pro Pro Pro Ala Ala Pro Arg Glu 755 760 765 Pro Ala Ile His Ser Glu Gly Gln Trp Val Thr Leu Pro Ala Pro Leu 770 775 780 Asp Thr Ile Asn Val His Leu Arg Ala Gly Tyr Ile Ile Pro Leu Gln 785 790 795 800 Gly Pro Gly Leu Thr Thr Thr Glu Ser Arg Gln Gln Pro Met Ala Leu 805 810 815 Ala Val Ala Leu Thr Lys Gly Gly Glu Ala Arg Gly Glu Leu Phe Trp 820 825 830 Asp Asp Gly Glu Ser Leu Glu Val Leu Glu Arg Gly Ala Tyr Thr Gln 835 840 845 Val Ile Phe Leu Ala Arg Asn Asn Thr Ile Val Asn Glu Leu Val Arg 850 855 860 Val Thr Ser Glu Gly Ala Gly Leu Gln Leu Gln Lys Val Thr Val Leu 865 870 875 880 Gly Val Ala Thr Ala Pro Gln Gln Val Leu Ser Asn Gly Val Pro Val 885 890 895 Ser Asn Phe Thr Tyr Ser Pro Asp Thr Lys Val Leu Asp Ile Cys Val 900 905 910 Ser Leu Leu Met Gly Glu Gln Phe Leu Val Ser Trp Cys 915 920 925 <210> 16 <211> 917 <212> PRT <213> Artificial <220> <223> hGAA-Δ-8 <400> 16 Leu Leu Val Pro Arg Glu Leu Ser Gly Ser Ser Pro Val Leu Glu Glu 1 5 10 15 Thr His Pro Ala His Gln Gln Gly Ala Ser Arg Pro Gly Pro Arg Asp 20 25 30 Ala Gln Ala His Pro Gly Arg Pro Arg Ala Val Pro Thr Gln Cys Asp 35 40 45 Val Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys Ala Ile Thr 50 55 60 Gln Glu Gln Cys Glu Ala Arg Gly Cys Cys Tyr Ile Pro Ala Lys Gln 65 70 75 80 Gly Leu Gln Gly Ala Gln Met Gly Gln Pro Trp Cys Phe Phe Pro Pro 85 90 95 Ser Tyr Pro Ser Tyr Lys Leu Glu Asn Leu Ser Ser Ser Glu Met Gly 100 105 110 Tyr Thr Ala Thr Leu Thr Arg Thr Thr Pro Thr Phe Phe Pro Lys Asp 115 120 125 Ile Leu Thr Leu Arg Leu Asp Val Met Met Glu Thr Glu Asn Arg Leu 130 135 140 His Phe Thr Ile Lys Asp Pro Ala Asn Arg Arg Tyr Glu Val Pro Leu 145 150 155 160 Glu Thr Pro His Val His Ser Arg Ala Pro Ser Pro Leu Tyr Ser Val 165 170 175 Glu Phe Ser Glu Glu Pro Phe Gly Val Ile Val Arg Arg Gln Leu Asp 180 185 190 Gly Arg Val Leu Leu Asn Thr Thr Val Ala Pro Leu Phe Phe Ala Asp 195 200 205 Gln Phe Leu Gln Leu Ser Thr Ser Leu Pro Ser Gln Tyr Ile Thr Gly 210 215 220 Leu Ala Glu His Leu Ser Pro Leu Met Leu Ser Thr Ser Trp Thr Arg 225 230 235 240 Ile Thr Leu Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly Ala Asn Leu 245 250 255 Tyr Gly Ser His Pro Phe Tyr Leu Ala Leu Glu Asp Gly Gly Ser Ala 260 265 270 His Gly Val Phe Leu Leu Asn Ser Asn Ala Met Asp Val Val Leu Gln 275 280 285 Pro Ser Pro Ala Leu Ser Trp Arg Ser Thr Gly Gly Ile Leu Asp Val 290 295 300 Tyr Ile Phe Leu Gly Pro Glu Pro Lys Ser Val Val Gln Gln Tyr Leu 305 310 315 320 Asp Val Val Gly Tyr Pro Phe Met Pro Pro Tyr Trp Gly Leu Gly Phe 325 330 335 His Leu Cys Arg Trp Gly Tyr Ser Ser Thr Ala Ile Thr Arg Gln Val 340 345 350 Val Glu Asn Met Thr Arg Ala His Phe Pro Leu Asp Val Gln Trp Asn 355 360 365 Asp Leu Asp Tyr Met Asp Ser Arg Arg Asp Phe Thr Phe Asn Lys Asp 370 375 380 Gly Phe Arg Asp Phe Pro Ala Met Val Gln Glu Leu His Gln Gly Gly 385 390 395 400 Arg Arg Tyr Met Met Ile Val Asp Pro Ala Ile Ser Ser Ser Gly Pro 405 410 415 Ala Gly Ser Tyr Arg Pro Tyr Asp Glu Gly Leu Arg Arg Gly Val Phe 420 425 430 Ile Thr Asn Glu Thr Gly Gln Pro Leu Ile Gly Lys Val Trp Pro Gly 435 440 445 Ser Thr Ala Phe Pro Asp Phe Thr Asn Pro Thr Ala Leu Ala Trp Trp 450 455 460 Glu Asp Met Val Ala Glu Phe His Asp Gln Val Pro Phe Asp Gly Met 465 470 475 480 Trp Ile Asp Met Asn Glu Pro Ser Asn Phe Ile Arg Gly Ser Glu Asp 485 490 495 Gly Cys Pro Asn Asn Glu Leu Glu Asn Pro Pro Tyr Val Pro Gly Val 500 505 510 Val Gly Gly Thr Leu Gln Ala Ala Thr Ile Cys Ala Ser Ser His Gln 515 520 525 Phe Leu Ser Thr His Tyr Asn Leu His Asn Leu Tyr Gly Leu Thr Glu 530 535 540 Ala Ile Ala Ser His Arg Ala Leu Val Lys Ala Arg Gly Thr Arg Pro 545 550 555 560 Phe Val Ile Ser Arg Ser Thr Phe Ala Gly His Gly Arg Tyr Ala Gly 565 570 575 His Trp Thr Gly Asp Val Trp Ser Ser Trp Glu Gln Leu Ala Ser Ser 580 585 590 Val Pro Glu Ile Leu Gln Phe Asn Leu Leu Gly Val Pro Leu Val Gly 595 600 605 Ala Asp Val Cys Gly Phe Leu Gly Asn Thr Ser Glu Glu Leu Cys Val 610 615 620 Arg Trp Thr Gln Leu Gly Ala Phe Tyr Pro Phe Met Arg Asn His Asn 625 630 635 640 Ser Leu Leu Ser Leu Pro Gln Glu Pro Tyr Ser Phe Ser Glu Pro Ala 645 650 655 Gln Gln Ala Met Arg Lys Ala Leu Thr Leu Arg Tyr Ala Leu Leu Pro 660 665 670 His Leu Tyr Thr Leu Phe His Gln Ala His Val Ala Gly Glu Thr Val 675 680 685 Ala Arg Pro Leu Phe Leu Glu Phe Pro Lys Asp Ser Ser Thr Trp Thr 690 695 700 Val Asp His Gln Leu Leu Trp Gly Glu Ala Leu Leu Ile Thr Pro Val 705 710 715 720 Leu Gln Ala Gly Lys Ala Glu Val Thr Gly Tyr Phe Pro Leu Gly Thr 725 730 735 Trp Tyr Asp Leu Gln Thr Val Pro Val Glu Ala Leu Gly Ser Leu Pro 740 745 750 Pro Pro Pro Ala Ala Pro Arg Glu Pro Ala Ile His Ser Glu Gly Gln 755 760 765 Trp Val Thr Leu Pro Ala Pro Leu Asp Thr Ile Asn Val His Leu Arg 770 775 780 Ala Gly Tyr Ile Ile Pro Leu Gln Gly Pro Gly Leu Thr Thr Thr Glu 785 790 795 800 Ser Arg Gln Gln Pro Met Ala Leu Ala Val Ala Leu Thr Lys Gly Gly 805 810 815 Glu Ala Arg Gly Glu Leu Phe Trp Asp Asp Gly Glu Ser Leu Glu Val 820 825 830 Leu Glu Arg Gly Ala Tyr Thr Gln Val Ile Phe Leu Ala Arg Asn Asn 835 840 845 Thr Ile Val Asn Glu Leu Val Arg Val Thr Ser Glu Gly Ala Gly Leu 850 855 860 Gln Leu Gln Lys Val Thr Val Leu Gly Val Ala Thr Ala Pro Gln Gln 865 870 875 880 Val Leu Ser Asn Gly Val Pro Val Ser Asn Phe Thr Tyr Ser Pro Asp 885 890 895 Thr Lys Val Leu Asp Ile Cys Val Ser Leu Leu Met Gly Glu Gln Phe 900 905 910 Leu Val Ser Trp Cys 915 <210> 17 <211> 27 <212> PRT <213> Artificial <220> <223> sp1 <400> 17 Met Gly Val Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Val Cys 1 5 10 15 Ala Leu Val Ser Leu Ala Thr Ala Ala Leu Leu 20 25 <210> 18 <211> 18 <212> PRT <213> artificial <220> <223> sp7 <400> 18 Met Ala Phe Leu Trp Leu Leu Ser Cys Trp Ala Leu Leu Gly Thr Thr 1 5 10 15 Phe Gly <210> 19 <211> 24 <212> PRT <213> artificial <220> <223> sp2 <400> 19 Met Pro Ser Ser Val Ser Trp Gly Ile Leu Leu Leu Ala Gly Leu Cys 1 5 10 15 Cys Leu Val Pro Val Ser Leu Ala 20 <210> 20 <211> 25 <212> PRT <213> artificial <220> <223> sp6 <400> 20 Met Pro Pro Pro Arg Thr Gly Arg Gly Leu Leu Trp Leu Gly Leu Val 1 5 10 15 Leu Ser Ser Val Cys Val Ala Leu Gly 20 25 <210> twenty one <211> twenty two <212> PRT <213> Artificial <220> <223> sp8 <400> twenty one Met Ala Ser Arg Leu Thr Leu Leu Thr Leu Leu Leu Leu Leu Leu Ala 1 5 10 15 Gly Asp Arg Ala Ser Ser 20 <210> twenty two <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> twenty two ggctgtattc ccctccatcg 20 <210> twenty three <211> twenty two <212> DNA <213> Artificial <220> <223> Primers <400> twenty three ccagttggta acaatgccat gt 22 <210> twenty four <211> twenty two <212> DNA <213> Artificial <220> <223> Primers <400> twenty four ggtctttctg gtgcttgtct ca 22 <210> 25 <211> 19 <212> DNA <213> Artificial <220> <223> Primers <400> 25 gttcggcttc ccattctcc 19 BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the expression cassette used

[0037] A: ubiquitous promoter (CAG) and basic single tissue promoter composed of cytomegalovirus (CMV) enhancer and chicken β-actin promoter (CBA) promoter. B (present invention): hybrid multi-tissue selective promoter. ITR: inverted terminal repeats for AAV packaging; ApoE: apolipoprotein enhancer; hAAT: human α-1 antitrypsin promoter; spC5.12: synthetic promoter C5.12; hSYN: human synapsin promoter; intron: HBB2 2.1 (modified synthetic human β-globin source (HBB22.1) or SV40 intron; hGAA: human acid α-glucosidase coding sequence followed by bovine growth hormone polyadenylation signal.

[0038] Figure 2. Activity of the hybrid liver-muscle promoter Enh.C5.12 and LiMP in cell lines

[0039] In the human hepatocyte cell line HuH7 ( Figure 2A ) and myoblast cell line C2 ( Figure 2B) were analyzed for GAA expression 72 hours after transfection with plasmids encoding a highly secretable hGAA transgene (sp7-Δ8-co, abbreviated as sec-hGAA, Table 1) under the control of a muscle-selective (C5.12), a hepatocyte-selective (hAAT) or our newly generated hybrid liver-muscle promoter (Enh.C5.12 and LiMP). A plasmid encoding enhanced green fluorescent protein (Ctrl) was used as a negative control and co-transfected with a plasmid expressing GAA as a positive control for transfection. Panels AB. Left: GAA activity in cell culture medium at 72H (n=4 independent experiments); Right: GAA protein expression in cell lysates assessed by Western blot analysis using an anti-GAA antibody (n=2 independent experiments). Anti-eGFP and anti-tubulin antibodies were used as transfection controls and loading controls, respectively. GAA band quantification is depicted. Statistical analysis was performed by one-way ANOVA and Tukey post hoc test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, #p<0.05, ##p<0.01.

[0040] Figure 3. Activity of the hybrid hepatic-neuronal promoter LiNeuP in cell lines.

[0041] In the human hepatocyte cell line HuH7 ( Figure 3A ) or the neuronal cell line NSC34 ( Figure 3B ) were analyzed for GAA expression 72 hours after transfection with plasmids encoding a highly secretable hGAA transgene (sp7-Δ8-co, abbreviated as sec-hGAA, Table 1) under the control of the neuron-selective human synapsin promoter (hSYN), hepatocyte-selective (hAAT) or our newly generated hybrid liver-neuronal promoter (LiNeuP). A plasmid encoding enhanced green fluorescent protein (Ctrl) was used as a negative control and co-transfected with a plasmid expressing GAA as a positive control for transfection. Panels AB. Left: GAA activity in cell culture medium at 72H (n=2 independent experiments); Right: GAA protein expression in cell lysates assessed by Western blot analysis using an anti-GAA antibody (n=2 independent experiments). Anti-eGFP and anti-tubulin antibodies were used as transfection controls and loading controls, respectively. GAA band quantification is depicted. Statistical analysis was performed by one-way ANOVA and Tukey post hoc test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0042] Figure 4A . Circulating GAA protein in wild-type C57BL / 6 mice.

[0043] Analysis of GAA expression 4 weeks after intravenous injection of AAV9 vectors carrying the full-length, codon-optimized GAA transgene (abbreviated as hGAA) under the control of the ubiquitous (CAG), liver-selective (hAAT), and muscle-selective (C5.12) promoters or our newly generated liver-muscle (Enh.C5.12, LiMP) and liver-neuronal (LiNeuP) promoters (AAV dose: 2×10 12 vg / kg; mice n=4 / group). Upper panel: representative Western blot of mouse plasma using anti-GAA antibody; Lower panel: quantification of GAA bands. The GAA band intensity was normalized to the intensity of the nonspecific band detected in plasma and used as a loading control. rhGAA (trade name Myozyme), a recombinant human GAA protein, was used as a positive control; molecular weight markers (kDa on the left); untreated: plasma from uninjected C57BL / 6 mice used as a negative control. Statistical analysis was performed by one-way ANOVA and Tukey post hoc test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0044] Figure 4B . RNA expression of human GAA in wild-type C57BL / 6 mice.

[0045] Analysis of GAA expression 5 weeks after intravenous injection of AAV9 vectors carrying the full-length, codon-optimized GAA transgene (abbreviated as hGAA) under the control of the ubiquitous (CAG), liver-selective (hAAT), and muscle-selective (C5.12) promoters or our newly generated liver-muscle (Enh.C5.12, LiMP) and liver-neuronal (LiNeuP) promoters (AAV dose: 2×10 12 vg / kg). Human GAA RNA expression in liver, heart, quadriceps, spinal cord and brain was assessed and normalized to the expression of the endogenous mouse actin gene. The relative fold change in expression is depicted. Untreated: non-injected C57BL / 6 mice used as negative control. Vector genome copy number (VGCN) normalized to each μg DNA is depicted for tissues where RNA and DNA extraction can be performed. Statistical analysis: One-way ANOVA and Tukey post-test for RNA expression, or two-way ANOVA (promoter and tissue) and Tukey post-test for VGCN. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0046] Figure 5. Humoral immune response against GAA in adult Gaa- / - mice when using a promoter active in muscle or liver-muscle.

[0047] Analysis of anti-GAA antibodies (immunoglobulin G: IgG; Figure 5A ), and analysis of circulating GAA enzyme activity after intravenous injection of AAV8 vectors encoding native (hGAA) or highly secretable GAA (sec-hGAA) under the control of the muscle-selective (C5.12) or our newly generated liver-muscle promoter Enh.C5.12 and LiMP ( Figure 5B )(AAV8 dose: 2x10 12 vg / kg). A. Anti-GAA IgG was measured 1 to 3 months after intravenous injection of AAV8 vectors. 5 mice / group were treated, the numbers above the bars indicate the number of live mice at each time point, and the numbers below the bars indicate the number of months after injection. Statistical analysis: two-way ANOVA and Tukey post hoc test. B. Analysis of circulating GAA enzyme activity three months after intravenous injection of AAV8 vectors encoding native GAA (hGAA) or highly secretable GAA (sec-hGAA). Statistical analysis: one-way ANOVA and Tukey post hoc test. Control: plasma from untreated Gaa- / - littermate mice. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0048] Figure 6 : Anti-hGAA humoral immune responses in Gaa- / - mice after AAV gene transfer of hGAA using dual promoters following recombinant hGAA injection.

[0049] (A) Experimental design: Two-month-old Gaa- / - mice were immunized by intravenous injection of recombinant human GAA protein (rhGAA). Six weeks later, the immunized Gaa- / - mice were intravenously injected with AAV9-hGAA vectors carrying dual liver-muscle LiMP promoters or hepatocyte-specific hAAT promoters (dose: 2×10 12vg / kg); an AAV9 vector encoding luciferase was used as a control (AAV-Ctrl, dose: 2x1012 vg / kg). Anti-hGAA IgG was measured as indicated (W: week). (B) Analysis of anti-hGAA IgG in Gaa- / - mice at 5.5 and 12 weeks (see Figure C). Data are described as mean ± SD; AAV-hGAA n = 3 mice / group; AAV-Ctrl n = 2 mice / group. Statistical analysis: two-way ANOVA (AAV, week) and Sidak post hoc test. *p<0.05, **p<0.01, ##p<0.01.

[0050] Figure 7 Circulating GAA protein and anti-GAA IgG in adult Gaa- / - mice when a hybrid promoter (LIMP and LiNeuP) that is very active in the liver is used.

[0051] AAV9 vectors encoding the highly secretable GAA protein (sec-hGAA) under the control of the ubiquitous (CAG) promoter, the liver-selective (hAAT) promoter, and our newly generated liver-muscle (LiMP) and liver-neuronal (LiNeuP) promoters were injected intravenously (AAV dose: 5x10 11 vg / kg). Analysis of circulating GAA protein 4 weeks after administration of 100 mg / kg (vg / kg). Upper panel: Western blot of mouse plasma using anti-GAA antibody; humoral responses (IgG) against GAA measured in mouse plasma at the same time points are depicted below each corresponding lane. rhGAA: recombinant human GAA used as a positive control; molecular weight markers (kDa on the left); neg: mouse plasma from uninjected Gaa- / - mice used as a negative control. The number of mice in each group is depicted in the bars. Lower panel: quantification of GAA protein bands. GAA band intensities were normalized to the intensities of nonspecific bands detected in plasma and used as loading controls. Statistical analysis: One-way ANOVA and Tukey post hoc test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0052] Figure 8 . Rescue of muscle strength and respiratory function in adult Gaa- / - mice when using a hybrid promoter active in the liver (LIMP and LiNeuP).

[0053] In Gaa- / - mice, AAV9 vectors encoding highly secretable GAA (sec-hGAA) under the control of our newly generated liver-muscle (LiMP) and liver-neuron (LiNeuP) promoters were injected intravenously (AAV9 dose: 2x10 12vg / kg). (A) Analysis of circulating GAA enzyme activity 2 months after intravenous injection of AAV9 vectors. Analysis of muscle strength by 4-stage grip strength test (B) and analysis of respiratory function by whole body plethysmography (C, D) 3 months after intravenous injection of AAV9 vectors. Te: expiratory time; EF50: (mid-expiratory flow); Ctrl: untreated Gaa- / - mice used as control treatment group. Gaa+ / +: wild-type unaffected littermate mice. Statistical analysis: A. One-way ANOVA and Tukey post hoc test; One-way ANOVA and Dunnet's post hoc test for Ctrl. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0054] Fig. 9 .Activity of the heterozygous liver-muscle promoter LiMP in newborn Gaa- / - mice.

[0055] The cells were injected intravenously with AAV8 vectors encoding the highly secretable GAA protein under the control of muscle-selective (C5.12), liver-selective (hAAT), or our newly generated hybrid liver-muscle promoter LiMP with enhanced activity in both muscle and liver (sec-hGAA) (see Figures 2 and 4B, AAV dose: 3×10 13 vg / kg). AB: Representative Western blot analysis of mouse plasma performed with anti-GAA antibody 3 months after treatment; rhGAA: recombinant human GAA used as negative control; Untr: plasma from untreated Gaa- / - mice used as negative control; molecular weight markers (kDa) are depicted on the left. Quantification of GAA bands is shown in Figure B. Statistical analysis: One-way ANOVA and Tukey post hoc test. CF: Analysis of GAA activity in myocardium, diaphragm, triceps and quadriceps 3 months after intravenous injection of AAV8 vectors. Ctrl: untreated Gaa- / - mice. Statistical analysis: One-way ANOVA and Tukey post hoc test. Gaa+ / +: wild-type unaffected littermate mice; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0056] Fig.10 Analysis of GAA protein amounts in muscle and CNS after AAV gene therapy using the hybrid liver-muscle promoter LiMP in Gaa- / - mice treated as neonates.

[0057] Neonatal Gaa- / - mice were injected intravenously with AAV8 vectors encoding highly secretable GAA protein (sec-hGAA) under the control of muscle-selective (C5.12), liver-selective (hAAT), or our newly generated hybrid liver-muscle promoter LiMP (AAV dose: 3x10 13 vg / kg). AC: Western blot analysis of mouse tissues performed with anti-GAA antibodies 3 months after treatment. Anti-tubulin antibody was used as a loading control; rhGAA: recombinant human GAA used as a positive control; Untr: tissue from untreated Gaa- / - mice used as a negative control; molecular weight markers (kDa) are depicted on the left. Quantification of GAA bands is shown. The intensity of the GAA band was normalized to the intensity of the tubulin band used as a loading control. D. Relative expression (fold change) of sec-hGAA transgenic RNA by RT-qPCR in the liver of Gaa- / - mice. The fold change of transgenic expression compared with hAAT is depicted. E. Relative expression (-ΔΔCt) of sec-hGAA transgenic RNA by RT-qPCR in the gastrocnemius of AAV-treated Gaa- / - mice. Relative transgene expression (-ΔΔCt) compared to C5.12 is depicted. AE. Statistical analysis: One-way ANOVA and Tukey post hoc test. Gaa+ / +: wild-type unaffected littermate mice; Untr: untreated Gaa- / - mice. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0058] Fig.11 .Preservation of muscle strength using AAV-LiMP-sec-hGAA in Gaa- / - mice treated as neonates.

[0059] In Gaa+ / + wild-type unaffected littermates and Gaa- / - mice, AAV8 vectors encoding highly secretable GAA proteins under the control of muscle-selective (C5.12), liver-selective (hAAT), or our newly generated liver-muscle promoter LiMP with enhanced activity in both muscle and liver (sec-hGAA) were injected intravenously (see Figures 2 and 4B, AAV dose: 3x10 13 vg / kg), analysis of muscle strength by grip strength test 3 months after treatment. Gaa+ / +: wild-type unaffected littermate mice; Ctrl: untreated Gaa- / - mice. Statistical analysis: One-way ANOVA and Tukey post hoc test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0060] Fig.12 . Lack of upregulation of Rtl1 RNA after delivery of AAV-LiMP-sec-hGAA to newborn Gaa- / - mice.

[0061] Analysis of Rtl1 RNA expression in Gaa- / - mice 3 months after intravenous injection of AAV8 vectors encoding highly secretable GAA protein (sec-hGAA) under the control of muscle-selective (C5.12, n=3 mice), liver-selective (hAAT, n=4 mice), or our newly generated liver-muscle promoter LiMP (n=3 mice). AAV dose: 3x10 13 vg / kg. Ctrl: untreated Gaa- / - mice (n=4). Statistical analysis: One-way ANOVA and Tukey post hoc test, no significant differences were observed.

[0062] Fig.13 .Rescue of disease phenotype in Gaa- / - mice as neonatal treatment using low-dose AAV gene therapy using the LiMP promoter.

[0063] The cells were injected intravenously with AAV9 vectors encoding codon-optimized highly secretable human GAA (sec-hGAA) under the control of the dual liver-muscle LiMP promoter (n=5) or, as a comparison, a hepatocyte-specific promoter (hAAT, n=5). 12vg / kg), analysis of hGAA transgene expression in 4-month-old Gaa- / - mice treated as neonates (AG) and rescue of disease phenotype (HM). Untreated Gaa- / - mice were used as affected controls (Ctrl, n=5); littermate Gaa+ / + mice were used as unaffected controls (Gaa+ / +, n=6). (A) Representative Western blot of Gaa- / - plasma using anti-human GAA antibody. Molecular weight markers (kDa) are depicted; rhGAA: recombinant human GAA loaded as a positive control. (B) Quantification of hGAA protein bands in Gaa- / - plasma. (CE) Analysis of GAA enzyme activity in muscle. (FG) Western blot analysis of Gaa- / - spinal cord (F) and brain (G) using anti-human GAA antibody; anti-tubulin antibody was used as a loading control. Molecular weight markers (kDa) are depicted. (HK) Glycogen accumulation measured in muscle (HJ) and central nervous system (K). (L) Heart weight normalized for body weight. (M) Muscle strength measured by 4-limb grip test. (BE, HM) Data are depicted as mean ± SD; n = 6-5 mice per group as described above. Statistical analysis: t-test (B), one-way ANOVA and Tukey post hoc test (CE, HM). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, #p<0.05, ###p<0.001. Asterisks and hash marks on the bars show significant differences compared to the mouse groups specified in the legend.

[0064] Fig.14 Analysis of GAA protein amounts in muscle after AAV gene therapy using the hybrid liver promoters LiMP and LiNeuP in Gaa- / - mice treated as neonates.

[0065] Neonatal Gaa- / - mice were injected intravenously with AAV9 vectors encoding the highly secretable GAA protein (sec-hGAA) under the control of the ubiquitous (CAG) promoter, the liver-specific (hAAT) promoter, or our newly generated hybrid liver-muscle LiMP or liver-neuron LiNeuP promoters (AAV dose: 2x10 13vg / kg). Analysis of GAA protein in triceps muscle 4 months after treatment with 1% leukemia / lysine triglyceride (vg / kg). Upper panel: Western blot analysis of triceps muscle using anti-GAA antibody 4 months after treatment. Anti-GAPDH antibody was used as loading control; rhGAA: recombinant human GAA used as positive control; Ctrl: tissue from untreated Gaa- / - mice used as negative control; molecular weight markers (kDa) are depicted on the left. Lower panel: Quantification of lysosomal GAA bands is shown. The number of mice in each group is depicted. The intensity of the GAA bands was normalized to the intensity of the GAPDH band used as loading control. Statistical analysis: One-way ANOVA and Tukey post hoc test. Gaa+ / +: wild-type unaffected littermate mice; Ctrl: untreated Gaa- / - mice. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0066] Fig.15 Analysis of GAA, p62, and Parkin protein amounts in muscle after AAV gene therapy using the hybrid liver promoter LiMP in Gaa- / - mice treated as neonates.

[0067] Neonatal Gaa- / - mice were injected intravenously with AAV9 vectors encoding the highly secretable GAA protein (sec-hGAA) under the control of either the liver-specific (hAAT) or our newly generated hybrid liver-muscle LiMP promoter (AAV dose: 2x10 13 vg / kg), analysis of GAA, p62 and Parkin in triceps muscle 4 months after treatment. Upper panel: Western blot analysis of triceps muscle using anti-GAA, anti-p62, anti-Parkin antibodies 4 months after treatment. Anti-GAPDH antibody was used as a loading control; Ctrl: tissue from untreated Gaa- / - mice used as negative control; molecular weight markers (kDa) are depicted on the left. Lower panel: Quantification of lysosomal GAA bands, p62 and Parkin bands are shown. The number of mice in each group is depicted. The band intensity is normalized to the intensity of the GAPDH band used as a loading control. Statistical analysis: One-way ANOVA and Tukey post hoc test. Gaa+ / +: wild-type unaffected littermate mice; Ctrl: untreated Gaa- / - mice. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ##p<0.01, ###p<0.001.

[0068] Fig.16 . Analysis of vector genome copy number (VGCN) in liver and triceps muscle of Gaa- / - mice treated as neonates.

[0069] Neonatal Gaa- / - mice were injected intravenously with AAV9 vectors encoding highly secretable GAA protein (sec-hGAA) under the control of ubiquitous (CAG), liver-specific (hAAT), or our newly generated hybrid liver-muscle LiMP or liver-neuron LiNeuP promoters (AAV dose: 2x10 13 vg / kg) 4 months later, Fig.14 and 15 Analysis of vector genome copy number (VGCN) in the liver (A) and triceps (B) of the mice depicted in Figure 2. The number of mice in each group is depicted. Statistical analysis: One-way ANOVA and Tukey post hoc test. Gaa+ / +: wild-type unaffected littermate mice; Ctrl: untreated Gaa- / - mice. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0070] Fig.17 .Analysis of GAA transgene mRNA expression in Gaa- / - mice treated systemically with AAV9 vector.

[0071] (AB) AAV9-hGAA vectors carrying the indicated promoters (native hGAA, dose: 2×10 12 vg / kg) in tissues from Gaa- / - mice; n=3 mice / group. AAV9 vector encoding luciferase was used as a negative control (Ctrl). The fold change of transgene mRNA expression compared to the liver as a control target tissue is depicted. (CD) VGCN in the tissues depicted in Figure AB. Data are depicted as mean ± SD. Statistical analysis: (AD) Two-way ANOVA (tissue, vector) and Tukey post hoc test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0072] Fig.18 . Anti-hGAA humoral immune responses in adult Gaa- / - mice after AAV gene transfer of hGAA using a hybrid promoter.

[0073] The AAV9 vectors (dose: 2×10 12vg / kg), analysis of anti-hGAA antibodies (immunoglobulin G: IgG) and liver vector genome copy number (C) in Gaa- / - mice at 1.5 (A), 3 and 5 (B) months. Gaa- / - mice were treated at 3 months of age. Data are depicted as mean ± SD; n = 3-5 mice / group. Untreated Gaa- / - mice were used as affected controls. Statistical analysis: (A) One-way ANOVA and Tukey post hoc test. (B) Two-way ANOVA and Tukey post hoc test (**p<0.01C5.12 compared to CAG, ***p<0.001C5.12 compared to hAAT, Enh.C5.12, LiMP and LiNeuP); (C) One-way ANOVA and Tukey post hoc test *p<0.05, **p<0.01, ***p<0.001.

[0074] Fig.19 . Activity of the hybrid LiMP promoter in human myoblasts.

[0075] (AB) In the presence of liver-muscle (Enh.C5.12 and LiMP, Figure 1 A) Analysis of hGAA protein expression after infection (MOI: 2x105 vg / cell) of human myoblasts with AAV9-hGAA vectors expressing either the promoter or control muscle-specific (C5.12) and hepatocyte-specific (hAAT) promoters. AAV9 vector encoding enhanced green fluorescent protein was used as a negative control (Ctrl). (A) Representative Western blot analysis of cell lysates using anti-human GAA antibodies. Molecular weight markers (kDa) are depicted. Images are representative of n=2 independent experiments. (B) Western blot quantification. GAA band intensity was normalized to the amount of protein lysate loaded. Data are shown as mean ± SD of n=2 independent experiments. Statistical analysis was performed by one-way ANOVA (vs. Ctrl) and Dunnet's post hoc test. *p<0.05.

[0076] Detailed Description

[0077] definition

[0078] In the context of the present invention, a "transcriptional regulatory element" is a DNA sequence that is capable of driving or enhancing the expression of a transgenic gene in a tissue or cell. In the context of the present invention, the transcriptional regulatory element is selected from a tissue-selective promoter and a tissue-selective enhancer. In a specific embodiment, the transcriptional regulatory element is selected from a tissue-selective promoter and a tissue-selective enhancer of a tissue-selective or tissue-specific gene.

[0079] In the context of the present invention, the expression "tissue selective promoter" includes natural or synthetic promoters. In particular, the expression "tissue selective promoter" also refers to a synthetic promoter comprising a tissue selective promoter and an enhancer having the same tissue selectivity as said promoter. An illustrative promoter encompassed by this expression is, for example, a fusion of the ApoE enhancer with the hAAT promoter, which corresponds to a liver selective promoter that complies with the definition provided in this paragraph.

[0080] According to the present invention, "tissue selectivity" means that a transcriptional regulatory element preferentially drives (in the case of a promoter) or enhances (in the case of an enhancer) the expression of a gene operably connected to the transcriptional regulatory element in a given tissue or a group of tissues compared to expression in another tissue. This definition of "tissue selectivity" does not exclude the possibility that a tissue-selective transcriptional regulatory element (e.g., a tissue-selective promoter) leaks to a certain extent. "Leakage" or its variations means that a tissue-selective transcriptional regulatory element drives or enhances the possibility of expression of a transgenic gene operably connected to the transcriptional regulatory element in another tissue, although the expression level is low. For example, a muscle-selective promoter may leak in liver tissue, meaning that the expression driven from the promoter is higher in muscle tissue than in liver tissue. Alternatively, the tissue-selective transcriptional regulatory element may be a "tissue-specific" transcriptional regulatory element, meaning that this transcriptional regulatory element not only drives or enhances expression in a given tissue or a group of tissues in a preferential manner, but also that the regulatory element does not or only minimally drives or enhances expression in other tissues.

[0081] In the context of the present invention, a "hybrid transcriptional regulatory element" refers to a DNA sequence that is capable of driving the expression of a transgene in two or more tissues or a group of tissues in a tissue-dependent manner. According to the present invention, and as explained in more detail below, each transcriptional regulatory element is tissue- or cell-selective, i.e., it can drive the expression of a transgene of interest in a tissue-selective manner, thereby preferentially limiting the expression of the transgene to tissues that require the transgene product.

[0082] In the context of the present invention, a "tolerogenic tissue" is a tissue, such as the liver, that can achieve immune tolerance against a transferred gene when the transferred gene is expressed from the tissue.

[0083] The term "immune tolerance" refers to a state of non-response to a specific antigen or a group of antigens to which a subject normally responds. Alternatively, immune tolerance can be defined as a state in which the immune system actively mediates the suppression of an immune response to an antigen, for example, through regulatory T cells. In the context of the present invention, the "antigen" or "group of antigens" to which immune tolerance is sought is the transgene of interest.

[0084] According to the present invention, "transposon of interest" refers to a polynucleotide sequence that encodes an RNA or protein product, can be introduced into a cell for the purpose sought, and can be expressed under appropriate conditions. The transposon of interest can encode a product of interest, such as a therapeutic or diagnostic product of interest. "Therapeutic transposon" is selected and used to cause the desired therapeutic result, particularly for achieving expression of the therapeutic transposon in cells, tissues or organs that require expression of the therapeutic transposon. Therapy can be achieved in a variety of ways, including by expressing a protein in a cell that does not express the protein, by expressing a protein in a cell that expresses a mutant form of the protein, by expressing a protein that is toxic to the target cell in which the protein is expressed (a strategy for, for example, killing unwanted cells such as cancer cells), by expressing antisense RNA to induce gene repression or exon skipping, or by expressing a silencing RNA such as shRNA that aims to inhibit the expression of a protein.

[0085] According to the present invention, the term "treatment" includes a cure, relief or preventive effect. Therefore, treatment and preventive treatment include symptom improvement of the disorder or prevention or otherwise reducing the risk of a specific disorder. Treatment can be implemented to delay, slow down or reverse the progress of the disease and / or one or more symptoms thereof. The term "prevention" can be considered to reduce the severity or onset of a specific condition. "Prevention" also includes preventing the recurrence of a specific condition in a patient previously diagnosed with the condition. "Treatment" can also refer to the reduction of the severity of an existing condition. The term "treatment" is used herein to refer to any therapy that can benefit an animal, particularly a mammal, and more particularly a human subject. In a specific embodiment, the mammal can be an infant or an adult subject, such as a human infant or an adult human.

[0086] "Cells of therapeutic interest" or "tissues of therapeutic interest" herein means the primary cells or tissues in which the expression of the therapeutic transgene will be useful for the treatment of the disorder. These tissues of therapeutic interest include, but are not limited to, muscle (e.g., skeletal muscle, diaphragm, and myocardium), nervous system (e.g., brain or spinal cord), kidney, lung, and intestine. Cells of therapeutic interest include, but are not limited to, hepatocytes, cardiomyocytes, myofibers, neurons (e.g., motor neurons, sensory neurons), glial cells, and endothelial cells.

[0087] Hybrid transcriptional regulatory element

[0088] The present inventors have designed new multi-tissue selective transcriptional regulatory elements for improving the efficacy of gene therapy, which are also referred to herein as "hybrid transcriptional regulatory elements". Specifically, the new multi-tissue selective transcriptional regulatory elements can combine different tissue-selective enhancers and / or tissue-selective promoters.

[0089] The nucleic acid sequence of the present invention relates to such a hybrid transcriptional regulatory element. The nucleic acid molecule of the present invention comprises: (i) a first transcriptional regulatory element capable of driving or enhancing tissue-selective expression in a first tissue (i.e., a first tissue-selective transcriptional regulatory element); and (ii) a second transcriptional regulatory element capable of driving or enhancing tissue-selective expression in a second tissue (i.e., a second tissue-selective transcriptional regulatory element), and wherein the first transcriptional regulatory element and the second transcriptional regulatory element are fused together. In the present invention, the first transcriptional regulatory element and the second transcriptional regulatory element have different tissue selectivities, and at least one of the first transcriptional regulatory element and the second transcriptional regulatory element is a promoter.

[0090] The selection of the transcriptional regulatory element included in the nucleotide sequence of the present invention will depend on the specific target of the interested transgenic gene that is operably connected to the nucleotide sequence and the nucleotide sequence. Specifically, in the case where the nucleotide sequence of the present invention is used in the carrier for gene therapy, it will depend on the disease or obstacle that the practitioner is intended to treat. Depending on the circumstances, the transcriptional regulatory element can be selected to be able to drive expression in a large number of tissues or cells, such as in the liver, muscle, in the central nervous system, such as in the brain or spinal cord, such as in neurons (such as in motor neurons, sensory neurons or interneurons) or glial cells, in the peripheral nervous system (PNS), in the kidney, in the eyes, or in the lungs. Other tissues or cells of interest can include circulating cells such as cells of the immune system such as B cells, T cells or macrophages, hematopoietic cells or endothelial cells.

[0091] In certain embodiments, expression in the liver is sought, for example, but not exclusively, to induce immune tolerance to the transgene of interest.

[0092] In another specific embodiment, expression in muscle is sought.

[0093] In yet another embodiment, expression in neurons is sought.

[0094] In other specific embodiments, transcriptional regulatory elements are selected for expression in liver and muscle.

[0095] In another embodiment, transcriptional regulatory elements are selected for expression in liver and neurons.

[0096] In another embodiment, transcriptional regulatory elements are selected for expression in muscle and neurons.

[0097] In other embodiments, transcriptional regulatory elements are selected for expression in liver, muscle, and neurons.

[0098] As mentioned in the above definition, the transcriptional regulatory element may be a tissue-selective enhancer or a tissue-selective promoter.

[0099] The first tissue selective transcriptional regulatory element drives / enhances expression of the transgenic gene in a first cell or tissue of interest, e.g., a first cell or tissue of therapeutic interest. In a specific embodiment, the first tissue selective transcriptional regulatory element drives / enhances expression of the transgenic gene in the liver. In a specific embodiment, expression in the liver is sought because of the tolerogenic properties of this tissue. Thus, in this specific embodiment, the first transcriptional regulatory element is a liver selective transcriptional regulatory element. A composite or artificial liver promoter is generated by combining promoter regions of liver expressed genes. Illustrative liver-selective transcriptional regulatory elements include, but are not limited to, apolipoprotein E (ApoE - enhancer sequence is shown in SEQ ID NO: 4) and AI (Apo AI) enhancers (Van Linthout S, Hum Gene Ther. 2002 May 1; 13 (7): 829-40), antitrypsin promoters - for example, alpha-1 antitrypsin promoter (hAAT - shown in SEQ ID NO: 2), transthyretin promoter (TTR), albumin promoter (Alb), thyroxine binding globulin (TBG) promoter, LSP promoter (comprising thyroid hormone binding globulin promoter sequence, two copies of alpha 1-microglobulin / bikunin enhancer sequence and leader sequence - 111, Charles R. et al., 1997, Optimization of the human factor VIII complementary DNA expression plasmid for gene therapy of hemophilia A A), Blood Coag. Fibrinol. 8: S23–S30), etc. Other useful liver-selective promoters are known in the art, such as those listed in the liver-specific gene promoter database compiled by Cold Spring Harbor Laboratory (http: / / rulai.cshl.edu / LSPD / ). Specifically, other transcriptional regulatory elements capable of enhancing liver-selective expression of genes are disclosed in WO2009130208.In a specific embodiment, the liver-selective transcriptional regulatory element comprises a combination of an ApoE enhancer and a liver-selective promoter selected from an antitrypsin promoter, such as an alpha-1 antitrypsin promoter (hAAT - shown in SEQ ID NO: 2), a thyroxine transporter promoter (TTR), an albumin promoter (Alb), a thyroxine binding globulin (TBG) promoter, the LSP promoter defined above, and any other liver-selective promoter, such as those listed in the Liver-Specific Gene Promoter Database compiled by Cold Spring Harbor Laboratory (http: / / rulai.cshl.edu / LSPD / ). In a specific embodiment, the liver-selective transcriptional regulatory element used in the context of the present invention is a liver-selective promoter selected from an alpha-1 antitrypsin promoter (hAAT), a combination of an ApoE enhancer and a hAAT promoter, a thyroxine transporter promoter, an albumin promoter, a thyroxine binding globulin (TBG) promoter, and a LSP promoter. A specific liver-selective transcriptional regulatory element used in the context of the present invention is the ApoE enhancer (ApoE) in combination with the hAAT promoter.

[0100] The second tissue-selective transcriptional regulatory element drives or enhances the expression of the transgenic gene in the second cell or tissue of interest. Specifically, the second tissue-selective transcriptional regulatory element can drive the expression of the transgenic gene in the second cell or tissue of interest.

[0101] In a specific embodiment, the second tissue-selective transcriptional regulatory element is a muscle-selective promoter ultimately coupled to a muscle-selective enhancer. In another specific embodiment, the second tissue-selective transcriptional regulatory element is a muscle-selective enhancer.

[0102] An example of a suitable muscle selective promoter includes a muscle creatine kinase (MCK) promoter. Non-limiting examples of suitable muscle creatine kinase promoters are human muscle creatine kinase promoters and truncated murine muscle creatine kinase [(tMCK) promoter] (Wang B et al., Construction and analysis of compact muscle-selective promoters for AAV vectors, Gene Ther. 2008 Nov; 15 (22): 1489-99) (representative GenBank accession number AF188002). Human muscle creatine kinase has Gene ID No. 1158 (representative GenBank accession number NC_000019.9, accessed on December 26, 2012). Other examples of muscle-selective promoters include the synthetic promoter C5.12 (spC5.12, also referred to herein as "C5.12"), such as the spC5.12 shown in SEQ ID NO: 1 or the spC5.12 promoter (disclosed in Wang et al., Gene Therapy volume 15, pages 1489-1499 (2008)), the MHCK7 promoter (Salva et al., Mol Ther. 2007 Feb; 15(2):320-9), the myosin light chain (MLC) promoter such as MLC2 (Gene ID No. 4633; representative GenBank accession number NG_007554.1, accessed on December 26, 2012), the myosin heavy chain (MHC) promoter such as α-MHC (Gene ID No. 4624; representative GenBank accession number NG_023444.1, accessed on December 26, 2012), desmin promoter (Gene ID No. 1674; representative GenBank accession number NG_008043.1, accessed on December 26, 2012), cardiac troponin C promoter (Gene ID No. 7134; representative GenBank accession number NG_008963.1, accessed on December 26, 2012), troponin I promoter (Gene ID Nos. 7135, 7136 and 7137; representative GenBank accession numbers NG_016649.1, NG_011621.1 and NG_007866.2, accessed on December 26, 2012), myoD gene family promoter (Weintraub et al., Science, 251, 761 (1991); Gene ID No.4654; representative GenBank accession number NM_002478, accessed on December 26, 2012), α-actin promoter (Gene ID Nos. 58, 59 and 70; representative GenBank accession numbers NG_006672.1, NG_011541.1 and NG_007553.1, accessed on December 26, 2012), β-actin promoter (Gene ID No. 60; representative GenBank accession number NG_007992.1, accessed on December 26, 2012), γ-actin promoter (Gene ID Nos. 71 and 2; representative GenBank accession numbers NG_011433.1 and NM_001199893, accessed on December 26, 2012), a muscle-selective promoter located in intron 1 of eye-type Pitx3 (Gene ID No.5309) (Coulon et al.; the muscle selective promoter corresponds to residues 11219-11527 of representative GenBank accession number NG_008147, accessed on December 26, 2012) and the promoter described in U.S. Patent Publication US 2003 / 0157064 and the CK6 promoter (Wang et al., 2008 doi:10.1038 / gt.2008.104). In another specific embodiment, the muscle selective promoter is the E-Syn promoter described in Wang et al., Gene Therapy volume 15, pages 1489-1499 (2008) (sequence shown in SEQ ID NO: 13), which comprises a combination of an MCK-derived enhancer and a spC5.12 promoter. In a specific embodiment of the present invention, the muscle selective promoter is selected from the group consisting of spC5.12 promoter, MHCK7 promoter, E-syn promoter, muscle creatine kinase myosin light chain (MLC) promoter, myosin heavy chain (MHC) promoter, cardiac troponin C promoter, troponin I promoter, myoD gene family promoter, α-actin promoter, β-actin promoter, γ-actin promoter, muscle selective promoter located in intron 1 of eye-type Pitx3 and CK6 promoter. In a specific embodiment, the muscle selective promoter is selected from the group consisting of spC5.12, desmin and MCK promoter. In other embodiments, the muscle selective promoter is selected from the group consisting of spC5.12 and MCK promoter. In a specific embodiment, the muscle selective promoter is spC5.12 promoter. In a specific embodiment, the muscle selective promoter is not desmin promoter. .

[0103] Specifically, transcriptional regulatory elements capable of enhancing the muscle-selective expression of genes, especially in myocardial and / or skeletal muscle, are those disclosed in WO2015110449. Specific examples of nucleic acid transcriptional regulatory elements comprising artificial sequences include transcriptional regulatory elements obtained by rearranging the transcription factor binding sites (TFBS) present in the sequences disclosed in WO2015110449. The rearrangement may cover changes in the order of TFBS and / or changes in the position of one or more TFBS relative to other TFBSs and / or changes in the copy number of one or more TFBSs. For example, nucleic acid transcriptional regulatory elements for enhancing muscle-selective gene expression, especially myocardial and skeletal muscle selective gene expression, may include binding sites for E2A, HNH 1, NF1, C / EBP, LRF, MyoD and SREBP, or binding sites for E2A, NF1, p53, C / EBP, LRF and SREBP, or binding sites for E2A, HNH 1, HNF3a, HNF3b, NF1, C / EBP, LRF, MyoD and SREBP binding sites, or for E2A, HNF3a, NF1, C / EBP, LRF, MyoD and SREBP binding sites, or for E2A, HNF3a, NF1, CEBP, LRF, MyoD and SREBP binding sites, or for HNF4, NF1, RSRFC4, C / EBP, LRF and MyoD binding sites, or for NF1, PPAR, p53, C / EBP, LRF and MyoD binding sites. In other examples, these nucleic acid transcription regulatory elements comprise at least 2, such as 2, 3, 4 or more copies of the aforementioned one or more TFBS.

[0104] In yet another specific embodiment, the second tissue-selective transcriptional regulatory element is a neuron-selective promoter ultimately coupled to a neuron-selective enhancer. In another specific embodiment, the second tissue-selective transcriptional regulatory element is a neuron-selective enhancer.

[0105] Neuron-selective promoters include, but are not limited to, the following promoters: synapsin-1 (Syn) promoter (shown in SEQ ID NO: 3), neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13: 503-15 (1993)), neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88: 5611-5 (1991)), and neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15: 373-84 (1995)), as well as other promoters that are obvious to the skilled artisan. In a specific embodiment, the neuron-selective promoter is the Syn promoter. Other neuron-selective promoters include, but are not limited to, the synapsin-2 promoter, the tyrosine hydroxylase promoter, the dopamine β-hydroxylase promoter, the hypoxanthine phosphoribosyltransferase promoter, the low affinity NGF receptor promoter, and the choline acetyltransferase promoter (Bejanin et al., 1992; Carroll et al., 1995; Chin and Greengard, 1994; Foss-Petter et al., 1990; Harrington et al., 1987; Mercer et al., 1991; Patei et al., 1986). Representative promoters that are selective for motor neurons include, but are not limited to, the promoter of the known motor neuron-derived factor, calcitonin gene-related peptide (CGRP). Other promoters that function in motor neurons include the promoters of choline acetyltransferase (ChAT), neuron-specific enolase (NSE), synapsin, and Hb9. Other neuron-selective promoters for use in the present invention include, but are not limited to, the promoters of GFAP (for astrocytes), calbindin 2 (for interneurons), Mnx1 (motor neurons), nestin (neurons), parvalbumin, somatostatin, and Plp1 (oligodendrocytes and Schwann cells).

[0106] CRMs useful in the practice of the present invention include those described in Rincon et al., Mol Ther. 2015 Jan; 23(1):43-52, Chuah et al., Mol Ther. 2014 Sep; 22(9):1605-13, or Nair et al., Blood. 2014 May 15; 123(20):3195-9.

[0107] In other embodiments, the nucleic acid sequence of the present invention comprises more than two tissue selective transcriptional regulatory elements, such as 3, 4 or more than 4 tissue selective transcriptional regulatory elements. The design of the nucleic acid of the present invention depends on the specific disorder attempted to be treated, such as whether the disorder is a multi-system disease whose treatment will benefit from the expression of the therapeutic transgenic gene in more than one tissue. For example, the nucleic acid sequence of the present invention may comprise a first tissue selective transcriptional regulatory element (e.g., a promoter) that can drive or enhance the expression of the transgenic gene in a tolerogenic tissue, such as in the liver, a second tissue selective transcriptional regulatory element (e.g., a promoter) and a third tissue selective transcriptional regulatory element (e.g., a promoter), wherein the first tissue selective transcriptional regulatory element, the second tissue selective transcriptional regulatory element and the third tissue selective transcriptional regulatory element can drive the expression of the transgenic gene in different tissues. For example, the first tissue selective transcriptional regulatory element can be a liver selective promoter, the second tissue selective transcriptional regulatory element can be a muscle selective promoter, and the third tissue selective transcriptional regulatory element can be a neuron selective promoter. Alternatively, the second tissue-selective transcriptional regulatory element and the third tissue-selective transcriptional regulatory element may both have the same tissue selectivity, which is different from the tissue selectivity of the first transcriptional regulatory element, so as to further improve the expression of the therapeutic transgene in the tissue of interest.

[0108] The relative order of the first tissue selective transcriptional regulatory element, the second tissue selective transcriptional regulatory element and other tissue selective transcriptional regulatory elements (e.g., the first, second and other tissue selective promoters) to each other can be changed. In a specific embodiment, the first tissue selective transcriptional regulatory element is located at 5' or 3' of the second tissue selective transcriptional regulatory element, in particular 5' of the second tissue selective transcriptional regulatory element. In a specific embodiment in which the first transcriptional regulatory element is a liver selective promoter, the first transcriptional regulatory element is located at 5' relative to any other transcriptional regulatory element introduced in the nucleic acid molecule of the present invention. For example, the nucleic acid molecule of the present invention can include in the following order from 5' to 3':

[0109] (i) a liver-selective promoter; and

[0110] - any other transcriptional regulatory element with tissue selectivity other than liver; or

[0111] (ii) - a liver-selective promoter; and

[0112] - a muscle-selective transcriptional regulatory element, such as a muscle-selective promoter; or

[0113] (iii) - a liver-selective promoter; and

[0114] - a neuron-selective transcriptional regulatory element, such as a neuron-selective promoter; or

[0115] (iv) - liver-selective promoter;

[0116] - a muscle-selective transcriptional regulatory element, such as a muscle-selective promoter; and

[0117] - a neuron-selective transcriptional regulatory element, such as a neuron-selective promoter; or

[0118] (v) - liver-selective promoter;

[0119] - a neuron-selective transcriptional regulatory element, such as a neuron-selective promoter; and

[0120] - A muscle-selective transcriptional regulatory element, such as a muscle-selective promoter.

[0121] In the context of the present invention, the transcriptional regulatory element introduced into the nucleic acid molecule of the present invention can be directly fused or connected by a connector. For example, in the case of a design with two different promoters, direct fusion means that the first nucleotide of the second promoter directly follows the last nucleotide of the first promoter. In the case of being connected by a connector, there is a nucleotide sequence between the last nucleotide of the first promoter and the first nucleotide of the second promoter. For example, the length of the connector can be between 1 and 50 nucleotides, for example 1 to 40 nucleotides, for example 1 to 30 nucleotides, for example 1 to 20 nucleotides, for example 1 to 10 nucleotides.

[0122] In a specific embodiment, the nucleic acid sequence of the present invention specifically comprises the following sequence from 5' to 3':

[0123] - a liver-selective transcriptional regulatory element; and

[0124] - a muscle-selective and / or neuron-selective transcriptional regulatory element, in particular a muscle-selective or neuron-selective transcriptional regulatory element.

[0125] In other specific embodiments, the nucleic acid sequence of the present invention specifically comprises the following sequence from 5' to 3':

[0126] - ApoE enhancer; and

[0127] -spC5.12 promoter.

[0128] In a variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:4 and SEQ ID NO:1, for example the sequence shown in SEQ ID NO:5.

[0129] In another specific embodiment, the nucleic acid sequence of the present invention specifically comprises in the following order from 5' to 3':

[0130] - transcriptional regulatory elements, in particular promoters, capable of driving / enhancing the expression of the transgene in tolerogenic tissues; and

[0131] - a muscle-selective and / or neuron-selective transcriptional regulatory element, in particular a promoter, more in particular a muscle-selective or neuron-selective promoter.

[0132] In other specific embodiments, the nucleic acid sequence of the present invention specifically comprises the following sequence from 5' to 3':

[0133] - a liver-selective promoter; and

[0134] - a muscle-selective and / or a neuron-selective promoter, in particular a muscle-selective or a neuron-selective promoter.

[0135] In an even more specific embodiment, the nucleic acid sequence of the invention specifically comprises in the following order from 5' to 3':

[0136] -hAAT promoter; and

[0137] -spC5.12 promoter.

[0138] In a specific variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:2 and SEQ ID NO:1.

[0139] In another more specific embodiment, the nucleic acid sequence of the present invention specifically comprises in the following order from 5' to 3':

[0140] - ApoE enhancer / hAAT promoter; and

[0141] -spC5.12 promoter.

[0142] In a particular variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:4, SEQ ID NO:2 and SEQ ID NO:1, for example the sequence shown in SEQ ID NO:6.

[0143] In another more specific embodiment, the nucleic acid sequence of the present invention specifically comprises in the following order from 5' to 3':

[0144] -hAAT promoter; and

[0145] -Syn promoter.

[0146] In a specific variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:2 and SEQ ID NO:3.

[0147] In other specific embodiments, the nucleic acid sequence of the present invention specifically comprises the following sequence from 5' to 3':

[0148] - ApoE enhancer; and

[0149] -Syn promoter.

[0150] In a variation of this embodiment, the nucleic acid sequence of the present invention comprises a combination of SEQ ID NO:4 and SEQ ID NO:3.

[0151] In another more specific embodiment, the nucleic acid sequence of the present invention specifically comprises in the following order from 5' to 3':

[0152] - ApoE enhancer / hAAT promoter; and

[0153] -Syn promoter.

[0154] In a particular variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:4, SEQ ID NO:2 and SEQ ID NO:3, for example the sequence shown in SEQ ID NO:7.

[0155] In another specific embodiment, the nucleic acid sequence of the present invention specifically comprises in the following order from 5' to 3':

[0156] -hAAT promoter;

[0157] -spC5.12 promoter; and

[0158] -Syn promoter.

[0159] In a specific variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:2, SEQ ID NO:1 and SEQ ID NO:3.

[0160] In another specific embodiment, the nucleic acid sequence of the present invention specifically comprises in the following order from 5' to 3':

[0161] -hAAT promoter;

[0162] -Syn promoter; and

[0163] -spC5.12 promoter.

[0164] In a specific variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:1.

[0165] In another specific embodiment, the nucleic acid sequence of the present invention specifically comprises in the following order from 5' to 3':

[0166] -ApoE enhancer / hAAT promoter;

[0167] -spC5.12 promoter; and

[0168] -Syn promoter.

[0169] In a specific variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:4, SEQ ID NO:2, SEQ ID NO:1 and SEQ ID NO:3.

[0170] In other specific embodiments, the nucleic acid sequence of the present invention specifically comprises the following sequence from 5' to 3':

[0171] -ApoE enhancer / hAAT promoter;

[0172] -Syn promoter; and

[0173] -spC5.12 promoter.

[0174] In a specific variation of this embodiment, the nucleic acid sequence of the invention comprises a combination of SEQ ID NO:4, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:1.

[0175] In another specific embodiment, the nucleic acid sequence of the present invention specifically comprises in the following order from 5' to 3':

[0176] -spC5.12 promoter; and

[0177] -Syn promoter.

[0178] In other specific embodiments, the nucleic acid sequence of the present invention specifically comprises the following sequence from 5' to 3':

[0179] -MHCK7 promoter; and

[0180] -Syn promoter.

[0181] In another specific embodiment, the nucleic acid sequence of the present invention specifically comprises the following sequence from 5' to 3':

[0182] -CK promoter; and

[0183] -Syn promoter.

[0184] Expression cassette

[0185] The nucleic acid sequences of the present invention can be introduced into expression cassettes designed to provide for expression of the transgene of interest in the tissue of interest.

[0186] Therefore, the expression cassette of the present invention comprises the above-mentioned nucleic acid sequence and the transferred gene of interest.

[0187] The expression cassette may contain at least one additional regulatory sequence that can further control the expression of the therapeutic transgenic gene of interest by reducing or inhibiting its expression in certain tissues of no interest, or by stabilizing the mRNA encoding a protein of interest, such as a therapeutic protein, encoded by the transgenic gene of interest. These sequences include, for example, silencers (e.g., tissue-specific silencers), microRNA target sequences, introns, and polyadenylation signals.

[0188] In another specific embodiment, an intron can be placed before the therapeutic transgenic gene, in particular, an intron is placed between the hybrid promoter of the present invention and the therapeutic transgenic gene. The introduction of introns can improve the stability of mRNA and the production of proteins of interest, such as therapeutic proteins of interest. In other embodiments, the intron is a human beta globin b2 (or HBB2) intron, a coagulation factor IX (FIX) intron, an SV40 intron, or a chicken beta-globin intron. In another other embodiment, the intron is a modified intron (in particular a modified HBB2 or FIX intron), which is designed to reduce the number of optional open reading frames (ARFs) present in the intron or even completely remove them. The inventors have previously shown in WO2015 / 162302 that such modified introns, in particular modified HBB2 or FIX introns, have favorable properties and can significantly improve the expression of transgenic genes.

[0189] In a specific embodiment, the expression cassette of the invention comprises in the following order from 5' to 3':

[0190] - a nucleic acid sequence according to the invention;

[0191] - the transgene of interest; and

[0192] -Polyadenylation signal.

[0193] In other specific embodiments, the expression cassette of the present invention comprises in the following order from 5' to 3':

[0194] - a nucleic acid sequence according to the invention;

[0195] - introns, such as HBB2 or SV40 introns;

[0196] - the transgene of interest; and

[0197] -Polyadenylation signal.

[0198] Vectors, cells and pharmaceutical compositions

[0199] The expression cassette of the present invention can be introduced into a vector. Therefore, the present invention also relates to a vector comprising the above expression cassette. The vector used in the present invention is a vector suitable for RNA / protein expression and particularly suitable for gene therapy.

[0200] In one embodiment, the vector is a plasmid vector.

[0201] In another embodiment, the vector is a non-viral vector, such as a nanoparticle, lipid nanoparticle (LNP), or liposome containing the expression cassette of the invention.

[0202] In another embodiment, the vector is a transposon-based system that allows integration of the expression cassette of the invention into the genome of the target cell, such as the highly active Sleeping Beauty (SB100X) transposon system (Mates et al., 2009).

[0203] In another embodiment, the vector is a viral vector suitable for gene therapy, targeting any cell or tissue of interest, such as the above-mentioned tolerogenic tissue (e.g., liver tissue or cells) and therapeutically interesting tissues such as muscle or CNS cells (e.g., neurons or other spinal cord or brain cells). In this case, as is well known in the art, other sequences suitable for producing efficient viral vectors are added to the expression cassette of the present invention. In a specific embodiment, the viral vector is derived from an integrating virus. Specifically, the viral vector can be derived from an adenovirus, a retrovirus, or a lentivirus (e.g., an integration-defective lentivirus). In a specific embodiment, the lentivirus is a pseudotyped lentivirus with an envelope that can target cells / tissues of interest, such as liver and / or muscle cells (as described in patent applications EP17306448.6 and EP17306447.8). In the case where the viral vector is derived from a retrovirus or a lentivirus, the other sequences are retrovirus or lentivirus LTR sequences on both sides of the expression cassette. In another specific embodiment, the viral vector is an AAV vector, such as an AAV vector suitable for transducing tolerogenic tissues such as liver and another tissue of therapeutic interest. In this embodiment, the additional sequences are AAV ITR sequences flanking the expression cassette.

[0204] In a preferred embodiment, the vector is an AAV vector. Human parvovirus adeno-associated virus (AAV) is a naturally replication-deficient dependent virus that can integrate into the genome of infected cells to establish a latent infection. The last property seems to be unique among mammalian viruses because integration occurs at a specific site in the human genome located on chromosome 19 (19q13.3-qter) called AAVS1.

[0205] Therefore, AAV vectors have attracted considerable interest as potential vectors for human gene therapy. Advantageous properties of the virus include the lack of association with any human disease, the ability to infect both dividing and non-dividing cells, and a wide range of cell lines derived from different tissues that can be infected.

[0206] Among the AAV serotypes isolated from humans or non-human primates (NHPs) and well characterized, human serotype 2 was the first AAV to be developed as a gene transfer vector. Other currently used AAV serotypes include AAV-1, AAV-2 variants (e.g., a quadruple-mutated capsid-optimized AAV-2 comprising an engineered capsid with changes Y44+500+730F+T491V, disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods), AAV-3 and AAV-3 variants (e.g., an AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), AAV-3B and AAV-3B variants, -4, -5, -6 and AAV-6 variants (e.g., an AAV6 variant comprising a triple-mutated AAV6 capsid in the form of Y731F / Y705F / T492V, disclosed in Rosario et al., 2016, Mol Ther. Vol. 24(6), p. 1042). Methods Clin Dev.3, p.16026), -7, -8, -9, -2G9, -10 such as cy10 and -rh10, -rh74, -dj, Anc80, LK03, AAV2i8, porcine AAV serotypes such as AAVpo4 and AAVpo6, and tyrosine, lysine and serine capsid mutants of AAV serotypes, etc. In addition, other non-natural engineered variants and chimeric AAVs may also be useful.

[0207] AAV viruses can be engineered using conventional molecular biology techniques, such that these particles can be optimized for cell-specific delivery of nucleic acid sequences, for minimizing immunogenicity, for regulating stability and particle lifespan, for efficient degradation, and for precise delivery to the nucleus.

[0208] The AAV segments required for assembling the vector include cap proteins including vp1, vp2, vp3 and hypervariable regions, rep proteins including rep 78, rep 68, rep 52 and rep 40, and sequences encoding these proteins. These segments can be easily used in a variety of different vector systems and host cells.

[0209] AAV-based recombinant vectors lacking the Rep protein integrate into the host's genome with low efficiency and exist primarily as stable circular episomes that can persist in target cells for several years.

[0210] Instead of using AAV natural serotypes, artificial AAV serotypes may also be used in the context of the present invention, including but not limited to AAV with non-naturally occurring capsid proteins. Such artificial capsids may be produced by any suitable technique using a combination of selected AAV sequences (e.g., fragments of the vp1 capsid protein) with heterologous sequences, which may be obtained from different selected AAV serotypes, non-contiguous portions of the same AAV serotype, non-AAV viral sources, or non-viral sources. The artificial AAV serotype may be, but is not limited to, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid.

[0211] In the context of the present invention, the AAV vector comprises an AAV capsid capable of transducing target cells of interest, ie cells of tolerogenic tissues (eg stem cells) and cells of therapeutically interesting tissues, such as muscle cells, CNS cells or cardiac cells.

[0212] According to a specific embodiment, the AAV vector is AAV-1, -2, AAV-2 variant (e.g., a capsid-optimized AAV-2 comprising a quadruple mutation of an engineered capsid with Y44+500+730F+T491V changes, as disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods [Epub ahead of print]), AAV-3 and AAV-3 variants (e.g., AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), AAV-3B and AAV-3B variants, -4, -5, -6 and AAV-6 variants (e.g., AAV6 variant comprising a triple-mutated AAV6 capsid in the form of Y731F / Y705F / T492V, disclosed in Rosario et al., 2016, Mol Ther Methods Clin Dev.3, p.16026), -7, -8, -9, -2G9, -10 such as cy10 and -rh10, -rh39, -rh43, -rh74, -dj, Anc80, LK03, AAV.PHP, AAV2i8, porcine AAV such as AAVpo4 and AAVpo6, and tyrosine, lysine and serine capsid mutants of AAV serotypes, etc. In a specific embodiment, the AAV vector is an AAV8, AAV9, AAVrh74 or AAV2i8 serotype (ie, the AAV vector has a capsid of the AAV8, AAV9, AAVrh74 or AAV2i8 serotype). In other specific embodiments, the AAV vector is a pseudotype vector, that is, its genome and capsid are derived from AAVs of different serotypes. For example, the pseudotyped AAV vector can be a vector whose genome is derived from one of the above-mentioned AAV serotypes and whose capsid is derived from another serotype. For example, the genome of the pseudotype vector may have a capsid derived from AAV8, AAV9, AAVrh74 or AAV2i8 serotype, and its genome may be derived from a different serotype. In a specific embodiment, the AAV vector has a capsid of AAV8, AAV9 or AAVrh74 serotype, particularly AAV8 or AAV9 serotype, more particularly AAV8 serotype.

[0213] In a specific embodiment in which the vector is used to deliver the therapeutic transgene to muscle cells, the AAV vector can be selected among AAV8, AAV9 and AAVrh74.

[0214] In another specific embodiment in which the vector is used to deliver the transfer gene to hepatocytes, the AAV vector can be selected from AAV1, AAV5, AAV8, AAV9, AAVrh10, AAVrh39, AAVrh43, AAVrh74, AAV-LK03, AAV2G9, AAV.PHP, AAV-Anc80 and AAV3B.

[0215] In another specific embodiment in which the vector is used to deliver the transgene to the CNS, the AAV vector can be selected among AAV9, AAV10 and AAV2G9.

[0216] In another embodiment, the capsid is a modified capsid. In the context of the present invention, a "modified capsid" may be a chimeric capsid or a capsid comprising one or more variant VP capsids derived from one or more wild-type AAV VP capsid proteins.

[0217] In a specific embodiment, the AAV vector is a chimeric vector, i.e., its capsid comprises VP capsid proteins derived from at least two different AAV serotypes, or comprises at least one chimeric VP protein incorporating VP protein regions or domains derived from at least two AAV serotypes. Examples of such chimeric AAV vectors that can be used to transduce hepatocytes are described in Shen et al., Molecular Therapy, 2007 and Tenney et al., Virology, 2014. For example, a chimeric AAV vector can be generated from a combination of AAV8 capsid sequences and sequences of an AAV serotype other than the AAV8 serotype, such as those specifically mentioned above. In another embodiment, the capsid of the AAV vector comprises one or more variant VP capsid proteins, such as those described in WO2015013313, in particular RHM4-1, RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4, and RHM15-6 capsid variants that exhibit high liver tropism.

[0218] In another embodiment, the modified capsid may also be derived from capsid modifications inserted by error-prone PCR and / or peptide insertion (e.g., as described in Bartel et al., 2011). In addition, capsid variants may include single amino acid changes such as tyrosine mutants (e.g., as described in Zhong et al., 2008).

[0219] In addition, the genome of the AAV vector can be a single-stranded or self-complementary double-stranded genome (McCarty et al., Gene Therapy, 2003). The self-complementary double-stranded AAV vector is produced by deleting the terminal melting site from one of the AAV terminal repeat sequences. These modified vectors whose replicated genomes are half the length of the wild-type AAV genome have a tendency to package DNA dimers. In a preferred embodiment, the AAV vector used in the practice of the present invention has a single-stranded genome, and in addition preferably comprises an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, particularly an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid. As known in the art, other suitable sequences can be introduced into the nucleic acid construct of the present invention to obtain a functional viral vector. Suitable sequences include AAV ITR.

[0220] Of course, in designing the nucleic acid sequence of the present invention and the expression cassette of the present invention, those skilled in the art should be careful to comply with the size limitations of the vector used to deliver the construct to a cell or organ. Specifically, in the case where the vector is an AAV vector, those skilled in the art know that the main limitation of the AAV vector is its carrying capacity, which can vary with the AAV serotype, but is believed to be limited by the approximate size of the parent viral genome. For example, 5kb is generally considered to be the maximum size that is packaged in an AAV8 capsid (Wu Z. et al., Mol Ther., 2010, 18 (1): 80-86; Lai Y. et al., Mol Ther., 2010, 18 (1): 75-79; Wang Y. et al., Hum Gene Ther Methods, 2012, 23 (4): 225-33). Therefore, those skilled in the art should carefully select the components of the nucleic acid construct of the present invention in practicing the present invention so that the resulting nucleic acid sequence including the sequences encoding AAV 5'- and 3'-ITR preferably does not exceed 110% of the carrying capacity of the AAV vector used, and in particular preferably does not exceed 5.5 kb.

[0221] The present invention further relates to isolated cells transformed with nucleic acid sequences of the present invention or expression cassettes of the present invention, such as liver, muscle or neuronal cells. The cells of the present invention can be delivered to the object by injection in the tissue of interest or the bloodstream of the object in need. In a specific embodiment, the present invention relates to introducing nucleic acid sequences of the present invention or expression cassettes into the cells of the object to be treated, particularly the liver, muscle or neuronal cells of the object to be treated, and administering the cells into which the nucleic acid or expression cassette has been introduced back to the object.

[0222] The present invention also provides pharmaceutical compositions comprising the nucleic acid sequences, vectors or cells of the present invention. These compositions comprise a therapeutically effective amount of the nucleic acid sequences, vectors or cells of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" means that it is approved by the regulatory authorities of the federal or state governments or listed in the U.S. or European Pharmacopoeia or other recognized pharmacopoeias and can be used in animals and humans. The term "carrier" refers to a diluent, adjuvant, excipient or medium that is administered along with the therapeutic agent. These pharmaceutical carriers can be sterile liquids such as water and oils, including oils from petroleum, animals, plants or synthetic sources, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. Saline solutions and aqueous dextrose solutions and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glyceryl monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene glycol, water, ethanol, etc.

[0223] If necessary, the composition may also contain a small amount of a wetting or emulsifying agent or a pH buffer. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations, and the like. Oral dosage forms may include standard carriers such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. Examples of suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by EW Martin. These compositions will contain a therapeutically effective amount of a therapeutic agent, preferably in purified form, and a suitable amount of a carrier to provide a form suitable for administration to the subject. In a specific embodiment, the nucleic acid sequence, expression cassette, vector, or cell of the present invention is formulated in a composition comprising phosphate buffered saline supplemented with 0.25% human serum albumin. In another specific embodiment, the carrier of the invention is formulated in a composition comprising Ringer's lactate and a non-ionic surfactant such as pluronic F68 at a final concentration of 0.01-0.0001% by weight of the total composition, for example at a concentration of 0.001%. The dosage form may also comprise serum albumin, in particular human serum albumin, for example 0.25% human serum albumin. Other dosage forms suitable for storage or administration are known in the art, in particular from WO 2005 / 118792 or Allay et al., 2011.

[0224] In a preferred embodiment, the composition is formulated according to conventional procedures as a pharmaceutical composition suitable for intravenous or intramuscular administration, preferably intravenous administration to humans. Typically, the composition for intravenous administration is a solution in a sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to relieve pain at the injection site.

[0225] In one embodiment, the nucleic acid sequence, expression cassette or vector of the invention can be delivered in a vesicle, particularly a liposome. In yet another embodiment, the nucleic acid sequence, expression cassette or vector of the invention can be delivered in a controlled release system.

[0226] How to use the carrier

[0227] Due to the multiple selective transcriptional regulatory elements contained in the nucleic acid sequence of the present invention, the transgenic gene of interest can be expressed in more than one tissue without causing concerns caused by ubiquitous promoters. Specifically, the nucleic acid sequence of the present invention can be used to produce expression cassettes with lower genotoxicity. Specifically, the nucleic acid sequence of the present invention can advantageously avoid the undesirable upregulation of oncogenes.

[0228] The nucleic acid sequences, expression cassettes or vectors of the invention can be used to treat disorders by gene therapy. Likewise, the cells of the invention can be used to treat disorders by cell therapy.

[0229] Thus, in one aspect, the present invention relates to a nucleic acid sequence, an expression cassette, a vector, a cell or a pharmaceutical composition as described above for use as a medicament.

[0230] In another aspect, the present invention relates to a nucleic acid sequence, an expression cassette, a vector, a cell or a pharmaceutical composition as described above, for use in a method for treating a disorder by gene therapy.

[0231] In another aspect, the present invention relates to the use of a nucleic acid sequence, an expression cassette, a vector, a cell or a pharmaceutical composition as described above for the manufacture of a medicament for use in the treatment of cancer by gene therapy.

[0232] In another aspect, the present invention relates to a method of treating a disorder by gene therapy, comprising administering to a subject in need thereof a therapeutically effective amount of a nucleic acid sequence, expression cassette, vector, cell or pharmaceutical composition described herein.

[0233] The disorder may be any disorder that may require expression of a given gene in at least two different tissues, particularly a disorder whose treatment may be hampered by an anti-transgene immune response. Specifically, the disorder is a genetic or acquired disorder, such as a genetic or acquired neuromuscular disease. Of course, the choice of a therapeutic transgene and the promoter that drives its expression in the tissue of therapeutic interest will depend on the disorder to be treated.

[0234] In specific embodiments, the disorder is a lysosomal storage disease [(LSD), such as mucopolysaccharidosis types I to VII (MPSI-VII), Sandhoff disease and Tay-Sachs], and the nucleic acid sequence of the invention comprises a liver-selective, muscle-selective and / or neuron-selective transcriptional regulatory element, such as a liver-selective and muscle-selective transcriptional regulatory element, a liver-selective and neuron-selective transcriptional regulatory element, and a liver-selective, muscle-selective and neuron-selective transcriptional regulatory element.

[0235] In specific embodiments, the disorder is a metabolic disease [e.g., maple syrup urine disease (MSUD), methylmalonic acidemia (MMA), glycogen storage disease type I and type III (GSDI and III), Niemann-Pick disease (NPC), Canavan disease, phenylketonuria (PKU)], and the nucleic acid sequence of the invention comprises a liver-selective, muscle-selective and / or neuron-selective transcriptional regulatory element, e.g., a liver-selective and muscle-selective transcriptional regulatory element, a liver-selective and neuron-selective transcriptional regulatory element, and a liver-selective, muscle-selective and neuron-selective transcriptional regulatory element.

[0236] In a particular embodiment, the disorder is a neuromuscular disorder.The term "neuromuscular disorder" encompasses diseases and conditions that impair muscle function either directly as a pathology of voluntary muscles or indirectly as a pathology of nerves or neuromuscular junctions. Illustrative neuromuscular disorders include, but are not limited to, muscular dystrophies (e.g., myotonic dystrophy (Steinert disease), Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, Emory-Dreyfuss muscular dystrophy), motor neuron disease (e.g., amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (infantile progressive spinal muscular atrophy (type 1, Werdnig-Hoffmann disease), intermediate spinal muscular atrophy (type 2), juvenile spinal muscular atrophy (type 3, Kugelberg-Welander disease), adult-onset spinal muscular atrophy (type 4)), spinal-bulbar muscular atrophy (Kennedy disease)), inflammatory myopathies (e.g., polymyositis dermatomyositis, inclusion body myositis), diseases of the muscle-nerve junction ( For example, myasthenia gravis, Lambert-Eaton syndrome, congenital myasthenic syndrome), diseases of the peripheral nerves (for example, Charcot-Marie-Tooth disease, Friedrich's ataxia, Dejerine-Sottas disease), metabolic diseases of muscle (for example, phosphorylase deficiency (McArdle disease), acid maltase deficiency (Pompe disease), phosphofructokinase deficiency (Tarui disease), debranching enzyme deficiency (Cori or Forbes disease), mitochondrial myopathy, carnitine deficiency, carnitine palmitoyltransferase deficiency, phosphoglycerate kinase deficiency, phosphoglycerate mutase deficiency, lactate dehydrogenase deficiency, myoadenylate deaminase deficiency), myopathies caused by endocrine abnormalities (for example, hyperthyroid myopathy, hypothyroid myopathy) and other myopathies (for example, myotonia congenita, paramyotonia congenita, central axonal disease, nematode myopathy, myotubular myopathy, periodic paralysis). In this embodiment, the nucleic acid sequence of the invention comprises liver-selective, muscle-selective and / or neuron-selective transcriptional regulatory elements, such as liver-selective and muscle-selective transcriptional regulatory elements, liver-selective and neuron-selective transcriptional regulatory elements, and liver-selective, muscle-selective and neuron-selective transcriptional regulatory elements.

[0237] In a specific embodiment, the disorder is a glycogen storage disease. The expression "glycogen storage disease" refers to a group of inherited metabolic disorders involving enzymes responsible for glycogen synthesis and degradation. In a more specific embodiment, the glycogen storage disease can be GSDI (von Gierke's disease), GSDII (Pompe disease), GSDIII (Corey disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII or a fatal congenital glycogen storage disease of the heart. More specifically, the glycogen storage disease is selected from GSDI, GSDII and GSDIII, even more particularly selected from GSDII and GSDIII. In an even more specific embodiment, the glycogen storage disease is GSDII. In particular, the nucleic acid molecules of the present invention can be useful in treating GAA deficiency disorders or other disorders associated with the accumulation of glycogen, such as GSDI (von Gierke's disease), GSDII (Pompe disease), GSDIII (Corey disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII and fatal congenital glycogen storage diseases of the heart, more particularly GSDI, GSDII or GSDIII, even more particularly GSDII and GSDIII gene therapy. In other specific embodiments, the disorder is Pompe disease, and the therapeutic transgene is a gene encoding acid alpha-glucosidase (GAA) or a variant thereof. These variants of GAA are specifically disclosed in applications PCT / 2017 / 072942, PCT / EP2017 / 072945 and PCT / EP2017 / 072944, which are incorporated herein by reference in their entirety. In this embodiment, the nucleic acid sequence of the invention comprises a liver-selective, muscle-selective and / or neuron-selective transcriptional regulatory element, e.g., a liver-selective and muscle-selective transcriptional regulatory element, a liver-selective and neuron-selective transcriptional regulatory element, a muscle-selective and neuron-selective transcriptional regulatory element, and a liver-selective, muscle-selective and neuron-selective transcriptional regulatory element. In a specific embodiment, the disorder is infantile-onset Pompe disease (IOPD) or late-onset Pompe disease (LOPD). Preferably, the disorder is IOPD.

[0238] Other diseases of interest include, but are not limited to, hemophilia A, MPSI, Alzheimer's disease, Parkinson's disease, Huntington's disease, Tourette syndrome, schizophrenia, Sly disease, Hunter disease, dementia, paranoia, obsessive-compulsive disorder, learning disabilities, ALS, Charcot-Marie-Tooth disease, Kennedy's disease, glioblastoma, neuroblastoma, autism, Gaucher disease, Hurler's disease, Krabbe's disease, behavioral changes (e.g., disturbances in sleep, perception, or cognition).

[0239] Those skilled in the art will recognize that the transfer genes of interest are useful in treating these and other disorders by gene therapy. For example, the therapeutic transfer genes are: FVIII for hemophilia A, lysosomal enzyme α-L-iduronidase [IDUA (α enzyme-L-iduronidase)] for MPSI, acid-α-glucosidase (GAA) for Pompe disease, glycogen debranching enzyme (GDE) for Corey disease (GSDIII), G6P for GSDI, α-sarcoglycan (SGCA) for LGMD2D, dystrophin or its shortened form for DMD, and SMN1 for SMA. The transfer genes of interest can also be transfer genes that provide other therapeutic properties in addition to providing lost proteins or RNA that inhibits the expression of a given protein. For example, the transfer genes of interest can include, but are not limited to, transfer genes that can improve muscle strength, can reduce apoptosis in the CNS, or can specifically kill cancer cells.

[0240] The inventors have shown that the present invention has the beneficial effect of reducing existing antibodies against a therapeutic protein (e.g., GAA) encoded by the transgenic gene in a subject that has previously undergone ERT using the transgenic gene, using a vector. Thus, in a specific embodiment, the subject in need of the treatment is a subject that has previously received ERT for the treatment of a disease such as LSD. In other specific embodiments, the subject is treated for LSD or GSD by ERT. In other specific embodiments, the subject previously received ERT using GAA for the treatment of Pompe disease. In a specific variation of this embodiment, including administration to a subject that has previously received ERT treatment, the subject is further administered with an expression cassette, vector, cell or pharmaceutical composition according to the present invention, in particular a vector such as a viral vector, more particularly an AAV vector. In a specific variation, the nucleic acid of the present invention is a hybrid regulatory element comprising a first regulatory element capable of driving or enhancing liver-selective expression and a second regulatory element capable of driving or enhancing muscle-selective expression, in particular comprising (i) a combination of an ApoE enhancer and a hAAT promoter and (ii) a spC5.12 promoter.

[0241] Thus, the present invention relates to an expression cassette, vector, cell or pharmaceutical composition as described herein, comprising a hybrid regulatory element of the present invention operably linked to a gene of interest encoding a therapeutic enzyme for use in treating a disease by gene therapy, wherein the subject has previously undergone ERT using the same enzyme. In a specific embodiment, the subject has previously undergone ERT and developed an immune response to the administered enzyme.

[0242] In addition, the expression cassettes, vectors, cells or pharmaceutical compositions described herein comprising a hybrid regulatory element operably linked to a gene encoding a therapeutic enzyme can be used in a method of treating a disease by reducing or eliminating the immune response induced by ERT previously administered to the subject using the same enzyme.

[0243] In another embodiment, the present invention relates to an expression cassette, vector, cell or pharmaceutical composition as described herein, comprising a hybrid regulatory element of the present invention operably linked to a gene encoding a therapeutic enzyme, for use in combination with ERT using the same enzyme for treating a disease. In a specific embodiment, the ERT is administered to the subject before or after, in particular before, the expression cassette, vector, cell or pharmaceutical composition as described herein.

[0244] In other specific embodiments, an expression cassette, vector, cell or pharmaceutical composition described herein comprises a hybrid regulatory element of the invention operably linked to a gene encoding GAA and is used in a method of treating Pompe disease in a subject who has previously received ERT with GAA.

[0245] It should be understood that all specific embodiments of the expression cassettes, vectors, cells and pharmaceutical compositions of the present invention also include the possibility that the transgene of interest is any therapeutic transgene specifically disclosed in the present application, preferably acid-α-glucosidase (GAA). As mentioned elsewhere in the present application, GAA can be used to treat Pompe disease, for example, for the treatment of infantile-onset Pompe disease (IOPD) or late-onset Pompe disease (LOPD). In a specific embodiment, the transgene of interest encodes a wild-type GAA protein comprising a native signal peptide. In another specific embodiment, the transgene of interest encodes a truncated GAA polypeptide comprising at least one amino acid deleted from the N-terminus of a parent GAA polypeptide, wherein the parent polypeptide corresponds to a precursor form of a GAA polypeptide without a signal peptide.

[0246] wherein the truncated GAA polypeptide has 1 to 75 consecutive amino acids deleted from its N-terminal end compared to the parent GAA polypeptide, and

[0247] The truncated GAA polypeptide further comprises a signal peptide fused to its N-terminal end.

[0248] In a particular embodiment, the truncated GAA polypeptide has 1 to 75 consecutive amino acids deleted at its N-terminal end compared to the parent GAA polypeptide, in particular 6, 7, 8, 9, 10, 40, 41, 42, 43, 44, 45 or 46 consecutive amino acids deleted at its N-terminal end compared to the parent GAA polypeptide, even more in particular 8, 42 or 43 consecutive amino acids deleted at its N-terminal end compared to the parent GAA polypeptide. In a particular embodiment, the parent polypeptide is human GAA (hGAA), in particular hGAA having the amino acid sequence shown in SEQ ID NO: 14 or SEQ ID NO: 15, in particular SEQ ID NO: 14, or hGAA that is a functional variant of hGAA having the amino acid sequence shown in SEQ ID NO: 14 or SEQ ID NO: 15, in particular SEQ ID NO: 14. In a further embodiment, the truncated GAA polypeptide has the amino acid sequence shown in SEQ ID NO: 16. The signal peptide fused to the truncated GAA polypeptide may be the natural signal peptide of GAA shown in SEQ ID NO: 17, or an alternative signal peptide selected from SEQ ID NO: 18 to 21, in particular the signal peptide of SEQ ID NO: 18. In a specific embodiment, the truncated GAA polypeptide has SEQ ID NO: 16 and is fused to the signal peptide of SEQ ID NO: 18 (the polypeptide is also referred to as "highly secretable GAA protein" or "sp7-Δ8-co" or "sec-hGAA" in this application). These truncated forms of GAA are disclosed in application PCT / EP2017 / 072944.

[0249] The method of administration of the carrier of the present invention includes, but is not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, local area administration and oral routes described in WO2015158924. In a specific embodiment, the administration is by intravenous or intramuscular route. The carrier of the present invention can be administered by any convenient route, such as by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (such as oral mucosa, rectal and intestinal mucosa, etc.), and can be administered together with other bioactive agents. Administration can be systemic or local.

[0250] In certain embodiments, it may be desirable to administer the pharmaceutical compositions of the invention locally to an area in need of treatment, such as the liver or muscle. This can be achieved, for example, using an implant that is a porous, non-porous or gel-like material, including membranes such as silicone rubber membranes or fibers.

[0251] The amount of the vector of the present invention that is effective in the treatment of the disorder to be treated can be determined by standard clinical techniques. In addition, in vivo and / or in vitro assays can optionally be used to help predict the optimal dosage range. The precise dose used in the formulation also depends on the route of administration and the severity of the disease, and should be determined according to the judgment of the practitioner and the circumstances of each patient. The dosage of the vector of the present invention administered to a subject in need varies with several factors, including but not limited to the route of administration, the specific disease being treated, the age of the subject, or the expression level necessary to obtain a therapeutic effect. A person skilled in the art can readily determine the dosage range required based on these and other factors based on the knowledge in the art. In the case where the treatment comprises administering an AAV vector to a subject, a typical dose of the vector is at least 1x10 8 vector genomes per kilogram body weight (vg / kg), for example at least 1x10 9 vg / kg, at least 1x10 10 vg / kg, at least 1x10 11 vg / kg, at least 1x10 12 vg / kg, at least 1x10 13 vg / kg, at least 1x10 14 vg / kg or at least 1x10 15 vg / kg.

[0252] In certain embodiments, the vectors of the invention can be administered at lower doses than typical doses used in gene therapy. In particular, in a therapy comprising administering an AAV vector to a subject in need thereof, the vector can be administered at a dose that is at least 2 times lower than the typical dose described above, and in particular at a dose that is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or even at least 50 times lower than the typical AAV dose commonly used in gene therapy. In a specific embodiment, this lower dose reduction is used to treat LSD, in particular Pompe disease. In other specific embodiments, the lower dose is used with an AAV vector comprising a hybrid regulatory element according to the present invention, comprising a first regulatory element capable of driving or enhancing liver-selective expression and a second regulatory element capable of driving or enhancing muscle-selective expression, in particular comprising (i) an ApoE enhancer in combination with a hAAT promoter and (ii) a spC5.12 promoter. Example

[0253] Materials and methods

[0254] GAA expression cassette and AAV vector

[0255] The GAA transgene expression cassette used in this study contained a codon-optimized human GAA (hGAA) coding sequence [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)]. Codon optimization was performed using a commercial algorithm (Thermo Fisher Scientific) [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)]. There were two types of hGAA transgenes used: 1. hGAA, which encodes native hGAA protein (hGAA); or 2. sec-hGAA, which encodes an engineered highly secretable GAA with a heterologous signal peptide and a deletion of 8 amino acids in the propeptide (sp7-Δ8-hGAAco, abbreviated in the text as sec-hGAA) [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)]. The transgenic sequence was cloned into the AAV vector backbone under the transcriptional control of apolipoprotein E (hepatocyte control region enhancer) and human α1-antitrypsin (hAAT) promoter, SPc5.12 promoter or CMV enhancer / chicken β-actin promoter (CAG). All DNA sequences used in this study were synthesized by GeneCust or Thermo Fisher Scientific.

[0256] The AAV vectors used in this study were produced as described using an adenovirus-free transient transfection method for HEK293 cells [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)]. The titer of AAV vector stocks was determined using quantitative real-time PCR (qPCR) and SDS-PAGE followed by SYPRO Ruby protein gel staining and band densitometry. All vector preparations used in this study were quantified side by side before use. Primers used for qPCR on the AAV genome annealed to BGH polyA (Fw: tctagttgccagccatctgttgt (SEQ ID NO: 8); Rev: tgggagtggcaccttcca (SEQ ID NO: 9) and codon-optimized hGAA (Fw: agatacgccggacattggactg (SEQ ID NO: 10); Rev: gcacgcccagcagattgaac (SEQ ID NO: 11)). The AAV serotypes used were AAV8 and AAV9 which show similar transduction properties after systemic administration to mice (Zincarelli et al., Mol Ther. 2008 Jun; 16(6): 1073-80).

[0257] In vitro experiments

[0258] Human hepatoma cells (HuH7), mouse myoblast C2 cells (C2), and mouse NSC34 cells were seeded in 6-well plates (5 x 10 5 Cells / well) were added and transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer's instructions. 72 hours after transfection, cells and conditioned medium were harvested and analyzed for GAA activity and Western blot. Human skeletal myoblasts (CSC-C3196, Creative Bioarray) were seeded on collagen-coated 12-well plates and transfected with AAV9-hGAA or AAV9-EGFP vectors at 2×10 5 After infection, cells were maintained in Creative Biosystems supplemented with 10% fetal bovine serum and human fibroblast growth factor-2 (FGF-2, Miltenyi Biotec). The cells were cultured in the skeletal muscle cell growth medium kit (Creative Bioarray). The infection was repeated twice, each for 48 hours; cells were harvested 48 hours after the second infection.

[0259] Mouse studies

[0260] Wild-type C57BL / 6 mice were purchased from Charles River (Charles River, France). Gaa- / - mice were generated by targeted disruption of exon 6 (Raben N. et al., J Biol Chem. 1998 Jul 24; 273(30): 19086-92). C57BL / 6J / 129X1 / SvJ background (Figures 5, 6, 8, 9, 10, 11, 12, 13, 16, 17, 18) or DBA / 2J C57 background (Figures 5, 6, 8, 9, 10, 11, 12, 13, 16, 17, 18) were used. Figure 7 , 8 , 14, 15). Male littermates of affected Gaa- / - and unaffected Gaa+ / + mice were used. AAV vectors were delivered to: 1. adult mice, via the tail vein in a volume of 0.2 ml; 2. neonatal mice on days 1-2 after birth, via the temporal vein in a volume of 0.03 ml. The size of the experimental groups allowed statistical analysis; all animals were included in the analysis and no outliers were excluded. Mice were randomly assigned to experimental groups, and operators performing vector delivery and functional analysis were blinded to the identity of the groups. For the immuno-eradication study, 14 mice were treated by intravenous injection of rhGAA at a dose of 20 mg / kg every two weeks for a total of 3 administrations. As previously described, each rhGAA infusion was performed 15 minutes after intraperitoneal administration of 25 mg / kg antihistamine (benadryl hydrochloride). Anti-hGAA IgG was measured 2 weeks after the last rhGAA administration. Immunized Gaa- / - mice (n=8) were assigned to three AAV9 treatment groups (2×10 12 vg / kg; AAV-Ctrl n=2, AAV-hAAT n=3, AAV-LiMP ​​n=3).

[0261] GAA activity

[0262] GAA activity was measured in mouse plasma (1 / 1000-1 / 2000 dilution) and tissues. Snap-frozen tissues were placed in a dual UltraPure TMHomogenize in DNase / RNase-free distilled water (Thermo Fisher Scientific). Weigh out 50-100 mg tissue and homogenize, then centrifuge at 10000 x g for 20 minutes to collect supernatant. Use 10 μ l sample (plasma or tissue homogenate) and 20 μ l substrate 4MU α-D-glucoside to set up enzyme reaction in 96-well plates. The reaction mixture was incubated at 37 ° C for 1 hour, and then the reaction was terminated by adding 150 μ l sodium carbonate buffer of pH 10.5. Using EnSpireα plate reader (Perkin-Elmer), at 449 nm (emission) and 360 nm (excitation), a standard curve (0-2500 pmol / μl of 4MU) was used to calculate the fluorescence 4MU released from each reaction mixture. The protein concentration of the clarified supernatant was quantified by BCA (Thermo Fisher Scientific). In order to calculate GAA activity, the concentration of 4MU released was divided by the sample protein concentration, and the activity was reported as nmol / hour / mg protein.

[0263] Vector genome copy number analysis

[0264] DNA was extracted from tissue homogenates and quantified using Nucleospin 8 (Macherey-Nagel, France). Vector genome copy number was determined by qPCR using 100 ng DNA, primers annealing on codon-optimized hGAA and probes (Fw: agatacgccggacattggactg (SEQ ID NO: 10); Rev: gcacgcccagcagattgaac (SEQ ID NO: 11); probe gtgtggtcctcttgggagc (SEQ ID NO: 12)). Sybergreen or Taqman systems were used as previously described [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)]. VGCN was normalized to the number of milligrams of DNA used in qPCR. To quantify VGCN per diploid genome, DNA was extracted from tissue homogenates and quantified using the GentraPuregene tissue kit (Qiagen).

[0265] RNA extraction and expression analysis

[0266] The quick-frozen tissue was weighed and 50-100 mg was homogenized in Trizol reagent (Thermo Fisher Scientific). Total RNA was extracted from the tissue homogenate using the PureLink RNA Mini Kit and PureLink DNAse Set (Thermo Fisher Scientific). RNA was quantified and 2-5 μg was reverse transcribed into cDNA using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR and dsDNase (Thermo Scientific); RT-minus reactions were performed as negative controls. For hGAA RNA expression, cDNA was subjected to qPCR analysis using Sybergreen and primers annealing on codon-optimized hGAA (Fw: agatacgccggacattggactg (SEQ ID NO: 10); Rev: gcacgcccagcagattgaac (SEQ ID NO: 11)); primers annealing on the mouse actin gene were used to normalize hGAA expression (mActinFw: ggctgtattcccctccatcg (SEQ ID NO: 22); mActin Rev: ccagttggtaacaatgccatgt (SEQ ID NO: 23)); mouse actin and β-2 microglobulin (B2m; B2m forward: 5'-ggtctttctggtgcttgtctca-3'; B2m reverse: 5'-gttcggcttcccattctcc-3') were used to normalize hGAA expression. Fig.17 Data depicted in. For Rtl1 expression analysis, cDNA was subjected to qPCR using the TaqMan method, commercial probes and primers previously reported by Chandler and collaborators (Chandler et al., JCI, 2015 Feb; 125(2): 870-80) and Maxima ROX qPCR Master Mix (ThermoScientific). TaqMan Gene Expression Assay System (#4331182, Thermo Scientific) is as follows: Rtl1 (Mm02392620_s1); Gapdh (Mm 99999915_g1).

[0267] Western blot analysis

[0268] HuH7, C2 and NSC34 cell lysates were prepared using 10 mM PBS (pH 7.4) containing 1% Triton-X100 and protease inhibitors (Roche Diagnosis). Western blots performed on mouse plasma were performed on samples diluted 1:4 in distilled water. Mouse tissues were prepared as indicated for GAA activity. Protein concentrations were determined using the BCA protein assay (Thermo Fisher Scientific). SDS-page electrophoresis was performed in 4-15% gradient polyacrylamide gels. SDS-page electrophoresis was performed in 4-15% gradient polyacrylamide gels. After transfer, the membrane was blocked with Odyssey buffer (Li-Cor Biosciences) and incubated with anti-GAA antibody (mouse monoclonal, SantaCruz Biotechnology, or rabbit monoclonal, Abcam), anti-eGFP antibody (mouse monoclonal, Santa Cruz) or anti-tubulin (mouse monoclonal, Sigma Aldrich), anti-p62 antibody (mouse monoclonal, Abcam), anti-Parkin antibody (rabbit polyclonal, Abcam), anti-Gapdh antibody (rabbit polyclonal, Thermo Fischer Scientific). The membrane was washed and incubated with appropriate secondary antibodies (Li-Cor Biosciences) and visualized by Odyssey imaging system (Li-Cor Biosciences).

[0269] Anti-GAA antibody test

[0270] Anti-GAA antibody measurements were performed according to published protocols. Briefly, maxisorp 96-well plates (ThermoFisher Scientific) were coated with 1 μg / ml rhGAA. An IgG standard curve was prepared by serial 1- to 2-fold dilutions of commercial mouse (Sigma Aldrich) recombinant IgG, which was coated directly on the wells in duplicate. An anti-mouse (Southern biotech) IgG secondary antibody was used as the secondary antibody.

[0271] Functional assessment

[0272] Grip strength was measured as reported. Using a grip dynamometer (Columbus instruments), three independent measurements of limb strength were calculated. The average grip strength of each mouse was calculated.

[0273] Respiratory function during quiet breathing was assessed according to reported methods [DeRuisseau et al., PNAS, 2009]. Briefly, respiratory patterns were measured in treated Gaa- / - mice and controls using a flow-through (0.5 L / min) plethysmograph (EMKA technologies). Prior to data collection, the instrument was calibrated with known air flow and pressure signals. Signals were analyzed using IOX2 software (EMKA technologies). Animals were allowed to acclimate to the environment in the plethysmograph chamber prior to testing. During both acclimatization and data acquisition, mice breathed in normoxic air (21% O2, 79% N2).

[0274] result

[0275] 1. Cloning of multi-tissue promoters in AAV plasmids

[0276] We selected basic single-tissue transcriptional regulatory elements from the literature to evaluate the possibility of generating multi-tissue promoters.

[0277] For the liver , we selected the hepatocyte-restricted apolipoprotein (ApoE) enhancer (SEQ ID NO: 4) and the human alpha-1 antitrypsin (hAAT) promoter (SEQ ID NO: 2).

[0278] For muscles , we chose to synthesize the spC5.12 muscle-selective promoter (SEQ ID NO: 1).

[0279] For neurons , we selected the pan-neuronal human synapsin (hSYN) promoter (SEQ ID NO: 3).

[0280] Based on these transcriptional regulatory elements, we generated three different multi-tissue promoters ( Figure 1 ).

[0281] Liver enhanced-muscle promoter (referred to as Enh.C5.12), SEQ ID NO: 5

[0282] This promoter was generated by cloning the ApoE hepatocyte control region / enhancer upstream of the synthetic spC.12 muscle-selective promoter.

[0283] Liver-muscle promoter (LiMP), SEQ ID NO: 6

[0284] This promoter was generated by cloning the ApoE hepatocyte control region and the hAAT promoter upstream of the synthetic spC5.12 muscle-selective promoter.

[0285] Liver-neuronal promoter (LiNeuP), SEQ ID NO: 7

[0286] This promoter was generated by cloning the ApoE hepatocyte control region and the hAAT promoter upstream of the hSYN promoter.

[0287] The codon-optimized human GAA transgene (hGAA) was cloned into all expression cassettes ( Figure 1 and Table 1). Two versions of hGAA were used: the native version and an engineered highly secretable version with a heterologous signal peptide (sp7-Δ8-co, referred to as sec-hGAA; Table 1) [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)]. An improved synthetic human β-globin-derived (HBB2.1) intron was inserted between the promoter and the GAA transgene to stabilize the transgene mRNA (Ronzitti et al., Molecular therapy Methods & clinical development. 2016; 3: 16049). The HBB2 intron was exchanged with a short SV40 intron in the LiMP and LiNeuP expression cassettes (Trapani et al., EMBO molecular medicine. 2014; 6 (2): 194-211) to fit the AAV DNA packaging restrictions (Table 1).

[0288] Table 1. List of all GAA expression cassettes used

[0289]

[0290] 2. Evaluation of multi-tissue promoters in cell lines

[0291] First, we tested the multi-tissue promoter in vitro in cell lines and compared it with the basic single tissue promoter (Figures 2-3). A highly secretable version of the GAA transgene was used as a model therapeutic gene [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)].

[0292] We evaluated the ability of the Enh.C5.12 and LiMP hybrid liver-muscle promoters to drive expression of sec-hGAA in both hepatocyte and muscle cell lines ( Figure 2A For this purpose, we transiently transfected the HuH7 human hepatocyte cell line ( Figure 2A ) and C2 mouse myoblast cell line ( Figure 2BWe then assessed GAA enzyme activity in the cell culture medium and protein expression in cell lysates by Western blot analysis (Figure 2). In hepatocytes, the intact liver-muscle promoter LiMP (hAAT+C5.12) but not Enh.C512 showed significantly higher activity compared to C5.12 ( Figure 2A ). Compared with C5.12, Enh.C512 (ApoE + C5.12) actually provided a small but insignificant increase in enzyme activity ( Figure 2A In muscle cells, both LiMP and Enh.C5.12 showed significantly higher activity than both C5.12 and hAAT ( Figure 2A These characteristics make LiMP a good candidate for strong expression of liver-muscle transgenes. It is noteworthy that the enhanced transcriptional activity we found in muscle cells using Enh.C5.12 and LiMP was significantly increased based on the combination of a muscle-selective promoter (spC5.12) and a hepatocyte-selective regulatory element (ApoE / hAAT). Figure 2B ) was unexpected. We then evaluated the ability of the liver-neuron LiNeuP promoter (hAAT+hSYN) to drive sec-hGAA expression in both hepatocytes and neuronal cell lines. For this purpose, we transiently transfected HuH7 hepatocytes and NSC34 mouse neuronal cell lines (spinal cord neuron x neuroblastoma hybrid cell line) (Figure 3). In hepatocytes, we found that LiNeuP produced significant enzymatic activity in the culture medium and produced significant protein amounts in the lysate ( Figure 3A In neuronal cells, LiNeuP produced significant enzyme activity in the culture medium ( Figure 3B ) and produced significant GAA protein expression in cell lysates ( Figure 3B ). Thus, LiNeuP can induce expression in both hepatocytes and neurons, whereas each of the individual promoters contained in this new hybrid promoter can only drive expression in hepatocytes (for hAAT) or neurons (for hSYN). In summary, the ability of LiNeuP to drive efficient expression of transgenic genes in both hepatocytes and neurons makes it a promising hybrid hepatic-neuronal promoter.

[0293] 3. Evaluation of multi-tissue promoters in animal models

[0294] To evaluate the tissue selectivity and tolerogenicity properties of the Enh.C5.12, LiMP, and LiNeuP promoters in vivo, we generated AAV vectors and performed gene transfer in the C57Bl / 6 mouse model and in a mouse model of Pompe disease.

[0295] I. Evaluation of promoter activity after systemic AAV gene transfer in wild-type B6 mice.

[0296] In order to evaluate the ability of newly generated Enh.C5.12, LiMP and LiNeuP promoters to drive expression in different tissues, as designed, we have produced an AAV vector of serotype 9, which can infect liver, muscle and neurons after intravenous administration to animal models. We use native human GAA (hGAA) as a transgene, which is a codon-optimized full-length GAA. In this study, we compared the ubiquitous CAG promoter, single tissue promoter (hAAT, C5.12 and hSYN) and our multi-tissue promoter (Enh.C5.12, LiMP and LiNeuP, Table 2). This study provides data on the ability of these promoters to provide hGAA to the circulation and the activity of all promoters in the desired tissues (liver, heart, quadriceps, spinal cord and brain).

[0297] One month after intravenous injection of AAV9 vectors encoding native GAA, circulating GAA protein was very low or barely detectable using the C5.12 and hSYN promoters, whereas it was clearly detected using the multi-tissue promoters Enh.C5.12, LiMP, and LiNeuP promoters ( Figure 4A Results Among the promoters generated to provide hGAA protein to the circulation for therapeutic cross-correction, LiMP and LiNeuP were the best performing hybrid promoters ( Figure 4A ).

[0298] Mouse tissues were collected from treated mice 6 weeks after treatment for RNA expression analysis ( Figure 4B hGAA RNA expression was assessed in liver, myocardium (heart), skeletal muscle (quadriceps), and CNS (spinal cord and brain). hGAA expression was normalized to that of a reference mouse gene (actin). Figure 4B The relative expression of hGAA mRNA in all tissues analyzed is shown. As observed in vitro ( Figure 2A -B), the hAAT promoter is active in liver but not in muscle (heart and quadriceps), while the C5.12 promoter is active in muscle but not in liver. Notably, we found that the multi-tissue promoter LiMP was able to drive efficient transgene expression in both liver and muscle, indicating that it is a hybrid liver-muscle promoter ( Figure 4B ). In contrast, the Enh.C5.12 promoter was able to drive high expression in muscle but low expression in liver. In fact, in liver, Enh.C5.12 provided significantly lower transgene expression compared to hAAT and slightly higher but not significant expression compared to the C5.12 promoter ( Figure 4B ). Therefore, when strong expression in muscle and weak expression in liver is required, Enh.C5.12 can be used. As we observed in vitro (Figure 3), the liver-neuronal promoter LiNeuP is able to drive high expression of GAA in both liver and CNS ( Figure 4B Importantly, we confirmed that the basal hAAT and hSYN promoters were inactive in the CNS and liver, respectively ( Figure 4B ). Notably, the tissue selectivity of LiMP and LiNeuP was preserved, as they remained inactive in neurons and muscles, respectively ( Figure 4B ). Overall, the hGAA transgene expression data clearly demonstrate the generation of a hybrid promoter capable of driving transgene expression selectively in multiple tissues. As expected, analysis of vector genome copy number (VGCN) in the analyzed tissues showed that most AAV vectors transduced to the liver after intravenous injection into mice (Zincarelli et al., Mol Ther. 2008 Jun; 16(6): 1073-80). No significant differences in VGCN were observed between the different vectors ( Figure 4B ).

[0299] Table 2. Promoters evaluated in vivo in Study I

[0300]

[0301] II. Evaluation of the activity and tolerogenic properties of liver / muscle promoters after systemic AAV gene transfer in a mouse model of Pompe disease (Gaa- / -).

[0302] In this study, we compared the expression of both native (hGAA) and highly secretable (sec-hGAA) GAA proteins driven by single tissue promoters of liver and muscle (hAAT and C5.12) with our multi-tissue liver + muscle promoters (Enh.C5.12, LiMP) (Table 3). Gaa- / - mice were used to model the pathophysiology of Pompe disease. We and others have previously reported that the expression of native GAA in Gaa- / - muscle induced a strong humoral immune response against the protein [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)], Zhang et al., Hum Gene Ther. 2012 May; 23 (5): 460-72). Subsequently, we recently reported that the immunogenicity of highly secretable GAA proteins was lower than that of native GAA [Puzzo & Colella et al., Sci Transl Med. 2017 Nov 29; 9 (418)]. Thus, this study provides data on the tolerogenic properties of the newly developed hybrid liver-muscle promoters (Enh.C5.12 and LiMP) in the context of high and low immunogenicity provided by native and highly secretable forms of GAA, respectively. The ability of the promoters to provide GAA in the circulation for therapeutic purposes was also evaluated. When we delivered AAV expressing the immunogenic native GAA protein (hGAA) to Gaa- / - mice, we observed that the promoters C5.12 and Enh.C5.12 ( Figure 4B ) drives GAA expression, leading to a humoral immune response against the protein ( Figure 5A ). Notably, the use of the hybrid liver-muscle LiMP promoter significantly prevented the induction of anti-hGAA immune responses ( Figure 5A These data demonstrate the robust hepatic expression of GAA provided by LiMP (as reported in Study 1, Figure 4B ) induced immune tolerance against hGAA ( Figure 5A GAA enzyme activity in mouse plasma confirmed that the hybrid Enh.C5.12 and LiMP promoter provides higher GAA protein levels to the circulation compared with C5.12 for therapeutic purposes ( Figure 5B ).

[0303] Next, we tested whether AAV gene transfer using the LiMP promoter could eradicate pre-existing humoral immune responses against the transgene, as muscle is a highly immunogenic tissue. To this end, we immunized Gaa- / - mice with three intravenous injections of recombinant human GAA (rhGAA) at a dose of 20 mg / kg. Figure 6A). Subsequently, two weeks later, we measured anti-GAA IgG in plasma and treated the immunized mice with AAV9-LiMP-hGAA vector delivered intravenously ( Figure 6 B). AAV9-hAAT-hGAA vector was used as a tolerogenicity control. 12 Six weeks after administration of 100 vg / kg, anti-hGAA IgG was significantly reduced in mice treated with LIMP and hAAT vectors, but not with a control AAV vector expressing luciferase ( Figure 6 B).

[0304] Collectively, these results demonstrate that AAV gene transfer using dual promoters with strong hepatic expression components results in dominant immune tolerance of the transgene.

[0305] Table 3. Promoters evaluated in vivo in Study II

[0306]

[0307] III. Evaluation of the tolerogenic properties and therapeutic efficacy of hybrid liver-muscle and liver / neuronal promoters in adult Gaa- / - mice by systemic AAV gene transfer.

[0308] Based on our previous data (Figures 2-5), in this study we tested the advantages of using the best-performing tolerogenic multi-tissue promoters (LiMP and LiNeuP) to rescue the systemic disease phenotype of Gaa- / - mice. Specifically, we evaluated the therapeutic efficacy of AAV vectors expressing highly secretable GAA protein (sp7-Δ8-co, referred to as sec-hGAA) under the control of the liver-selective hAAT promoter, the liver-muscle LiMP promoter, and the liver-neuron LiNeuP promoter (Table 4). AAV vectors expressing sec-hGAA under the control of the ubiquitous CAG promoter were used as controls. In the case of Pompe disease, secretable GAA expressed from the liver into the circulation will allow targeting to other tissues by protein uptake. However, GAA uptake in skeletal muscle and neurons is limited by the following factors: 1. Low levels of GAA receptors on the cell surface, and 2. Autophagy blockade that impairs GAA targeting to lysosomes; then, the size restrictions imposed by the blood-brain barrier significantly limit the biodistribution of GAA to the CNS.

[0309] Based on our results reported above, we anticipate that by co-expressing GAA in the liver and other affected tissues, we will achieve higher therapeutic efficacy than targeting the liver alone. Importantly, we showed in Study III that liver targeting provided immune tolerance to the expressed GAA transgene due to our novel multi-tissue promoter (see Figure 5AIn Study III, analysis of circulating sec-hGAA protein levels and humoral immune responses to GAA confirmed that the LiMP and LiNeuP promoters provided comparable GAA levels compared to hAAT in the absence of a humoral immune response ( Figure 7 , above)( Figure 7 , anti-GAA IgG levels are indicated below the western blot photographs). Notably, a strong immune response against GAA was observed when the ubiquitous CAG promoter was used ( Figure 7 , upper panel). The CAG promoter also provides significantly less circulating GAA than hAAT, LiMP, and LiNeuP ( Figure 7 , lower figure). These data demonstrate that the hybrid liver-based multi-tissue promoter according to the present invention is superior to the ubiquitous promoter. It is noteworthy that ubiquitous GAA expression driven by the CAG promoter that also causes expression in the liver does not necessarily lead to immune tolerance to the transgene product, and the plasma of all mice receiving the LiMP and LiNeuP driven GAA vectors did not contain detectable anti-GAA IgG. The above results surprisingly show that carefully selected multi-tissue selective promoters cause transgene expression in several tissues of interest and induce immune tolerance, which is in contrast to the results that can be achieved using muscle selective promoters or ubiquitous promoters.

[0310] On the basis of these promising results, we then evaluated the therapeutic efficacy of AAV vectors expressing sec-hGAA under the control of the LiMP and LiNeuP promoters in Gaa- / - mice. Circulating GAA enzyme activity confirmed that GAA was expressed from all tested AAV vectors ( Figure 8 A). Compared with unaffected Gaa+ / + mice (Ctrl, Figure 8 Muscle strength was significantly reduced in untreated Gaa- / - mice compared with (Ctrl, Figure 8 B). Notably, Gaa- / - mice treated with AAV-sec-hGAA gene therapy using LiMP and LiNeuP showed no significant differences in muscle strength compared to unaffected Gaa+ / + ( Figure 8 B). Of note, compared with untreated Gaa- / - mice (Ctrl, Figure 8 Significant rescue was also observed in Gaa- / - mice treated with AAV-LiNeuP vectors compared to untreated Gaa- / - mice (Ctrl). Respiratory function was significantly improved in Gaa- / - mice treated with AAV expressing sec-hGAA under the control of LiMP and LineUP promoters compared to untreated Gaa- / - mice (Ctrl) and was comparable to Gaa+ / + animals ( Figure 8 C, D).

[0311] Table 4. Promoters evaluated in vivo in Study III

[0312]

[0313]

[0314] IV. Evaluation of the therapeutic efficacy of liver / muscle promoter LiMP by systemic AAV gene transfer in neonatal Gaa- / - mice.

[0315] In this study, we tested the advantages of using the liver-muscle tolerogenic multi-tissue promoter LiMP to determine whether sustained GAA expression and therapeutic efficacy can be achieved under conditions that may lead to dilution of the AAV genome and therapeutic efficacy from the liver [Wang et al., Hum Gene Ther. 2012 May; 23(5): 533-9]. To this end, we injected Gaa- / - mice with AAV vectors, mimicking the treatment of Pompe disease subjects in the early postnatal stage. Therapeutic intervention in the first month of life is an important medical need for PD subjects who manifest the infantile form of the disease [infant-onset PD (IOPD)] [Chien et al., Pediatr Neonatol. 2013 Aug; 54(4): 219-27]. Of note, newborn screening for PD has been approved in many countries and can facilitate timely therapeutic intervention. Specifically, we evaluated here the advantages of expressing a highly secretable GAA protein (sp7-Δ8-co, referred to as sec-hGAA) from a single tissue promoter [muscle (C5.12) and liver (hAAT)] compared to the LiMP promoter (Table 5), which provides GAA expression in both liver and muscle (as observed in Study I, Figure 4B ) and provide therapeutic enzymes to the circulation (Study I, Figure 4A ).

[0316] Analysis of circulating GAA protein 3 months after treatment of neonatal Gaa- / - mice with the AAV-sec-hGAA vector showed that similar amounts of protein were obtained using the hAAT and LiMP promoters, consistent with the effects of hepatic proliferation on both AAV genomes ( Fig. 9 ). It is noteworthy that the circulating GAA provided by the muscle promoter C5.12 is significantly lower than that provided by the hAAT and LiMP promoters ( Fig. 9 AB). GAA activity in cardiac and skeletal muscle was also significantly higher in the heart, diaphragm, triceps, and quadriceps of Gaa- / - mice treated with AAV-LiMP ​​compared with AAV-C5.12 or AAV-hAAT vectors ( Fig. 9CF). Notably, the amount of therapeutic GAA protein was significantly higher in the muscles (e.g., triceps) and CNS (spinal cord) of Gaa- / - mice treated with the LiMP vector compared to the C5.12 and hAAT vectors ( Fig.10 AB). Compared with Gaa- / - mice treated with C5.12 vector, ( Fig.10 C) significantly higher GAA protein. This result reflects the heterozygous transcriptional activity of the LiMP promoter, which allows transgene expression from the liver ( Fig.10 D), used for cross-calibration with endogenous transgene expression in muscle ( Fig.10 E). It is noteworthy that since hAAT and LiMP carriers provide similar amounts of enzyme to the circulation ( Fig. 9 AB), so in muscle ( Fig.10 A) and spinal cord ( Fig.10 The higher expression achieved with LiMP in B) is a result of endogenous transgene expression in muscle ( Fig.10 E). Importantly, muscle strength was significantly preserved in Gaa- / - mice solely by treatment with AAV encoding sec-hGAA under the control of the LiMP promoter ( Fig.11 This is the result of GAA secretion into the circulation ( Fig. 9 AB), and high GAA expression in muscle ( Fig. 9 CDF and Fig.10 A) can only be achieved by using the hybrid LiMP promoter but not by using the single tissue C5.12 and hAAT promoters.

[0317] It has been previously reported that systemic AAV gene transfer to neonatal mice causes a portion of the vector genome to integrate into liver genomic DNA (Chandler et al., JCI, 2015 Feb; 125(2): 870-80). Only when the CAG and TBG but not the hAAT promoters were used, most integration occurred in a mouse-specific genomic hotspot (Rian locus), promoting liver genotoxicity and the development of hepatocellular carcinoma (HCC) (Chandler et al., JCI, 2015 Feb; 125(2): 870-80). This is due to the strong transactivation activity of the CAG and TBG promoters, which induce upregulation of the HCC-associated Rtl1 gene close to Rian (Chandler et al., JCI, 2015 Feb; 125(2): 870-80). Notably, we found that Rian RNA was not upregulated in Gaa- / - mice treated with AAV-LiMP ​​vectors as neonates compared to both untreated and AAV-hAAT-treated Gaa- / - mice ( Fig.12No significant Rtl1 transactivation was observed in Gaa- / - mice treated with AAV-C5.12 vectors compared with untreated Gaa- / - mice ( Fig.12 ). Therefore, the use of the hAAT promoter in our hybrid LiMP and LiNeUP promoters and the C5.12 promoter in LiMP provides additional advantageous features to our hybrid regulatory elements for in vivo gene therapy.

[0318] Subsequently, unlike the ubiquitous promoter, the present invention prevents ectopic transgene expression in tissues that do not physiologically express the therapeutic transgene of interest or do not need to express the transgene of interest. Therefore, the present invention can also prevent the possible toxicity reported recently in preclinical studies in non-human primates treated by systemic delivery of AAV vectors injected at high doses and containing the ubiquitous chicken β-actin promoter (Hinderer et al., Hum Gene Ther. 2018 Feb 12.).

[0319] Table 5. Promoters evaluated in vivo in Study IV

[0320]

[0321] V. Evaluation of the ability of liver / muscle promoter LiMP to provide sustained therapeutic efficacy in neonatal Gaa- / - mice at low vector doses.

[0322] Next, we investigated whether AAV gene therapy using the LiMP-sec-hGAA vector in neonatal Gaa- / - mice could produce therapeutic efficacy at low vector doses [1.2x10 10 vg / cub(6x10 12 vg / kg); Fig.13 At the end of the study (4 months after treatment), there was no difference in the amount of enzyme in the bloodstream of Gaa- / - mice treated with LiMP and hAAT vector ( Fig.13 AB). Analysis of hGAA RNA expression in the liver also showed no significant difference between the LiMP and hAAT promoters. In contrast, in the hearts of Gaa- / - mice treated with LiMP, compared with hAAT, Fig.13 C) Diaphragm ( Fig.13 D), quadriceps (data not shown), and triceps ( Fig.13 E). The use of the LiMP promoter also increased the GAA activity in the triceps (as a representative muscle) and spinal cord ( Fig.13 F) produced greater amounts of hGAA protein. No differences in brain hGAA levels were found when the LiMP and hAAT promoters were used ( Fig.13 G).

[0323] Compared with both untreated (Ctrl) and hAAT-treated Gaa- / - mice, after treatment with LiMP vector, there was a significant decrease in the heart ( Fig.13 H) diaphragm ( Fig.13 I), quadriceps (data not shown) and triceps ( Fig.13 Compared with untreated Gaa- / - mice (Ctrl), a significant reduction in glycogen was observed in the spinal cord and brain in all AAV-treated Gaa- / - mice, although the levels were still different from those in unaffected Gaa+ / + ( Fig.13 K). Notably, cardiac hypertrophy was observed only in Gaa- / - mice treated with LiMP vector compared with untreated Gaa- / - mice ( Fig.13 L) and muscle strength ( Fig.13 VGCN in liver and quadriceps muscle showed similar levels of tissue transduction (data not shown).

[0324] No IgG against hGAA was detected in the plasma of AAV-treated Gaa- / - mice analyzed monthly by ELISA assay (Table 6).

[0325] Table 6:

[0326]

[0327] a AAV dose: 6x10 12 vg / kg(1.2x10 10 vg / cub)

[0328] c Mean ± SD

[0329] b Number of mice

[0330] As observed in Gaa- / - mice treated with AAV8 vectors ( Fig.12 ), no significant transactivation activity on the Rtl1 oncogene was observed in the liver of Gaa- / - mice treated with AAV9 vectors containing the hAAT or LiMP promoter compared with untreated Gaa- / - mice.

[0331] Overall, these results show that the dual liver-muscle promoter LiMP allows superior therapeutic efficacy compared to the hAAT promoter following systemic AAV liver gene therapy at low doses in neonatal animals.

[0332] VI. In newborn Gaa- / - mice, the level of GAA supplied to muscle by the liver / muscle promoter LiMP was no different from that of the strong ubiquitous promoter after systemic AAV gene transfer.

[0333] In this study, we evaluated the amount of GAA delivered to muscle using the liver-muscle LiMP and liver-neuron LiNeuP promoters compared to a strong ubiquitous promoter after systemic AAV gene transfer in newborn Gaa- / - mice. As shown above, in this setting, hepatocyte proliferation causes dilution of the AAV genome from the liver and therapeutic efficacy [Wang et al., Hum Gene Ther. 2012 May; 23(5): 533-9]. We injected Gaa- / - mice with an AAV vector encoding a highly secretable GAA protein (sp7-Δ8-co, referred to as sec-hGAA) from the ubiquitous promoter CAG [CMV enhancer / chicken β-actin promoter (CAG) promoter] and compared it with the LiMP and LiNeuP promoters (Table 7); a single liver promoter hAAT was used as a control (Table 7).

[0334] Four months after neonatal Gaa- / - mice were treated with AAV-sec-hGAA vector, skeletal muscle (triceps, Fig.14 Analysis of GAA protein in the muscle showed that similar amounts of protein were obtained using the CAG and LiMP promoters, which were both higher than those obtained using hAAT and LiNeuP. This is consistent with the effect of liver proliferation on the AAV genome (which was significantly lost after growth in mice) and the lack of transcriptional activity of hAAT and LiNeuP in muscle ( Fig.14 ) are consistent.

[0335] Table 7. Promoters evaluated in vivo in Studies VI and VII.

[0336]

[0337] VII. The liver / muscle promoter LiMP normalizes autophagy and mitophagy in the muscle of Gaa- / - mice after neonatal AAV gene transfer.

[0338] In the present study, we evaluated the normalization of p62 (a marker of autophagy blockade) and Parkin (a marker of mitochondrial autophagy) in the muscles of Gaa- / - mice treated as neonates by systemic AAV gene transfer. For this purpose, we injected Gaa- / - mice with an AAV vector encoding a highly secretable GAA protein (sp7-Δ8-co, referred to as sec-hGAA) from the liver-muscle promoter LiMP and compared it with the single liver promoter hAAT. As expected from the data reported above, GAA protein was higher in the triceps of mice treated with LiMP compared with hAAT 4 months after treatment of neonatal Gaa- / - mice ( Fig.15 AB). Second, p62 was increased in the triceps of untreated Gaa- / - mice compared with unaffected Gaa+ / +, reflecting a blockade of autophagy ( Fig.15 C). Notably, p62 levels were restored to normal in the triceps of Gaa- / - mice treated with LiMP but not with hAAT vector ( Fig.15 A, C). In contrast, the amount of Parkin protein was significantly reduced in the triceps of untreated Gaa- / - mice compared with unaffected Gaa+ / + ( Fig.15 A, D), reflecting impaired mitochondrial autophagy. Notably, the amount of Parkin in the triceps of Gaa- / - mice returned to normal after treatment with the LiMP vector but not the hAAT vector ( Fig.15 A, D).

[0339] Fig.15 and 16 Analysis of vector genome copy number (VGCN) in liver and triceps of mice depicted in Figure 2 showed no significant differences, with the exception of the CAG vector, for which there was a significantly higher VCGN in liver ( Fig.16 AB).

[0340] VIII. Specificity of LiMP and LiNeuP Promoters in Mice Following Systemic AAV Gene Therapy

[0341] The specificity of the liver-muscle promoter LiMP and the liver-neuron promoter LiNeuP was confirmed by the low or no activity observed in non-target tissues such as kidney, lung and spleen ( Fig.17 AB). In the lung, some detectable hGAA mRNA expression observed with the LiMP promoter may result from promoter activity in smooth muscle cells ( Fig.17 B). As expected, VGCN was higher in the liver compared to other tissues ( Fig.17 CD).

[0342] Overall, the hGAA mRNA expression data showed that the hybrid promoters LiMP and LiNeuP drove efficient and specific transgene expression in target tissues ( Fig.17 ).

[0343] IX. A hybrid promoter with strong hepatic activity in Gaa- / - mice prevents the occurrence of immune responses against hGAA.

[0344] It has been reported that gene transfer of native hGAA driven by ubiquitous or muscle-specific promoters to Gaa- / - mice induced an unwanted humoral immune response against the hGAA protein [Falk et al., Mol Ther Methods Clin Dev. 2015, Mar 25; 2: 15007; Franco et al., Mol Ther. 2005 Nov; 12(5): 876-84]. In contrast, we [Puzzo et al., Sci Transl Med. 2017 Nov 29; 9(418)] and others [Franco et al., Mol Ther. 2005 Nov; 12(5): 876-84] showed that localizing the expression of the native hGAA transgene to hepatocytes prevented the development of anti-hGAA immunity and provided stable immune tolerance to the transgene product. To evaluate the immunological properties of the hybrid liver-muscle and liver-neuron promoters of the present invention, we systemically delivered AAV9 vectors encoding native hGAA into immunocompetent Gaa- / - mice (vector dose: 2×10 12 vg / kg) and evaluate the anti-hGAA humoral immune response ( Fig.18 Adult Gaa- / - mice were specifically used in these experiments because newborn animals have been reported to be more susceptible to tolerogenic responses. At early time points after treatment, high anti-hGAA IgG ( Fig.18 A). In contrast, anti-hGAA IgG ( Fig.18 A) is low or absent and significantly different from that measured in the CAG cohort ( Fig.18 A). The use of the hybrid promoters LiMP and LiNeuP prevented the long-term induction of anti-hGAA IgG ( Fig.18 B). In contrast, anti-hGAA IgG increased over time in the C5.12 cohort, resulting in significantly higher levels than those measured in the other cohorts ( Fig.18B). The reduced humoral immune response observed with Enh.C5.12 compared to C5.12 suggests improved transgene expression in the liver through use of the ApoE enhancer ( Figure 4B , liver) allows long-term reduction of anti-GAA immunity ( Figure 5A , Fig.18 Interestingly, these data suggest that hepatic transgene expression determined by the CAG and Enh.C5.12 promoters may reduce but not prevent anti-hGAA humoral immune responses ( Fig.18 AB). VGCN showed no significant effect of vector genome on liver transduction ( Fig.18 C) X. In vitro transcriptional activity of the liver / muscle LiMP promoter in human myoblasts

[0345] The transcriptional activity of the liver / muscle promoter LiMP was further confirmed in vitro in human myoblasts ( Fig.19 ).

[0346] VI. Conclusion:

[0347] In this study, we showed that hybrid regulatory elements allow for overcoming the persistence limitations of transgenic expression mediated by AAV gene transfer. Specifically, we demonstrated that in Gaa- / - mice treated as neonates, systemic AAV gene therapy using the LIMP promoter produced superior therapeutic efficacy compared to single tissue promoters (liver-specific hAAT or muscle-specific C5.12). In this model, we observed long-term complete rescue of disease phenotypes, including clearance of systemic pathological glycogen accumulation and significant rescue of cardiac hypertrophy and muscle strength. These results were obtained using AAV vector doses 10-50 times lower than those currently used in newborn animals in other studies and in ongoing clinical trials of other lethal neuromuscular diseases. These findings support the future application of this AAV gene therapy to infantile-onset Pompe disease. Based on its favorable safety and efficacy characteristics, dual promoters may provide significant advantages in the development of gene-based therapies for the treatment of several other diseases with systemic multi-organ involvement and early lethality.

Claims

1. A nucleic acid comprising: (i) a first transcriptional regulatory element capable of driving or enhancing tissue-selective expression in the liver, wherein the first transcriptional regulatory element is an ApoE enhancer, or a combination of an ApoE enhancer and an alpha-1 antitrypsin promoter (hAAT); and (ii) a second transcriptional regulatory element capable of driving or enhancing tissue-selective expression in a second tissue, wherein the second transcriptional regulatory element is the spC5.12 promoter; And wherein the first transcriptional regulatory element and the second transcriptional regulatory element are fused together.

2. The nucleic acid according to claim 1, wherein the nucleic acid comprises: (i) ApoE enhancer in combination with hAAT promoter, and (ii) spC5.12 promoter.

3. An expression cassette comprising the nucleic acid according to claim 1 or 2 and a transgenic gene of interest.

4. The expression cassette of claim 3, wherein the transgene of interest is a therapeutic transgene of interest.

5. The expression cassette of claim 4, wherein the therapeutic transgene of interest comprises acid alpha-glucosidase (GAA).

6. A vector comprising the expression cassette according to any one of claims 3 to 5.

7. The vector according to claim 6, wherein the vector is a viral vector.

8. The vector according to claim 7, wherein the viral vector is an adenoviral vector, a retroviral vector, a lentiviral vector or an AAV vector.

9. The vector of claim 8, wherein the AAV vector is an AAV vector comprising an AAV8 or AAV9 capsid.

10. An isolated cell transformed with the nucleic acid according to claim 1 or 2, the expression cassette according to any one of claims 3 to 5 or the vector according to any one of claims 6 to 9.

11. A pharmaceutical composition comprising a vector according to any one of claims 6 to 9 or a cell transformed with an expression cassette according to any one of claims 3 to 5 or a cell transformed with a vector according to any one of claims 6 to 9, wherein the transgenic gene of interest is a therapeutic transgenic gene.

12. Use of an expression cassette according to any one of claims 3 to 5, a vector according to any one of claims 6 to 9 or a cell according to claim 10 in the preparation of a medicament for treating a disorder by gene therapy through expression of a transgene of interest in a therapeutic tissue of interest, wherein the transgene of interest comprises GAA, and wherein the disorder is Pompe's disease.

13. The use according to claim 12, wherein the disorder is infantile-onset Pompe disease or late-onset Pompe disease.

14. The use according to claim 12, wherein the disorder is infantile-onset Pompe disease.

Images