Soluble interleukin-7 receptor (sIL7R) modulation therapy for the treatment of autoimmune diseases and cancer

Abstract

The present invention includes compositions and methods for treating autoimmune diseases or cancers in a subject in need thereof, the methods comprising: administering an effective amount of a composition comprising an oligonucleotide that specifically binds to a complementary sequence of interleukin-7 receptor (IL7R) pre-mRNA that affects exon 6 splicing, wherein the SM-ASO increases or decreases the inclusion of exon 6 in the IL7R pre-mRNA and respectively decreases or increases the expression of the soluble isoform (sIL7R) of IL7R. In some embodiments, the oligonucleotide is an antisense oligonucleotide (ASO) or a splicing-modulating antisense oligonucleotide (SM-ASO).

Description

[0001] Cross - Reference to Related Applications

[0002] None.

[0003] Statement of Federally Sponsored Research

[0004] This invention was made with government support under Grant No. F32 - NS087899 awarded by the NIH. The U.S. government has certain rights in this invention.

[0005] Field of the Invention

[0006] The present invention generally relates to the field of new therapies for treating autoimmune diseases (e.g., multiple sclerosis) or cancer by respectively decreasing or increasing soluble IL7R (sIL7R). Background of the Invention

[0008] Without limiting the scope of the present invention, the background of the present invention is described with multiple sclerosis as an example.

[0009] Multiple sclerosis (MS) is a chronic autoimmune disease characterized by damage to neuronal myelin in the central nervous system (CNS) mediated by autoreactive immune cells, leading to axonal demyelination, neuronal death, and progressive neurological dysfunction. To date, there is no cure for this disease, and existing treatments can only slow the progression of the disease, typically by globally suppressing the immune system, resulting in a large number of potentially severe or fatal adverse side effects. This global immunosuppression is the main limitation of existing therapies.

[0010] The breakdown of immune tolerance leading to MS is thought to be caused by a complex interaction between environmental and genetic factors. According to this view, an individual's genetic background can create an environment that allows autoreactive lymphocytes to survive, which can then be activated by the presence of environmental triggers, typically in the form of viral or bacterial infections.

[0011] The inventors and others have previously shown that the variant rs6897932 (C / T, where C is the risk allele) within exon 6 of the interleukin-7 receptor (IL7R) gene is strongly associated with an increased risk of MS (Gregory et al., 2007; International Multiple Sclerosis Genetics et al., 2007; Lundmark et al., 2007). In addition, the inventors have shown that the risk 'C' allele of this variant increases skipping of this exon (Evsyukova et al., 2013; Gregory et al., 2007), leading to upregulation of sIL7R (Hoe et al., 2010; Lundstrom et al., 2013). Importantly, sIL7R has been shown to exacerbate the clinical progression and severity of disease in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS, presumably by enhancing the bioavailability and / or bioactivity of the IL7 cytokine (Lundstrom et al., 2013). Further supporting a role for sIL7R in the pathogenesis of multiple sclerosis, and potentially in autoimmunity in general, elevated sIL7R protein or RNA levels have been reported in patients with multiple sclerosis (McKay et al., 2008), rheumatoid arthritis (Badot et al., 2011), type 1 diabetes (Monti et al., 2013), and systemic lupus erythematosus (Lauwerys et al., 2014). Collectively, these data link elevated levels of sIL7R to the pathogenesis of MS and autoimmunity, and localize alternative splicing of exon 6 of IL7R as a novel therapeutic target for MS and autoimmunity.

[0012] While these references teach the existence of sIL7R in relation to multiple sclerosis and animal studies suggest that sIL7R exacerbates MS-like conditions, there remains a need for new compositions and methods for treating autoimmune diseases such as MS by targeting the production of sIL7R.

[0013] Autoimmune diseases have many different etiologies, and each of these can be a target for precise or personalized treatment. In the present invention, the inventors address one such etiology caused by elevated sIL7R levels, which may affect up to 60% of MS patients and a large number of patients with other autoimmune diseases caused by elevated sIL7R.

[0014] Immuno-oncology is a rapidly evolving field with great promise for patients with hitherto incurable cancers; however, the powerful effects of immunotherapy are limited by very low response rates in certain cancers and individuals.

[0015] Antisense oligonucleotide therapies target the genetic sequences of specific genes that cause a particular disease with short oligonucleotides complementary to the target sequence. Typically, a single nucleic acid strand (DNA, RNA, or chemical analog) designed to bind to the messenger RNA (mRNA) or pre-mRNA of the target sequence. In the case of splice-modulating antisense oligonucleotides (SM-ASOs), a complementary nucleic acid is designed to bind to a specific sequence in the pre-mRNA that alters the exon content of the resulting mRNA. Antisense oligonucleotides have been used to target diseases such as cancer, diabetes, amyotrophic lateral sclerosis (ALS), Duchenne muscular dystrophy, spinal muscular atrophy, ataxia-telangiectasia, asthma, and arthritis. The US Food and Drug Administration (FDA) has approved several antisense oligonucleotide drugs for the treatment of cytomegalovirus retinitis, homozygous familial hypercholesterolemia, Duchenne muscular dystrophy, and spinal muscular atrophy, to name a few, the latter two being SM-ASOs. However, in each case, the oligonucleotide target sequence must be customized to the specific cause underlying the disease in question. Summary of the Invention

[0017] In one embodiment, the present invention includes a method of treating a disease or condition in a subject in need thereof having an elevated level of a soluble isoform of interleukin 7 receptor (sIL7R), the method comprising: administering an effective amount of a composition comprising an oligonucleotide that specifically binds to a sequence in the interleukin-7 receptor (IL7R) pre-mRNA that affects the splicing of exon 6, wherein the oligonucleotide increases the inclusion of exon 6 in the IL7R pre-mRNA and reduces the expression of the IL7R soluble isoform (sIL7R). In one aspect, the oligonucleotide is an antisense oligonucleotide (ASO) or a splicing-modulating antisense oligonucleotide (SM-ASO). In another aspect, the oligonucleotide in the composition specifically binds to a sequence in the IL7R pre-mRNA in at least one of the group consisting of an exon splicing silencer (ESS) and / or an intron splicing silencer (ISS), thereby enhancing the inclusion of exon 6 in the IL7R pre-mRNA and reducing the expression of sIL7R. In another aspect, the oligonucleotide in the composition specifically binds to a sequence on the IL7R pre-mRNA at an intron-exon splicing site, a branch point sequence, and / or a polypyrimidine tract. In another aspect, at least one or more nucleotides in the oligonucleotide comprise a non-naturally occurring modification, which modification comprises a modification or substitution of: (1) a ribose or other sugar moiety, (2) a base, or (3) a backbone, selected from: one or more phosphorothioates, dithiophosphates, phosphodiesters, methylphosphonates, amidophosphates, methylphosphonates, phosphotriesters, phosphoroaridates, morpholinos, amidated carbamates, carboxymethyls, acetamidates, polyamides, sulfonates, sulfonamides, sulfamidates, formaldehyde acetals, thioformaldehyde acetals, and / or alkylsilyl substitutions, a partially or fully modified backbone such as a fully modified phosphorothioate backbone, a locked nucleic acid backbone, a peptide backbone, a phosphotriester backbone, an amidophosphate backbone, a siloxane backbone, a carboxymethyl ester backbone, an acetamidate backbone, a carbamate backbone, a thioether backbone, a bridged methylphosphonate backbone, a phosphorothioate backbone, a methylphosphonate backbone, an alkylphosphonate backbone, a phosphate ester backbone, an alkylthiophosphonate backbone, a dithiophosphate backbone, a carbonate backbone, a phosphotriester backbone, a carboxymethyl ester backbone, a methylthiophosphate backbone, a dithiophosphate backbone, a backbone having a p-ethoxy bond, a sugar modification such as 2'-O-methyl (2'-O-methyl nucleotide), 2'-O-methoxyethoxy (2'-O-MOE), a 2'-O-alkyl modified sugar moiety, or a bicyclic sugar moiety, a nucleotide mimetic, a peptide nucleic acid (PNA), a morpholino nucleic acid, a cyclohexenyl nucleic acid, a anhydrohexitol nucleic acid, a glycol nucleic acid, a threose nucleic acid, and a locked nucleic acid (LNA), and combinations of any two or more of the foregoing. In another aspect, at least one or more nucleotides in the oligonucleotide comprise a non-naturally occurring modification to a nucleobase.In another aspect, the oligonucleotide specifically binds to any target SEQ ID (SEQ ID NO: 1-13) selected from Table 1, alone or in combination, or a portion thereof, or the sequence of the oligonucleotide has at least 70%, 75%, 80%, 84%, 85%, 88%, 92%, 93%, 94%, 95% or 96% complementarity to the complete target sequence within IL7R RNA. In another aspect, the oligonucleotide targets any SEQ ID (SEQ ID NO: 1-13) in Table 1, in whole or in part. In another aspect, the composition further comprises a pharmaceutically acceptable excipient, salt or carrier. In another aspect, the disease or condition is an autoimmune disease selected from at least one of the following: multiple sclerosis, type 1 diabetes, rheumatoid arthritis, systemic lupus erythematosus, atopic dermatitis, ankylosing spondylitis, primary biliary cirrhosis or an inflammatory bowel syndrome such as ulcerative colitis, Crohn's disease or any other condition in which sIL7R is elevated compared to a normal subject without the disease or condition. In another aspect, the disease or condition is an inflammatory disease or condition. In another aspect, the oligonucleotide enhances the degradation of IL7R mRNA lacking exon 6 by targeting the boundary of exon 5 - exon 7 of IL7R, e.g., with an ASO, siRNA, shRNA that reduces the stability of sIL7R RNA (e.g., increases degradation) and / or an ASO that reduces the translation of sIL7R RNA. In another aspect, the method further comprises combination therapy of an SM-ASO and one or more active agents effective in treating autoimmune diseases, such active agents including but not limited to mitoxantrone, interferon beta-1a, PEG-interferon beta-1a, azathioprine, fingolimod, natalizumab, methylprednisolone or ocrelizumab. In another aspect, the method further comprises the step of obtaining cells from a patient and modifying the cells to transiently or permanently express an oligonucleotide that specifically binds to a sequence that affects exon 6 splicing in the pre-mRNA of interleukin-7 receptor (IL7R). In another aspect, the method further comprises generating a vector expressing an oligonucleotide that specifically binds to a sequence that affects exon 6 splicing in the pre-mRNA of interleukin-7 receptor (IL7R) for gene therapy and treating the patient with the vector.

[0018] In another embodiment, the present invention includes a composition comprising an oligonucleotide, which is an antisense oligonucleotide (ASO) or a splicing-modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in the interleukin 7 receptor (IL7R) pre-mRNA that affects the splicing of exon 6, wherein the SM-ASO increases the inclusion of exon 6 in the IL7R pre-mRNA and reduces the expression of the IL7R soluble isoform (sIL7R). In one aspect, the oligonucleotide in the composition specifically binds to a sequence in the IL7R pre-mRNA in at least one of the group consisting of exon splicing silencers (ESSs) and / or intron splicing silencers (ISSs), thereby enhancing the inclusion of exon 6 in the IL7R pre-mRNA and reducing the expression of sIL7R. In another aspect, the oligonucleotide in the composition specifically binds to a sequence on the IL7R pre-mRNA at an intron-exon splicing site, a branch point sequence, and / or a polypyrimidine tract. In another aspect, at least one or more nucleotides in the oligonucleotide comprise a non-naturally occurring modification, which includes a modification or substitution of: (1) a ribose or other sugar unit, (2) a base, or (3) a backbone, selected from: one or more phosphorothioates, dithiophosphates, phosphodiesters, methylphosphonates, aminophosphates, methylphosphonates, phosphotriesters, phosphoroaridates, morpholinos, amidated carbamates, carboxymethyls, acetamidates, polyamides, sulfonates, sulfonamides, aminosulfonates, formaldehyde acetals, thioformaldehyde acetals, and / or alkylsilyl substitutions, partially or fully modified backbones such as a fully modified phosphorothioate backbone, a locked nucleic acid backbone, a peptide backbone, a phosphotriester backbone, an aminophosphate backbone, a siloxane backbone, a carboxymethyl ester backbone, an acetamidate backbone, a carbamate backbone, a thioether backbone, a bridged methylene phosphonate backbone, a phosphorothioate backbone, a methylphosphonate backbone, an alkylphosphonate backbone, a phosphate ester backbone, an alkylthiophosphonate backbone, a dithiophosphate backbone, a carbonate backbone, a phosphotriester backbone, a carboxymethyl ester backbone, a methylthiophosphonate backbone, a dithiophosphate backbone, a backbone with a p-ethoxy bond, sugar modifications such as 2'-O-methyl (2'-O-methyl nucleotides), 2'-O-methyloxyethoxy (2'-O-MOE), 2'-O-alkyl-modified sugar moieties, or bicyclic sugar moieties, nucleotide analogs, peptide nucleic acids (PNAs), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, ethylene glycol nucleic acids, threose nucleic acids, and locked nucleic acids (LNAs), and any combination of any two or more of the foregoing. In another aspect, at least one or more nucleotides in the oligonucleotide comprise a non-naturally occurring modification of the nucleobase.In another aspect, the oligonucleotide specifically binds to any target SEQ ID (SEQ ID NO: 1-13) selected from Table 1, alone or in combination, or a portion thereof, or the sequence of the oligonucleotide has at least 70%, 75%, 80%, 84%, 85%, 88%, 92%, 93%, 94%, 95% or 96% complementarity to the complete target sequence within IL7R RNA. In another aspect, the oligonucleotide targets any SEQ ID (SEQ ID NO: 1-13) in Table 1, in whole or in part. In another aspect, the composition further comprises a pharmaceutically acceptable excipient, salt or carrier. In another aspect, the composition is adapted for administration to treat an autoimmune disease selected from at least one of the following: multiple sclerosis, type 1 diabetes, rheumatoid arthritis, systemic lupus erythematosus, atopic dermatitis, ankylosing spondylitis, primary biliary cirrhosis, inflammatory bowel syndromes such as ulcerative colitis and Crohn's disease, or any other condition in which sIL7R is elevated. In another aspect, the oligonucleotide enhances the degradation of IL7R mRNA lacking exon 6 by targeting the boundary of exon 5 - exon 7 of IL7R, for example, with an ASO, siRNA, shRNA that reduces the stability of sIL7R RNA (e.g., increases degradation) and / or an ASO that reduces the translation of sIL7R RNA.

[0019] In yet another embodiment, the present invention includes a method of increasing the inclusion of exon 6 of interleukin-7 receptor (IL7R) pre-mRNA, the method comprising: contacting interleukin-7 receptor (IL7R) pre-mRNA with a splicing regulatory antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in interleukin-7 receptor (IL7R) pre-mRNA that affects the splicing of exon 6, wherein the SM-ASO increases the inclusion of exon 6 in IL7R pre-mRNA and reduces the expression of the IL7R soluble isoform (sIL7R). In one aspect, the SM-ASO in the composition specifically binds to a sequence in IL7R pre-mRNA in at least one of the group consisting of exon splicing silencers (ESSs) and / or intron splicing silencers (ISSs), thereby enhancing the inclusion of exon 6 in IL7R pre-mRNA and reducing the expression of sIL7R. In another aspect, the SM-ASO in the composition specifically binds to a sequence on IL7R pre-mRNA at an intron-exon splicing site, a branch point sequence, and / or a polypyrimidine tract. In another aspect, at least one or more nucleotides in the SM-ASO comprise non-naturally occurring modifications, which modifications or substitutions include: (1) ribose or other sugar moieties, (2) bases, or (3) backbones, selected from: one or more phosphorothioates, dithiophosphates, phosphodiesters, methylphosphonates, amidophosphates, methylphosphonates, phosphotriesters, phosphoroaridates, morpholinos, amidated carbamates, carboxymethyls, acetamidates, polyamides, sulfonates, sulfonamides, amidosulfonates, formaldehyde acetals, thioformaldehyde acetals, and / or alkylsilyl substitutions, partially or fully modified backbones, such as fully modified phosphorothioate backbones, locked nucleic acid backbones, peptide backbones, phosphotriester backbones, amidophosphate backbones, siloxane backbones, carboxymethyl ester backbones, acetamidate backbones, carbamate backbones, thioether backbones, bridged methylene phosphonate backbones, phosphorothioate backbones, methylphosphonate backbones, alkylphosphonate backbones, phosphate ester backbones, alkylthiophosphonate backbones, dithiophosphate backbones, carbonate backbones, phosphotriester backbones, carboxymethyl ester backbones, methylthiophosphate backbones, dithiophosphate backbones, backbones with p-ethoxy linkages, sugar modifications such as 2'-O-methyl (2'-O-methyl nucleotides), 2'-O-methoxyethoxy (2'-O-MOE), 2'-O-alkyl modified sugar moieties, or bicyclic sugar moieties, nucleotide mimics, peptide nucleic acids (PNAs), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, ethylene glycol nucleic acids, threose nucleic acids, and locked nucleic acids (LNAs), and any combination of any two or more of the above. In another aspect, at least one or more nucleotides in the SM-ASO comprise non-naturally occurring modifications to the nucleobases.In another aspect, SM-ASO enhances the degradation of IL7R mRNA lacking exon 6 by targeting the boundary of exon 5-exon 7 of IL7R, for example, with ASOs, siRNAs, shRNAs that reduce the stability of sIL7R RNA (e.g., increase degradation), and / or ASOs that reduce the translation of sIL7R RNA. In another aspect, SM-ASO blocks the translation of IL7R mRNA lacking exon 6. In another aspect, SM-ASO specifically binds to any target SEQ ID (SEQ ID NO: 1-13) selected from Table 1 alone or in combination, or a portion thereof, or the sequence of the SM-ASO has at least 70%, 75%, 80%, 84%, 85%, 88%, 92%, 93%, 94%, 95%, or 96% complementarity to the complete target sequence within the IL7R RNA. In another aspect, the oligonucleotide targets any SEQ ID (SEQ ID NO: 1-13) in Table 1, in whole or in part. In another aspect, the composition further comprises a pharmaceutically acceptable excipient, salt, or carrier. In another aspect, the autoimmune disease is selected from at least one of the following: multiple sclerosis, type 1 diabetes, rheumatoid arthritis, systemic lupus erythematosus, atopic dermatitis, ankylosing spondylitis, primary biliary cirrhosis, inflammatory bowel syndromes such as ulcerative colitis and Crohn's disease, or any condition in which sIL7R is elevated. In another aspect, the method further comprises the step of obtaining cells from a patient and modifying the cells to transiently or permanently express an oligonucleotide that specifically binds to a sequence in the interleukin-7 receptor (IL7R) pre-mRNA that affects exon 6 splicing. In another aspect, the method further comprises generating a vector expressing an oligonucleotide that specifically binds to a sequence in the interleukin-7 receptor (IL7R) pre-mRNA that affects exon 6 splicing for gene therapy, and treating a patient with the vector.

[0020] In another embodiment, the invention includes a composition for increasing the inclusion of exon 6 in interleukin-7 receptor (IL7R) pre-mRNA, the method comprising: contacting the interleukin-7 receptor (IL7R) pre-mRNA with a splicing-modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in the interleukin-7 receptor (IL7R) pre-mRNA that affects exon 6 splicing, wherein the SM-ASO increases the inclusion of exon 6 in the IL7R pre-mRNA and reduces the expression of the IL7R soluble isoform (sIL7R). In one aspect, the composition further comprises combination therapy of the SM-ASO and one or more active agents effective in treating autoimmune diseases, the active agents selected from, but not limited to, mitoxantrone, interferon beta-1a, PEG-interferon beta-1a, azathioprine, fingolimod, natalizumab, methylprednisolone, or ocrelizumab.

[0021] In another embodiment, the invention includes a vector expressing a nucleic acid comprising an oligonucleotide that is an antisense oligonucleotide (ASO) or a splicing-modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in the interleukin-7 receptor (IL7R) pre-mRNA that affects exon 6 splicing, wherein the SM-ASO increases the inclusion of exon 6 in the IL7R pre-mRNA and reduces the expression of the soluble isoform of IL7R (sIL7R). In one aspect, the vector is a viral vector or a plasmid.

[0022] In another embodiment, the invention includes a vector expressing a nucleic acid comprising an antisense oligonucleotide (ASO), a splicing-modulating antisense oligonucleotide (SM-ASO), a translation-blocking antisense oligonucleotide, siRNA, shRNA or miRNA that specifically binds to a sequence in the interleukin-7 receptor (IL7R) pre-mRNA that enhances the inhibition or degradation of IL7R RNA lacking exon 6, wherein the nucleic acid reduces the expression of the soluble isoform of IL7R (sIL7R). In one aspect, the vector is a viral vector or a plasmid.

[0023] In another embodiment, the invention includes a method of treating multiple sclerosis in a subject in need thereof, the method comprising: administering an effective amount of a composition that comprises a splicing-modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in the interleukin-7 receptor (IL7R) pre-mRNA that affects exon 6 splicing, wherein the SM-ASO increases the inclusion of exon 6 in the IL7R pre-mRNA and reduces the expression of the soluble isoform of IL7R (sIL7R). In one aspect, the method further comprises combination therapy of the SM-ASO and one or more active agents effective in treating multiple sclerosis. In another aspect, the one or more agents for treating multiple sclerosis are selected from, but not limited to, mitoxantrone, interferon beta-1a, PEG-interferon beta-1a, azathioprine, fingolimod, natalizumab, methylprednisolone or ocrelizumab.

[0024] In another embodiment, the present invention includes a method of treating cancer in a subject in need thereof, the method comprising: administering an effective amount of a composition comprising an oligonucleotide that specifically binds to a sequence in the interleukin-7 receptor (IL7R) pre-mRNA that affects the splicing of exon 6, wherein the oligonucleotide reduces the inclusion of exon 6 in the IL7R pre-mRNA and increases the expression of the soluble isoform (sIL7R) of IL7R. In one aspect, the oligonucleotide is an antisense oligonucleotide (ASO) or a splicing-modulating antisense oligonucleotide (SM-ASO). In another aspect, the oligonucleotide in the composition specifically binds to a sequence in the IL7R pre-mRNA in at least one of the group consisting of exon splicing enhancers (ESEs) and / or intron splicing enhancers (ISEs), thereby reducing the inclusion of exon 6 and increasing the expression of sIL7R. In another aspect, the oligonucleotide in the composition specifically binds to a sequence on the IL7R pre-mRNA at an intron-exon splicing site, a branch point sequence, and / or a polypyrimidine tract. In another aspect, at least one or more nucleotides in the oligonucleotide comprise a non-naturally occurring modification, which modification or substitution includes: (1) ribose or other sugar moieties, (2) bases, or (3) backbones, selected from: one or more phosphorothioates, dithiophosphates, phosphodiesters, methylphosphonates, aminophosphates, methylphosphonates, phosphotriesters, phosphoroaridates, morpholinos, amidated carbamates, carboxymethyls, acetamidates, polyamides, sulfonates, sulfonamides, aminosulfonates, formaldehyde acetals, thioformaldehyde acetals, and / or alkylsilyl substitutions, partially or fully modified backbones, such as fully modified phosphorothioate backbones, locked nucleic acid backbones, peptide backbones, phosphotriester backbones, aminophosphate backbones, siloxane backbones, carboxymethyl ester backbones, acetamidate backbones, carbamate backbones, thioether backbones, bridged methylene phosphonate backbones, phosphorothioate backbones, methylphosphonate backbones, alkylphosphonate backbones, phosphate ester backbones, alkylthiophosphonate backbones, dithiophosphate backbones, carbonate backbones, phosphotriester backbones, carboxymethyl ester backbones, methylthiophosphonate backbones, dithiophosphate backbones, backbones with p-ethoxy linkages, sugar modifications such as 2'-O-methyl (2'-O-methyl nucleotides), 2'-O-methoxyethoxy (2'-O-MOE), 2'-O-alkyl-modified sugar moieties, or bicyclic sugar moieties, nucleotide mimics, peptide nucleic acids (PNAs), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, ethylene glycol nucleic acids, threose nucleic acids, and locked nucleic acids (LNAs), and combinations of any two or more of the foregoing. In another aspect, at least one or more nucleotides in the oligonucleotide comprise a non-naturally occurring modification to the nucleobase.In another aspect, the oligonucleotide specifically binds to any target SEQ ID (SEQ ID NO: 14 - 50) selected from Table 2, either alone or in combination, or a portion thereof, or the sequence of the oligonucleotide has at least 70%, 75%, 80%, 84%, 85%, 88%, 92%, 93%, 94%, 95% or 96% complementarity to the complete target sequence within IL7R RNA. In another aspect, the oligonucleotide targets any SEQ ID (SEQ ID NO: 14 - 50) in Table 2 or a portion thereof. In another aspect, the composition further comprises a pharmaceutically acceptable excipient, salt or carrier. In another aspect, the cancer shows low response to conventional immunotherapy (such as hepatocellular carcinoma). In another aspect, the method further comprises combination therapy of the SM - ASO and one or more active agents effective in treating cancer, such active agents including but not limited to immune checkpoint inhibitors (e.g., nivolumab), therapeutic antibodies (e.g., Herceptin), conventional chemotherapy (e.g., paclitaxel) or therapeutic radiation. In another aspect, the method further comprises the step of obtaining cells from a patient and modifying the cells to transiently or permanently express an oligonucleotide that specifically binds to a sequence affecting exon 6 splicing in the pre - mRNA of interleukin - 7 receptor (IL7R). In another aspect, the method further comprises generating a vector expressing an oligonucleotide that specifically binds to a sequence affecting exon 6 splicing in the pre - mRNA of interleukin - 7 receptor (IL7R) for gene therapy and treating the patient with the vector.

[0025] In another embodiment, the invention includes a composition comprising an oligonucleotide that is an antisense oligonucleotide (ASO) or a splicing-modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in the interleukin 7 receptor (IL7R) pre-mRNA that affects the splicing of exon 6, wherein the SM-ASO reduces the inclusion of exon 6 in the IL7R pre-mRNA and increases the expression of the soluble isoform of IL7R (sIL7R). In another aspect, the oligonucleotide in the composition specifically binds to a sequence in the IL7R pre-mRNA in at least one of the group consisting of exon splicing enhancers (ESEs) and / or intron splicing enhancers (ISEs), thereby reducing the inclusion of exon 6 and increasing the expression of sIL7R. In another aspect, the oligonucleotide in the composition specifically binds to a sequence on the IL7R pre-mRNA at an intron-exon splicing site, a branch point sequence, and / or a polypyrimidine tract. In another aspect, at least one or more nucleotides in the oligonucleotide comprise a non-naturally occurring modification, which modification includes a modification or substitution of: (1) a ribose or other sugar moiety, (2) a base, or (3) a backbone, selected from: one or more phosphorothioates, dithiophosphates, phosphodiesters, methylphosphonates, amidophosphates, methylphosphonates, phosphotriesters, phosphoroaridates, morpholinos, amidated carbamates, carboxymethyls, acetamidates, polyamides, sulfonates, sulfonamides, amidosulfonates, formaldehyde acetals, thioformaldehyde acetals, and / or alkylsilyl substitutions, partially or fully modified backbones such as a fully modified phosphorothioate backbone, a locked nucleic acid backbone, a peptide backbone, a phosphotriester backbone, an amidophosphate backbone, a siloxane backbone, a carboxymethyl ester backbone, an acetamidate backbone, a carbamate backbone, a thioether backbone, a bridged methylphosphonate backbone, a phosphorothioate backbone, a methylphosphonate backbone, an alkylphosphonate backbone, a phosphate ester backbone, an alkylthiophosphonate backbone, a dithiophosphate backbone, a carbonate backbone, a phosphotriester backbone, a carboxymethyl ester backbone, a methylthiophosphonate backbone, a dithiophosphate backbone, a backbone with a p-ethoxy linkage, sugar modifications such as 2'-O-methyl (2'-O-methyl nucleotides), 2'-O-methoxyethoxy (2'-O-MOE), 2'-O-alkyl-modified sugar moieties, or bicyclic sugar moieties, nucleotide mimics, peptide nucleic acids (PNAs), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, glycol nucleic acids, threose nucleic acids, and locked nucleic acids (LNAs), and any combination of any two or more of the foregoing. In another aspect, at least one or more nucleotides in the oligonucleotide comprise a non-naturally occurring modification to the nucleobase.In another aspect, the oligonucleotide specifically binds to any target SEQ ID (SEQ ID NO: 14 - 50) selected from Table 2, either alone or in combination, or a portion thereof, or the sequence of the oligonucleotide has at least 70%, 75%, 80%, 84%, 85%, 88%, 92%, 93%, 94%, 95% or 96% complementarity to the complete target sequence within IL7R RNA. In another aspect, the oligonucleotide targets any SEQ ID (SEQ ID NO: 14 - 50) in Table 2, either completely or partially. In another aspect, the composition further comprises a pharmaceutically acceptable excipient, salt or carrier. In another aspect, the composition is suitable for administration to treat cancer.

[0026] In yet another embodiment, the present invention includes a method of reducing the inclusion of exon 6 in interleukin-7 receptor (IL7R) pre-mRNA, the method comprising: contacting interleukin-7 receptor (IL7R) pre-mRNA with a splicing modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in interleukin-7 receptor (IL7R) pre-mRNA that affects the splicing of exon 6, wherein the SM-ASO reduces the inclusion of exon 6 in IL7R pre-mRNA and increases the expression of the IL7R soluble isoform (sIL7R). In another aspect, the oligonucleotide in the composition specifically binds to a sequence in IL7R pre-mRNA in at least one of the group consisting of exon splicing enhancers (ESEs) and / or intron splicing enhancers (ISEs), thereby reducing the inclusion of exon 6 and increasing the expression of sIL7R. In another aspect, the SM-ASO in the composition specifically binds to a sequence on IL7R pre-mRNA at an intron-exon splicing site, a branch point sequence, and / or a polypyrimidine tract. In another aspect, at least one or more nucleotides in the SM-ASO comprise non-naturally occurring modifications, which modifications or substitutions include: (1) ribose or other sugar moieties, (2) bases, or (3) backbones, selected from: one or more phosphorothioates, dithiophosphates, phosphodiesters, methylphosphonates, amidophosphates, methylphosphonates, phosphotriesters, phosphoroaridates, morpholinos, amidated carbamates, carboxymethyls, acetamidates, polyamides, sulfonates, sulfonamides, sulfamidates, formacetals, thioformacetals, and / or alkylsilyl substitutions, partially or fully modified backbones such as fully modified phosphorothioate backbones, locked nucleic acid backbones, peptide backbones, phosphotriester backbones, amidophosphate backbones, siloxane backbones, carboxymethyl ester backbones, acetamidate backbones, carbamate backbones, thioether backbones, bridged methylene phosphonate backbones, phosphorothioate backbones, methylphosphonate backbones, alkylphosphonate backbones, phosphate ester backbones, alkylthiophosphonate backbones, dithiophosphate backbones, carbonate backbones, phosphotriester backbones, carboxymethyl ester backbones, methylthiophosphate backbones, dithiophosphate backbones, backbones with p-ethoxy linkages, sugar modifications such as 2'-O-methyl (2'-O-methyl nucleotides), 2'-O-methoxyethoxy (2'-O-MOE), 2'-O-alkyl modified sugar moieties, or bicyclic sugar moieties, nucleotide mimics, peptide nucleic acids (PNAs), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, ethylene glycol nucleic acids, threose nucleic acids, and locked nucleic acids (LNAs), and any combination of any two or more of the foregoing. In another aspect, at least one or more nucleotides in the SM-ASO comprise non-naturally occurring modifications to the nucleobases. In another aspect, the SM-ASO enhances the stability of IL7R mRNA lacking exon 6 by targeting the boundary of exon 5-exon 7 of IL7R.On the other hand, SM-ASO enhances the translation of IL7R mRNA lacking exon 6. On the other hand, the SM-ASO specifically binds to any target SEQ ID selected from Table 2, alone or in combination, or a portion thereof, or the sequence of the SM-ASO has at least 70%, 75%, 80%, 84%, 85%, 88%, 92%, 93%, 94%, 95% or 96% complementarity to the complete target sequence within the IL7R RNA. On the other hand, the oligonucleotide targets any SEQ ID in Table 2, either fully or partially. On the other hand, the composition further comprises a pharmaceutically acceptable excipient, salt or carrier. On the other hand, the disease is a cancer. On the other hand, the method further comprises the step of obtaining cells from a patient and modifying the cells to transiently or permanently express an oligonucleotide that specifically binds to a sequence that affects exon 6 splicing in the pre-mRNA of interleukin-7 receptor (IL7R). On the other hand, the method further comprises generating a vector expressing an oligonucleotide that specifically binds to a sequence that affects exon 6 splicing in the pre-mRNA of interleukin-7 receptor (IL7R) for gene therapy and treating the patient with the vector.

[0027] In another embodiment, the invention includes a composition for increasing the inclusion of exon 6 in the pre-mRNA of interleukin-7 receptor (IL7R), the method comprising: contacting the pre-mRNA of interleukin-7 receptor (IL7R) with a splicing-modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence that affects exon 6 splicing in the pre-mRNA of interleukin-7 receptor (IL7R), wherein the SM-ASO reduces the inclusion of exon 6 in the IL7R pre-mRNA and increases the expression of the soluble isoform of IL7R (sIL7R). In one aspect, the composition further comprises combination therapy of the SM-ASO and one or more active agents effective in treating cancer, such active agents including but not limited to immune checkpoint inhibitors (e.g., nivolumab), therapeutic antibodies (e.g., Herceptin), conventional chemotherapy (e.g., paclitaxel) or therapeutic radiation.

[0028] In another embodiment, the invention includes a vector that expresses a nucleic acid comprising an oligonucleotide that is an antisense oligonucleotide (ASO) or a splicing-modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence that affects exon 6 splicing in the pre-mRNA of interleukin-7 receptor (IL7R), wherein the SM-ASO reduces the inclusion of exon 6 in the IL7R pre-mRNA and increases the expression of the soluble isoform of IL7R (sIL7R). In one aspect, the vector is a viral vector or a plasmid. Brief Description of the Drawings

[0030] To more fully understand the features and advantages of the present invention, reference is now made to the detailed description of the invention and the drawings, in which:

[0031] Figures 1A to 1C Shows the validation of a GFP-IL7R fluorescent splicing reporter for screening splicing-modulating antisense oligonucleotides (SM-ASOs).

[0032] Figures 2A to 2E Shows the targeted screening of an IL7R splicing-modulating antisense oligonucleotide (SM-ASO) complementary to the sequence in exon 6.

[0033] Figures 3A to 3E Shows the SM-ASO walking screening targeted sequences in introns 5 and 6 of IL7R.

[0034] Figures 4A to 4D Shows the effect of the selected SM-ASOs on the expression of IL7R protein isoforms.

[0035] Figures 5A to 5D Shows the dose-responsive effect of the major SM-ASO that reduces sIL7R on the regulation of IL7R exon 6 splicing.

[0036] Figures 6A to 6D Shows the dose-responsive effect of the major SM-ASO that increases sIL7R on the regulation of IL7R exon 6 splicing.

[0037] Figures 7A to 7B Shows the correction of the genetic aberrant effect of IL7R-005 on increasing the exclusion of IL7R exon 6 and the level of sIL7R in MS. DETAILED DESCRIPTION OF THE INVENTION

[0039] Although various embodiments of making and using the present invention are discussed in detail below, it should be understood that the present invention provides many applicable inventive concepts that can be implemented in various specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways of making and using the present invention and do not limit the scope of the present invention.

[0040] To facilitate understanding of the present invention, many terms are defined below. The terms defined herein have the meanings commonly understood by those of ordinary skill in the relevant art of the present invention. Terms such as "a", "an", and "the" are not intended to refer only to a single entity but include the general category of specific instances that can be used for illustration. The terms herein are used to describe specific embodiments of the present invention, but their usage does not limit the scope of the present invention except as outlined in the claims.

[0041] The present invention relates to new compositions and methods for treating autoimmune diseases (such as multiple sclerosis) or cancer by respectively reducing or increasing soluble IL7R (sIL7R). The present invention uses SM-ASO to control the alternative splicing of interleukin 7 receptor (IL7R) pre-mRNA to prevent or reduce the expression of sIL7R or, conversely, increase the expression of sIL7R. For example, given the ability of sIL7R to enhance autoreactivity, it is shown herein that increasing sIL7R levels can enhance the response to currently employed immunotherapies (such as immune checkpoint inhibitors).

[0042] Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature and experimental procedures used herein in cell culture, molecular genetics, organic chemistry, organic synthesis, nucleic acid chemistry, and nucleic acid hybridization are those well known and commonly employed in the art. In addition, standard techniques are available for the synthesis of nucleic acids and peptides. Such techniques and procedures are generally carried out according to conventional methods known in the art and various general references (e.g., Sambrook and Russell, 2012, Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., and Ausubel et al., 2012, Current Protocols in Molecular Biology, John Wiley & Sons, NY), relevant portions of which are incorporated herein by reference.

[0043] Conventional symbols are used herein to describe polynucleotide sequences. For example, the left-hand end of a single-stranded polynucleotide sequence is the 5'-end, and vice versa for the 3'-end (right-hand end); for a sequence such as a sequence that becomes a coding sequence, the left-hand direction of a double-stranded polynucleotide sequence is called the 5'-direction, and vice versa for the 3'-direction (right-hand direction). The direction of nucleotide addition to the nascent RNA transcript from 5' to 3' is called the transcription direction. The DNA strand having the same sequence as the mRNA is called the "coding strand". A sequence on a DNA or RNA strand that is located 5' from a reference point on the DNA or RNA is called an "upstream sequence", and a sequence on a DNA or RNA strand that is located 3' from a reference point on the DNA or RNA is called a "downstream sequence".

[0044] As used herein, the term "antisense" refers to an oligonucleotide having a sequence that hybridizes to a target sequence in RNA through Watson-Crick base pairing to form an RNA:oligonucleotide heteroduplex with the target sequence (usually with mRNA or pre-mRNA). The antisense oligonucleotide can have exact sequence complementarity or near complementarity to the target sequence. These antisense oligonucleotides can block or inhibit the translation of mRNA, alter the processing of mRNA to produce spliced variants of mRNA, and / or promote the specific degradation of a given mRNA or mRNA variant. A non-limiting example can also be RNase H-dependent degradation. The antisense sequence need not be complementary only to the coding portion of the RNA molecule. The antisense sequence can be complementary to regulatory sequences specified on the non-coding regions (e.g., introns, untranslated regions) of an RNA molecule encoding a protein, which control the expression of the coding sequence. The length of the antisense oligonucleotide is generally between about 5 and about 100 nucleotides, more typically between about 7 and about 50 nucleotides, and even more typically between about 10 nucleotides and about 30 nucleotides.

[0045] As used herein, the term "nucleic acid" or "nucleic acid molecule" refers to any single-stranded or double-stranded DNA or RNA molecule, whether linear or circular. With respect to the nucleic acids of the present invention, when applied to DNA or RNA, the term "isolated nucleic acid" refers to a DNA or RNA molecule that is separated from the sequences that flank it in the naturally occurring genome or gene product of the organism from which the DNA or RNA molecule is derived. For example, an "isolated nucleic acid" can comprise a DNA molecule inserted into a vector such as a plasmid or viral vector, or integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism.

[0046] As used herein, the term "specifically hybridizes" or "substantially complementary" refers to an association between two nucleotide molecules having sufficient complementarity to permit hybridization under the pre-determined conditions commonly used in the art. Examples of low, medium or moderate and high stringency hybridization conditions are well known to those skilled in the art, such as those described in Sambrook and Russell, 2012, Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., or Ausubel et al., 2012, Current Protocols in Molecular Biology, John Wiley & Sons, NY, the relevant portions of which are incorporated herein by reference.

[0047] As used herein, the phrase "chemically modified oligonucleotide" refers to short nucleic acids (DNA or RNA), which can be sense or antisense, including modifications or substitutions such as those taught by Wan and Seth, "The Medicinal Chemistry of Therapeutic Oligonucleotides", J. Med. Chem. 2016, 59, 21, 9645 - 9667, the relevant portions of which are incorporated herein by reference, and which may include the following modifications: (1) ribose or other sugar units; (2) bases; or (3) backbones, which essentially include phosphate esters as known in the art.Non-limiting examples of modified or nucleotide analogs include, but are not limited to, nucleotides having phosphate modifications, which include one or more phosphorothioates, dithiophosphates, phosphodiesters, methylphosphonates, aminophosphonates, methylphosphonates, triesters, phosphoroaridates, morpholinos, amidated carbamates, carboxymethyls, acetamidates, polyamides, sulfonates, sulfonamides, sulfamates, formacetals, thioformacetals, and / or alkylsilyl substitutions (see, e.g., Hunziker and Leumann (1995) Nucleic Acid Analogues: Synthesis and Properties, in Modem Synthetic Methods, VCH, 331-417; Mesmaeker et al. 1994) Novel Backbone Replacements for Oligonucleotides, in Carbohydrate Modifications in Antisense Research, ACS, 24-39); nucleotides having modified sugars (see, e.g., U.S. Patent Application Publication No. 2005 / 0118605) and sugar modifications such as 2'-O-methyl (2'-O-methyl nucleotides) and 2'-O-methoxyethoxy (2'-O-MOE), 2'-O-alkyl modified sugar moieties or bicyclic sugar moieties, and nucleotide analogs such as, but not limited to, peptide nucleic acids (PNAs), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, glycol nucleic acids, threose nucleic acids, and locked nucleic acids (LNAs), and partially or fully modified backbones such as fully modified sugar phosphate backbones, locked nucleic acid backbones, peptide backbones, triester backbones, aminophosphate backbones, siloxane backbones, carboxymethyl ester backbones, acetamidate backbones, carbamate backbones, thioether backbones, bridged methylene phosphonate backbones, phosphorothioate backbones, methylphosphonate backbones, alkylphosphonate backbones, phosphate ester backbones, alkylthiophosphonate backbones, dithiophosphate backbones, carbonate backbones, triester backbones, carboxymethyl ester backbones, methylthiophosphate backbones, dithiophosphate backbones, backbones having p-ethoxy linkages, and combinations of any two or more of the foregoing (see, e.g., U.S. Patent Nos. 5,886,165; 6,140,482; 5,693,773; 5,856,462; 5,973,136; 5,929,226; 6,194,598; 6,172,209; 6,175,004; 6,166,197; 6,166,188; 6,160,152; 6,160,109; 6,153,737; 6,147,200; 6,146,829; 6,127,533, and 6,124,445, the relevant portions of which are incorporated herein by reference).

[0048] As used herein, the term "expression cassette" refers to a nucleic acid molecule comprising a coding sequence operably linked to promoter / regulatory sequences necessary for transcription, processing and optionally translation or splicing of the coding sequence.

[0049] IL7R SM-ASOs that decrease sIL7R can be used to treat diseases or disorders such as autoimmune and / or inflammatory diseases. IL7R SM-ASOs that increase sIL7R can be used in immuno-oncology applications. Whether increasing or decreasing the expression of sIL7R messenger or protein, the present invention can be used in combination with gene therapy and ex vivo applications. For example, the oligonucleotides can be used in methods in which cells are isolated from a subject or another subject and the cells are modified to express the oligonucleotides that modify sIL7R expression, and then the cells can be transferred back to the subject. The present invention can be used in conjunction with a variety of known delivery and expression methods such as plasmid or viral vectors. In addition, the present invention can be used with all methods of cell modification, for example delivery of gene editing, nucleic acids (any nucleic acid, natural, synthetic or modified), proteins (full-length proteins or peptides), whether transient or permanent, or under the control of an inducible promoter. The oligonucleotides or vectors expressing the oligonucleotides can be delivered by known methods such as transfection, electroporation, vector-mediated, viral, etc.

[0050] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product and operably linked to the promoter / regulatory sequence. In some cases, the promoter / regulatory sequence can be a core promoter sequence and in other cases, the sequence can also include enhancer sequences and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence can be, for example, a sequence that drives expression of the gene product in a constitutive and / or inducible manner. As used herein, the term "inducible promoter" refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, results in significant production of the gene product only when an inducer corresponding to the promoter is present.

[0051] As used herein, the terms "percent similarity", "percent identity" and "percent homology", when referring to a comparison between two specific sequences, refer to the percentage or bases that are the same along a specific sequence. The percentage of similarity, identity or homology can be calculated using, for example, the University of Wisconsin GCG software program or equivalents.

[0052] As used herein, the term "replicon" refers to any genetic element, such as a plasmid, cosmid, bacmid, phage or virus, that is capable of replicating in large numbers under its own control. A replicon can be RNA or DNA, and can be single-stranded or double-stranded.

[0053] As used herein, the term "vector" refers to a genetic element, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (DNA or RNA) can be attached. A vector can be a replicon, resulting in replication of the attached sequence or element. An "expression vector" is a vector that facilitates the expression of a nucleic acid, such as an oligonucleotide or a nucleic acid sequence encoding a polypeptide, in a host cell or organism.

[0054] As used herein, the term "operably linked" refers to a nucleic acid sequence that is placed in a functional relationship with another nucleic acid sequence. Examples of nucleic acid sequences that can be operably linked include, but are not limited to, promoters, transcription terminators, enhancers or activators, and heterologous genes, which, when transcribed and, if appropriate, translated, will produce a functional product, such as a protein, ribozyme or RNA molecule.

[0055] As used herein, the term "oligonucleotide" refers to a single-stranded or double-stranded nucleic acid chain that is typically shorter in length than the coding sequence of a gene. For example, the length of an oligonucleotide is typically at least 4-6 bases or base pairs and up to about 200, and the most typical oligonucleotides are in the range of 8-20, 10-25, 12-30 bases or base pairs or about 30, 35, 40 or 50 bases or base pairs. In a specific example of the present invention, the oligonucleotide is a nucleic acid chain having a sequence that includes exon 6 in the pre-mRNA of the interleukin-7 receptor (IL7R) gene and is defined as including a nucleic acid molecule of two or more, preferably more than four ribonucleotides or deoxyribonucleotides. The exact size of the oligonucleotide will depend on a variety of factors and the specific application and use of the oligonucleotide, which can be varied as known to those skilled in the art without undue experimentation based on the teachings herein and the teachings in the following: for example, Sambrook and Russell, 2012, Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., or Ausubel et al., 2012, Current Protocols in Molecular Biology, John Wiley & Sons, NY, the relevant portions of which are incorporated herein by reference.

[0056] As used herein, the term "splicing variant or isoform of an mRNA" refers to a variant mRNA that may be defective or pathogenic and is the result of alternative splicing of an RNA encoding a protein. A splicing event that gives rise to a defective or pathologic mRNA splicing variant is referred to in the present invention as a splicing defect. An example of such a splicing defect is the exclusion of exon 6 of IL7R, resulting in the expression of a shorter soluble protein IL7R (sIL7R) secreted from the cell, leading to its presence in, for example, the bloodstream or other body fluids. The present invention is directed to elements (i.e., sequences) in the IL7R pre-mRNA that control the inclusion or exclusion of IL7R exon 6 in the ultimately mature or processed mRNA, or sequences in the sIL7R mRNA that control its translation or stability.

[0057] As used herein, the term "splicing variant or isoform of a protein" refers to a variant protein that may be defective or pathogenic and is the result of alternative splicing of an RNA encoding a protein. Optionally, when discussing those variants that increase degradation, those splicing variants reduce or eliminate protein production. A splicing event that gives rise to a defective or pathologic protein splicing variant is referred to in the present invention as a splicing defect. An example of such a splicing defect is the exclusion of exon 6 of IL7R, resulting in the expression of a shorter soluble protein IL7R (sIL7R) secreted from the cell, leading to its presence in, for example, the bloodstream or other body fluids. The present invention is directed to elements (i.e., sequences) in the IL7R pre-mRNA that control the inclusion or exclusion of IL7R exon 6 in the ultimately mature or processed mRNA, or sequences in the sIL7R mRNA that control its translation or stability.

[0058] As used herein, the term "treatment" refers to reversing, alleviating, delaying the onset of, inhibiting the progression of, and / or preventing a disease or disorder or one or more of its symptoms, and this term applies to a subject, such as an autoimmune disease or disorder. In some embodiments, treatment can be administered after one or more symptoms have developed. In other embodiments, treatment can be administered in the absence of symptoms. For example, treatment can be administered before symptoms appear (e.g., in view of a history of symptoms and / or one or more other susceptibility factors) or after symptoms have disappeared, for example, to prevent or delay their recurrence. One such non-limiting example is relapsing-remitting MS.

[0059] As used herein, the terms "effective amount" and "pharmaceutically effective amount" refer to an amount of an agent sufficient to provide the desired biological result. Preferably, a sufficient amount of the agent will not cause toxic side effects. Use of the IL7R SM-ASO of the invention that reduces sIL7R will result in a reduction and / or alleviation of the signs, symptoms, or causes of an autoimmune disease or disorder. As designed, it is expected that the invention will not cause a reduction in the host immune response and thus has few or low side effects associated with widespread immunosuppression. In any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation. Use of the IL7R SM-ASO of the invention that increases sIL7R will result in a reduction and / or alleviation of the signs, symptoms, or causes of cancer. As designed, it is expected that the invention causes an enhancement of the host immune response and thus enhances current immunotherapies. In any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.

[0060] The invention can be provided in combination with one or more "pharmaceutically acceptable" agents, carriers, buffers, salts, or other reagents listed in the United States Pharmacopeia or other generally recognized pharmacopeias for use in animals, and more specifically in humans, which are generally indicated as being approved by a regulatory agency of the federal or state government. Typical pharmaceutically acceptable formulations for use with oligonucleotides include, but are not limited to, salts such as: calcium chloride dihydrate (United States Pharmacopeia (USP)), magnesium chloride hexahydrate USP, potassium chloride USP, sodium chloride USP; and may include buffers such as "sodium hydrogen phosphate anhydrous USP, sodium dihydrogen phosphate dihydrate USP, and water USP. Generally, the pH of the product can be adjusted to a pH of ~6.8, 6.9, 7.0, 7.1, or 7.2 using hydrochloric acid or sodium hydroxide.

[0061] The invention can be provided in combination with one or more diagnostic tests for demonstrating therapeutic efficacy.

[0062] As used herein, the term "carrier" refers to, for example, a diluent, preservative, solubilizer, emulsifier, adjuvant, excipient, auxiliary, or vehicle administered together with the active agent of the invention. Such pharmaceutical carriers can be sterile liquids such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. Aqueous saline solutions and aqueous dextrose and glycerol solutions can be used as carriers. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" 2012.

[0063] In one embodiment, the present invention relates to novel compositions and methods for treating autoimmune diseases, including but not limited to multiple sclerosis (MS). MS is the most common neurological disease in early adulthood and is mediated by autoimmune mechanisms, leading to demyelination and neuronal damage in the central nervous system, resulting in progressive neurological dysfunction. To date, there is no cure for this disease, and currently available treatments mainly prevent future immune attacks, usually by suppressing the immune system. This immunosuppressive approach causes numerous adverse side effects, including an increased risk of cancer and infection, which can be severe or fatal. Therefore, the inventors have developed novel treatment methods to meet the clear, unmet need for the development of effective and well-tolerated treatments to halt the progression of MS without adverse immunosuppressive side effects.

[0064] The present invention also relates to novel compositions and methods for treating cancer. Cancer is the second leading cause of death in the United States and is mediated by multiple etiologies. To date, many cancers are incurable; however, recent therapies based on immune recognition and killing of cancer cells have brought new hope. Unfortunately, many patients receiving immunotherapy do not respond well, and the response rate is low for some cancer types (e.g., hepatocellular carcinoma). Therefore, the inventors have developed novel therapies to meet the clear, unmet need to enhance conventional immunotherapy.

[0065] The inventors have developed targeted antisense oligonucleotides, such as antisense oligonucleotides (ASO) and / or splicing-modulating antisense oligonucleotides (SM-ASO), to correct specific MS etiologies. SM-ASO has proven to be a novel and valuable therapeutic tool for treating diseases caused by abnormal RNA splicing. Two such SM-ASO recently received FDA approval for the treatment of spinal muscular atrophy (Spinraza, Biogen) and Duchenne muscular dystrophy (Exondys 51, Sarepta Therapeutics).

[0066] New targeted therapies correct abnormal splicing of interleukin 7 receptor (IL7R) RNA, where exclusion of alternative exon 6 leads to elevated levels of a pathogenic soluble form of IL7R (sIL7R). Multiple lines of evidence directly link and strongly support the role of alternative splicing of IL7R exon 6 in the pathogenesis of MS and other autoimmune diseases: (1) genetic variants that increase exclusion of this exon are strongly associated with increased MS risk (Galarza-Munoz et al., 2017; Gregory et al., 2007); (2) sIL7R exacerbates the severity and progression of disease in a murine MS model of experimental autoimmune encephalomyelitis (EAE) (Lundstrom et al., 2013); (3) sIL7R is elevated in patients with multiple autoimmune diseases, including MS, type I diabetes, rheumatoid arthritis, and systemic lupus erythematosus (Badot et al., 2011; Badot et al., 2013; Lauwerys et al., 2014; McKay et al., 2008; Monti et al., 2013).

[0067] The inventors have developed several SM-ASOs (Table 1), where the primary ASOs are IL7R-005 and IL7R-006, which promote inclusion of exon 6 in the IL7R pre-mRNA and correct expression of IL7R protein isoforms in cultured cells. Critically for this therapeutic approach, these SM-ASOs reduce sIL7R levels without negatively impacting the expression of membrane-bound IL7R (mIL7R). For treating autoimmunity, the present invention is used to block specific sequences in the IL7R pre-mRNA that drive exon 6 exclusion, thereby promoting exon 6 inclusion and reducing sIL7R levels. Additionally, for treating cancer, the present invention is used to block specific sequences in the IL7R pre-mRNA that drive exon 6 inclusion, thereby reducing exon 6 inclusion and increasing sIL7R levels. Those skilled in the art will recognize that the SM-ASOs of the present invention can be used alone or in combination with other therapies. Further, through simple single-base mutations, the SM-ASOs can be adapted to control splicing of exon 6 in human IL7R or allelic variants of IL7R in different animals, or in individuals carrying polymorphisms or mutations at the target sequence, thereby customizing the complementarity of the SM-ASO to the variant sequence.

[0068]

[0069] * Nucleotides highlighted in bold and underlined indicate positions of mismatches where the complementary positions in the SM-ASO were engineered to disrupt potential secondary structures that may limit SM-ASO activity.

[0070] ^Efficacy grades: low (+), medium (++), and high (+++).

[0071] The present invention can use a variety of SM-ASOs, such as those comprising various base or backbone modifications of the SM-ASO. Non-limiting examples of SM-ASOs can include natural nucleic acids, but can also include, for example, backbone or base modifications (chemically modified oligonucleotides) that increase the binding efficiency of the SM-ASO, increase the stability of the SM-ASO (e.g., half-life), increase its expression, control the location of its expression, distribution or localization, etc.

[0072] Current treatments for autoimmune diseases such as MS help patients with autoimmune diseases control their symptoms, but these drugs are far from ideal because they cause a variety of adverse side effects that can be severe or even fatal. The complex nature of the disease has hindered the development of effective but safer MS drugs, where multiple etiologies contribute to the pathogenesis of MS. Given that all these etiologies ultimately lead to the disruption of immune tolerance to myelin, to date, the field has been focused on developing therapies that reduce the immune response through multiple mechanisms. For example, natalizumab is designed to block the migration of leukocytes across the blood-brain barrier and their recruitment at the site of inflammation. Another example is ocrelizumab, which depletes B cells. However, both of these mechanisms (although through different actions) ultimately lead to immunosuppression. To provide patients with effective but safer drugs, rather than dealing with the consequences of a given etiology through immunomodulation, new therapies targeting the correction of specific MS etiologies, which the inventors herein refer to as immune correction, must be developed.

[0073] The typical membrane-bound interleukin 7 receptor (mIL7R) has been a previous candidate for therapeutic intervention in MS and many autoimmune diseases. However, mIL7R is essential for T cell homeostasis and normal immune function, and loss of human and murine IL7R function both lead to severe immunodeficiency (Maraskovsky et al., 1996; Peschon et al., 1994; Puel et al., 1998; Roifman et al., 2000). Thus, new MS therapies that inhibit mIL7R expression or function will lead to severe immunodeficiency. The therapeutic SM-ASOs developed herein correct the abnormal splicing of exon 6 of IL7R, and in doing so, they reduce sIL7R levels while preventing negative effects on mIL7R expression and / or function. Thus, unlike existing MS treatments that rely on immunosuppressive mechanisms, the therapeutic SM-ASOs of the present invention that reduce sIL7R (Table 1) are an effective and safer option for treating MS that avoids immunosuppression. The SM-ASOs of the present invention that reduce sIL7R (Table 1) represent a significant improvement over existing drugs because they correct the root cause of the problem rather than dealing with its consequences by suppressing the immune system.

[0074] In addition, increased sIL7R levels (compared to normal levels of sIL7R in subjects without autoimmune disease) have been associated with other autoimmune diseases such as type 1 diabetes, rheumatoid arthritis, and systemic lupus erythematosus, and patients with these diseases have been shown to have elevated circulating sIL7R levels (Badot et al., 2011; Badot et al., 2013; Lauwerys et al., 2014; Monti et al., 2013). Thus, therapeutic SM-ASOs can be used to treat many diseases or conditions with elevated sIL7R levels.

[0075] Cancer is the second leading cause of death in the United States. Many cancers lack effective treatment options because many causative factors are at play. Immuno-oncology is a rapidly evolving field that harnesses the human immune system as a new therapy for previously refractory cancers. Immune checkpoint inhibitors, such as monoclonal antibodies targeting the negative immune regulators CTLA-4 (Ipilimumab (Yervoy, Bristol-Myers Squibb)) and PD-1 (Pembrolizumab (Keytruda, Merck)) and Nivolumab (Opdivo, Bristol-Myers Squibb), have received FDA approval. An example of their potential is the study of patients with previously untreated melanoma and inoperable or metastatic melanoma, who were treated with Nivolumab and Ipilimumab and reported an overall response rate of 50% (Larkin J, Chiarion-Sileni V, Gonzalez R, Grob JJ, Cowey CL, et al. 2015. N Engl J Med 373:23-34).

[0076] Although recent cancer immunotherapies offer new hope, unfortunately, many patients who receive immunotherapy respond poorly, and response rates are low for some cancer types (e.g., hepatocellular carcinoma). For example, although Nivolumab is FDA-approved for patients with hepatocellular carcinoma who are unresponsive to the kinase inhibitor sorafenib, the overall response rate in 154 treated patients was only 14.3%, and complete responses were observed in only 3 patients (NCT01658878). Despite being encouraging, these data indicate that there is an urgent need to improve response rates.

[0077] The need to improve the response rate of immunotherapy has inspired in-depth research on markers (e.g., PD-L1 expression and high microsatellite instability in tumor cells) that predict the success of currently deployed immune checkpoint blockers. Also exciting (although less developed) is research on pro-immunomodulators that can act synergistically with checkpoint blockade. Elevated sIL7R levels are thought to enhance the immune response by increasing the bioavailability and / or bioactivity of the cytokine IL7, thereby increasing the survival rate of T cells (Lundstrom et al., 2013). This creates a pro-inflammatory environment that has the potential to increase the immune response to cancer. Accordingly, the present invention uses SM-ASOs that increase sIL7R, such as the primary SM-ASOs IL7R-001 and IL7R-004, and additional SM-ASOs in Table 2, as novel immunotherapies against cancer.

[0078]

[0079] * Nucleotides highlighted in bold and underlined indicate positions where mismatches in the complementary positions in the SM-ASO were engineered to disrupt potential secondary structures that may limit SM-ASO activity.

[0080] ^ Efficacy grades: low (+), medium (++), and high (+++).

[0081] Figures 1A to 1C Validation of the GFP-IL7R fluorescent splicing reporter used for screening splicing-modulating antisense oligonucleotides (SM-ASOs) is shown. Figure 1A A schematic of the GFP-IL7R reporter is shown, illustrating the positions of the SM-ASO target (red) and mutations in the corresponding cis-splicing elements (blue). Figure 1B Shown is Splicing analysis of exon 6 of IL7R in transcripts from GFP-IL7R reporter Figure 1C . Hela cells stably expressing the WT (C) or mutant form reporter (5'Mut, 5'Cons, ΔESE2&ΔESS2) were transfected with control (Ctrl) or experimental (IL7R-001&IL7R-002) SM-ASOs. Exon 6 splicing was analyzed by RT-PCR using primers specific for the GFP-IL7R reporter (+E6 = includes exon 6; -E6 = excludes exon 6), and the percentage of exon 6 inclusion was calculated as follows: [inclusion / (inclusion + exclusion)] * 100. GFP expression Shown is Figures 2A to 2E analysis. The GFP mean fluorescence intensity (MFI) was quantified by flow cytometry. Data normalized against the control SM-ASO (Ctrl) are shown.

[0082] To evaluate the feasibility of this reporter system for screening SM-ASOs that modulate the splicing of IL7R exon 6, the inventors compared the effects of blocking specific cis-acting splicing elements in exon 6 with mutations of the corresponding elements. For example, SM-ASO IL7R-001 blocks the 5'-splice site of exon 6 and forces almost complete exclusion of the exon equivalent to a mutation (5'Mut) that disrupts that 5'-splice site. Similarly, blockade of exon splicing enhancer 2 (ESE2), previously identified, by IL7R-002 results in an effect equivalent to mutation of that enhancer (ΔESE2). IL7R-002 has a lower affinity for IL7R RNA, which may explain the slightly lower order of magnitude of affinity of IL7R-002 compared to ΔESE2. The equivalent effects caused by SM-ASO-mediated blockade or mutation of a given cis-splicing element demonstrate the ability of SM-ASOs to control splicing decisions in this reporter system. More importantly, the observed changes in exon 6 splicing led to the expected changes in GFP expression, thus validating the use of GFP expression as a readout of splicing outcome in this reporter system.

[0083] Figure 2A Targeted screening of IL7R SM-ASOs complementary to cis-acting splicing elements within exon 6 is shown. Figure 2B Schematic of the GFP-IL7R splicing reporter used for screening is shown. The genomic sequence of IL7R spanning introns 5 and 6 was cloned, interrupting the GFP coding sequence such that GFP expression is determined by the splicing of IL7R exon 6. Figure 2C and Figure 2B Analysis of GFP expression is shown. HeLa cells stably expressing the fluorescent reporter were transfected with control (ASO-Ctrl) or experimental morpholino SM-ASOs (IL7R-001 - IL7R-005), and GFP expression was quantified by flow cytometry. Figure 2C Representative bar graph of the mean fluorescence intensity (MFI) of GFP for the selected SM-ASOs is shown, while Figure 2D Quantification of GFP MFI normalized against control ASO (ASO-ctrl) is shown. The red dashed line indicates the efficacy cut-off for a 1.5-fold change in GFP expression in either direction. Figure 2E Analysis of the splicing of IL7R exon 6 in transcripts from the GFP-IL7R reporter is shown. Splicing of IL7R exon 6 in transcripts from the reporter was analyzed by RT-PCR using primers specific for the GFP-IL7R reporter (+E6 = exon 6 included; -E6 = exon 6 excluded), and the percentage of exon 6 inclusion was determined as follows: [inclusion / (inclusion + exclusion)]*100. The red dashed line indicates the efficacy cut-off for a 1.5-fold change in the percentage of exon 6 inclusion. Figures 3A to 3ESplicing analysis of IL7R exon 6 in transcripts from the endogenous IL7R gene. Splicing of IL7R exon 6 was analyzed in transcripts from the endogenous IL7R gene using primers specific for the endogenous transcript (FL = containing exon 6; ΔE6 = excluding exon 6), and the percentage of exon 6 inclusion was determined as follows: [FL / (FL + ΔE6)] * 100. In all figures, statistical significance was assessed by two-tailed Student's t-test, comparing experimental ASO and control (*p < 0.05, **p < 0.005, ***p < 0.0005).

[0084] This targeted screen identified several SM-ASOs that regulate IL7R exon 6 splicing in either direction. For example, blocking the 5'-splice site (IL7R-001) or the previously identified ESE2 (IL7R-002) induced near-complete exclusion of the exon. Most importantly, IL7R-005 was identified, which blocks exon splicing silencer 3 (ESS3) and promotes near-complete exon inclusion. This SM-ASO was found to be particularly useful for treating autoimmune diseases. In addition, the inventors identified four SM-ASOs (IL7R-001, IL7R-002, IL7R-003, and IL7R-004) that enhance exon 6 exclusion and are candidates for immuno-oncology applications. Critically for therapeutic purposes, all tested SM-ASOs induced similar regulation of exon 6 splicing in transcripts from the GFP-IL7R reporter and the endogenous IL7R gene.

[0085] Figure 3A Shown are the SM-ASO walk screening target sequences in IL7R introns 5 and 6. Figure 2A Shown is a schematic of the SM-ASO walk method. For example, the inventors designed morpholino SM-ASOs 15 - 25 nt in length that are complementary to overlapping sequences every 5 nt within intronic regions near IL7R exon 6. These regions include the last 209 nt of IL7R intron 5, avoiding the last 40 nt containing core splicing elements such as the branch point sequence, polypyrimidine tract, and 3'-splice site, and the first 169 nt of IL7R intron 6, avoiding the first 15 nt including the 5'-splice site. Control (ASO-Ctrl) or experimental SM-ASOs targeting these intronic regions (e.g., IL7R-006 - IL7R-065) were transfected into HeLa cells stably expressing the reporter system as Figure 3B shown. IL7R-001 and IL7R-005 were used as positive controls. Figure 3C and Figure 3B Shown is targeting intron 5 ( Figure 3C ) and intron 6 ( Figure 3DGFP expression analysis of SM-ASO. As described previously, the mean fluorescence intensity (MFI) of GFP was determined by flow cytometry. The red and blue lines indicate the cut-off values for a 20% decrease or increase in GFP MFI, respectively. Figure 3D and 3E show the splicing analysis of exon 6 of IL7R in transcripts from the GFP-IL7R reporter for selected SM-ASOs targeting intron 5 ( Figure 3E ) and intron 6 ( Figure 3B ). The percentage of exon 6 inclusion in transcripts from the reporter was determined as described previously. The red dashed line indicates the level of exon 6 inclusion in the control (ASO-Ctrl). In all figures, statistical significance was evaluated by two-tailed Student's t-test, comparing the experimental SM-ASO and the control (*p < 0.05, **p < 0.005, ***p < 0.0005).

[0086] This approach identified IL7R-006, another SM-ASO, which promotes a high level of exon 6 inclusion by blocking a sequence within intron 6. In the target sequence of SM-ASO IL7R-006 (UAAUAAAGAGGGUGAUUGUG), there is a polyadenylation signal (AAUAAA) near the 5' splice site of intron 6, which the inventors previously found promotes exon 6 skipping, most likely by blocking the 5' splice site when binding to CPSF1 (Evsyukova et al., 2013). However, the IL7R-006 oligonucleotide of the present invention blocks a 20 nt sequence containing additional splicing regulatory sequences, which is different from the results published by Evsyukova et al., 2013.

[0087] In addition to IL7R-006, the present inventors also identified additional target sequences that increase exon 6 inclusion (listed in Table 1). These include two clusters of SM-ASOs, cluster 1 (intron 5) and cluster 2 (intron 6), as well as several other SM-ASOs that increase exon 6 inclusion, although with lower efficiency than the major SM-ASOs IL7R-005 and IL7R-006. The present inventors are currently improving the final target sequences of the newly identified SM-ASOs to increase their efficiency.

[0088] This screen also identified several SM-ASOs that reduce exon 6 inclusion (see increased GFP expression in Figure 3C and Figures 4A to 4D and listed in Table 2). The latter are candidates for therapeutic intervention in immuno-oncology. Importantly, this approach identified new SM-ASO targets for autoimmunity and cancer, which will be tested in preclinical models.

[0089] Figure 4AShows the effect of the selected SM-ASOs on the expression of IL7R protein isoforms. As previously described, HeLa cells were transfected with control (ASO-Ctrl) or experimental (IL7R-001, IL7R-004, IL7R-005, and IL7R-006) morpholino SM-ASOs using the Endo-Porter transfection system (Gene Tools). Figure 4B Shows the splicing analysis of exon 6 in transcripts from the endogenous IL7R gene. As previously described, total RNA was isolated from the cells and the percentage of exon 6 inclusion was determined by RT-PCR. Figure 4C Shows the quantification of soluble IL7R (sIL7R) secretion. The secretion of sIL7R in the supernatant collected from the cells in panel A was quantified by ELISA. Data are shown as the mean absorbance of the experimental SM-ASOs normalized to the control (ASO-Ctrl). Figure 4D Shows the quantification of cell surface expression of membrane-bound IL7R (mIL7R). The cell surface expression of mIL7R was determined by flow cytometry using staining of IL7R in intact cells. Data are shown as the mean fluorescence intensity (MFI) of IL7R staining normalized to the control. Figure 4C Shows the ratio of IL7R protein isoform expression. The ratio of mIL7R to sIL7R (mIL7R / sIL7R) was determined by dividing the value of the mIL7R cell surface expression ( Figure 4B ) by the sIL7R secretion ( Figures 5A to 5D ). In all panels, statistical significance was assessed by two-tailed Student's t test, comparing the experimental SM-ASOs and the control (*p < 0.05, **p < 0.005, ***p < 0.0005).

[0090] These results indicate that the SM-ASO targeting sequences in exon 6 or intron 6 of IL7R not only induce the expected results of exon 6 splicing but, more importantly, induce the ratio of IL7R protein isoforms (mIL7R / sIL7R). Notably, IL7R-005 and IL7R-006 reduced the sIL7R level and had minimal effect on the cell surface expression of mIL7R. The latter is crucial for the treatment of MS and autoimmunity because inhibition of mIL7R expression or activity leads to immunosuppression. SM-ASO IL7R-005 and IL7R-006 meet the first efficacy endpoint, i.e., restoration of the IL7R protein isoform. Importantly, by preventing the mechanism of immunosuppression, these SM-ASOs are predicted to be safe and effective therapeutic agents for MS and other autoimmune diseases.

[0091] In addition, these analyses showed that reducing the IL7R SM-ASOs (IL7R-001 and IL7R-004) that contain exon 6 effectively increased sIL7R levels, meeting the first efficacy endpoint for potential cancer immunotherapy. These SM-ASOs were predicted to enhance the immune system's ability to combat and eradicate cancer cells.

[0092] Figure 5A Showed the dose-response regulation of the major SM-ASOs that reduce sIL7R on the splicing of IL7R exon 6. As described previously, HeLa cells stably expressing a fluorescent reporter were transfected with increasing concentrations [0 μM, 1 μM, 5 μM, and 10 μM] of control (ASO-Ctrl = 0 μM) or experimental (IL7R-005 and IL7R-006) morpholino SM-ASOs. Figure 5B and Figure 5A Showed the analysis of GFP expression. As described previously, the mean fluorescence intensity (MFI) of GFP was measured by flow cytometry. Figure 5B Showed a representative bar graph of GFP MFI for different concentrations of IL7R-005, while Figure 5C Showed the normalized GFP MFI as a function of SM-ASO concentration. Figure 5D and Figure 5C Showed the splicing analysis of IL7R exon 6 in transcripts from the reporter ( Figure 5D ) or the endogenous gene ( Figures 6A to 6D ). The percentage of exon 6 inclusion in transcripts from the reporter or the endogenous gene was determined as described previously and shown as a function of SM-ASO concentration. In all figures, statistical significance was evaluated by two-tailed Student's t-test, comparing experimental concentrations to the control (*p < 0.05, **p < 0.005, ***p < 0.0005).

[0093] Figure 6A Showed the dose-response regulation of the major SM-ASOs that increase sIL7R on the splicing of IL7R exon 6. As described previously, HeLa cells stably expressing a fluorescent reporter were transfected with increasing concentrations [0 μM, 1 μM, 5 μM, and 10 μM] of control (ASO-Ctrl = 0 μM) or experimental (IL7R-001 and IL7R-004) morpholino SM-ASOs. Figure 6B and Figure 6A Showed the analysis of GFP expression. As described previously, the mean fluorescence intensity (MFI) of GFP was measured by flow cytometry. Figure 6B Showed a representative bar graph of GFP MFI for different concentrations of IL7R-001, while Figure 6C Showed the normalized GFP MFI as a function of SM-ASO concentration. Figure 6D andFigure 6C shows the splicing analysis of IL7R exon 6 in transcripts from reporter Figure 6D ) or endogenous gene Figures 5A to 5D ). The percentage of exon 6 inclusion in transcripts from reporter or endogenous gene was determined as described previously and shown as varying with SM-ASO concentration. In all figures, statistical significance was assessed by two-tailed Student's t-test, comparing experimental concentrations and controls (*p < 0.05, **p < 0.005, ***p < 0.0005).

[0094] Figures 6A to 6D and Figures 7A to 7B analysis showed that IL7R exon 6 splicing can be fine-tuned in a dose-dependent manner by manipulating the dose of SM-ASO used and revealed the minimum effective concentration for IL7R splicing regulation in cell culture. Importantly, these results can be used to infer in vivo doses in preclinical studies in non-human primates and human clinical trials. This dose-response analysis illustrates an example of the dose-responsiveness of the lead SM-ASO and does not limit our application to the concentration range tested.

[0095] Figure 7A shows the correction of aberrant exclusion of IL7R exon 6 driven by the MS-related SNP rs6897932 by IL7R-005. Hela cells stably expressing a GFP-IL7R reporter form containing either the protective 'T' allele or the risk 'C' allele of the MS-related variant rs6897932 in IL7R exon 6 were transfected with control SM-ASO (ASO-Ctrl) or IL7R-005. Figure 7B shows the splicing analysis of IL7R exon 6 in transcripts from GFP-IL7R reporters containing variable alleles (C or T) of rs68978932. The percentage of exon 6 inclusion was determined by RT-PCR as described previously. Figure 7A shows the analysis of GFP expression in cells from ​ . The mean fluorescence intensity (MFI) of GFP was measured by flow cytometry as described previously and shown as normalized to cells expressing the 'T' reporter treated with control SM-ASO. In all figures, statistical significance was assessed by two-tailed Student's t-test, comparing experimental SM-ASO and control or as indicated (*p < 0.05, **p < 0.005, ***p < 0.0005).

[0096] Previous studies by the inventors and others have found that the risk 'C' allele of the genetic variant rs6897932 (C or T) in exon 6 of IL7R increases the risk of MS by enhancing the exclusion of exon 6 and sIL7R levels (Gregory et al., 2007; Evsyukova et al., 2013; Hoe et al., 2010; Lundstrom et al., 2013). The above analysis indicates that IL7R-005, the main SM-ASO for treating autoimmunity, restores the function of the risk 'C' allele of rs6897932, which strongly supports the therapeutic potential of IL7R-005.

[0097] Accordingly, the present inventors have described compositions and methods for the therapeutic intervention of autoimmune and cancer using antisense oligonucleotides to control the alternative splicing of exon 6 of interleukin 7 receptor (IL7R) RNA. These antisense oligonucleotides control the splicing of IL7R exon 6 by blocking specific signals embedded in the IL7R RNA. These signals are specific sequences that determine the splicing outcome of IL7R exon 6. In addition, Table 1 lists specific sequences in the IL7R RNA that will be blocked by antisense oligonucleotides to reduce sIL7R, including variants of these sequences, any part of these sequences, or any nucleotides flanking these sequences, which increase the inclusion of IL7R exon 6, thereby reducing sIL7R secretion. In addition, Table 2 lists additional signals in the IL7R RNA that will be blocked by antisense oligonucleotides to increase sIL7R, including variants of these sequences, any part of these sequences, or any nucleotides flanking these sequences, which reduce the inclusion of IL7R exon 6, thereby increasing sIL7R secretion. Blocking just a few nucleotides in these sequences can affect the splicing of exon 6 because the actual elements driving exclusion / inclusion are not the entire targeted sequence, but are typically sequences of 4 - 8 nt within the targeted sequence. For example, an important sequence in the IL7R-005 target sequence is the last 5 nt UGGUC, thus, an ASO blocking only this 5 nt sequence or a few nt of this sequence may be sufficient to produce the desired effect. However, to maximize the targeting specificity and efficiency of the functional sequence, oligonucleotides are typically made into longer complementary sequences. Finally, it is known that one or more bases in the antisense oligonucleotide may be replaced to modify base pairing while maintaining high affinity, selectivity, and effective antisense activity for the target sequence. Depending on the length of the SM-ASO, non-limiting examples are those having 15, 20, or 25 nucleotides, which may have 70%, 75%, 80%, 84%, 85%, 87%, 88%, 90%, 92%, 93%, 94%, 95%, or 96% identity with any SEQ ID in Table 1 and Table 2 or a portion thereof, alone or in combination, in whole or in part, or any bioactive arrangement of these SEQ IDs, respectively for the treatment of autoimmune diseases, inflammatory diseases, or cancer, or a sequence complementary thereto, for use as compositions and in methods for reducing the expression of soluble IL7R by enhancing the inclusion of IL7R exon 6 for the treatment of autoimmune and / or inflammatory diseases, or for enhancing the expression of soluble IL7R by reducing the inclusion of IL7R exon 6 for the treatment of cancer. For SM-ASOs having 5, 10, 15, 20, or 25 nucleotides, the mismatches may be, for example, 1, 2, 3, 4, 5, or more mismatches.

[0098] Table 3. Overview of the percentage identity (% identity) with up to 8 mismatches for each of IL7R-005 and IL7R-006.

[0099]

[0100] It is contemplated that any of the embodiments discussed in this specification can be implemented with respect to any method, kit, reagent, or composition of the invention and vice versa. In addition, the compositions of the invention can be used to implement the methods of the invention.

[0101] It will be understood that the specific embodiments described herein are shown by way of illustration and not as limitations of the invention. The main features of the invention can be applied in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of the invention and are covered by the claims.

[0102] All publications and patent applications mentioned in the specification represent the level of those skilled in the art to which the invention pertains. All publications and patent applications are hereby incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0103] When used in conjunction with the term "comprising" in the claims and / or specification, the words "a" or "an" can mean "one," but it also is in accordance with the meaning of "one or more," "at least one," and "one or more than one." The term "or" as used in the claims is used to mean "and / or" unless explicitly indicated to refer only to alternatives or the alternatives are mutually exclusive, although the disclosure supports definitions that refer only to alternatives and "and / or." Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method of determining the value, or the variation that exists among the study subjects.

[0104] As used in this specification and the claims, the word "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "include" and "includes"), or "containing" (and any form of "containing", such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. In any embodiments of the compositions and methods provided herein, "comprising" may be replaced with "consisting essentially of" or "consisting of". As used herein, the phrase "consisting essentially of" requires the specified integers or steps, and those integers or steps that do not materially affect the characteristics or functions of the claimed invention. As used herein, the term "consisting of" is used to indicate the presence of only the specified integers (e.g., features, elements, characteristics, properties, method / process steps or limitations) or groups of integers (e.g., features, elements, characteristics, properties, method / process steps or limitations).

[0105] As used herein, the term "or combinations thereof" refers to all permutations and combinations of the items listed before the term. For example, "A, B, C, or combinations thereof" is intended to include at least one of the following: A, B, C, AB, AC, BC, or ABC, and, if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, combinations that include repeats of one or more items or terms are specifically included, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, etc. Those skilled in the art will understand that there is typically no limit to the number of items or terms in any combination, unless otherwise apparent from the context.

[0106] As used herein, approximate terms such as "unrestricted", "about", "substantially" or "substantially" refer to such conditions that when so modified, are understood not necessarily to be absolute or perfect, but rather to be considered close enough for a person of ordinary skill in the art to ensure the specified condition exists. The degree to which a description can vary will depend on how much change can be made and a person of ordinary skill in the art will still recognize that the modified feature still has the characteristics and capabilities required of the unmodified feature. Generally, but in accordance with the foregoing discussion, a numerical value modified by an approximate term such as "about" herein can vary from the stated value by at least ±1%, 2%, 3%, 4%, 5%, 6%, 7%, 10%, 12% or 15%.

[0107] All compositions and / or methods disclosed and claimed herein can be made and executed in accordance with the present disclosure without undue experimentation. While the compositions and methods of the present invention have been described in terms of preferred embodiments, variations can be applied to the compositions and / or methods and steps described herein or to the order of steps of the method without departing from the concepts, spirit and scope of the present invention, which will be apparent to those skilled in the art. All such similar substitutions and modifications that are apparent to those skilled in the art are considered to be within the spirit, scope and concepts of the present invention as defined by the appended claims.

[0108] To assist the Patent Office and any readers of any patent issued under this application in interpreting the appended claims, the Applicants wish to note that they do not intend any of the appended claims to invoke 35 U.S.C. § 112, paragraph 6 or AIA 35 U.S.C. § 112, paragraph (f) or their equivalents, as they existed on the filing date of this application, unless the phrase "means for..." or "step for..." is expressly used in a particular claim.

[0109] For each claim, each dependent claim can depend on either the independent claim or each and every prior dependent claim of each and every claim, so long as the prior claim provides an appropriate prior basis for the claim item or element.

[0110] References

[0111] Allcock, R.J., Williams, J.H., and Price, P. (2001). The central MHC gene, BAT1, may encode a protein that down-regulates cytokine production. Genes Cells 6, 487-494. 974.

[0112] Anderson, C.A., Boucher, G., Lees, C.W., Franke, A., D'Amato, M., Taylor, K.D., Lee, J.C., Goyette, P., Imielinski, M., Latiano, A., et al. (2011). Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nature genetics 43, 246-252.

[0113] V. Badot et al, Rheumatoid arthritis synovial fibroblasts produce a soluble form of the interleukin-7 receptor in response to pro-inflammatory cytokines. J Cell Mol Med 15, 2335-2342 (2011).

[0114] V. Badot et al, Serum soluble interleukin 7 receptor is strongly associated with lupus nephritis in patients with systemic lupus erythematosus. Ann Rheum Dis 72, 453-456 (2013).

[0115] Barrett, J.C., Clayton, D.G., Concannon, P., Akolkar, B., Cooper, J.D., Erlich, H.A., Julier, C., Morahan, G., Nerup, J., Nierras, C., et al. (2009). Genome-wide association study and meta-analysis find that over 40 loci affect risk of type 1 diabetes. Nature genetics 47, 703-707.

[0116] Cheong, K.Y., Allcock, R.J., Eerligh, P., Witt, C.S., Christiansen, F.T., McCann, V., and Price, P. (2001). Localization of central MHC genes influencing type I diabetes. Human immunology 62, 1363 - 1370.

[0117] Degli-Esposti, M.A., Leelayuwat, C., and Dawkins, R.L. (1992). Ancestral haplotypes carry haplotypic and haplospecific polymorphisms of BAT1: possible relevance to autoimmune disease. Eur J Immunogenet 19, 121 - 127.

[0118] Evsyukova, I., Bradrick, S.S., Gregory, S.G., and Garcia-Blanco, M.A. (2013). Cleavage and polyadenylation specificity factor 1 (CPSF1) regulates alternative splicing of interleukin 7 receptor (IL7R) exon 6. RNA 19, 103 - 115.

[0119] Galarza-Munoz, G., Briggs, F.B., Evsyukova, L, Schott-Lemer, G., Kennedy, E.M., Nyanhete, T., Wang, L., Bergamaschi, L., Widen, S.G., Tomaras, G.D., et al. (2017). Human Epistatic Interaction Controls IL7R Splicing and Increases Multiple Sclerosis Risk. Cell 169, 72 - 84 e13.

[0120] Gregory, S.G., Schmidt, S., Seth, P., Oksenberg, J.R., Hart, J., Prokop, A., Caillier, S.J., Ban, M., Goris, A., Barcellos, L.F., et al. (2007). Interleukin 7 receptor alpha chain (IL7R) shows allelic and functional association with multiple sclerosis. Nature genetics 39, 1083 - 1091.

[0121] Kilding, R., Iles, M.M., Timms, J.M., Worthington, I, and Wilson, A.G. (2004). Additional genetic susceptibility for rheumatoid arthritis telomeric of the DRB1 locus. Arthritis and rheumatism 50, 763 - 769.

[0122] B.R. Lauwerys, S.N. Husson, A.L. Maudoux, V. Badot, F.A. Houssiau, sIL7R concentrations in the serum reflect disease activity in the lupus kidney. Lupus Sci Med 1, e000036 (2014).

[0123] Lundstrom, W., Highfill, S., Walsh, S.T., Beq, S., Morse, E., Kockum, I., Alfredsson, L., Olsson, T., Hillert, J., and Mackall, C.L. (2013). Soluble IL7R alpha potentiates IL - 7 bioactivity and promotes autoimmunity. Proceedings of the National Academy of Sciences of the United States of America 110, E1761 - 1770.

[0124] Maraskovsky,E.,Teepe,M.,Morrissey,P.J.,Braddy,S.,Miller,R.E.,Lynch,D.H.,and Peschon,J.J.(1996).Impaired survival and proliferation in IL-7receptor-deficient peripheral T cells.Journal of immunology 157,5315-5323.

[0125] F.C.McKay et al,Haplotypes of the interleukin 7 receptor alpha geneare correlated with altered expression in whole blood cells in multiplesclerosis.Genes Immun 9,1-6(2008).

[0126] P.Monti,C.Brigatti,M.Krasmann,A.G.Ziegler,E.Bonifacio,Concentrationand activity of the soluble form of the interleukin-7 receptor alpha in type1 diabetes identifies an interplay between hyperglycemia and immunefunction.Diabetes 62,2500-2508(2013).

[0127] Nakamura, M., Nishida, N., Kawashima, M., Aiba, Y., Tanaka, A., Yasunami, M., Nakamura, H., Komori, A., Nakamuta, M., Zeniya, M., et al. (2012). Genome-wide association study identifies TNFSF15 and POU2AF1 as susceptibility loci for primary biliary cirrhosis in the Japanese population. American journal of human genetics 91, 721-728.

[0128] Okamoto, K., Makino, S., Yoshikawa, Y., Takaki, A., Nagatsuka, Y., Ota, M., Tamiya, G., Kimura, A., Bahrain, S., and Inoko, H. (2003). Identification of I kappaBL as the second major histocompatibility complex-linked susceptibility locus for rheumatoid arthritis. American journal of human genetics 72, 303-312.

[0129] Paternoster, L., Standl, M., Chen, C.M., Ramasamy, A., Bonnelykke, K., Duijts, L., Ferreira, M.A., Alves, A.C., Thyssen, J.P., Albrecht, E., et al. (2012). Meta-analysis of genome wide association studies identifies three new risk loci for atopic dermatitis. Nature genetics 44, 187-192.

[0130] Peschon, J.J., Morrissey, P.J., Grabstein, K.H., Ramsdell, F.J., Maraskovsky, E., Gliniak, B.C., Park, L.S., Ziegler, S.F., Williams, D.E., Ware, C.B., et al. (1994). Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J Exp Med 180, 1955-1960.

[0131] Price, P., Wong, A.M., Williamson, D., Voon, D., Baltic, S., Allcock, R.J., Boodhoo, A., and Christiansen, F.T. (2004). Polymorphisms at positions -22 and -348 in the promoter of the BAT1 gene affect transcription and the binding of nuclear factors. Human molecular genetics 13, 967-974.

[0132] Puel, A., Ziegler, S.F., Buckley, R.H., and Leonard, W.J. (1998). Defective IL7R expression in T(-)B(+)NK(+) severe combined immunodeficiency. Nature genetics 20, 394-397.

[0133] Quinones-Lombrana, A., Lopez-Soto, A., Ballina-Garcia, F. J., Alperi-Lopez, M., Queiro-Silva, R., Lopez-Vazquez, A., Lopez-Larrea, C., and Gonzalez, S. (2008). BAT1 promoter polymorphism is associated with rheumatoid arthritis susceptibility. J Rheumatol 35, 741-744.

[0134] Roifman, C. M., Zhang, J., Chitayat, D., and Sharfe, N. (2000). A partial deficiency of interleukin-7R alpha is sufficient to abrogate T-cell development and cause severe combined immunodeficiency. Blood 96, 2803-2807.

[0135] Todd, J. A., Walker, N. M., Cooper, J. D., Smyth, D. J., Downes, K., Plagnol, V., Bailey, R., Nejentsev, S., Field, S. F., Payne, F., et al. (2007). Robust associations of four new chromosome regions from genome-wide analyses of type 1 diabetes. Nature genetics 39, 857-864.

[0136] Wong, A.M., Allcock, R.J., Cheong, K.Y., Christiansen, F.T., and Price, P. (2003). Alleles of the proximal promoter of BAT1, a putative anti-inflammatory gene adjacent to the TNF cluster, reduce transcription on a disease-associated MHC haplotype. Genes Cells 8, 403-412. Sequence Listing <110> Mariano A. Garcia-Blanco Gadel Garaza-Munoz Sheldon S. Bradrick <120> Anti-Soluble Interleukin-7 Receptor (sIL7R) Therapy for Treating Autoimmune Diseases <130> UTMB:1050 <140> UNKNOWN <141> 2019-03-19 <150> 62 / 646,716 <151> 2018-03-22 <160> 50 <170> PatentIn version 3.5 <210> 1 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 1 gucgcucugu ugguc 15 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 2 uaauaaagag ggugauugug 20 <210> 3 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 3 uuguguggga ucacg 15 <210> 4 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 4 ugggaucacg gacag 15 <210> 5 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 5 ucacggacag ucaga 15 <210> 6 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 6 uuguguggga ucacggacag ucaga 25 <210> 7 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 7 gacagucaga gcuuaagc 18 <210> 8 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 8 ugagaaaacc acaaa 15 <210> 9 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 9 uacccccacu gcaug 15 <210> 10 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 10 gacccuaccc ccacu 15 <210> 11 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 11 ccugagaccc uaccc 15 <210> 12 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 12 agcacccuga gaccc 15 <210> 13 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 13 agcacccuga gacccuaccc ccacu 25 <210> 14 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 14 aggugaccuu cuucaacuaa uaaag 25 <210> 15 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 15 caucagcauu uugag 15 <210> 16 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 16 uuuuuucucu gucgcucugu ugguc 25 <210> 17 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 17 ucucugucgc ucugu 15 <210> 18 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 18 ggugauugug uggga 15 <210> 19 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 19 gcuuaagccc cauuuauuga ug 22 <210> 20 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 20 cauuuauuga ugagaaaacc a 21 <210> 21 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 21 aaaccacaaa gggga 15 <210> 22 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 22 acaaagggga uuaagg 16 <210> 23 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 23 ggggauuaag gcauuuca 18 <210> 24 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 24 uuaaggcauu ucacga 16 <210> 25 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 25 ucacgaauuu agugcc 16 <210> 26 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 26 cccacauuac uaaguaaa 18 <210> 27 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 27 ggcccacauu acuaa 15 <210> 28 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 28 aagugggccc acauu 15 <210> 29 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 29 auaauaagug ggccc 15 <210> 30 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 30 ucucuuaacu gaaaagcaa 19 <210> 31 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 31 caaauauguc ucuuaacuga aa 22 <210> 32 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 32 ugucaaauau gucucuuaac 20 <210> 33 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 33 gcugucaaau augucuc 17 <210> 34 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 34 auaaagcugu caaauau 17 <210> 35 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 35 uccauaaagc uguca 15 <210> 36 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 36 aucccuccau aaagc 15 <210> 37 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 37 aaccaaaauc ccuccau 17 <210> 38 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 38 ugccuuuuaa accaaaaucc c 21 <210> 39 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 39 gucaaugccu uuuaaaccaa a 21 <210> 40 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 40 cccaagucaa ugccuuuuaa a 21 <210> 41 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 41 gucacccaag ucaau 15 <210> 42 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 42 gccuggucac ccaag 15 <210> 43 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 43 aauuuagugc ccagu 15 <210> 44 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 44 agugcccagu auccc 15 <210> 45 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 45 ccaguauccc uaucu 15 <210> 46 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 46 aucccuaucu auccuca 17 <210> 47 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 47 uaucuauccu cagcg 15 <210> 48 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 48 auccucagcg aauuuc 16 <210> 49 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 49 cagcgaauuu ccaca 15 <210> 50 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 50 aauuuccaca guuaauuuca uaag 24

Claims

1. Use of a composition in the preparation of a medicament for treating a disease or disorder in a subject in need thereof, wherein the disease or disorder is associated with an elevated level of a soluble isoform (sIL7R) of interleukin-7 receptor, the composition comprising a splicing-modulating antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in the pre-mRNA of interleukin-7 receptor (IL7R) that affects the splicing of exon 6, wherein the oligonucleotide increases the inclusion of exon 6 in the IL7R pre-mRNA and reduces the expression of the soluble isoform (sIL7R) of IL7R, wherein the SM-ASO is complementary to one or more of SEQ ID NO: 1-13, and wherein the disease or condition is an autoimmune disease selected from at least one of the following: multiple sclerosis, type 1 diabetes, rheumatoid arthritis, systemic lupus erythematosus, atopic dermatitis, ankylosing spondylitis, primary biliary cirrhosis, or inflammatory bowel syndrome.

2. Use according to claim 1, wherein at least one nucleotide of the oligonucleotide comprises a non-naturally occurring modification, the modification comprising a modification or substitution of: (1) ribose or other sugar moiety, (2) base, or (3) backbone, selected from: one or more phosphorothioates, methylphosphonates, aminophosphates, phosphotriesters, morpholinos, amidated carbamates, carboxymethyls, acetamidates, polyamides, sulfonates, sulfonamides, aminosulfonates, formaldehyde acetals, thioformaldehyde acetals, and / or alkylsilyl substitutions, partially or fully modified backbones, sugar modifications, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, ethylene glycol nucleic acids, and threose nucleic acids, and any combination of any two or more of the above.

3. Use according to claim 1, wherein at least one nucleotide of the oligonucleotide comprises a non-naturally occurring modification, the modification comprising a modification or substitution selected from: peptide backbone, aminophosphate backbone, siloxane backbone, acetamidate backbone, carbamate backbone, thioether backbone, bridged methylene phosphonate backbone, phosphorothioate backbone, alkylphosphonate backbone, phosphate backbone, alkylthiophosphonate backbone, dithiophosphate backbone, carbonate backbone, phosphotriester backbone, carboxymethyl ester backbone, backbone with p-ethoxy linkage, and locked nucleic acid (LNA).

4. Use according to claim 2, wherein the modification or substitution is selected from a modified phosphosugar backbone and a bicyclic sugar moiety.

5. Use according to claim 1, wherein the disease or condition is an autoimmune disease selected from ulcerative colitis and Crohn's disease.

6. Use according to claim 1, wherein the composition further comprises one or more active agents for treating autoimmune diseases, the active agents selected from: mitoxantrone, interferon β-1a, PEG-interferon β-1a, azathioprine, fingolimod, natalizumab, methylprednisolone, or ocrelizumab.

7. The use according to claim 1, wherein the composition comprises a vector that delivers or expresses the oligonucleotide intracellularly in vivo or ex vivo, and the vector is a plasmid, viral vector, lipid nanoparticle or polymer.

8. A composition comprising an oligonucleotide which is a splicing regulatory antisense oligonucleotide (SM-ASO) that specifically binds to a sequence in the pre-mRNA of interleukin-7 receptor (IL7R) that affects the splicing of exon 6, wherein the SM-ASO increases the inclusion of exon 6 in the IL7R pre-mRNA and reduces the expression of the soluble isoform of IL7R (sIL7R), and wherein the SM-ASO is complementary to one or more of SEQ ID NO: 1-13.

9. The composition according to claim 8, wherein at least one nucleotide in the SM-ASO comprises a non-naturally occurring modification, which modification comprises a modification or substitution of: (1) ribose or other sugar moiety, (2) base or (3) backbone, selected from: one or more phosphorothioates, methylphosphonates, aminophosphates, phosphotriesters, morpholinos, amidated carbamates, carboxymethyl, acetamidates, polyamides, sulfonates, sulfonamides, sulfamates, formaldehyde acetals, thioformaldehyde acetals and / or alkylsilyl substitutions, partially or fully modified backbones, sugar modifications, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, ethylene glycol nucleic acids and threose nucleic acids, and any combination of any two or more of the above.

10. The composition according to claim 8, wherein at least one nucleotide in the SM-ASO comprises a non-naturally occurring modification, which modification comprises a modification or substitution of: peptide backbone, phosphotriester backbone, aminophosphate backbone, siloxane backbone, carboxymethyl ester backbone, acetamidate backbone, carbamate backbone, thioether backbone, bridged methylene phosphonate backbone, phosphorothioate backbone, alkylphosphonate backbone, phosphate backbone, alkylthiophosphonate backbone, dithiophosphate backbone, carbonate backbone, methylthiophosphate backbone, backbone with p-ethoxy bond and locked nucleic acid (LNA).

11. The composition according to claim 9, wherein the modification or substitution is selected from modified phosphosugar backbones and bicyclic sugar moieties.

12. The composition according to claim 8, wherein at least one nucleotide in the SM-ASO comprises a non-naturally occurring modification of the nucleobase.

13. Use of the composition according to claim 8 in the preparation of a medicament for the treatment of an autoimmune disease selected from: multiple sclerosis, type 1 diabetes, rheumatoid arthritis, systemic lupus erythematosus, atopic dermatitis, ankylosing spondylitis, primary biliary cirrhosis or inflammatory bowel syndrome.

14. The use according to claim 13, wherein the disease or condition is an autoimmune disease selected from ulcerative colitis and Crohn's disease.

Images