A vector, kit and application for long-acting gene knockdown of animal parasitic nematodes
The lentivirus-mediated shRNA integration and expression technology has solved the problem of low dsRNA or siRNA delivery efficiency in animal parasitic nematodes, achieving long-lasting and stable gene knockdown effects, broadening the application scenarios, and making it suitable for gene function research in various tissues or organs.
Patent Information
- Application Number
- CN202510962517.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-14
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2045-07-14
AI Technical Summary
Existing technologies for animal parasitic nematodes suffer from problems such as low dsRNA or siRNA delivery efficiency, unstable gene silencing effects, poor reproducibility, and poor timeliness, which limit the in-depth development of gene function research in animal parasitic nematodes.
By employing lentivirus-mediated shRNA integration and expression technology, lentivirus recombinant plasmids are constructed, packaged and concentrated into lentivirus suspensions, and then used to infect animal parasitic nematodes, achieving stable and efficient delivery of shRNA and breaking through the bottleneck of traditional RNAi technology.
It achieves long-lasting and stable RNAi in animal parasitic nematodes with high delivery efficiency, suitable for gene function research in tissues or organs outside the intestine, with interference effect lasting up to 7 days or more and good reproducibility.
Smart Images

Figure CN120442717B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of animal parasitic disease prevention and treatment, and in particular to a vector, a kit and applications thereof for long-term gene knockdown of animal parasitic nematodes. Background Art
[0002] Parasitic nematode infections cause tens of billions of dollars in direct economic losses to the global livestock industry annually. However, widespread problems in aquaculture, such as multidrug resistance, slow development of new antiparasitic drugs, and a lack of effective vaccine protection, have long been a major bottleneck in the prevention and control of animal parasitic nematode diseases. Research into key biological processes in animal parasitic nematodes, including development, infection, and parasitism, as well as understanding the molecular mechanisms of drug resistance, developing new antiparasitic drugs, and exploring effective vaccine immunization options, has important socioeconomic and veterinary public health implications for the prevention and control of animal parasitic nematode infections and related human diseases.
[0003] The core scientific issues behind the technical bottlenecks in the prevention and control of animal parasitic nematode diseases include the large-scale activation of infective larvae in spring, which leads to animal disease (perinatal peak or spring peak), the worms' tolerance to the mode of action of existing anthelmintics, and the worms' ability to evade the host's immune attack. In-depth research on these core scientific issues relies on functional information at the molecular level, namely, the transmission of genetic information, the biological processes involved, and the phenotypic characteristics determined by it. Over the past 30 years, the Caenorhabditis elegans ( Caenorhabditis elegans ) has always been a model organism for biological research, and has played an unprecedented role in revealing the biological processes of animal parasitic nematodes such as development, reproduction, and drug resistance. Its functional gene information has therefore become an important reference for the study of homologous genes in parasitic nematodes. For example, based on the cross-species research strategy of homologous genes, nucleic acid sequencing, mass spectrometry analysis, heterologous expression, heterologous interference and other technologies are widely used in the molecular biology research of animal parasitic nematodes, which has promoted the research of animal parasitic nematodes and C. elegans The function and mechanism of genes related to common biological processes (including but not limited to growth, development and reproduction). However, this research strategy that relies on homologous genes of free-living nematodes is not suitable for studying the unique biological processes of animal parasitic nematodes, such as infection and immune evasion. For example, the blood-sucking parasitic nematode (Haemonchus contortus) that is widely parasitic on ruminants such as cattle, sheep, and camels, although it is related to C. elegans Although both belong to the closely related Clade V clade, the former has over 7,000 genes that have no homologs in the latter. These genes are highly likely to play a role in infection, pathogenicity, and immune evasion in Haemonchus contortus. However, a lack of detailed functional information and effective research tools has severely hampered the screening and translational research of novel intervention targets.
[0004] RNA interference (RNAi) is a C. elegans The classic reverse genetics research technology discovered in the literature can specifically mediate the degradation of target mRNA through exogenous or endogenous double-stranded RNA (dsRNA), leading to gene silencing at the post-transcriptional level. The principle is that after exogenous dsRNA enters the cell, it will form 21-25 nt primary single-stranded small RNA (siRNA) under the treatment of nuclease endonuclease. These siRNAs will form silencing complexes with homologous target gene mRNA and some enzymes, causing the target gene mRNA to degrade and thus achieve gene silencing. People have completed using high-throughput platforms C. elegans The genome-wide RNAi studies and phenotypic analyses of nematodes (Conte et al., 2015; Kamath et al., 2003; Lehner et al., 2006) have become an important reference for the study of gene function in animal parasitic nematodes.
[0005] Currently, there are three methods for preparing dsRNA or siRNA: chemical synthesis, in vitro transcription, and in vivo expression. The first two require specialized RNA transfection reagents to introduce the synthesized siRNA into the worm, while the latter (in vivo expression) involves constructing an siRNA expression vector, transfecting it into cells, and producing the corresponding siRNA through transcription. By introducing dsRNA or siRNA into animal parasitic nematodes through methods such as microinjection, feeding, immersion, and electroporation, dsRNA- or siRNA-mediated gene silencing or knockdown can be achieved. However, a series of RNAi studies on animal parasitic nematode genes have shown that RNAi technology has limitations in animal parasitic nematodes, such as low dsRNA or siRNA delivery efficiency, unstable gene silencing effects, and poor reproducibility, which severely restrict the study of gene function in animal parasitic nematodes.
[0006] Short hairpin RNA (shRNA) consists of two complementary RNA sequences of approximately 19-22 bp, connected by a short loop of approximately 4-11 bp. It is primarily transcribed in cells by RNA polymerase II or III from a DNA vector. The shRNA precursor is then processed by the RNase II enzyme, the Drosha complex, to produce the shRNA precursor, which is then transported to the cytoplasm. Finally, the Dicer complex removes the hairpin loop to produce the double-stranded siRNA. Therefore, shRNA can also mediate RNAi to achieve gene knockdown in cells, with higher specificity than dsRNA and lower off-target potential compared to in vitro synthesized siRNA.
[0007] Lentiviruses can integrate specific DNA fragments into cell chromosomes to achieve stable expression of exogenous genes. Integrating shRNA coding sequences into cells can also achieve sustained and stable expression of specific siRNAs. Therefore, lentiviral-mediated RNAi has been demonstrated and widely used in mammalian cells. Due to the unique biological characteristics of parasites, the application of this technology in animal parasitic nematodes is still in the exploratory stage. However, it holds great potential for addressing the limitations of reverse genetics research in animal parasitic nematodes, such as limited dsRNA or siRNA delivery, low gene silencing efficiency, unstable effects, poor reproducibility, and poor timeliness.
[0008] CRISPR / Cas9-based gene editing technology has not yet been successfully applied to the study of gene function in any obligate parasitic nematodes, limiting basic research on the infection, parasitism, and pathogenicity of animal parasitic nematodes and the discovery of new intervention targets. RNAi technology, widely used in functional genomics research in model organisms, also has shortcomings in the study of gene function in animal parasitic nematodes, such as low efficiency and poor reproducibility. Specifically,
[0009] (1) dsRNA or siRNA delivery technologies such as microinjection and electroporation are complex and costly, and the mortality rate of parasitic nematodes in treated animals is high, making it impossible to conduct subsequent experiments such as gene knockdown and phenotypic analysis.
[0010] (2) The feeding method is complex, costly, and inefficient. It requires constructing a dsRNA or siRNA expression vector first, transforming it into Escherichia coli, and then feeding the transformed Escherichia coli to the larvae in the free-feeding stage. The dsRNA or siRNA released by Escherichia coli can only exert its RNAi effect after being absorbed by the intestine, and the area in which it exerts its effect is limited.
[0011] (3) The immersion method uses transfection reagents to transfer in vitro synthesized siRNA into the worm body, which is costly and inefficient. Because the cuticle of the nematode epidermis is thick, the area where the siRNA delivered by the immersion method exerts RNAi is similar to the area where the siRNA exerts RNAi by the feeding method.
[0012] (4) The above methods are widely used in RNAi research on animal parasitic nematodes, but they have common limitations, including limited dsRNA or siRNA delivery, low gene silencing efficiency (can only achieve knockdown but not knockout or silencing effects), unstable effects, poor reproducibility, and short timeliness (gene knockout can generally only last for 24 hours, and basically recover to the original level after 72 hours). The core scientific problem behind these technical bottlenecks is that animal parasitic nematodes have special physiological structures and living habits, and the efficiency and range of dsRNA or siRNA delivery (nematode development period and nematode tissues and organs) are limited. A small amount of dsRNA or siRNA can only mediate gene knockdown in the short term and the effect is unstable. At present, there are no reports on long-term and stable RNAi technologies for animal parasitic nematodes. Summary of the Invention
[0013] The purpose of the present invention is to address the deficiencies of the existing technology and propose a vector, kit and application for long-term gene knockdown of animal parasitic nematodes. The lentivirus-mediated shRNA integration and expression technology is used to stably, efficiently and widely deliver siRNA in animal parasitic nematodes, prolong the interference time, broaden the application scenarios, break through the bottleneck of traditional animal parasitic nematode RNAi technology, establish a long-term RNAi technology system for animal parasitic nematodes, and solve the technical difficulties in the study of animal parasitic nematode infection and parasitism-related gene functions.
[0014] The purpose of the present invention is achieved through the following technical solutions: a vector for long-term gene knockdown of animal parasitic nematodes, first using the pGIPZ plasmid as a template, inserting the strong promoter of Caenorhabditis elegans by seamless cloning Ce-peft-3 , enhance fluorescent signal elements TurboGFP and Ce-tbb-2 The gene expression regulatory element 3'UTR was used to construct a lentiviral recombinant plasmid, which was packaged and concentrated into a lentiviral suspension and infected with the L3 larvae of the parasitic nematode infection stage of animals to verify the lentiviral-mediated integration of exogenous DNA; the target gene shRNA was designed and selected Age I and EcoR I designed the forward primer sequence SEQ ID NO.9 and the reverse primer sequence SEQ ID NO.10, inserted the shRNA into the pLKO.1 vector by double enzyme digestion, constructed an interference vector for stable expression of the target gene shRNA, and verified the stability of RNA interference.
[0015] Furthermore, a strong promoter was obtained by PCR amplification using the genomic DNA of Caenorhabditis elegans as a template. Ce- PEFT-3 Sequence, upstream primer and Ce-tbb-2 The 5' end of the primer downstream of the 3' UTR was respectively introduced with a restriction enzyme site to Ce-peft-3, Ce-tbb-2 3'UTR and TurboGFP Specific primers were designed and synthesized based on the CDS sequence for seamless cloning technology.
[0016] Furthermore, the designed interference plasmid primer sequence was used to form an insert fragment using the Anneal program, and the shRNA was inserted into the pLKO.1 vector using the double enzyme digestion method to construct the interference vector. The Anneal program parameters were: 37°C for 30 min, 95°C for 5 min, then the temperature was lowered from 95°C to 25°C in increments of 5°C every 2 min, and finally to 16°C for maintenance.
[0017] Further, the lentiviral recombinant plasmid was transformed into E. coli In TOP10 competent cells, after bacterial liquid PCR identification, the positive bacterial liquid was sequenced. 50 μL of the correctly sequenced bacterial liquid was inoculated into 25 mL of liquid LB medium containing ampicillin resistance, and cultured in a constant temperature shaker at 37°C, 190 rpm, and then the plasmid was extracted using a plasmid DNA miniprep kit for 24 h.
[0018] Further, the process of concentrating into a lentiviral suspension is as follows: all plasmids are added to 500 μL of DMEM, and then 120 μL of PEI is added to 500 μL of DMEM alone. After standing for 5 minutes, the liquid is mixed and then stood for 20 minutes; the mixed liquid is added to a 10 cm cell culture dish containing HEK 293T cells, and the HEK 293T cells are infected for 6 hours. After the liquid in the dish is changed, 12 μL of DMEM containing 10% fetal bovine serum is added to each dish; 5 μL of DMEM containing 10% fetal bovine serum is added at 24-36 hours; after filtering the collected supernatant, 7.5 mL of 5 x PEG8000 is added to every 30 mL, and mixed every 30 minutes for a total of 3-5 times, and incubated at 4°C overnight; centrifuged at 4000 g for 20 minutes at 4°C, the supernatant is discarded, the tube is left to stand for 1-2 minutes, and the residual liquid is aspirated; 500 μL The lentiviral precipitate was dissolved in DMEM, and the concentrated virus suspension was used for infection.
[0019] Furthermore, the L3 larvae of Haemonchus contortus were treated before infection. The specific process was as follows: physiological saline was added to the agar plate, and the L3 larvae of Haemonchus contortus were scraped from the wall of the culture dish with a pipette tip. After filtering, they were washed with sterile saline. 98 μL of NaClO solution was added to 10 mL of the larvae solution, and the larvae were desheathed at 190 rpm in a constant temperature shaker at 37°C for 25 min. 10 mL of sterile saline was added and shaken, and the larvae were centrifuged at 1000 g for 5 min, and the process was repeated several times to fully wash out the NaClO solution. 10 mL of nematode sterilization solution was added, and the larvae were thoroughly mixed on a rotary shaker and sterilized for 5 min. The process was repeated several times to fully sterilize the larvae. After each centrifugation at 1000 g for 5 min, the supernatant was discarded, DEME was added to resuspend the larvae, and 10 μL was taken for counting.
[0020] Furthermore, the L3 larvae of Haemonchus contortus were infected with lentivirus. Specifically, the L3 larvae treated with an MOI of 100 were cultured in an incubator at 38°C and 10% CO2. The worms were enriched after 24 hours of culture. After infection with the integration vector virus, DNA was extracted using the instructions of the tissue genomic DNA extraction kit. Specific primers for the integration and non-integration parts were designed according to the lentiviral vector. The extracted nematode genome was used as a template for PCR amplification. After infection with the interference vector virus, the worm RNA was extracted using the Trizol method and reverse transcribed using specific primers for real-time fluorescence quantitative PCR experiments to analyze the changes in gene transcription levels after interference.
[0021] In a second aspect, the present invention also provides a kit for a vector for long-term gene knockdown of animal parasitic nematodes.
[0022] In the third aspect, the present invention also provides a lentiviral vector-mediated Haemonchus contortus spi-i8 Application of long-term gene knockdown.
[0023] Beneficial effects of the present invention:
[0024] 1. It does not rely on traditional methods such as electroporation, feeding, and soaking to deliver dsRNA or siRNA. Instead, it integrates the shRNA coding sequence of the target gene into the animal parasitic nematode through lentiviral infection, producing specific siRNA targeting the target gene, with high delivery efficiency and good specificity.
[0025] 2. Lentiviruses integrated into the chromosomes of animal parasitic nematodes can stably express specific siRNAs, targeting target genes for extended periods, achieving stable, long-term interference effects with good reproducibility. Compared to the short-term interference (generally within 24 hours) of traditional electroporation, feeding, and immersion methods, lentivirus-mediated interference effects can last for 7 days or longer.
[0026] 3. Due to the infectious characteristics of lentiviruses, the RNAi technology mediated by lentiviruses is not limited to the developmental stage of nematodes, has high delivery efficiency and a wide range, and is suitable for functional studies of genes expressed in tissues or organs other than the intestines of animal parasitic nematodes, and may work across generations. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.
[0028] Figure 1 The following is a schematic diagram of the construction of the lentiviral transfection recombinant plasmid and the control of plasmid PCR. Among them, A is a schematic diagram of the pGIPZ (PG) template plasmid; B is a schematic diagram of the PCET recombinant plasmid, which is based on pGIPZ and adds Ce-peft-3 Promoter and Ce-tbb-2 3' UTR; C is the control amplification using the template plasmid (pGIPZ). M is a 100 bp DNA ladder (3422A) (same as below).
[0029] Figure 2 Schematic diagram of lentiviral transfection and concentration and standard curve drawing of the present invention; wherein A is the lentiviral transfection and concentration process, and B is the standard curve drawing process.
[0030] Figure 3 This is a schematic diagram of the identification results of the present invention's lentivirus-infected L3-stage Haemonchus contortus nematodes. A is nested PCR amplification of the Haemonchus contortus genome; 1: integrated gene from the negative control group; 2: integrated gene from the PCET group; 3: plasmid gene from the negative control group; 4: plasmid gene from the PCET group; B is laser confocal microscopy imaging of Haemonchus contortus.
[0031] Figure 4 Schematic diagram of the analysis results of the lentivirus-mediated exogenous protein expression of the present invention.
[0032] Figure 5 The present invention is the contortion nematode Haemonchus contortus spi-i8 Schematic diagram of the plasmid and the corresponding sequence.
[0033] Figure 6 The present invention is a lentiviral RNAi Haemonchus contortus spi-i8 Schematic diagram of gene level detection results.
[0034] Figure 7 The present invention is a lentiviral RNAi knockdown of Haemonchus contortus spi-i8Schematic diagram of phenotypic statistics; A is a schematic diagram for measuring body length, and B is a schematic diagram for measuring body width.
[0035] Figure 8 The present invention is a lentiviral RNAi knockdown of Haemonchus contortus spi-i8 Activity statistics diagram.
[0036] Figure 9 The present invention is a lentiviral RNAi knockdown of Haemonchus contortus spi-i8 Schematic diagram of the long-lasting gene knockdown effect.
[0037] Figure 10 The conventional immersion RNAi knockdown of Haemonchus contortus spi-i8 Schematic diagram of gene knockdown effect. DETAILED DESCRIPTION
[0038] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described below with reference to the accompanying drawings and examples. It should be understood that the specific examples described herein are only used to explain the present invention and are not intended to limit the present invention.
[0039] The present invention provides a vector for long-term gene knockdown of animal parasitic nematodes, and the specific construction process is as follows:
[0040] Lentiviral recombinant plasmid construction
[0041] (1) Ce-peft-3, Ce-tbb-2 3'UTR and TurboGFP The CDS sequence was used to design and synthesize specific primers (primers upstream of the promoter and primers upstream of the promoter). Ce-tbb-2 The promoter sequence was obtained by PCR amplification using the genomic DNA of Caenorhabditis elegans as a template. The PCR product was recovered and purified, and then ligated to the pMD19-T (simple) vector. The ligated product was then transformed into E. coli After PCR identification of the TOP10 competent cells, the positive bacterial cultures were sent to a biotechnology company for sequencing analysis. The total PCR reaction volume was 25 μL (Template: 1 μL, dNTPMixture (2.5 mM each): 2 μL; 10×LA PCR Buffer II (MgCl2) 2+The PCR reaction was performed in a Thermo Scientific SimpliAmp thermal cycler with a 95°C initial denaturation step of 5 min, followed by 30 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min; followed by a hold at 16°C.
[0042] (2) Using the pGIPZ plasmid as a template, perform double enzyme digestion to obtain a linearized vector. The total reaction volume is 20 μL (Plasmid / PCR product: 8 μL; QuickCut Xba I: 1 μL; QuickCut Not I: 1 μL; 10× QuickCut Green Buffer: 2 μL; sterile water: 8 μL). Mix well and incubate in a 37°C water bath for 2 h. The digestion products are separated and recovered by 1% (w / v; g / ml) agarose gel electrophoresis and purified using a DNA gel recovery kit.
[0043] (3) Use seamless cloning to insert the corresponding promoter, TurboGFP and Ce-tbb-2 3'UTR, construct a recombinant plasmid containing fluorescent protein for viral packaging. Seamless cloning system 20 μL (vector pGIPZ plasmid: 4 μL; 2× Seamless Cloning Mix: 10 μL; DNA fragment: 6 μL (1:1:1)). Mix well, keep in a 50℃ constant temperature water bath for 30 min, and then transform the ligation product into E. coli TOP10 competent cells. After bacterial liquid PCR identification, the positive bacterial liquid is sent to a biological company for sequencing analysis. Take 50 μL of the correct sequencing bacterial liquid and inoculate it into 25 mL of liquid LB medium containing ampicillin resistance, shake in a 37℃ constant temperature shaker at 190 rpm, and culture for 24 h. After that, use a plasmid DNA mini-extraction kit to extract the plasmid, see Figure 1 .
[0044] Lentivirus packaging, concentration, and titer determination
[0045] After thawing frozen HEK 293T cells, successfully identified plasmids were co-transfected into HEK 293T cells in a six-well plate at a dose of 12 μg of fluorescent plasmid, 9 μg of psPAX2, and 3 μg of pMD2.G per well. All plasmids were added to 500 μL of DMEM, followed by 120 μL of PEI per well in 500 μL of DMEM. Each well was allowed to stand for 5 minutes, then mixed and allowed to stand for another 20 minutes. The mixture was then gently added to a 10 cm cell culture dish containing 293T cells. After 6 hours of infection, the medium was changed, the contents of the dish were discarded, and 12 μL of DMEM supplemented with 10% (v / v) fetal bovine serum was added to each dish. At 24–36 hours, 5 μL of DMEM supplemented with 10% (v / v) fetal bovine serum was added. The collected supernatant was filtered through a 0.45 μm pore size filter, and 7.5 mL of 5xPEG8000 was added per 30 mL. Mix every 30 minutes for 3-5 times, and incubate at 4°C overnight. Centrifuge at 4000 g for 20 minutes at 4°C, discard the supernatant, and let the tube rest for 1-2 minutes before aspirating the remaining liquid. Add 500 μL of DMEM to dissolve the lentiviral precipitate. The concentrated viral suspension was used for infection experiments or stored at -80°C. The standard curve was drawn and the viral titer was determined using the Lenti-Pac™ Lentivirus Titer Assay Kit (GeneCopoeia, LT005). Figure 2 .
[0046] Lentivirus infection of nematodes and analysis of exogenous gene integration (taking Haemonchus contortus as an example)
[0047] (1) Collection and desheathing of L3 stage Haemonchus contortus: 10,000 active Haemonchus contortus nematodes were used to infect 4-6 month old Hu sheep. Fresh feces were collected 18 days after infection and thoroughly crushed with saturated salt water. The turbid liquid was passed through a 100-mesh copper sieve and centrifuged at 8,000 rpm for 10 min at room temperature. The eggs floating on the surface were dipped into clean water with a metal loop and centrifuged at 8,000 rpm for 10 min at room temperature. The supernatant was discarded and the precipitate was enriched with D-hanks' buffer. The precipitate suspension was spread on a 2% (w / v; g / mL) agar plate (6 mm in diameter) and cultured in a constant temperature incubator at 28°C for 7 days to obtain L3 stage larvae. Add physiological saline to the agar plate and scrape L3 Haemonchus contortus larvae from the sides of the culture dish with a pipette. Filter and wash three times with sterile physiological saline. Add 98 μL of NaClO solution (chemically pure CP) to 10 mL of the larval solution. Desheath the larvae at 190 rpm on a 37°C shaker for 25 minutes. Add 10 mL of sterile physiological saline, shake thoroughly, and centrifuge at 1000 g for 5 minutes five times to thoroughly remove the NaClO solution. Add 10 mL of nematode sterilization solution, mix thoroughly on a rotary shaker, and sterilize for 5 minutes. Repeat five times to thoroughly sterilize the larvae. Centrifuge at 1000 g for 5 minutes each time, discard the supernatant, resuspend the larvae in DEME, and take 10 μL of the solution for counting.
[0048] (2) Lentivirus infection of Haemonchus contortus: The treated Haemonchus contortus was immersed in the concentrated lentivirus suspension and cultured in a 38°C, 10% (v / v) CO2 incubator for 24 h before the worms were collected.
[0049] (3) Extraction of nematode genome: About 500 adult nematodes were placed in a 1.5 mL EP tube, 200 μL of buffered GA and 20 μL of Proteinase K solution were added, and the tube was incubated in a 56°C water bath for about 3 h (the sample was inverted and mixed 2–3 times per hour) until the tissue was completely dissolved. DNA was then extracted according to the instructions of the tissue genomic DNA extraction kit, and the genomic DNA was frozen at −20°C for later use.
[0050] (4) PCR identification of lentiviral integration in nematode genome: Specific primers for the integration part and the non-integration part were designed according to the lentiviral vector (PCR1 forward primer SEQ ID NO.1: ATGAACAGGGTCACGTCGTC; PCR1 reverse primer SEQ ID NO.2: AAGGAAGGTCCGCTGGATTG; PCR2 forward primer SEQ ID NO.3: CGTTTAGTGAACCGTCAGATCGCC; PCR2 reverse primer SEQ ID NO.4: CTCGAGCCGCGGCCGCTACTTGTACA; PCR3 forward primer SEQ ID NO.5: TTCCCTTCCTTTCTCGCCAC; PCR3 reverse primer SEQ ID NO.6: GGGAACCGGAGCTGAATGAA; PCR4 forward primer SEQ ID NO.7: ATGAAAAAAGCCTGAACTCA; PCR4 reverse primer SEQ ID NO.8: CTATTCCTTTGCCCTCGGA). The extracted nematode genome was used as a template for PCR amplification, and the product was purified by 1% (w / v; g / mL) agarose gel electrophoresis followed by UV imaging.
[0051] The total PCR reaction system was 25 μL (Template: 1 μL, dNTP Mixture (2.5 mM each): 2 μL; 10× LA PCR Buffer II (Mg 2+ The PCR reaction was performed using a Thermo Scientific SimpliAmp thermal cycler with a 95°C initial denaturation step of 5 min, followed by 30 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 1 min 30 s, and extension at 72°C for 1 min; the reaction was then held at 16°C.
[0052] (5) Fluorescence identification of worms: 10 Haemonchus contortus nematodes were collected and paralyzed with 1 M levamisole hydrochloride, and then slides were prepared. Fluorescence imaging was performed using a Zeiss 880 laser confocal microscope. Figure 3 .
[0053] (6) Identification of exogenous proteins by Western blot: Collect the contorted Haemonchus contortus and add 400 μL of 50 mM PBS (pH 7.4). Grind thoroughly on ice until homogenized. Add 50 mM PBS (pH 7.4) to 800 μL and grind thoroughly. Transfer the mixture to a 1.5 mL EP tube and freeze at -80°C for 1 h. Place it at 4°C for 30 min and freeze-thaw four times. Grind thoroughly again and add 0.5 M EDTA to the mixture to a final concentration of 10 mM. Use ultrasonic wave to break it (200 W, working 4.0 sec, interval 8.0 sec) for 10 min and store it at 4°C overnight. Centrifuge at 5000 rpm for 30 min at 4°C and collect the supernatant as water-soluble whole worm protein. Dissolve the precipitate with 500 μL of 8 M urea and centrifuge at 8000 rpm for 10 min at 4°C. Afterwards, the supernatant was collected as urea-soluble whole insect protein; water-soluble whole insect protein and urea-soluble whole insect protein were mixed at a ratio of 1:1 (v / v), and 5× protein loading buffer was added to prepare the protein sample. The remaining whole insect protein was frozen at -80℃.
[0054] A 12% (w / v, g / mL) polyacrylamide gel was prepared according to the instructions of the FINDER Biotech Polyacrylamide Gel Kit. Protein samples were centrifuged at 12,000 g for 5 minutes, and the appropriate amount of supernatant was added to the gel sample wells. The gel was then run on a Bio-Rad protein electrophoresis instrument at 200 V for 50 minutes. The gel and methanol-activated PVDF membrane were loaded onto a transfer cassette and transferred at a constant current of 0.22 A for 50 minutes. After transfer, the PVDF membrane was transferred to 5% (w / v, g / mL) skim milk (in TBST) and blocked at 37°C for 2 hours. The membrane was then washed five times for 3 minutes each with TBST, and then a 1:1000 (v / v) dilution of rat anti-TurboGFP antibody was added and incubated overnight at 4°C. The membrane was then washed five times for 5 minutes each with TBST, and then a 1:5000 (v / v) dilution of goat anti-rat IgG antibody was added and incubated for 2 hours. Wash with TBST 5 times, 5 min each time, add ECL chemiluminescence color development solution and take pictures with an imager. Figure 4 Tubulin is a microtubule protein and is used as an internal control for western blot protein expression analysis.
[0055] Lentiviral RNAi-mediated gene knockdown analysis (using Haemonchus contortus) spi-i8 genes as an example)
[0056] (1) Construction of lentivirus-mediated RNAi vector
[0057] Design target gene shRNA, select Age I and EcoR I designed primers (forward primer SEQ ID NO.9: ACCGGT GCCAAGAAACTGCCACGAAAT CTCGAG ATTTCGTGGCAGTTTCTTGGC TTTTTGAATT; reverse primer SEQ ID NO.10: AATTCAAAAA GCCAAGAAACTGCCACGAAAT CTCGAG ATTTCGTGGCAGTTTCTTGGC ACCGGT; the underline indicates the shRNA and its reverse complementary sequence). Insert fragments were formed using the Anneal procedure (37°C for 30 min, 95°C for 5 min, then decreasing from 95°C to 25°C every 2 min by 5°C, and finally decreasing to 16°C for maintenance). The shRNA was inserted into the pLKO.1 vector using the double enzyme digestion method to construct the interference vector. Since positive strains could not be detected by PCR and the copy number was low, the strains should be cultured in a constant temperature shaker at 37°C, 190 rpm, for 24 h before being sent for testing. Figure 5 .
[0058] (2) Lentivirus interference with Haemonchus contortus spi-i8 Gene
[0059] After obtaining the corresponding lentiviral concentrate by referring to the lentiviral packaging, concentration, and titer determination methods, the lentiviral concentrate was infected at an MOI of 100 according to the lentiviral infection nematode and exogenous gene detection methods to obtain treated L3 stage Haemonchus contortus nematodes, and cultured in a 38°C, 10% (w / v; g / mL) CO2 incubator.
[0060] (3) Extraction of total RNA from nematodes (Trizol method) and reverse transcription
[0061] Dissolve the parasites in 1 mL of Trizol and add an equal amount of grinding beads to each EP tube. Disrupt the mixture in a tissue homogenizer and let it stand at room temperature for 10 minutes. Add 200 μL of chloroform to the sample, shake vigorously for 15 seconds, mix thoroughly, and let it stand at room temperature for 10 minutes. Centrifuge at 12,000 rpm at 4°C for 15 minutes. Transfer 400 μL of the supernatant to a new EP tube, add 400 μL of isopropanol, mix thoroughly, and let it stand at room temperature for 10 minutes. Centrifuge at 12,000 rpm at 4°C for 10 minutes, and discard the supernatant. Wash the pellet thoroughly with 1 mL of 75% ethanol (prepared from 0.25 mL of DEPC water and 0.75 mL of anhydrous ethanol). Centrifuge at 12,000 rpm at 4°C for 10 minutes, and discard the supernatant. Open the lid and invert the tube onto filter paper to air-dry for 5–10 minutes. When the RNA pellet becomes transparent, add 11 μL of RNase-free water to dissolve the RNA. Measure the RNA concentration using a nano micro-nucleic acid analyzer. Perform reverse transcription using the HiScript® II Q RT SuperMix for qPCR (+gDNAwiper) kit using the following system: RNase-free ddH2O to 16 μL; 4× gDNA wiper mix: template RNA: Total RNA: 1 pg to 1 μg. Mix thoroughly by pipetting. Incubate at 42°C for 2 minutes. Add 4 μL of 5× HiScript II qRT SuperMix II directly to the reaction tube from step 1. Mix thoroughly by pipetting. Incubate at 50°C for 15 minutes and then at 85°C for 5 seconds. Store samples at -20°C.
[0062] (4) Phenotype and gene expression level determination (real-time fluorescence quantitative PCR experiment)
[0063] Target gene-specific primers were designed, and real-time fluorescence quantitative PCR was performed using cDNA as a template. The reaction system was 20 μL (2×SYBR qPCR Master Mix: 10 μL; Template: 1 μL; Primer F (10 μM): 1 μL; Primer R (10 μM): 1 μL; Sterile water: 7 μL). In a Roche LC480 fluorescence quantitative PCR instrument, the reaction was pre-denatured at 95°C for 1 min; 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s were performed; and melting curve data were collected at 95°C for 10 s, annealing at 60°C for 5 s, and denaturation at 95°C for 0.5 s. The CT values obtained in the experiment were calculated using the 2 -ΔΔCTRelative quantitative analysis was performed by comparative method. Statistical analysis was performed using one-way analysis of variance and t-test. GraphPad Prism 9.0 was used for plotting. When P < 0.05, the difference was significant and the experiment was statistically significant. The changes in gene transcription levels after interference were analyzed. Figure 6 .
[0064] Lentivirus-mediated RNAi knockdown in vitro has long-term efficacy
[0065] (1) Lentiviral long-term interference with Haemonchus contortus spi-i8 : After obtaining the corresponding lentiviral concentrate by referring to the lentivirus packaging, concentration and titer determination methods, the L3 stage Haemonchus contortus nematodes were infected at an MOI of 10 according to the lentivirus infection nematode and exogenous gene detection methods. The nematodes were cultured in a 38°C, 10% CO2 (v / v) incubator for 24 h. The worms were enriched and centrifuged at 1000 g for 5 min. Sterile saline was added and shaken, and then centrifuged at 1000 g for 5 min. This was repeated three times. The lentiviral concentrate was thoroughly washed, and 1:100 triple-antibody DMED medium was added. 300 worms per well (about 50 μL per well) were added to a 96-well plate and cultured in a 38°C, 10% CO2 (v / v) incubator.
[0066] (2) Activity measurement: The activity of larvae was measured every 24 h from 24 to 144 h after the disturbance using a WmicroTracker small animal activity analyzer, see Figure 8 .
[0067] (3) Phenotype and gene expression level determination: Body length and width were measured every 48 hours after anesthesia from 24 to 144 hours after the intervention. Figure 7 The RNA of the parasite was extracted by Trizol and reverse transcribed. Real-time fluorescence quantitative PCR was performed using specific primers to analyze the changes in gene transcription levels after interference. Figure 9 and Figure 10 .
[0068] The above embodiments are used to illustrate the present invention rather than to limit the present invention. Any modifications and changes made to the present invention within the spirit of the present invention and the protection scope of the claims shall fall within the protection scope of the present invention.
Claims
1. A vector for long-term gene knockdown of animal parasitic nematodes, characterized in that: First, the genomic DNA of Caenorhabditis elegans was used as a template to obtain Ce-peft-3 Promoter sequence, upstream primer and Ce- tbb-2 The 5' end of the primer downstream of the 3' UTR was respectively introduced with a restriction enzyme site to Ce-peft-3, Ce-tbb-2 3'UTR and TurboGFP The CDS sequence was used to design and synthesize specific primers for seamless cloning technology; Using pGIPZ plasmid as a template, insert the strong promoter of Caenorhabditis elegans by seamless cloning Ce-peft-3 、 TurboGFP and Ce-tbb-2 The gene expression regulatory element 3'UTR of the gene was used to construct a lentiviral recombinant plasmid, which was packaged and concentrated into a lentiviral suspension and infected with the L3 larvae of the animal parasitic nematode infection stage to verify the lentiviral-mediated integration of foreign DNA; Design target gene shRNA, select Age I and EcoR I designed the forward primer sequence SEQ ID NO.9 and the reverse primer sequence SEQ ID NO.10, and inserted the shRNA into the pLKO.1 vector by double enzyme digestion to construct an interference vector for stable expression of the target gene shRNA, targeting the target gene for a long time, achieving a stable and long-term interference effect, and verifying the stability of RNA interference.
2. A vector for long-term gene knockdown of animal parasitic nematodes according to claim 1, characterized in that: Transform the lentiviral recombinant plasmid into E. coli In the TOP10 competent cells, after bacterial liquid PCR identification, the positive bacterial liquid was sequenced. The correctly sequenced bacterial liquid was inoculated into liquid LB medium containing ampicillin resistance. After cultivation, the plasmid was extracted using a plasmid DNA mini kit.
3. A vector for long-term gene knockdown of animal parasitic nematodes according to claim 1, characterized in that: The specific process of concentrating into a lentiviral suspension is as follows: all plasmids are added to DMEM, and then PEI is added to DMEM alone; after standing, the mixture is added to a cell culture dish containing HEK 293T cells, and after infecting the HEK 293T cells, the medium is changed, the liquid in the dish is discarded, and DMEM containing fetal bovine serum is added to each dish; the collected supernatant is filtered, 5× PEG8000 is added, mixed and centrifuged, and the supernatant and residual liquid are discarded by aspiration; DMEM was added to dissolve the lentiviral precipitate, and the concentrated virus suspension was used for infection.
4. A vector for long-term gene knockdown of animal parasitic nematodes according to claim 1, characterized in that: The designed primer sequences were used to form insert fragments using the Anneal program, and the shRNA was inserted into the pLKO.1 vector using the double enzyme digestion method to construct the interference vector.
5. A kit comprising the vector for long-term gene knockdown of animal parasitic nematodes according to any one of claims 1 to 4.
6. A vector for long-term gene knockdown of animal parasitic nematodes according to any one of claims 1 to 4 for knocking down Haemonchus contortus in vitro by RNAi Hc-spi-i8 Application in genes.
Citation Information
Cited By
Application of nuclear receptor target gene in preparation of biological agent for blocking diapause larva activation
CN121780548A
Use of a nuclear receptor target gene in preparation of a biological agent for blocking activation of diapause larvae
CN121780548B