Cystathionine beta-synthase for the treatment of homocystinuria

Abstract

The present invention relates to cystathionine beta-synthase for treating homocystinuria. The present invention provides reagents and methods for enzyme replacement therapy using human cystathionine beta-synthase (CBS), homologs, variants or mutants thereof to treat homocystinuria and other related diseases and conditions.

Description

[0001] This application is a divisional application. The application date of the original application is January 29, 2014, the application number is 201480006554.0 (PCT / US2014 / 013602), and the name of the invention is “Cystathionine β-synthase for treating homocystinuria”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 61 / 758,138, filed January 29, 2013, and U.S. Non-Provisional Application No. 13 / 803,804, filed March 14, 2013, the disclosures of each of which are incorporated herein by reference. Field of the Invention

[0004] The present invention generally relates to a composition suitable for enzyme replacement therapy, which comprises a form of human cystathionine β-synthase (CBS), which can significantly reduce serum homocysteine ​​(Hcy) concentration and increase the production of downstream metabolites such as cystathionine and cysteine. Such a composition can be used to treat conditions or diseases such as homocystinuria and homocysteine ​​remethylation disorder. Background of the Invention

[0005] CBS, an important enzyme in the transsulfurization pathway, plays an important role in the metabolism of homocysteine ​​(Hcy) in eukaryotes (Mudd et al., 2001, in THE METABOLIC AND MOLECULAR BASES OF INHERITED DISEASE, 8th edition, pp. 2007-2056, McGraw-Hill, New York). The CBS enzyme catalyzes the pyridoxal-5'-phosphate (PLP; vitamin B6)-dependent condensation of serine and homocysteine ​​to form cystathionine, which is subsequently used to produce cysteine ​​by another PLP-dependent enzyme (cystathionine γ-lyase). When CBS activity is sharply reduced or absent, Hcy is built up in tissues and blood as a result of certain genetic mutations. In mammalian cells with a transsulfurization pathway, CBS occupies a key regulatory position between the remethylation of Hcy to methionine or its alternative use in the biosynthesis of cysteine.

[0006] In healthy normal individuals, the CBS-mediated conversion of Hcy to cystathionine is the rate-limiting intermediate step in the metabolism of methionine (Met) to cysteine ​​(Cys). Vitamin B6 is an essential coenzyme for this process. In individuals with certain genetic mutations in the CBS enzyme, the conversion from Hcy to cystathionine is slowed or absent, resulting in an increase in the serum concentration of the enzyme substrate (Hcy) and a corresponding decrease in the serum concentration of the enzyme product (cystathionine; Cth). The clinical condition of elevated serum levels of Hcy and its concurrent excretion in urine is collectively referred to as homocystinuria.

[0007] Estimates of the prevalence of homocystinuria vary widely. Data from newborn screening and clinical confirmation provide a range of 1:200,000-1:335,000 live births (Mudd et al., 2001). Recent evidence from newborn DNA screening studies in Denmark, Germany, Norway, and the Czech Republic suggests that the true incidence may be as high as ~1:6,000 (Gaustadnes et al., 1999, N Engl J Med . 1340:1513; Linnebank et al., 2001, Thromb Haemost . 85:986; Refsum et al., 2004, Clin. Chem 50:3; Sokolova et al., 2001, Hum Mutat .18:548). In addition, recent work has indicated that individuals with CBS-deficient homocystinuria (CBSDH) have psychiatric or cardiovascular complications but are currently undiagnosed because of the lack of characteristic connective tissue defects that typically aid in diagnosis (Li and Stewart, 1999, Pathol . 31:221; Linnebank et al., 2003, J. Inherited Metabol. Dis. 26: 509; Maclean et al., 2002, Hum Mutat . 19:641). Major health problems associated with CBSDH include: cardiovascular disease with a tendency to form blood clots, resulting in high mortality in both untreated and partially treated patients; connective tissue problems affecting the visual system with progressive myopia and ectopia lentis; connective tissue problems affecting the skeleton characterized by Marfan syndrome, osteoporosis, and scoliosis; and central nervous system problems, including mental retardation and epilepsy.

[0008] The treatment solution for CBS-related homocystinuria depends on the type of mutation present in the CBS gene. Approximately 160 pathogenic mutations of the CBS gene have been identified in humans to date. There is a functional trichotomy in the nature of pathogenic mutations associated with CBSDH. One group of mutations is classified as "pyridoxine-responsive", in which CBS enzyme function can be restored by high-dose vitamin B6 treatment. This treatment can be effective, but it does not always alleviate pathological events in these individuals, and some events in these individuals even occur over time. The second group of functional mutations is represented by "C-terminal CBS mutants", which lack the ability to respond to post-translational upregulation caused by S-adenosylmethionine. Individuals with this type of mutation usually lack mental retardation and connective tissue phenotypes. This type of mutation was detected after measuring plasma Hcy levels after idiopathic thrombotic events before the age of 40 (Maclean et al., 2002, Hum Mutat. 19: 641-55). The last group of CBSDH mutations is "classic homocystinuria", representing the most severe form of the disease. For these latter two groups of individuals, vitamin B6 treatment alone is not effective in reducing serum Hcy levels.

[0009] The pathophysiology of homozygous CBS deficiency is undoubtedly complex, but there is a consensus that the fundamental instigator of end-organ damage is the extremely elevated serum Hcy. The toxicity of greatly elevated blood and tissue concentrations of Hcy can arise from the molecular reactivity and biological effects of Hcy itself, or from its metabolites (e.g., Hcy-thiolactone) that affect a large number of biological processes (Jakubowski et al., 2008, FASEB J 22: 4071-6). Abnormalities in chronic platelet aggregation, alterations in vascular parameters, and endothelial dysfunction have all been described in individuals with homocystinuria.

[0010] There are currently three treatment options for CBSDH:

[0011] 1) Use pharmacological doses of vitamin B6 to increase residual CBS activity in vitamin B6-responsive patients;

[0012] 2) lowering serum Hcy by a diet that strictly restricts Met intake; and

[0013] 3) Detoxification through betaine-mediated conversion of Hcy to Met, thereby reducing serum Hcy concentrations.

[0014] The purpose of each of these 3 therapies is to reduce serum Hcy concentration. The standard treatment for individuals who are affected by CBSDH that is unresponsive to vitamin B6 consists of a Met-restricted diet supplemented with a metabolic formula and Cys (which has become a conditionally essential amino acid in this case). The intake of meat, dairy products, and other foods rich in natural protein is prohibited. An unpalatable anabolic formula containing amino acids and trace nutrients needs to be consumed daily to prevent secondary malnutrition. Supplementation with betaine (trade name: CYSTADANE™, synonym: trimethylglycine) is also a standard therapy. Betaine acts as a methyl donor for the remethylation of Hcy to Met in the liver by betaine-homocysteine ​​methyltransferase catalysis (Wilcken et al., 1983, N. Engl. J. Med . 309: 448-53). Even in centers with optimal care and resources, dietary compliance is often poor, and this nonadherence is critically implicated in the development of life-threatening complications of homocystinuria.

[0015] The evidence presented in the previous section is summarized in the following key points:

[0016] Untreated homocystinuria has a high rate of complications in the vascular, connective tissue, and central nervous system.

[0017] Treatments to lower serum Hcy, such as strict Met-restricted diets and betaine, if well implemented, reduce the associated clinical problems. Improvements in cognitive performance require treatment to be started in early infancy.

[0018] Compliance with the diet is uniformly poor. In individuals who begin treatment in the neonatal period, a decrease in compliance occurs during adolescence. In individuals who begin treatment after the neonatal period, compliance is poor at all ages. The extreme difficulty of current treatment approaches is evident in individuals who experience life-threatening symptoms that could be prevented by the diet, but still fail to adhere to the treatment.

[0019] Failure of dietary compliance results in increased serum Hcy, vascular and connective tissue complications including recurrence of fatal and incapacitating events, and risks of severe adverse reactions such as cerebral edema (due to excessive serum Met concentrations) or severe malnutrition (due to deficiencies in essential amino acids).

[0020] The most effective treatment strategy is to increase enzyme activity, which is evident when pyridoxine is administered to vitamin B6-responsive homocystinuria. This strategy is powerless in vitamin B6-nonresponsive individuals because of the mutational status and increased enzyme activity in these individuals would depend on the delivery of exogenous enzymes, i.e., enzyme replacement therapy (ERT), a strategy that has never been attempted to treat homocystinuria.

[0021] There is demonstrated efficacy in these three existing treatment strategies: (1) increasing enzyme activity with pyridoxine in vitamin B6 responsive individuals; (2) reducing accumulated metabolites through dietary Met restriction; and (3) detoxification through enzymatic activity of betaine-homocysteine ​​methyltransferase in betaine therapy, all of which together reduce total Hcy in plasma (Walter, et al., 1998, Eur J Pediatr 157(Suppl 2):S71-6).

[0022] In addition, for all existing treatment strategies for human patients (except B6 supplementation, which is only suitable for a subset of homocystinuria), the reduction of homocysteine ​​is not accompanied by an increase in Cth or Cys. Because it has not been determined that excess Hcy (rather than a lack of downstream metabolites) is the cause of clinical symptoms, existing treatments limited to reducing homocysteine ​​may be inadequate for providing robust and effective treatment options.

[0023] Therefore, there remains a need in the art for more effective treatment strategies for individuals with homocystinuria. SUMMARY OF THE INVENTION

[0024] As described herein, the present invention provides compositions, especially compositions, and methods for reducing serum Hcy, especially in individuals with homocystinuria. Also provided are compositions, especially pharmaceutical compositions, which restore substantially normal metabolite levels, including but not limited to methionine, such as cysteine ​​and cystathionine. As described in more detail herein, reagents and methods for enzyme replacement therapy (ERT) for homocystinuria are provided, wherein modified forms of the natural enzyme have been recombinantly engineered to improve their pharmaceutical acceptability by providing, in particular, improved stability, activity, and in vivo drug utility.

[0025] In a first aspect, the invention provides an isolated CBS polypeptide comprising SEQ ID NO: 02, wherein the isolated CBS polypeptide comprises a chemical modification and is a genetically engineered truncation of the full-length human CBS protein at the amino terminus, the carboxyl terminus, or at both its amino terminus and carboxyl terminus. In one embodiment, the invention provides an engineered variant of human CBS, which constitutes a recombinant human CBS in which the C-terminal regulatory region has been removed (e.g., rhCBSΔC - the rhCBSΔC has a truncated 138 residues at the carboxyl terminus and comprises amino acids 1-413 of the 551 amino acids of the full-length protein) (SEQ ID NO: 3). In certain embodiments, the rhCBSΔC is mutated, and in a preferred embodiment, the truncated mutant CBS is rhCBSΔC-C15S (or abbreviated as "C15S" - the C15S has a truncated 138 residues at the carboxyl terminus; identical to rhCBSΔC) (SEQ ID NO: 13), wherein the cysteine ​​residue at position 15 of the CBS amino acid sequence is changed to serine. In specific embodiments disclosed herein include truncated recombinant human CBS species that have been chemically modified, especially by covalent attachment of a polyethylene glycol (PEG) moiety to a C-terminal truncated recombinant human CBS (especially rhCBSΔC). These pegylated species are referred to as PEG-rhCBSΔC or PEG-C15S, respectively. These compositions (modified recombinant enzymes) and methods of use, particularly therapeutic uses as given herein, allow individuals with homocystinuria to enjoy a much less restricted diet (e.g., daily intake of 2 g or more protein / kg) with significantly reduced Hcy plasma levels and essentially normal metabolite levels (including but not limited to methionine, such as cysteine ​​and cystathionine), resulting in long-term clinical improvement.

[0026] Advantageously, the present invention enables individuals to achieve good control of serum Hcy levels without extreme dietary restriction, which has unacceptable non-compliance rates. The use of the truncated species, especially the mutant species, especially the C15S mutant (pegylated or simultaneously mutated and pegylated) can be advantageously accompanied by improved metabolism of the individual, and thus improve clinical outcomes, which are embodied in the reduction of morbidity and mortality, especially associated with significantly reduced serum Hcy concentrations.

[0027] As disclosed herein, C15S mutant human CBS species advantageously employ such a structure: it significantly increases drug utilization in vivo (e.g., no detectable aggregation levels). C15S mutant human CBS species also exhibit highly reproducible expression, purification and PEGylation patterns, and the C15S mutation reduces the formation of aggregates, thereby improving yields by improving recovery and enabling more consistent and reproducible PEGylation. These aspects can also be used for quality issues, which are particularly relevant for steps prior to in vivo application.

[0028] As disclosed herein, the PEGylated species advantageously have an increased size compared to non-PEGylated truncated variants, particularly the rhCBSΔC or C15S species, wherein the PEGylated species have reduced or delayed clearance. In addition, chemical modification with PEG masks potential immunogenic epitopes on the protein surface and hinders proteolytic enzyme access to the protein. PEGylation also advantageously alters the physicochemical properties of the rhCBSΔC protein, thereby altering its biodistribution, stability and solubility without significantly losing its potency.

[0029] These and other features and advantages of the present invention will be more fully understood from the following detailed description and appended claims. Note that the scope of the claims is defined by the detailed description therein and not by the specific discussion of the features and advantages given in this description.

[0030] BRIEF DESCRIPTION OF THE DRAWINGS OF THE PRESENT INVENTION

[0031] The following detailed description of embodiments of the invention is best understood when read in conjunction with the following drawings.

[0032] Figure 1 Experimental evidence that the retention time of plasma enzymes in vivo is increased after rhCBSΔC PEGylation is presented. Figure 1 The pharmacokinetic profiles of rhCBSΔC and PEGylated rhCBSΔC after single administration and evidence of their stability in vivo are provided. Figure 1 a is a bar graph showing the results of an experiment in which C57BL / 6J mice were injected with 5 mg / kg body weight of human truncated CBS (rhCBSΔC) via intraperitoneal (IP), intravascular (IV) or subcutaneous (SQ) routes. Two experimental groups (referred to as 1 and 2) of 5 mice each were used for each injection route (total n=30). For each injection route, blood was collected from group 1 at 0, 1, 8 and 24 hours after injection, and blood was collected from group 2 at 1, 4, 10 and 48 hours after injection. The CBS activity of plasma was analyzed by radioactivity assay (as described in Example 1). Figure 1 b is after CBS is cleared from the loop, such as Figure 1A photograph of the results of Western blot analysis of CBS in the plasma of 2 representative mice in each group as described above. After SDS-PAGE separation of CBS on a 12% gel and Western blotting onto a polyvinylidene fluoride (PVDF) membrane, the membrane was probed with a rabbit polyclonal anti-hCBS antibody, followed by a secondary anti-rabbit antibody conjugated to horseradish peroxidase, and the bands were then developed with SuperSignal West Pico chemiluminescent substrate (Pierce catalog number 34077). Figure 1 c is a bar graph showing the results of an experiment in which mice were injected with 5 mg / kg body weight of ME020MA- or GL4-400MA-PEGylated rhCBSΔC or non-PEGylated rhCBSΔC via the SQ route. ME020MA represents rhCBSΔC enzyme PEGylated with ME020MA, GL4-400MA represents rhCBSΔC enzyme PEGylated with GL4-400MA, and rhCBSΔC represents unmodified rhCBSΔC enzyme. Each treatment included 2 groups of 5 mice each, as described in Example 2 and Figure 1 Mice were bled at the indicated time points as shown in A (total 30 mice). Plasma was analyzed for CBS activity by radioactivity assay.

[0033] Figure 2 is a bar graph showing the steady-state level of CBS activity achieved after repeated SQ administration. Injection of PEGylated, but not non-PEGylated rhCBSΔC, demonstrated that CBS activity was established in vivo. GL4-400MA represents rhCBSΔC enzyme PEGylated with GL4-400MA, and rhCBSΔC represents unmodified rhCBSΔC enzyme. C57BL / 6J mice were injected with 5 mg / kg body weight of non-PEGylated rhCBSΔC (n=5) or GL4-400MArhCBSΔC (n=5) at 0, 24, and 48 hours (arrows) and bled at the indicated time points. Plasma was analyzed for CBS activity using the radioactivity assay described in Example 1c.

[0034] Figure 3 illustrates experimental evidence that a single injection of PEGylated rhCBSΔC reduces homocysteine ​​and increases cystathionine in plasma. Figure 3a is a graph showing that PEG modification of rhCBSΔC prolongs the systemic presence of CBS enzyme activity after a single SQ administration of rhCBSΔC modified with a specified type of activated PEG. The graph shows the results of an experiment in which 27 C57BL / 6J mice were divided into 9 experimental groups (n=3). Each experimental group was injected with 5 mg / kg body weight of rhCBSΔC PEGylated with a specified PEG molecule via the SQ route, or injected with non-PEGylated enzyme. ME020MA represents rhCBSΔC enzyme pegylated with ME020MA, ME050GS represents rhCBSΔC enzyme pegylated with ME050GS, ME200GS represents rhCBSΔC enzyme pegylated with ME200GS, 200MA0B represents rhCBSΔC enzyme pegylated with 200MA0B, ME400MA represents rhCBSΔC enzyme pegylated with ME400MA, GL2400MA represents rhCBSΔC enzyme pegylated with GL2400MA, GL4400MA represents rhCBSΔC enzyme pegylated with GL4400MA, GL2800MA represents rhCBSΔC enzyme pegylated with GL2800MA, and rhCBSΔC represents non-pegylated rhCBSΔC enzyme. Blood samples were drawn at designated time points and CBS enzyme activity was measured using the radioactivity assay described in Example 1c. Data are presented as histograms with standard deviation (STD), and scatter plots. FIG3b is a bar graph showing the natural diurnal variation of Hcy, Cth, Cys, and Met levels in HO mouse plasma. Results are presented for 6 HO mice (HO mouse model of homocystinuria, described in Maclean et al., 2010, Mol. Genet. Metab At each time point as described in Example 1e, plasma amino acid levels were measured by stable isotope dilution liquid chromatography-mass spectrometry.

[0035] Figure 3c is a photograph of the electrophoresis analysis of rhCBSΔC PEGylated with ME-400MA (lane 1), GL4-400MA (lane 2) or ME-200MA0B (lane 3), electrophoretically analyzed together with the non-PEGylated enzyme (lane 4), and stained with Coomassie blue (M indicates molecular weight standard). The specific activity (SA) of each PEGylated and non-PEGylated rhCBSΔC is shown in the table.

[0036] Figures 3d and 3e are bar graphs showing the results of an experiment in which HO mice were injected once at 0 time via the SQ route with rhCBSΔC PEGylated with a designated PEG molecule and bled at 0 time (pre-injection), 24, 48 and 72 hours after injection. Plasma homocysteine ​​(d) and cystathionine (e) levels are indicated for each group (n=5-6). For Figures 3D and 3E, ME-200MA0B represents rhCBSΔC enzyme PEGylated with ME-200MA0B, ME-400MA represents rhCBSΔC enzyme PEGylated with ME-400MA, and GL4-400MA represents rhCBSΔC enzyme PEGylated with GL4-400MA.

[0037] FIG. 4 illustrates experimental evidence that interrupting CBS treatment to allow amino acid levels to return to pre-treatment levels and then restarting repeated injections of PEGylated rhCBSΔC significantly affects homocysteine ​​and cystathionine plasma levels and restores normal cysteine ​​levels. Six HO mice were injected with rhCBSΔC PEGylated with GL4-400MA PEG on days 0, 1, 2, 3, and 4, followed by a 10-day washout period and then injected again on days 14, 15, 16, 17, and 18 (arrows). Plasma samples were drawn on the following days (all before injection): days 0, 2, 4, 5, 11, 14, 16, 18, 19, 24, and 31. For comparison, the same injection regimen was performed in five HO mice injected with non-PEGylated enzymes. Plasma metabolite levels were determined as described in Example 1e. FIG. 4a is a graph showing the results of homocysteine ​​plasma concentrations for each HO mouse, and FIG. 4b is a graph showing the results of cystathionine plasma concentrations. FIG. 4c is a graph showing the mean concentrations of homocysteine ​​and cystathionine in the plasma of treated HO mice in this study. FIG. 4d is a graph showing the effect of PEGylated rhCBSΔC on plasma homocysteine ​​levels in this study compared to non-PEGylated rhCBSΔC (expressed as a percentage of 0). GL4-400MA represents rhCBSΔC enzyme PEGylated with GL4-400MA, and rhCBSΔC represents unmodified rhCBSΔC enzyme. FIG. 4e is a graph showing the effect of PEGylated rhCBSΔC on plasma cysteine ​​levels in this study compared to non-PEGylated rhCBSΔC. GL4-400MA represents rhCBSΔC enzyme PEGylated with GL4-400MA, and rhCBSΔC represents unmodified rhCBSΔC enzyme.

[0038] Figure 5 The variability in the extent of aggregation of human truncated CBS preparations (rhCBSΔC) is shown. Figure 5A is a 4-15% native gel stained with Coomassie blue from different batches (112, 13, 7, 27 and 28) of rhCBSΔC. Note the different ratios between the tetrameric form (T) of rhCBSΔC and the dimeric form (D) of rhCBSΔC, as well as higher forms of aggregated CBS. M represents a molecular weight marker. Figure 5 B is the in-gel CBS activity assay of non-denaturing gel, indicating that Figure 5 The bands shown in rhCBSΔC batches 112 and 28 in A are indeed CBS-related. In addition, note the different ratios between the tetrameric form (T) of rhCBSΔC and the dimeric form (D) of rhCBSΔC, as well as higher forms of aggregated CBS. Figure 5 C is a SDS PAGE gel (12%) showing two different rhCBSΔC batches PEGylated with ME-200MA0B (+), indicating different ratios between the two PEGylated species formed after PEGylation (in the PEGylated (+) lanes), while only the unmodified rhCBSΔC subunit is present when no PEG reagent is added (in the non-PEGylated (-) lanes).

[0039] FIG6 shows that the human C15S mutated CBS only forms dimers. Fig. 6A is a non-denaturing gel showing that the C15S mutant CBS forms only dimers, in contrast to the recombinant human truncated CBS (rhCBSΔC) which forms dimers (D) and tetramers (T) and higher oligomeric forms. TCEP, a reducing agent, does not affect the oligomeric state of the C15S mutant. M indicates a molecular weight marker. Figure 6B is a non-denaturing gel showing different batches (51, 60 and 73) of CBS with C15S mutation, demonstrating that human C15S mutant CBS reproducibly forms only dimers, in contrast to rhCBSΔC without PEG (-) and PEGylated with ME-200MA0B (+) and recombinant human double truncation (batch RC-2-76; construct with additional deletion of rhCBSΔC residues 2-39). PEGylation of either C15S or double truncation constructs produced consistent and reproducible bands, with similar ratios between PEGylated bands, in contrast to rhCBSΔC. Using only denaturing SDS PAGE, Figure 6C and Figure 6B C15S produces a reproducible PEGylation pattern that is different from that of recombinant human truncated CBS (rhCBSΔC). This is also consistent with Figure 5 C, showing an irreproducible PEGylation pattern of rhCBSΔC.

[0040] Figure 7 shows that rhCBSΔC ( Fig. 7A ) and C15S mutant ( Figure 7B ). Figure 7 provides additional indication that the C15S mutant CBS exists only as a dimer, as a single peak ( Figure 7B ).Notice Fig. 7A Six different modes of rhCBSΔC in Figure 7B The single peak of C15S CBS in .

[0041] Figure 8 It was shown that continuous administration of the C15S mutant for 20 days in 2 HO mice resulted in a significant and sustained reduction in plasma homocysteine. The C15S mutant enzyme was administered using an ALZET® pump, which was continuously administered to mice in place of repeated subcutaneous injections. The ALZET® pump, model 1002, had an average pump rate of 0.21 μL / hour (stock concentration of 26.2 mg / mL) and an average fill volume of 106.6 ul. Mice were bled at designated time points, and plasma was separated and Hcy was measured by mass spectrometry.

[0042] Fig. 9 Is a bar graph showing the results of an experiment in which HO mice were injected at time zero with a single dose (7.5 mg / kg) of rhCBSΔC, C15S mutant (C15S) and double truncated construct (Double Truncated), which had been pegylated with ME-200MA0B. Mice were bled at time zero (pre-injection) and 24, 48 and 72 hours after injection. Plasma homocysteine ​​levels for each group (n=5-6) are indicated. DETAILED DESCRIPTION OF THE INVENTION

[0043] Provided herein are forms of human cystathionine beta-synthase (CBS) that are particularly suitable for pharmaceutical compositions, and methods for treating individuals with homocystinuria, such as by enzyme replacement therapy (ERT).

[0044] The nucleotide sequence of coding people's CBS and the amino acid sequence encoding it can be obtained from GenBank accession number L19501, and these sequences are also disclosed in U.S. Patent number 5,523,225, which is fully incorporated herein by reference. The coding sequence of CBS is represented as SEQ ID NO: 1 herein, is the nucleotide sequence encoding SEQ ID NO: 2, and SEQ ID NO: 2 is the amino acid sequence of the full-length people's CBS with 551 amino acid residues. The nucleotide sequence of the genomic DNA encoding CBS is also publicly available through sequence databases such as GenBank and the webpage (University of Colorado-Denver webpage under Kraus Lab) of Kraus Laboratory of Colorado-Denver University.

[0045] The isolated truncated forms of cystathionine β-synthase proteins (CBS proteins), especially human CBS proteins, used herein may include, but are not limited to, purified truncated CBS proteins, truncated CBS proteins produced by chemical cleavage and recombination, and isolated CBS proteins associated with other proteins. More specifically, the isolated proteins of the present invention are proteins (including polypeptides or peptides) that have been removed from their natural environment (i.e., have been artificially manipulated) and may include, for example, purified proteins, partially purified proteins, recombinantly produced proteins, and synthetically produced proteins. Therefore, "isolated" does not reflect the degree to which the protein is purified. The isolated truncated CBS protein of the present invention may be produced by recombination in cells such as bacterial cells. In addition, and by way of example, "human truncated CBS protein" refers to a protein from human. (Homo sapiens) The term "human truncated CBS protein" refers to a truncated CBS protein (as described herein) or a CBS protein that has been generated by other means based on knowledge of the structure (e.g., sequence) and possibly the function of a naturally occurring CBS protein from Homo sapiens. In other words, human truncated CBS proteins include biologically active truncated human CBS proteins as described in detail herein.

[0046] As used herein, the term "variant" or "mutant" is used to refer to a protein or peptide that is different from a naturally occurring protein or peptide (i.e., a "prototype" or "wild-type" protein), i.e., by altering a naturally occurring protein or peptide, but which retains the basic protein and side chain structure of the naturally occurring form. Such alterations include, but are not limited to: alterations in one, several, or even several amino acid side chains; alterations in one, several, or several amino acids (e.g., cysteine ​​at position 15 becomes serine; C15S); alterations in one or several atom stereochemistry; and / or minor derivatizations, including, but not limited to: methylation, glycosylation, phosphorylation, acetylation, myristoylation, prenylation, palmitation, amidation, and / or addition of glycosylphosphatidylinositol. A "variant" or "mutant" may have enhanced, reduced, altered, or substantially similar properties compared to a naturally occurring protein or peptide. In a specific embodiment, the present invention provides a truncated CBS protein having a C-terminal deletion of a naturally occurring CBS protein.

[0047] The term "homolog" or "ortholog" as used herein refers to a protein or DNA sequence with a common ancestor, and may be a substantially identical protein or DNA sequence in different species. Homologous and orthologous proteins and genes typically have similar amino acid and nucleotide sequences, or a high degree of sequence similarity (e.g., homologous proteins may have 50%, 60%, 70%, 80%, 90%, 95% or higher amino acid sequence similarity).

[0048] Methods for determining the expression level of CBS protein of the present invention include, but are not limited to, Coomassie blue or silver staining of proteins in a separation medium, such as gel electrophoresis, Western blot, immunohistochemistry, other immunoassays based on immunoassays; assays based on protein properties, including, but not limited to, enzyme assays, ligand binding or interactions with other protein partners. Binding assays are also well known in the art. For example, a BIAcore instrument can be used to determine the binding constant of a complex between two proteins. The dissociation constant of the complex can be determined by monitoring the change in refractive index over time as the buffer passes through the chip. Other suitable assays for determining the binding of one protein to another include, for example, immunoassays such as enzyme-linked immunosorbent assays (ELISA) and radioimmunoassays (RIA), or monitoring changes in the spectroscopic or optical properties of proteins by fluorescence, ultraviolet absorption, circular dichroism or nuclear magnetic resonance (NMR) to determine binding.

[0049] In certain aspects, the CBS variant may include any combination of an N-terminal deletion or modification (e.g., a deletion of N-terminal residues 2-39 or 1-70) and a C-terminal deletion or modification (e.g., a deletion of C-terminal residues 383-551, 397-551, 414-551, 442-551, 489-551, 497-551, 524-551, 534-551, or 544-551), as described herein or in U.S. Pat. Nos. 7,485,307 and 8,007,787, all of which are incorporated herein by reference. In another embodiment, additional modifications may be achieved by modifying other amino acid residues to provide a specified % identity to a wild-type CBS sequence. In a specific embodiment, the human CBS variant of the invention is a truncated recombinant human CBS (rhCBSΔC) homodimeric enzyme in which the C-terminal regulatory region has been removed (SEQ ID NO: 3). In other embodiments, the human CBS variant of the invention is rhCBSΔC wherein the cysteine ​​at amino acid position 15 has been mutated to serine (C15S) (SEQ ID NO: 13).

[0050] In other embodiments of the invention, any CBS variant described herein has no more than one or two non-CBS amino acid residues at the N-terminus (i.e., the variant comprises no more than one or two amino acid residues at the N-terminus that are not residues at that position in the naturally occurring human cystathionine β-synthase amino acid sequence). Such variants can be produced using novel methods for recombinant CBS production, such as those described below.

[0051] In a further embodiment, any of the above-mentioned CBS variants of the present invention, including any truncated CBS proteins, comprises an amino acid sequence having at least about 50% identity, or at least about 55% identity, or at least about 60% identity, or at least about 65% identity, or at least about 70% identity, or at least about 75% identity, or at least about 80% identity, or at least about 85% identity, or at least about 90% identity, or at least about 95% identity, or at least about 96% identity, or at least about 97% identity, or at least about 98% identity, or at least about 99% identity with the wild-type amino acid sequence represented by SEQ ID NO: 2 or a biologically active truncation thereof; in particular including non-heme-binding or non-S-adenosylmethionine (AdoMet) binding, wherein the variant retains catalytic activity (for example, wherein the activity of certain truncated forms of CBS in the presence of AdoMet may even exceed that of the full-length CBS). In a specific embodiment, the human CBS variant of the present invention is a truncated recombinant human CBS (rhCBSΔC) homodimeric enzyme, wherein the C-terminal regulatory region has been removed (SEQ ID NO: 3). In other embodiments, the human CBS variant of the present invention is a truncated recombinant human CBS enzyme, wherein the cysteine ​​at amino acid position 15 has been mutated to serine (SEQ ID NO: 13).

[0052] In certain embodiments, the CBS protein of the invention comprises an amino acid sequence having less than 100% identity to SEQ ID NO: 2, particularly truncated embodiments thereof having the amino acid sequence of a truncated variant given in U.S. Patent No. 8,007,787, and particularly SEQ ID NO: 3 and SEQ ID NO: 13 given herein, and in specific embodiments having less than 99% sequence identity, less than 98% sequence identity, less than 97% sequence identity, less than 96% sequence identity, less than 95% sequence identity, less than 94% sequence identity, less than 93% sequence identity, less than 92% sequence identity, less than 91% sequence identity, less than 90% sequence identity, etc. in an increase of the truncated variant given in U.S. Patent No. 8,007,787, and particularly SEQ ID NO: 3 and SEQ ID NO: 13 given herein.

[0053] Unless otherwise indicated, references to percent identity (% identity) as used herein refer to evaluation of homologs using sequence alignment tools or programs including, but not limited to, (1) BLAST 2.0 Basic BLAST homology searches using blastp for amino acid searches and blastn for nucleic acid searches, using standard default parameters, wherein the query sequence is filtered by default for low complexity regions; (2) BLAST 2 alignments (using the parameters described below); (3) and / or PSI-BLAST, using standard default parameters (position-specific iterative BLAST). Note that because of some differences in standard parameters between BLAST 2.0 Basic BLAST and BLAST 2, two particular sequences may be identified as having significant homology when using the BLAST 2 program, whereas a search using one of the sequences as the query sequence in BLAST 2.0 Basic BLAST may not identify the second sequence as the best match. In addition, PSI-BLAST provides an automated, easy-to-use "profile" search format, which is a sensitive way to find sequence homologs. The program first performs a gapped BLAST database search. The PSI-BLAST program uses the information from any significant alignment to construct a position-specific scoring matrix that is substituted for the query sequence in the next round of database searching. Thus, it should be appreciated that % identity can be determined by using any of these programs.

[0054] CBS derivatives are included within the scope of the present invention. Such derivatives are chemically modified CBS polypeptide compositions in which the CBS polypeptide is connected to a polymer. The selected polymer is typically water soluble so that the protein to which it is connected does not precipitate in an aqueous environment and so that the CBS enzyme is biologically active in a biological fluid, such as a physiological environment. The polymer can be of any molecular weight and can be branched or unbranched. The scope of CBS polypeptide polymers includes polymer mixtures. In specific embodiments, for therapeutic uses of the final product formulation, the polymer will be pharmaceutically acceptable.

[0055] The water-soluble polymer or mixture thereof can be selected from, for example, polyethylene glycol (PEG), monomethoxy-polyethylene glycol, dextran (e.g., low molecular weight dextran, e.g., low molecular weight dextran of about 6 kDa), cellulose, or other carbohydrate-based polymers, poly-(N-vinyl pyrrolidone) polyethylene glycol, propylene glycol homopolymer, polyoxypropylene / ethylene oxide copolymer, polyoxyethylene polyol (e.g., glycerol), polysalicylic acid, and polyvinyl alcohol. The present invention also includes bifunctional PEG cross-linking molecules that can be used to prepare covalently linked CBS polypeptide polymers. In one embodiment, the polyethylene glycol molecule is selected from unbranched and branched polyethylene glycol, wherein the molecular weight of the polyethylene glycol molecule is equal to or greater than 2000 Daltons. In another embodiment, the molecular weight range of the polyethylene glycol molecule is 2-100 kD, 5-80 kD, or 10-40 kD. In yet another embodiment, the polyethylene glycol molecule is selected from ME-200MA0B, ME-020MA, ME-400MA, GL2-400MA, GL4-400MA, GL2-800MA, ME-050GS, ME-200GS, ME-200AL or MEPA-20T.

[0056] In a specific embodiment, the present invention provides a truncated recombinant human CBS (rhCBSΔC) homodimer enzyme, wherein the C-terminal regulatory region has been removed (SEQ ID NO: 3), the enzyme has been chemically modified by covalently linking to polyethylene glycol (PEG), the enzyme includes the "PEGylated species" given herein. In other embodiments of the present invention, the human CBS variant of the present invention is a truncated recombinant human CBS enzyme, wherein the cysteine ​​at amino acid position 15 has been mutated to serine (SEQ ID NO: 13), the enzyme has been chemically modified by covalently linking to polyethylene glycol (PEG), the enzyme includes the "PEGylated species" given herein.

[0057] Specific embodiments of various PEG reagents used in the PEGylation reaction to produce modified PEGylated species are shown in Table 1.

[0058] Table 1

[0059] PEG Name Target Group Molecular weight (Dalton) ME-200MA0B -SH 20,000 ME-020MA -SH 2,000 ME-400MA -SH 40,000 GL2-400MA -SH 40,000 GL4-400MA -SH 40,000 GL2-800MA -SH 80,000 ME-050GS <![CDATA[-NH2, -OH, -OH]]> 5,000 ME-200GS <![CDATA[-NH2, -OH, -SH]]> 20,000 ME-200AL <![CDATA[-NH2]]> 20,000 MEPA-20T -COOH 20,000

[0060] The pegylation of CBS polypeptides can be carried out by any pegylation reaction known in the art. Pegylation can be carried out via an acylation reaction or an alkylation reaction with a reactive polyethylene glycol molecule (or a similar reactive water-soluble polymer) as described below. For acylation reactions, the selected polymer should have a single reactive ester group. For reductive alkylation, the selected polymer should have a single reactive aldehyde group. The reactive aldehyde is, for example, polyethylene glycol propionaldehyde, which is water-stable, or a single C1-C ... 10 Alkoxy or aryloxy derivatives. In one embodiment, the polyethylene glycol molecule is connected to the CBS via a linking group selected from the group consisting of N-hydroxysuccinimide (NHS), amines, and aldehydes consisting of monoaldehydes, monoesters of monoacids, monoamines, monothiols, monodisulfides, monobromophenyl carbonate, monochlorophenyl carbonate, monofluorophenyl carbonate, mononitrophenyl carbonate, monocarbonylimidazole, monohydrazide, monoiodoacetamide, monomaleimide, monoorthopyridyl disulfide, monooxime, monophenylglyoxal, monothiazolidine-2-thione, monothioesters, monotriazines, and monovinyl sulfone.

[0061] One water-soluble polymer used herein is polyethylene glycol, abbreviated as PEG. As used herein, polyethylene glycol is intended to include any form of PEG that has been used to derivatize other proteins, such as mono-(C1-C 10 ) alkoxy- or aryloxy-polyethylene glycol.

[0062] In general, chemical derivatization can be carried out under any suitable conditions for reacting bioactive substances with activated polymer molecules. The method for preparing pegylated CBS polypeptides generally comprises the following steps: (a) reacting the polypeptide with polyethylene glycol (e.g., reactive esters, amines, aldehydes or maleimide derivatives of PEG) under conditions where the CBS polypeptide is connected to one or more PEG groups, and (b) obtaining a reaction product. In general, the optimal reaction conditions for the acylation reaction are determined based on known parameters and the desired results. For example, the greater the ratio of PEG:protein, the greater the percentage of the poly-pegylated product. In a specific aspect, the CBS polypeptide derivative will have a single PEG moiety at the amino terminus. In a specific embodiment, the pegylated CBS enzyme provided by the invention has an average of about 1 to about 10, more particularly 2 to about 5 and more particularly 3 to 5 PEG molecules covalently attached to each enzyme subunit in the composition.

[0063] The proteins of the present invention are preferably recovered, obtained, and / or used in a "substantially pure" form. "Substantially pure," as used herein, refers to a purity that allows the protein to be effectively used in vitro, ex vivo, or in vivo in accordance with the present invention. For a protein to be used in an in vitro, ex vivo, or in vivo method in accordance with the present invention, it is substantially free of contaminants, other proteins, and / or chemicals that may or would interfere with its use in the methods disclosed herein, or that are undesirable at least for the inclusion of CBS proteins (including homologs) when used in the methods disclosed herein. Such methods include enzymatic reactions (e.g., to produce cystathionine), preparation of therapeutic compositions, administration of therapeutic compositions, and all other methods disclosed herein. A "substantially pure" protein as referred to herein is a protein that can be produced by any method (i.e., by direct purification from a natural source, recombinantly, or synthetically) and purified from other protein components such that the protein comprises at least about 80% by weight of the total protein weight in a given composition (e.g., the CBS protein is about 80% protein in a solution / composition / buffer), and more preferably at least about 85% by weight of the total protein weight in a given composition, and more preferably at least about 90%, and more preferably at least about 91%, and more preferably at least about 92%, and more preferably at least about 93%, and more preferably at least about 94%, and more preferably at least about 95%, and more preferably at least about 96%, and more preferably at least about 97%, and more preferably at least about 98%, and more preferably at least about 99% by weight. In embodiments where the CBS protein or a truncated variant thereof is produced in recombinant bacteria, the terms "purified" or "substantially pure" will be understood to include purification from lipopolysaccharide and other pyrogenic compounds.

[0064] Those skilled in the art will appreciate that the use of recombinant DNA techniques can improve the control of expression of transfected nucleic acid molecules by manipulating, for example, the number of copies of the nucleic acid molecule in the host cell, the efficiency of transcription of the nucleic acid molecule, the efficiency of translation of the resulting transcripts, and the efficiency of post-translational modifications. In addition, promoter sequences can be genetically engineered to improve expression levels compared to native promoters.

[0065] Recombinant techniques for controlling the expression of nucleic acid molecules include, but are not limited to, integration of nucleic acid molecules into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitution or modification of transcriptional control signals (e.g., promoters, operators, enhancers), substitution or modification of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of nucleic acid molecules to conform to the codon usage of the host cell, and deletion of sequences that disrupt transcript stability.

[0066] In another aspect, the present invention relates to a method for recombinantly producing and purifying human cystathionine β-synthase. The method comprises the following steps: cloning a nucleic acid sequence encoding a human CBS enzyme or a truncated or mutant variant thereof into an expression vector, the sequence being given in U.S. Patent No. 8,007,787 and in particular SEQ ID NO: 4 herein. In certain embodiments, the human CBS-coding sequence has been modified to utilize optimized codons for expression in microorganisms such as E. coli. In other embodiments, the vector comprises: (a) a cloning site for linking a fusion partner (e.g., glutathione S-transferase or GST) to the nucleic acid sequence to be expressed, and (b) a protease cleavage recognition site for human rhinovirus 3C protease (e.g., available from GE Healthcare, a fusion protein known as PreScission protease) or for a protease using a similar cleavage site for cleaving the fusion partner from the CBS protein after expression of the recombinant fusion protein. As part of the present invention, the expression vector is first genetically modified for the introduction of a CBS-encoding nucleic acid sequence specifically which will result in the expression of a CBS-fusion protein which can be cleaved by the human rhinovirus 3C protease, resulting in a CBS protein having only one additional non-CBS N-terminal amino acid residue. This result is not possible using the unmodified multiple cloning site in commercially available vectors. The CBS-encoding nucleic acid sequence is introduced into the genetically modified vector, the recombinant fusion protein is expressed and purified, using conventional methods or those suitable for CBS production (see, e.g., U.S. Pat. No. 5,635,375). , Ibid.), and finally, the fusion partner and all but the non-CBS amino acid residues are cleaved from the CBS protein, resulting in a highly purified, nearly intact human recombinant CBS protein that is ideal for therapeutic use in humans. In a particularly advantageous embodiment, the nucleotide encoding the human CBS protein is engineered to the codon usage frequency of the recombinant cell that was recombinantly produced. A non-limiting example of such an embodiment is given herein as SEQ ID NO: 4, wherein the CBS-encoding nucleic acid is engineered to be suitable for optimized recombinant expression in E. coli.

[0067] Some aspects of the invention include compositions comprising any of the CBS variants described herein for in vitro production of cystathionine or cysteine ​​to remove or produce hydrogen sulfide in vitro, or for in vivo therapeutic uses (e.g., to treat or prevent homocystinuria and conditions associated therewith). Therefore, another embodiment of the invention relates to a composition comprising an isolated CBS protein and, in particular, a truncated variant thereof as given in U.S. Patent No. 8,007,787 and, in particular, SEQ ID NO: 3 or SEQ ID NO: 13 as described herein. The composition typically also comprises a pharmaceutically acceptable carrier. The composition and its components can be used in any in vitro or therapeutic embodiment of the invention as described herein.

[0068] The "HO" mouse used herein is a new mouse model of traditional homocystinuria, in which the mouse cbs gene is inactivated and expresses low levels of human CBS transgene under the control of the human CBS promoter. The mouse model shows severe elevations in plasma and tissue levels of Hcy, methionine, S-adenosylmethionine, and S-adenosylhomocysteine, accompanied by a decrease in plasma and liver levels of cysteine. See Maclean et al., 2010 Mol. Genet. Metab . 101:153-62).

[0069] The compositions of the invention can be used to generate cystathionine and cysteine ​​in vitro or to treat individuals who may benefit from increased CBS activity (eg, individuals with homocystinuria).

[0070] According to the present invention, "pharmaceutically acceptable carrier" includes a pharmaceutically acceptable excipient and / or a pharmaceutically acceptable delivery vehicle, which is suitable for administering the composition to a suitable in vitro, ex vivo or in vivo site. Suitable in vitro, in vivo or ex vivo sites preferably include any site where the activity of CBS needs to be regulated. A pharmaceutically acceptable carrier is capable of maintaining the protein or recombinant nucleic acid molecule of the present invention in such a form that when the protein or recombinant nucleic acid molecule reaches the target cell or tissue in the culture or individual, the protein or recombinant nucleic acid molecule is able to interact with its target (e.g., a substrate of CBS).

[0071] Suitable excipients of the present invention include excipients or formulations (also referred to herein as non-targeted carriers) that transport or facilitate transport, but do not specifically target the composition to cells. Examples of pharmaceutically acceptable excipients include, but are not limited to, water, phosphate buffered saline, Ringer's solution, glucose solution, serum-containing solutions, Hank's solution, other aqueous physiologically balanced solutions, oils, esters, and glycols. Aqueous carriers may contain appropriate auxiliary substances required to approximate the physiological conditions of the recipient, such as by enhancing chemical stability and isotonicity. The compositions of the present invention can be sterilized and / or lyophilized by conventional methods.

[0072] A class of pharmaceutically acceptable carriers includes controlled release formulations, which can slowly release the compositions of the present invention into individuals or culture media. The controlled release formulations used herein include compounds of the present invention (e.g., proteins (including homologues), antibodies, nucleic acid molecules, or mimetics) in controlled release vehicles. Suitable controlled release vehicles include, but are not limited to, biocompatible polymers, other polymer matrices, capsules, microcapsules, microparticles, push formulations, osmotic pumps (e.g., ALZET® osmotic pumps), diffusion devices, liposomes, lipid spheres, and transdermal delivery systems. Other carriers of the present invention include liquids, which, when administered to individuals, form solids or gels in situ. In a specific embodiment, the carrier is also biodegradable (i.e., bioerodible). When the compound is a recombinant nucleic acid molecule, suitable carriers include, but are not limited to, liposomes, viral vectors, or other carriers, including ribozymes, gold particles, poly-L-lysine / DNA-molecule conjugates, and artificial chromosomes. Carriers containing natural lipids include cells and cell membranes. Carriers containing artificial lipids include liposomes and micelles.

[0073] The carrier of the present invention can be modified to target a specific site of an individual, thereby targeting and using the protein of the present invention for the site. Pharmaceutically acceptable carriers capable of targeting may also be referred to herein as "delivery vehicles" or "targeting vehicles". Suitable modifications include manipulating the chemical formula of the lipid portion of the delivery vehicle and / or introducing a targeting agent capable of specifically targeting the delivery vehicle to a preferred site or target site (e.g., a preferred cell type) into the vehicle. "Target site" refers to a site in an individual to which the composition is desired to be delivered. Alternatively, the pharmaceutically acceptable carrier may include an agent suitable for delivering the CBS protein to the plasma or serum of an animal (preferably a human). Suitable targeting compounds include ligands that can selectively (i.e., specifically) bind to another molecule at a specific site. Examples of such ligands include antibodies, antigens, receptors, and receptor ligands. Manipulating the chemical formula of the lipid portion of the delivery vehicle can adjust the extracellular or intracellular targeting of the delivery vehicle. For example, chemicals can be added to the lipid formula of the liposome, which changes the charge of the lipid bilayer of the liposome, allowing the liposome to fuse with specific cells having specific charge characteristics. In specific embodiments, the liposomes of the present invention include those liposomes known to those skilled in the art that are commonly used in, for example, protein delivery methods. Complexing liposomes with the proteins of the present invention can be achieved using standard methods in the art.

[0074] In another aspect, the present invention relates to a method for regulating biological processes including cystathionine production by regulating the expression and / or activity of CBS. This embodiment may generally include using (e.g., administering) a therapeutic composition comprising one or more CBS variants, particularly truncated CBS variants thereof as provided in U.S. Patent No. 8,007,787 and particularly SEQ ID NO: 3 or SEQ ID NO: 13 as described herein, which may be used in a method for regulating cystathionine production, which may be mediated by or related to the expression and biological activity of CBS.

[0075] Thus, in one embodiment, the methods of the invention modulate cystathionine production in animal and human subjects, wherein the subject is protected from or treated for a disease associated with modulation of cystathionine production, such as homocystinuria and conditions / symptoms associated therewith (e.g., ectopic eye lenses, skeletal disorders, mental retardation, and premature arteriosclerosis and thrombosis). As used herein, the phrase "protection...from a disease" refers to reducing the symptoms of a disease; reducing the incidence of a disease, and / or reducing the severity of a disease. Protecting a subject may refer to the ability of the therapeutic compositions of the invention to prevent the occurrence of a disease and / or cure or treat a disease by alleviating the symptoms, signs, or causes of a disease when administered to a subject. Thus, protecting a subject from a disease includes both preventing the occurrence of a disease (prophylactic treatment) and treating a subject who has a disease or is experiencing the initial symptoms or late symptoms of a disease (therapeutic treatment). The term "disease" refers to any deviation from normal health of a subject and includes states when symptoms of a disease are present, as well as states where deviations have occurred (e.g., including, in non-limiting examples, infections, genetic mutations, and genetic defects, etc.), but symptoms have not yet manifested (e.g., pre-disease conditions).

[0076] More specifically, the therapeutic compositions described herein, when administered to an individual by the methods of the invention, preferably produce a result that can include alleviation of the disease (e.g., reduction of at least one symptom or clinical manifestation of the disease), elimination of the disease, alleviation of a secondary disease resulting from the occurrence of the primary disease, or prevention of the disease. In other aspects, administration of the therapeutic composition can produce a result that can include increasing the accumulation of a downstream metabolite of transsulfuration in a mammal.

[0077] According to the present invention, an effective dosing regimen (i.e., administering a therapeutic composition in an effective manner) includes appropriate dosage parameters and modes of administration that produce a desired effect in an individual (e.g., an increase in cystathionine β-synthase activity or an increase in the condensation of serine and homocysteine ​​to form cystathionine in an individual), preferably protecting the individual from disease (e.g., by disease prevention or by alleviating one or more symptoms of an ongoing disease). Effective dosage parameters can be determined using standard methods in the art for specific diseases. Such methods include, for example, determining survival rates, side effects (i.e., toxicity), and progression or regression of the disease.

[0078] According to the present invention, a suitable single dose size is a dose that, when administered once or multiple times over a suitable time period, results in an increase in CBS activity in an individual with normal protein intake or a dose that controls Hcy levels or cystathionine or cysteine ​​formation in an individual, or a dose that results in an improvement in at least one symptom of an individual's condition. The dose may vary, depending on the disease being treated. A person skilled in the art can easily determine a suitable single dose size for a given individual, based on individual size and route of administration.

[0079] In certain embodiments of the present invention, a suitable single dose of the therapeutic composition of the present invention is such an amount that when administered by any route of administration, compared to an individual not administered with the therapeutic composition of the present invention (i.e., a predetermined control individual or assay), compared to an individual before administration of the composition, or compared to a standard established for a specific disease, individual type, and composition, the amount increases CBS activity as described above. The administered therapeutic composition has enzymatic activity over an extended period of time. The period is preferably more than 24 hours. The chemically modified therapeutic composition retains 70% or more of the initial activity of the administered composition after 24 hours. More preferably, the enzymatically effective activity period of the administered therapeutic composition exceeds 48 hours. Even more preferably, the enzymatically effective activity period of the administered therapeutic composition exceeds 72 hours. In certain embodiments, the therapeutic composition can be administered several times (e.g., 2 times, 3 times or more) or less frequently per day, including but not limited to once a week, once every two weeks, once a month, once every two months, or less frequently. In other embodiments, the therapeutic composition can be administered continuously for several days, weeks, or months. In another embodiment of the invention, a suitable dose of the therapeutic composition of the invention may be administered in combination with a betaine (e.g., CYSTADANE®), a more relaxed protein restriction diet, an anticoagulant, or a statin.

[0080] As described above, the therapeutic composition of the present invention is administered to an individual in a manner that effectively delivers the composition to the cell, tissue and / or system of the individual, thereby achieving the desired result of administering the composition. Suitable administration regimens include any in vivo or ex vivo administration regimen. The preferred route of administration is apparent to those skilled in the art and depends on the type of condition to be prevented or treated; whether the composition is nucleic acid-based, protein-based or cell-based; and / or the target cell / tissue. For proteins, in vivo administration methods include parenteral administration, especially including but not limited to osmotic pump administration, intravenous administration, intraperitoneal administration, intramuscular administration, intrasegmental administration, intracoronary administration, intraarterial administration (e.g., to the carotid artery), subcutaneous administration, intraarticular administration, intraventricular administration, and direct injection into tissues. A combination of delivery routes can be used, and in some cases such combinations can enhance the therapeutic effect of the composition.

[0081] Many of the above routes of administration, including intravenous, intraperitoneal, intradermal, intramuscular administration or via osmotic pumps, can be accomplished using methods standard in the art.

[0082] One method of local administration is by direct injection. Direct injection techniques are particularly useful for administering the composition to cells or tissues that are accessible by surgery, and especially on or near the body surface. Local administration of the composition into the target cell area refers to injecting the composition a few centimeters, and preferably a few millimeters, from the target cell or tissue.

[0083] Another method of local administration is by using one or more osmotic pumps (e.g., ALZET® osmotic pumps), which allow for stable delivery of the drug over an extended period of time (e.g., weeks or months). Implanted osmotic pumps are particularly useful for delivering the composition to cells, tissues, or subjects that are accessible by surgery, and especially on or near the body surface. Topical administration of the composition to a target cell or tissue region of a subject refers to implanting an osmotic pump containing the composition a few centimeters, and preferably a few millimeters, from the target cell or tissue.

[0084] In the methods of the present invention, the therapeutic composition may be administered to any member of the vertebrate class of mammals, including but not limited to primates, rodents, livestock, and pets. Livestock include mammals for consumption or mammals for producing useful products (e.g., sheep for wool production). Preferred individuals in need of protection include humans.

[0085] Some aspects of the invention include the use of an isolated CBS polypeptide or any of the CBS variants described herein for the preparation of non-aggregating CBS derivatives.

[0086] Each reference described and / or cited herein is hereby incorporated by reference in its entirety.

[0087] The following examples are provided for illustrative purposes and are not intended to limit the scope of the present invention. Example

[0088] Example 1: Production of truncated CBS protein in bacteria

[0089] a. Recombinant expression of truncated CBS protein in bacteria

[0090] A truncated human CBS variant lacking a specific portion of the non-conserved region (rhCBSΔC; SEQ ID No: 3) was constructed and overexpressed using a previously described E. coli based expression system (Kozich and Kraus, 1992, supra). The construct encoding the truncated human CBS protein variant rhCBSΔC (DNA encoding rhCBSΔC is shown in SEQ ID NO: 4) was constructed by modifying a previously described pHCS3 CBS expression construct (Kozich and Kraus, 1992, supra). Hum. Mutat. 1:113-123) to generate, the construct contains the CBS full-length coding sequence cloned into pKK388.1 (SEQ ID NO: 1). In order to generate the C-terminal deletion construct, the CBS cDNA fragment spanning the desired nucleotide residues was amplified using primers that incorporated Sph I and Kpn I sites into the 5' and 3' ends of the PCR product, respectively. All PCR products were then cut open using Sph I and Kpn I and cloned by ligating to the pHCS3 vector digested with Sph I and Kpn I. There is a natural Sph I site in the CBS cDNA, just upstream of the antisense primer hybridization site (base pair position 1012, according to CBS cDNA numbering SEQ ID NO: 1). The PCR product thus generated was then digested using Nco I and Sph I and ligated to the pHCS3 plasmid cut open with the same enzymes.

[0091] pKK CBS Δ414-551

[0092] Sense: 5'-CGTAGAATTCACCTTTGCCCGCATGCTGAT (SEQ ID NO: 5)

[0093] ( The SphI restriction site is in bold )

[0094] Antisense: 5'-TACGGGTACCTCAACGGAGGTGCCACCACCAGGGC (SEQ ID NO: 6)

[0095] ( The KpnI restriction site is in bold )

[0096] Finally, the construct was transformed into E. coli BL21 (Stratagene). The authenticity of the construct was verified by DNA sequencing using the Thermo Sequenase Cy5.5 sequencing kit (Amersham Pharmacia Biotech) and the Visible Genetics Long-Read Tower System-V3.1 DNA sequencer according to the manufacturer's instructions.

[0097] Bacterial expression analysis of CBS deletion mutants was performed as previously described (Maclean et al., 2002, Hum. Mutat. 19:641-55), E. coli BL21 cells containing CBS truncation mutant constructs were cultured, expression was induced and crude cell lysates were produced.

[0098] An alternative approach was also used to prepare a sequence-optimized, truncated human CBS enzyme (rhCBSΔC; SEQ ID No: 3) in the pET28a (+) vector. The full-length (551 aa) human CBS coding sequence was optimized for bacterial expression and cloned into the pUC57 vector, which was then expressed using a commercially available commercial kit from GenScript USA Inc. (NJ, USA). Eco RV restriction enzyme digestion. The CBS sequence was then amplified by PCR using primers A1 and A2 to generate a sequence encoding a truncation enzyme (aa 1-413):

[0099] Primers:

[0100] A1

[0101] 5' agtcgc CCATGGcgtcagaaacccgcag 3' (SEQ ID NO: 7)

[0102] The NcoI restriction site is in the cap (CAP). The bold G is mutated to a C (for proline).

[0103] A2

[0104] 5' atcgcg CTCGAGttagcgcaggtgccaccac 3’ (SEQ ID NO: 8)

[0105] The XhoI restriction site is in the cap (CAP), followed by TTA, the stop codon.

[0106] The PCR product was then cleaved with restriction enzyme Nco I and XOt I digested and ligated into pET-28a(+) vector (available from EMD Millipore, Billerica, MA) that had been digested with the same enzyme. Nco I site, compared to the CBS wild-type sequence, results in a G→C mutation (encoding alanine instead of proline). Therefore, a site-directed mutagenesis kit (Stratagene, CA, USA) using primers B1 and B2 was used to regenerate the wild-type sequence to encode proline:

[0107] B1

[0108] 5' GGAGATATACCATGCcgtcagaaacccgc 3' (SEQ ID NO: 9)

[0109] B2

[0110] 5' GCGGGGTTTCTGACGGCATGGTATATCTCC 3' (SEQ ID NO: 10)

[0111] The same strategy was used to generate the C15S mutant (T→A mutation) by using primers:

[0112] C1 5'-TGGGTCCGACGGGT A GCCCGCAC -3' (SEQ ID NO: 11) and

[0113] C2 5'-GTCGGGC T ACCCGTCGGACCCA - 3' (SEQ ID NO: 12).

[0114] The complete sequences of the optimized rhCBSΔC and C15S mutant polynucleotide constructs were confirmed by sequencing.

[0115] In the pET-28a(+) vector, the expression of the truncated CBS is controlled by the upstream T7 promoter and needs to be transformed into DE3 bacteria and induced by IPTG.

[0116] b. Expression of sequence-optimized, truncated human CBS enzyme

[0117] The pET-28a(+) vector carrying the sequence encoding the truncated human CBS was transformed into DE3 bacteria, i.e. HMS174(DE3) or BL-21(DE3), and kanamycin-resistant clones were selected and maintained as stock glycerol at -80°C for further use.

[0118] Grow bacteria from a glycerol stock overnight at 37°C in 5 ml Luria-Bertani (LB) medium containing 30 ug / ml kanamycin on a rotary shaker at 275 RPM. The next morning, add 1 ml of the overnight culture to 100 ml Terrific Broth (TB) medium containing 30 ug / ml kanamycin and grow overnight as above. Add 10 ml of the overnight culture to 1 liter of TB medium containing the following supplements:

[0119] 0.001% Thiamine HCl pH 8.0

[0120] 0.0025% Pyridoxine HCl pH 8.0

[0121] 0.3 mM δ-(Aminolevulinic acid) (δ-ALA) pH 8.0

[0122] 150 µM Ferric Chloride

[0123] 30 ug / ml kanamycin

[0124] The 1 liter culture was then grown at 30°C on a rotary shaker at 275 RPM until the OD 600 The value reached ~0.6-0.7 and protein expression was induced by adding 1 mM IPTG. The fermentation was continued for an additional 16 hours. The cells were then harvested by centrifugation at 6000 RCF for 10 minutes at 4°C, washed with ice-cold 0.9% NaCl, centrifuged again as above, and frozen at -80°C.

[0125] For each gram of pellet, an aliquot of 4.45 ml of lysis buffer (20 mM NaH2PO4, pH=7.2, 40 mM NaCl, 0.1 mM PLP) was added to the cell pellet and then homogenized in a Dounce homogenizer until no cell clumps were visible. The homogenate was then treated with lysozyme (final 2 mg / ml), incubated at 4°C on a rocking platform for 1 hour, sonicated to reduce viscosity, and centrifuged at 53,000 RCF. The supernatant containing the soluble fraction was then stored at -80°C.

[0126] Expression levels were confirmed by gel electrophoresis followed by Coomassie gel staining, and specific activity was determined by radioactivity assay.

[0127] c. CBS determination

[0128] The radioisotope assay was performed as described previously using [ 14 C]serine was used as the labeled substrate to measure CBS activity (Kraus, 1987, Methods Enzymol . 143,388-394). Protein concentration was determined by the Bradford procedure (Bradford, 1976, Anal. Biochem. 72, 248-254) using bovine serum albumin (BSA) as a standard. One unit of activity was defined as the amount of CBS that catalyzes the formation of 1 µmol of cystathionine in 1 hour at 37°C.

[0129] d. Denaturing and native polyacrylamide gel electrophoresis and protein blotting

[0130] As previously described (Majtan et al., 2010 J Biol Chem . 2010;285(21):15866-73), Western blot analysis of CBS samples was performed under denaturing and non-denaturing conditions.

[0131] e. Determination of plasma metabolites

[0132] Essentially according to Allen et al. (1993, Serum betaine N, N-dimethylglycine and N-methylglycine levels in individuals with cobalamin and folate deficiency and related inborn errors of metabolism), Metabolism 42: 1448–1460), a stable isotope dilution liquid chromatography-mass spectrometry method was used to determine the levels of sulfur-containing amino acid metabolites in mouse plasma.

[0133] Example 2

[0134] After PEGylation of rhCBSΔC, the plasma retention time in vivo was increased.

[0135] In order to evaluate the retention time and activity of rhCBSΔC in the blood circulation, experiments were performed in which C57BL / 6J mice were injected with 5 mg / kg body weight of rhCBSΔC via intraperitoneal (IP), intravascular (IV) or subcutaneous (SQ) routes. In order to avoid excessive bleeding, 5 mice from each of two experimental groups (referred to as 1 and 2) were used for each injection route (total n=30). For each injection route, blood was collected from group 1 at 0, 1, 8 and 24 hours after injection, and from group 2 at 1, 4, 10 and 48 hours after injection. Animals were bled under the mandible by a disposable lancet and blood was collected into Capiject T-MLHG lithium heparin (12.5 IU) tubes containing gel (Terumo Medical Corporation, NJ, USA). Each tube was then centrifuged at 1200G for 10 min, and then plasma was collected into 1.5 ml tubes and stored at -80°C.

[0136] Plasma CBS activity was analyzed using the radioactivity assay method given in Example 1. CBS enzyme activity at the indicated time points for injected enzyme is shown in Table 1. Figure 1 a. Peak activity was recorded at 1 hour post-injection for the IP and IV routes, and at 4 hours post-injection for the SQ route due to slower release from the SQ compartment into the circulation. Interestingly, activity was comparable for all routes of injection at 8-10 hours post-injection, with almost no activity at 24-48 hours post-injection.

[0137] To monitor whether the clearance of rhCBSΔC from the circulation could contribute to the rapid loss of in vivo activity as shown above, plasma proteins from two representative mice from each group were separated by electrophoresis, transferred to PVDF membranes and reacted with anti-human CBS antibodies to track the clearance of CBS from the circulation. Figure 1 As shown in (b), the gradual clearance of rhCBSΔC from the circulation occurs over time after injection, with no enzyme detectable as early as 24 h after injection. Thus, the clearance of rhCBSΔC contributes to the observed rapid loss of in vivo activity.

[0138] To extend the retention time of rhCBSΔC, the enzyme was modified with polyethylene glycol (PEG) molecules (PEGylated) using ME-020MA or GL4-400MA PEG. Activated PEG derivatives were purchased from NOF Corporation (Tokyo, Japan). PEGylation was performed according to the manufacturer's instructions. For example, coupling of PEG maleimide derivatives to SH groups of CBS (5 mg / ml) was performed overnight at 4°C in 100 mM phosphate buffer (pH = 6). The molar ratio of PEG molecules to CBS protein was 10:1 or 5:1, depending on the activated PEG derivative.

[0139] To evaluate the activity of PEGylated rhCBSΔC, C57BL / 6J mice were injected with 5 mg / kg body weight of ME020MA- or GL4-400MA-PEGylated rhCBSΔC or non-PEGylated rhCBSΔC via the SQ route. Each treatment included 2 groups of 5 mice each (30 mice in total) which were bled as described above. Plasma CBS activity was analyzed using the radioactivity assay given in Example 1. Significant activity was detected for both forms of the PEGylated enzyme at 24 and 48 h after injection, with a peak activity of GL4-400MA-PEGylated rhCBSΔC at 24 h, as shown in Table 1. Figure 1 c. This is in sharp contrast to non-PEGylated rhCBSΔC, which showed low or no activity at these same time points. These results indicate that PEGylation of the rhCBSΔC enzyme is effective in prolonging its activity both in vitro and in vivo.

[0140] Example 3

[0141] A repeated injection regimen with PEGylated, but not non-PEGylated rhCBSΔC, showed that CBS activity accumulated in vivo.

[0142] The rapid clearance of the protein from the circulation can be ignored by increasing the number of injections to maintain a high plasma concentration. Therefore, a repeated injection schedule was tested with non-PEGylated and PEGylated rhCBSΔC. Figure 2 C57BL / 6J mice were injected with 5 mg / kg body weight of non-PEGylated rhCBSΔC (n=5) or GL4-400MA rhCBSΔC (n=5) and bled at the indicated time points. Plasma CBS activity was analyzed by the radioactivity assay described in Example 1. Figure 2 As shown, repeated injections of the non-PEGylated enzyme did not result in accumulation of enzyme activity in the circulation, resulting in almost no activity 24 hours after each injection. In contrast, the activity of the PEGylated enzyme peaked after two injections and reached a plateau.

[0143] Example 4

[0144] A single injection of PEGylated rhCBSΔC decreased homocysteine ​​and increased cystathionine in plasma.

[0145] The foregoing examples were performed in wild-type mice and focused on the characterization of the clearance and activity of injected rhCBSΔC, as well as the comparison between PEGylated and non-PEGylated enzymes. Once it was determined that PEGylation prolonged circulation time, a different panel of PEGylated CBS enzyme molecules was first tested in wild-type mice and then evaluated in a mouse model of homocystinuria.

[0146] A panel of rhCBSΔC enzymes modified with different PEG molecules were tested in wild-type mice to determine the optimal PEGylation strategy. 27 C57BL / 6J mice were divided into 9 experimental groups (n=3). Each experimental group was injected via the SQ route with 5 mg / kg body weight of rhCBSΔC PEGylated with the PEG molecules specified in Figure 3, or with non-PEGylated enzyme. Blood samples were taken at the time points indicated in Figure 3 and the activity of the PEGylated rhCBSΔC was determined using the radioactivity assay given in Example 1. Data are shown in Table 1. Figure 3A , as a histogram, with standard deviation (STD), and as a scatter plot. In general, PEGylation with higher molecular weight PEGs (GL2800MA, 80 kDa; ME-400MA and GL2-400MA, 40 kDa; and ME200-MA0B, 20 kDa) resulted in greater exposure than observed with PEGylation of molecules less than 20 kDa in size, and PEGylation using chemistries targeting cysteine ​​residues (referred to as "MA" to indicate the use of maleimide reactive groups) generally resulted in greater exposure than observed with PEGylation of other chemistries.

[0147] In addition to the aforementioned research on HO mice, the daily fluctuations of homocysteine, cystathionine, cysteine ​​and methionine were measured in these mice to determine the daily changes of these amino acids in these animals. Therefore, 6 HO mice were drawn blood at the time points specified in Figure 3 B within a 24-hour cycle and the plasma metabolite levels were measured at each specified time point. As shown in Figure 3 B, the levels of cystathionine and cysteine ​​are mostly constant within a 24-hour cycle. Homocysteine ​​and methionine levels tend to decrease from 7:00 in the morning to the early morning-afternoon. This is consistent with the animals of eating at night and lacking the homocysteine ​​metabolic capacity via the transsulfurization pathway. Therefore, all injections and bloodletting were carried out at 15:00 (3PM), when the Hcy level was the lowest, thereby determining whether treatment causes the further reduction of Hcy and other metabolites.

[0148] The molecular weight and specific activity (SA) of PEGylated rhCBSΔC were the main properties to be characterized. Figure 3C After PEGylation with GL4-400MA (lane 2), GL4-400MA (lane 2), or ME-200MA0B (lane 3), the products were separated by electrophoresis on a 12% SDS-PAGE gel and compared with the non-PEGylated enzyme (lane 4). The resulting gel was stained with Coomassie blue. The SA (U / mg) of each PEGylated and non-PEGylated rhCBSΔC was shown in Figure 2. Figure 3C As shown in the attached table. As shown, PEGylation has no significant effect on the SA value and the enzyme still retains the same activity as before PEGylation. Pegylation of rhCBSΔC under the conditions used in this experiment produced di- and tri-pegylated rhCBSΔC based on the apparent molecular weight.

[0149] The overall goal of the experiments described in this article was to evaluate the pharmacodynamic parameters of the administered PEGylated rhCBSΔC. Particular emphasis was placed on reducing plasma homocysteine ​​and increasing plasma cystathionine in an animal model of homocystinuria with CBS deficiency. HO mice fed a normal mouse diet were selected as a model system for testing such enzyme replacement therapies (ERT). HO mice were given a single injection of rhCBSΔC PEGylated with PEG molecules (GL4-400MA, ME-400MA, ME-200MA0B) at time zero and bled at time zero (before injection), 24, 48, and 72 hours. Plasma homocysteine ​​(Figure 3D) and cystathionine ( Figure 3E As shown in Figure 3D, for each PEGylated form used, homocysteine ​​levels were significantly reduced compared to time zero, and cystathionine levels ( Figure 3E) increased by approximately 6 to 7 fold. Thus, it was found that administration of PEGylated rhCBSΔC in vivo significantly and robustly affected homocysteine ​​and cystathionine levels.

[0150] Example 5

[0151] Repeated injections of PEGylated rhCBSΔC significantly affected homocysteine ​​and cystathionine plasma levels and restored normal cysteine ​​levels.

[0152] A repeated injection protocol with a washout period was performed as follows to compare the ability of non-PEGylated and PEGylated rhCBSΔC to reduce and maintain low levels of homocysteine ​​and increase cystathionine and cysteine ​​levels. Six HO mice were injected (arrows, Figure 4) with GL4-400MA PEG-PEGylated rhCBSΔC on days 0, 1, 2, 3 and 4, followed by a 10-day washout and then injected again on days 14, 15, 16, 17 and 18. Plasma samples were extracted at the time points shown in Figure 4 (always before injection). For comparison, the same injection protocol was performed in 5 HO mice injected with non-PEGylated enzymes. Plasma metabolite levels were determined by stable isotope dilution liquid chromatography-mass spectrometry as described in Example 1e. Plasma concentrations of homocysteine ​​(results shown in Figure 4a) and cystathionine (Figure 4b) are indicated for each mouse. The mean values ​​of homocysteine ​​and cystathionine for each experimental group are also given (in Figure 4c). As shown in Figures 4a-4c, the mean homocysteine ​​concentration decreased from 182 µM to 38 µM within 48 hours and remained at low values ​​for a whole week. Cystathionine started from a starting point of 4.7 µM at time zero, reached a concentration of 42 µM at 48 hours and remained at high values ​​for the first week. During the washout period, the metabolites returned to their starting values. Subsequent CBS injections again resulted in a sharp drop in homocysteine ​​levels and an increase in cystathionine levels. Then, again, cessation of treatment resulted in the return of these parameters to untreated levels.

[0153] The effect of PEGylated rhCBSΔC on plasma homocysteine ​​levels was also determined compared to non-PEGylated rhCBSΔC, as shown in Figure 4d as a percentage at time zero. Figure 4d illustrates that when blood samples were taken 24 hours or more after injection, the non-PEGylated enzyme had no significant effect on homocysteine ​​concentrations compared to PEGylated rhCBSΔC. This is consistent with the results shown in Examples 2 and 3, which showed that the non-PEGylated enzyme was rapidly cleared from the circulation, with no significant activity present at 24 hours and 48 hours after injection.

[0154] The effect of PEGylated rhCBSΔC on plasma cysteine ​​levels was also determined using the same experimental method compared to non-PEGylated rhCBSΔC. Figure 4EAs shown, during the injection of the PEGylated enzyme, cysteine ​​levels normalized (doubled compared to time zero), whereas no changes in cysteine ​​levels were observed with the non-PEGylated enzyme.

[0155] These results indicate that administration of PEGylated rhCBSΔC enzyme to HO mice via SQ significantly and robustly affected homocysteine ​​and cystathionine concentrations and simultaneously restored cysteine ​​levels to their normal values. The latter experimental results indicate activation of the intracellular transsulfuration pathway following administration of rhCBSΔC.

[0156] Example 6

[0157] Variability in aggregation of human truncated CBS preparations (rhCBSΔC).

[0158] Different batches (112, 13, 7, 27 and 28) of rhCBSΔC were run on native PAGE gels (4-15%, ie without the addition of denaturing agents such as sodium dodecyl sulfate). Figure 5 The results shown in A show that different preparations have different proportions of tetramer (T) and dimer (D), and higher forms of aggregated CBS. In-gel CBS activity was determined by electrophoresis on protein samples at 4°C in a non-denaturing polyacrylamide gel (stained with activity). Figure 5 B). The gel is then immersed in activity staining solution (see Table A) and incubated at 37°C for approximately 15 minutes. After approximately 15 minutes, a dark gray band (~45 kDa dimer of the 1-413 CBS species) appears, depending on the amount loaded. Tetramers are visible after much longer times; up to 1 hour or overnight at room temperature. Non-denaturing gels, such as Figure 5 As shown in B, the bands of tetramer (T), dimer (D) and other higher aggregation forms of rhCBSΔC were confirmed, indicating that Figure 5 Batches 112 and 28 in A are CBS related.

[0159] Table A. Active staining solutions

[0160]

[0161] SDS PAGE analysis of batches 28 and 112 and their PEGylated products showed that the rhCBSΔC batches PEGylated with ME-200MA0B showed different ratios between the two PEGylated bands (P) formed after PEGylation (see Figure 5 C) Thus, tools were found to reduce aggregation and increase reproducibility.

[0162] Example 7

[0163] Human C15S mutant CBS only forms dimers.

[0164] The cysteine ​​at position 15 of rhCBSΔC is uncoupled and was therefore considered a possible factor contributing to aggregate formation. Therefore, a new recombinant plasmid was prepared for the production of rhCBSΔC mutant protein, referred to herein as C15S. The same strategy used to prepare rhCBSΔC in Example 1b was used to produce the C15S mutant CBS enzyme (T to A nucleotide mutation) by using primers:

[0165] C1 5'-TGGGTCCCGACGGGTAGCCCGCAC – 3' (SEQ ID NO: 11) and

[0166] C2 5' - GTGCGGGCTACCCGTCGGACCCA - 3' (SEQ ID NO: 12).

[0167] The complete nucleotide sequence of the C15S mutant CBS truncation enzyme was confirmed by nucleotide sequencing (SEQ ID NO: 14).The same method described in Example 1 for recombinant human CBS truncation was used for the expression and isolation of the C15S mutant CBS enzyme.

[0168] The native PAGE of the separated C15S CBS enzyme demonstrated that C15S CBS exists only as a dimer (see Fig. 6A ), which is different from the results obtained for the recombinant human truncated CBS (rhCBSΔC), which forms dimers (D) and tetramers (T), as well as higher oligomers. Multiple batches of C15S mutant CBS (51, 60 and 73) and recombinant human double truncation (batch RC-2-76) demonstrated that both of them only form dimers, which is different from the recombinant human truncated CBS (rhCBSΔC) (see Figure 6B ). C15S pegylated with ME-200MA0B produced consistent and reproducible bands with similar ratios between the pegylated bands. Denaturing SDS PAGE showed that C15S produced a reproducible pegylation pattern that was similar to that of the recombinant human double truncation (lot RC-2-76) and both of which were different from the pattern obtained using recombinant human truncated CBS (rhCBSΔC) ( Figure 6C ). This is also related to Figure 5 C, showing a non-reproducible rhCBSΔC PEGylation pattern.

[0169] HPLC size exclusion chromatography of CBS preparations was performed. Recombinant human truncated CBS (rhCBSΔC) ( Fig. 7A ) and C15S mutant ( Figure 7B) were both separated on a Yarra SEC-3000, 300 x 7.8 mm size exclusion column (Phenomenex, CA, USA). The column was calibrated and operated in 100 mM sodium phosphate pH = 6.8 at room temperature with a flow rate of 1 ml / min. Figure 7 shows that rhCBSΔC ( Fig. 7A ) and C15S mutant ( Figure 7B These analyses provided additional evidence that the C15S mutant CBS existed only as a dimer, since a single peak was reproducible for 5 different batches (see Figure 7B ). For comparison, note Fig. 7A The 6 different modes of rhCBSΔC and Figure 7B The single peak of the C15S mutant CBS in .

[0170] Example 8

[0171] Continuous administration of PEGylated C15S for 20 days in 2 HO mice resulted in a decrease in plasma homocysteine.

[0172] The ALZET® osmotic pump allows for stable, controlled delivery of the C15S enzyme over extended periods of time. The C15S CBS enzyme was administered using an ALZET® pump (Micro-osmotic ALZET® pump, Model 1002. Lot No. 10268-12) to provide continuous delivery of the C15S CBS enzyme to mice, replacing repeated subcutaneous injections. In these experiments, the average pump rate was 0.21 ul / hr; the average fill volume was 106.6 ul; and the pump was loaded with approximately 106 ul of PEGylated C15S CBS enzyme at a concentration of 26.2 ug / ul. Continuous administration of C15S CBS for 20 days in 2 HO mice resulted in an initial significant reduction in plasma homocysteine ​​and a subsequent sustained reduction (see Figure 8 ).

[0173] To reduce pain before and after the procedure, animals received TYLENOL® (2 mg / ml) in their water bottles ad libitum for 48 hours before and after surgical implantation of the ALZET® pump. In addition, animals were given carprofen 5 mg / kg subcutaneously every 24 hours for 48 hours prior to surgery.

[0174] For animal anesthesia and surgery, isoflurane was administered by inhalation. Mice were induced with 5% isoflurane and maintained at 2-3%. While the mice were anesthetized, they each received the implantation of a medical grade ALZET® osmotic pump under sterile conditions in a biosafety cabinet. The pump was implanted subcutaneously in an area of ​​loose skin on the ventral side of the neck. Prior to implantation of the pump, the mice were shaved and skin prepared with BETADINE®. Implantation of the pump requires a small surgical incision (5 mm) made with sterile scissors. The incision was closed with wound clips. The clips were removed after 1 week when the skin was completely healed. Just before and during the implantation of the pump, the mice were placed in a plastic bag and placed in a plastic bag. Figure 8 At the indicated times, blood samples were collected for determination of homocysteine ​​levels. The results indicate that this mode of administration reduces homocysteine ​​levels in a manner similar to that achieved by daily rhCBSΔC administration. Similar experiments were performed using non-pegylated C15S mutant CBS, resulting in no significant reduction in Hcy plasma levels (results not shown).

[0175] Example 9

[0176] Comparison of three PEGylated truncated human CBS enzymes.

[0177] Fig. 9 It is a bar graph showing the results of an experiment in which HO mice were injected with a single dose (7.5 mg / kg) of rhCBSΔC, C15S mutant (C15S) and double truncated construct (double truncation) at zero time, which was pegylated with ME-200MA0B. Mice were bled at zero time (before injection) and 24, 48 and 72 hours after injection. The plasma homocysteine ​​levels of each group (n=5-6) are indicated. The results show that all 3 enzyme forms result in a considerable reduction in Hcy plasma concentrations.

[0178] Table 2: CBS sequences

[0179]

[0180]

[0181]

[0182] Having described the present invention in detail and with reference to its specific embodiments, it is apparent that modifications and variations are possible without departing from the scope of the present invention as defined in the appended claims. More specifically, although some aspects of the present invention are considered to be particularly advantageous herein, it is contemplated that the present invention need not be limited to these specific aspects of the present invention. <110> Colorado State University Council Kraus, Jan P Majtan, Tomas Bublil, Erez <120> Cystathionine beta-synthase for treating homocystinuria <130> 11-1309-WO <140> PCT / US2014 / 013602 <141> 2014-01-29 <150> US 61 / 758,138 <151> 2013-01-29 <150> US 13 / 803,804 <151> 2013-03-14 <160> 16 <170> PatentIn version 3.5 <210> 1 <211> 1656 <212> DNA <213> Homo sapiens <400> 1 atgccgtcag aaaccccgca ggcagaagtg ggtccgacgg gttgcccgca ccgtagcggt 60 ccgcattctg caaaaggcag tctggaaaaa ggttccccgg aagataaaga agccaaagaa 120 ccgctgtgga ttcgtccgga cgcaccgtca cgctgtacct ggcagctggg tcgtccggca 180 agcgaatctc cgcatcacca tacggctccg gcgaaaagtc cgaaaattct gccggatatc 240 ctgaagaaaa ttggtgacac cccgatggtt cgtatcaaca aaatcggcaa aaaattcggt 300 ctgaaatgcg aactgctggc taaatgtgaa tttttcaatg cgggcggttc cgtgaaagat 360 cgtatctcac tgcgcatgat tgaagatgct gaacgcgacg gcaccctgaa accgggtgat 420 acgattatcg aaccgacctc tggcaacacg ggtatcggtc tggcactggc ggcggcagtc 480 cgtggttatc gctgcattat cgtgatgccg gaaaaaatga gctctgaaaa agttgatgtc 540 ctgcgtgctc tgggcgcgga aattgttcgt accccgacga atgcccgctt cgacagtccg 600 gaatcccatg tgggtgttgc atggcgcctg aaaaacgaaa tcccgaattc gcacattctg 660 gatcagtatc gtaacgctag caatccgctg gcgcattacg ataccacggc cgacgaaatc 720 ctgcagcaat gtgatggcaa actggacatg ctggtcgctt ctgtgggtac cggcggtacc 780 attacgggca tcgcgcgtaa actgaaagaa aaatgcccgg gctgtcgcat tatcggtgtg 840 gatccggaag gcagtattct ggcggaaccg gaaactga accagaccga acaaaccacg 900 tatgaagttg aaggcatcgg ttacgatttt attccgaccg tcctggatcg cacggtggtt 960 gcaaatggt tcaaaagcaa tgaacgaagaa gcctttacct tcgcacgtat gctgatcgct 1020 caggaaggtc tgctgtgcgg tggttcagca ggttcgacgg tcgcagtggc agttaaagct 1080 gcgcaggaac tgcaagaagg tcaacgttgt gtcgtgattc tgccggattc tgttcgcaac 1140 tacatgacca aatttctgag tgaccgttgg atgctgcaaa aaggcttcct gaaagaagaa 1200 gatctgaccg agaaaaaacc gtggtggtgg cacctgcgcg tgcaggaact gggtctgtcc 1260 gcaccgctga ccgttctgcc gaccatcacg tgcggccata cgattgaaat cctgcgtgaa 1320 aaaggttttg atcaggcccc ggttgtcgac gaagcaggcg tgattctggg tatggttacc 1380 ctgggtaaca tgctgagttc cctgctggcg ggcaaagtgc aaccgagcga tcaggttggt 1440 aaagtcatct acaaacaatt caaacagatt cgtctgaccg atacgctggg ccgcctgtcg 1500 cacatcctgg aaatggacca tttcgcgctg gttgtgcacg aacagattca ataccatagc 1560 accggcaaat catcgcagcg ccaaatggtc tttggtgtcg tgacggccat tgatctgctg 1620 aatttcgtgg ccgcacaaga acgtgaccag aaataa 1656 <210> 2 <211> 551 <212> PRT <213> Homo sapiens <400> 2 Met Pro Ser Glu Thr Pro Gln Ala Glu Val Gly Pro Thr Gly Cys Pro 1 5 10 15 His Arg Ser Gly Pro His Ser Ala Lys Gly Ser Leu Glu Lys Gly Ser 20 25 30 Pro Glu Asp Lys Glu Ala Lys Glu Pro Leu Trp Ile Arg Pro Asp Ala 35 40 45 Pro Ser Arg Cys Thr Trp Gln Leu Gly Arg Pro Ala Ser Glu Ser Pro 50 55 60 His His His Thr Ala Pro Ala Lys Ser Pro Lys Ile Leu Pro Asp Ile 65 70 75 80 Leu Lys Lys Ile Gly Asp Thr Pro Met Val Arg Ile Asn Lys Ile Gly 85 90 95 Lys Lys Phe Gly Leu Lys Cys Glu Leu Leu Ala Lys Cys Glu Phe Phe 100 105 110 Asn Ala Gly Gly Ser Val Lys Asp Arg Ile Ser Leu Arg Met Ile Glu 115 120 125 Asp Ala Glu Arg Asp Gly Thr Leu Lys Pro Gly Asp Thr Ile Ile Glu 130 135 140 Pro Thr Ser Gly Asn Thr Gly Ile Gly Leu Ala Leu Ala Ala Ala Val 145 150 155 160 Arg Gly Tyr Arg Cys Ile Ile Val Met Pro Glu Lys Met Ser Ser Glu 165 170 175 Lys Val Asp Val Leu Arg Ala Leu Gly Ala Glu Ile Val Arg Thr Pro 180 185 190 Thr Asn Ala Arg Phe Asp Ser Pro Glu Ser His Val Gly Val Ala Trp 195 200 205 Arg Leu Lys Asn Glu Ile Pro Asn Ser His Ile Leu Asp Gln Tyr Arg 210 215 220 Asn Ala Ser Asn Pro Leu Ala His Tyr Asp Thr Thr Ala Asp Glu Ile 225 230 235 240 Leu Gln Gln Cys Asp Gly Lys Leu Asp Met Leu Val Ala Ser Val Gly 245 250 255 Thr Gly Gly Thr Ile Thr Gly Ile Ala Arg Lys Leu Lys Glu Lys Cys 260 265 270 Pro Gly Cys Arg Ile Ile Gly Val Asp Pro Glu Gly Ser Ile Leu Ala 275 280 285 Glu Pro Glu Glu Leu Asn Gln Thr Glu Gln Thr Thr Tyr Glu Val Glu 290 295 300 Gly Ile Gly Tyr Asp Phe Ile Pro Thr Val Leu Asp Arg Thr Val Val 305 310 315 320 Asp Lys Trp Phe Lys Ser Asn Asp Glu Glu Ala Phe Thr Phe Ala Arg 325 330 335 Met Leu Ile Ala Gln Glu Gly Leu Leu Cys Gly Gly Ser Ala Gly Ser 340 345 350 Thr Val Ala Val Ala Val Lys Ala Ala Gln Glu Leu Gln Glu Gly Gln 355 360 365 Arg Cys Val Val Ile Leu Pro Asp Ser Val Arg Asn Tyr Met Thr Lys 370 375 380 Phe Leu Ser Asp Arg Trp Met Leu Gln Lys Gly Phe Leu Lys Glu Glu 385 390 395 400 Asp Leu Thr Glu Lys Lys Pro Trp Trp Trp His Leu Arg Val Gln Glu 405 410 415 Leu Gly Leu Ser Ala Pro Leu Thr Val Leu Pro Thr Ile Thr Cys Gly 420 425 430 His Thr Ile Glu Ile Leu Arg Glu Lys Gly Phe Asp Gln Ala Pro Val 435 440 445 Val Asp Glu Ala Gly Val Ile Leu Gly Met Val Thr Leu Gly Asn Met 450 455 460 Leu Ser Ser Leu Leu Ala Gly Lys Val Gln Pro Ser Asp Gln Val Gly 465 470 475 480 Lys Val Ile Tyr Lys Gln Phe Lys Gln Ile Arg Leu Thr Asp Thr Leu 485 490 495 Gly Arg Leu Ser His Ile Leu Glu Met Asp His Phe Ala Leu Val Val 500 505 510 His Glu Gln Ile Gln Tyr His Ser Thr Gly Lys Ser Ser Gln Arg Gln 515 520 525 Met Val Phe Gly Val Val Thr Ala Ile Asp Leu Leu Asn Phe Val Ala 530 535 540 Ala Gln Glu Arg Asp Gln Lys 545 550 <210> 3 <211> 413 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 3 Met Pro Ser Glu Thr Pro Gln Ala Glu Val Gly Pro Thr Gly Cys Pro 1 5 10 15 His Arg Ser Gly Pro His Ser Ala Lys Gly Ser Leu Glu Lys Gly Ser 20 25 30 Pro Glu Asp Lys Glu Ala Lys Glu Pro Leu Trp Ile Arg Pro Asp Ala 35 40 45 Pro Ser Arg Cys Thr Trp Gln Leu Gly Arg Pro Ala Ser Glu Ser Pro 50 55 60 His His His Thr Ala Pro Ala Lys Ser Pro Lys Ile Leu Pro Asp Ile 65 70 75 80 Leu Lys Lys Ile Gly Asp Thr Pro Met Val Arg Ile Asn Lys Ile Gly 85 90 95 Lys Lys Phe Gly Leu Lys Cys Glu Leu Leu Ala Lys Cys Glu Phe Phe 100 105 110 Asn Ala Gly Gly Ser Val Lys Asp Arg Ile Ser Leu Arg Met Ile Glu 115 120 125 Asp Ala Glu Arg Asp Gly Thr Leu Lys Pro Gly Asp Thr Ile Ile Glu 130 135 140 Pro Thr Ser Gly Asn Thr Gly Ile Gly Leu Ala Leu Ala Ala Ala Val 145 150 155 160 Arg Gly Tyr Arg Cys Ile Ile Val Met Pro Glu Lys Met Ser Ser Glu 165 170 175 Lys Val Asp Val Leu Arg Ala Leu Gly Ala Glu Ile Val Arg Thr Pro 180 185 190 Thr Asn Ala Arg Phe Asp Ser Pro Glu Ser His Val Gly Val Ala Trp 195 200 205 Arg Leu Lys Asn Glu Ile Pro Asn Ser His Ile Leu Asp Gln Tyr Arg 210 215 220 Asn Ala Ser Asn Pro Leu Ala His Tyr Asp Thr Thr Ala Asp Glu Ile 225 230 235 240 Leu Gln Gln Cys Asp Gly Lys Leu Asp Met Leu Val Ala Ser Val Gly 245 250 255 Thr Gly Gly Thr Ile Thr Gly Ile Ala Arg Lys Leu Lys Glu Lys Cys 260 265 270 Pro Gly Cys Arg Ile Ile Gly Val Asp Pro Glu Gly Ser Ile Leu Ala 275 280 285 Glu Pro Glu Glu Leu Asn Gln Thr Glu Gln Thr Thr Tyr Glu Val Glu 290 295 300 Gly Ile Gly Tyr Asp Phe Ile Pro Thr Val Leu Asp Arg Thr Val Val 305 310 315 320 Asp Lys Trp Phe Lys Ser Asn Asp Glu Glu Ala Phe Thr Phe Ala Arg 325 330 335 Met Leu Ile Ala Gln Glu Gly Leu Leu Cys Gly Gly Ser Ala Gly Ser 340 345 350 Thr Val Ala Val Ala Val Lys Ala Ala Gln Glu Leu Gln Glu Gly Gln 355 360 365 Arg Cys Val Val Ile Leu Pro Asp Ser Val Arg Asn Tyr Met Thr Lys 370 375 380 Phe Leu Ser Asp Arg Trp Met Leu Gln Lys Gly Phe Leu Lys Glu Glu 385 390 395 400 Asp Leu Thr Glu Lys Lys Pro Trp Trp Trp His Leu Arg 405 410 <210> 4 <211> 1242 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 4 atgccgtcag aaaccccgca ggcagaagtg ggtccgacgg gttgcccgca ccgtagcggt 60 ccgcattctg caaaaggcag tctggaaaaa ggttccccgg aagataaaga agccaaagaa 120 ccgctgtgga ttcgtccgga cgcaccgtca cgctgtacct ggcagctggg tcgtccggca 180 agcgaatctc cgcatcacca tacggctccg gcgaaaagtc cgaaaattct gccggatatc 240 ctgaagaaaa ttggtgacac cccgatggtt cgtatcaaca aaatcggcaa aaaattcggt 300 ctgaaatgcg aactgctggc taaatgtgaa tttttcaatg cgggcggttc cgtgaaagat 360 cgtatctcac tgcgcatgat tgaagatgct gaacgcgacg gcaccctgaa accgggtgat 420 acgattatcg aaccgacctc tggcaacacg ggtatcggtc tggcactggc ggcggcagtc 480 cgtggttatc gctgcattat cgtgatgccg gaaaaaatga gctctgaaaa agttgatgtc 540 ctgcgtgctc tgggcgcgga aattgttcgt accccgacga atgcccgctt cgacagtccg 600 gaatcccatg tgggtgttgc atggcgcctg aaaaacgaaa tcccgaattc gcacattctg 660 gatcagtatc gtaacgctag caatccgctg gcgcattacg ataccacggc cgacgaaatc 720 ctgcagcaat gtgatggcaa actggacatg ctggtcgctt ctgtgggtac cggcggtacc 780 attacgggca tcgcgcgtaa actgaaagaa aaatgcccgg gctgtcgcat tatcggtgtg 840 gatccggaag gcagtattct ggcggaaccg gaaactga accagaccga acaaaccacg 900 tatgaagttg aaggcatcgg ttacgatttt attccgaccg tcctggatcg cacggtggtt 960 gcaaatggt tcaaaagcaa tgaacgaagaa gcctttacct tcgcacgtat gctgatcgct 1020 caggaaggtc tgctgtgcgg tggttcagca ggttcgacgg tcgcagtggc agttaaagct 1080 gcgcaggaac tgcaagaagg tcaacgttgt gtcgtgattc tgccggattc tgttcgcaac 1140 tacatgacca aatttctgag tgaccgttgg atgctgcaaa aaggcttcct gaaagaagaa 1200 gatctgaccg agaaaaaacc gtggtggtgg cacctgcgct aa 1242 <210> 5 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 5 cgtagaattc acctttgccc gcatgctgat 30 <210> 6 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 6 tacgggtacc tcaacggagg tgccaccacc agggc 35 <210> 7 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 7 agtcgcccat ggcgtcagaa accccgcag 29 <210> 8 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 8 atcgcgctcg agttagcgca ggtgccacca c 31 <210> 9 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 9 ggagatatac catgccgtca gaaaccccgc 30 <210> 10 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 10 gcggggtttc tgacggcatg gtatatctcc 30 <210> 11 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 11 tgggtccgac gggtagcccg cac 23 <210> 12 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 12 gtgcgggcta cccgtcggac cca 23 <210> 13 <211> 413 <212> PRT <213> Artificial sequence <220> <223> Truncated human C15S mutant CBS polypeptide <400> 13 Met Pro Ser Glu Thr Pro Gln Ala Glu Val Gly Pro Thr Gly Ser Pro 1 5 10 15 His Arg Ser Gly Pro His Ser Ala Lys Gly Ser Leu Glu Lys Gly Ser 20 25 30 Pro Glu Asp Lys Glu Ala Lys Glu Pro Leu Trp Ile Arg Pro Asp Ala 35 40 45 Pro Ser Arg Cys Thr Trp Gln Leu Gly Arg Pro Ala Ser Glu Ser Pro 50 55 60 His His His Thr Ala Pro Ala Lys Ser Pro Lys Ile Leu Pro Asp Ile 65 70 75 80 Leu Lys Lys Ile Gly Asp Thr Pro Met Val Arg Ile Asn Lys Ile Gly 85 90 95 Lys Lys Phe Gly Leu Lys Cys Glu Leu Leu Ala Lys Cys Glu Phe Phe 100 105 110 Asn Ala Gly Gly Ser Val Lys Asp Arg Ile Ser Leu Arg Met Ile Glu 115 120 125 Asp Ala Glu Arg Asp Gly Thr Leu Lys Pro Gly Asp Thr Ile Ile Glu 130 135 140 Pro Thr Ser Gly Asn Thr Gly Ile Gly Leu Ala Leu Ala Ala Ala Val 145 150 155 160 Arg Gly Tyr Arg Cys Ile Ile Val Met Pro Glu Lys Met Ser Ser Glu 165 170 175 Lys Val Asp Val Leu Arg Ala Leu Gly Ala Glu Ile Val Arg Thr Pro 180 185 190 Thr Asn Ala Arg Phe Asp Ser Pro Glu Ser His Val Gly Val Ala Trp 195 200 205 Arg Leu Lys Asn Glu Ile Pro Asn Ser His Ile Leu Asp Gln Tyr Arg 210 215 220 Asn Ala Ser Asn Pro Leu Ala His Tyr Asp Thr Thr Ala Asp Glu Ile 225 230 235 240 Leu Gln Gln Cys Asp Gly Lys Leu Asp Met Leu Val Ala Ser Val Gly 245 250 255 Thr Gly Gly Thr Ile Thr Gly Ile Ala Arg Lys Leu Lys Glu Lys Cys 260 265 270 Pro Gly Cys Arg Ile Ile Gly Val Asp Pro Glu Gly Ser Ile Leu Ala 275 280 285 Glu Pro Glu Glu Leu Asn Gln Thr Glu Gln Thr Thr Tyr Glu Val Glu 290 295 300 Gly Ile Gly Tyr Asp Phe Ile Pro Thr Val Leu Asp Arg Thr Val Val 305 310 315 320 Asp Lys Trp Phe Lys Ser Asn Asp Glu Glu Ala Phe Thr Phe Ala Arg 325 330 335 Met Leu Ile Ala Gln Glu Gly Leu Leu Cys Gly Gly Ser Ala Gly Ser 340 345 350 Thr Val Ala Val Ala Val Lys Ala Ala Gln Glu Leu Gln Glu Gly Gln 355 360 365 Arg Cys Val Val Ile Leu Pro Asp Ser Val Arg Asn Tyr Met Thr Lys 370 375 380 Phe Leu Ser Asp Arg Trp Met Leu Gln Lys Gly Phe Leu Lys Glu Glu 385 390 395 400 Asp Leu Thr Glu Lys Lys Pro Trp Trp Trp His Leu Arg 405 410 <210> 14 <211> 1242 <212> DNA <213> Artificial sequence <220> <223> Truncated human C15S mutant CBS nucleotide <400> 14 atgccgtcag aaaccccgca ggcagaagtg ggtccgacgg gtagcccgca ccgtagcggt 60 ccgcattctg caaaaggcag tctggaaaaa ggttccccgg aagataaaga agccaaagaa 120 ccgctgtgga ttcgtccgga cgcaccgtca cgctgtacct ggcagctggg tcgtccggca 180 agcgaatctc cgcatcacca tacggctccg gcgaaaagtc cgaaaattct gccggatatc 240 ctgaagaaaa ttggtgacac cccgatggtt cgtatcaaca aaatcggcaa aaaattcggt 300 ctgaaatgcg aactgctggc taaatgtgaa tttttcaatg cgggcggttc cgtgaaagat 360 cgtatctcac tgcgcatgat tgaagatgct gaacgcgacg gcaccctgaa accgggtgat 420 acgattatcg aaccgacctc tggcaacacg ggtatcggtc tggcactggc ggcggcagtc 480 cgtggttatc gctgcattat cgtgatgccg gaaaaaatga gctctgaaaa agttgatgtc 540 ctgcgtgctc tgggcgcgga aattgttcgt accccgacga atgcccgctt cgacagtccg 600 gaatcccatg tgggtgttgc atggcgcctg aaaaacgaaa tcccgaattc gcacattctg 660 gatcagtatc gtaacgctag caatccgctg gcgcattacg ataccacggc cgacgaaatc 720 ctgcagcaat gtgatggcaa actggacatg ctggtcgctt ctgtgggtac cggcggtacc 780 attacgggca tcgcgcgtaa actgaaagaa aaatgcccgg gctgtcgcat tatcggtgtg 840 gatccggaag gcagtattct ggcggaaccg gaaactga accagaccga acaaaccacg 900 tatgaagttg aaggcatcgg ttacgatttt attccgaccg tcctggatcg cacggtggtt 960 gcaaatggt tcaaaagcaa tgaacgaagaa gcctttacct tcgcacgtat gctgatcgct 1020 caggaaggtc tgctgtgcgg tggttcagca ggttcgacgg tcgcagtggc agttaaagct 1080 gcgcaggaac tgcaagaagg tcaacgttgt gtcgtgattc tgccggattc tgttcgcaac 1140 tacatgacca aatttctgag tgaccgttgg atgctgcaaa aaggcttcct gaaagaagaa 1200 gatctgaccg agaaaaaacc gtggtggtgg cacctgcgct aa 1242 <210> 15 <211> 1656 <212> DNA <213> Artificial Sequence <220> <223> Full-length Human C15S Mutant CBS Nucleotide <400> 15 atgccgtcag aaaccccgca ggcagaagtg ggtccgacgg gtagcccgca ccgtagcggt 60 ccgcattctg caaaaggcag tctggaaaaa ggttccccgg aagataaaga agccaaagaa 120 ccgctgtgga ttcgtccgga cgcaccgtca cgctgtacct ggcagctggg tcgtccggca 180 agcgaatctc cgcatcacca tacggctccg gcgaaaagtc cgaaaattct gccggatatc 240 ctgaagaaaa ttggtgacac cccgatggtt cgtatcaaca aaatcggcaa aaaattcggt 300 ctgaaatgcg aactgctggc taaatgtgaa tttttcaatg cgggcggttc cgtgaaagat 360 cgtatctcac tgcgcatgat tgaagatgct gaacgcgacg gcaccctgaa accgggtgat 420 acgattatcg aaccgacctc tggcaacacg ggtatcggtc tggcactggc ggcggcagtc 480 cgtggttatc gctgcattat cgtgatgccg gaaaaaatga gctctgaaaa agttgatgtc 540 ctgcgtgctc tgggcgcgga aattgttcgt accccgacga atgcccgctt cgacagtccg 600 gaatcccatg tgggtgttgc atggcgcctg aaaaacgaaa tcccgaattc gcacattctg 660 gatcagtatc gtaacgctag caatccgctg gcgcattacg ataccacggc cgacgaaatc 720 ctgcagcaat gtgatggcaa actggacatg ctggtcgctt ctgtgggtac cggcggtacc 780 attacgggca tcgcgcgtaa actgaaagaa aaatgcccgg gctgtcgcat tatcggtgtg 840 gatccggaag gcagtattct ggcggaaccg gaaactga accagaccga acaaaccacg 900 tatgaagttg aaggcatcgg ttacgatttt attccgaccg tcctggatcg cacggtggtt 960 gcaaatggt tcaaaagcaa tgaacgaagaa gcctttacct tcgcacgtat gctgatcgct 1020 caggaaggtc tgctgtgcgg tggttcagca ggttcgacgg tcgcagtggc agttaaagct 1080 gcgcaggaac tgcaagaagg tcaacgttgt gtcgtgattc tgccggattc tgttcgcaac 1140 tacatgacca aatttctgag tgaccgttgg atgctgcaaa aaggcttcct gaaagaagaa 1200 gatctgaccg agaaaaaacc gtggtggtgg cacctgcgcg tgcaggaact gggtctgtcc 1260 gcaccgctga ccgttctgcc gaccatcacg tgcggccata cgattgaaat cctgcgtgaa 1320 aaaggttttg atcaggcccc ggttgtcgac gaagcaggcg tgattctggg tatggttacc 1380 ctgggtaaca tgctgagttc cctgctggcg ggcaaagtgc aaccgagcga tcaggttggt 1440 aaagtcatct acaaacaatt caaacagatt cgtctgaccg atacgctggg ccgcctgtcg 1500 cacatcctgg aaatggacca tttcgcgctg gttgtgcacg aacagattca ataccatagc 1560 accggcaaat catcgcagcg ccaaatggtc tttggtgtcg tgacggccat tgatctgctg 1620 aatttcgtgg ccgcacaaga acgtgaccag aaataa 1656 <210> 16 <211> 551 <212> PRT <213> Artificial Sequence <220> <223> Full-length Human C15S Mutant CBS Polypeptide <400> 16 Met Pro Ser Glu Thr Pro Gln Ala Glu Val Gly Pro Thr Gly Ser Pro 1 5 10 15 His Arg Ser Gly Pro His Ser Ala Lys Gly Ser Leu Glu Lys Gly Ser 20 25 30 Pro Glu Asp Lys Glu Ala Lys Glu Pro Leu Trp Ile Arg Pro Asp Ala 35 40 45 Pro Ser Arg Cys Thr Trp Gln Leu Gly Arg Pro Ala Ser Glu Ser Pro 50 55 60 His His His Thr Ala Pro Ala Lys Ser Pro Lys Ile Leu Pro Asp Ile 65 70 75 80 Leu Lys Lys Ile Gly Asp Thr Pro Met Val Arg Ile Asn Lys Ile Gly 85 90 95 Lys Lys Phe Gly Leu Lys Cys Glu Leu Leu Ala Lys Cys Glu Phe Phe 100 105 110 Asn Ala Gly Gly Ser Val Lys Asp Arg Ile Ser Leu Arg Met Ile Glu 115 120 125 Asp Ala Glu Arg Asp Gly Thr Leu Lys Pro Gly Asp Thr Ile Ile Glu 130 135 140 Pro Thr Ser Gly Asn Thr Gly Ile Gly Leu Ala Leu Ala Ala Ala Val 145 150 155 160 Arg Gly Tyr Arg Cys Ile Ile Val Met Pro Glu Lys Met Ser Ser Glu 165 170 175 Lys Val Asp Val Leu Arg Ala Leu Gly Ala Glu Ile Val Arg Thr Pro 180 185 190 Thr Asn Ala Arg Phe Asp Ser Pro Glu Ser His Val Gly Val Ala Trp 195 200 205 Arg Leu Lys Asn Glu Ile Pro Asn Ser His Ile Leu Asp Gln Tyr Arg 210 215 220 Asn Ala Ser Asn Pro Leu Ala His Tyr Asp Thr Thr Ala Asp Glu Ile 225 230 235 240 Leu Gln Gln Cys Asp Gly Lys Leu Asp Met Leu Val Ala Ser Val Gly 245 250 255 Thr Gly Gly Thr Ile Thr Gly Ile Ala Arg Lys Leu Lys Glu Lys Cys 260 265 270 Pro Gly Cys Arg Ile Ile Gly Val Asp Pro Glu Gly Ser Ile Leu Ala 275 280 285 Glu Pro Glu Glu Leu Asn Gln Thr Glu Gln Thr Thr Tyr Glu Val Glu 290 295 300 Gly Ile Gly Tyr Asp Phe Ile Pro Thr Val Leu Asp Arg Thr Val Val 305 310 315 320 Asp Lys Trp Phe Lys Ser Asn Asp Glu Glu Ala Phe Thr Phe Ala Arg 325 330 335 Met Leu Ile Ala Gln Glu Gly Leu Leu Cys Gly Gly Ser Ala Gly Ser 340 345 350 Thr Val Ala Val Ala Val Lys Ala Ala Gln Glu Leu Gln Glu Gly Gln 355 360 365 Arg Cys Val Val Ile Leu Pro Asp Ser Val Arg Asn Tyr Met Thr Lys 370 375 380 Phe Leu Ser Asp Arg Trp Met Leu Gln Lys Gly Phe Leu Lys Glu Glu 385 390 395 400 Asp Leu Thr Glu Lys Lys Pro Trp Trp Trp His Leu Arg Val Gln Glu 405 410 415 Leu Gly Leu Ser Ala Pro Leu Thr Val Leu Pro Thr Ile Thr Cys Gly 420 425 430 His Thr Ile Glu Ile Leu Arg Glu Lys Gly Phe Asp Gln Ala Pro Val 435 440 445 Val Asp Glu Ala Gly Val Ile Leu Gly Met Val Thr Leu Gly Asn Met 450 455 460 Leu Ser Ser Leu Leu Ala Gly Lys Val Gln Pro Ser Asp Gln Val Gly 465 470 475 480 Lys Val Ile Tyr Lys Gln Phe Lys Gln Ile Arg Leu Thr Asp Thr Leu 485 490 495 Gly Arg Leu Ser His Ile Leu Glu Met Asp His Phe Ala Leu Val Val 500 505 510 His Glu Gln Ile Gln Tyr His Ser Thr Gly Lys Ser Ser Gln Arg Gln 515 520 525 Met Val Phe Gly Val Val Thr Ala Ile Asp Leu Leu Asn Phe Val Ala 530 535 540 Ala Gln Glu Arg Asp Gln Lys 545 550

Claims

1. An isolated PEGylated cystathionine-β-synthase (CBS) polypeptide consisting of a CBS polypeptide covalently linked to one or more polyethylene glycol molecules, wherein each polyethylene glycol molecule has a molecular weight equal to or greater than 2000 Daltons, wherein the CBS polypeptide consists of the amino acid sequence of SEQ ID NO:

13.

2. The isolated PEGylated CBS polypeptide according to claim 1, wherein the polyethylene glycol molecule is linked to the CBS polypeptide via NHS.

3. The isolated PEGylated CBS polypeptide of claim 1, wherein the CBS polypeptide is PEGylated with ME-200GS.

4. The isolated PEGylated CBS polypeptide according to claim 1, wherein the CBS polypeptide has been isolated from Escherichia coli, which has been transfected with an expression vector encoding the nucleic acid sequence of SEQ ID NO:

14.

5. A pharmaceutical composition comprising the isolated PEGylated CBS polypeptide according to any one of claims 1 to 4 and a pharmaceutically acceptable excipient.

6. Use of the isolated PEGylated CBS polypeptide according to any one of claims 1 to 4 in the preparation of a medicament for treating or improving homocystinuria.

7. Use of the pharmaceutical composition according to claim 5 in the preparation of a medicament for treating or improving homocystinuria.

Images