Transcriptional regulation element

By tandemly aligning sequences of specific transcriptional regulatory elements in the promoter region of the vector, the problem of inefficient expression of target genes in eukaryotic cell lines is solved, and a significant expression enhancement effect is achieved.

CN120210286APending Publication Date: 2025-06-27CANTONBIO CO LTD +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510199340.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-02-22
Filing Date
2025-02-21
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the expression level of the gene of interest in eukaryotic cell lines, especially the gene of interest that is low in expression or difficult to recombinantly express.

Method used

A transcriptional regulatory element is provided that comprises specific nucleotide sequences such as RELA, NFE2I2, XBP1 or YBX1, or functional variants thereof, which enhance transcription factor binding sites to improve expression of the gene of interest by arranging these sequences in the promoter region of the vector.

Benefits of technology

By using this transcriptional regulatory element, the expression level of the target gene in eukaryotic cell lines is significantly improved and the expression efficiency is improved, especially on low-expression or difficult-to-expression genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005283209270000091
    Figure BDA0005283209270000091
  • Figure BDA0005283209270000101
    Figure BDA0005283209270000101
  • Figure BDA0005283209270000111
    Figure BDA0005283209270000111
Patent Text Reader

Abstract

The invention relates to a transcriptional regulatory element which can be used for improving the expression level of a target gene in a eukaryotic cell line, and also provides a vector containing the transcriptional regulatory element, a recombinant cell containing the vector and a composition.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to the field of genetic engineering, and more particularly, to the design of vectors, especially transcriptional regulatory elements in vectors. Background Art

[0002] The transcription of eukaryotic cell genes requires transcription factors (TFs) to bind to transcription factor binding sites (TFBSs) in the promoter region, thereby promoting the formation of transcription complexes and further regulating the transcription of downstream genes. According to relevant literature reports, enhancing the binding of transcription factors in the promoter region can promote the transcription and expression of downstream target genes. One of the strategies is to modify the promoter sequence of the expression vector to add more TFBS sequences, which can further enhance the expression of downstream target genes. There is still a need for TFBSs that can improve the transcription and expression of target genes in host cells. Summary of the Invention

[0003] To solve at least one of the above technical problems, the present disclosure provides a transcriptional regulatory element and a method for screening a stable cell line that efficiently and stably expresses a protein or transcription. Using the transcriptional regulatory element provided by the present disclosure, the expression level of a target gene can be increased in a eukaryotic cell line.

[0004] According to a first aspect of the present invention, there is provided a transcriptional regulatory element comprising a nucleotide sequence as shown in SEQ ID NO: 1 (RELA), SEQ ID NO: 2 (NFE2I2), SEQ ID NO: 3 (XBP1), or SEQ ID NO: 4 (YBX1), or a functional variant having at least 80% sequence identity therewith, or any two of them (such as SEQ ID NO: 1 (RELA) and SEQ ID NO: 2 (NFE2I2), SEQ ID NO: 3 (XBP1) and SEQ ID NO: 4 (YBX1), etc.), three of them (such as SEQ ID NO: 1 (RELA), SEQ ID NO: 2 (NFE2I2) and SEQ ID NO: 3 (XBP1), SEQ ID NO: 2 (NFE2I2), SEQ ID NO: 3 (XBP1) and SEQ ID NO: 4 (YBX1), etc.) or four of them (i.e., SEQ ID NO: 1 (RELA), SEQ ID NO: 2 (NFE2I2), SEQ ID NO: 3 (XBP1), and SEQ ID NO: 4 (YBX1)) in combination.

[0005] In some embodiments, the transcriptional regulatory element comprises multiple contiguous copies of the nucleotide sequence shown in SEQ ID NO:1 (RELA) or a functional variant having at least 80% sequence identity thereto, and / or

[0006] comprises multiple contiguous copies of the nucleotide sequence shown in SEQ ID NO:2 (NFE2I2) or a functional variant having at least 80% sequence identity thereto, and / or

[0007] comprises multiple contiguous copies of the nucleotide sequence shown in SEQ ID NO:3 (XBP1) or a functional variant having at least 80% sequence identity thereto, and / or

[0008] comprises multiple contiguous copies of the nucleotide sequence shown in SEQ ID NO:4 (YBX1) or a functional variant having at least 80% sequence identity thereto, or any combination thereof.

[0009] In some embodiments, the multiple contiguous copies are 2 to 50 copies, such as: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 copies.

[0010] In some embodiments, the transcriptional regulatory element comprises the nucleotide sequence shown in SEQ ID NO:5 (RELA 8repeats), SEQ ID NO:6 (RELA 16repeats), SEQ ID NO:7 ([RELA / XBP1 / YBX1 / NFE2I2]3repeats), SEQ ID NO:21 (NFE2I28repeats), SEQ ID NO:22 (NFE2I28 repeats+RELA 8repeats) or SEQ ID NO:23 (XBP18 repeats), or a functional variant having at least 80% sequence identity thereto.

[0011] In some embodiments, it is used to increase the expression level of a target gene in a eukaryotic cell line.

[0012] According to the second aspect of the present invention, there is provided a vector containing the transcriptional regulatory element as described in the first aspect, wherein the transcriptional regulatory elements are arranged in series.

[0013] In some embodiments, the vector further comprises a promoter element operably linked to the transcriptional regulatory element.

[0014] In some embodiments, the promoter element comprises a promoter or a promoter core selected from the group consisting of: CMV promoter, CAG promoter, SV40 promoter, heat shock protein promoter, mH1 promoter, hH1 promoter, chicken β-actin promoter, U6 promoter, ubiquitin C promoter, and EF-1α promoter, particularly the CMV promoter and the CMV promoter core.

[0015] In some embodiments, the vector comprises multiple contiguous copies of a nucleotide sequence as shown in any one or more of SEQ ID NOs: 1 to 4, or a functional variant having at least 80% sequence identity thereto, and the mCMV promoter / mCMV promoter core.

[0016] In some embodiments, the vector comprises the nucleotide sequence as shown in SEQ ID NO: 5 and the mCMV promoter / mCMV promoter core, or

[0017] comprises the nucleotide sequence as shown in SEQ ID NO: 6 and the mCMV promoter / mCMV promoter core, or

[0018] comprises the nucleotide sequence as shown in SEQ ID NO: 7 and the mCMV promoter / mCMV promoter core, or

[0019] comprises the nucleotide sequence as shown in SEQ ID NO: 21 and the mCMV promoter / mCMV promoter core, or

[0020] comprises the nucleotide sequences as shown in SEQ ID NOs: 5 and 21 and the mCMV promoter / mCMV promoter core, or

[0021] comprises the nucleotide sequence as shown in SEQ ID NO: 22 and the mCMV promoter / mCMV promoter core, or

[0022] comprises the nucleotide sequence as shown in SEQ ID NO: 23 and the mCMV promoter / mCMV promoter core.

[0023] In the present invention, the mCMV promoter / mCMV promoter core means the mCMV promoter or the mCMV promoter core.

[0024] In some embodiments, the vector includes a nucleotide sequence as shown in any one of SEQ ID NOs: 8 to 12 or 14 to 18, or a functional variant having at least 80% sequence identity thereto.

[0025] In some embodiments, the vector further comprises a coding gene of a target protein operably linked downstream of the promoter element.

[0026] In some embodiments, the protein includes, but is not limited to, bioengineered proteins or polypeptides such as recombinant proteins, fusion proteins, etc.

[0027] In some embodiments, the protein includes, but is not limited to, antibodies or antigen-binding fragments, vaccines, and bioenzymes.

[0028] In some embodiments, the antibody includes, but is not limited to, monoclonal antibodies or polyclonal antibodies.

[0029] In some embodiments, the protein includes, but is not limited to, GLP-Fc recombinant protein, PH-20 recombinant protein, RSV recombinant protein, IgG1 antibody.

[0030] According to a third aspect of the present invention, there is provided a recombinant host cell containing the vector as described in the second aspect.

[0031] In some embodiments, the recombinant host cell does not relate to propagating materials.

[0032] In some embodiments, the recombinant host cell can be a mammalian cell. In some embodiments, the recombinant host cell can include, but is not limited to, Chinese hamster ovary cells (CHO cells), human embryonic kidney epithelial cells HEK293, mouse myeloma cells (NS0 cells), baby hamster kidney cells (BHK cells).

[0033] According to a fourth aspect of the present invention, there is provided a composition containing the vector as described in the second aspect.

[0034] In some embodiments, the composition further comprises a delivery agent, such as nanoparticles.

[0035] According to a fifth aspect of the present invention, there is provided a method for screening a stable cell line stably expressing a protein or transcription. Using the vector described in the second aspect, a target gene (such as a target gene of a recombinant protein or a target gene expressing RNA) is transfected into a mammalian host cell, and a stable cell line highly expressing the target gene is screened. In some embodiments, the high expression is relative to the expression of the target gene that does not have the transcriptional regulatory element described in the first aspect. Among them, compared with the expression of the target gene that does not have the transcriptional regulatory element described in the first aspect, the expression of the target gene having the transcriptional regulatory element described in the first aspect is at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 50 times, at least 100 times or greater than 100 times.

[0036] In some embodiments, the protein includes, but is not limited to, bioengineered proteins or polypeptides such as recombinant proteins and fusion proteins.

[0037] In some embodiments, the protein includes, but is not limited to, antibodies or antigen-binding fragments, vaccines, and biological enzymes.

[0038] In some embodiments, the antibody includes, but is not limited to, monoclonal antibodies or polyclonal antibodies.

[0039] In some embodiments, the protein includes, but is not limited to, GLP-Fc recombinant protein, PH-20 recombinant protein, RSV recombinant protein, IgG1 antibody.

[0040] In some embodiments, the mammalian host cell is Chinese hamster ovary cell CHO and / or human embryonic kidney epithelial cell HEK293.

[0041] According to a sixth aspect of the present invention, there is provided a method for preparing a recombinant host cell stably expressing a protein or transcription, which includes the step of inserting the vector described in the second aspect into a host cell.

[0042] According to a seventh aspect of the present invention, there is provided a method for preparing a protein or nucleic acid, the method including the step of culturing the recombinant host cell described in the third aspect under conditions allowing the production of the protein or nucleic acid.

[0043] According to an eighth aspect of the present invention, there is provided the use of the transcriptional regulatory element described in the first aspect, the vector described in the second aspect, or the recombinant cell described in the third aspect in any one or more of the following aspects a)-g):

[0044] a) Highly transcribing a target gene,

[0045] b) Highly expressing a target gene,

[0046] c) Preparing cells for highly efficient transcription or highly efficient expression of a target gene,

[0047] d) Preparing nucleic acids, proteins or polypeptides,

[0048] e) Preparing reagents or kits for highly efficient transcription or highly efficient expression of a target gene,

[0049] f) Preparing reagents or kits for detecting diseases caused by abnormal protein expression,

[0050] g) Preparing drugs for treating or preventing diseases.

[0051] In some embodiments, the cells are Chinese hamster ovary (CHO) cells and / or human embryonic kidney epithelial cells HEK293.

[0052] In some embodiments, the preparation of the protein comprises the step of culturing the recombinant host cell described in the third aspect under conditions permitting protein production.

[0053] In some embodiments, the protein or polypeptide includes, but is not limited to, recombinant proteins, fusion proteins or other bioengineered proteins or polypeptides.

[0054] In some embodiments, the protein or polypeptide includes, but is not limited to, antibodies or antigen-binding fragments, vaccines or bioenzymes.

[0055] In some embodiments, the antibody includes, but is not limited to, monoclonal antibodies or polyclonal antibodies.

[0056] In some embodiments, the protein or polypeptide includes, but is not limited to, glucagon-like peptide-1 (GLP1), glucagon-like peptide-1-Fc fusion protein (GLP-Fc), hyaluronidase (PH-20), respiratory syncytial virus envelope protein (RSV), and dulaglutide.

[0057] In some embodiments, the protein or polypeptide includes, but is not limited to, GLP-Fc recombinant protein, PH-20 recombinant protein, RSV recombinant protein, IgG1 antibody.

[0058] The present disclosure provides a transcriptional regulatory element. Using the transcriptional regulatory element provided by the present disclosure, the expression level of a target gene can be significantly increased in eukaryotic cell lines, especially for target genes with low expression levels or difficult to recombinantly express. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1A and Figure 1B respectively show the expression of GLP1-Fc protein in CHO cell cultures transfected with different vectors.

[0060] Figure 2 Shows the expression of PH-20 protein in CHO cell cultures transfected with a vector containing 8RELA+mCMV.

[0061] Figure 3 Shows the expression of RSV protein in CHO cell cultures transfected with a vector containing 8RELA+mCMV.

[0062] Figure 4 Shows the expression of IgG1 antibody protein in CHO cell cultures transfected with a vector containing 8RELA+mCMV. Detailed implementation mode

[0063] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further details the present invention in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessarily confusing the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0064] Definition

[0065] Unless otherwise defined, all technical terms and scientific and technical terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of explaining this specification, the following definitions will be applied, and where appropriate, terms used in the singular form will also include the plural form, and vice versa.

[0066] Unless the context clearly indicates otherwise, the expressions "a" and "an" used herein include plural referents.

[0067] The expression "about" used in the present disclosure is as understood by those of ordinary skill in the art and varies within a certain range according to the context in which it is used. If those of ordinary skill in the art do not understand the use of this term according to the context in which it is used, "about" will mean up to plus or minus 10% of a specific value.

[0068] The term "vector" refers to a nucleic acid sequence capable of transporting another nucleic acid linked to the vector sequence into a cell. The term "expression vector" includes any vector (such as a plasmid, cosmid, phage chromosome, bacterial artificial chromosome, yeast artificial chromosome, P1-derived artificial chromosome) containing a gene construct in a form suitable for expression by a cell (for example, linked to transcriptional regulatory elements). A "vector" can be a plasmid or a viral vector, such as a retroviral vector and a lentiviral vector. In addition, the present invention is intended to include other vectors that can perform the same function.

[0069] The term "target sequence" or "target gene" can refer to a nucleic acid sequence (such as a therapeutic gene) that is partially or wholly heterologous, i.e., foreign, to the cell into which it is introduced.

[0070] The term "target sequence" or "target gene" can also refer to a nucleic acid sequence that is partially or wholly homologous to an endogenous gene of the cell into which it is introduced, but the nucleic acid sequence is designed to be inserted into the genome of the cell to alter the genome (e.g., the sequence is inserted at a different location from where the natural gene is located or its insertion results in a "knockout"). For example, the target sequence can be cDNA, DNA, or mRNA.

[0071] The term "target sequence" or "target gene" can also refer to a nucleic acid sequence that is partially or completely complementary to an endogenous gene of the cell into which it is introduced. For example, the target sequence can be microRNA, shRNA, or siRNA.

[0072] The term "target sequence" or "target gene" can also include one or more transcriptional regulatory sequences and any other nucleic acids required for optimizing the expression of the selected nucleic acid, such as introns. "Target protein" refers to a peptide or polypeptide sequence (such as a therapeutic protein) expressed by the target sequence or target gene.

[0073] The term "operably linked" refers to a functional relationship between one nucleic acid and another nucleic acid sequence, which can be achieved by standard techniques known in molecular biology for ligating nucleic acid fragments. The connections between promoters, enhancers, transcription and translation termination sites, and other signal sequences are examples of operable linkages. For example, an operable linkage between a target DNA sequence and a transcriptional regulatory element refers to the physical and functional relationship between the DNA and the promoter such that RNA polymerase can initiate transcription of the DNA sequence from the promoter, and the RNA polymerase specifically recognizes, binds to, and transcribes the DNA.

[0074] The term "transfection" refers to the method of artificially introducing nucleic acids (DNA or RNA) into cells using various chemical, biological, or physical methods. Introducing exogenous nucleic acids into host cells through transfection can change the characteristics of the cells, thereby enabling the study of cell gene functions and protein expression. After transfection, the introduced nucleic acids can exist transiently in the cells, expressing only for a period of time and not replicating (transient transfection), or they can be stably integrated into the host genome and replicated along with the replication of the host genome (stable transfection). The methods of transfection include physical-mediated transfection (such as electroporation, microinjection, and gene gun), chemical-mediated transfection (such as DEAE-dextran method, calcium phosphate co-precipitation method, liposome transfection), and virus-mediated transfection (such as transfection mediated by recombinant lentivirus, retrovirus, adenovirus, or adeno-associated virus (AAV), or herpesvirus).

[0075] The term "recombinant host cell", as is well known in the art, a recombinant polynucleotide (such as DNA) molecule is a polynucleotide (such as DNA) molecule formed by pooling genetic materials from multiple sources through laboratory methods of gene recombination (such as molecular cloning) to create sequences that cannot be found in biological organisms in other ways. As can be understood by those skilled in the art, a recombinant host cell contains a recombinant polynucleotide (such as DNA) molecule.

[0076] The term "nucleic acid" consists of polymers composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and their synthetic non-naturally occurring analogs) linked by phosphodiester bonds, related naturally occurring structural variants, and their synthetic non-naturally occurring analogs.

[0077] The term "protein or polypeptide" refers to a protein encoded by a nucleic acid molecule, including polypeptide fragments, mutants, and homologs. The proteins or polypeptides described in the present disclosure are produced by the expression of recombinant nucleic acid molecules.

[0078] The term "recombinant protein" refers to a polypeptide prepared by recombinant DNA technology. Examples of such techniques include inserting the DNA encoding the expressed protein into a suitable expression vector, which is then used to transform host cells to produce the protein or polypeptide encoded by the DNA.

[0079] The term "fusion protein" refers to a polypeptide or protein containing two or more subunits. In some embodiments, the fusion proteins described herein contain two or more subunits, which can be linked by covalent or non-covalent bonds. Preferably, the fusion protein is a translational fusion between two or more subunits. This translational fusion can be generated by engineering the coding sequence of one subunit in-frame with the coding sequence of another subunit.

[0080] The term "antibody" refers to a polypeptide encoded substantially by one or more immunoglobulin genes or fragments thereof in nature, which specifically binds to and recognizes an analyte (such as an antigen or immunogen), such as an RSVF protein or an antigenic fragment thereof. Immunoglobulin genes include κ, λ, α, γ, 6, ε, and μ constant region genes, as well as numerous immunoglobulin variable region genes. The term "antibody" as used herein includes, for example, antibody fragments produced by modification of intact antibodies and de novo synthesis using recombinant DNA methods.

[0081] The term "antigen-binding fragment" refers to a part of an intact antibody and generally contains the antigen-determining variable region of the intact antibody. Some examples of antibody fragments include, but are not limited to, Fab, Fab’, F(ab')2, and Fv fragments, linear antibodies, scFv antibodies, and multispecific antibodies formed by antibody fragments. A "Fab fragment (antigen-binding fragment)" is also called an antigen-binding fragment and is the region in the antibody structure that can bind to an antigen. The Fab fragment consists of a complete light chain and a partial heavy chain structure. The light chain and the heavy chain are connected by a disulfide bond, and it is relatively small in size with a molecular weight of 47-48 kDa. The Fab fragment can be obtained by protease digestion of the full-length antibody. For example, under the action of papain, human immunoglobulin G (IgG) can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab’)2 fragment and one pFc' fragment. The F(ab')2 fragment can be further reduced to form two Fab’ fragments. The Fab fragment can also be prepared by expression in prokaryotic systems (such as E. coli systems) and mammalian cell systems. The E. coli expression system has the characteristics of low production cost and fast production speed, but it is prone to form inclusion bodies, and the subsequent purification and renaturation are more troublesome, and the activity of the protein obtained by renaturation is very low or even inactive. The Fab fragment expressed in mammalian cells can successfully form disulfide bonds, is closer to the structure of the natural Fab fragment, and has higher activity.

[0082] The term "vaccine" refers to any immunocomposition that can specifically induce an immune response in the body against a target antigen, thereby effectively preventing or treating diseases related to the target antigen. Vaccines typically use one of four types of antigens: live microorganisms administered via non-natural routes, live attenuated microorganisms, killed microorganisms, and parts of microorganisms or even single antigens or products. In all cases, the goal is to present the antigen without causing disease. The term "vaccine" as used in this disclosure includes antigens such as parts of microorganisms or even single antigens or products.

[0083] The term "biological enzyme" refers to a protein with biological activity (or "polypeptide" or "peptide composition"), including both naturally occurring proteins and their variants and modified forms.

[0084] The term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous group of antibodies, i.e., each antibody contained in the group of antibodies is identical and / or binds to the same epitope, except for variant antibodies that may be present in trace amounts (e.g., containing naturally occurring mutations or generated during the production of monoclonal antibody preparations and usually present in small amounts). Different from polyclonal antibody preparations that usually include different antibodies against different antigenic determinants (epitopes), each monoclonal antibody in a monoclonal antibody preparation targets a single determinant on the antigen.

[0085] The term "polyclonal antibody" refers to a group of globulins with the ability to specifically bind to an antigen, which are synthesized and secreted by the plasma cells of the body after the antigen stimulates the body to produce an immunological reaction. An antigen usually consists of multiple antigenic determinants. An antibody produced by a single B lymphocyte stimulated by one antigenic determinant is called a monoclonal antibody. When the body is stimulated by multiple antigenic determinants, various monoclonal antibodies are produced accordingly, and these monoclonal antibodies mixed together are polyclonal antibodies.

[0086] Preferred promoters for regulating vector transcription in host cells can be obtained from different sources such as viral genomes, or from heterologous mammals such as the β-actin promoter. Such viruses include polyomavirus, simian virus 40 (SV40), adenovirus, retrovirus, hepatitis B virus, and most preferably cytomegalovirus. The early and late promoters of the SV40 virus can be conveniently obtained in the form of SV40 restriction fragments, which also contain the SV40 virus replication origin (Fiers et al., Nature, 273: 113 (1978)). The immediate early promoter of human cytomegalovirus can be conveniently obtained in the form of the HindIII E restriction fragment (Greenway, P.J. et al., Gene 18: 355 - 360 (1982)). Of course, the present invention can also use promoters from host cells or related species, and such promoters can be used for tissue-specific gene expression or gene expression regulated by tissue specificity. The teachings regarding promoters in the cited references are hereby incorporated into the present invention by reference in their entirety.

[0087] In one aspect of the present invention, a transcriptional regulatory element is provided. More specifically, this transcriptional regulatory element can be used to increase the expression level of a target gene in eukaryotic cell lines, and thus can be regarded as an enhancer element to a certain extent.

[0088] In some embodiments, the transcriptional regulatory element of the present invention comprises a nucleotide sequence as shown in SEQ ID NO: 1 (RELA), SEQ ID NO: 2 (NFE2I2), SEQ ID NO: 3 (XBP1), or SEQ ID NO: 4 (YBX1), or a functional variant having at least 80% sequence identity thereto, or any combination thereof.

[0089] In some embodiments, the transcriptional regulatory element of the present invention comprises a nucleic acid sequence as shown in SEQ ID NO: 1 (RELA) or a functional variant having at least 80% sequence identity thereto, such as a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity. When used in the present invention, a functional variant of a certain nucleic acid sequence can be constructed by nucleotide mutations, namely deletions, substitutions, insertions, and / or inversions.

[0090] In some embodiments, the transcriptional regulatory element of the present invention further comprises a nucleic acid sequence as shown in SEQ ID NO: 2 (NFE2I2), or a functional variant having at least 80% sequence identity thereto, such as a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0091] In some embodiments, the transcriptional regulatory element of the present invention further comprises a nucleic acid sequence as shown in SEQ ID NO: 3 (XBP1), or a functional variant having at least 80% sequence identity thereto, such as a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0092] In some embodiments, the transcriptional regulatory element of the present invention further comprises a nucleic acid sequence as shown in SEQ ID NO: 4 (YBX1), or a functional variant having at least 80% sequence identity thereto, such as a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0093] In some embodiments, the transcriptional regulatory element of the present invention further comprises at least two of the nucleic acid sequences shown in SEQ ID NO:2 (NFE2I2), SEQ ID NO:3 (XBP1), and SEQ ID NO:4 (YBX1). For example, it comprises SEQ ID NO:1 + SEQ ID NO:2 + SEQ ID NO:3, or SEQ ID NO:1 + SEQ ID NO:2 + SEQ ID NO:4, or SEQ ID NO:1 + SEQ ID NO:3 + SEQ ID NO:4. The combined sequences shown do not constitute a limitation on the linking order of the individual sequences, but rather include various effective linkages of the individual sequences, including but not limited to, for example, SEQ ID NO:1 - SEQ ID NO:2 - SEQ ID NO:3, or SEQ ID NO:2 - SEQ ID NO:1 - SEQ ID NO:3, or SEQ ID NO:2 - SEQ ID NO:3 - SEQ ID NO:1, etc. starting from the 5'-end. Moreover, the transcriptional regulatory element of the present invention may further comprise a nucleic acid sequence having at least 80% sequence identity with the combined sequences shown, for example, a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity therewith.

[0094] In some embodiments, the transcriptional regulatory element of the present invention comprises the nucleic acid sequences shown in SEQ ID NO:1 (RELA), SEQ ID NO:2 (NFE2I2), SEQ ID NO:3 (XBP1), and SEQ ID NO:4 (YBX1), or a functional variant having at least 80% sequence identity therewith, for example, a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4 can be effectively linked in various orders.

[0095] In some embodiments, the transcriptional regulatory element of the present invention comprises multiple consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 1 (RELA) (or a functional variant having at least 80% sequence identity therewith), for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive copies. In some embodiments, the transcriptional regulatory element of the present invention comprises no more than 25 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 1 (RELA) (or a functional variant having at least 80% sequence identity therewith), for example, no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8 consecutive copies of said sequence. In some embodiments, the transcriptional regulatory element of the present invention comprises 2 to 25 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 1 (RELA) (or a functional variant having at least 80% sequence identity therewith).

[0096] In some embodiments, the transcriptional regulatory element of the present invention comprises multiple consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 2 (or a functional variant having at least 80% sequence identity therewith), for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive copies. In some embodiments, the transcriptional regulatory element of the present invention comprises no more than 25 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 2 (or a functional variant having at least 80% sequence identity therewith), for example, no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8 consecutive copies of said sequence. In some embodiments, the transcriptional regulatory element of the present invention comprises 2 to 25 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 2 (or a functional variant having at least 80% sequence identity therewith).

[0097] In some embodiments, the transcriptional regulatory element of the present invention comprises multiple consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 3 (or a functional variant having at least 80% sequence identity therewith), for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive copies. In some embodiments, the transcriptional regulatory element of the present invention comprises no more than 25 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 3 (or a functional variant having at least 80% sequence identity therewith), for example, no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8 consecutive copies of said sequence. In some embodiments, the transcriptional regulatory element of the present invention comprises 2 to 25 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 3 (or a functional variant having at least 80% sequence identity therewith).

[0098] In some embodiments, the transcriptional regulatory element of the present invention comprises multiple consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 4 (or a functional variant having at least 80% sequence identity therewith), for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive copies. In some embodiments, the transcriptional regulatory element of the present invention comprises no more than 25 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 4 (or a functional variant having at least 80% sequence identity therewith), for example, no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8 consecutive copies of said sequence. In some embodiments, the transcriptional regulatory element of the present invention comprises 2 to 25 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 4 (or a functional variant having at least 80% sequence identity therewith).

[0099] In some embodiments, the transcriptional regulatory element of the present invention comprises a combined sequence, which is composed of (1) SEQ ID NO: 1 and (2) at least two of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. In some embodiments, the transcriptional regulatory element of the present invention comprises multiple consecutive copies of such a combined sequence (or a functional variant having at least 80% sequence identity therewith), for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive copies. In some embodiments, the transcriptional regulatory element of the present invention comprises no more than 25 consecutive copies of such a combined sequence (or a functional variant having at least 80% sequence identity therewith), for example, no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8 consecutive copies of the said sequence. In some embodiments, the transcriptional regulatory element of the present invention comprises 2 to 25 consecutive copies of such a combined sequence (or a functional variant having at least 80% sequence identity therewith).

[0100] In a specific embodiment, the transcriptional regulatory element of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 5 (RELA8 repeats) (which contains 8 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 1), or a functional variant having at least 80% sequence identity therewith.

[0101] In a specific embodiment, the transcriptional regulatory element of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 6 (RELA16 repeats) (which contains 16 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 1), or a functional variant having at least 80% sequence identity therewith.

[0102] In a specific embodiment, the transcriptional regulatory element of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 7 (Mixed: RELA / XBP1 / YBX1 / NFE2I2) (which contains 3 consecutive copies of the combined sequence composed of SEQ ID NO: 1 - SEQ ID NO: 3 - SEQ ID NO: 4 - SEQ ID NO: 2 connected in sequence), or a functional variant having at least 80% sequence identity therewith.

[0103] In one specific embodiment, the transcriptional regulatory element of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 21 (NFE2I2 8 repeats) (which contains 8 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 2), or a functional variant having at least 80% sequence identity thereto.

[0104] In one specific embodiment, the transcriptional regulatory element of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 22 (NFE2I2 8 repeats + RELA 8 repeats) (which contains 8 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 2 and 8 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 1), or a functional variant having at least 80% sequence identity thereto.

[0105] In one specific embodiment, the transcriptional regulatory element of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 23 (XBP1 8 repeats) (which contains 8 consecutive copies of the nucleic acid sequence shown in SEQ ID NO: 3), or a functional variant having at least 80% sequence identity thereto.

[0106] In a second aspect of the present invention, there is provided a vector into which the transcriptional regulatory element of the present invention is integrated. In some embodiments, the vector of the present invention further comprises a promoter element operably linked to the transcriptional regulatory element. Promoters suitable for the present invention may include, but are not limited to, CMV-based promoters, CAG promoters, SV40-based promoters, heat shock protein promoters, mH1 promoters, hH1 promoters, chicken β-actin promoters, U6 promoters, ubiquitin C promoters, or promoters of EF-1α. Promoters suitable for the present invention may also include wild-type CMV promoters and promoter cores thereof, including but not limited to promoter cores containing the following nucleotides: nucleotides -406 to -19, -299 to -10, -299 to +1, -299 to +31, -277 to -19, -277 to -14, -266 to +32, -343 to +32, -179 to +32, -500 to 0, etc. from the transcription start site. In some embodiments, the transcriptional regulatory element of the present invention is integrated at the 5'-end of the promoter element.

[0107] In some embodiments, the vector of the present invention further comprises a target sequence integrated downstream of the promoter element. Preferably, the target sequence is a codon-optimized nucleic acid sequence. In some embodiments, the target sequence is capable of encoding a bioactive protein, such as an enzyme, blood derivative, hormone, cytokine such as interleukin and interferon, coagulant, growth factor, neurotransmitter, tumor inhibitor, apolipoprotein, antigen, antibody, and other bioactive proteins.

[0108] In some embodiments, the transcriptional regulatory elements of the present invention can be used together with other viral vectors that can be used for gene transfer, including but not limited to vectors derived from retroviruses, herpesviruses, adeno-associated viruses, lentiviruses, and other viruses known to those skilled in the art. For example, a transcriptional regulatory element of the present invention, together with a promoter element and a target sequence operably linked thereto, can be inserted into an adenovirus genomic fragment, and then co-transfected into recipient cells with a linear viral genome derived from an adenovirus vector under conditions that allow homologous recombination to occur between the genomic fragment and the virus.

[0109] Thus, in a third aspect of the present invention, there is provided a recombinant cell containing the vector of the present invention. In some embodiments, the recombinant cell can be used to produce the vector of the present invention, such as a microbial cell, for example, a bacterial cell such as Escherichia coli (E. coli) and a yeast cell such as Saccharomyces cerevisiae. In some embodiments, the recombinant cell is used for the expression of a target gene, for example, mammalian host cells can be used, such as Chinese hamster ovary (CHO) cells; murine C127 cells; human embryonic kidney cells of the 293 lineage; human cancer cells, such as HeLa, A549, MCF7, HepG2, etc.

[0110] In a fourth aspect of the present invention, there is provided a composition containing the vector of the present invention. Nucleic acids can be introduced into cells using a variety of methods known in the art. Examples of such methods include but are not limited to electroporation, calcium phosphate-mediated transfer, nucleofection, sonoporation, heat shock, magnetofection, liposome-mediated transfer, microinjection, microprojectile-mediated transfer (nanoparticles), cationic polymer-mediated transfer (DEAE-dextran, polyethyleneimine, polyethylene glycol (PEG), etc.) or cell fusion. In some embodiments, the composition of the present invention further contains a delivery agent, such as nanoparticles. Studies have shown that nanoparticle carriers such as liposomes, micelles, and polymeric nanoparticles can be used to improve the bioavailability and pharmacokinetic properties of therapeutic agents through various mechanisms, such as the enhanced permeability and retention effect (EPR).

[0111] In a fifth aspect of the present invention, there is provided a method for screening a stable cell line that highly and stably expresses a protein or transcription. Using the vector described in the second aspect, a target gene (for example, a target gene of a recombinant protein or a target gene expressing RNA) is transfected into a host cell, and a stable cell line that highly expresses the target gene is screened.

[0112] In some embodiments, the high expression is relative to the expression of the target gene without the transcriptional regulatory element described in the first aspect. Compared with the expression of the target gene without the transcriptional regulatory element described in the first aspect, the expression of the target gene with the transcriptional regulatory element described in the first aspect is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, at least 100-fold or greater than 100-fold.

[0113] In some embodiments, the mammalian host cell is Chinese hamster ovary cell CHO and / or human embryonic kidney epithelial cell HEK293.

[0114] Examples and drawings are provided below to assist in understanding the present invention. However, it should be understood that these examples and drawings are only for illustrating the present invention and do not constitute any limitation. The actual protection scope of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0115] Design of Transcription Factor Binding Site Sequences and Synthetic Promoters in Example 1

[0116] By referring to relevant literature and combining database retrieval, the inventors designed four transcription factor binding site sequences (TFBS) corresponding to transcription factors RELA, NFE2I2, XBP1, and YBX1 as shown in Table 1, and combined with the mCMV promoter, designed and synthesized the corresponding synthetic promoters (Table 2), where core mCMV is the wild-type mCMV promoter core (SEQ ID NO: 19).

[0117] Table 1 Transcription factor binding site sequences (TFBS) designed and used

[0118] SEQ ID NO: TFBS Transcription factor 1 AAGGTCAATAGGGACTTTCCAATGGGTTTTTCCCAGTACAT RELA 2 ATGACTAAGCA NFE2I2 3 GGATGACGTGTACAAT XBP1 4 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCT YBX1

[0119] Table 2 Synthetic promoters

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127] According to the above design, EcoRV and NotI restriction endonuclease sequences were added to both ends of different synthetic promoters, and they were ligated with a spacing spacer sequence (SEQ ID NO: 20). Different promoters were obtained by gene synthesis. The synthetic promoters with EcoRV and NotI restriction endonuclease sequences added to both ends were synthesized into the pUC57 vector (purchased from GenScript, SD1176), and pUC57 cloning vectors containing different synthetic promoters were prepared.

[0128] Vector Construction in Example 2

[0129] The pUC57 cloning vectors containing different synthetic promoters as shown in Table 2 were digested with EcoRV and NotI, and the synthetic promoter fragments were recovered by gel extraction. Similarly, pMGT expression vector (the target gene expression vector used in Example 4 of Patent CN116445542A (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker))) was digested with EcoRV and NotI, the vector was recovered and ligated with different synthetic promoters to obtain pMGT / TFBS expression vectors containing different synthetic promoters. Through the multiple cloning site, the target genes encoding GLP-Fc recombinant protein (Dulaglutide), PH-20 recombinant protein (SEQ ID NO: 2 in CN114762677A), RSV recombinant protein (SEQ ID NO: 2 in US2015 / 0166610 A1) and IgG1 antibody (Rituximab) were ligated into the pMGT / TFBS expression vector by T4 ligase. After transformation of Escherichia coli competent cells, positive bacteria were selected, plasmids were extracted, and after sequencing verification, they were used for mammalian cell transfection.

[0130] Preparation of Stable Cell Lines Expressing GLP-Fc Recombinant Protein in Example 3

[0131] A CHO cell pool stably expressing the target protein GLP1 was prepared by the following method:

[0132] 1. Host cell resuscitation and amplification passage: Resuscitate CHO-K1 host cells into a shake flask and perform a recovery passage. The passage density is 0.5x10 6 cells / ml, passage once every 3 days for 3 passages.

[0133] 2. Transfection: Centrifuge the cells, discard the supernatant, resuspend the cells with pre-warmed HyCell Transfx-C medium, and adjust to 3.0x10 6cells / ml. Add one portion of the premixed PEI-plasmid (GLP-Fc high-expression vector obtained in Example 2) mixture (30 μg PEI + 15 μg high-expression vector) to every 5 mL of the cell suspension, and quickly mix well. Then, place the cells in a shaker and continue culturing for 2 days.

[0134] 3. Pressure screening: Perform pressure screening on the cells on the 2nd day after transfection with 25 μM MSX (Methionine sulfoximine). Conduct one round of pressure every 3 days until the cell viability recovers to over 90%.

[0135] 4. Fed-batch culture: Conduct recovery culture on the cells after the pressure screening is completed. After subculturing 2 times, inoculate them into Ex-cell Advanced CHO Fed-batch medium for fed-batch culture. The inoculation density is 0.5×10 6 cells / ml, 15 ml per tube. Perform feeding at a ratio of 3% v / v cell boost 7a + 0.3% v / v cell boost 7b on the 3rd day of culture. At the same time, detect the change in glucose content every day. When the glucose content is lower than 4 g / L, increase the glucose to 8 g / L. Culture until the 14th day, take the fed-batch culture and collect the supernatant for titer detection to evaluate the effect of different synthetic promoters on the yield of the target protein.

[0136] 5. Expression level detection: Take the supernatant collected from the fed-batch culture and use a molecular interaction analysis system and use a Protein A probe to detect the expression level of GLP1-Fc in the supernatant. The experimental results of the expression level detection of cell pools containing different synthetic promoters are shown in Table 3 and Figure 1A and Figure 1B as shown.

[0137] Table 3 Detection of GLP1-Fc protein expression in the finally harvested supernatant of fed-batch culture

[0138]

[0139] Note: The mixed TFBS is RELA / XBP1 / YBX1 / NFE2I2 (3 repeats).

[0140] Since the wild-type mCMV promoter contains some enhancer sequences, in order to exclude its interference with the transcriptional regulatory elements proposed in the present invention, the inventor added different TFBS sequences upstream of the core sequence of the mCMV promoter (core mCMV) from which the enhancer was removed, and detected its effect on the expression of the target protein. The results are shown in Table 3 and Figure 1AAs shown, compared with the wild-type mCMV promoter (mCMV group), when only the core sequence of the mCMV promoter was retained after removing the enhancer (core mCMV group), the expression level of the target protein was significantly down-regulated. However, after adding various transcriptional regulatory elements proposed in the present invention upstream of the core mCMV, the expression level of the target protein was significantly increased. Among them, adding different copy numbers of RELA, NFE2I2, XBP1, and mixed TFBS could increase the expression level of the target gene by 2.0 to 7.3 times (compared with the core mCMV group). Among them, adding RELA, NFE2I2, and mixed adding RELA / XBP1 / YBX1 / NFE2I2 TFBS had a better expression promotion effect.

[0141] Meanwhile, as Figure 1B shown, adding different TFBS upstream of the wild-type mCMV promoter could also significantly enhance the expression of the target protein. Among them, adding 8 copies of the TFBS of RELA upstream of the mCMV promoter could increase the expression of the target gene to 1.45 times (compared with the mCMV group). Further increasing the number of RELA TFBS to 16 copies could further increase the expression level of the target protein to 1.76 times (compared with the mCMV group). Mixing and adding the TFBS of the transcription factors RELA / XBP1 / YBX1 / NFE2I2 could increase the expression level of the target protein to 1.82 times (compared with the mCMV group). The above results fully indicate that adding specific binding sites (TFBS) of transcription factors upstream of the promoter can effectively improve the expression of the target protein in mammalian cells.

[0142] Preparation of Stable Cell Lines Expressing PH-20 Recombinant Protein in Example 4

[0143] The CHO cell pool stably expressing the target protein PH-20 was prepared by the following method:

[0144] 1. Host cell resuscitation and amplification passage: Resuscitate CHO-K1 host cells into a shake tube and perform a recovery passage with a passage density of 0.5x10 6 cells / ml, passage once every 3 days for 3 passages.

[0145] 2. Transfection: Centrifuge the cells, remove the supernatant, resuspend the cells with pre-warmed HyCell Transfx-C medium, and adjust to 3.0x10 6 cells / ml. Add a pre-mixed PEI-plasmid (the high-efficiency expression vector of PH-20 obtained in Example 2) mixture (30 μg PEI + 15 μg high-efficiency expression vector) to each 5 mL cell suspension, and quickly mix well. Then place the cells in a shaker and continue to culture for 2 days.

[0146] 3. Pressure screening: Cells on the second day after transfection were subjected to pressure screening with 25 μM MSX (Methionine sulfoximine). One round of pressure was carried out every three days until the cell viability recovered to over 90%.

[0147] 4. Fed-batch culture: The cells after the end of pressure screening were subjected to recovery culture. After two passages, they were inoculated into Ex-cell Advanced CHO Fed-batch medium for fed-batch culture. The inoculation density was 0.5×10 6 cells / ml, 15 ml per tube. At the third day of culture, feeding was carried out at a ratio of 3% v / v cell boost 7a + 0.3% v / v cell boost 7b. Meanwhile, the change in glucose content was detected every day. When the glucose content was lower than 4 g / L, glucose was increased to 8 g / L. On the 14th day of culture, the fed-batch culture was taken and the supernatant was collected for titer detection to evaluate the effect of different synthetic promoters on the yield of the target protein.

[0148] 5. Expression level detection: The supernatant collected from the fed-batch culture was taken for PH-20 activity detection. Meanwhile, the expression level of PH-20 was estimated using the standard curve. The experimental results of the expression level detection of cell pools containing different synthetic promoters are shown in Table 4 and Figure 2 as follows.

[0149] Table 4 Detection of PH-20 protein expression in the finally harvested supernatant of fed-batch culture

[0150] Name of synthetic promoter mCMV 8RELA + mCMV Protein expression level (mg / L) 28.2 135.8

[0151] Human PH-20 is a hyaluronidase that is difficult to express and can be used for swelling reduction of wounds after surgery or trauma in patients, and can also be used for subcutaneous injection to promote the rapid diffusion of drugs under the skin. However, human PH-20 is difficult to recombinantly express. The general expression level of PH-20 with the human WT sequence in the CHO cell culture supernatant is about 15 - 20 mg / L (CN111971387A). It can be seen that by adding 8 copies of the TFBS of the RELA transcription factor upstream of the mCMV promoter, the expression of the PH-20 target protein can be increased to about 4.8 times (compared with the mCMV promoter group), and the expression level in the culture supernatant reaches about 135 mg / L. It shows that by adding specific transcription factor binding sites (TFBS) upstream of the promoter, the expression of the target gene in mammalian cells can be effectively improved.

[0152] Preparation of Stable Cell Lines Expressing RSV Recombinant Protein in Example 5

[0153] The CHO cell pool stably expressing the RSV target protein was prepared by the following method:

[0154] 1. Host cell resuscitation and amplification by subculture: Resuscitate CHO-K1 host cells into a shake flask and perform recovery subculture at a seeding density of 0.5x10 6 cells / ml, with subculture every 3 days for 3 passages.

[0155] 2. Transfection: Centrifuge the cells, discard the supernatant, resuspend the cells with pre-warmed HyCell Transfx-C medium, and adjust the cell density to 3.0x10 6 cells / ml. Add one portion of the pre-mixed PEI-plasmid (RSV high-expression vector obtained in Example 2) mixture (30 μg PEI + 15 μg high-expression vector) to every 5 mL of cell suspension, and mix quickly. Then, continue culturing the cells in a shaker for 2 days.

[0156] 3. Pressure screening: Perform pressure screening on the cells on the second day after transfection with 25 μM MSX (Methionine sulfoximine), with one round of pressure every 3 days until the cell viability recovers to over 90%.

[0157] 4. Fed-batch culture: Perform recovery culture on the cells after the pressure screening is completed. After 2 passages, inoculate the cells into Ex-cell Advanced CHO Fed-batch medium for fed-batch culture at an inoculation density of 0.5×10 6 cells / ml, 15 ml per tube. Perform feeding at a ratio of 3% v / v cell boost 7a + 0.3% v / v cell boost 7b on the third day of culture. At the same time, detect the change in glucose content every day. When the glucose content is lower than 4 g / L, increase the glucose to 8 g / L. Culture until the 14th day, collect the fed-batch culture and harvest the supernatant for titer detection to evaluate the effect of different synthetic promoters on the yield of the target protein.

[0158] 5. Expression level detection: Harvest the supernatant from the fed-batch culture and detect the RSV protein expression level in the supernatant by ELISA. The experimental results of the expression level detection of cell pools containing different synthetic promoters are shown in Table 5 and Figure 3 as follows.

[0159] Table 5 Detection of RSV protein expression in the supernatant finally harvested from fed-batch culture

[0160] Name of synthetic promoter mCMV 8RELA + mCMV Protein expression level (mg / L) 214.7 504.5

[0161] The RSV protein is the envelope protein of the Respiratory syncytial virus (RSV) and can be used as a vaccine to immunize the human body and generate antibodies against the RSV virus. It can be seen that by adding 8 copies of the TFBS of the RELA transcription factor upstream of the mCMV promoter, the expression of the RSV target protein can be increased to about 2.3 times (compared to the mCMV promoter group). This indicates that by adding specific transcription factor binding sites (TFBS) upstream of the promoter, the expression of the target gene in mammalian cells can be effectively enhanced.

[0162] Preparation of Stable Cell Lines Expressing IgG1 Antibody Protein in Example 6

[0163] The following method is used to prepare a CHO cell pool stably expressing the IgG1 antibody target protein:

[0164] 1. Host cell resuscitation and amplification passage: Resuscitate CHO-K1 host cells into a shake tube and perform a recovery passage with a passage density of 0.5x10 6 cells / ml, passage once every 3 days for 3 passages.

[0165] 2. Transfection: Centrifuge the cells, discard the supernatant, resuspend the cells with pre-warmed HyCell Transfx-C medium, and adjust to 3.0x10 6 cells / ml. Add one portion of the pre-mixed PEI-plasmid (the IgG1 high-expression vector obtained in Example 2) mixture (30 μg PEI + 15 μg high-expression vector) to every 5 mL of the cell suspension, and mix quickly. Then place the cells in a shaker and continue culturing for 2 days.

[0166] 3. Pressure screening: Perform pressure screening of 25 μM MSX (Methionine sulfoximine) on the cells on the 2nd day after transfection. Perform one round of pressure every 3 days until the cell viability recovers to more than 90%.

[0167] 4. Fed-batch culture: Perform recovery culture on the cells after the pressure screening is completed. After 2 passages, inoculate them into Ex-cellAdvanced CHO Fed-batch medium for fed-batch culture with an inoculation density of 0.5×10 6 cells / ml, 15 ml per tube. Perform feeding at a ratio of 3% v / v cell boost 7a + 0.3% v / v cell boost 7b on the 3rd day of culture. At the same time, detect the change in glucose content every day. When the glucose content is lower than 4 g / L, increase the glucose to 8 g / L. Culture until the 14th day, take the fed-batch culture and collect the supernatant for titer detection to evaluate the effect of different synthetic promoters on the yield of the target protein.

[0168] 5. Expression level detection: Take the supernatant collected from fed-batch culture and use a molecular interaction analysis system and use a Protein A probe to detect the expression level of IgG1 antibody in the supernatant. The experimental results of the expression level detection of cell pools containing different synthetic promoters are shown in Table 6 and Figure 4 as follows.

[0169] Table 6 Detection of IgG1 antibody expression in the finally harvested supernatant of fed-batch culture

[0170] Name of synthetic promoter mCMV 8RELA + mCMV IgG1 antibody expression level (g / L) 6.3 7.3

[0171] Monoclonal antibodies have been widely used in the diagnosis and treatment of human diseases. They are the main category in the research and development of macromolecular drugs and one of the most commonly expressed target proteins in CHO cell production. Among them, IgG1 antibody is the most commonly used antibody type in current antibody drugs. It can be seen that adding 8 copies of the TFBS of the RELA transcription factor upstream of the mCMV promoter can increase the expression of the IgG1 antibody target protein to about 1.2 times (compared with the mCMV promoter group). This shows that adding specific transcription factor binding sites (TFBS) upstream of the promoter can effectively increase the expression of the target gene in mammalian cells.

[0172] The technical solution of the present invention is not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.

Claims

1. A transcriptional regulatory element comprising a nucleotide sequence as shown in SEQ ID NO: 1 (RELA), SEQ ID NO: 2 (NFE2I2), SEQ ID NO: 3 (XBP1), or SEQ ID NO: 4 (YBX1), or a functional variant thereof having at least 80% sequence identity, or a combination of any two, three or four thereof.

2. The transcriptional regulatory element according to claim 1, It comprises a nucleotide sequence as shown in SEQ ID NO:1 or a functional variant having at least 80% sequence identity therewith; preferably, it further comprises a nucleotide sequence as shown in SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or a functional variant having at least 80% sequence identity therewith, or a combination of any two or three thereof.

3. The transcriptional regulatory element according to claim 1, comprising a plurality of consecutive copies of the nucleotide sequence as shown in SEQ ID NO: 1 or a functional variant thereof having at least 80% sequence identity thereto, and / or It comprises multiple consecutive copies of the nucleotide sequence shown in SEQ ID NO: 2 or a functional variant thereof having at least 80% sequence identity, and / or It comprises multiple consecutive copies of the nucleotide sequence as shown in SEQ ID NO: 3 or a functional variant thereof having at least 80% sequence identity, and / or It comprises multiple consecutive copies of the nucleotide sequence shown in SEQ ID NO: 4 or a functional variant thereof having at least 80% sequence identity.

4. The transcriptional regulatory element according to claim 1, comprising a nucleotide sequence as shown in any one of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 21 to 23, or a functional variant thereof having at least 80% sequence identity. The transcriptional regulatory element according to claim 1 , which is used to increase the expression level of a target gene in a eukaryotic cell line. 6 . A vector comprising the transcriptional regulatory element according to claim 1 .

7. The vector of claim 6, further comprising a promoter element operably linked to the transcriptional regulatory element.

8. The vector of claim 7, wherein the promoter element comprises a promoter or a promoter core, wherein the promoter or the promoter core is selected from: CMV promoter, CAG promoter, SV40 promoter, heat shock protein promoter, mH1 promoter, hH1 promoter, chicken β-actin promoter, U6 promoter, ubiquitin C promoter and EF-1α promoter, preferably from CMV promoter and CMV promoter core.

9. The vector according to claim 6, comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 8 to 12 or 14 to 18, or a functional variant thereof having at least 80% sequence identity.

10. The vector according to claim 7, further comprising a gene encoding a protein of interest operably linked downstream of the promoter element.

11. A recombinant host cell comprising the vector according to any one of claims 6 to 10.

12. A composition comprising the carrier according to any one of claims 6 to 10.

13. The composition of claim 12, further comprising a delivery agent, such as nanoparticles.

14. A method for screening a stable cell line that stably expresses a protein or transcribes, characterized in that: The vector according to any one of claims 6 to 10 is used to transfect the target gene into mammalian host cells, and a stable cell line with high expression of the target gene is obtained by screening.

15. The method for screening a stable cell line stably expressing a protein or transcription according to claim 14, characterized in that: The mammalian host cells are Chinese hamster ovary cells (CHO) and / or human embryonic kidney epithelial cells (HEK293).

16. A method for preparing a recombinant host cell that stably expresses a protein or transcription, comprising the step of inserting the vector according to any one of claims 6 to 10 into a host cell.

17. A method for preparing a protein or a nucleic acid, the method comprising the step of culturing the recombinant host cell of claim 11 under conditions that allow for the production of the protein or nucleic acid.

18. Use of the transcriptional regulatory element according to any one of claims 1 to 5, the vector according to any one of claims 6 to 10, or the recombinant host cell according to claim 11 in any one or more of the following aspects a) to g): a) Efficient transcription of target genes, b) Efficient expression of target gene, c) preparing cells that efficiently transcribe or express target genes, d) preparing nucleic acids, proteins or polypeptides, e) preparing reagents or kits for efficiently transcribing or expressing target genes, f) preparing reagents or kits for detecting diseases caused by abnormal protein expression, g) preparing a medicament for treating or preventing a disease.

Citation Information

Patent Citations

  • Novel hyaluronic acid-hydrolyzing enzyme mutant and pharmaceutical composition comprising same

    CN111971387A

  • Recombinant human hyaluronidase preparation and application thereof

    CN114762677A

  • Recombinant RSV antigens

    US20150166610A1