Methods and polynucleotides for amplifying target polynucleotides

Abstract

A method of amplifying a target polynucleotide, the method comprising: providing a template polynucleotide comprising a 5' hairpin, a target polynucleotide, and a 3' hairpin, wherein the 5' hairpin comprises one or more non-canonical nucleotides; and contacting the template polynucleotide with a polymerase and canonical nucleotides, wherein the polymerase extends the target polynucleotide from its 3' end using the canonical nucleotides to form a first extended polynucleotide comprising the 5' hairpin at its 5' end and a complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin; and the polymerase extends the first extended polynucleotide from its 3' end to form a second extended polynucleotide comprising the 5' hairpin at its 5' end and a complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin.

Description

Technical Field

[0001] This invention generally relates to methods for amplifying polynucleotides. It also generally relates to methods for characterizing amplified polynucleotides, and to reagents and kits for amplifying polynucleotides. Background Technology

[0002] Isothermal DNA amplification technology—rolling circle amplification (RCA)—has been developed based on the natural rolling circle replication process of bacteriophages. RCA is a process of unidirectional nucleic acid replication that can be used to rapidly synthesize multiple copies of circular polynucleotide molecules. RCA is widely used in molecular biology, especially for amplifying signals in biological detection methods.

[0003] There are three main methods for preparing RCA templates. In the first method, the template DNA can be circularized using a single-stranded DNA ligase before annealing with random or designed primers. The polymerase is used to amplify the DNA, and as amplification proceeds around the circular template, the polymerase replaces the primers and extension products. The disadvantage of this method is that it is difficult to circularize the DNA, only information about the template strand is obtained, and the template is never included in the product; only copies are contained within it.

[0004] In the second method, an oligonucleotide clamp with a known sequence complementary to both ends of a single-stranded DNA is annealed to the single-stranded DNA, and the gap between the two ends of the single-stranded DNA is sealed with double-stranded DNA ligase to circularize the template. Polymerase amplification begins with the clamp acting as a primer, and the primers and extension products are replaced as polymerase amplification progresses. The disadvantage of this method is that it requires knowledge of the single-stranded sequence to circularize the DNA; it only provides information about the template strand, and the template is never included in the product, only the copy is.

[0005] In the third method, a DNA hairpin is attached to both strands of a double-stranded DNA. Primers complementary to the DNA hairpin are annealed, and polymerase is used to amplify both strands of the DNA. As amplification proceeds, the polymerase replaces the primers and the extension product. A disadvantage of this method is that the template is never included in the product; only copies are contained within it.

[0006] Loop-mediated isothermal amplification (LAMP) is a single-tube technique for amplifying DNA at an isothermal temperature using two or three primer pairs and polymerase. Summary of the Invention

[0007] The inventors have devised a method for rolling linear amplification. This method uses a polymerase to copy 5' hairpins at the ends of a polynucleotide chain, each hairpin comprising at least one atypical base to generate a complementary sequence that may form a 3' hairpin. Because the 5' hairpin contains at least one modified nucleotide, and the complementary sequence is synthesized using typical nucleotides, it is energy-efficient to form 3' and 5' hairpins at the ends of the extended polynucleotide compared to hybridization between the 3' and 5' ends of the extended polynucleotide. Therefore, in the extended polynucleotide, after the synthesis of an extension complementary to the original polynucleotide chain, the original 5' hairpin and the new 3' hairpin are rapidly formed. The newly formed 3' hairpin provides a site from which the polymerase can copy the extended polynucleotide, allowing the entire cycle to be repeated. This cycle can be repeated multiple times.

[0008] The advantage of the new method is that it can be performed without knowledge of the target sequence or can be made target-specific. For example, an adaptor including a 5' hairpin can be attached to the 5' end of a single-stranded target polynucleotide, or to the 5' end of one or both strands of a double-stranded polynucleotide. The 5' hairpin can be attached, for example, by ligation, topological ligation, click chemistry, or by using a transposase. An adaptor including a 3' hairpin can be attached to the 3' end of a template polynucleotide, or to the 3' end of one or both strands of a double-stranded polynucleotide. The adaptor can include both the 5' and 3' hairpins. Alternatively, the 5' hairpin can be included in PCR primers that can be used to amplify a polynucleotide sequence between two known sequences.

[0009] The advantage of this new method is that the original target sequence can be included in the amplified product, which is an extension of the template polynucleotide. This is particularly useful for generating products for detecting modifications to polynucleotides (e.g., DNA methylation).

[0010] Therefore, this paper provides a method for amplifying target polynucleotides, the method comprising:

[0011] (a) Provide a template polynucleotide comprising a 5' hairpin, a target polynucleotide, and a 3' hairpin, wherein the 5' hairpin comprises one or more atypical nucleotides;

[0012] (b) Contact the template polynucleotide with a polymerase and a typical nucleotide, wherein:

[0013] (i) The polymerase uses the typical nucleotide to extend the template polynucleotide from its 3' end to form a first extended polynucleotide, the first extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin; and

[0014] (ii) The polymerase causes the first extended polynucleotide to extend from its 3' end to form a second extended polynucleotide, the second extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin.

[0015] The following methods utilizing this principle are also provided:

[0016] - A method for amplifying a target polynucleotide, the method comprising:

[0017] (a) Provide primer pairs, wherein each primer includes a 5' hairpin containing one or more atypical nucleotides;

[0018] (b) Under conditions suitable for polymerase activity, contact the sample comprising the target polynucleotide with the primer pair, polymerase, and typical nucleotide; and

[0019] - A method for amplifying a target polynucleotide, the method comprising:

[0020] (a) Linking an adaptor to the target polynucleotide to generate a template polynucleotide, the adaptor comprising a 5' hairpin containing one or more atypical nucleotides;

[0021] (b) Under conditions suitable for polymerase activity, the template polynucleotide is contacted with polymerase and typical nucleotides.

[0022] Also provided:

[0023] - An extended polynucleotide, which can be obtained by the above method;

[0024] - A method for characterizing polynucleotides, the method comprising:

[0025] (a) Contacting the extended polynucleotide obtained by the above method with a nanopore, causing the polynucleotide to translocate through the nanopore; and

[0026] (b) Perform one or more measurements as the polynucleotide moves relative to the nanopore, wherein the measurements indicate one or more properties of the polynucleotide and thereby characterize the polynucleotide;

[0027] - A double-stranded polynucleotide adapter comprising a first strand and a second strand, wherein the first strand comprises a 5' hairpin containing one or more atypical nucleotides, and the second strand comprises a 3' hairpin.

[0028] - A PCR primer pair, wherein each primer includes a 5' hairpin containing one or more atypical nucleotides; and

[0029] - A kit for amplifying target polynucleotides, the kit comprising: an adaptor comprising a first strand and a second strand, wherein the first strand comprises a 5' hairpin containing one or more atypical nucleotides, and the second strand comprises a 3' hairpin or a PCR primer pair, wherein each primer comprises a 5' hairpin containing one or more atypical nucleotides; and a polymerase. Attached Figure Description

[0030] It should be understood that the accompanying drawings are for illustrative purposes and are not intended to be restrictive.

[0031] Figure 1 illustrates the principle of rolling circle amplification (RoBA) as known in the prior art. Figure 1 shows three main methods for preparing RoBA templates. A: The template DNA is circularized using a single-stranded DNA ligase before annealing with random or designed primers. Polymerase amplification begins, and primers and extension products are replaced as polymerase amplification proceeds. B: An oligonucleotide clip with a known sequence complementary to both ends of the single-stranded DNA is annealed, and the gap is sealed with double-stranded DNA ligase to circularize the template. Polymerase amplification begins (where the clip acts as a primer), and primers and extension products are replaced as polymerase amplification proceeds. C: A DNA hairpin is ligated to both strands of a double-stranded DNA. Primers complementary to the DNA hairpin are annealed, and polymerase amplification begins. As amplification continues, primers and extension products are replaced as amplification proceeds.

[0032] Figure 2The principle of rolling linear amplification is demonstrated. The starting template polynucleotide includes a target polynucleotide (1), a 5' hairpin (2), and a 3' hairpin (3). The 5' hairpin (2) includes at least one atypical nucleotide. The 3' hairpin promotes the binding of polymerase (6) to the 3' end of the template polynucleotide. The polymerase then extends the 3' end of the template polynucleotide by synthesizing complement of the template using only typical nucleotides (dA, dT, dG, dC) containing the target polynucleotide and the 5' hairpin. It is more energy-efficient for the 5' hairpin to reorganize and for the complement of the 5' hairpin to form a new 3' hairpin compared to hybridizing the 5' hairpin to its complement. Therefore, the extension product forms a new template including the target polynucleotide (1), the 5' hairpin (2), the 3' hairpin (3), and the complement of the target polynucleotide (4). The 3' hairpin promotes the binding of polymerase (6) to the 3' end of the template polynucleotide. Then, the polymerase extends the 3' end of the template polynucleotide by synthesizing complement of the template using only typical nucleotides (dA, dT, dG, dC) containing the target polynucleotide and the 5' hairpin. It is more energy-efficient to reorganize the 5' hairpin and for the complement of the 5' hairpin to form a new 3' hairpin compared to hybridizing the 5' hairpin to its complement. Therefore, the second extension product forms a new template comprising the target polynucleotide (1), the 5' hairpin (2), the 3' hairpin (3), two complements of the target polynucleotide (4), and a copy of the target polynucleotide. The extension cycle can be repeated to produce increasingly longer templates comprising multiple copies of the template polynucleotide, the template polynucleotide, and its complement.

[0033] Figure 3 further illustrates the principle of rolling linear amplification using a connector including a 5' hairpin. Figure 2 The amplification cycle shown is depicted in the lower right corner of Figure 3, but using a double-stranded template instead of the one shown. Figure 2The single-stranded template is shown. A: A double-stranded adapter consisting of a 5' hairpin (3) composed only of typical nucleotides is attached to a double-stranded template polynucleotide (1), and then polymerase (4) and typical nucleotides (dA, dT, dG, dC) are added to produce a double-stranded polynucleotide in which the two strands hybridize along the full length of the polynucleotide. The polymerase synthesizes complement of the 5' hairpin and is more energy-efficient than forming a terminal hairpin. B: A double-stranded polynucleotide consisting of a 5' hairpin (2) composed of both typical and atypical nucleotides (e.g., dITAZ, where dI is deoxyinosine and dZ is deoxyzebularine) is attached to a double-stranded template polynucleotide (1), and then polymerase and typical nucleotides are added to produce a double-stranded polynucleotide in which only the central portions of the two strands hybridize with each other, while the 5' and 3' ends form hairpins. This occurs because folding the dGTAC complement of the dITAZ sequence to form a hairpin containing GC base pairs is more advantageous than maintaining base pairing between the dGTAC complement of the dITAZ sequence and the dITAZ nucleotide in the top strand. When base pairing occurs with the typical nucleotides G and C in the bottom strand, the atypical nucleotides I and Z each form two hydrogen bonds per base pair. Therefore, the dissociation of the top and bottom strands and the formation of the hairpin are more energy-advantageous than the formation of two hydrogen bonds per base pair with atypical nucleotides, because dissociation allows the typical nucleotides G and C in the bottom strand to form GC base pairs, each with three hydrogen bonds. The polymerase then fills in the newly formed 3' hairpin and repeats the process to produce, for example, the hairpin with GC base pairs containing GC base pairs. Figure 2 The illustration depicts multiple copies of the link template and complement.

[0034] Figure 4The diagram shows the analytical results of products obtained when an adaptor including a 5'dGTAC hairpin (B) or a 5'dITAZ hairpin (C) was ligated to a 124 bp polynucleotide (a PCR product with end repair and a polyA tail) on an Agilent chip. A shows the trace obtained when analyzing the 124 bp polynucleotide alone. Peaks labeled 15 and 1500 are labeled, and the peak labeled 119 represents the 124 bp polynucleotide. B shows the trace overlaid on the trace from A after ligating the adaptor including the 5'dGTAC hairpin to the 124 bp polynucleotide. During the ligation reaction, the adaptor was added to both ends of some molecules of the 124 bp polynucleotide (indicated by peaks labeled 2x) and only to one end of other molecules of the 124 bp polynucleotide (labeled by peaks labeled 1x). C shows the trace overlaid on the trace from A after ligating the adaptor including the 5'dITAZ hairpin to the 124 bp polynucleotide. During the ligation reaction, an adaptor is added to both ends of some 124 bp polynucleotide molecules (represented by peaks labeled 2x) and to one end of other 124 bp polynucleotide molecules (represented by peaks labeled 1x).

[0035] Figure 5 shows the analytical results of the product obtained when polymerase and SSB were added to the 124 bp polynucleotide ligated to the adaptor. A shows the product obtained using a dGTAC 5' hairpin, where the trace of the product from the ligation reaction was obtained before the addition of polymerase and the overlying SSB. The ligation product ( Figure 4 The peaks (labeled 1x and 2x) were transferred to the 3' end of the double-stranded 124 bp polynucleotide opposite to the 5' hairpin in the inner strand, which had been filled in by polymerase. B shows the product obtained using the dITAZ 5' hairpin, with trace coverage obtained for the product of the ligation reaction before the addition of polymerase and SSB. The ligation product ( Figure 4 Some ligation products (labeled 1x and 2x) shifted to small peaks corresponding to a 124 bp double-stranded polynucleotide whose 3' end, opposite to the 5' hairpin, had been filled in by polymerase. Large peaks also existed corresponding to high molecular weight repetitive polynucleotide structures. C represents the coverage of the reaction products obtained using the dGTAC 5' hairpin and the reaction products obtained using the dITAZ 5' hairpin.

[0036] Figure 6 shows the electrophysiological data obtained using the MinION DNA sequencing device from Oxford Nanopore Technology. A shows the short reads obtained when using the dGTAC 5' hairpin adaptor, while B shows the population of reads with increased lengths obtained when using the dITAZ 5' hairpin adaptor.

[0037] Figure 7The analysis results of MinION sequencing data from a single repetitive molecule obtained using the dITAZ 5' hairpin adaptor are shown. The repetitive molecule contains multiple repetitive sequences of the target sequence and complement. The sequencing data of each repetitive sequence were stacked collectively, achieving 98% accuracy for a single molecule.

[0038] Figure 8 This illustrates the principle behind Example 4. The adaptor consists of a top chain containing a spacer region (XXXXXXXX) and an IZ-containing region forming a hairpin, and an annealed bottom chain containing a restriction site sequence, wherein there is a base pair mismatch between the top chain and the bottom chain annealed to the restriction site sequence. The polymerase produces complement of the hairpin sequence and terminates when the polymerase reaches the spacer. The hairpin in the top chain re-aligns because this is more energy-efficient than binding to its newly synthesized complement (which forms a 3' hairpin on the bottom chain). The 3' hairpin serves as the starting site for the polymerase to synthesize complement of the bottom chain. This produces a double-stranded product containing a restriction site that can be cleaved by a restriction enzyme (SpeI in Example 4).

[0039] Figure 9 The size of the hairpin connectors on the Agilent 1000 chip is shown. Connector 1 is RLA_Top+RLA_btm_v2_SpeI; connector 2 is RLA_Top-dA+RLA_btm_v2_SpeI; connector 3 is RLA_Top-12bp1+RLA_btm_v2_SpeI; connector 4 is RLA_Top-12bp2+RLA_btm_v2_SpeI.

[0040] Figure 10 This shows the Agilent 1000 chip traces of the products generated when polymerase Bst 3.0 was used to complete the adaptors formed by annealing RLA_Top and RLA_btm_v2_SpeI. Traces with and without polymerase are shown.

[0041] Figure 11 This shows the Agilent 1000 chip traces showing the products generated when polymerase Bst 3.0 was used to complete the adaptors formed by annealing RLA_Top-dA and RLA_btm_v2_SpeI. Traces with and without polymerase are shown.

[0042] Figure 12 This shows the Agilent 1000 chip traces of the product obtained when polymerase Bst 3.0 was used to fill in the adaptor formed by annealing RLA_Top-12bp1 and RLA_btm_v2_SpeI. Traces with and without polymerase are covered. The size of the additional peak is the same as that of one of the digestion products. Therefore, it is believed that a small amount of SpeI contaminated the sample.

[0043] Figure 13 This shows the Agilent 1000 chip traces of the product obtained when polymerase Bst 3.0 was used to complete the adaptor formed by annealing RLA_Top-12bp2 and RLA_btm_v2_SpeI. Traces with and without polymerase are covered.

[0044] Figure 14 This is an instance of the negative result seen for SpeI digestion used in the connectors RLA_Top and RLA_btm_v2_SpeI. It covers traces where SpeI is absent and where it is present.

[0045] Figure 15 The digestion of the Spe1-completion product is shown, confirming that the Spe1 remodeling site is formed in the amplification product generated by the action of Bst 3.0 polymerase. Traces of the RLA_Top and RLA_btm_v2_SpeI adaptors, the completion product, and the completion product digested by SpeI are shown.

[0046] Figure 16 Amplification products generated at different incubation temperatures were compared. Baseline _noTS was performed at 50°C. Other temperatures used, as indicated in the figure, were 55°C, 60°C, 65°C, and 70°C. Products were sequenced using a flow cell from Oxford Nanopore Technologies, and the presence of repetitive sequences in the template and complement regions was analyzed. The number of repetitive sequences was... Figure 16 The bar chart is shown in the image.

[0047] Sequence List Description

[0048] SEQ ID NO:1 is the top strand of a control DNA adaptor that includes only a 5' hairpin-forming sequence comprising dGTAC nucleotides.

[0049] SEQ ID NO:2 is the top strand of a DNA adaptor that includes a 5' hairpin forming sequence containing dITAZ nucleotides.

[0050] SEQ ID NO:3 is the bottom strand of both the control DNA adaptor and the DNS adaptor disclosed herein.

[0051] SEQ ID NO:4 is the sequence of the 5'dITAZ tail added to the PCR primer.

[0052] SEQ ID NO:5 is the top strand (RLA_Top) of a DNA adaptor that includes a 5' hairpin forming sequence containing dITAZ nucleotides.

[0053] SEQ ID NO:6 is the top strand (RLA_Top-Da) of a DNA adaptor that includes a 5' hairpin-forming sequence containing dITAZ nucleotides.

[0054] SEQ ID NO:7 is the top strand (RLA_Top-12bp1) of a DNA adaptor that includes a 5' hairpin-forming sequence containing dITAZ nucleotides.

[0055] SEQ ID NO:8 is the top strand (RLA_Top-12bp2) of a DNA adaptor that includes a 5' hairpin forming sequence containing dITAZ nucleotides.

[0056] SEQ ID NO:9 is the bottom strand (RLA_btm_v2_SpeI) of the DNA adaptor that includes the restriction site of SpeI and hybridizes with each of SEQ ID NO:5 to 8 in a single base pair mismatch at the restriction site region.

[0057] SEQ ID NO:10 is the bottom strand (RLA_btm_v2) of the DNA adaptor that is complementary to and hybridizes with each of SEQ ID NO:5 to 8.

[0058] SEQ ID NO:11 is the top strand of a DNA adaptor that includes a 5' hairpin forming sequence containing dITAZ nucleotides. Detailed Implementation

[0059] It should be understood that different applications of the disclosed methods and products can be tailored to specific needs in the art. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments of the methods and products only and is not intended to be limiting.

[0060] Furthermore, as used in this specification and the appended claims, unless otherwise expressly indicated, the singular forms "a," "an," and "the" all include the plural objects. Thus, for example, references to "polynucleotide" include two or more polynucleotides, references to "an anchor" refer to two or more anchors, references to "helicase" include two or more helicases, and references to "transmembrane pore" include two or more pores, etc.

[0061] All publications, patents and patent applications cited in this document (both above and below) are incorporated herein by reference in their entirety.

[0062] Amplification methods

[0063] The inventors have devised a method for amplifying polynucleotides, the method comprising:

[0064] (a) Provide a template polynucleotide comprising a 5' hairpin, a target polynucleotide, and a 3' hairpin, wherein the 5' hairpin comprises one or more atypical nucleotides;

[0065] (b) Contact the template polynucleotide with a polymerase and a typical nucleotide, wherein:

[0066] (i) The polymerase uses the typical nucleotide to extend the template polynucleotide from its 3' end to form a first extended polynucleotide, the first extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin; and

[0067] (ii) The polymerase causes the first extended polynucleotide to extend from its 3' end to form a second extended polynucleotide, the second extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin.

[0068] Similar to the starting template polynucleotide, the extended polynucleotide in the method comprises a 5' hairpin and a 3' hairpin containing at least one atypical nucleotide. Therefore, each extended polynucleotide can serve as a template polynucleotide and be extended by polymerase to produce additional extended polynucleotides comprising a 5' hairpin and a 3' hairpin containing at least one atypical nucleotide.

[0069] Therefore, the polymerase can extend the second extended polynucleotide from its 3' end to form a third extended polynucleotide, the third extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin. The polymerase can extend the third extended polynucleotide, and optionally by extending the third extended polynucleotide and / or by any other extended polynucleotides generated by subsequent extension, to produce additional extended polynucleotides comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin.

[0070] The amplification cycle (i.e., the extension of the polymerase from the 3' hairpin to synthesize complement containing a polynucleotide chain with a 5' hairpin having at least one atypical nucleotide) can be repeated multiple times, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times to up to about 20, 30, 40, 50, 100, 200, 300, 400 or 500 times.

[0071] In one embodiment, the amplification cycle can be repeated until the extension product has the desired length. For example, the amplification cycle can be repeated until the length of the extension product is 50 base pairs, such as 100 base pairs, 500 base pairs, 1 kb, 10 kb, 100 kb, 250 kb, or 500 kb, to more than 1,000 kb, such as 2,000 kb, 5,000 kb, or 10,000 kb.

[0072] The method can be performed such that steps (a) and (b) are performed sequentially or simultaneously.

[0073] In one embodiment, a method for amplifying a target polynucleotide is provided, the method comprising:

[0074] a) Provide a template polynucleotide comprising a 5' hairpin, a target polynucleotide, and a 3' hairpin, wherein the 5' hairpin comprises a typical nucleotide;

[0075] b) Contact the template polynucleotide with a polymerase and at least one atypical nucleotide, wherein:

[0076] (i) The polymerase causes the template polynucleotide to extend from its 3' end to form a first extended polynucleotide, the first extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin; and

[0077] (ii) The polymerase causes the first extended polynucleotide to extend from its 3' end to form a second extended polynucleotide, the second extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin.

[0078] In this embodiment, the 5' hairpin may contain only typical nucleotides, and the complementary sequence is synthesized using at least one atypical nucleotide. Therefore, it is more energy-efficient to form 3' and 5' hairpins at the ends of the extended polynucleotide compared to hybridization between the 3' and 5' ends of the extended polynucleotide. Thus, in the extended polynucleotide, after the synthesis of an extension complementary to the original polynucleotide chain, the original 5' hairpin and the new 3' hairpin are rapidly formed. The newly formed 3' hairpin provides a site from which the polymerase can copy the extended polynucleotide, allowing the entire cycle to be repeated. This cycle can be repeated multiple times.

[0079] Hairpin structures can be formed in ways other than using atypical nucleotides. For example, because the ends of double-stranded DNA are in a dynamic equilibrium between a melted single-stranded form and an annealed double-stranded form, hairpins may form at the ends of double-stranded DNA when a palindromic complementary sequence is present. In such DNA molecules, hairpin formation can be influenced by increasing the AT content and / or by including repetitive sequences to increase the likelihood of hairpin formation by weakening the double-strand conformation. The use of atypical nucleotides in this disclosure is advantageous compared to using repetitive AT-containing sequences because it is more energy-efficient to form hairpins between typical nucleotides at the 3' end of the newly synthesized strand than to form double-stranded polynucleotides between atypical and typical nucleotides. Therefore, hairpin formation is guaranteed, rather than being in a balance of limited probabilities of hairpin formation. This means that more and longer amplification products containing more copies of the target polynucleotide will be produced.

[0080] 5' hairpin

[0081] A 5' hair clip can be of any length. For example, a hair clip can include 2 to 20 base-paired nucleotides, such as 3, 4, 5, 6, 7, 8, 9, 10, 12, or 15 base-paired nucleotides.

[0082] Nucleic acid hairpins, also known as stem-loops, typically consist of a double-stranded stem portion of base-paired nucleotides and a single-stranded loop portion of non-base-paired nucleotides connecting the two strands of the stem.

[0083] Therefore, a 5' hair clip may include a stem portion and a loop portion.

[0084] In some embodiments, the stem of the 5' hairpin is about 5 to about 15 nucleotides in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length. Thus, the stem may comprise about 5 to about 15 nucleotide base pairs forming a double-stranded polynucleotide segment.

[0085] In some embodiments, the loop of the 5' hairpin comprises about 2 to about 10 nucleotides, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

[0086] The 5' hairpin includes at least one atypical nucleotide. Any atypical nucleotide that can form base pairs with a typical nucleotide can be used. As used herein, the term atypical nucleotide includes any nucleotide that includes bases other than guanine (G), thymine (T), adenine (A), cytosine (C), and uracil (U). Examples of suitable atypical nucleotides include inosine, zebularine, 2-amino-adenine (e.g., 2-amino-dA), 2-thiothymine, and 2-aminopurine. Inosine is a universal nucleotide. Specifically, inosine can form base pairs with cytosine, uracil, adenine, or zebularine. Zebularine is similar to cytosine and therefore can form base pairs with guanine or inosine. 2-amino-dA can form base pairs with thymine or inosine. Preferably, the hairpin includes zebularine and inosine. In one embodiment, zebralin and inosine nucleotides are located in a polynucleotide such that zebralin and inosine nucleotides are base-paired with each other in the hairpin.

[0087] Atypical nucleotides can be modified nucleotides, including those modified with G, T, A, C, or U. Atypical nucleotides may include methylcytosine, 2,6-diaminopurine-2'-deoxyribonucleoside, 2-aminopurine-2'-deoxyribonucleoside, 2,6-diaminopurine-ribonucleoside, 2-aminopurine-ribonucleoside, pseudouridine, puromycin, 2,6-diaminopurine-2'-O-methylribonucleoside, 2-aminopurine-2'-O-methylribonucleoside, and cytarabine.

[0088] Atypical nucleotides can be universal nucleotides. A universal nucleotide is a nucleotide that hybridizes or binds to all nucleotides of the template polynucleotide to some extent. A universal nucleotide is preferably a nucleotide that hybridizes or binds to any two or more, such as any three, any four, or all of the nucleotides including A, T, G, C, and U. A universal nucleotide can hybridize or bind to some nucleotides more strongly than others. For example, a preferred pairing order of IC>IA>IG approximately = IT will be shown.

[0089] Universal nucleotides may include one of the following bases: hypoxanthine, 4-nitroindole, 5-nitroindole, 6-nitroindole, formylindole, 3-nitropyrrole, nitroimidazole, 4-nitropyrazole, 4-nitrobenzimidazole, 5-nitroindazole, 4-aminobenzimidazole, or phenyl (C6-aromatic ring). Universal nucleotides may include one of the following nucleosides: 2'-deoxyinosine, inosine, 7-deazo-2'-deoxyinosine, 7-deazo-inosine, 2-aza-deoxyinosine, 2-aza-inosine, 2-O'-methylinosine, 4-nitroindole 2'-deoxynucleoside, 4-nitroindole nucleoside, 5-nitroindole 2'-deoxynucleoside, 5-nitroindole nucleoside, 6-nitroindole 2'-deoxynucleoside, 6-nitroindole nucleoside, 3-nitropyrrole 2'-deoxynucleoside, 3-nitropyrrole nucleoside, noncyclic sugar analogs of hypoxanthine, nitroimide 2'-deoxynucleoside, nitroimidazole nucleoside, 4-nitropyrazole 2'-deoxynucleoside, 4-nitropyrazole nucleoside, 4-nitrobenzimidazole 2'-deoxynucleoside, 4-nitrobenzimidazole nucleoside, 5-nitroindazole 2'-deoxynucleoside, 5-nitroindazole nucleoside, 4-aminobenzimidazole 2'-deoxynucleoside, 4-aminobenzimidazole nucleoside, phenyl C-nucleoside, phenyl C-2'-deoxyribosylnucleoside, 2'-deoxycytosine, 2'-deoxyisoguanosine, K-2'-deoxynucleoside, P-2'-deoxynucleoside and pyrrolidine.

[0090] Atypical nucleotides may include chemical atoms or groups not present in typical nucleotides, such as propynyl, thio, oxo, methyl, hydroxymethyl, formyl, carboxyl, carbonyl, benzyl, propynyl, or propynylamine. Chemical groups or atoms may be or may include fluorescent molecules, biotin, digitalisin, DNP (dinitrophenol), light-labile groups, alkynes, DBCO, azides, free amino groups, redox dyes, mercury atoms, or selenium atoms.Commercially available nucleosides that may be present in atypical nucleotides and include such chemical groups include, but are not limited to, 6-thio-2'-deoxyguanosine, 7-deazon-2'-deoxyadenosine, 7-deazon-2'-deoxyguanosine, 7-deazon-2'-deoxyflavin, 7-deazon-8-nitro-2'-deoxyadenosine, 8-5'(5'S)-cyclo-2'-deoxyadenosine, 8-amino-2'-deoxyadenosine, 8-amino-2'-deoxyguanosine, 8-deuteron-2'-deoxyguanosine, 8-oxo-2'-deoxyadenosine, 8-oxo-2'-deoxyguanosine, vinylidene-2'-deoxyadenosine, N6-methyl-2'-deoxyadenosine, O6 2-Methyl-2'-deoxyguanosine, O6-phenyl-2'-deoxyinosine, 2'-deoxypseudouridine, 2-thiothymidine, 4-thio-2'-deoxyuridine, 4-thiothymidine, 5'-aminothymidine, 5-(1-alkynylethynyl)-2'-deoxyuridine, 5-(C2-EDTA)-2'-deoxyuridine, 5-(carboxy)vinyl-2'-deoxyuridine, 5,6-dihydro-2'-deoxyuridine, 5,6-dihydrothymidine, 5-bromo-2'-deoxycytidine, 5-bromo-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-fluoro-2'-deoxyuridine, 5-formyl-2'-deoxycytidine, 5-hydroxy -2'-Deoxycytidine, 5-hydroxy-2'-deoxyuridine, 5-hydroxymethyl-2'-deoxycytidine, 5-hydroxymethyl-2'-deoxyuridine, 5-iodo-2'-deoxycytidine, 5-iodo-2'-deoxyuridine, 5-methyl-2'-deoxycytidine, 5-methyl-2'-deoxyisocytidine, 5-propynyl-2'-deoxycytidine, 5-propynyl-2'-deoxyuridine, 6-O-(TMP)-5-F-2'-deoxyuridine, C4-(1,2,4-triazol-1-yl)-2'-deoxyuridine, C8-ethynyl-thymidine, dT-ferrocene, N4-ethyl-2'-deoxycytidine, O4-methylthymidine, pyrrole -2'-Deoxycytidine, thymidine glycol, 4-thiouridine, 5-methylcytidine, 5-methyluridine, pyrrolocytidine, 3-deazino-5-aza-2'-O-methylcytidine, 5-fluoro-2'-O-methyluridine, 5-fluoro-4-O-TMP-2'-O-methyluridine, 5-methyl-2'-O-methylcytidine, 5-methyl-2'-O-methylthymidine, 2',3'-dideoxyadenosine, 2',3'-dideoxycytidine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine, 3'-deoxyadenosine, 3'-deoxycytidine, 3'-deoxyguanosine, 3'-deoxythymidine and 5'-O-methylthymidine.

[0091] Atypical nucleotides may include halogen atoms. Halogen atoms can be attached to any position on a nucleotide, such as a base and / or sugar. Halogen atoms can be fluorine (F), chlorine (Cl), bromine (Br), or iodine (I). Commercially available nucleosides containing halogens that may be present in atypical nucleotides include, but are not limited to, 8-bromo-2'-deoxyadenosine, 8-bromo-2'-deoxyguanosine, 5-bromouridine, 5-iodouridine, 5-bromouridine, 5-iodouridine, 5'-iodothymidine, and 5-bromo-2'-O-methyluridine.

[0092] In a 5' hairpin, one or more base-paired nucleotides may comprise one or two atypical nucleotides. For example, 2 to 20, such as 3, 4, 5, 6, 7, 8, 9, 10, 12, or 15, base-paired nucleotides in the hairpin may each comprise one or two atypical nucleotides. In one embodiment, at least about 10%, 20%, 30%, 40%, or 50% of the base-paired nucleotides in the hairpin each comprise one or two atypical nucleotides, preferably two atypical nucleotides. In one embodiment, up to about 60%, 70%, 80%, 90%, or more, such as 100%, of the base-paired nucleotides in the hairpin each comprise one or two atypical nucleotides, preferably two atypical nucleotides.

[0093] Each atypical nucleotide is typically capable of base pairing with one or more typical nucleotides. In the methods disclosed herein, the polymerase is typically incorporated with a typical base, such as A, C, G, or T, corresponding to the atypical nucleotide. Preferably, each atypical nucleotide is capable of base pairing with typical nucleotides G and C or their modified forms, but only two hydrogen bonds are formed when base pairing occurs (compared to the three hydrogen bonds formed in a GC base pair). Examples of atypical nucleotides capable of forming two hydrogen bonds when base pairing with typical nucleotides G and C or their modified forms include inosine and zablaline.

[0094] In this embodiment, when atypical nucleotides are present in the template strand, the polymerase will typically preferentially incorporate G or C, or their modified forms, which correspond to the atypical nucleotides. For example, the polymerase may preferentially incorporate cytosine, which corresponds to inosine, and guanine, which corresponds to zablaline.

[0095] Therefore, in the method of the present invention, a 5' hairpin comprising atypical nucleotides, such as inosine and zablaline, can serve as a template for polymerase to form a complementary strand comprising typical nucleotides cytosine and guanine or their modified forms, thereby facilitating the separation of the two complementary strands and the formation of the hairpin as described herein.

[0096] Hairpins typically consist of two or more, such as three, four, five, six, seven, eight or more, central nucleotides that do not form base pairs but instead form a loop within the hairpin structure. Any nucleotide can be present in the loop, including typical and / or atypical nucleotides. All nucleotides in the loop can be identical, such as polyT, polyA, polyC, polyG, polyI, or polyZ, or the loop can include more than one type of nucleotide.

[0097] Therefore, a hairpin can be formed from a single-stranded polynucleotide of about 7 to about 50 or more nucleotides, such as about 10 to about 40, about 15 to about 30, or about 20 nucleotides. The outer nucleotides form base pairs, and the central nucleotide forms a loop.

[0098] The hairpin may be present in the adaptor or primer, which includes additional nucleotides. In some embodiments, the additional nucleotides may be used for the purposes described below. The adaptor and / or primer may contain additional nucleotides on either side or both sides of the hairpin in the adaptor. For example, the additional nucleotides may be present in the 5' and / or 3' of the hairpin adaptor. Preferably, the additional nucleotides are present on the 3' side of the 5' hairpin or on the 5' side of the 3' hairpin.

[0099] The adaptor or primer can be of any suitable length. For example, the length of the adaptor and / or primer can be from about 8 to about 100 nucleotides, such as about 10 to about 90, about 20 to about 80, about 30 to about 70, or about 40, 50, or 60 nucleotides.

[0100] In some embodiments, the 5' hairpin receptacle may include one or more spacers. When present, the spacers are preferably located at the 5' end of the 5' hairpin in the receptacle. In the disclosed method, polymerase activity may terminate upon reaching the spacer after synthesis of a sequence complementary to the 5' hairpin. Spacers are well known in the art and comprise, for example, one or more iSpC3 groups (i.e., nucleotides lacking sugar and base), one or more photolyzable (PC) groups, one or more hexanediol groups, one or more spacer 9 (iSp9) groups, one or more spacer 18 (iSp18) groups, polymers, or one or more thiol linkages. The one or more spacers may include any combination of these groups. Many of these groups are commercially available from Integrated DNA Technologies ).

[0101] RLA terminated using a modified connector.

[0102] Rolling linear amplification can be terminated at a specified time point in the reaction by incorporating a selectively cleaving group, such as a modified base, into a 5' hairpin or a 5' hairpin adaptor, and then selectively targeting the introduced modified base with an enzyme that specifically cleaves the sequence at the modified base. The modified base can be incorporated, for example, into the 5' hairpin, into the loop or stem portion of the hairpin. Alternatively, the modified base can be contained on the 5' side of the adaptor, or preferably on the 3' side of the 5' hairpin in the adaptor. This means that all products will terminate upon completion of the copy event, resulting in double-stranded DNA ends that may be suitable for ligation. An example of a suitable location for incorporating a modified base is shown below with underlined text.

[0103] IZITAZTTTTTAITAZIZTT T GCTTACGGTTCACTACTCACGACGATGT

[0104] (SEQ ID NO:11)

[0105] Examples of suitable modified bases that can be used in this regard include RNA bases used with RNase H, inosine or deoxyuridine used with hAAG and T7 endonucleases, and USER. A 5' hairpin or 5' hairpin adaptor may contain one or more, for example, two or three such modified bases, which may vary to achieve the selection of the cleavage option used.

[0106] Therefore, in some embodiments, the connector includes a selectively cleavable group. In some embodiments, the connector includes a hairpin forming region comprising a stem-ring-stem and a selectively cleavable group.

[0107] Barcodes were added to the RLA products using modified linkers.

[0108] To further characterize individual DNA molecules, barcodes can be incorporated into the double-stranded DNA portion of the adaptor. This allows for the identification of individual molecules within a sample or the identification of different samples when run in a sequencing assay in mixture form. Therefore, in some embodiments, the adaptor includes a barcode region. In some embodiments, the adaptor includes a hairpin-forming region comprising a stem-loop-stem and a barcode. The adaptor may include a hairpin-forming region comprising a stem-loop-stem, a barcode, and a selectively cleavable group. The selectively cleavable group is preferably located at the 5' end of the barcode. A restriction site may be located on either side of the barcode, preferably at the 5' end, and preferably at the 3' end of the cleavable group. The barcode is preferably located at the 3' end of the 5' hairpin.

[0109] Polynucleotide barcoding is well-known in the field (Kozarewa, I. et al., (2011), Methods in Molecular Biology, 733, pp. 279-298). A barcode is a specific sequence of polynucleotides that influences the current flowing through the pore in a specific and known manner.

[0110] Digestion of RLA products

[0111] Increasing the concentration of the analyte in solution can be proven useful. For this purpose, the rolling linear amplification product can be digested into individual repeats by incorporating a restriction site into the adaptor. After synthesis, the product can then be decomposed and analyzed independently. By additionally incorporating a barcode, the barcode can be recombined informatively after further analysis, if desired. Therefore, in some embodiments, the adaptor includes a restriction site or other sites on the amplification product that the enzyme can cleave. In some embodiments, the adaptor includes a hairpin-forming region comprising a stem-loop-stem and a restriction site. The adaptor may additionally include a barcode and / or a selectively cleaving group.

[0112] When the limiting site is present in the 5' hairpin connector, the limiting site can be located at the 5' end or the 3' end of the 5' hairpin, preferably at the 3' end. When the limiting site is present in the 3' hairpin connector, the limiting site can be located at the 5' end or the 3' end of the 3' hairpin, preferably at the 5' end.

[0113] The selectively cleavable group is preferably located at the 5' end of the barcode. The restrictive site can be located on either side of the barcode, preferably at the 5' end, and more preferably at the 3' end of the cleavable group.

[0114] Restriction sites are well known in the field. Skilled technicians can easily identify restriction sites and select appropriate restriction enzymes.

[0115] Template polynucleotide

[0116] Template polynucleotides typically include target polynucleotides flanked by 5' and 3' hairpin formation sequences.

[0117] A 5' hair clip can have the above-mentioned characteristics.

[0118] In the initial template polynucleotide, the 3' hairpin can be the complement of a 5' hairpin, typically consisting only of typical (i.e., GTAC) nucleotides, or it can be any polynucleotide forming the hairpin. The 3' hairpin can be of any length. For example, a hairpin can comprise nucleotides of 2 to 20 base pairs, such as 3, 4, 5, 6, 7, 8, 9, 10, 12, or 15 base pairs. Hairpins typically include two or more, such as 3, 4, 5, 6, 7, 8, or more, central nucleotides that do not form base pairs in the hairpin structure but instead form a loop. Any nucleotide can be present in the loop, including typical and / or atypical nucleotides. The nucleotides in the loop can be identical, such as polyT, polyA, polyC, polyG, or the loop can include more than one type of nucleotide.

[0119] In any extended polynucleotide used as a subsequent template polynucleotide for further extension by polymerase, the 3' hairpin is the complement of the 5' hairpin and consists only of typical (i.e., GTAC) nucleotides.

[0120] The template polynucleotide can be single-stranded or double-stranded. When the template polynucleotide is double-stranded, one or both strands may include 5' and 3' hairpins as defined above. When both strands of the template polynucleotide include 5' and 3' hairpins as defined above, both strands typically extend during the amplification reaction.

[0121] In one embodiment, each strand of the double-stranded template polynucleotide includes a 5' hairpin containing at least one atypical nucleotide. The double-stranded template polynucleotide does not necessarily include a 3' hairpin, because the 3' end of each strand of the template polynucleotide can serve as a starting site for polymerase, allowing the polymerase to copy the 5' hairpin on the sense strand to produce a 3' hairpin before amplifying the template polynucleotide, and particularly before amplifying the target polynucleotide.

[0122] Therefore, a method is provided, the method comprising: providing a double-stranded polynucleotide comprising a 5' hairpin containing one or more atypical nucleotides, and contacting the polynucleotide with a polymerase and a typical nucleotide under conditions suitable for polymerase activity. A single-stranded binding protein may also be added together with the polymerase.

[0123] When the template polynucleotide is single-stranded, it includes a 5' hairpin and a 3' hairpin. The 3' hairpin of the single-stranded polynucleotide serves as the starting site for polymerase.

[0124] Target polynucleotides

[0125] Target polynucleotides are used as template polynucleotides in amplification methods. Target polynucleotides can be double-stranded or single-stranded.

[0126] The target polynucleotide can be a nucleic acid, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The template can be single-stranded DNA or RNA, double-stranded DNA or RNA, or a DNA / RNA duplex, such as an RNA strand hybridized to a DNA strand.

[0127] Polynucleotides can be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threonine nucleic acid (TNA), locked nucleic acid (LNA), or other synthetic polymers with nucleotide side chains. The PNA backbone contains repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. The GNA backbone contains repeating ethylene glycol units linked by phosphodiester bonds. The TNA backbone contains repeating threose units linked together by phosphodiester bonds. LNAs are formed from ribonucleotides discussed above that have an additional bridge connecting the 2' oxygen to the 4' carbon in the ribose moiety.

[0128] The target polynucleotide can be of any length. For example, the length of the target polynucleotide can be at least about 10, at least 50, at least 70, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, or at least 500 nucleotides or nucleotide pairs. The length of the target polynucleotide can be up to about 1,000 or more nucleotides or nucleotide pairs, 5,000 or more nucleotides or nucleotide pairs, 10,000 or more nucleotides or nucleotide pairs, 100,000 or more nucleotides or nucleotide pairs, or 500,000 or more nucleotides or nucleotide pairs, or 1,000,000 or more nucleotides or nucleotide pairs, or 10,000,000 or more nucleotides or nucleotide pairs. The length of the target oligonucleotide is preferably from about 30 to about 100,000 nucleotides, such as from about 50 to about 50,000 nucleotides, or from about 70 to about 10,000 nucleotides.

[0129] The target polynucleotide can be a fragment of a longer polynucleotide. In this embodiment, the longer polynucleotide is typically fragmented into multiple, such as two or more shorter target polynucleotides.

[0130] In some embodiments, the methods described herein can be used to amplify multiple target polynucleotides in a sample, such as 2, 3, 4, or 5 to 10, 15, 20, or more polynucleotides.

[0131] sample

[0132] The target polynucleotide can be present in the sample. The sample can be any suitable sample. The sample can be a biological sample. Any embodiment of the methods described herein can be performed in vitro on a sample obtained or extracted from any organism or microorganism. The organism or microorganism is typically an archaea, prokaryotic, or eukaryotic microorganism and generally belongs to one of the following five kingdoms: plant, animal, fungi, prokaryotes, and protists. In some embodiments, the methods described herein can be performed in vitro on a sample obtained or extracted from any virus.

[0133] The sample is preferably a fluid sample. Samples typically include bodily fluids. Bodily fluids can be obtained from a human or animal. The human or animal may have, is suspected of having, or is at risk of having a disease. Samples may be urine, lymph, saliva, mucus, semen, or amniotic fluid, but are preferably whole blood, plasma, or serum. Typically, samples are derived from humans, but alternatively, samples may be derived from another mammal, such as commercially raised animals like horses, cattle, sheep, or pigs, or alternatively, from pets such as cats or dogs.

[0134] Alternatively, plant-derived samples are typically obtained from cash crops such as cereals, legumes, fruits, or vegetables, such as wheat, barley, oats, rapeseed, corn, soybeans, rice, bananas, apples, tomatoes, potatoes, grapes, tobacco, kidney beans, lentils, sugarcane, cocoa, cotton, tea, or coffee.

[0135] The sample can be a non-biological sample. Non-biological samples are preferably fluid samples. Examples of non-biological samples include surgical fluids, water such as drinking water, seawater or river water, and reagents used for laboratory testing.

[0136] Samples can be processed before measurement, for example, by centrifugation or filtration to remove unwanted molecules or cell membranes such as red blood cells. Measurements can then be performed immediately after sample acquisition. Samples are also typically stored, preferably at below -70°C, prior to measurement.

[0137] In some embodiments, the sample may include genomic DNA. The genomic DNA may be fragmented, or any of the methods described herein may further include fragmenting the genomic DNA. DNA fragmentation can be performed by any suitable method. For example, methods for fragmenting DNA are known in the art. Such methods may use transposases, such as MuA transposase, or commercially available G tubes.

[0138] polymerase

[0139] Any suitable polymerase can be used in this method. A polymerase is any enzyme capable of synthesizing a polynucleotide complementary to the template polynucleotide chain, starting at the 3' end of a polynucleotide chain that hybridizes with its complement in the same or another polynucleotide chain. A polymerase is an enzyme that synthesizes polynucleotides by adding a series of typical nucleotides to the 3' end to produce a complementary polynucleotide. The polymerase continues to synthesize the complementary chain until it reaches the 5' end of the template polynucleotide.

[0140] The polymerase is preferably a strand displacement polymerase. A strand displacement polymerase is a polynucleotide that can replace the strand of a template polynucleotide, which is copied as the strand displacement polymerase moves along the template polynucleotide. Compared to a polymerase, the replaced strand typically hybridizes closer to the 5' end of the copied template polynucleotide strand.

[0141] Some examples of polymerases that can be used include, but are not limited to, BST 2.0 or BST 3.0 (which are commercially available from NEB), Pyro 3173 DNA polymerase (which can be obtained from...) (obtained through company purchase), SD polymerase (available from...) Commercially available polymerases include Kleno enzyme (available from NEB), Phi29 DNA polymerase, or variants thereof. The polymerase can be a thermostable polymerase, such as Taq polymerase (available from Thermo Scientific Enzymes).

[0142] Single-chain binding protein (SSB) can be added. SSB can help with chain substitution. SSB can be commercially available, for example, from NEB and Promega.

[0143] Polymerases amplify polynucleotides by adding free nucleotides. Therefore, nucleotides are added to the reaction. The added nucleotides are typical nucleotides such as guanine (G), cytosine (C), adenine (A), and threonine (T) or uracil (U). For example, in the case where the template polynucleotide is DNA, dG, dC, dA, and dT are added. These are commonly referred to as dNTPs.

[0144] Buffers suitable for polynucleotide amplification are known in the art.

[0145] Reaction conditions

[0146] The method can be an isothermal amplification method. Therefore, in one embodiment, the method is performed at a constant temperature. The method can be performed, for example, at temperatures from about 20°C to about 70°C, such as about 37°C, about 55°C, or about 65°C at room temperature (RT). A skilled technician will be able to readily determine the optimal temperature for a given polymerase. When using a thermostable polymerase, such as Taq polymerase, higher temperatures, such as 75°C to 80°C, can be used.

[0147] Amplification can be performed at any suitable time period. This may depend on the length of the target polynucleotide and / or the desired degree of amplification. For example, amplification may be allowed to last for about 20 minutes or longer, such as about 30 minutes or longer, preferably about 45 minutes, about 60 minutes, about 90 minutes, about 2 hours, about 6 hours, about 12 hours to about 24 hours, about 3 days or longer.

[0148] At the end of amplification, the reaction mixture can be heated, for example to at least about 80°C, to inactivate the polymerase. When using a thermostable polymerase, such as Taq polymerase, a higher inactivation temperature, such as at least about 100°C, can be used. To inactivate the polymerase, maintain the temperature at at least about 80°C or at least about 100°C for about 5 minutes or longer.

[0149] In one embodiment, heat can be used to separate the strands of the template polynucleotide. Alternatively, the pH and / or ionic strength of the reaction mixture can be increased to separate the strands.

[0150] Preparation of template polynucleotides

[0151] The method may include an initial step of preparing a template polynucleotide. The template polynucleotide can be prepared by attaching an adaptor comprising a 5' hairpin, or designed to form a 5' hairpin, to the 5' end of each strand of a double-stranded target polynucleotide, wherein the 5' hairpin comprises at least one atypical nucleotide. The adaptor may be a single-stranded adaptor. The adaptor may be a double-stranded adaptor. The double-stranded adaptor preferably comprises a 3' hairpin, or is designed to form a 3' hairpin. The 3' hairpin typically contains only typical nucleotides, but may include one or more atypical nucleotides. Attaching a double-stranded adaptor comprising a 5' hairpin, or a sequence capable of forming a 5' hairpin, and a 3' hairpin, or a sequence capable of forming a 3' hairpin, to the end of the target polynucleotide results in the formation of a template polynucleotide comprising a double-stranded target polynucleotide side-attached by sequences formed by the 5' and 3' hairpins at both ends.

[0152] When the target polynucleotide is a double-stranded polynucleotide, the single-stranded adaptor includes a 5' hairpin or a sequence capable of forming a 5' hairpin, or the double-stranded adaptor includes a 5' hairpin or a sequence capable of forming a 5' hairpin, wherein the strand of the adaptor attached to the 3' end of each strand of the target polynucleotide is shorter than the strand attached to the 5' end of each strand of the target polynucleotide. After ligation, a double-stranded template is generated, comprising a 5' hairpin or a sequence capable of forming a 5' hairpin at each end. When polymerase and a typical nucleotide are added to the double-stranded template, the 3' end of each strand of the template polynucleotide extends to produce a 3' hairpin complementary to the 5' hairpin. The 3' hairpin consists only of the typical nucleotide.

[0153] Template polynucleotides can be prepared by linking an adaptor including a 5' hairpin to the 5' end of a single-stranded target polynucleotide including a 3' hairpin, wherein the 5' hairpin comprises at least one atypical nucleotide. Template polynucleotides can be prepared by linking an adaptor including a 5' hairpin to the 5' end of a single-stranded target polynucleotide, wherein the 5' hairpin comprises at least one atypical nucleotide, and by linking an adaptor including a 3' hairpin to the 3' end of a single-stranded target polynucleotide. In this embodiment, the adaptor is typically a single-stranded adaptor. The 3' hairpin typically contains only typical nucleotides, but may include one or more atypical nucleotides.

[0154] Ligation can be performed using methods known in the art. Typically, a ligase is used to ligate the adaptor to the target polynucleotide. The double-stranded target nucleotide may be blunt-ended. The double-stranded target nucleotide can be blunt-ended by any suitable method, such as end repair. The double-stranded target polynucleotide preferably includes a dA tail, but may alternatively include a dG tail, a dC tail, or a dT tail. The adaptor may include a blunt end excluding the hairpin. The adaptor preferably includes a dT tail excluding the hairpin, but may alternatively include a dG tail, a dC tail, or a dA tail. The double-stranded target polynucleotide can be linked by its dA tail to its dT tail in the adaptor. Alternatively, the double-stranded target polynucleotide can hybridize to the tail of the adaptor via its other complementary tails. One or more hairpins in the adaptor are described above.

[0155] The adaptor may include additional nucleotides at the end to link with the target polynucleotide. For example, in addition to one or more hairpin-forming sequences, the adaptor may include about 2, 3, 4, or 5 to about 20, 30, 50, or more additional nucleotides and / or base-pairing nucleotides, such as about 10 to about 40 or about 20 to about 30 additional nucleotides and / or base-pairing nucleotides. The additional nucleotides and / or base-pairing nucleotides are typically typical nucleotides.

[0156] The adaptor can link to the target polynucleotide without knowing the sequence of the target polynucleotide.

[0157] In one embodiment, the double-stranded adaptor may be a MuA substrate, and the MuA transposase may be used to (i) cleave the polynucleotide to produce the target polynucleotide, and (ii) ligate the MuA substrate to the target polynucleotide. A method for ligating adaptors using the MuA transposase is described in WO2016 / 059363.

[0158] Template polynucleotides can be prepared through primer hybridization and extension. Amplification can be performed on known targets for which at least some sequence information is known, or on random fragments, via primer addition.

[0159] To amplify the desired region of interest, primers can be designed according to established methods, such as PCR.

[0160] For random fragments, an amplification adaptor with a primer binding site is first ligated to the end of a target polynucleotide, for example, using methods known for next-generation sequencing (NGS) library preparation. The target polynucleotide can be double-stranded or single-stranded. Methods for attaching adaptors to the ends of double-stranded polynucleotides and for attaching adaptors to the ends of single-stranded polynucleotides are known.

[0161] If desired, PCR can be performed prior to the linear rolling amplification reaction. Polymerases suitable for incorporating dNTPs opposite to deoxyinosine are recommended; such polymerases are well-known, and a suitable example is Taq polymerase. As with standard PCR reactions, the annealing and extension times and temperatures depend on the primer sequences used and can be easily determined. Therefore, in this method, template polynucleotides can be generated by PCR.

[0162] Therefore, in the method, the following can be used to amplify the target polynucleotide: (i) a first primer comprising a 5' hairpin and a sequence at its 3' end, the sequence being complementary to a sequence at the 3' end of the first strand of the target polynucleotide; and (ii) a second primer comprising a 5' hairpin and a sequence at its 3' end, the sequence being complementary to a sequence at the 3' end of the second strand of the target polynucleotide.

[0163] In one embodiment, the target polynucleotide may be generated using an isothermal amplification method and a strand displacement polymerase.

[0164] This article provides a method for amplifying polynucleotides, comprising: (a) providing a primer pair, wherein each primer includes a 5' hairpin containing one or more atypical nucleotides; (b) contacting a sample containing a target polynucleotide with the primer pair; and (c) performing an amplification reaction using the primer pair.

[0165] Amplification products

[0166] Novel amplification products are generated using the methods disclosed herein. The amplification products are polynucleotides obtainable by any of the methods described herein. The polynucleotides provided herein comprise multiple copies of a target sequence and its complement. The target (Tar) and complement (Com) are present in the sequence at the 5' to 3' orientation, as follows: (Tar-Com) x , where x is an integer greater than 2. X can be, for example, 2 to about 100 or greater, such as about 3, 5, 10 or 20 to about 50, 60, 70, 80 or 90.

[0167] In a polynucleotide, the target sequence closest to the 5' end and the complement sequence are separated by the initial 3' hairpin (3'H) sequence and any adaptor and / or primer sequences used in the method. Subsequent target and complement repeats are separated by repeats of the same sequence, which is the complement of the 5' hairpin and any adjacent adaptor and / or primer sequences in the original template polynucleotide, but containing a typical nucleotide (5'HC). The target sequence closest to the 5' end is the original target sequence (OTar). The original target sequence may contain modifications such as methyl groups. Typically, a 5' hairpin comprising at least one atypical nucleotide (5'H) and any adjacent adaptor and / or primer sequences are present in the product.

[0168] Therefore, polynucleotides can have the formula 5'H-OTar-3'H-Com-(5'HC-Tar-5'HC-Com-)x, where x is an integer. X can be, for example, from 1 to about 100 or greater, such as about 3, 5, 10 or 20 to about 50, 60, 70, 80 or 90.

[0169] The amplification products may include a mixture of polynucleotides of different lengths, each of which is as defined above. Therefore, the products may include a variety of different polynucleotides, such as 2, 3, 4, 5, 10 to 20, 30, 50, 100 or more, as described above, where x has a different value in each of the different polynucleotides.

[0170] Characterization methods

[0171] In one embodiment, the method can be used to detect the presence of a target polynucleotide in a sample. In this embodiment, the presence of the amplification product indicates that the target polynucleotide is present in the sample.

[0172] In one embodiment, the amplified product can be used for any desired purpose. In one embodiment, the amplified product is characterized. Characterization methods may include: gel analysis, detection of pH changes due to dNTP incorporation, detection of fluorescence changes (increase or decrease), detection of turbidity / viscosity, detection of absorbance changes (increase or decrease), and detection of any reporter genes on the dNTPs. The characterization method may utilize nanopores.

[0173] For characterization, the amplified product can be left intact or cleaved into individual units. This can be easily achieved, for example, by incorporating the restriction site into the hairpin instead of polyT (e.g., TTTT), polyA, polyC, or polyG, or otherwise. One advantage of cleavage is that it can lead to an increase in analyte.

[0174] This article provides a method for characterizing polynucleotides, the method comprising:

[0175] (a) Contacting a polynucleotide produced by an amplification method with a nanopore, causing the polynucleotide to translocate through the nanopore; and

[0176] (b) Perform one or more measurements as the polynucleotide moves relative to the nanopore, wherein the measurements indicate one or more properties of the polynucleotide and thereby characterize the polynucleotide.

[0177] Measurement results can include, for example, translocation time, reporter gene incorporation, tag release, and / or blob counting.

[0178] The amplified products can be sequenced. Any method can be used for sequencing, typically next-generation sequencing methods, such as any method of ensemble or single-molecule sequencing. Examples of suitable sequencing methods include standard sequencing via synthesis (SBS) sequencing methods such as the Genia, PacBio, Illumina, Helicos, solid-phase, or 454 methods, as well as single-molecule sequencing methods, which can be direct or indirect. These methods can be performed using nanopores, such as sequencing technologies from Oxford Nanopore Technologies, or via any other known method, such as AFM, hybridization sequencing, or Stratos extended sequencing.

[0179] Sequencing the amplified products provides a way to enhance the accuracy of the target sequence. Multiple copies of the target sequence and its complement provide a means to achieve, for example... Figure 7 The sequence information shown is based on the highly accurate identification of the target polypeptide sequence. Typically, the accuracy of sequence identification is 95% or higher, such as 98% or higher, or 99% or higher.

[0180] The method may further include adding a sequencing adaptor to one or both ends of the extended polynucleotide.

[0181] In one embodiment, size selection can be performed prior to characterization. For example, a long polynucleotide that is likely to include at least about 5, such as at least 10 or more copies of the target sequence can be selected for characterization.

[0182] The amplification method described in this article can be used in other applications, such as qPCR and LAMP processes.

[0183] In one embodiment, the method provides simultaneous amplification and detection / characterization, such as sequencing via synthesis. As an example, the amplified product can be detected and / or characterized by detecting and analyzing optical signals using a nanopore sensor, a zero-mode waveguide, or Raman spectroscopy. As another example, the amplified product can be detected and / or characterized by detecting and analyzing non-optical signals using a nanopore sensor (such as a nanopore).

[0184] To facilitate such detection and / or characterization, any suitable optical or non-optical label can be used to label the nucleotides provided with polymerase.

[0185] Nucleotides that provide polymerase can be modified. Generally, modification does not reduce the strength of binding between nucleotides in double-stranded polynucleotides or hairpin structures and their complementary nucleotides.

[0186] To facilitate detection and / or characterization, template polynucleotides can be ligated to nanopore sensors or membranes including nanopore sensors. The ligation can be contained in sequencing adaptors linked to the ends of the amplification product. Such sequencing adaptors are known in the art and disclosed, for example, in WO2012 / 164270.

[0187] connector

[0188] A double-stranded polynucleotide adapter is provided, comprising a first strand and a second strand, wherein the first strand includes a 5' hairpin containing one or more atypical nucleotides, and the second strand includes a 3' hairpin.

[0189] The features of the connector and hairpin are as described above.

[0190] Primers

[0191] A primer pair is provided, wherein each primer includes a 5' hairpin containing one or more atypical nucleotides.

[0192] To amplify the desired region of interest, primers can be designed according to established methods, such as PCR. Other primers include 5' hairpins as described herein.

[0193] Primers are typically single-stranded polynucleotides, such as single-stranded DNA. Primer length can range from, for example, at least about 20, 30, 40, or 50 to about 100 nucleotides. Primers may contain sequences of about 6, 8, 10, 15, 20, or more nucleotides, said sequences being complementary to sequences in the target polynucleotide or in the adaptor linked to the target polynucleotide.

[0194] Reagent test kit

[0195] A kit for amplifying target polynucleotides is provided, the kit comprising: (i) the adaptor or primer pair described herein; and (ii) a polymerase. The polymerase is preferably a strand displacement polymerase. The kit may further comprise any one or more components of the amplification methods described herein. In one embodiment, the kit may further comprise one or more sequencing adaptors.

[0196] The following examples illustrate the present invention.

[0197] Example 1: Linear amplification via linker connection

[0198] Materials and methods

[0199] connector

[0200] At 10 μM, by incubation at 2 °C for minutes in 10 mM Tris-HCl pH 7.5, 50 mM NaCl, and 0.5 mM EDTA. -1 The adaptor with the following sequence was prepared by slowly cooling from 95°C to 23°C.

[0201] Connector subsequence:

[0202] Rolling linear top chain – dGTAC control (SEQ ID NO:1)

[0203] / 5Phos / GCGTACTTTTTAGTACGCTTTTCGGCGTCTGCTTGGGTGTTTAACCT

[0204] Rolling linear top chain (SEQ ID NO:2)

[0205] / 5Phos / IZITAZTTTTTAITAZIZTTTTCGGCGTCTGCTTGGGTGTTTAACCT

[0206] Rolling linear bottom chain (SEQ ID NO:3)

[0207] / 5Phos / GGTTAAACACCCAAGCAGACGCCG

[0208] connect

[0209] Prepare the ligation reactant as follows, and keep the ligation reactant at room temperature for 10 minutes:

[0210]

[0211] According to the manufacturer's instructions, the reaction product was purified using Agencourt AMPure XP beads (Beckman Coulter) and eluted in 37.5 μl of 10 mM Tris-HCl pH 7.5, 50 mM NaCl, and 0.5 mM EDTA.

[0212] Amplification

[0213] Prepare the rolling linear amplification reactant as follows, and incubate it at 37°C for 60 minutes, then at 80°C for 5 minutes for heat inactivation:

[0214]

[0215] According to the manufacturer's instructions, the reaction product was purified using Agencourt AMPure XP beads (Beckman Coulter) and eluted in 43 μl of 10 mM Tris-HCl pH 7.5, 50 mM NaCl, and 0.5 mM EDTA.

[0216] Example 2: Sequencing

[0217] Nanopore sequencing was performed using the MinION DNA Sequencing Device and Sample Preparation Kit Ligation Sequencing Kit 1D (SQK-LSK108) from Oxford Nanopore Technologies, according to the manufacturer's instructions.

[0218] The results are as follows Figures 4 to 7 As shown.

[0219] Example 3: Linear amplification via primer addition

[0220] Materials and methods

[0221] Primers

[0222] Primers are designed based on the experimental type and target DNA, and user selection is retained. Primers are tailed at the 5' end with the following sequence:

[0223] / 5Phos / IZITAZTTTTTAITAZIZTTTT(SEQ ID NO:4)

[0224] Amplification

[0225] Prepare the rolling linear amplification reaction as follows, and incubate it at 65°C for 60 minutes, followed by heat inactivation at 80°C for 5 minutes. Perform PCR before the amplification reaction. Primers have been omitted from the rolling linear amplification reaction, but this omission is optional. If PCR has not been performed before this step, the reaction may already be supplemented with 200 nM primers.

[0226]

[0227] According to the manufacturer's instructions, the reaction product was purified using Agencourt AMPure XP beads (Beckman Coulter) and eluted in 43 μl of 10 mM Tris-HCl pH 7.5, 50 mM NaCl, and 0.5 mM EDTA.

[0228] The results obtained are similar to those obtained using amplification methods that generate template polynucleotides using adaptors.

[0229] Example 4: Replacing the top chain

[0230] A series of top strands with different 5' hairpin compositions were prepared to demonstrate the ability of different 5' hairpin sequences to serve as templates for the following rolling linear amplification (RLA):

[0231] RLA_Top(SEQ ID NO:5)

[0232] 2GCTTGGGTGTTTAACC8888IZITAZTTTTTAITAZIZTTTTGCTTACGGTTCACTCACGACGATGT

[0233] RLA_Top-Da(SEQ ID NO:6)

[0234] 2GCTTGGGTGTTTAACC8888IZITAZAAAAATITAZIZAAAAGCTTACGGTTCACTCACGACGATGT

[0235] RLA_Top-12bp1(SEQ ID NO:7)

[0236] 2GCTTGGGTGTTTAACC8888IZIAZIITATIAAAAATZATAZZITZIZAAAAGCTTACGGTTCACTCACGACGATGT

[0237] RLA_Top-12bp2(SEQ ID NO:8)

[0238] 2GCTTGGGTGTTTAACC8888ZAITAZITAIIAAAAATZZTAZITAZTIAAAAGCTTACGGTTCACTCACGACGATGT

[0239] To confirm the ability of the 5' hairpin to serve as a template for rolling linear amplification, the bottom strand containing the restriction site of the restriction enzyme SpeI was annealed:

[0240] RLA_btm_v2_SpeI(SEQ ID NO:9)

[0241] 5CATCGTCGTGACTAGTGAACCGTAAGC

[0242] Key: 2:5'DBCO-TEG

[0243] 5:5' phosphate

[0244] 8:C3 spacer

[0245] I: Deoxyinosine

[0246] Z: Deoxyzebralin

[0247] The restriction site is present only on the bottom strand and therefore is not digested when incubated with homologous enzymes. However, if the 5' hairpin can act as a template for rolling linear amplification when incubated with polymerase and nucleotides, the resulting product will contain restriction sites on both strands of the dsDNA product and will therefore be digested when incubated with homologous enzymes. This was demonstrated for all the alternative 5' hairpin sequences tested.

[0248] At 10 μM, in 10 mM Tris at pH 7.5 and 50 mM NaCl, at 2 °C for minutes -1 Anneal the top and bottom chains of the connector at 95°C.

[0249] 1 μl of a 100 nM annealing chain was run on an Agilent 1000 chip to determine the size of the linker. Figure 9 ).

[0250] Test the adaptor's ability to act as a template for rolling linear amplification as follows. Mix the reagents shown in the table below and incubate at 65°C for 5 minutes. Run 1 μl of the 100 nM product on an Agilent 1000 chip to determine the leveling agent.

[0251] reagents control material filler Final item water 3.8 3.6 Connector (10 μM) 0.5 0.5 1μM 10x isothermal buffer 0.5 0.5 10mM dNTP 0.2 0.2 Bst 3.0 0.2 total 5 5

[0252] For all adaptors, the disappearance of the band corresponding to the adaptor (approximately 100-150 bp on the x-axis) can be observed in the trace without polymerase. Figure 10-13 Additionally, in all cases, a new band appears in the trace containing polymerase (between approximately 25-50 bp on the x-axis), which is presumed to be a filler product.

[0253] The adaptor and the finishing product were digested with SpeI to determine whether rolling linear amplification occurred. The adaptor or finishing product was diluted to 200 nM in 20 μl of reaction mixture containing 1x NEBCutSmart buffer and 5 U SpeI, and then incubated at 37 °C for 30 min. 1 μl of the reaction mixture was run on an Agilent 1000 chip to determine the digestion.

[0254] like Figure 14 For the chain combinations RCA_Top and RLA_btm_v2_Spe1, the SpeI digest is not shown in the annealed chain combinations.

[0255] Figure 14 The results shown represent all adaptors incubated with and without SpeI, since no digestion was observed.

[0256] In contrast, all the other bands in the traces obtained in the presence of SpeI, i.e., the assumed rolling linear amplification products, were digested by Spe1, indicating that rolling linear amplification had occurred successfully and that these were indeed amplification products. Figure 15 An example trace is shown in the figure.

[0257] Example 5: Alternating Temperature

[0258] Rolling linear amplification is performed within different temperature ranges.

[0259] The adaptor formed by RLA_Top and RLA_btm_v2(5CATCGTCGTGAGTAGTGAACCGTAAG C)(SEQ ID NO: 10) was ligated to the amplified product of λ phage gDNA after end repair and dA tailing.

[0260] Incubate 50 μl of the following ligand: 1x Fast T4 ligase buffer containing 1 μg 3.6 kb strand, 200 nM adaptor, and 4,000 U T4 DNA ligase at room temperature for 10 min, then perform 0.6x SPRI purification, in which DNA is eluted in 50 μl of 10 mM Tris-HCl pH 7.5.

[0261] Prepare a 200 μl master mixture consisting of 40 μl of recovered ligation product, 400 μM dNTPs, and 2.4 μB 1x isothermal amplification buffer (NEB) at 3.0 μg / L. Aliquot the sample into 40 μl portions of the reaction mixture and incubate at 50°C, 55°C, 60°C, 65°C, or 70°C for 30 min. After incubation, purify the sample using 0.6x SPRI and elute with 12 μl of 10 mM Tris-HCl pH 7.5. Mix 10 μl of the recovered DNA with 1 μl of RAP from the RAD004 kit from Oxford Nanopore Technologies and load it into a pre-prepared flow cell according to the manufacturer's instructions. Then analyze the sequenced strand for the presence of template and complement repetitive sequences and plot the number of repetitive sequences in a bar graph to indicate rolling linear amplification occurring within the measured temperature range. Figure 16 ).

[0262] Example 6: Linear amplification via linker connection

[0263] Materials and methods

[0264] connector

[0265] At 10 μM, by incubation at 2 °C for minutes in 10 mM Tris-HCl pH 7.5, 50 mM NaCl, and 0.5 mM EDTA. -1 The adaptor with the following sequence was prepared by slowly cooling from 95°C to 23°C.

[0266] Connector subsequence:

[0267] Rolling linear top chain – dGTAC control (SEQ ID NO:1)

[0268] / 5Phos / GCGTACTTTTTAGTACGCTTTTCGGCGTCTGCTTGGGTGTTTAACCT

[0269] Rolling linear top chain (SEQ ID NO:2)

[0270] / 5Phos / IZITAZTTTTTAITAZIZTTTTCGGCGTCTGCTTGGGTGTTTAACCT

[0271] Rolling linear bottom chain (SEQ ID NO:3)

[0272] / 5Phos / GGTTAAACACCCAAGCAGACGCCG

[0273] connect

[0274] Prepare the ligation reactant as follows, and keep the ligation reactant at room temperature for 10 minutes:

[0275]

[0276] According to the manufacturer's instructions, the reaction product was purified using Agencourt AMPure XP beads (Beckman Coulter) and eluted in 37.5 μl of 10 mM Tris-HCl pH 7.5, 50 mM NaCl, and 0.5 mM EDTA.

[0277] Amplification

[0278] Prepare the rolling linear amplification reactant as follows, and incubate it at 65°C for 60 minutes, then at 80°C for 5 minutes for heat inactivation:

[0279]

[0280] According to the manufacturer's instructions, the reaction product was purified using Agencourt AMPure XP beads (Beckman Coulter) and eluted in 43 μl of 10 mM Tris-HCl pH 7.5, 50 mM NaCl, and 0.5 mM EDTA.

[0281] The results obtained were similar to those obtained using the Kleno fragment polymerase in Example 1, thus demonstrating the successful rolling linear amplification using BST3.0 polymerase.

Claims

1. A method for amplifying a target polynucleotide, the method comprising: a) Provide a template polynucleotide comprising a 5' hairpin, a target polynucleotide, and a 3' hairpin, wherein the 5' hairpin comprises one or more atypical nucleotides, wherein each atypical nucleotide forms only two hydrogen bonds when base-paired with typical nucleotides G and C or their modified forms; b) Contact the template polynucleotide with the polymerase and the typical nucleotide, wherein: (i) The polymerase uses the typical nucleotide to extend the template polynucleotide from its 3' end to form a first extended polynucleotide, the first extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin; and (ii) The polymerase causes the first extended polynucleotide to extend from its 3' end to form a second extended polynucleotide, the second extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin.

2. The method of claim 1, wherein the polymerase causes the second extended polynucleotide to extend from its 3' end to form a third extended polynucleotide, the third extended polynucleotide comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin.

3. The method of claim 2, wherein the polymerase causes the third extended polynucleotide and optionally by causing the third extended polynucleotide to extend and / or by any additional extended polynucleotide produced by subsequent extension to produce additional extended polynucleotides, the additional extended polynucleotides comprising the 5' hairpin at its 5' end and the complement of the 5' hairpin at its 3' end, wherein the complement of the 5' hairpin forms a 3' hairpin.

4. The method according to any one of claims 1 to 3, wherein the polymerase is a chain displacement polymerase.

5. The method according to any one of claims 1 to 3, wherein the method is performed at a constant temperature.

6. The method according to any one of claims 1 to 3, wherein the method further comprises an initial step of preparing the template polynucleotide.

7. The method according to any one of claims 1 to 3, the method further comprising an initial step of preparing the template polynucleotide by attaching an adaptor including a 5' hairpin to one or more 5' ends of the target polynucleotide.

8. The method of claim 7, wherein the target polynucleotide is a double-stranded polynucleotide, and the method comprises attaching a double-stranded adapter comprising a 5' hairpin and a 3' hairpin to both ends of the target polynucleotide.

9. The method of claim 8, wherein the target polynucleotide is a double-stranded polynucleotide, and the method comprises: A double-stranded linker, including a 5' hairpin, is attached to both ends of the target polynucleotide, and a polymerase is used to extend the 3' end of each strand of the target polynucleotide to produce a 3' hairpin complementary to the 5' hairpin.

10. The method of claim 9, wherein the double-stranded linker is a MuA substrate, and the polynucleotide is cleaved using a MuA transposase (i) to produce the target polynucleotide, and (ii) the MuA substrate is linked to the target polynucleotide.

11. The method according to any one of claims 1 to 3, the method further comprising an initial step of preparing the template polynucleotide by primer hybridization and extension.

12. The method of claim 11, wherein the target polynucleotide is amplified using: (i) a first primer comprising a 5' hairpin and a sequence at its 3' end, the sequence being complementary to a sequence at the 3' end of the first strand of the target polynucleotide; and (ii) a second primer comprising a 5' hairpin and a sequence at its 3' end, the sequence being complementary to a sequence at the 3' end of the second strand of the target polynucleotide.

13. The method of claim 11, wherein the template polynucleotide is generated by PCR.

14. The method of claim 11, wherein the template polynucleotide is generated using an isothermal amplification method and a strand displacement polymerase.

Images