Quantitative PCR probes

Abstract

The subject of the present invention is to provide a probe for qPCR as a novel means capable of detecting human cells transplanted or administered to animals other than humans. The solution of the present invention is a quantitative PCR probe, which comprises: a sequence that can hybridize with an oligonucleotide comprising a sequence of 10 to 35 consecutive bases in a prescribed base sequence from a human LINE-1 gene; and a labeling portion. The quantitative PCR probe can also be used for the preparation of a quantitative PCR kit comprising a forward primer from human LINE-1 and a reverse primer from human LINE-1 (each sequence is in a prescribed positional relationship).

Description

Technical Field

[0001] The present invention relates to a quantitative PCR (polymerase chain reaction) (qPCR) probe, a qPCR kit, and a detection method using the kit. More specifically, the present invention relates to a qPCR probe, a kit, and a detection method for detecting human cells transplanted into animals other than humans (representatively, rodents (mice, rats, etc.), rabbits, dogs, sheep, goats, pigs, cattle, non-human primates, etc., particularly non-human primates, especially animals classified as Macaca fascicularis (e.g., cynomolgus monkeys)). Background Art [Background of the invention]

[0003] As part of the treatment of various diseases, research and development of regenerative medicine that produces desired cells or tissues from human-derived stem cells (such as iPS cells (artificial pluripotent stem cells) and ES cells (embryonic stem cells)) through differentiation induction for transplantation into patients is ongoing. In this research and development, before clinical trials with humans, non-clinical trials (preclinical trials) are conducted with experimental animals as subjects, transplanting cells induced by differentiation from the above-mentioned human-derived stem cells, etc., and how the transplanted human-derived cells behave in the body of the experimental animals and / or how they are distributed becomes one of the analysis items. As one of the non-human primates, the crab-eating macaque (Macaca fascicularis) is used as such an experimental animal in many countries because it has a genome that is more similar to that of humans.

[0004] Patent Document 1 describes a detection kit comprising forward primers and reverse primers having specific base sequences for PCR, which can be used to detect expression in human cells transplanted into animals other than humans. On the other hand, the comparative example of Patent Document 1 states that even when primers and probes are used to amplify the DUF1220 sequence that is human-specific and does not exist in cynomolgus monkeys, DNA amplification is still observed in samples obtained only from cynomolgus monkeys, and human cells cannot be specifically detected in cynomolgus monkeys.

[0005] Non-patent document 1 (Figure 4, etc.) states: There is a Ta family including Ta-1 and Ta-0 in LINE-1 elements (genes); the Ta family is specific to humans (human sequences are different from those of apes, Old World monkeys, New World monkeys, etc.); etc. However, not all base sequences that differ between humans and their closely related species can be used as probes, forward primers, and reverse primers for qPCR. Non-patent document 1 only discloses that the base sequences of the Ta family have become base sequences that are specific to humans and different from apes, etc. during the evolution process, but does not record which parts of the base sequences of the Ta family are suitable as probes and primers for qPCR.

[0006] Prior art literature

[0007] Patent Literature

[0008] Patent Document 1: Japanese Patent Application Publication No. 2017-18011

[0009] Non-patent literature

[0010] Non-patent document 1: Boissinot et al., "LI (LINE-1) Retrotransposon Evolution and Amplification in Recent Human History", Mol. Biol. Evol. 17(6): 915-928. 2000. Summary of the invention

[0011] Problems to be solved by the invention

[0012] An object of the present invention is to provide a probe for qPCR, a kit, a detection method, and the like that can detect human cells transplanted or administered to animals other than humans.

[0013] Means for solving problems

[0014] In order to solve the above-mentioned problems, the present invention provides the following [1] to [7]. [1]

[0016] A quantitative PCR probe comprising:

[0017] A sequence that can hybridize with an oligonucleotide comprising a sequence of 10 to 35 consecutive bases in the base sequence represented by SEQ ID NO: 1 derived from the human LINE-1 gene, or

[0018] A sequence capable of hybridizing with an oligonucleotide comprising a sequence of 10 to 35 consecutive bases in the base sequence represented by SEQ ID NO: 2 derived from a human LINE-1 gene; and

[0019] Mark the section. [2]

[0021] The quantitative PCR probe according to item [1], wherein the labeling portion is a combination of a fluorescent substance and a quencher corresponding to the fluorescent substance. [3]

[0023] A quantitative PCR kit comprising:

[0024] The quantitative PCR probe described in item [1];

[0025] A forward primer from human LINE-1; and

[0026] reverse primer from human LINE-1;

[0027] The sequence of the forward primer and the sequence of the reverse primer are selected so as to sandwich the quantitative PCR probe sequence on the base sequence of the human LINE-1 gene. [4]

[0029] The kit according to item [3], [6] or [7], further comprising a DNA polymerase having 5' to 3' exonuclease activity. [5]

[0031] A method for detecting human cells in a non-human animal to which human cells have been transplanted or administered, the method comprising using the quantitative PCR kit described in item [3], [6] or [7]. [6]

[0033] The quantitative PCR kit as described in item [3], wherein

[0034] The quantitative PCR probe is formed by any one of the following oligonucleotides (P1) to (P4) and a labeling portion (preferably a combination of FAM (more preferably 5-carboxyfluorescein) and NFQ-MGB) (preferably (P1)):

[0035] (P1) an oligonucleotide comprising the base sequence of SEQ ID NO: 3;

[0036] (P2) an oligonucleotide comprising a base sequence capable of hybridizing under highly stringent conditions (highly stringent hybridization conditions) with a base sequence targeted by the base sequence of SEQ ID NO: 3 (a base sequence complementary to SEQ ID NO: 3 in the human LINE-1 gene (antisense strand));

[0037] (P3) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 3 (i.e., having 1 to 5 bases mismatched with the antisense strand of the human LINE-1 gene that is the hybridization target of the probe); and

[0038] (P4) an oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 3,

[0039] The forward primer is formed from any one of the following oligonucleotides (F1) to (F4) (preferably (F1)):

[0040] (F1) an oligonucleotide comprising the base sequence of SEQ ID NO: 4;

[0041] (F2) an oligonucleotide comprising a base sequence capable of hybridizing with a base sequence targeted by the base sequence of SEQ ID NO: 4 (a base sequence complementary to SEQ ID NO: 4 in the human LINE-1 gene (antisense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0042] (F3) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 4 (i.e., having 1 to 5 bases mismatched with the antisense strand of the human LINE-1 gene that is the hybridization target of the forward primer); and

[0043] (F4) an oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 4, and

[0044] The reverse primer is formed from any one of the following oligonucleotides (R1) to (R4) (preferably (R1)):

[0045] (R1) an oligonucleotide comprising the base sequence of SEQ ID NO: 5;

[0046] (R2) an oligonucleotide comprising a base sequence capable of hybridizing with a base sequence targeted by the base sequence of SEQ ID NO: 5 (a base sequence complementary to SEQ ID NO: 5 in the human LINE-1 gene (sense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0047] (R3) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 5 (i.e., having 1 to 5 bases mismatched with the sense strand of the human LINE-1 gene that is the hybridization target of the reverse primer); and

[0048] (R4) An oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 5. [7]

[0050] The quantitative PCR kit as described in item [3], wherein

[0051] The quantitative PCR probe is formed by any one of the following oligonucleotides (P5) to (P8) and a labeling portion (preferably a combination of FAM (more preferably 5-carboxyfluorescein) and NFQ-MGB) (preferably (P5)):

[0052] (P5) an oligonucleotide comprising the base sequence of SEQ ID NO: 6;

[0053] (P6) an oligonucleotide comprising a base sequence capable of hybridizing with a base sequence targeted by the base sequence of SEQ ID NO: 6 (a base sequence complementary to SEQ ID NO: 6 in the human LINE-1 gene (sense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0054] (P7) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 6 (i.e., having 1 to 5 bases mismatched with the sense strand of the human LINE-1 gene that is the hybridization target of the probe); and

[0055] (P8) an oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 6,

[0056] The forward primer is formed from any one of the following oligonucleotides (F5) to (F8) (preferably (F5)):

[0057] (F5) an oligonucleotide comprising the base sequence of SEQ ID NO: 8;

[0058] (F6) an oligonucleotide comprising a base sequence capable of hybridizing with a base sequence targeted by the base sequence of SEQ ID NO: 8 (a base sequence complementary to SEQ ID NO: 8 in the human LINE-1 gene (antisense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0059] (F7) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 8 (i.e., having 1 to 5 bases mismatched with the antisense strand of the human LINE-1 gene that is the hybridization target of the forward primer); and

[0060] (F8) an oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 8, and

[0061] The reverse primer is formed by any one of the following oligonucleotides (R5) to (R8) (preferably R5):

[0062] (R5) an oligonucleotide comprising the base sequence of SEQ ID NO: 7;

[0063] (R6) an oligonucleotide comprising a base sequence that can hybridize with a base sequence targeted by the base sequence of SEQ ID NO: 7 (a base sequence complementary to SEQ ID NO: 7 in the human LINE-1 gene (sense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0064] (R7) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 7 (i.e., having 1 to 5 bases mismatched with the sense strand of the human LINE-1 gene that is the hybridization target of the reverse primer); and

[0065] (R8) An oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 7.

[0066] Effects of the Invention

[0067] By using the qPCR probe, kit, detection method, etc. of the present invention, human cells in a sample collected from an animal other than a human to which human cells have been transplanted or administered can be quantitatively detected over time using PCR. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] [ Figure 1A ] Figure 1A The figure shows the amplification curve of human genomic DNA in the cerebral cortex sample of cynomolgus monkey containing human cell lysate. The vertical axis (ΔRn) represents the amount of PCR reaction product, which is shown as the logarithm of fluorescence intensity. The horizontal axis (cycle number, CycleNumber) represents the number of cycles of the PCR reaction. The horizontal line (threshold, Threshold) in the figure is drawn in the area where the PCR reaction product grows exponentially (at Figure 1C , Figure 2A , Figure 2C , Figure 3A The numerical values ​​near the amplification curve indicate that the amplification curve is an amplification curve for a sample to which a human cell lysate corresponding to each numerical value is added ( Figure 2A The same is true in ).

[0069] [ Figure 1B ] Figure 1B The standard curve of human genomic DNA in the cerebral cortex sample of cynomolgus monkey containing human cell lysate is shown. The vertical axis (Ct value) represents the number of PCR reaction cycles and shows the intersection of the amplification curve and the threshold value. The horizontal axis (Quantity) represents the number of human cells added to the sample (unless otherwise specified). Figure 2B , Figure 3B The same is true in ).

[0070] [ Figure 1C ] Figure 1CThe amplification curve of cynomolgus monkey genomic DNA in cynomolgus monkey cerebral cortex samples (without human cell lysate) is shown.

[0071] [ Figure 2A ] Figure 2A Amplification curves of human genomic DNA in mouse blood samples containing human cell lysate are shown.

[0072] [ Figure 2B ] Figure 2B A standard curve of human genomic DNA in mouse blood samples containing human cell lysate is shown.

[0073] [ Figure 2C ] Figure 2C Amplification curves of mouse genomic DNA in mouse blood samples (without human cell lysate) are shown.

[0074] [ Figure 3A ] Figure 3A The amplification curve of human genomic DNA in monkey genomic DNA samples extracted from cynomolgus monkey liver samples is shown.

[0075] [ Figure 3B ] Figure 3B The standard curve of human genomic DNA in monkey genomic DNA samples extracted from cynomolgus monkey liver samples is shown. The horizontal axis (Quantity) represents the weight (ng) of human genomic DNA added to the PCR wells. DETAILED DESCRIPTION

[0076] The base sequence of the human LINE-1 (also referred to as "Long interspersed nucleotide factor-1" and "Long interspersed nuclear elements-1") gene is registered in the GenBank database (http: / / www.ncbi.nlm.nih.gov / genbank / ) provided by the National Center for Biotechnology Information (NCBI) of the United States with a prescribed accession number (e.g., GenBank accession number KP237032.1, GenBank accession number JN698885.1, GenBank accession number GU477637.1, etc.) There are many families of human LINE-1 genes, and the "human LINE-1 gene" in this specification also includes family genes other than those exemplified above, and may be a human LINE-1 gene of any base sequence as long as the quantitative PCR probe, forward primer, and reverse primer prescribed in the present invention can be designed.

[0077] In this specification, the "antisense strand" used in relation to the LINE-1 gene refers to the DNA strand having a base sequence that serves as a template for synthesizing mRNA of the LINE-1 protein (ORF (Open Reading Frame) 1 and ORF2) among the two DNA strands.

[0078] In the present specification, the "sense strand" used in relation to the LINE-1 gene refers to a DNA strand having a base sequence complementary to the antisense strand of the above-mentioned LINE-1 gene.

[0079] [Quantitative PCR probe]

[0080] The first quantitative PCR probe in the present invention (referred to as "first probe" in this specification) comprises: a sequence that can hybridize with an oligonucleotide comprising a sequence of 10 to 35 consecutive bases in the base sequence represented by SEQ ID NO: 1 (on the antisense strand) from the LINE-1 gene (referred to as "first probe sequence" in this specification), and a labeling site. The first probe is used in combination with the forward primer of the present invention described below that also binds to the antisense strand (and, optionally, the reverse primer of the present invention described below that binds to the sense strand).

[0081] Sequence No. 1:

[0082] 5'-CCATTACTGGGTATATACCCAAATGAGTATAAATCATGCTGC TATAAAGACACATGCACACGTATGTTTTATTGCGGCACTATTCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATATCCTTTGTAGGGACATGGATGAAATTGGAAACCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACAC CGCATATTCTCACTCATAGGTGGGAATTGAACAATGAGATCACATGGACACAGGAAGGGGAATATCACACTCTGGGGACTGTGGGTGGGGTTGGGGGAGGGGGGAGGGATAGTATTGGGAGATATACCTAATGCTAGATGACACATTAGTGGGTGCAGCGCACCAGCATGGCACATGTATACATATGTAACTAACCTGCACAATGTGCACATGTACCCTAAAACTTAGAGTAT-3'

[0083] The second quantitative PCR probe in the present invention (referred to as "second probe" in this specification) comprises: a sequence that can hybridize with an oligonucleotide comprising a sequence of 10 to 35 consecutive bases in the base sequence represented by SEQ ID NO: 2 (on the sense strand) from the LINE-1 gene (referred to as "second probe sequence" in this specification), and a labeling site. The second probe is used in combination with the reverse primer of the present invention described below that also binds to the sense strand (and, optionally, the forward primer of the present invention described below that binds to the antisense strand).

[0084] Sequence number 2:

[0085] 5'-ATACTCTAAGTTTTAGGGTACATGTGCACATTGTGCAGGTTA GTTACATATGTATACATGTGCCATGCTGGTGCGCTGCACCCACTAATGTGTCATCTAGCATTAGGTATATCTCCCAATACTATCCCTCCCCCCTCCCCCAACCCACCACAGTCCCCAGAGGTTGATATTCC CCTTCCTGTGTCCATGTGATCTCATTGTTCAATTCCCACCTATGAGTGAGAATATGCGGTGTTTGGTTTTTTGTTCTTGCGATAGTTTACTGAGAATGATGGTTTCCAATTTCATCCATGTCCCTACAAAGGATATGAACTCATCATTTTTTATGGCTGCATAGTATT CCATGGTGTATATGTGCCACATTTTCTTAATCCAGTCTATCATTGTTGGACATTTGGGTTGGTTCCAAGTCTTTGCTATTGTGAATAGTGCCGCAATAAACATACGTGTGCATGTGTCTTTATAGCAGCATGATTTATACTCATTTGGGTATATACCCAGTAATGG-3'

[0086] "Quantitative PCR" (sometimes referred to as "qPCR" in this specification) is also called real-time PCR, which is an improved method of PCR and is a method for quantitatively measuring the copy number of a target gene in a sample over time. qPCR is well known and commonly used by those skilled in the art (for example, see Stephen A. Bustin, AZ of Quantitative PCR), and its basic technical matters belong to the technical common sense of those skilled in the art and can also be applied to the present invention.

[0087] As a typical embodiment of quantitative PCR, "real-time quantitative PCR" can be cited, which monitors and analyzes the increase of PCR amplification products in real time by using fluorescent labels. As an example of real-time quantitative PCR, a fluorescent probe method (e.g., TaqMan method, molecular beacon method, and cycling probe method) using a probe labeled with a fluorescent substance (and a quencher corresponding to the fluorescent substance) can be cited (e.g., see Stephen A. Bustin, ed., AZ of Quantitative PCR).

[0088] The basic technical matters for making the quantitative PCR probe of the present invention suitable for the implementation of real-time quantitative PCR such as TaqMan method, molecular beacon method, and cycle probe method, such as the design of the base sequence of the quantitative PCR probe, the design of the labeling part, and the conditions of PCR, can be set based on the previous real-time quantitative PCR (each method mentioned above). In addition, in order to implement real-time quantitative PCR, enzymes (such as DNA polymerase), reagents (such as buffer), kits containing these enzymes and / or reagents (such as TaqPathProAmp Master Mixes (Thermo Fisher Scientific)), and devices (such as 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific), QuantStudio 7 (Thermo Fisher Scientific)) sold by Thermo Fisher Scientific, Takara Bio Inc., etc. can also be used.

[0089] The first probe sequence and the second probe sequence of the present invention (collectively referred to as "the quantitative PCR probe sequence of the present invention" in this specification) are sequences that can hybridize with an oligonucleotide comprising a sequence of 10 to 35 consecutive bases, preferably 13 to 30 bases, and more preferably 15 to 25 bases in the base sequence shown in sequence number 1 or 2.

[0090] In this specification, the term "capable of hybridization" means that hybridization can be performed in the step of actually using the quantitative PCR probe of the present invention (or under conditions assuming its use) in quantitative PCR, and as a result, the genomic DNA of human cells in the sample can be quantified with desired accuracy based on the amplification curve and standard curve of quantitative PCR. In other words, it means that it specifically binds (hybridizes) to the target base sequence with high stringency (under highly stringent conditions) and does not bind to other base sequences.

[0091] Hybridization can be carried out according to a known method per se or a method based thereon, for example, the method described in Molecular Cloning, 2nd edition (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989).

[0092] The term "highly stringent conditions" refers to conditions under which a nucleic acid having a complementary strand sequence of a certain base sequence can hybridize with a nucleic acid having a base sequence having about 70% or more, preferably about 80% or more, more preferably about 90% or more, and particularly preferably about 95% or more complementarity in an overlap region. In the case of temperature, about 50 to 70° C., preferably about 50 to 65° C., can be mentioned. A person skilled in the art can easily adjust to a desired stringency by appropriately changing the salt concentration of the hybridization solution, the temperature of the hybridization reaction, the probe concentration, the length of the probe, the number of mismatches, the time of the hybridization reaction, the salt concentration of the washing solution, the temperature of the washing, and the like.

[0093] In one embodiment of the present invention, the quantitative PCR probe sequence of the present invention may contain base pairs that mismatch with the target sequence (e.g., 5 bases or less, preferably 3 bases or less, and more preferably 1 base) as long as it can hybridize with the target sequence under highly stringent conditions.

[0094] In other embodiments of the present invention, the quantitative PCR probe sequence of the present invention may be a base sequence having, for example, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more identity with a sequence that is 100% complementary to the target sequence, as long as it can hybridize with the target sequence under highly stringent conditions.

[0095] In this specification, "identity" is used with the same meaning as "homology". The homology of base sequences can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc Natl Acad Sci USA 90: 5873, 1993), based on the following conditions (expectation value = 10; allow gaps; filter = ON; match score = 1; mismatch score = -3). As other algorithms for determining the homology of base sequences, BLASTN, BLASTX (Altschul SF et al., J Mol Biol 215: 403, 1990) and the like can be cited. These programs can use their respective default parameters.

[0096] The quantitative PCR probe sequence of the present invention can be formed by oligonucleotides corresponding to the embodiment of quantitative PCR. For example, the oligonucleotides of the probes that can be used for the TaqMan method, the molecular beacon method, etc. are DNA probes composed of adenine (A), guanine (G), cytosine (C) and thymine (T). On the other hand, the oligonucleotides of the probes that can be used for the circulating probe method are DNA composed of adenine (A), guanine (G), cytosine (C) and thymine (T), and a chimeric probe (oligonucleotide) connected to RNA composed of adenine (A), guanine (G), cytosine (C) and uracil (U). In addition, modified nucleotides (such as LNA (locked nucleic acids)) can also be used as needed. It should be noted that these modified nucleotides can also be used when designing forward primers and reverse primers.

[0097] The quantitative PCR probe sequences (first probe sequence and second probe sequence) of the present invention can be designed to bind to a base sequence (sequence number 1 or 2) of a suitable position and length based on the base sequence information of the human LINE-1 gene, and to label the amplification product generated by quantitative PCR. Particularly suitable are the following first probe sequence and second probe sequence, which are specific to the antisense strand and sense strand of the human LINE-1 gene, respectively, and use base sequences that do not exist in the antisense strand and sense strand of the LINE-1 gene of the non-human animal sample as the target.

[0098] In a preferred embodiment of the present invention, the first probe sequence of the present invention is formed of any one of the following (P1) to (P4) that can hybridize with the target base sequence (preferably (P1)):

[0099] (P1) an oligonucleotide comprising the base sequence of SEQ ID NO: 3;

[0100] (P2) an oligonucleotide comprising a base sequence capable of hybridizing under highly stringent conditions (highly stringent hybridization conditions) with a base sequence targeted by the base sequence of SEQ ID NO: 3 (a base sequence complementary to SEQ ID NO: 3 in the human LINE-1 gene (antisense strand));

[0101] (P3) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 3 (i.e., having 1 to 5 bases mismatching with the antisense strand of the LINE-1 gene that is the hybridization target of the first probe);

[0102] (P4) An oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 3.

[0103] In another preferred embodiment of the present invention, the second probe sequence of the present invention is formed by any one of the following (P5) to (P8) that can hybridize with the target base sequence (preferably (P5)):

[0104] (P5) an oligonucleotide comprising the base sequence of SEQ ID NO: 6;

[0105] (P6) an oligonucleotide comprising a base sequence capable of hybridizing with a base sequence targeted by the base sequence of SEQ ID NO: 6 (a base sequence complementary to SEQ ID NO: 6 in the human LINE-1 gene (sense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0106] (P7) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 6 (i.e., having 1 to 5 bases mismatched with the sense strand of the LINE-1 gene that is the hybridization target of the second probe);

[0107] (P8) An oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 6.

[0108] The labeling part included in the quantitative PCR probe of the present invention can be set to a labeling part corresponding to the implementation method of quantitative PCR. For example, the quantitative PCR probes that can be used for the TaqMan method, the molecular beacon method, the circulating probe method, etc. all include a labeling part based on the principle of FRET (fluorescence resonance energy transfer), and the labeling part is composed of a fluorescent substance connected to the 5' end of the probe oligonucleotide and a quencher (corresponding to the fluorescent substance) connected to the 3' end of the probe oligonucleotide. The combination of fluorescent substances and quenchers that can be used for FRET is various, and substances with excitation wavelengths and detection wavelengths suitable for the device for implementing quantitative PCR (real-time PCR) can be selected.

[0109] Examples of fluorescent substances include FITC (fluorescein isothiocyanate), FAM (e.g., 5-carboxyfluorescein, 6-carboxyfluorescein), TET, VIC, HEX, NED, PET, JOE, ROX (6-carboxy-X-rhodamine), TAMRA (carboxytetramethyl-rhodamine), Texas Red, Cy3, Cy5, etc. (all fluorescent substances are commercially available from Thermo Fisher Scientific, etc.).

[0110] Examples of the quencher include TAMRA, IBRQ, BHQ1, NFQ-MGB, etc. (All quenchers are available from Thermo Fisher Scientific, etc.).

[0111] The fluorescent substances mentioned above may also function as quenchers depending on the combination. In addition, among the quenchers mentioned above, quenchers having fluorescence characteristics may also function as fluorescent substances. Those skilled in the art may appropriately select a quencher for a substance when a substance is used as a fluorescent substance.

[0112] In a preferred embodiment of the present invention, a combination of FAM (more preferably 5-carboxyfluorescein) (fluorescent substance) and NFQ-MGB (quencher) is used as the labeling moiety.

[0113] It should be noted that, in quantitative PCR, there are also methods that can quantitatively determine the number of copies of the target gene in the sample based on the signal intensity of the labeling substance contained in the PCR amplification product, such as agarose gel electrophoresis and Southern blotting, although the results cannot be given in real time. The quantitative PCR probe of the present invention can also be used in such non-real-time quantitative PCR (non-real-time quantitative PCR). In the case of non-real-time quantitative PCR, the labeling part contained in the quantitative PCR probe of the present invention can be cited as the labeling part of the substance used in conventional agarose gel electrophoresis, Southern blotting, etc., for example, including fluorescent substances (for example, fluorescent substances, fluorescent proteins, etc., the same as the substances contained in the quantitative PCR probe of the present invention for real-time quantitative PCR), luminescent substances (for example, ruthenium, luminescent proteins, etc.), enzymes (for example, alkaline phosphatase, peroxidase, etc.), magnetic substances, conductive substances, biotin, haptens, antigens, antibodies, etc., including labeling parts.

[0114] "Non-human animals" refer to animals other than humans, and typically refer to all experimental animals (including disease model animals) for human cell transplantation or administration. Examples of such experimental animals include non-human primates (marmosets, cynomolgus monkeys, macaques, capuchins, chimpanzees, etc.), cattle, pigs, goats, sheep, dogs, rabbits, rodents (mice, rats, etc.), etc. Non-human primates (Primates) include chimpanzees (subtribe), gorillas (tribe), orangutans (subfamily), gibbons (family), monkeys (superfamily (Cercopithecoidea), family (Cercopithecidae)), spider monkeys (family), tarsiers (family), lemurs (infraorder, family), etc. As monkeys (monkeys of the family Cercidae), monkeys of the genus Macaca, such as cynomolgus monkeys, macaques, and Japanese macaques (Macaca fuscata), can be mentioned.

[0115] In a preferred embodiment of the present invention, the non-human animal is a cynomolgus macaque or an animal that is taxonomically more distantly related to humans than the cynomolgus macaque. Among non-human primates (Primates), spider monkeys, tarsiers, lemurs, etc. belong to "animals taxonomically more distantly related to humans than the cynomolgus macaque." In addition, animals belonging to orders other than primates (Primates) are also "animals taxonomically more distantly related to humans than the cynomolgus macaque." On the contrary, among the cathartic monkeys, gibbons, orangutans, gorillas, chimpanzees, etc. that do not belong to the superfamily of monkeys to which the cynomolgus macaque belongs but belong to the superfamily of Hominoidea like humans do not belong to "animals taxonomically more distantly related to humans than the cynomolgus macaque.

[0116] In other preferred embodiments of the present invention, the homology between the base sequences of non-human animals and humans is lower than the homology between humans and cynomolgus macaques. Specifically, the homology between the base sequence of the portion targeted by the quantitative PCR probe (and forward primer and reverse primer) of the present invention in the human LINE-1 gene is lower than the homology between the base sequence of the target portion in the human LINE-1 gene and the base sequence of the corresponding portion in the cynomolgus macaque LINE-1 gene.

[0117] [Quantitative PCR Kit]

[0118] The quantitative PCR kit of the present invention comprises the quantitative PCR probe of the present invention, a forward primer from human LINE-1, and a reverse primer from human LINE-1, and may also comprise a DNA polymerase having 5'→3' exonuclease activity (5' to 3' exonuclease activity) as required, and other reagents for quantitative PCR (e.g., 50 mM magnesium chloride and 10-fold concentration of standard PCR buffer), instruments, instructions, etc.

[0119] In the quantitative PCR kit of the present invention, as the quantitative PCR probe, only the first probe may be used, only the second probe may be used, or both the first probe and the second probe may be used in combination.

[0120] The "forward primer derived from human LINE-1" is composed of an oligonucleotide containing a sequence that can hybridize with a predetermined sequence in the antisense strand of the human LINE-1 gene (referred to as a "forward primer sequence" in this specification).

[0121] The "reverse primer derived from human LINE-1" is composed of an oligonucleotide containing a sequence that can hybridize with a predetermined sequence in the sense strand of the human LINE-1 gene (referred to as a "reverse primer sequence" in this specification).

[0122] The "prescribed sequence" to which the forward primer sequence and the reverse primer sequence bind is located at a position sandwiching the sequence to which the quantitative PCR probe of the present invention binds on the base sequence of the human LINE-1 gene. For example, in an embodiment of the first probe of the present invention, in the antisense strand of the human LINE-1 gene, the sequence to which the forward primer binds (hybridizes) is set to "f", the sequence to which the quantitative PCR probe of the present invention binds is set to "p", and the sequence complementary to the sequence in the sense strand to which the reverse primer binds is set to "r", so that the sequence f, sequence p, and sequence r are arranged from the 3' side to the 5' side of the antisense strand of the human LINE-1 gene. In an embodiment of the second probe of the present invention, the sequence complementary to the sequence in the sense strand to which the quantitative PCR probe of the present invention binds is set to "p'", so that the sequence f, sequence p', and sequence r are arranged from the 3' side to the 5' side of the antisense strand of the human LINE-1 gene.

[0123] Two types of forward primers and two types of reverse primers can be used (two types of forward primers or two types of reverse primers). The positional relationship (with or without gaps or repeats) of the sequences in the antisense strands hybridized by the two types of forward primers can be appropriately set according to the implementation method of quantitative PCR (real-time PCR). The same is true for the positional relationship of the sequences in the sense strands hybridized by the two types of reverse primers.

[0124] The forward primer sequence and the reverse primer sequence can be designed based on the information of the base sequence of the human LINE-1 gene, so as to bind to the base sequence (prescribed sequence) of the appropriate position and length thereof and produce an amplification product by quantitative PCR. Particularly suitable are the forward primer sequence and the reverse primer sequence, which are specific to the antisense strand and the sense strand of the human LINE-1 gene, respectively, and target the base sequence that does not exist in the LINE-1 gene of the non-human animal from which the specimen is collected.

[0125] In a preferred embodiment of the present invention, the forward primer combined with the first probe sequence of the present invention is formed of any one of the following (F1) to (F4) that can hybridize with the target base sequence (preferably (F1)):

[0126] (F1) an oligonucleotide comprising the base sequence of SEQ ID NO: 4;

[0127] (F2) an oligonucleotide comprising a base sequence capable of hybridizing with a base sequence targeted by the base sequence of SEQ ID NO: 4 (a base sequence complementary to SEQ ID NO: 4 in the human LINE-1 gene (antisense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0128] (F3) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 4 (i.e., having 1 to 5 bases mismatched with the antisense strand of the human LINE-1 gene that is the hybridization target of the forward primer combined with the first probe sequence);

[0129] (F4) An oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 4.

[0130] In another preferred embodiment of the present invention, the forward primer combined with the second probe sequence of the present invention is formed of any one of the following (F5) to (F8) that can hybridize with the target base sequence (preferably (F5)):

[0131] (F5) an oligonucleotide comprising the base sequence of SEQ ID NO: 8;

[0132] (F6) an oligonucleotide comprising a base sequence capable of hybridizing with a base sequence targeted by the base sequence of SEQ ID NO: 8 (a base sequence complementary to SEQ ID NO: 8 in the human LINE-1 gene (antisense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0133] (F7) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 8 (i.e., having 1 to 5 bases mismatched with the antisense strand of the human LINE-1 gene that is the hybridization target of the forward primer combined with the second probe sequence);

[0134] (F8) An oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 8.

[0135] In a preferred embodiment of the present invention, the reverse primer combined with the first probe sequence of the present invention is formed of any one of the following (R1) to (R4) that can hybridize with the target base sequence (preferably (R1)):

[0136] (R1) an oligonucleotide comprising the base sequence of SEQ ID NO: 5;

[0137] (R2) an oligonucleotide comprising a base sequence capable of hybridizing with a base sequence targeted by the base sequence of SEQ ID NO: 5 (a base sequence complementary to SEQ ID NO: 5 in the human LINE-1 gene (sense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0138] (R3) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 5 (i.e., having 1 to 5 bases mismatched with the sense strand of the human LINE-1 gene that is the hybridization target of the reverse primer in combination with the first probe sequence);

[0139] (R4) An oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 5.

[0140] In another preferred embodiment of the present invention, the reverse primer combined with the second probe sequence of the present invention is formed by any one of the following (R5) to (R8) that can hybridize with the target base sequence (preferably (R5)):

[0141] (R5) an oligonucleotide comprising the base sequence of SEQ ID NO: 7;

[0142] (R6) an oligonucleotide comprising a base sequence that can hybridize with a base sequence targeted by the base sequence of SEQ ID NO: 7 (a base sequence complementary to SEQ ID NO: 7 in the human LINE-1 gene (sense strand)) under highly stringent conditions (highly stringent hybridization conditions);

[0143] (R7) an oligonucleotide having 1 to 5 bases different from the base sequence of SEQ ID NO: 7 (i.e., having 1 to 5 bases mismatched with the sense strand of the human LINE-1 gene that is the hybridization target of the reverse primer in combination with the second probe sequence);

[0144] (R8) An oligonucleotide having 70% or more and less than 100% homology with the base sequence of SEQ ID NO: 7.

[0145] When the quantitative PCR kit of the present invention is a kit in an embodiment using the TaqMan method as the quantitative PCR, the kit may further include a DNA polymerase having 5'→3' exonuclease activity (available from Thermo Fisher Scientific, Takara Bio Inc., TOYOBO LIFE SCIENCE, NEW ENGLAND BioLabs, etc.). In the TaqMan method, a DNA polymerase having 5'→3' exonuclease activity (representatively, Taq DNA polymerase) is used to extend the DNA chain from the primer in the 5'→3' direction, and the nucleotides of the TaqMan probe (corresponding to the quantitative PCR probe of the present invention) previously bound to the downstream side thereof are decomposed in the 5'→3' (5' to 3') direction, thereby dissociating the fluorescent substance and the quencher (corresponding to the fluorescent substance), so that the fluorescence suppressed by FRET emits as a signal that an amplification product has been generated.

[0146] [Human Cell Detection Method]

[0147] The method for detecting human cells of the present invention is a method for detecting human cells in non-human animals transplanted or given human cells, and is implemented using the quantitative PCR kit of the present invention (probes for quantitative PCR, forward primers, and reverse primers). That is, the method for detecting human cells of the present invention includes using a specimen collected from a non-human animal transplanted or given human cells, and treating the sample prepared from the specimen with the quantitative PCR kit of the present invention (probes for quantitative PCR, forward primers, and reverse primers). More specifically, it includes hybridization of genomic DNA from human cells in the sample or its amplified product with a probe for quantitative PCR, and annealing with a forward primer and a reverse primer. The method for detecting human cells of the present invention may also include a step of quantifying the number of human cells in the sample based on the amplification curve and standard curve of quantitative PCR.

[0148] The human cell detection method of the present invention can be implemented based on conventional quantitative PCR. For example, the steps for collecting specimens, preparing samples from specimens (such as DNA extraction), implementing each step of quantitative PCR (real-time PCR) (thermal denaturation, primer annealing and probe hybridization, etc.), preparing amplification curves and standard curves, and the devices and reagents used at this time can basically be applied in the same way as conventional quantitative PCR.

[0149] For the detection of human cells, specifically, it can be confirmed based on the amount of the reaction product of PCR exceeding a specified level, typically when the amplification curve in quantitative PCR intersects with a specified threshold value. When the amplification curve of quantitative PCR does not reach the threshold, that is, when the amount of the reaction product of PCR is insufficient, it can be considered that no human cells are detected. By comparing the amplification curve with a standard curve prepared using a standard sample with a known number of human cells, the number of human cells in the sample can be quantified (quantitatively detected). In other words, the threshold is set to a suitable value for the amount of PCR reaction products (reflecting its fluorescence intensity ΔRn, etc.) in a manner that can prepare a standard curve that can detect (and preferably quantify) human cells based on the intersection (Ct value) of the amplification curve with the standard sample. For example, the threshold value may be set so that the interval between the Ct value of a standard sample (blank sample) to which human cells are not added and the Ct value of a standard sample to which human cells corresponding to the number of human cells added (Lower Limit of Quantification: LLOQ) (for example, 10 / 50 μL (body fluid) or 15 mg (tissue), although it may vary depending on the qPCR kit and the instrument used) is 1 or more, 2 or more, or 3 or more. It should be noted that the blank sample, i.e., the sample prepared from a specimen from a non-human animal that does not contain any human cells at all, does not substantially amplify the PCR reaction product by the quantitative PCR probe (and the forward primer and the reverse primer) of the present invention, and may not cross the threshold value. The quantitative PCR probe (as well as the forward primer and the reverse primer) of the present invention can be designed as a probe that uses the base sequence of the human LINE-1 gene as a target and has specificity thereto. However, even if it non-specifically hybridizes with the base sequence of the LINE-1 gene of a non-human animal and a product derived from a non-human animal is mixed in the PCR reaction product, such an embodiment is also included in the present invention as long as the amount of contamination is within a range that does not hinder the preparation of an appropriate standard curve as described above.

[0150] The specimen collected from non-human animals is not particularly limited as long as it can prepare a sample for quantitative PCR, and various organs, tissues or cell groups can be used as specimens. As organs that can collect specimens, for example, brain (for example: olfactory bulb, amygdala, cerebral basal nucleus, hippocampus, thalamus, hypothalamus, subthalamic nucleus, cerebral cortex, medulla oblongata, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, caudate nucleus, corpus callosum, substantia nigra and other parts, whole brain, etc.), spinal cord, pituitary gland, stomach, pancreas, kidney, liver, gonad, thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (for example: large intestine, small intestine, etc.), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate, testis, testis, ovary, placenta, uterus, bone, joint and skeletal muscle can be cited, and tissues and cell groups contained in these organs can also be used as specimens. The specimen can be a cancerous tissue or cell group.

[0151] The human cells transplanted or administered to the non-human animal are not particularly limited as long as they are transplanted or administered to the organs of the non-human animal described above and human genomic DNA can be extracted when preparing a sample for quantitative PCR. Examples of such human cells include spleen cells, nerve cells, glial cells, pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fibrocytes, muscle cells (e.g., skeletal muscle cells, cardiomyocytes, myoblasts, and muscle satellite cells), adipocytes, immune cells (e.g., macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes, and megakaryocytes), synoviocytes, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, hepatocytes, mesenchymal cells, oocytes, and sperm cells, as well as stem cells (including artificial pluripotent stem cells (iPS cells) and embryonic stem cells (ES cells)) that can be induced to differentiate into the above cells, progenitor cells, blood cell lineage cells, oocytes, and fertilized eggs. Furthermore, human cells also include the above-mentioned human-derived cells produced by inducing differentiation of the above-mentioned stem cells (including artificial pluripotent stem cells (iPS cells) and embryonic stem cells (ES cells)) in vitro.

[0152] Example

[0153] In the following Examples 1 and 2, as the first probe of the present invention designed for the human LINE-1 gene, a probe having a structure represented by 5'-FAM-(SEQ ID NO: 3)-NFQ-MGB-3' was used, that is, a TaqMan probe composed of an oligonucleotide having a base sequence of SEQ ID NO: 3, FAM (5-carboxyfluorescein, Thermo Fisher Scientific) as a reporter fluorescent dye and its corresponding non-fluorescent quencher NFQ (Thermo Fisher Scientific), and MGB (minor groove binder, Minor Groove Binder, Thermo Fisher Scientific) molecules.

[0154] Sequence number 3: 5'-CACTAATGTGTCATCTAGCAT-3'

[0155] In addition, oligonucleotides having the base sequences of SEQ ID NO: 4 and SEQ ID NO: 5 were used as forward primers and reverse primers designed for the human LINE-1 gene, respectively.

[0156] SEQ ID NO: 4: 5'-CATGTGCCATGCTGGTGC-3'

[0157] SEQ ID NO: 5'-CCATTACTGGGTATATACCCAAATGAG-3'

[0158] [Example 1] Amplification of DNA from human cells in cynomolgus monkey brain samples

[0159] A sample was prepared using 15 mg of cynomolgus macaque cerebral cortex as a specimen, to which was added ATL solution (70 μL, DNeasy Blood & Tissue Kits, QIAGEN) containing human cells (peripheral blood T cells, Cryo-T8: Human CD8+ Negatively Selected (5-8M cells), Precision Bioservices) equivalent to 10, 100, 1,000, 10,000, and 100,000 cells, respectively, and a sample to which only ATL solution (70 μL) without human cells was added was added. After extracting genomic DNA from each of the above samples using a commercially available DNA extraction reagent (DNeasy Blood & Tissue Kits, QIAGEN), qPCR quantification was performed using TaqPath ProAmp Master Mixes (containing a DNA polymerase with 5'→3' exonuclease activity (Thermo Fisher Scientific)), the probe of sequence number 3 (5 pmol / well), the forward primer of sequence number 4 (3 pmol / well), and the reverse primer of sequence number 5 (3 pmol / well). qPCR was performed using 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific) under the conditions of 50°C, 2 minutes / 95°C, 5 minutes / (95°C, 15 seconds and 60°C, 1 minute) as one cycle for 45 cycles.

[0160] The amplification curve of Example 1 is shown in Figure 1A No substantial (significant) PCR amplification of cynomolgus monkey genomic DNA was confirmed in the samples without human cells added ( Figure 1C ). On the other hand, in the sample to which human cells were added, PCR amplification of human genomic DNA was confirmed at approximately equal intervals according to the number of cells. That is, cynomolgus monkey genomic DNA was not amplified, and only human genomic DNA was specifically amplified.

[0161] Depend on Figure 1A The standard curve prepared from the amplification curve is shown in Figure 1B The linearity of the standard curve was confirmed in the range of human cell counts from 10 (1.0E+1) to 100,000 (1.0E+5). In this way, the unknown concentration (cell number) can be estimated by using the amplification curve (Ct value when crossing the threshold) of the sample with unknown concentration (cell number) and the standard curve prepared from the sample with known concentration (cell number).

[0162] [Example 2] Amplification of DNA from human cells in mouse blood samples

[0163] The same procedures as in Example 1 were followed, except that 50 μL of mouse blood was used instead of 15 mg of cynomolgus monkey brain, to prepare samples with and without the addition of human cell lysate, and qPCR quantification was performed on the genomic DNA extracted from each sample.

[0164] The amplification curve and standard curve of Example 2 are shown in Figure 2A and Figure 2B The amplification curve and the standard curve were confirmed to be the same as those in Example 1 ( Figure 1A and Figure 1B ) The same thing. In addition, in the sample without adding human cells, no substantial (significant) PCR amplification of mouse genomic DNA was confirmed ( Figure 2C )

[0165] It can be seen from the results of Examples 1 and 2 above that by using the probe of the present invention (as well as the forward primer and the reverse primer), in the tissues of crab-eating macaques (cerebral cortex) and mice (blood), as long as there are even a small number of human cells in the sample, the number of human cells in the sample can be quantitatively determined based on the qPCR human genomic DNA amplification curve and the standard curve.

[0166] In Example 3 described below, as the second probe of the present invention designed for the human LINE-1 gene, a probe having a structure represented by 5'-FAM-(SEQ ID NO: 6)-NFQ-MGB-3' was used, that is, a TaqMan probe composed of an oligonucleotide having a base sequence of SEQ ID NO: 6, FAM (5-carboxyfluorescein, Thermo Fisher Scientific) as a reporter fluorescent dye and its corresponding non-fluorescent quencher NFQ (Thermo Fisher Scientific), and MGB (minor groove binder, Minor Groove Binder, Thermo Fisher Scientific) molecules.

[0167] SEQ ID NO: 6: 5'-TGAGTTCATATCCTTTGTAGGGA-3'

[0168] In addition, oligonucleotides having the base sequences of SEQ ID NO: 7 and SEQ ID NO: 8 were used as reverse primers and forward primers designed for the human LINE-1 gene, respectively.

[0169] SEQ ID NO: 7: 5'-CCATTACTGGGTATATACCCAAATGAG-3'

[0170] SEQ ID NO: 8: 5'-GCGCTGCACCCACTAATGT-3'

[0171] [Example 3] Amplification of DNA from human cells in cynomolgus monkey liver samples

[0172] Commercially available human genomic DNA (Promega) was added to monkey genomic DNA extracted from cynomolgus monkey liver samples (equivalent to 400 ng / reaction (ng / well)) in the form of 80, 8, 0.8, 0.08, 0.008, and 0 ng / reaction (ng / well) to prepare the sample. qPCR quantification was performed using the probe of sequence number 6 (10 pmol / well), the reverse primer of sequence number 7 (10 pmol / well), and the forward primer of sequence number 8 (10 pmol / well). qPCR was performed using QuantStudio 7 (Thermo Fisher Scientific) under the conditions of 95°C, 10 minutes / (95°C, 15 seconds and 60°C, 1 minute) as 1 cycle for 40 cycles.

[0173] The amplification curve of Example 3 is shown in Figure 3A PCR amplification was not confirmed in the sample without human genomic DNA added, while PCR amplification was confirmed at approximately equal intervals in the sample with human genomic DNA added, depending on the concentration of the added DNA. That is, the genomic DNA of cynomolgus monkeys was not amplified, and only the genomic DNA of humans was specifically amplified.

[0174] Depend on Figure 3A The standard curve prepared from the amplification curve is shown in Figure 3B The linearity of the standard curve was confirmed in the range of human genomic DNA concentration from 0.008 to 80 ng / reaction (ng / well). In this way, the unknown concentration can be estimated by using the amplification curve of the sample with unknown concentration (Ct value when crossing the threshold) and the standard curve prepared from the sample with known concentration.

[0175] Industrial Applicability

[0176] The qPCR probe of the present invention is useful as a reagent, a kit, or the like for quantitatively detecting human cells over time in a sample collected from an animal other than a human to which human cells have been transplanted or administered, using PCR.

[0177] This application is based on Japanese Patent Application No. 2018-110951 filed in Japan, and all the contents of the above application are included in this specification.

[0178] Sequence Listing Free Text

[0179] SEQ ID NO: 1: Target range of the quantitative PCR probe of the present invention in the human LINE-1 gene (antisense strand).

[0180] SEQ ID NO: 2: Target range of the quantitative PCR probe of the present invention in the human LINE-1 gene (sense strand).

[0181] SEQ ID NO: 3: The quantitative PCR probe of the present invention for the human LINE-1 gene used in Examples 1 and 2 (the first probe of the present invention).

[0182] SEQ ID NO: 4: Forward primer of the quantitative PCR of the present invention for the human LINE-1 gene used in Examples 1 and 2.

[0183] SEQ ID NO: 5: Reverse primer of the quantitative PCR of the present invention used in Examples 1 and 2 for the human LINE-1 gene.

[0184] SEQ ID NO: 6: The quantitative PCR probe of the present invention for the human LINE-1 gene used in Example 3 (the second probe of the present invention).

[0185] SEQ ID NO: 7: Reverse primer of the quantitative PCR of the present invention for the human LINE-1 gene used in Example 3.

[0186] SEQ ID NO: 8: Forward primer of the quantitative PCR of the present invention for the human LINE-1 gene used in Example 3.

Claims

1. A quantitative PCR kit comprising: Quantitative PCR probes; A forward primer from human LINE-1; and reverse primer from human LINE-1; in, The quantitative PCR probe comprises: (i) an oligonucleotide having a first probe sequence capable of hybridizing with an oligonucleotide consisting of a sequence of 10 to 35 consecutive bases in the base sequence represented by SEQ ID NO: 1 derived from the human LINE-1 gene, or (ii) an oligonucleotide having a second probe sequence capable of hybridizing with an oligonucleotide consisting of a sequence of 10 to 35 consecutive bases in the base sequence represented by SEQ ID NO: 2 derived from the human LINE-1 gene; and Marking part, Wherein, the oligonucleotide (i) having the first probe sequence is: (P1) an oligonucleotide consisting of the base sequence of SEQ ID NO: 3, The forward primer is: (F1) an oligonucleotide consisting of the base sequence of SEQ ID NO: 4, The reverse primer is: (R1) an oligonucleotide consisting of the base sequence of SEQ ID NO: 5, or Wherein, the oligonucleotide (ii) having the second probe sequence is: (P5) an oligonucleotide consisting of the base sequence of SEQ ID NO: 6, The forward primer is: (F5) an oligonucleotide consisting of the base sequence of SEQ ID NO: 8, The reverse primer is: (R5) An oligonucleotide consisting of the base sequence of SEQ ID NO:

7.

2. The kit according to claim 1, wherein The labeling part is a combination of a fluorescent substance and a quencher corresponding to the fluorescent substance. The kit according to claim 1 , further comprising a DNA polymerase having 5′→3′ exonuclease activity.

4. A method for detecting human cells in a non-human animal to which human cells have been transplanted or administered, the method comprising using the quantitative PCR kit according to claim 1.

Images