Intranasal vector vaccine against porcine epidemic diarrhea

By inserting the heterologous nucleotide sequence of the PEDV spike protein into the CDV vector, intranasal immunity is achieved, the stress problem caused by intramuscular injection is solved, and the protection effect of PEDV infection in piglets is improved.

CN112867506BActive Publication Date: 2025-08-05BOEHRINGER INGELHEIM VETMEDICA GMBH
View PDF 47 Cites 0 Cited by

Patent Information

Application Number
CN201980060564.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-03-28
Filing Date
2019-09-18
Publication Date
2025-08-05
Estimated Expiration
2040-02-07

AI Technical Summary

Technical Problem

The existing intramuscular injection methods of swine epidemic diarrhea virus (PEDV) vaccines cause stress on animals and it is difficult to effectively administer vector vaccines against PEDV through the intranasal route.

Method used

A heterologous nucleotide sequence encoding the spike (S) protein of swine epidemic diarrhea virus (PEDV) was inserted between the phosphoprotein (P) gene of canine distemper virus (CDV) and the matrix protein (M), and CDV vector was prepared for intranasal immunity of sows and protecting piglets through colostrum delivery.

Benefits of technology

Effectively induce the immune response of sows, reduce the incidence, severity and virus shedding of piglets, and provide passive immune protection against PEDV infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0002978087660000371
    Figure BDA0002978087660000371
  • Figure BDA0002978087660000401
    Figure BDA0002978087660000401
Patent Text Reader

Abstract

The present invention relates to the field of (vector) vaccines, and in particular to canine distemper virus (CDV) vectors comprising a heterologous nucleotide sequence encoding a porcine epidemic diarrhea virus (PEDV) antigen. The PEDV antigen is preferably the PEDV spike (S) protein. The viral vectors of the present invention can be used to produce immunogenic compositions or vaccines for intranasal immunization of sows and thereby protecting piglets suckled by such sows against clinical signs associated with PEDV infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of (vector) vaccines. The viral vectors of the present invention can be used to produce immunogenic compositions or vaccines for inducing an immune response against porcine epidemic diarrhea virus (PEDV) in pigs. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV) is an enveloped, positive-sense, single-stranded RNA virus that causes acute diarrhea, vomiting, and dehydration in pigs. In pigs three weeks of age and younger, clinical signs (including acute watery diarrhea, vomiting, and dehydration) can be observed within 24 hours of infection, resulting in up to 100% mortality. Furthermore, gross and histological changes in the intestinal tract of PEDV-infected animals can result in severe pathological lesions in the small intestine.

[0003] Although only one serotype of PEDV has been reported, phylogenetic studies of the S gene have shown that PEDV can be genetically divided into two groups: genotype 1 (G1; typical) and genotype 2 (G2; regionally endemic or pandemic). Each genotype can be further divided into subgroups (1a and 1b; 2a and 2b). G1a includes the prototype PEDV strain CV777, vaccine strains, and other cell culture-adapted strains, while G1b includes novel variants first identified in China and later identified in the United States, South Korea, and Europe. G2 comprises global field isolates, which are further clustered into subgroups 2a and 2b (G2a and G2b), which have previously caused localized epidemic outbreaks in Asia and more recently caused pandemic outbreaks in North America and Asia, respectively.

[0004] PEDV is a member of the subfamily Coronavirus in the genus Alphacoronavirus. PEDV is an enveloped virus with a positive-sense, single-stranded RNA genome of approximately 28 kb, a 5' cap, and a 3' polyadenylated tail (Pensaert and DeBouck, 1978). The genome comprises a 5' untranslated region (UTR), a 3' UTR, and at least seven open reading frames (ORFs) encoding four structural proteins (spike (S), envelope (E), membrane (M), and nucleocapsid (N)) and three nonstructural proteins (replicases 1a and 1b, and ORF3). These are arranged on the genome in the sequence 5'-replicase (1a / 1b)-S-ORF3-EMN-3' (Oldham, 1972; and Bridgen et al., 1993).

[0005] The PEDV S protein is a type I glycoprotein, consisting of 1,383 amino acids (aa) (G2b PEDV). Based on its homology with the S proteins of other coronaviruses, the S protein can be divided into S1 (e.g., 1-789 aa) and S2 (e.g., 790-1,383 aa) domains. The S protein in coronaviruses is a surface antigen that plays a role in mediating viral entry by interacting with host cell receptor glycoproteins and stimulating the induction of neutralizing antibodies in the natural host. Therefore, the S glycoprotein is a major target for the development of an effective vaccine against PEDV.

[0006] PEDV was first identified in Europe but has become an increasing problem in many Asian countries, including South Korea, China, Japan, the Philippines, and Thailand. Since 2013, PEDV has been present in the United States, and the economic impact of PEDV infection has been significant. Therefore, there is a continuing need to develop vaccines that can protect pigs from PEDV-related diseases.

[0007] WO2017165366(A1) describes that an orofacial renal cell virus (ORFV) vector expressing the PEDV S protein induces serum IgG, IgA, and neutralizing antibody responses in pigs when administered intramuscularly (paragraph

[0172] of WO2017165366(A1)). In addition, intramuscular administration of this vector to pregnant gilts was shown to result in passive immunity in piglets born to these gilts (Joshi et al. Arch Virol. 163(9):2327-2335 (2018)).

[0008] However, because repeated intramuscular injections using conventional needles and syringes can be stressful for animals, vectored vaccines against porcine epidemic diarrhea (PED) that can be administered via the intranasal route, for example as a nasal spray, are desirable. Summary of the Invention

[0009] The solution to the above technical problem is achieved through the description and embodiments characterized in the scope of the patent application.

[0010] Thus, the present invention may be implemented in its various aspects in accordance with the claims.

[0011] The present invention is based on the surprising discovery that the insertion of a heterologous nucleotide sequence encoding the porcine epidemic diarrhea virus (PEDV) spike (S) protein between the phosphoprotein (P) gene and the matrix protein (M) of the viral genome of canine distemper virus (CDV) can produce a CDV vector that can be used to intranasally immunize sows and thereby protect piglets suckled by such sows against clinical signs associated with PEDV infection.

[0012] In a first aspect, the present invention therefore provides a canine distemper virus (CDV) vector comprising a heterologous nucleotide sequence of interest, wherein the heterologous nucleotide sequence of interest encodes a porcine epidemic diarrhea virus (PEDV) antigen.

[0013] In a specific aspect, the present invention uses the Lederle vaccine strain of CDV (deposited with ATCC under accession number VR-128) as the backbone (genotype represented by GenBank Accession No. DQ903854.1, AY288311 or AY286480) or a sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical thereto, for example, from a virus derived from additional passages thereof (e.g., Canine Distemper Virus, Lederle Avirulent, Catalog No. NR-3845, Biodefense and Emerging Infections Research Resources Repository, PO Box 4137, Manassas, VA 20108-4137, USA).

[0014] The vector of the present invention can be used in particular for vaccination of mammals, particularly pigs.

[0015] Furthermore, the present invention encompasses vectors for inducing an immune response against porcine epidemic diarrhea virus in pigs. Thus, in the context of the present invention, a CDV vector is also provided, comprising an expression cassette having a heterologous RNA sequence encoding the spike protein of porcine epidemic diarrhea virus.

[0016] The present invention further relates to mammalian host cells comprising the vectors and methods of producing vector vaccines using the host cells, as well as immunogenic compositions and vaccines comprising the CDV vectors of the present invention. DETAILED DESCRIPTION

[0017] The present invention solves the problems inherent in the prior art and provides a significant advancement in the state of the art.

[0018] In the context of the present invention, CDV vectors encoding the spike protein of porcine epidemic diarrhea virus (PEDV) are intranasally administered to pregnant sows, which subsequently elicit passive immunity in piglets via ingestion of antibody-positive colostrum, as seen by reduced morbidity or severity of clinical signs, mortality, and viral shedding after challenge with PEDV.

[0019] Thus, the present invention provides a canine distemper virus vector, also referred to herein as a "CDV vector of the present invention," wherein the vector comprises a heterologous nucleotide sequence of interest, and wherein the heterologous nucleotide sequence of interest encodes a porcine epidemic diarrhea virus (PEDV) antigen.

[0020] A heterologous nucleotide sequence of interest as referred to herein is in particular a heterologous RNA sequence of interest.

[0021] Preferably, the PEDV antigen is selected from the group consisting of: PEDV spike (S) protein and PEDV nucleoprotein (N protein), wherein the PEDV spike protein is particularly preferred.

[0022] Preferably, the PEDV antigen is therefore a PEDV S protein, and wherein the PEDV S protein preferably comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0023] In a preferred aspect, the PEDV S protein thus comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1.

[0024] In another preferred aspect, the PEDV S protein thus comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 2.

[0025] As another preferred option, the PEDV antigen is a PEDV S protein, and wherein the PEDV S protein preferably comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

[0026] In a preferred aspect, the PEDV S protein thus comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16.

[0027] In another preferred aspect, the PEDV S protein thus comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 17.

[0028] According to another preferred aspect, the heterologous nucleotide sequence of interest encodes a PEDV S protein, wherein the heterologous nucleotide sequence of interest consists of or comprises an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of any one of SEQ ID NOs: 3 to 5.

[0029] Thus, in a preferred aspect, the heterologous nucleotide sequence of interest consists of or comprises a RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 3.

[0030] In another preferred aspect, the heterologous nucleotide sequence of interest thus consists of or comprises a RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 4.

[0031] In a further preferred aspect, the heterologous nucleotide sequence of interest thus consists of or comprises a RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 5.

[0032] In particular, it is preferred that the length of the RNA sequence of interest conforms to the "rule of six," meaning that the number of nucleotides in the RNA sequence of interest represents a multiple of six. Thus, it is optionally preferred to extend a given nucleotide sequence encoding a PEDV antigen, in particular encoding a stop codon, by additional triplets such that the number of nucleotides in the resulting nucleotide sequence of interest is divisible by six.

[0033] According to a preferred aspect of the present invention, the heterologous RNA sequence of interest is preferably located between the P gene and the M gene of CDV, and / or

[0034] Preferably, the heterologous RNA sequence of interest is operably linked to a gene start (GS) sequence located in the 3′ direction of the heterologous RNA sequence, wherein the GS sequence is most preferably included in the exogenous 3′ non-coding region of the H gene of CDV; and / or is linked to the genomic promoter of CDV.

[0035] Thus, in a preferred aspect, the heterologous RNA sequence of interest is located between the P and M genes of CDV and is operably linked to

[0036] - a gene start (GS) sequence located 3' to the heterologous RNA sequence, wherein the GS sequence is included in the exogenous 3' non-coding region of the H gene of CDV, and / or

[0037] -Genomic promoter of CDV.

[0038] In another preferred aspect, the heterologous RNA sequence of interest is operably linked to a gene start (GS) sequence and / or a genomic promoter of CDV located in the 3' direction of the heterologous RNA sequence.

[0039] The GS sequence is preferably included in the exogenous 3' non-coding region of the H gene of CDV.

[0040] Specifically, the heterologous RNA sequence of interest in the CDV vector is operably linked to

[0041] - the exogenous 3′ non-coding region of the H gene of CDV, specifically the GS sequence included therein, wherein the exogenous 3′ non-coding region of the H gene of CDV is flanked by the 3′ end of the heterologous RNA sequence of interest encoding the PEDV S protein, and

[0042] -Genomic promoter of CDV.

[0043] Preferably, the CDV vector of the present invention comprises an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 6 or SEQ ID NO: 7. Thus, the CDV vector of the present invention preferably comprises a heterologous nucleotide sequence of interest, wherein the heterologous nucleotide sequence of interest is an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 6 or SEQ ID NO: 7.

[0044] Thus, according to a preferred aspect, the CDV vector of the present invention comprises an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 6. Thus, according to a preferred aspect, the CDV vector of the present invention comprises a heterologous nucleotide sequence of interest, wherein the heterologous nucleotide sequence of interest is an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 6.

[0045] According to another preferred aspect, the CDV vector of the present invention thus comprises an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 7. Thus, according to another preferred aspect, the CDV vector of the present invention comprises a heterologous nucleotide sequence of interest, wherein the heterologous nucleotide sequence of interest is an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 7.

[0046] Specifically, the CDV vector of the present invention comprises an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 8. Thus, the CDV vector of the present invention specifically comprises a heterologous nucleotide sequence of interest, wherein the heterologous nucleotide sequence of interest is an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 8.

[0047] The CDV vector of the present invention preferably further comprises an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 9, and wherein the RNA sequence is flanked at the 5′ end by an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 8.

[0048] The CDV vector of the present invention preferably further comprises an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 10, and wherein the RNA sequence is flanked at the 3′ end by an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 8.

[0049] Most preferably, the CDV vector of the present invention comprises or consists of:

[0050] - a first RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 8, and

[0051] a second RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 9, and wherein the second RNA sequence is flanked on the 5′ end of the first RNA sequence, and

[0052] - a third RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 10, and wherein the third RNA sequence is flanked at the 3' end of the first RNA sequence.

[0053] The present invention further provides a nucleic acid molecule encoding the CDV vector of the present invention, wherein the nucleic acid molecule is preferably a DNA molecule, and wherein the DNA molecule is hereinafter also referred to as a "DNA molecule of the present invention".

[0054] In particular, the nucleic acid molecule is an isolated nucleic acid molecule.

[0055] Preferably, the nucleic acid molecule comprises a DNA sequence encoding a PEDV spike (S) protein, and wherein the sequence is preferably a DNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.

[0056] In a preferred aspect, the nucleic acid molecule thus comprises a DNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 11.

[0057] In another preferred aspect, the nucleic acid molecule thus comprises a DNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO:12.

[0058] Furthermore, the present invention provides a DNA molecule, in particular a DNA molecule of the present invention, wherein the molecule comprises a DNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 13.

[0059] Specifically, the molecule comprises a DNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO:14.

[0060] The present invention further provides a mammalian host cell comprising

[0061] - a CDV vector of the present invention, or

[0062] - a DNA molecule according to the present invention,

[0063] And wherein the mammalian host cell is preferably an isolated mammalian host cell.

[0064] The present invention also provides

[0065] - a CDV vector of the present invention, or

[0066] -DNA molecules of the present invention

[0067] It is used as a medicament, preferably as a vaccine.

[0068] In addition, in the context of the present invention, a DNA construct comprising a DNA molecule of the present invention is provided, wherein the DNA construct is specifically a DNA vector, such as a plasmid. A DNA vector or plasmid into which a DNA molecule of the present invention can be inserted will be recognized by those skilled in the art. The DNA construct as described herein is preferably an isolated DNA construct. As used herein, the term "comprising a DNA molecule" is specifically to be understood as being equivalent to the term "comprising the sequence of a DNA molecule."

[0069] Furthermore, the present invention provides RNA transcripts of the DNA constructs described herein, wherein the RNA transcripts are preferably isolated RNA transcripts.

[0070] The present invention also provides cells transfected with the DNA constructs described herein, wherein the cells are preferably isolated cells.

[0071] Furthermore, the present invention provides a cell transfected with the RNA transcript mentioned herein, wherein the cell is preferably an isolated cell.

[0072] Preferably, the cell line is from a eukaryotic cell line.

[0073] In particular aspects of the methods of the present invention, the cell line is a Vero cell, a ST cell, a BHK-21 cell, a Ma104 cell, a MDBK cell, a RK13 cell, a MDCK cell, or a PK15 cell.

[0074] All cell lines mentioned are well known to those skilled in the art and are publicly available. Vero cells are exemplarily deposited at the American Tissue Culture Collection under the accession number ATCC CCL-81. ST cells are exemplarily deposited at the American Tissue Culture Collection under the accession number CRL-1746. BHK-21 cells are exemplarily deposited at the American Tissue Culture Collection under the accession number ATCC CCL-10. MDCK cells are exemplarily deposited at the American Tissue Culture Collection under the accession numbers ATCC CCL-34 or ATCC CRL-2285.

[0075] Most preferably, the cell or mammalian host cell, respectively, is a Vero cell.

[0076] Furthermore, in the context of the present invention, a method for preparing an infectious CDV containing a heterologous gene, in particular a CDV vector of the present invention, is provided, wherein the method comprises the following steps:

[0077] a. Providing a host cell expressing a heterologous RNA polymerase;

[0078] b. transfecting a host cell with a DNA construct as described herein, wherein the DNA molecule of the present invention included in the DNA construct is transfected by a heterologous RNA polymerase, and

[0079] c. Isolating the viruses produced by the cells.

[0080] Preferably, the CDV vectors of the present invention are grown in Vero cells.

[0081] Therefore, the host cell as referred to herein is preferably a Vero cell.

[0082] Because CDV has a negative strand RNA genome, it is necessary to have an RNA polymerase, preferably T7 RNA polymerase or an RNA polymerase encoded by CDV, in the transfected cells. Most preferably, T7 RNA polymerase is used. The presence of RNA polymerase in the transfected cells can be provided, for example, by co-transfection of a plasmid encoding and expressing RNA polymerase or by penetrating the cells with RNA polymerase protein. According to the present invention, in this regard, it is particularly preferred to use transgenic cells that produce RNA polymerase, for example, by transfection of a DNA construct into BHK-21 cells expressing T7 polymerase or into BSR-T7 / 5 cells. Alternatively, cells can also be transfected with mRNA encoding RNA polymerase and translated into RNA polymerase when transfected into host cells.

[0083] According to another aspect, the present invention further provides use of the CDV vector of the present invention or the cell described herein for the manufacture of an immunogenic composition or vaccine.

[0084] In yet another aspect, the present invention also provides an immunogenic composition, also referred to herein as "the immunogenic composition of the present invention", wherein the immunogenic composition comprises

[0085] a. a CDV vector of the present invention, wherein the vector is optionally an infectious and / or attenuated virus, or wherein the vector is optionally an attenuated and / or modified live virus, and

[0086] b. a recombinant protein expressed by the vector and / or a quaternary structure comprising a plurality of recombinant proteins expressed by the vector, and

[0087] c. Optionally a pharmaceutically or veterinarily acceptable carrier or excipient, wherein preferably, the carrier is suitable for intranasal administration.

[0088] In particular it is to be understood that the phrase "expressed by the vector" or "expressed by the vector" as used herein is specifically equivalent to "expressed in cells infected by the vector" or "expressed in cells infected by the vector", respectively.

[0089] For the purposes of the present invention, a "quaternary structure comprising multiple recombinant proteins" refers to a three-dimensional arrangement of multiple such recombinant proteins, such as a trimer structure consisting of three PEDV S proteins associated along the coiled coil included in the amino acid sequence of the protein(s).

[0090] Preferably, the recombinant protein expressed by the vector is

[0091] -PEDV S protein, or

[0092] -PEDV N protein.

[0093] Specifically, the recombinant protein expressed by the vector is a PEDV S protein, specifically comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0094] As another preferred option, the recombinant protein expressed by the vector is PEDV S protein, specifically comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

[0095] According to another preferred aspect, the immunogenic composition of the present invention comprises or consists of:

[0096] a. CDV vector of the present invention, and

[0097] b. a polypeptide comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2, wherein the polypeptide is preferably a recombinant protein expressed by the vector,

[0098] c. and optionally a pharmaceutically or veterinarily acceptable carrier or excipient, wherein the carrier is preferably suitable for intranasal administration.

[0099] Preferably, the CDV vector comprises a heterologous nucleotide sequence of interest encoding the polypeptide that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0100] According to another preferred option, the immunogenic composition of the present invention comprises or consists of:

[0101] a. CDV vector of the present invention, and

[0102] b. a polypeptide comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17, wherein the polypeptide is preferably a recombinant protein expressed by the vector,

[0103] c. and optionally a pharmaceutically or veterinarily acceptable carrier or excipient, wherein the carrier is preferably suitable for intranasal administration.

[0104] Preferably, the CDV vector comprises a heterologous nucleotide sequence of interest encoding the polypeptide that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

[0105] The present invention also provides a vaccine or pharmaceutical composition, which is hereinafter referred to as "the vaccine or pharmaceutical composition of the present invention", wherein the vaccine or pharmaceutical composition comprises

[0106] a. CDV vector of the present invention, and

[0107] b. a recombinant protein expressed by the vector and / or a quaternary structure comprising a plurality of recombinant proteins expressed by the vector, and

[0108] c. a pharmaceutically or veterinarily acceptable carrier or excipient, wherein the carrier is preferably suitable for oral, intradermal, intramuscular or intranasal administration, and

[0109] d. Optionally the vaccine further comprises an adjuvant,

[0110] The recombinant protein expressed by the vector is preferably PEDV S protein or PEDV N protein.

[0111] Preferably, the recombinant protein expressed by the vector included in the vaccine or pharmaceutical composition of the present invention is PEDV S protein, and wherein the PEDV S protein specifically comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0112] As another preferred option, the recombinant protein expressed by the vector included in the vaccine or pharmaceutical composition of the present invention is PEDV S protein, and wherein the PEDV S protein specifically comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

[0113] The present invention further provides a method for preparing an immunogenic composition or vaccine for reducing the incidence or severity of one or more clinical signs associated with or caused by an infection, comprising the steps of:

[0114] a. Infecting mammalian host cells, particularly Vero cells, with the vector of the present invention,

[0115] b. Cultivate infected cells under appropriate conditions,

[0116] c. Collect infected cell cultures,

[0117] d. optionally purifying the collected infected cell culture of step c),

[0118] e. optionally mixing the collected infected cell culture with a pharmaceutically acceptable carrier,

[0119] And wherein the immunogenic composition or vaccine preferably reduces the severity of one or more clinical signs associated with or caused by infection with porcine epidemic diarrhea virus (PEDV). In addition, the present invention relates to a method of immunizing an individual, comprising administering to the individual the immunogenic composition of the present invention.

[0120] Advantageously, the immunogenic compositions of the present invention have been shown to be safe and effective.

[0121] The term "immunizing" refers to active immunization achieved by administering an immunogenic composition to the individual to be immunized, thereby eliciting an immunological response against the antigens included in the immunogenic composition.

[0122] Preferably, the immunization results in a reduction in the incidence of, or a reduction in the severity of, clinical signs caused by or associated with, a specific PEDV infection in a herd.

[0123] Furthermore, immunization of individuals in need thereof using the immunogenic compositions provided herein can prevent infection of individuals infected with PEDV. Even more preferably, immunization results in an effective, long-lasting immunological response against PEDV infection. It is understood that this period of time will last for more than 1 month, preferably more than 2 months, preferably more than 3 months, more preferably more than 4 months, more preferably more than 5 months, and more preferably more than 6 months. It is understood that immunization may not be effective in all individuals immunized. However, the term requires that a substantial portion of the individuals in the herd be effectively immunized.

[0124] Preferably, in this context, a herd of individuals is designed that would normally (i.e., without immunization) develop clinical signs typically caused by or associated with PEDV infection. A person skilled in the art can determine whether a herd of individuals has been effectively immunized without further explanation. Preferably, immunization will be effective if at least 33%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, still more preferably at least 95%, and most preferably 100% of the individuals in a given herd have at least 10%, more preferably at least 20%, still more preferably at least 30%, even more preferably at least 40%, still more preferably at least 50%, even more preferably at least 60%, still more preferably at least 70%, even more preferably at least 80%, still more preferably at least 90%, still more preferably at least 95%, and most preferably 100% of the clinical signs in the individuals of a given herd are reduced in incidence or severity compared to individuals who have not been immunized or who have been immunized with an immunogenic composition obtained prior to the present invention but who are subsequently infected with a specific PEDV.

[0125] Furthermore, the present invention provides a method of treating and / or preventing clinical signs caused by PEDV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of an immunogenic composition of the present invention.

[0126] Advantageously, the immunogenic compositions of the present invention have been shown to reduce clinical signs caused by PEDV infection.

[0127] The term "treatment and / or prevention" specifically refers to reducing the incidence of a specific PEDV infection in a herd or reducing the severity of clinical signs caused by or associated with a specific PEDV infection. Therefore, the term "treatment and / or prevention" also refers to reducing the number of individuals infected with a specific PEDV in a herd (= reducing the incidence of a specific PEDV infection), or reducing the severity of clinical signs typically associated with or caused by a PEDV infection, or reducing viral shedding after a specific PEDV infection, or preventing or alleviating diarrhea after a specific PEDV infection in a population of individuals who have received an effective amount of an immunogenic composition as provided herein, compared to a population of individuals who have not received such an immunogenic composition.

[0128] "Treatment and / or prevention" generally involves administering an effective amount of the immunogenic composition of the present invention to an individual or group of individuals in need of or who would benefit from such treatment / prevention. The term "treatment" refers to administering an effective amount of the immunogenic composition after at least some individuals in the individual or group have been infected with the PEDV and wherein such individuals have shown some clinical signs caused by or associated with the PEDV infection. The term "prevention" refers to administering to an individual before any infection of the individual with the PEDV or before at least no individual in the individual or group of individuals shows any clinical signs caused by or associated with the PEDV infection. The terms "prevention" and "prevent" are used interchangeably in this application.

[0129] Preferably, clinical signs are reduced in incidence or severity by at least 10%, more preferably at least 20%, still more preferably at least 30%, even more preferably at least 40%, still more preferably at least 50%, even more preferably at least 60%, still more preferably at least 70%, even more preferably at least 80%, still more preferably at least 90%, still more preferably at least 95%, and most preferably 100%, compared to an individual who has not been treated or has been treated with an immunogenic composition obtained prior to the present invention but who is subsequently infected with a specific PEDV.

[0130] As used herein, the term "clinical signs" specifically refers to signs that a subject is infected with PEDV. Examples of such clinical signs include, but are not limited to, viral load, diarrhea, shedding, elevated body temperature, mortality, gross pathological lesions in the intestine, depression, weight loss, decreased growth rate, and decreased appetite. However, clinical signs also include, but are not limited to, clinical signs that can be directly observed in live animals. Examples of clinical signs that can be directly observed in live animals include weight loss, decreased growth rate, decreased appetite, dehydration, watery diarrhea, vomiting, lameness, lethargy, emaciation, and weakness, among others.

[0131] Preferably, the reduction in incidence or severity of clinical signs in treated individuals refers to reduced weight loss, lower viral load, reduced diarrhea, reduced shedding, reduced rectal temperature, reduced mortality, reduced gross pathological lesions in the intestine, or a combination thereof, compared to individuals who are not treated or who are treated with an immunogenic composition obtained prior to the present invention but are subsequently infected with a specific PEDV.

[0132] Additionally, the present invention provides a method of reducing diarrhea in a subject compared to a non-immunized control group of subjects of the same species, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition of the present invention.

[0133] Additionally, the present invention provides a method of reducing mortality in a subject compared to a non-immunized control group of subjects of the same species, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition of the present invention.

[0134] The term "reducing mortality" means that the mortality rate is reduced by at least 10%, more preferably at least 20%, still more preferably at least 30%, even more preferably at least 40%, still more preferably at least 50%, even more preferably at least 60%, still more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, still more preferably at least 95%, and most preferably 100%, compared to an individual who is not treated (or immunized) but is subsequently infected with a specific PEDV.

[0135] Thus, it will be appreciated that an individual may be vaccinated with the immunogenic composition of the invention to reduce or prevent clinical signs, such as diarrhoea or mortality, in the individual. Preferably, the individual is a piglet, pig or sow.

[0136] Furthermore, the present invention provides a method for inducing the production of antibodies specific for PEDV in an individual, wherein the method comprises administering to the individual an immunogenic composition of the present invention. Preferably, the individual is a piglet, a pig or a sow.

[0137] Furthermore, the present invention provides a method for inducing the production of antibodies specific for PEDV in a sow, wherein the method comprises administering the immunogenic composition of the present invention to the sow.

[0138] The term "antibodies specific for PEDV" refers to detectable anti-PEDV antibodies. Furthermore, anti-PEDV antibodies have been developed in sows in response to vaccination with the PEDV vaccines of the present invention. The term "antibodies specific for PEDV" should further mean, but is not limited to, sows having a detectable anti-PEDV antibody titer, preferably at least 1:10, more preferably 1:20 or greater, even more preferably 1:40 or greater, even more preferably 1:80 or greater, even more preferably 1:160, even more preferably 1:320 or greater, and most preferably 1:640 or greater. Preferably, the anti-PEDV antibody titer is detectable and quantifiable in a specific anti-PEDV immunoassay.

[0139] Advantageously, the immunogenic compositions of the present invention have been shown to induce the production of antibodies specific for PEDV in sows.

[0140] Those skilled in the art are familiar with how to detect the production of antibodies specific for PEDV, for example, by ELISA analysis (ELISA is commercially available).

[0141] Furthermore, the present invention provides a method for reducing diarrhea in piglets compared to a non-immunized control group of piglets, the method comprising administering a therapeutically effective amount of an immunogenic composition of the present invention to a sow of the piglets, wherein the piglets are to be nursed by the sow. As used herein, the term "sow of the piglets" is specifically to be understood as being equivalent to "mother sow of the piglets" or "nursing sow of the piglets", respectively.

[0142] Furthermore, the present invention provides a method of reducing mortality in piglets compared to a non-immunized control group of piglets, the method comprising administering a therapeutically effective amount of an immunogenic composition of the present invention to the sow of the piglet, wherein the piglet is to be nursed by the sow.

[0143] Furthermore, the present invention provides a method of reducing mortality in piglets compared to a non-immunized control group of piglets, the method comprising administering a therapeutically effective amount of an immunogenic composition of the present invention to the sow of the piglet, wherein the piglet is to be nursed by the sow.

[0144] Furthermore, the present invention provides methods of reducing or preventing clinical signs or disease caused by PEDV infection in piglets, wherein the piglets are to be nursed by sows to which the immunogenic composition of the present invention has been administered.

[0145] Preferably, the reduced clinical sign is mortality.In addition, the present invention also provides a method of reducing mortality caused by PEDV infection in piglets, wherein the piglets are to be nursed by sows to which the immunogenic composition of the present invention has been administered.

[0146] Furthermore, the present invention provides a method for reducing or preventing clinical signs or diseases caused by PEDV infection in piglets, wherein the method comprises

[0147] - administering the immunogenic composition of the invention to sows, and

[0148] - allowing the piglet to be nursed by the sow.

[0149] Advantageously, the immunogenic compositions of the present invention have been shown to reduce clinical signs in pigs when administered to sows during pregnancy.

[0150] If piglets are vaccinated with the immunogenic composition of the present invention, it must be understood that it takes time for the piglets to actually produce antibodies. Therefore, in another aspect of the method of the present invention, pregnant sows are vaccinated with the immunogenic composition of the present invention. This vaccination results in the production of antibodies specific for PEDV in the sow. The maternal antibodies from the sow are then passively transferred to the newborn piglets via colostrum and / or milk.

[0151] In another specific aspect of the method of the present invention, the sow to which the immunogenic composition is administered is a pregnant sow, in particular a sow carrying the piglet. However, it should be understood that the piglet can be nursed by any sow that gives colostrum or milk, in particular a sow to which the immunogenic composition has been administered.

[0152] In another specific aspect of the method of the present invention, the method comprises the following steps:

[0153] - administering the immunogenic composition of the present invention to a sow carrying the piglet,

[0154] - causing the sow to give birth to the piglet, and

[0155] - allowing the piglet to be nursed by the sow.

[0156] In another specific aspect of the method of the invention, the method produces an improvement in a clinical sign or performance parameter selected from the group consisting of: reduced weight loss, lower viral load, reduced diarrhea, reduced shedding, reduced rectal temperature, reduced mortality, reduced gross pathological lesions in the intestine, or a combination thereof, compared to individuals in a non-immune control group of the same species.

[0157] In another specific aspect of the method of the invention, the individual is a piglet, a pig or a sow.

[0158] Preferably, the immunogenic composition is administered to an individual within the first two months of age, more preferably within the first month of age.

[0159] In another specific aspect of the method of the invention, the immunogenic composition is administered to an individual within the first month of age.

[0160] Thus, it must be understood that the immunogenic composition may be administered to an individual, exemplarily within the first three weeks of age or within the first two weeks of age.

[0161] In another specific aspect of the method of the present invention, the immunogenic composition is administered to sows during pregnancy and lactation.

[0162] Advantageously, the immunogenic compositions of the present invention have been shown to be safe when administered to sows during pregnancy.

[0163] Thus, a method of vaccinating pigs against PEDV is provided by administering a PEDV vaccine of the present invention to a pregnant sow at least twice before farrowing, preferably three times before farrowing, and more preferably twice before farrowing ("repeat dose"). Preferably, the vaccine is administered to a pregnant sow twice before farrowing with a single dose of the PEDV vaccine of the present invention. However, when the vaccine is administered to a sow twice, the first administration should occur between 12 weeks and 4 weeks before farrowing, more preferably between 9 weeks and 5 weeks before farrowing. The second administration should occur between 8 weeks and 1 week before farrowing, more preferably between 6 weeks and 1 week before farrowing.

[0164] In another specific aspect of the method of the invention, the immunogenic composition is administered in two or more doses.

[0165] Advantageously, the immunogenic compositions of the present invention have been shown to induce the production of antibodies specific for PEDV following two doses, preferably intranasally.

[0166] In another specific aspect of the method of the invention, the immunogenic composition is administered to the sow twice, the first administration between 9 weeks and 5 weeks before farrowing, and the second administration between 6 weeks and 1 week before farrowing.

[0167] Preferably, the immunogenic composition is administered topically or systemically. Suitable routes of administration are oral or parenteral, such as intranasal, intravenous, intramuscular, intraperitoneal, subcutaneous, and inhalation. However, depending on the nature and mode of action of the compound, the immunogenic composition may be administered by other routes. Most preferably, however, the immunogenic composition is administered intranasally or orally.

[0168] In another specific aspect of the method of the invention, the immunogenic composition is administered intranasally, mucosally, orally, intradermally, or intramuscularly.

[0169] Advantageously, the immunogenic compositions of the present invention have been shown to be effective when administered intranasally.

[0170] In another specific aspect of the method of the invention, the immunogenic composition is administered intranasally or orally.

[0171] Preferably, the immunogenic composition comprises between 1×10 2 to 1×10 9 TCID 50 / ml, more preferably between 1×10 3 to 1×10 7 TCID 50 / ml and most preferably between 1×10 4 to 1×10 6 TCID 50 / ml.

[0172] In another specific aspect of the method of the present invention, the immunogenic composition comprises between 1×10 3 to 1×10 7 TCID 50 / ml.

[0173] The term "TCID 50 " / ml" refers to a measure of the infectious virus titer. Specifically, the tissue culture infectious dose (TCID50 / ml) gives the dilution of a viral preparation that infects 50% of various cell cultures inoculated in parallel with the dilution.

[0174] In another specific aspect of the method of the invention, the method results in reduced shedding from day 2 after challenge or infection.

[0175] In another specific aspect of the method of the invention, the method results in reduced shedding from day 3 post-challenge or infection.

[0176] In another specific aspect of the method of the invention, the method results in reduced shedding from day 4 after challenge or infection.

[0177] In another specific aspect of the method of the invention, the method results in reduced shedding from day 5 after challenge or infection.

[0178] In another specific aspect of the method of the invention, the method results in reduced shedding from day 7 post-challenge or infection.

[0179] In another specific aspect of the method of the invention, the method results in reduced shedding from day 10 after challenge or infection.

[0180] In another specific aspect of the method of the invention, the method results in reduced shedding from day 5, 7 or 10 after challenge or infection.

[0181] Advantageously, the immunogenic compositions of the invention have been demonstrated to reduce shedding following infection or challenge.

[0182] The term "reduction in shedding" means a reduction in shedding of at least 10%, more preferably at least 20%, still more preferably at least 30%, even more preferably at least 40%, still more preferably at least 50%, even more preferably at least 60%, still more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, still more preferably at least 95%, and most preferably 100%, compared to an individual who has not been treated (or immunized) but is subsequently infected with a specific PEDV. Those skilled in the art are familiar with how to measure viral shedding.

[0183] The term "shedding" refers to the secretion of PEDV in fecal excretion or feces. Thus, shedding can be measured by examining the viral titer in fecal excretion, feces, or rectal swabs. The term "shedding" further encompasses viral transfer to susceptible animals (i.e., sentinels). Those skilled in the art are familiar with how to measure viral shedding, for example, by PCR, qPCR, or ELISA.

[0184] In another specific aspect of the method of the invention, the method increases protection against homologous attack.

[0185] Advantageously, the immunogenic compositions of the present invention have been shown to be protective following challenge.

[0186] The present invention provides use of the CDV vector of the present invention or the immunogenic composition of the present invention for the manufacture of a medicament.

[0187] The present invention also provides use of the CDV vector of the present invention or the immunogenic composition of the present invention for treating and / or preventing clinical signs caused by PEDV infection in an individual or for alleviating diarrhea in an individual.

[0188] The present invention also relates to:

[0189] - the immunogenic composition of the present invention or

[0190] - The vaccine or pharmaceutical composition of the present invention

[0191] It is used in a method for reducing or preventing clinical signs or diseases caused by PEDV infection or in a method for treating or preventing PEDV infection in an animal, wherein preferably the animal is a pig.

[0192] In particular, the present invention also relates to an immunogenic composition or a vaccine according to the present invention or a pharmaceutical composition according to the present invention for use in a method for inducing an immune response against PEDV in pigs, in particular preferably pregnant sows.

[0193] In one aspect, the immunogenic composition or vaccine of the invention or the pharmaceutical composition of the invention is used in a method for reducing or preventing clinical signs or diseases caused by PEDV infection in piglets, wherein the piglets are to be nursed by a sow to which the immunogenic composition has been administered, and wherein the sow is preferably a sow to which the immunogenic composition has been administered while the sow is pregnant, in particular while carrying the piglets.

[0194] According to a particularly preferred aspect of the present invention, in this use, the immunogenic composition or vaccine of the present invention or the pharmaceutical composition of the present invention is to be administered transmucosally, preferably intranasally, to the sow, for example.

[0195] The present invention further provides a method for inducing antibodies specific for PEDV in sows, wherein the method comprises administering to the sow an immunogenic composition of the present invention or a vaccine or pharmaceutical composition of the present invention, in particular comprising a CDV vector of the present invention encoding a PEDV S protein, wherein the PEDV S protein comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2. The present invention further provides a method for inducing antibodies specific for PEDV in a sow, wherein the method comprises administering to the sow an immunogenic composition of the present invention, or a vaccine or pharmaceutical composition of the present invention, specifically comprising a CDV vector of the present invention encoding a PEDV S protein, wherein the PEDV S protein comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

[0196] Furthermore, the present invention specifically provides a method for reducing or preventing clinical signs or diseases caused by PEDV infection in piglets, wherein the method comprises

[0197] - administering to sows an immunogenic composition of the invention or a vaccine or pharmaceutical composition of the invention, in particular comprising a CDV vector of the invention encoding a PEDV S protein comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and

[0198] - allowing the piglet to be nursed by the sow.

[0199] Furthermore, the present invention specifically provides a method for reducing or preventing clinical signs or diseases caused by PEDV infection in piglets, wherein the method comprises

[0200] - administering to sows an immunogenic composition of the invention or a vaccine or pharmaceutical composition of the invention, in particular comprising a CDV vector of the invention encoding a PEDV S protein comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17, and

[0201] - allowing the piglet to be nursed by the sow, or allowing the piglet to suckle from the sow, respectively.

[0202] Preferably, the sow is pregnant, in particular is pregnant with the piglet.

[0203] More preferably, the method of reducing or preventing clinical signs or disease caused by PEDV infection in piglets comprises the following steps:

[0204] administering to a sow pregnant with the piglet an immunogenic composition of the invention, or a vaccine or pharmaceutical composition of the invention, in particular comprising a CDV vector of the invention encoding a PEDV S protein comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2,

[0205] - causing the sow to give birth to the piglet, and

[0206] - allowing the piglet to be nursed by the sow.

[0207] As another preferred option, the method of reducing or preventing clinical signs or diseases caused by PEDV infection in piglets comprises the following steps:

[0208] - administering to the sow pregnant with the piglet the immunogenic composition of the invention or the vaccine or pharmaceutical composition of the invention, in particular comprising the CDV vector of the invention encoding the PEDV S protein comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17,

[0209] - causing the sow to give birth to the piglet, and

[0210] - allowing the piglet to be nursed by the sow, or allowing the piglet to suckle from the sow, respectively.

[0211] Preferably, the immunogenic composition or vaccine of the invention or the pharmaceutical composition of the invention is administered to the animal transmucosally, for example by intranasal administration.

[0212] Most preferably, in this method of reducing or preventing clinical signs or disease caused by PEDV infection in piglets, the immunogenic composition or the vaccine or pharmaceutical composition is administered mucosally, preferably intranasally, to the sow.

[0213] According to another preferred aspect, the present invention also provides a kit for inducing an immune response against at least one pathogen, in particular against PEDV, in pigs or for vaccinating pigs against diseases associated with PEDV and / or reducing the incidence or severity of one or more clinical signs associated with or caused by PEDV in pigs, comprising:

[0214] a) a syringe or dispenser capable of administering the vaccine to the pig; and

[0215] b) an immunogenic composition of the invention or a vaccine or pharmaceutical composition of the invention, and

[0216] c) Optional instruction manual.

[0217] definition

[0218] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the invention pertains at the time of application. The meaning and scope of the terms should be clear; however, if there is any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definition. In addition, unless the context otherwise requires, singular terms include plural forms and plural terms include the singular. In this document, the use of "or" means "and / or" unless otherwise stated. In addition, the use of the term "including" and other forms (such as "includes" and "included") does not have a limiting meaning. All patents and publications mentioned herein are incorporated herein by reference.

[0219] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of virology, molecular biology, microbiology, recombinant DNA technology, protein chemistry and immunology, which are within the skill of the art and are fully explained in the literature. See, e.g., Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory Manual, Vols. I, II, and III, 2nd ed. (1989); DNA Cloning, Vols. I and II (D.N. Glover, ed., 1985); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Nucleic Acid Hybridization (B.D. Hames and S.J. Higgins, eds., 1984); Animal Cell Culture (R.K. Freshney, ed., 1986); Fixed Cells and Enzymes (IRL press, 1986); Perbal, B., A Practical Guide to Molecular Cloning (1984); Series, Methods in Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.); Protein Purification Methods - A Practical Approach (E.L.V. Harris and S. Angal, eds., IRL Press at Oxford University Press); and Handbook of Experimental Immunology, Volumes I-IV (DM Weir and CC Blackwell, eds., 1986, Blackwell Scientific Publications).

[0220] Before elaborating on the present invention in detail, it should be understood that the present invention is not limited to specific DNA, polypeptide sequences or process parameters, as these may of course vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments of the present invention only and is not intended to be limiting. It must be noted that the singular forms "a, an" and "the" used in this specification and the accompanying claims include plural designators unless the content clearly indicates otherwise. Thus, for example, a reference to an "antigen" includes a mixture of two or more antigens, a reference to an "excipient" includes a mixture of two or more excipients, and the like.

[0221] CDV Definition

[0222] As used herein, the term "3' non-coding region of a specific gene of CDV (e.g., H gene)" specifically refers to an RNA sequence of an expressible specific gene (e.g., H gene) of a preferably infectious CDV, which RNA sequence is flanked by the 3' end of the coding sequence (i.e., the 3' end of the RNA triplet complementary to the start codon) and includes the gene start sequence of the gene. Therefore, more specifically, the "3' non-coding region sequence" as referred to herein is an RNA sequence that is identical to the entire 3' non-coding sequence of an expressible specific gene (e.g., H gene) of a preferably infectious CDV. More specifically, the "3' non-coding region" as referred to herein is an RNA sequence that is identical to the non-coding sequence of a specific gene of CDV (e.g., H gene), wherein the non-coding sequence is flanked by (a) a coding sequence and (b) an intergenic sequence connecting the gene to the next gene in the 3' direction.

[0223] As used herein, the term "intergenic region" specifically refers to an RNA sequence connecting the 5' end of a gene of CDV with the 3' start of an adjacent gene in the 5' direction of CDV.

[0224] The term "gene start sequence" as used herein is specifically equivalent to the term "gene start signal".

[0225] As used herein, it is to be understood that the term "genomic promoter of CDV" is equivalent to the term "genomic leader sequence of CDV".

[0226] PEDV spike protein definition

[0227] The term "PEDV" is well known to those skilled in the art. PEDV stands for Porcine Epidemic Diarrhea Virus and is a member of the Coronavirinae subfamily of the genus Alphacoronavirus.

[0228] The term "spike" refers to a specific protein of PEDV that is well known to those skilled in the art. The spike protein is the primary inducer of antibodies and protective immune responses. Furthermore, the spike protein plays a major role in the cellular entry of PEDV by binding to host cell receptors and mediating viral-cellular membrane fusion with host cells.

[0229] The terms "protein," "amino acid," and "polypeptide" are used interchangeably. The term "protein" refers to an amino acid (aa) sequence composed of naturally occurring amino acids and their derivatives. Natural amino acids or genetically encoded amino acid residues, respectively, are well known in the art and described in standard biochemistry textbooks. Within an amino acid sequence, amino acids are linked by peptide bonds. Furthermore, the two ends of an amino acid sequence are referred to as the carboxyl terminus (C-terminus) and the amino terminus (N-terminus). The term "protein" encompasses substantially purified proteins or protein preparations that additionally contain other proteins. Furthermore, the term also refers to protein fragments. Furthermore, it includes chemically modified proteins. Such modifications can be artificial or naturally occurring, such as phosphorylation, glycosylation, myristoylation, and the like.

[0230] Molecular Biology Definition

[0231] The phrase "a sequence flanking the 5' end of ... " as used herein is in particular equivalent to the phrase "a sequence covalently linked to the 5' end of ... " or the phrase "a sequence wherein its 3' terminal nucleotide is covalently linked to the 5' terminal nucleotide of ... ", respectively, wherein it is to be understood in particular that the two terminal nucleotides are covalently linked between the phosphate group attached to the 5' carbon of the pentose and the 3' carbon atom of the adjacent pentose.

[0232] The phrase "a sequence flanking the 3' end of ... " as used herein is in particular equivalent to the phrase "a sequence covalently linked to the 3' end of ... " or the phrase "a sequence wherein the 5' terminal nucleotide thereof is covalently linked to the 3' terminal nucleotide of ... ", respectively, wherein it is to be understood in particular that the two terminal nucleotides are covalently linked between the 3' carbon atom of the pentose and the phosphate group linked to the 5' carbon of the adjacent pentose.

[0233] As known in the art, the term "vector" refers to a polynucleotide construct for delivering genetic material to a host cell, typically a plasmid or bacterial artificial chromosome. A vector may be, for example, a bacterium, a virus, a phage, a bacterial artificial chromosome, a cosmid, or a plasmid. As used herein, a vector may be composed of or comprise DNA or RNA. In some embodiments, the vector is composed of DNA. In some embodiments, the vector is an infectious virus. The viral vector contains a viral genome manipulated to carry exogenous genes that do not function in viral vector replication in cell culture or host animals. According to a specific aspect of the present invention, the vector can be used in various aspects, such as the delivery of genetic material only, for transfection of host cells or organisms, as a vaccine (e.g., a DNA vaccine), or for gene expression purposes. Gene expression is a term describing the biosynthesis of proteins in cells directed by specific polynucleotide sequences called genes. In a specific aspect, a vector may be an "expression vector," which is a vector that, when present in an appropriate environment, can direct the expression of proteins encoded by one or more genes carried by the vector.

[0234] Vectors and methods for preparing and / or using vectors (or recombinants) for expression can be by methods disclosed in, or analogous to, U.S. Patents 4,603,112, 4,769,330, 5,174,993, 5,505,941, 5,338,683, 5,494,807, 4,722,848, 5,942,235, 5,364,773, 5,762,938, 5,770,212, 5,942,235, 382,425, PCT Publications WO 94 / 16716, WO 96 / 39491, WO 95 / 30018; Paoletti, “Applications of pox virus vectors to vaccination: An update,” PNAS USA 93:11349-11353, October 1996; Moss, "Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety", PNAS USA 93:11341-11348, October 1996; Smith et al., U.S. Patent No. 4,745,051 (recombinant baculovirus); Richardson, CD (ed.), Methods in Molecular Biology 39, "Baculovirus Expression Protocols" (1995 Humana Press Inc.Smith et al., "Production of Human Beta Interferon in Insect Cells Infected with a Baculovirus Expression Vector", Molecular and Cellular Biology, December 1983, Vol. 3, No. 12, pp. 2156-2165; Pennock et al., "Strong and Regulated Expression of Escherichia coli B-Galactosidase in Infect Cells with a Baculovirus vector", Molecular and Cellular Biology, March 1984, Vol. 4, No. 3, p. 406; EPA 0 370 573; U.S. Application No. 920,197, filed October 16, 1986; EP Patent Publication No. 265 785; U.S. Patent No. 4,769,331 (recombinant herpes virus); Roizman, "The function of herpes simplex virus genes: A primer for genetic engineering of novel vectors", PNAS USA 93:11307-11312, October 1996; Andreansky et al., “The application of genetically engineered herpes simplex viruses to the treatment of experimental brain tumors,” PNAS USA 93:11313-11318, October 1996; Robertson et al., “Epstein-Barr virus vectors forgene delivery to B lymphocytes,” PNAS USA 93:11334-11340, October 1996; Frolov et al., “Alphavirus-based expression vectors: Strategies and applications,” PNAS USA 93:11371-11377, October 1996; Kitson et al., J. Virol.65, 3068-3075, 1991; U.S. Patent Nos. 5,591,439 and 5,552,143; WO 98 / 00166; allowed U.S. application Nos. 08 / 675,556 and 08 / 675,566, both filed July 3, 1996 (recombinant adenovirus); Grunhaus et al., 1992, “Adenovirus as cloning vectors,” Seminars in Virology (Vol. 3), pp. 237-52, 1993; Ballay et al., EMBO Journal, Vol. 4, pp. 3861-65; Graham, Tibtech 8, 85-87, April 1990; Prevec et al., J. Gen Virol. 70, 424-34; PCT WO 91 / 11525; Felgner et al. (1994), J. Biol. Chem.269, 2550-2561, Science, 259: 1745-49, 1993; and McClements et al., “Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease”, PNAS USA 93: 11414-11420, October 1996; and U.S. Patent Nos. 5,591,639, 5,589,466, and 5,580,859, as well as WO 90 / 11092, WO 93 / 19183, WO 94 / 21797, WO 95 / 11307, WO 95 / 20660; Tang et al., Nature, and Furth et al., Analytical Biochemistry, relating to DNA expression vectors. See also WO 98 / 33510; Ju et al., Diabetologia, 41:736-739, 1998 (lentiviral expression system); Sanford et al., U.S. Pat. No. 4,945,050; Fischbach et al. (Intracel); WO 90 / 01543; Robinson et al., Seminars in Immunology, Vol. 9, pp. 271-283 (1997), (DNA vector system); Szoka et al., U.S. Pat. No. 4,394,448 (methods for inserting DNA into living cells); McCormick et al., U.S. Pat. No. 5,677,178 (use of cytopathic viruses); and U.S. Pat. No. 5,928,913 (vectors for gene delivery); and other documents cited herein.

[0235] The term "viral vector" describes a genetically modified virus manipulated by recombinant DNA technology so that it enters a host cell and produces a specific biological activity, such as the expression of a transgene carried by the vector. In a specific aspect, the transgene is an antigen. The viral vector may or may not be replication competent in the target cell, tissue, or organism. In particular, it should be understood that the term "viral vector" as used herein is equivalent to the term "virus vector".

[0236] Production of viral vectors can be accomplished using any suitable genetic engineering technique well known in the art, including but not limited to standard techniques of restriction endonuclease digestion, ligation, transformation, plasmid purification, DNA sequencing, cell culture transfection, for example as described in Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY (1989)) or K. Maramorosch and H. Koprowski (Methods in Virology Volume VIII, Academic Press Inc. London, UK (2014)).

[0237] Viral vectors can incorporate sequences from the genome of any known organism. The sequences can be incorporated in their native form or can be modified in any way to obtain the desired activity. For example, the sequences can include insertions, deletions, or substitutions.

[0238] A viral vector may include coding regions for two or more proteins of interest. For example, a viral vector may include a coding region for a first protein of interest and a coding region for a second protein of interest. The first protein of interest and the second protein of interest may be the same or different. In some embodiments, a viral vector may include coding regions for a third or fourth protein of interest. The third and fourth proteins of interest may be the same or different. The total length of two or more proteins of interest encoded by a viral vector may vary. For example, the total length of the two or more proteins of interest may be at least about 200 amino acids, at least about 250 amino acids, at least about 300 amino acids, at least about 350 amino acids, at least about 400 amino acids, at least about 450 amino acids, at least about 500 amino acids, at least about 550 amino acids, at least about 600 amino acids, at least about 650 amino acids, at least about 700 amino acids, at least about 750 amino acids, at least about 800 amino acids, or longer.

[0239] The terms "viral vector" and "viral construct" are used interchangeably.

[0240] As used herein, the term "construct" refers to an artificially produced recombinant nucleic acid, such as a plasmid, BAC, or recombinant virus.

[0241] The term "plasmid" refers to cytoplasmic DNA that replicates independently of the bacterial chromosome within a bacterial host cell. In a specific aspect of the invention, the terms "plasmid" and / or "transfer plasmid" refer to components of recombinant DNA technology used to construct, for example, expression cassettes for insertion into viral vectors. In another specific aspect, the term "plasmid" can be used to designate a plasmid that can be used for DNA vaccination purposes.

[0242] As used herein, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to any nucleic acid. The term "nucleic acid sequence" should be understood as equivalent to the term "nucleotide sequence." The term "nucleotide sequence" should be understood as equivalent to the term "polynucleotide sequence."

[0243] As used herein, the terms "nucleic acid," "nucleic acid sequence," "nucleotide sequence," "polynucleotide," "polynucleotide sequence," "RNA sequence," or "DNA sequence" refer to oligonucleotides, nucleotides, or polynucleotides, and fragments and portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single-stranded or double-stranded and represent the sense or antisense strand. The sequence may be a non-coding sequence, a coding sequence, or a mixture of the two. The nucleic acid sequences of the present invention may be prepared using standard techniques well known to those skilled in the art.

[0244] The terms "nucleic acid" and "polynucleotide" also specifically include nucleic acids composed of bases other than the five bases (adenine, guanine, thymine, cytosine, and uracil).

[0245] As used herein, the term "promoter" or "promoter sequence" refers to a nucleotide sequence that allows RNA polymerase to bind and direct gene transcription. Typically, a promoter is located in the 5' noncoding region of a gene, near the gene's transcription start site. The sequence components within a promoter that initiate transcription are typically characterized by having a consensus nucleotide sequence. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and animals (e.g., mammals (including horses, pigs, cattle, and humans)), birds, or insects. Promoters can be inducible, repressible, and / or constitutive. Inducible promoters initiate increased transcription from DNA under their control in response to some change in culture conditions (e.g., temperature) (Ptashne, 2014). Examples of promoters familiar to those skilled in the art are, for example, the SV40 large T, HCMV and MCMV immediate early gene 1, the human elongation factor alpha promoter, and the baculovirus polyhedrin promoter.

[0246] The term "complementary nucleotide sequence" describes one of the two paired strands of a polynucleotide, such as DNA or RNA. The nucleotide sequence of the complementary strand mirrors the nucleotide sequence of its paired strand, such that for every adenosine, it contains thymidine (or uracil for RNA), for every guanine a cytosine, and vice versa. For example, the complementary nucleotide sequence of 5'-GCATAC-3' is 3'-CGTATG-5' or for RNA, 3'-CGUAUG-5'.

[0247] As used herein, the terms "gene", "gene of interest" have the same meaning and refer to a polynucleotide sequence of any length encoding a product of interest. The gene may further include a regulatory sequence (5' non-coding or non-translated sequence) and a subsequent regulatory sequence (3' non-coding or non-translated sequence) before the coding sequence. The selected sequence may be a full-length or truncated, fused or tagged gene, and may be a cDNA, genomic DNA or a DNA fragment. It is generally understood that genomic DNA encoding a polypeptide or RNA may include non-coding regions (i.e., introns) spliced from mature messenger RNA (mRNA) and therefore not present in the cDNA encoding the same polypeptide or RNA. It may be a native sequence, i.e., a natural form, or may be mutated, or include sequences derived from different sources or be otherwise modified as needed. Such modifications include codon optimization to optimize codon usage or labeling in the selected host cell. Furthermore, it may include the removal or addition of cis-acting sites, such as (hidden) splice donors, acceptor sites and branch points, polyadenylation signals, TATA-boxes, chi sites, ribosome entry sites, repetitive sequences, secondary structures (e.g. stem-loops), binding sites for transcription factors or other regulatory factors, restriction endonuclease sites, etc., to give only a few, but non-limiting, examples. The selected sequence may encode a secreted, cytoplasmic, nuclear, membrane-bound or cell surface polypeptide.

[0248] As used herein, the term "nucleotide sequence of interest" is a more general term than gene of interest because it does not necessarily include a gene, but may include components or portions of a gene or other genetic information (e.g., an ori (origin of replication)). A nucleotide sequence of interest can be any DNA or RNA sequence, regardless of whether it contains a coding sequence.

[0249] The term "transcription" describes the biosynthesis of mRNA in a cell.

[0250] As used herein, the term "expression" refers to the transcription and / or translation of a nucleic acid sequence in a host cell. According to a specific aspect of the present invention, the term "expression" refers to the transcription and / or translation of a heterologous and / or exogenous nucleic acid sequence in a host cell. The expression of desired products in a host cell can be measured based on the amount of the corresponding RNA or mRNA present in the cell or the amount of the desired polypeptide encoded by the selected sequence. For example, the mRNA transcribed from the selected sequence can be quantitatively analyzed by northern blot hybridization, ribonuclease RNA protection, in situ hybridization with cellular RNA, or by RTqPCR (reverse transcription, followed by quantitative PCR). The protein expressed from the selected sequence can be quantitatively analyzed by various methods, such as by ELISA, western blotting, by radioimmunoassay, by immunoprecipitation, by analyzing the biological activity of the protein, or by immunostaining of the protein, followed by FACS analysis.

[0251] The term "expression cassette" or "transcription unit" or "expression unit" defines a region within a vector, construct or polynucleotide sequence containing one or more genes to be transcribed, wherein the nucleotide sequence encoding the transcribed gene and the polynucleotide sequence containing the regulatory components contained in the expression cassette are operably linked to each other. It is transcribed from an activator, and transcription is terminated by at least one polyadenylation signal. In a specific aspect, it is transcribed from a single promoter. Thus, different genes are at least transcriptionally linked. More than one protein or product can be transcribed and expressed from each transcription unit (polycistronic transcription unit). Each transcription unit will contain the regulatory components required for transcription and translation of any selected sequence contained in the unit. And each transcription unit may contain the same or different regulatory components. For example, each transcription unit may contain the same terminator, IRES components or introns can be used for functional connection of genes within the transcription unit. A vector or polynucleotide sequence may contain more than one transcription unit.

[0252] The term "viral titer" is a measure of the number of infectious units per volume of a viral preparation. Viral titer is an endpoint in biological procedures and is defined as the dilution at which a proportion of tests performed in parallel show an effect (Reed and Muench, 1938). Specifically, the 50% tissue culture infectious dose / ml (TCID50 / ml) gives the dilution of a viral preparation that infects 50% of a variety of cell cultures inoculated in parallel with the dilution.

[0253] A "transcriptional regulatory element" generally comprises a promoter, transcription start and stop sites, and a polyadenylation signal upstream of the gene sequence to be expressed.

[0254] The term "transcription start site" refers to the nucleic acid in a construct corresponding to the first nucleic acid incorporated into the primary transcript (ie, the mRNA precursor). The transcription start site may overlap with the promoter sequence.

[0255] A "termination signal" or "terminator" or "polyadenylation signal" or "poly A" or "transcription termination site" or "transcription termination element" is a sequence that causes cleavage at a specific site at the 3' end of a eukaryotic mRNA and post-transcriptional incorporation of about 100-200 adenine nucleotides (poly A tail) at the cleaved 3' end, thereby causing RNA polymerase to terminate transcription. The polyadenylation signal comprises the sequence AATAAA approximately 10-30 nucleotides upstream of the cleavage site and a sequence located downstream. Various polyadenylation elements are known, such as tk poly A, SV40 late and early poly A, BGH poly A (described, for example, in U.S. Patent No. 5,122,458), or hamster growth hormone poly A (WO2010010107).

[0256] "Translational regulatory elements" include the translation start site (AUG), stop codon, and poly A signal for each individual polypeptide to be expressed. Some constructs may include an internal ribosome entry site (IRES). In order to optimize expression, it may be advisable to remove, add, or alter the 5' and / or 3' non-translated regions of the nucleic acid sequence to be expressed to eliminate any potential additional inappropriate alternative translation start codons or other sequences that may interfere with or reduce expression at the transcription or translation level. A consensus ribosome binding site (Kozak sequence) may be inserted immediately upstream of the start codon to enhance translation and thereby expression. The increased A / U content near this ribosome binding site promotes more efficient ribosome binding.

[0257] By definition, each polynucleotide sequence or each gene inserted into a host cell, and the individual proteins or RNA encoded thereby, is referred to as "exogenous," "exogenous sequence," "exogenous gene," or "exogenous coding sequence" relative to the host cell when it originates from a different (viral) species. The term "exogenous," as used herein with respect to a sequence or gene of interest (e.g., an antigen), means that the sequence or gene of interest, in particular the antigen, is expressed outside the context of its native material. Thus, the PEDV S protein is an example of an exogenous antigen relative to the CDV vector (see Examples). As used herein, the term "exogenous RNA" or "exogenous nucleic acid sequence" refers specifically to a nucleic acid sequence that is introduced into the genome of the CDV virus from an external source, such as a recombinant sequence. Examples of such external sources include PEDV-derived sequences. More specifically, the introduction of an exogenous nucleic acid sequence results in a genome or gene, respectively, having a non-naturally occurring portion. Thus, as used herein, the term "exogenous RNA" refers specifically to a nucleotide sequence that is not naturally found in the CDV genome. Such a non-naturally occurring portion or non-naturally occurring sequence, respectively, may also be the result of the insertion of a naturally occurring nucleotide sequence into another naturally occurring nucleotide sequence.

[0258] By definition, each polynucleotide sequence or each gene inserted into a host cell, and the respective protein or RNA encoded thereby, is referred to as "heterologous," "heterologous sequence," "heterologous gene," "heterologous coding sequence," "transgene," or "heterologous protein" relative to the host cell. This applies even if the sequence to be introduced or the gene to be introduced is identical to an endogenous sequence or endogenous gene of the host cell. For example, the 5' noncoding region of the N gene of CDV introduced into a CDV vector at a site different from that in the CDV wild-type virus or in a modified form is, by definition, a heterologous sequence. As used herein with respect to a sequence or gene of interest (e.g., an antigen), the term "heterologous" means that the sequence or gene of interest, in particular the antigen, is expressed outside the context of its native subtype.

[0259] The term "non-naturally occurring" means any sequence or gene of interest (e.g., antigen) that occurs naturally in this context, such as a hybridizing sequence or a sequence or gene of interest (e.g., antigen) from a different species, or a sequence or gene of interest (e.g., antigen) that is not a product of nature due to man-made mutations, insertions, deletions, or the like.

[0260] Throughout the present specification, the term "recombinant" can be used interchangeably with the terms "non-naturally occurring," "heterologous," and "exogenous." Thus, a "recombinant" protein is a protein expressed from a heterologous or exogenous polynucleotide sequence. The term recombinant, as used with respect to viruses, refers to a virus produced by artificial manipulation of the viral genome. A virus comprising a heterologous or exogenous sequence (e.g., an exogenous antigen encoding sequence) is a recombinant virus. The term recombinant virus is used interchangeably with the term non-naturally occurring virus.

[0261] Thus, the term "heterologous vector" means a vector comprising a heterologous or exogenous polynucleotide sequence. The term "recombinant vector" means a vector comprising a heterologous or recombinant polynucleotide sequence.

[0262] As used herein, the term "operably linked" is used to describe the link between a regulatory element and a gene or its coding region. Typically, gene expression is placed under the control of one or more regulatory elements, such as, but not limited to, constitutive or inducible promoters, tissue-specific regulatory elements, and enhancers. A gene or coding region is said to be "operably linked to," "operably linked to," or "operably associated with" a regulatory element if it means that the gene or coding region is controlled or influenced by the regulatory element. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence.

[0263] In particular it is to be understood that, in the context of the present invention, the term "identical to a sequence [...]" is equivalent to the term "having sequence identity [...] to a sequence".

[0264] As used herein, it is to be understood that the term "at least X% identical to the sequence of SEQ ID NO: Y" is equivalent to the term "at least X% identical to the sequence of SEQ ID NO: Y over the length of SEQ ID NO: Y" or the term "at least X% identical to the sequence of SEQ ID NO: Y over the entire length of SEQ ID NO: Y," respectively. In this context, "X" is any number from 70 to 100, in particular any integer selected from 70 to 100, such that "X% sequence identity" represents any of the % sequence identities mentioned herein. Respectively, "X" in this context is any integer selected from 1 to 17, such that "SEQ ID NO: Y" represents any of the SEQ ID NOs mentioned herein.

[0265] Furthermore, it is to be understood that the term "at least 99% identical" as used herein also encompasses (at one extreme of the range) and is related to the terms "100% identical" or "identical to the sequence", respectively.

[0266] The term "sequence identity" is known in the art and refers to the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, i.e., a reference sequence, and a given sequence to be compared to the reference sequence. Sequence identity is determined by comparing a given sequence to a reference sequence after the sequences are preferably aligned to produce the highest degree of sequence similarity, as determined by the match between the sequence strings. After this alignment, sequence identity is determined on a position-by-position basis, for example, if the nucleotide or amino acid residue is the same at a position, the sequences are "identical" at that position. The total number of these positional identities is then divided by the total number of nucleotides or residues in the reference sequence to obtain the % sequence identity. Sequence identity can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, AN, ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H. and Lipman, D., SIAM J. Applied Molecular Biology. Math., 48:1073 (1988), the teachings of which are incorporated herein by reference. Preferred methods for determining sequence identity are designed to give the largest match between the sequences tested. Methods for determining sequence identity are codified into publicly available computer programs that determine sequence identity between given sequences. Examples of such programs include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN, and BLASTX (Altschul, SF, et al., J. Molec. Biol., 215:403-410 (1990).The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda, MD 20894; Altschul, SF et al., J. Molec. Biol., 215:403-410 (1990), the teachings of which are incorporated herein by reference). These programs most preferably align sequences using default gap weights to produce the highest degree of sequence identity between a given sequence and a reference sequence. By way of illustration, for a polynucleotide having a nucleotide sequence that has at least, for example, 85%, preferably 90%, 91%, 92%, 93%, 94%, even more preferably 95%, 96%, 97%, 98%, 99%, 99.9% "sequence identity" to a reference nucleotide sequence, the nucleotide sequence of the given polynucleotide is expected to be identical to the reference sequence, except that the given polynucleotide sequence may include up to 15, preferably up to 10, even more preferably more than 5 point mutations per 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence that is at least 85%, preferably 90%, 91%, 92%, 93%, 94%, even more preferably 95%, 96%, 97%, 98%, 99%, 99.9% identical to a reference nucleotide sequence, up to 15%, preferably 10%, 9%, 8%, 7%, 6%, even more preferably 5%, 4%, 3%, 2%, 1%, 0.1% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or up to 15%, preferably 10%, 9%, 8%, 7%, 6%, even more preferably 5%, 4%, 3%, 2%, 1%, 0.1% of the total nucleotides in the reference sequence may be inserted into the reference sequence. Such mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or at any position between those terminal positions, interspersed individually between each nucleotide in the reference sequence or in one or more contiguous groups within the reference sequence. Similarly, for a polypeptide having a given amino acid sequence that has at least, for example, 85%, preferably 90%, 91%, 92%, 93%, 94%, even more preferably 95%, 96%, 97%, 98%, 99% sequence identity to a reference amino acid sequence, the given amino acid sequence of the polypeptide is expected to be identical to the reference sequence, except that the given polypeptide sequence may include up to 15, preferably up to 10, 9, 8, 7, 6, even more preferably up to 5, 4, 3, 2, 1 amino acid changes per 100 amino acids of the reference amino acid sequence.In other words, to obtain a given polypeptide sequence having at least 85%, preferably 90%, 91%, 92%, 93%, 94%, even more preferably 95%, 96%, 97%, 98%, 99% sequence identity to a reference amino acid sequence, up to 15%, preferably up to 10%, 9%, 8%, 7%, even more preferably up to 5%, 4%, 3%, 2%, 1% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or up to 15%, preferably up to 10%, 9%, 8%, 7%, even more preferably up to 5%, 4%, 3%, 2%, 1% of the total number of amino acid residues in the reference sequence may be inserted into the reference sequence. Such changes in the reference sequence may occur at the amino or carboxyl terminal positions of the reference amino acid sequence or at any position between those terminal positions, either individually interspersed between each residue in the reference sequence or in one or more contiguous groups within the reference sequence. Preferably, different residue positions differ by conservative amino acid substitutions. However, conservative substitutions are not included as a match when determining sequence identity.

[0267] The terms "sequence identity" or "% identity" are used interchangeably herein. For the purposes of the present invention, as defined herein, to determine the % identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid for optimal comparison with a second amino acid or nucleic acid sequence). The amino acid or nucleotide residues at corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, the molecules are identical at that position. The % identity between the two sequences varies with the number of identical positions shared by the sequences (i.e., % identity = number of identical positions / total number of positions (i.e., overlapping positions) × 100). Preferably, the two sequences are the same length.

[0268] Sequence comparison can be performed over the entire length of the two sequences being compared, or over a fragment of the two sequences. Typically, the comparison will be performed over the entire length of the two sequences being compared. However, sequence identity can be performed over a region of, for example, 20, 50, 100 or more contiguous amino acid residues.

[0269] Those skilled in the art will appreciate that several different computer programs can be used to determine the identity between two sequences. For example, sequence comparison and determination of % identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the % identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) algorithm, which is incorporated into the GAP program in the Accelrys GCG software package (available at http: / / www.accelrys.com / products / gcg / ), using a Blosum 62 matrix or a PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6. Those skilled in the art will appreciate that all of these different parameters will produce slightly different results, but the overall % identity between two sequences does not change significantly when different algorithms are used.

[0270] A search against public databases can be performed using a protein sequence or nucleic acid sequence of the invention as a "query sequence" to, for example, identify other family members or related sequences. Such searches can be performed using the BLASTN and BLASTP programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. BLAST protein searches can be performed using the BLASTP program with a score of 50 and a word length of 3 to obtain amino acid sequences homologous to the protein molecules of the invention. To obtain gapped alignments for comparison purposes, gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See the National Center for Biotechnology Information homepage at http: / / www.ncbi.nlm.nih.gov / .

[0271] Vaccine Definition

[0272] An "immunogenic or immunological composition" refers to a composition of matter comprising at least one antigen or an immunogenic portion thereof, which elicits an immune response in a host, either a cellular or antibody-mediated immune response to the composition.

[0273] The term "antigen" as used herein is well known in the art and includes substances that are immunogenic (i.e., immunogens), as well as substances that induce immune unresponsiveness or anergy (i.e., the body's defense mechanisms do not respond to foreign substances). As used herein, the term "antigen" is intended to refer to full-length proteins and peptide fragments thereof that contain or include epitopes.

[0274] As used herein, "immunogenic composition" may refer to a polypeptide or protein, such as a viral surface protein that elicits an immune response as described herein. The term "immunogenic fragment" or "immunogenic portion" refers to a fragment or truncated and / or substituted form of a protein or polypeptide that includes one or more epitopes and thereby elicits an immune response as described herein. Generally, such truncated and / or substituted forms or fragments will contain at least six contiguous amino acids from the full-length protein. Such fragments can be identified using any number of epitope mapping techniques well known in the art. See, for example, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, ed., 1996) Humana Press, Totowa, New Jersey. For example, linear epitopes can be determined by simultaneously synthesizing a large number of peptides (these peptides corresponding to portions of the protein molecule) on a solid support and reacting with antibodies while the peptides are still attached to the support. Such techniques are known and described in the art, see, for example, U.S. Patent No. 4,708,871; Geysen et al. (1984) Proc. Natl. Acad. Sci. USA 81:3998-4002; and Geysen et al. (1986) Molec. Immunol. 23:709-715. Similarly, conformational epitopes are readily identified by determining the spatial conformation of amino acids, for example, by x-ray crystallography and two-dimensional nuclear magnetic resonance. See Epitope Mapping Protocols, supra. Synthetic antigens, such as polytopes, flanking epitopes, and other recombinant or synthetically derived antigens, are also included within the definition. See, e.g., Bergmann et al. (1993) Eur. J. Immunol. 23:2777-2781; Bergmann et al. (1996) J. Immunol. 157:3242-3249; Suhrbier, A. (1997) Immunol. and Cell Biol. 75:402-408; and Gardner et al. (1998) 12th World AIDS Conference, Geneva, Switzerland, June 28-July 3, 1998. (The teachings and contents of which are incorporated herein by reference in their entirety.)

[0275] As used herein, the term "vaccine" refers to a pharmaceutical composition comprising at least one immunologically active component that induces an immune response in an animal and may, but not necessarily, comprise one or more additional components that enhance the immunological activity of the active component. The vaccine may additionally comprise other components typical of pharmaceutical compositions. By distinction, the immunologically active component of the vaccine may comprise complete viral particles in their original form or attenuated particles in so-called modified live vaccines (MLVs) or particles inactivated by appropriate methods in so-called killed vaccines (KVs). In another form, the immunologically active component of the vaccine may comprise appropriate components of an organism (subunit vaccines), wherein such components are generated by destroying entire particles or growth cultures containing such particles and optionally subsequent purification steps to produce the desired structure, or by synthetic methods, including utilizing appropriate manipulations based on, for example, bacteria, insects, mammals, or other species, plus optionally subsequent separation and purification procedures, or by using appropriate pharmaceutical compositions to directly incorporate genetic material to induce a synthetic process in an animal in need of a vaccine (polynucleotide vaccination). The vaccine may comprise one or more of the above-mentioned components at the same time. As used in a specific aspect of the invention, "vaccine" refers to a live vaccine or live virus, also known as a recombinant vaccine. In another specific aspect of the invention, "vaccine" refers to an inactivated or killed virus, including virus-like particles (VLPs). Thus, a vaccine can be a subunit vaccine or a killed (KV) or inactivated vaccine.

[0276] The term "multiplicity of infection (MOI)" describes how many infectious units (e.g., TCID50) of a viral preparation are used per cell to infect cultured cells. For example, an MOI of 0.01 means that one infectious unit is inoculated for every 100 cells in the culture vessel.

[0277] The term "DNA vaccination" or "polynucleotide vaccination" means the direct vaccination of genetic material using a suitable pharmaceutical composition.

[0278] Various physical and chemical methods of inactivation are known in the art. The term "inactivation" refers to the inactivation or killing of a previously virulent or avirulent virus or bacterium by irradiation (ultraviolet (UV), X-rays, electron beams, or gamma radiation), heating, or chemical treatment while retaining its immunogenicity. Suitable inactivating agents include β-propiolactone, di- or β- or acetyl-ethyleneimine, glutaraldehyde, ozone, and formalin (formaldehyde).

[0279] For inactivation with formalin or formaldehyde, formaldehyde is typically mixed with water and methanol to produce formalin. The addition of methanol prevents degradation or cross-reactions during the inactivation process. One example uses approximately 0.1% to 1% of a 37% formaldehyde solution to inactivate viruses or bacteria. It is crucial to adjust the amount of formalin to ensure that the material is inactivated, but not so much that side effects from high doses occur.

[0280] More specifically, the term "inactivated" in the context of a virus means that the virus is unable to replicate in vivo or in vitro, and the term "inactivated" in the context of a bacterium means that the bacterium is unable to replicate in vivo or in vitro, respectively. For example, the term "inactivated" can refer to a virus that has been propagated in vitro and then inactivated using chemical or physical means so that it can no longer replicate. In another example, the term "inactivated" can refer to bacteria that have been propagated and then inactivated using chemical or physical means to produce a suspension of bacteria, bacterial fragments, or components, such as a bacterin that can be used as a component of a vaccine.

[0281] As used herein, the terms "inactivate," "kill," or "KV" are used interchangeably.

[0282] The term "live vaccine" refers to a vaccine that contains a living organism or a replication competent virus or viral vector.

[0283] A "pharmaceutical composition" consists essentially of one or more ingredients capable of altering the physiological (e.g., immune) function of an organism to which it is administered, or an organism living in or on that organism. This term includes, but is not limited to, antibiotics or antiparasitic agents, as well as other ingredients typically used to achieve certain other objectives, such as, but not limited to, treatment properties, sterility, stability, feasibility of administration of the composition by enteral or parenteral routes (e.g., oral, intranasal, intravenous, intramuscular, subcutaneous, intradermal, or other suitable routes), tolerability after administration, or controlled release properties. A non-limiting example of such a pharmaceutical composition, provided merely for illustrative purposes, can be prepared by mixing cell culture supernatant from an infected cell culture with a stabilizer (e.g., spermidine and / or bovine serum albumin (BSA)) and subsequently lyophilizing or dehydrating the mixture by other methods. Prior to vaccination, the mixture is then rehydrated in an aqueous solution (e.g., saline, phosphate-buffered saline (PBS)) or a non-aqueous solution (e.g., an oil emulsion, an aluminum-based adjuvant).

[0284] As used herein, "pharmaceutically or veterinarily acceptable carriers" include any and all solvents, dispersion media, coating agents, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. In some preferred embodiments, and particularly those comprising lyophilized immunogenic compositions, stabilizers for use in the present invention include stabilizers for lyophilization or freeze-drying.

[0285] In some embodiments, the immunogenic compositions of the present invention contain an adjuvant. As used herein, "adjuvants" may include aluminum hydroxide and aluminum phosphate, saponins such as Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsions, oil-in-water emulsions, and water-in-oil-in-water emulsions. Specifically, the emulsion may be based on light liquid paraffin oil (European typical); isoprenoid oils such as squalane or squalene; oils produced by oligomerization of olefins (specifically isobutylene or decene); esters of acids or alcohols containing linear alkyl groups, more specifically vegetable oils, ethyl oleate, propylene glycol di-(caprylate / caprate), tri-(caprylyl / caprylyl) or propylene glycol dioleate; esters of branched fatty acids or alcohols, specifically isostearates. Oils are used in combination with emulsifiers to form emulsions. Emulsifiers are preferably nonionic surfactants, in particular sorbitan, mannide (e.g. anhydrous mannitol oleate), glycols, polyglycerols, propylene glycol and optionally ethoxylated esters of oleic acid, isostearic acid, ricinoleic acid or hydroxystearic acid, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular Pluronic products, especially L121. See Hunter et al., The Theory and Practical Application of Adjuvants (ed. Stewart-Tull, DES), John Wiley and Sons, NY, pp. 51-94 (1995) and Todd et al., Vaccine 15: 564-570 (1997). Exemplary adjuvants are SPT emulsion described on page 147 of "Vaccine Design, The Subunit and Adjuvant Approach," edited by M. Powell and M. Newman, Plenum Press, 1995, and emulsion MF59 described on page 183 of the same book.

[0286] Another example of an adjuvant is a compound selected from polymers of acrylic acid or methacrylic acid and copolymers of maleic anhydride and alkenyl derivatives. Preferred adjuvant compounds are polymers of acrylic acid or methacrylic acid, especially cross-linked with polyalkenyl ethers of sugars or polyols. These compounds are known by the term carbomer (Pharmeuropa, Vol. 8, No. 2, June 1996). Those skilled in the art may also refer to U.S. Patent No. 2,909,462, which describes such acrylic acid cross-linked with a polyhydroxylated compound as a polymer having at least 3 (preferably no more than 8) hydroxyl groups, the hydrogen atoms of at least 3 hydroxyl groups being replaced by unsaturated aliphatic groups having at least 2 carbon atoms. Preferred groups are those containing 2 to 4 carbon atoms, such as vinyl, allyl and other olefinically unsaturated groups. The unsaturated group itself may contain other substituents such as methyl. The products sold by BF Goodrich, Ohio, USA are particularly suitable. They are cross-linked with allyl sucrose or with allyl pentaerythritol. Among them, Carbopol 974P, 934P and 971P may be mentioned. Most preferably, 971P. Among the copolymers of maleic anhydride and alkenyl derivatives, in particular the copolymer EMA (Monsanto), which is a copolymer of maleic anhydride and ethylene, dissolving these polymers in water produces an acidic solution, which is preferably neutralized to physiological pH to obtain an adjuvant solution, into which the immunogenic, immune or vaccine composition itself is incorporated.

[0287] Other suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), block copolymers (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from Escherichia coli (recombinant or otherwise), cholera toxin, IMS 1314 or muramyl dipeptide, or natural or recombinant cytokines or analogs thereof, or stimulators of endogenous cytokine release, among others.

[0288] It is expected that the adjuvant can be added in an amount of about 100 μg to about 10 mg per dose, preferably in an amount of about 100 μg to about 10 mg per dose, more preferably in an amount of about 500 μg to about 5 mg per dose, even more preferably in an amount of about 750 μg to about 2.5 mg per dose, and most preferably in an amount of about 1 mg per dose. Alternatively, the adjuvant can be added in a concentration of about 0.01% to 50%, preferably in a concentration of about 2% to 30%, more preferably in a concentration of about 5% to 25%, still more preferably in a concentration of about 7% to 22%, and most preferably in a concentration of 10% to 20%, based on the volume of the final product.

[0289] "Diluents" may include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents may include, among others, sodium chloride, dextrose, mannitol, sorbitol, and lactose. Stabilizers include, among others, albumin and alkali metal salts of ethylenediaminetetraacetic acid.

[0290] "Isolated" means altered "by the hand of man" from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or polypeptide naturally present in a living organism is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials in its natural state is "isolated," as the term is used herein.

[0291] "Attenuation" means a reduction in the virulence of a pathogen. In the present invention, "attenuation" is synonymous with "avirulence." In the present invention, an attenuated virus is one whose virulence has been reduced so that it does not cause clinical signs of infection but is capable of inducing an immune response in a target mammal (e.g., a dog). However, it can also mean a reduction in the incidence or severity of clinical signs in animals (e.g., dogs) infected with an attenuated virus, particularly the claimed CDV vector, compared to a "control group" of animals infected with a non-attenuated virus or pathogen that did not receive the attenuated virus. In this context, the terms "reduce" and "reduced" mean a reduction of at least 10%, preferably 25%, even more preferably 50%, still more preferably 60%, even more preferably 70%, still more preferably 80%, even more preferably 90%, and most preferably 100%, compared to a control group as defined above. Therefore, attenuated avirulent pathogens (e.g., the claimed attenuated viral vectors, particularly the claimed CDV vectors) are suitable for the production of modified live vaccines (MLVs) or modified live immunogenic compositions.

[0292] Herein, "effective dose" means, but is not limited to, an amount that induces or is capable of eliciting an immune response and produces a reduction in clinical symptoms in an animal to which the antigen is administered.

[0293] As used herein, the term "effective amount" in the context of a composition means the amount of an immunogenic composition that is capable of inducing an immune response and reducing the severity of an infection or event of a disease in an animal. Specifically, an effective amount refers to colony forming units (CFU) per dose. Alternatively, in the context of therapy, the term "effective amount" refers to an amount of a therapy that is sufficient to alleviate or improve the severity or duration of a disease or disorder or one or more symptoms thereof, prevent the progression of a disease or disorder, cause the disease or disorder to subside, prevent the recurrence, development, onset or progression of one or more symptoms associated with a disease or disorder, or enhance or improve the prophylactic or therapeutic effects of another therapy or therapeutic agent.

[0294] "Immune response" or "immunological response" means, but is not limited to, the occurrence of a cellular and / or antibody-mediated immune response to an (immunogenic) composition or vaccine of interest. Typically, an immune (immune or immunological) response includes, but is not limited to, one or more of the following effects: the production or activation of antibodies, B cells, helper T cells, suppressor T cells, and / or cytotoxic T cells specific for one or more antigens included in the composition or vaccine of interest. Preferably, the host will exhibit a therapeutic or protective immune (memory) response such that resistance to new infection will be enhanced and / or the clinical severity of the disease will be reduced. This protection will be demonstrated by a reduction in the number of symptoms, a reduction in the severity of symptoms, or the absence of one or more symptoms associated with infection with a pathogen, a delay in the onset of viremia, a reduction in viral persistence, a reduction in overall viral load, and / or a reduction in viral excretion.

[0295] "Protection against disease," "protective immunity," "functional immunity," "reduction of clinical symptoms," "induction / production of neutralizing antibodies and / or seroconversion," and similar phrases refer to a partial or complete response to a disease or condition produced by the administration of one or more therapeutic compositions of the present invention, or a combination thereof, that results in a less deleterious effect than would be expected in an unimmunized individual exposed to the disease or infection. That is, the severity of the deleterious effects of the infection is reduced in the vaccinated individual. The infection may be reduced, slowed, or possibly completely prevented in the vaccinated individual. Where complete prevention of infection is intended, this will be specifically noted herein. If complete prevention is not indicated, the term includes partial prevention.

[0296] The term "neutralizing antibody" refers to an antibody that can prevent an infectious agent, typically a virus such as PEDV or CDV, from infecting cells by neutralizing or inhibiting its biological effects. Neutralization occurs when the antibody binds to a specific viral antigen, thereby blocking the pathogen from entering its host cell. In one example, it prevents the virus from binding to its receptor and gaining access to its genetic material within the cell.

[0297] As used herein, the terms "antibody" or "immunoglobulin" are used interchangeably herein and include whole antibodies and any antigen-binding fragments (antigen-binding portions) or single-chain homologs thereof. An "antibody" comprises at least one heavy (H) chain and one light (L) chain. In natural IgG, for example, the heavy and light chains are interconnected by disulfide bonds and there are two paired heavy and light chains, which are interconnected by disulfide bonds. Each heavy chain includes a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region includes three domains, namely CH1, CH2 and CH3. Each light chain includes a light chain variable region (abbreviated herein as VH). L) and a light chain constant region. The light chain constant region includes a domain CL. V H and V L The V domains are subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework (FR) or joining (J) regions (JH or JL in heavy and light chains, respectively). H and V L It is composed of three CDRs, three FRs, and one J domain, which are arranged in the following order from amino terminus to carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, J. The variable regions of the heavy and light chains bind to the antigen. The constant region of the antibody can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) or humoral factors, such as the first component (Clq) of the classical complement system.

[0298] As used herein, "reduction in the incidence and / or severity of clinical signs" or "reduction in clinical symptoms" means, but is not limited to, reducing the number of infected individuals in a group, reducing or eliminating the number of individuals exhibiting clinical signs of infection, or reducing the severity of any clinical signs present in one or more individuals compared to a wild-type infection. For example, it should refer to any reduction in pathogen load, pathogen shedding, reduction in pathogen transmission, or reduction in any clinical signs of symptoms of a disease (e.g., porcine epidemic diarrhea or malaria). Preferably, such clinical signs are reduced by at least 10% in one or more individuals receiving the therapeutic composition of the present invention compared to individuals who did not receive the composition and became infected. More preferably, clinical signs are reduced by at least 20%, preferably at least 30%, more preferably at least 40%, and even more preferably at least 50% in individuals receiving the composition of the present invention.

[0299] The term "increased protection" herein means, but is not limited to, a statistically significant reduction in one or more clinical symptoms associated with infection by an infectious agent in a group of vaccinated individuals relative to a control group of unvaccinated individuals. The term "statistically significant reduction in clinical symptoms" means, but is not limited to, that the frequency of onset of at least one clinical symptom in the group of vaccinated individuals is at least 10%, preferably 20%, more preferably 30%, even more preferably 50%, and even more preferably 70% lower than in a control group of unvaccinated individuals after challenge with an infectious agent.

[0300] "Durable protection" would mean "improved efficacy" that lasts for at least 3 weeks, but more preferably at least 3 months, still more preferably at least 6 months. In the case of livestock, most preferably, durable protection should last until the average age at which the animals are sold for meat.

[0301] The term "reduction of virus-induced viremia" means, but is not limited to, a reduction in the amount of virus entering the bloodstream of an animal, wherein the level of viremia in the serum of an animal receiving the composition of the present invention, i.e., the number of viral DNA or RNA copies per milliliter of serum or the number of plaque-forming colonies per cubic centiliter of serum, is reduced by at least 50% compared to an animal that has not received the composition of the present invention and can be infected. More preferably, the level of viremia in animals receiving the composition of the present invention is reduced by at least 90%, preferably at least 99.9%, more preferably at least 99.99%, and even more preferably at least 99.999%.

[0302] The term "viremia" as used herein is particularly to be understood as a condition in which viral particles replicate and / or circulate in the bloodstream of an animal, particularly a mammal, a bird or an insect.

[0303] "Safety" refers to the absence of adverse consequences in the vaccinated animal following vaccination, including but not limited to the potential for viral-based vaccines to revert to virulent, clinically significant side effects such as persistent, systemic disease, or unacceptable inflammation at the site of vaccine administration.

[0304] As used herein, the term "vaccination" or "vaccinating" or variations thereof means, but is not limited to, a process comprising administering an immunogenic composition of the present invention which, when administered to an animal, elicits or is capable of eliciting (directly or indirectly) an immune response in the animal.

[0305] In the context of the present invention, "mortality" refers to death caused by infection and includes situations where the infection is so severe that the animal is euthanized to prevent suffering and provide a humane end to its life.

[0306] formulations

[0307] The subject to which the composition is administered is preferably an animal, including but not limited to cattle, horses, sheep, pigs, poultry (e.g., chickens), goats, cats, dogs, hamsters, mice, and rats, most preferably the mammal is a pig.

[0308] The formulations of the present invention comprise an immunizing effective amount of one or more immunogenic compositions and a physiologically acceptable vehicle. Vaccines comprise an immunizing effective amount of one or more immunogenic compositions and a physiologically acceptable vehicle. The formulation should be suitable for the mode of administration.

[0309] The immunogenic composition may also contain a very small amount of a wetting agent, an emulsifier, or a pH buffer, if desired. The immunogenic composition may be a liquid solution, a suspension, an emulsion, a tablet, a pill, a capsule, a sustained-release formulation, or a powder. Oral formulations may include standard carriers such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like.

[0310] Treatment

[0311] Preferred routes of administration include, but are not limited to, intranasal, oral, intradermal, and intramuscular. Most preferably, administration in drinking water as a single dose is desirable. One skilled in the art will recognize that the compositions of the present invention may also be administered in one, two, or more doses via other routes of administration. For example, such other routes include subcutaneous, intradermal, and intraperitoneal, and depending on the desired duration and effectiveness of the treatment, the compositions of the present invention may be administered, for example, once or several times daily, or intermittently in different doses (e.g., about 10 3 to 10 8 TCID50 (see above for virus titer)) for several days, weeks or months. In a specific aspect of the invention, the dose is about 10 3 to 10 8 TCID50, especially for live viruses / live vaccines.

[0312] If desired, the composition may be presented in a package or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The package may, for example, comprise metal or plastic foil, such as a blister pack. The package or dispenser device may be accompanied by instructions for administration, preferably to a mammal, particularly a pig. The container(s) may be accompanied by a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals or biological products indicating that the agency has approved manufacture, use, or sale for human administration.

[0313] Examples

[0314] The following examples are included to illustrate preferred embodiments of the present invention. Those skilled in the art will appreciate that the techniques disclosed in the following examples represent techniques discovered by the inventors to function well in practicing the present invention and, therefore, can be considered to constitute preferred modes for its practice. However, those skilled in the art will appreciate, in light of this disclosure, that many changes can be made to the disclosed embodiments and still obtain the same or similar results without departing from the spirit and scope of the present invention.

[0315] Example 1: PEDV-S expression from a recombinant CDV vector

[0316] In in vitro experiments, a complete plasmid (pBR322) encoding the entire CDV genome derived from the Ledley vaccine strain (Ledley; ATCC VR-128) was digested with SacII endonuclease, and the PEDV spike (S) protein encoding the cassette between the P and M genes was cloned (resulting in a sequence comprising SEQ ID NO: 14). Upon cloning and rescuing the recombinant CDV-PEDV-S, expression of the PEDV spike protein of genotype 2b was visualized in CDV-associated fluorescent foci. Separate results were also achieved for the corresponding CDV vector (i.e., differing only in the sequence encoding the PEDV spike protein of genotype 2a, SEQ ID NO: 15). Immunofluorescence results for both vectors indicated robust expression of the PEDV spike protein in all CDV-infected syncytia (data not shown).

[0317] Example 2: Vaccine efficacy study

[0318] Porcine epidemic diarrhea (PED) is a highly contagious disease of pigs that can have a significant economic impact. Although pigs of all ages are susceptible, severe clinical signs and mortality are primarily seen in suckling piglets. The causative agent is PED virus (PEDV), an enveloped, single-stranded RNA virus of the genus Alphacoronavirus in the family Coronaviridae. In Europe, PEDV first occurred in England in the late 1970s. It subsequently spread throughout Europe, causing sporadic outbreaks. By the late 1990s, PEDV had disappeared from European pig farms, as evidenced by extremely low seroprevalence and a lack of disease reports. Outbreaks and endemic infections continue to be reported in Asia, where the disease has a significant impact on the productivity of industrial pig farms. Since 2005, PED cases have again been reported from Europe, namely Italy. Following the introduction of the seemingly highly virulent PEDV into the United States in 2013, cases have also been reported from Central Europe, including Germany and neighboring countries. The latter condition is caused by a related but different PEDV strain (the so-called S-INDEL strain). In Germany, cases have been reported since May 2014, with high morbidity and variable mortality in suckling pigs.

[0319] This study, in which a CDV backbone derived from the Laidley vaccine strain (see Example 1) with the sequence of SEQ ID NO: 4 (encoding PEDV spike protein) inserted between the P and M genes (thus, the vector contained the sequence of SEQ ID NO: 8) was tested as a vector vaccine (hereinafter referred to as "CDV_PEDV-Spike vaccine" or "CDV PEDV-Spike vector vaccine," respectively) included six sows and their offspring.

[0320] All animals were tested by RT-qPCR targeting the S gene and PEDV-specific antibodies. Only negative animals were included in this study.

[0321] Three treatment groups (see below) received randomly assigned animals:

[0322] - Group 1 (negative control): two sows (named No. 1 and No. 2), not vaccinated

[0323] - Group 2 (positive control): two sows (named No. 3 and No. 4), not vaccinated

[0324] - Group 3 (CDV_PEDV-Spike): Two sows (named No. 5 and No. 6) were vaccinated with CDV_PEDV-Spike vector vaccine.

[0325] Vaccination of two sows in Group 3 was performed according to the following protocol, where the stock titer of the CDV_PEDV-Spike vaccine, defined by endpoint titration, was 7.94 × 10 4 TCID50 / ml:

[0326] 9 weeks before expected farrowing date: each of two sows received 4 ml of vaccine intranasally (2 ml in each nostril);

[0327] 6 weeks before expected farrowing date: each of two sows received 4 ml of vaccine intranasally (2 ml in each nostril);

[0328] 3 weeks before expected farrowing date: Each of two sows received 4 ml of the respective vaccine intranasally (2 ml in each nostril) and an additional 2 ml intramuscularly.

[0329] Oral mock vaccination was performed on piglets born to sows in Group 1 (13 piglets from sow 1 and 12 piglets from sow 2). Four-day-old piglets born to sows in Group 2 (12 piglets from sow 3 and 14 piglets from sow 4) and piglets born to sows in Group 3 (5 piglets from sow 5 and 15 piglets from sow 6) were challenged with wild-type PEDV (hereinafter referred to as "PEDV EU").

[0330] For vaccination of piglets in Groups 2 and 3, cell culture-adapted PEDV EU was used. The titer was 2.15 × 10 5 TCID50 / ml. Piglets from Groups 2 and 3 were orally inoculated. In this case, each piglet received 1 ml of a 1:10 diluted virus stock solution (titer 2.15×10 4 TCID50).

[0331] Piglets in Group 1 were mock-inoculated orally using 1 ml of cell culture medium in a 2 ml syringe.

[0332] Throughout the trial, rectal swabs (COPAN plain swabs without culture medium) were taken on the day of inoculation and on days 1 to 10 post-inoculation (pi), as well as on days 14, 17, and 20 / 21 p.i. for all animals, for RT-qPCR analysis. Additional rectal swabs were taken from four piglets per sow before inoculation and two days after challenge for bacteriological examination. In addition, clinical signs indicative of PED were recorded daily using an established standardized cumulative scoring system (see below). Blood samples were collected on the day of inoculation and on days 14 and 20 / 21 p.i. (end of trial), or on the day of euthanasia or death of the individual animals.

[0333] Clinical monitoring

[0334] Clinical signs indicative of PED were monitored daily using an established cumulative clinical score (see table below).

[0335]

[0336] Table 1: Cumulative clinical scores for clinical signs indicative of PED

[0337] Sample preparation and nucleic acid extraction

[0338] Rectal swabs were immersed in 1 ml of Dulbecco's Modified Eagle Medium and incubated at room temperature for 1 hour. Viral RNA was extracted using the QIAmp Viral RNA Mini Kit (Qiagen) or the NucleoMag Vet Kit in combination with the KingFisher extraction platform. RNA was stored at -20°C until further use.

[0339] The blood samples were centrifuged at 2031 x g for 20 min at room temperature to obtain serum, which was aliquoted and stored at -20°C.

[0340] Virus detection

[0341] To detect PEDV shedding, an RT-qPCR system targeting the S gene of PEDV was used as previously described (Stadler et al., BMC Vet Res. 11:142 (2015)). Samples obtained on days 0 to 7, and 10 and 20 / 21, were tested for PEDV genomes. Genome copies / μl were calculated using an internal standard.

[0342] Antibody testing

[0343] All sera were subjected to a commercial indirect ELISA (INgezim PEDV, INGENASA, Madrid, Spain) according to the manufacturer's manual.

[0344] Bacteriology

[0345] Fecal swabs were taken from four piglets per litter at 0 and 2 dpi for different bacteriological studies.

[0346] statistics

[0347] Normality was tested using the Shapiro-Wilk test, and the Mann-Whitney rank sum test was performed as implemented in the software package. Statistical significance was tested using SigmaPlot software.

[0348] result

[0349] Antibody detection in serum:

[0350] Due to the ingestion of antibody-positive colostrum, all piglets in the CDV group showed positive results in ELISA (detecting antibodies against the PEDV spike protein) before challenge vaccination, while all animals in the positive and negative control groups showed clear negative results.

[0351] At 14 dpi, all but three piglets in the positive control group were seroconverted, whereas all animals in the vaccine group still showed high amounts of PEDV-specific IgG in serum samples.

[0352] At the end of the study, all piglets in the CDV group and the positive control group showed strongly positive results in ELISA. None of the animals in the negative control group seroconverted during the entire experimental period.

[0353] In further studies, it was also observed that when sows were vaccinated twice only via the intranasal route, the respective antibody results were also obtained.

[0354] Bacteriology:

[0355] Fecal swabs obtained at 0 and 2 dpi did not show any pathogenic bacteria. The bacterial flora did not undergo significant changes after infection.

[0356] Clinical signs:

[0357] Piglets in the positive control group (Group 2) showed clear clinical signs indicative of PEDV, beginning with vomiting at 24 hpi, followed by diarrhea over a 7-day period. Eight of the 26 piglets were euthanized due to severe dehydration and clinical scores exceeding 6 (humane endpoint). The first clinical signs indicative of PEDV were detectable at 36 hpi.

[0358] Clinical signs of CDV vector vaccinated and PEDV challenged piglets (Group 3) were overall more favorable with regard to general behavior, and only 2 of 20 pigs (10%) in Group 3 had to be euthanized due to severe dehydration and clinical score values exceeding 6 (compared to 31% of piglets in Group 2).

[0359] Animals in the negative control remained healthy throughout the experimental period.

[0360] Viral shedding

[0361] Significant differences in viral shedding were detected between the challenged groups. At 1 dpi, rectal swabs from all challenged piglets were positive for viral genomes, but animals in the CDV-PEDV vaccinated group showed significantly lower PEDV genome copy numbers (mean CT values, 32, 79) than those in the challenged group (mean CT values, 26, 65).

[0362] Meanwhile, during the next five days pi, the genome load in rectal swabs of the CDV group was very similar to that of the positive control, and starting at 7 dpi, the detectable amount of viral genomes dropped below the cut-off value in piglets protected by vaccinated sows, while all animals in the positive control group still shed PEDV.

[0363] No PEDV genome could be detected in swabs from the negative control group.

[0364] In summary, the results of this study showed that piglets born to sows vaccinated with the CDV PEDV-Spike recombinant vaccine showed reduced clinical signs compared to the positive control, and in particular, a significant improvement was observed in the mortality / lethality of the piglets. In addition, viral shedding after PEDV challenge was significantly reduced.

[0365] In addition, an animal study corresponding to the above-mentioned vaccine efficacy study was conducted, in which a CDV backbone derived from the Laidley vaccine strain (see Example 1) with an insert encoding the PEDV spike protein of SEQ ID NO: 17 between the P and M genes was administered twice (5 weeks before farrowing and 2 weeks before farrowing), and challenged with a highly virulent genotype 2a PEDV wild strain. Piglets born to sows vaccinated with this recombinant vaccine showed reduced mortality or clinical signs compared to challenge controls.

[0366] Example 3:

[0367] This animal study, in which a CDV backbone derived from the Laidley vaccine strain (see Examples 1 and 2) with an insert encoding the PEDV spike protein of SEQ ID NO: 15 between the P and M genes was tested as a vector vaccine (hereinafter referred to as "CDV_PEDV-G2a vaccine" or "CDV PEDV-G2a spike vector vaccine," respectively), included twenty (20) sows and their offspring.

[0368] Only animals deemed negative for PEDV by qRT-PCR and ELISA were included.

[0369] Three treatment groups (see below) received randomly assigned animals:

[0370] Group 1 (strict negative control): four sows (designated 1-4), not vaccinated;

[0371] Group 2 (challenge control): eight sows (designated 5-12), not vaccinated;

[0372] Group 3 (CDV_PEDV-G2a-Spike): Eight sows (named 13-20) were vaccinated with CDV PEDV-G2a-Spike vector vaccine.

[0373] Vaccination of 8 sows in Group 3 was performed 5 weeks before farrowing (DO) and 2 weeks before farrowing (D21) of the study, with a stock titer of CDV_PEDV-G2a spike vaccine of 2.57 × 10 5 TCID50 / ml. At each vaccination, sows received 4 mL of vaccine intranasally (2 mL in each nostril).

[0374] Piglets born to sows in Group 1 (41 piglets in total) were not challenged (strict control). 3 TCID 50 Piglets born to sows in Group 2 (81 piglets in total) and piglets born to sows in Group 3 (83 piglets in total) aged 3-7 days were orally challenged with a highly virulent wild-type PEDV strain of the G2a genotype at a dose of 2 mL / min (1 mL intranasal + 1 mL oral).

[0375] Throughout the trial, rectal swabs were obtained one day prior to inoculation and on days 1, 3, 7, and 14 pi (post-challenge viral inoculation).

[0376] Sample preparation and nucleic acid extraction

[0377] After collection, rectal swabs were immersed in 2 ml of Minimum Essential Medium (MEM) and stored at −70°C until processing. Samples were processed by vortexing for 10 seconds, followed by centrifugation at 1,500 x g for 10 minutes at 4°C. Following processing, viral RNA was extracted using the BS96 Vet 100 BioSprint extraction platform with the BioSprint One-For-All Vet Kit (Qiagen) using 100 μl per sample. RNA was stored at −20°C until further use.

[0378] The blood samples were centrifuged at 1960 x g for 10 min at room temperature to obtain serum, which was aliquoted and stored at -70°C.

[0379] Virus detection

[0380] To detect PEDV shedding, an in-house-derived RT-qPCR system targeting the PEDV S gene was used: a quantitative one-step RT-PCR kit (iTaq Universal One-Step RT-PCR Kit; BioRad, catalog number 1725140). Real-time RT-PCR was performed in a 25 μl reaction containing 2 μl of extracted total nucleic acid, 0.75 μl of probe (4 μM), 0.5 μl of each primer (10 μM), 12.5 μl of 2X RT-PCR mix, 0.5 μl of iScript reverse transcriptase, and 8.25 μl of DEPC-treated water. For primer, probe, and terminator sequences, see Table 2 below. Reactions were performed using a CFX96 Real-Time PCR Detection System (BioRad) under the following conditions: initial reverse transcription at 50°C for 30 min, followed by an initial denaturation at 95°C for 5 min, 40 cycles of denaturation at 95°C for 15 s, and annealing and extension at 57°C for 30 s. To generate quantitative data, PEDV terminators (Integrated DNA Technologies) were included in each run. Lyophilized terminators (4 nmol) were resuspended in DEPC-treated, nuclease-free sterile water to generate a stock concentration of 1.0E+10 genome copies / μl (gc / μl). From the stock terminator, 10-fold serial dilutions ranging from 1.0E+08 to 1.0E+01 were prepared in DEPC-treated water. Concentrations were confirmed by qubit dsDNA HS analysis before use. Optical data were analyzed using CFX Manager software. For each assay, the critical line was automatically calculated using the extinction setting of the cycle critical value (Ct) assay mode. Baseline subtraction was performed automatically using the baseline subtraction mode. Curves with a baseline final value less than 10 were manually corrected.

[0381]

[0382] Table 2: Probe (Pr), primer (F / R) and terminator sequences used for the in-house derived RT-qPCR system.

[0383] Antibody testing

[0384] Serum and milk samples for this study were tested using an in-house developed CCIF assay: A wild-type PEDV isolate (genotype 2a) was diluted 1:100 into PEDV growth medium (MEM + 2.5% HEPES + 0.3% trypsin phosphate broth + 0.02% yeast + 10 μg / mL trypsin). The diluted virus (100 μL / well) was inoculated onto 96-well plates containing two-day-old VERO cells. Prior to infection, the cell growth medium was removed from the plates and washed twice with 100 μL of PEDV growth medium. The plates were incubated at 37±2°C with CO2 (4-6%) for 24 hours. Following incubation, the supernatant was discarded and the plates were washed twice with 200 μL / well of 1X PBS. For fixation, 200 μL / well of ethanol was added. The plates were incubated at room temperature for 30 minutes, air-dried, and then stored at -20°C until use. Prior to use in the assay, the plates were rehydrated with 200 μl / well of 1X PBS (Gibco) at room temperature for 10 minutes and blocked with 100 μl / well of buffer (1X PBS + 1% normal goat serum + 0.1% triton X) at 37°C for 15 minutes. Serial two-fold dilutions of serum samples were prepared in dilution buffer (1X PBS + 5% BSA + 1% normal goat serum + 0.1% triton-X 100) containing a 1:1000 dilution of PEDV mAb antibody (Median diagnostics). The diluted samples (50 μl / well) were added to the prepared plates and incubated at 37°C for 1 hour. Following incubation, the plates were washed three times with 200 μl / well of 1X PBS. A total of 50 μl / well of diluted secondary antibodies [Alexa 594 goat anti-mouse IgG (Fisher, 1:500 dilution); FITC-labeled goat anti-swine IgG (BioRad, 1:500 dilution); Hoechst 33342 (Fisher, 1:1000 dilution]] were then added to each plate and incubated at 37°C for 1 hour. Following incubation, the plate was washed three times with 200 μl / well of 1X PBS. Fluorescence was observed, with PEDV-infected cells bound by Mab3F12 showing specific red fluorescence. Colocalization of green fluorescence indicated binding of swine IgG. The highest dilution at which specific green fluorescence was detected corresponded to the IgG titer.

[0385] result

[0386] mortality rate

[0387] 40 pigs survived in Group 1 (strict control), 16 pigs survived in Group 2 (challenge control), and 34 pigs survived in Group 3 (vaccinated with CDV-PEDV-G2a spike), with an average mortality rate of 2% (Group 1), 80% (Group 2), and 59% (Group 3).

[0388] Antibody response

[0389] The specific PEDV antibody response after challenge revealed that the mean CCIF IgG antibody titers in the serum and milk of sows in the CDV-PEDV-G2a spike vaccinated group were higher than those in Group 2 (challenge control). This indicates that vaccinated sows responded strongly to virus exposure from infected piglets after challenge by increasing IgG levels in milk and serum. In contrast, the antibody titers of sows in the challenge control, which were generated by PEDV infection solely through contact with challenged piglets (and their feces), were significantly lower.

[0390] Viral shedding

[0391] On day 3 after challenge virus inoculation, relatively similar average RNA loads were detected in the vaccinated and unvaccinated groups, reaching a group average log10 PEDV genome copies of 9.2 and 9.8 for the CDV-PEDV-G2a spike vaccinated group and the challenge control group, respectively. On D48 (7 dpi) and D55 (14 dpi), the average log10 PEDV genome copy numbers in the CDV-PEDV-G2a spike vaccinated group were 3.2 and 2.0 log10, respectively, while in the challenge control group, they were 5.5 and 3.9 log10, respectively, indicating a reduction of 2.3 and 1.9 logs on days 7 and 14, respectively. Although longer-term shedding monitoring was not performed, the trends in the kinetics of shedding observed on days 7 and 14 after challenge virus inoculation clearly indicate that the shedding time was shortened in vaccinated animals, based on the results described under Example 4 above.

[0392] PEDV genomes were undetectable in swabs from the strict negative control group.

[0393] In summary, the results of this study showed that piglets born or nursed by sows vaccinated with the CDV PEDV-G2a Spike recombinant vaccine showed significantly reduced mortality when challenged with a highly virulent PEDV strain compared to piglets in the control group. Furthermore, these piglets, which received PEDV protective IgG antibodies in milk via transfer of maternal antibodies in the first few days postpartum, showed significantly reduced viral shedding after challenge on days 7 and 14 post-infection, an important epidemiological parameter.

[0394] All compositions and methods disclosed and claimed herein can be obtained and implemented without undue experimentation in light of the present disclosure. Although the compositions and methods of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that the steps or order of steps of the compositions and methods and the methods described herein can be varied without departing from the concept, spirit, and scope of the present invention. More specifically, it will be apparent that certain chemically and physiologically related reagents can be substituted for the reagents described herein while achieving the same or similar results. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be encompassed within the spirit, scope, and concept of the present invention as defined by the appended claims.

[0395] This article also discloses the following solutions:

[0396] 1. A canine distemper virus (CDV) vector comprising a heterologous nucleotide sequence of interest, wherein the heterologous nucleotide sequence of interest encodes a porcine epidemic diarrhea virus (PEDV) antigen.

[0397] 2. The CDV vector of embodiment 1, wherein the PEDV antigen is selected from the group consisting of PEDV spike (S) protein and PEDV nucleoprotein (N protein).

[0398] 3. The CDV vector of claim 1 or 2, wherein the PEDV antigen is a PEDV S protein, and wherein the PEDV S protein preferably comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0399] 4. The CDV vector of any one of claims 1 to 3, wherein the PEDV antigen is a PEDV S protein, and wherein the PEDV S protein preferably comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

[0400] 5. The CDV vector of any one of claims 1 to 4, wherein the heterologous nucleotide sequence of interest encodes a PEDV S protein, and wherein the heterologous nucleotide sequence of interest consists of or comprises an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of any one of SEQ ID NOs: 3 to 5.

[0401] 6. The CDV vector of any one of schemes 1 to 5, wherein the heterologous nucleotide sequence of interest is an RNA sequence of interest.

[0402] 7. The CDV vector of any one of schemes 1 to 6, wherein

[0403] - the heterologous nucleotide sequence of interest is located between the P gene and the M gene of CDV; and / or

[0404] - the heterologous nucleotide sequence of interest is a heterologous RNA sequence of interest, and wherein the heterologous RNA sequence is operably linked to a gene start (GS) sequence and / or a genomic promoter of CDV located in the 3' direction of the heterologous RNA sequence.

[0405] 8. The CDV vector of scheme 7, wherein the GS sequence is included in the exogenous 3′ non-coding region of the CDV gene, and wherein the exogenous 3′ non-coding region of the CDV gene preferably flanks the 3′ end of the heterologous RNA sequence of interest.

[0406] 9. The CDV vector of any one of claims 1 to 8, comprising an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 6 or SEQ ID NO: 7.

[0407] 10. The CDV vector of any one of claims 1 to 9, comprising an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 8.

[0408] 11. The CDV vector of any one of claims 1 to 10, further comprising an RNA sequence consisting of or comprising an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 9, and wherein the RNA sequence is flanked at the 5′ end by an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 8.

[0409] 12. The CDV vector of any one of claims 1 to 11, further comprising an RNA sequence consisting of or comprising an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 10, and wherein the RNA sequence is flanked at its 3′ end by an RNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 8.

[0410] 13. A nucleic acid molecule encoding the CDV vector of any one of the preceding embodiments, wherein the nucleic acid molecule is preferably a DNA molecule.

[0411] 14. A DNA molecule according to claim 13, wherein the molecule comprises a DNA sequence encoding a PEDV spike (S) protein, and wherein the sequence is preferably a DNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.

[0412] 15. A DNA molecule, specifically a DNA molecule as in scheme 13 or 14, wherein the molecule comprises a DNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 13.

[0413] 16. A DNA molecule, in particular a DNA molecule according to any one of claims 13 to 15, wherein the molecule comprises a DNA sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 14.

[0414] 17. A mammalian host cell comprising the CDV vector or nucleic acid molecule or DNA molecule according to any one of the preceding embodiments.

[0415] 18. The CDV vector or nucleic acid molecule according to any of the preceding embodiments for use as a medicament, preferably as a vaccine.

[0416] 19. A DNA construct comprising the DNA molecule of any one of Schemes 13 to 18.

[0417] 20. An RNA transcript of the DNA construct of Scheme 19.

[0418] 21. A cell transfected with the DNA construct of Scheme 19.

[0419] 22. A cell transfected with the RNA transcript of Scheme 20.

[0420] 23. A method for preparing an infectious CDV containing a heterologous gene, in particular a method for preparing a CDV vector according to any one of Schemes 1 to 12, wherein the method comprises the following steps:

[0421] a. Providing a host cell expressing a heterologous RNA polymerase;

[0422] b. transfecting the host cell with a DNA construct as in Scheme 19, and wherein the DNA molecule is transcribed by the heterologous RNA polymerase, and

[0423] c. Isolating the viruses produced by the cells.

[0424] 24. Use of the vector of any one of schemes 1 to 12 or the cell of any one of schemes 17, 21 and 22 for producing an immunogenic composition or vaccine.

[0425] 25. An immunogenic composition comprising:

[0426] The CDV vector of any one of Schemes 1 to 12, wherein the vector is optionally an infectious and / or attenuated virus, or the vector is optionally an attenuated and / or modified live virus, and optionally

[0427] The recombinant protein expressed by the vector and / or the quaternary structure comprising a plurality of recombinant proteins expressed by the vector, and optionally

[0428] A pharmaceutically or veterinarily acceptable carrier or excipient, wherein the carrier is preferably suitable for oral, intradermal, intramuscular or intranasal administration.

[0429] 26. The immunogenic composition of claim 25, wherein the recombinant protein expressed by the vector is PEDV S protein, or

[0430] -PEDV N protein.

[0431] 27. The immunogenic composition of claim 25 or 26, comprising or consisting of:

[0432] The CDV vector of any one of Schemes 1 to 12, and

[0433] A recombinant protein expressed by the vector, wherein the recombinant protein expressed by the vector is PEDV S protein or PEDV N protein, and optionally

[0434] A pharmaceutically or veterinarily acceptable carrier or excipient, wherein the carrier is preferably suitable for oral, intradermal, intramuscular or intranasal administration.

[0435] 28. The immunogenic composition of any one of claims 25 to 27, wherein the recombinant protein expressed by the vector is PEDV S protein.

[0436] 29. The immunogenic composition of any one of claims 25 to 28, wherein the recombinant protein expressed by the vector is a PEDV S protein comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0437] 30. The immunogenic composition of any one of claims 25 to 29, wherein the recombinant protein expressed by the vector is a PEDV S protein comprising or consisting of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

[0438] 31. A vaccine or pharmaceutical composition comprising

[0439] a. A vector according to any one of Schemes 1 to 12, and

[0440] b. a recombinant protein expressed by the vector and / or a quaternary structure comprising a plurality of recombinant proteins expressed by the vector, and

[0441] c. a pharmaceutically or veterinarily acceptable carrier or excipient, preferably, the carrier is suitable for intranasal administration, and

[0442] d. The vaccine optionally further comprises an adjuvant.

[0443] 32. The vaccine or pharmaceutical composition of claim 31, wherein the recombinant protein expressed by the vector is PEDV S protein or PEDV N protein.

[0444] 33. The vaccine or pharmaceutical composition of claim 31 or 32, wherein the recombinant protein expressed by the vector is a PEDV S protein, and wherein the PEDV S protein preferably comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0445] 34. The vaccine or pharmaceutical composition of any one of claims 31 to 33, wherein the recombinant protein expressed by the vector is a PEDV S protein, and wherein the PEDV S protein preferably comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

[0446] 35. The vaccine or pharmaceutical composition of any one of claims 31 to 34, comprising or consisting of:

[0447] a. The CDV vector of any one of Schemes 1 to 12, and

[0448] b. a recombinant protein expressed by the vector, wherein the recombinant protein comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and

[0449] c. a pharmaceutically or veterinarily acceptable carrier or excipient, preferably the carrier is suitable for oral, intradermal, intramuscular or intranasal administration,

[0450] d. and optionally an adjuvant.

[0451] 36. The vaccine or pharmaceutical composition of any one of claims 31 to 35, comprising or consisting of:

[0452] a. The CDV vector of any one of Schemes 1 to 12, and

[0453] b. a recombinant protein expressed by the vector, wherein the recombinant protein comprises or consists of an amino acid sequence that is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 16 or SEQ ID NO: 17, and

[0454] c. a pharmaceutically or veterinarily acceptable carrier or excipient, preferably the carrier is suitable for oral, intradermal, intramuscular or intranasal administration,

[0455] d. and optionally an adjuvant.

[0456] 37. A method of preparing an immunogenic composition or vaccine for reducing the incidence or severity of one or more clinical signs associated with or caused by an infection, the method comprising the steps of:

[0457] a. infecting a mammalian host cell with a vector as described in any one of Schemes 1 to 12,

[0458] b. culturing the infected cells under suitable conditions,

[0459] c. Collect infected cell cultures,

[0460] d. optionally purifying the collected infected cell culture of step c),

[0461] e. optionally mixing the harvested infected cell cultures with a pharmaceutically acceptable carrier.

[0462] 38. The method of claim 37, wherein the immunogenic composition or the vaccine reduces the severity of one or more clinical signs associated with or caused by porcine epidemic diarrhea virus (PEDV) infection.

[0463] 39. The immunogenic composition of any one of claims 25 to 30, or the vaccine or pharmaceutical composition of any one of claims 31 to 36, for use in reducing or preventing clinical signs or disease caused by PEDV infection in an animal, or in a method of treating or preventing PEDV infection in an animal, wherein the animal is preferably a pig.

[0464] 40. The immunogenic composition of any one of claims 25 to 30 or the vaccine or pharmaceutical composition of any one of claims 31 to 36, for use in a method of inducing an immune response against PEDV in pigs, particularly preferably pregnant sows.

[0465] 41. The immunogenic composition of any one of claims 25 to 30, or the vaccine or pharmaceutical composition of any one of claims 31 to 36, for use in a method of reducing or preventing clinical signs or disease caused by PEDV infection in piglets, wherein the piglets are to be nursed by sows to which the immunogenic composition has been administered.

[0466] 42. The immunogenic composition of embodiment 41, wherein the sow to which the immunogenic composition has been administered is a sow to which the immunogenic composition has been administered while the sow is pregnant, specifically while the sow is carrying the piglet.

[0467] 43. The immunogenic composition of any one of claims 25 to 30 or the vaccine or pharmaceutical composition of any one of claims 31 to 36, for use according to any one of claims 39 to 42, wherein the immunogenic composition or the vaccine or pharmaceutical composition is to be administered transmucosally, preferably intranasally.

[0468] 44. The immunogenic composition of any one of claims 25 to 30, or the vaccine or pharmaceutical composition of any one of claims 31 to 36, for use according to any one of claims 40 to 43, wherein the immunogenic composition, the vaccine or the pharmaceutical composition is to be administered to the sow transmucosally, preferably intranasally.

[0469] 45. A method of immunizing an individual, comprising administering to the individual the immunogenic composition of any one of claims 25 to 30 or the vaccine or pharmaceutical composition of any one of claims 31 to 36.

[0470] 46. A method for immunizing a pig against clinical disease caused by at least one pathogen in the animal, the method comprising the step of administering to the animal an immunogenic composition of any one of claims 25 to 30 or a vaccine or pharmaceutical composition of any one of claims 31 to 36, wherein the immunogenic composition or vaccine is incapable of causing clinical signs of infection but is capable of inducing an immune response that immunizes the animal against the pathogenic form of the at least one pathogen.

[0471] 47. The method of claim 46, wherein the at least one pathogen is PEDV.

[0472] 48. A method of inducing antibodies specific for PEDV in a sow, wherein the method comprises administering to the sow the immunogenic composition of any one of schemes 25 to 30 or the vaccine or pharmaceutical composition of any one of schemes 31 to 36.

[0473] 49. A method of reducing or preventing clinical signs or diseases caused by PEDV infection in piglets, wherein the method comprises

[0474] - administering to a sow an immunogenic composition according to any one of schemes 25 to 30 or a vaccine or pharmaceutical composition according to any one of schemes 31 to 36, and

[0475] - allowing the piglet to be nursed by the sow.

[0476] 50. The method of claim 49, wherein the sow is pregnant, in particular a sow carrying the pig.

[0477] 51. The method of scheme 49 or 50, comprising the following steps

[0478] - administering the immunogenic composition of any one of schemes 25 to 30 or the vaccine or pharmaceutical composition of any one of schemes 31 to 36 to a sow pregnant with the piglet,

[0479] - causing the sow to give birth to the piglet, and

[0480] - allowing the piglet to be nursed by the sow.

[0481] 52. A method of reducing mortality caused by PEDV infection in piglets, wherein the piglets are to be nursed by sows to which the immunogenic composition of any one of schemes 25 to 30 has been administered.

[0482] 53. The method of any one of claims 45 to 52, wherein the immunogenic composition, the vaccine or the pharmaceutical composition is administered to the sow mucosally, preferably intranasally.

[0483] 54. The method of any one of claims 45 to 53, wherein the immunogenic composition, the vaccine, or the pharmaceutical composition is administered to the sow twice.

[0484] 55. The method of any one of claims 45 to 54, wherein the immunogenic composition, the vaccine or the pharmaceutical composition is administered to the sow twice transmucosally, preferably twice intranasally.

[0485] 56. A kit for inducing an immune response against PEDV in pigs or vaccinating pigs against PEDV-associated disease in pigs and / or reducing the incidence or severity of one or more clinical signs associated with or caused by PEDV, comprising:

[0486] a) a syringe or dispenser capable of administering the vaccine to the pig, in particular via the intranasal route; and

[0487] b) the immunogenic composition of any one of claims 25 to 30 or the vaccine of any one of claims 31 to 36, and

[0488] c) Optional instruction manual.

[0489] Sequence Overview

[0490] The following sequences are described and disclosed herein in detail in the present invention, wherein the nucleotide sequences in the sequence listing are provided from left to right in the 5' to 3' direction, and wherein:

[0491] SEQ ID NO: 1 corresponds to the amino acid sequence of PEDV S protein (derived from genotype 2b PEDV),

[0492] SEQ ID NO: 2 corresponds to the amino acid sequence of PEDV S protein (derived from genotype 2a PEDV),

[0493] SEQ ID NO: 3 (RNA) corresponds to the sequence encoding PEDV S protein (derived from G2b PEDV),

[0494] SEQ ID NO: 4 (RNA) corresponds to the sequence of SEQ ID NO. 3 with another sequence of a second stop codon (to satisfy the "rule of six"),

[0495] SEQ ID NO: 5 (RNA) corresponds to the sequence encoding PEDV S protein (derived from genotype 2a PEDV),

[0496] SEQ ID NO: 6 (RNA) corresponds to an expression cassette comprising the sequence of SEQ ID NO: 4,

[0497] SEQ ID NO: 7 (RNA) corresponds to an expression cassette comprising the sequence of SEQ ID NO: 4,

[0498] SEQ ID NO:8 (RNA) comprises the sequence of SEQ ID NO:6 and / or SEQ ID NO:7,

[0499] SEQ ID NO: 9 (RNA) corresponds to a sequence comprising the M, F, H, and L genes of CDV,

[0500] SEQ ID NO: 10 (RNA) corresponds to a sequence comprising the N and P genes of CDV,

[0501] SEQ ID NO: 11 corresponds to the reverse complement of DNA of SEQ ID NO: 3,

[0502] SEQ ID NO: 12 corresponds to the reverse complement of DNA of SEQ ID NO: 4,

[0503] SEQ ID NO: 13 corresponds to the reverse complement of DNA of SEQ ID NO: 8,

[0504] SEQ ID NO: 14 corresponds to a DNA sequence comprising the sequence of SEQ ID NO: 13,

[0505] SEQ ID NO: 15 corresponds to the amino acid sequence of the PEDV S protein encoded by SEQ ID NO: 5,

[0506] SEQ ID NO: 16 corresponds to the amino acid sequence of PEDV S protein (derived from genotype 2a PEDV),

[0507] SEQ ID NO: 17 corresponds to the amino acid sequence of PEDV S protein (derived from genotype 2a PEDV),

[0508] SEQ ID NO: 18-21: Probe, primer and ultramer sequences (Table 2). Sequence Listing <110> Boehringer Ingelheim Animal Health GmbH <120> Intranasal vectored vaccine against porcine epidemic diarrhea <130> 01-3333 <150> EP18195788.7 <151> September 20, 2018 <150> EP19165985.3 <151> 2019-3-28 <160> twenty one <170> PatentIn version 3.5 <210> 1 <211> 1383 <212> PRT <213> Porcine epidemic diarrhea virus <400> 1 Met Lys Ser Leu Asn Tyr Phe Trp Leu Phe Leu Pro Val Leu Ser Thr 1 5 10 15 Leu Ser Leu Pro Gln Asp Val Thr Arg Cys Gln Ser Thr Ile Asn Phe 20 25 30 Arg Arg Phe Phe Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val 35 40 45 Leu Gly Gly Tyr Leu Pro Ser Met Asn Ser Ser Ser Trp Tyr Cys Gly 50 55 60 Thr Gly Leu Glu Thr Ala Ser Gly Val His Gly Ile Phe Leu Ser Tyr 65 70 75 80 Ile Asp Ala Gly Gln Gly Phe Glu Ile Gly Ile Ser Gln Glu Pro Phe 85 90 95 Asp Pro Ser Gly Tyr Gln Leu Tyr Leu His Lys Ala Thr Asn Gly Asn 100 105 110 His Asn Ala Ile Ala Arg Leu Arg Ile Cys Gln Phe Pro Asn Asn Lys 115 120 125 Thr Leu Gly Pro Thr Val Asn Asp Val Thr Thr Gly Arg Asn Cys Leu 130 135 140 Phe Asn Lys Ala Ile Pro Ala Tyr Met Gln Asp Gly Lys Asn Ile Val 145 150 155 160 Val Gly Ile Thr Trp Asp Asn Asp Arg Val Thr Val Phe Ala Asp Lys 165 170 175 Ile Tyr His Phe Tyr Leu Lys Asn Asp Trp Ser Arg Val Ala Thr Arg 180 185 190 Cys Tyr Asn Lys Arg Ser Cys Ala Met Gln Tyr Val Tyr Thr Pro Thr 195 200 205 Tyr Tyr Met Leu Asn Val Thr Ser Ala Gly Glu Asp Gly Ile Tyr Tyr 210 215 220 Glu Pro Cys Thr Ala Asn Cys Ser Gly Tyr Ala Val Asn Val Phe Ala 225 230 235 240 Thr Asp Ser Asn Gly His Ile Pro Glu Gly Phe Ser Phe Asn Asn Trp 245 250 255 Phe Leu Leu Ser Asn Asp Ser Thr Leu Leu His Gly Lys Val Val Ser 260 265 270 Asn Gln Pro Leu Leu Val Asn Cys Leu Leu Ala Ile Pro Lys Ile Tyr 275 280 285 Gly Leu Gly Gln Phe Phe Ser Phe Asn Gln Thr Met Asp Gly Val Cys 290 295 300 Asn Gly Ala Ala Ala Gln Arg Ala Pro Glu Ala Leu Arg Phe Asn Ile 305 310 315 320 Asn Asp Thr Ser Val Ile Leu Ala Glu Gly Ser Ile Val Leu His Thr 325 330 335 Ala Leu Gly Thr Asn Leu Ser Phe Val Cys Ser Asn Ser Ser Asp Pro 340 345 350 His Leu Ala Thr Phe Thr Ile Pro Leu Gly Ala Thr Gln Val Pro Tyr 355 360 365 Tyr Cys Phe Leu Lys Val Asp Thr Tyr Asn Ser Asn Val Tyr Lys Phe 370 375 380 Leu Ala Val Leu Pro Pro Thr Val Arg Glu Ile Val Ile Thr Lys Tyr 385 390 395 400 Gly Asp Val Tyr Val Asn Gly Phe Gly Tyr Leu His Leu Gly Leu Leu 405 410 415 Asp Ala Val Thr Ile Asn Phe Thr Gly His Gly Thr Asp Asp Asp Val 420 425 430 Ser Gly Phe Trp Thr Ile Ala Ser Thr Asn Phe Val Asp Ala Leu Ile 435 440 445 Glu Val Gln Gly Thr Ala Ile Gln Arg Ile Leu Tyr Cys Asp Asp Pro 450 455 460 Val Ser Gln Leu Lys Cys Ser Gln Val Ala Phe Asp Leu Asp Asp Gly 465 470 475 480 Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His Glu Gln Pro Ile 485 490 495 Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe Val Asn Ile 500 505 510 Thr Val Ser Ala Ser Phe Gly Gly His Ser Gly Ala Asn Leu Ile Ala 515 520 525 Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val Asp Thr Arg 530 535 540 Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn Ser Tyr Gly Tyr 545 550 555 560 Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu Gln Ser Val 565 570 575 Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr Ser Leu Leu 580 585 590 Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu Phe Gly Ser 595 600 605 Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Glu Gly Glu Leu 610 615 620 Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr Asp Val Ser Phe 625 630 635 640 Met Thr Leu Asp Val Cys Thr Lys Tyr Thr Ile Tyr Gly Phe Lys Gly 645 650 655 Glu Gly Ile Ile Thr Leu Thr Asn Ser Ser Phe Leu Ala Gly Val Tyr 660 665 670 Tyr Thr Ser Asp Ser Gly Gln Leu Leu Ala Phe Lys Asn Val Thr Ser 675 680 685 Gly Ala Val Tyr Ser Val Thr Pro Cys Ser Phe Ser Glu Gln Ala Ala 690 695 700 Tyr Val Asp Asp Asp Ile Val Gly Val Ile Ser Ser Leu Ser Ser Ser 705 710 715 720 Thr Phe Asn Ser Thr Arg Glu Leu Pro Gly Phe Phe Tyr His Ser Asn 725 730 735 Asp Gly Ser Asn Cys Thr Glu Pro Val Leu Val Tyr Ser Asn Ile Gly 740 745 750 Val Cys Lys Ser Gly Ser Ile Gly Tyr Val Pro Ser Gln Ser Gly Gln 755 760 765 Val Lys Ile Ala Pro Thr Val Thr Gly Asn Ile Ser Ile Pro Thr Asn 770 775 780 Phe Ser Met Ser Ile Arg Thr Glu Tyr Leu Gln Leu Tyr Asn Thr Pro 785 790 795 800 Val Ser Val Asp Cys Ala Thr Tyr Val Cys Asn Gly Asn Ser Arg Cys 805 810 815 Lys Gln Leu Leu Thr Gln Tyr Thr Ala Ala Cys Lys Thr Ile Glu Ser 820 825 830 Ala Leu Gln Leu Ser Ala Arg Leu Glu Ser Val Glu Val Asn Ser Met 835 840 845 Leu Thr Ile Ser Glu Glu Ala Leu Gln Leu Ala Thr Ile Ser Ser Phe 850 855 860 Asn Gly Asp Gly Tyr Asn Phe Thr Asn Val Leu Gly Val Ser Val Tyr 865 870 875 880 Asp Pro Ala Ser Gly Arg Val Val Gln Lys Arg Ser Phe Ile Glu Asp 885 890 895 Leu Leu Phe Asn Lys Val Val Thr Asn Gly Leu Gly Thr Val Asp Glu 900 905 910 Asp Tyr Lys Arg Cys Ser Asn Gly Arg Ser Val Ala Asp Leu Val Cys 915 920 925 Ala Gln Tyr Tyr Ser Gly Val Met Val Leu Pro Gly Val Val Asp Ala 930 935 940 Glu Lys Leu His Met Tyr Ser Ala Ser Leu Ile Gly Gly Met Val Leu 945 950 955 960 Gly Gly Phe Thr Ser Ala Ala Ala Leu Pro Phe Ser Tyr Ala Val Gln 965 970 975 Ala Arg Leu Asn Tyr Leu Ala Leu Gln Thr Asp Val Leu Gln Arg Asn 980 985 990 Gln Gln Leu Leu Ala Glu Ser Phe Asn Ser Ala Ile Gly Asn Ile Thr 995 1000 1005 Ser Ala Phe Glu Ser Val Lys Glu Ala Ile Ser Gln Thr Ser Lys 1010 1015 1020 Gly Leu Asn Thr Val Ala His Ala Leu Thr Lys Val Gln Glu Val 1025 1030 1035 Val Asn Ser Gln Gly Ala Ala Leu Thr Gln Leu Thr Val Gln Leu 1040 1045 1050 Gln His Asn Phe Gln Ala Ile Ser Ser Ser Ile Asp Asp Ile Tyr 1055 1060 1065 Ser Arg Leu Asp Ile Leu Ser Ala Asp Val Gln Val Asp Arg Leu 1070 1075 1080 Ile Thr Gly Arg Leu Ser Ala Leu Asn Ala Phe Val Ala Gln Thr 1085 1090 1095 Leu Thr Lys Tyr Thr Glu Val Gln Ala Ser Arg Lys Leu Ala Gln 1100 1105 1110 Gln Lys Val Asn Glu Cys Val Lys Ser Gln Ser Gln Arg Tyr Gly 1115 1120 1125 Phe Cys Gly Gly Asp Gly Glu His Ile Phe Ser Leu Val Gln Ala 1130 1135 1140 Ala Pro Gln Gly Leu Leu Phe Leu His Thr Val Leu Val Pro Gly 1145 1150 1155 Asp Phe Ile Asp Val Ile Ala Ile Ala Gly Leu Cys Val Asn Asp 1160 1165 1170 Glu Ile Ala Leu Thr Leu Arg Glu Pro Gly Leu Val Leu Phe Thr 1175 1180 1185 His Glu Leu Gln Asn His Thr Ala Thr Glu Tyr Phe Val Ser Ser 1190 1195 1200 Arg Arg Met Phe Glu Pro Arg Lys Pro Thr Val Ser Asp Phe Val 1205 1210 1215 Gln Ile Glu Ser Cys Val Val Thr Tyr Val Asn Leu Thr Arg Asp 1220 1225 1230 Gln Leu Pro Asp Val Ile Pro Asp Tyr Ile Asp Val Asn Lys Thr 1235 1240 1245 Leu Asp Glu Ile Leu Ala Ser Leu Pro Asn Arg Thr Gly Pro Ser 1250 1255 1260 Leu Pro Leu Asp Val Phe Asn Ala Thr Tyr Leu Asn Leu Thr Gly 1265 1270 1275 Glu Ile Ala Asp Leu Glu Gln Arg Ser Glu Ser Leu Arg Asn Thr 1280 1285 1290 Thr Glu Glu Leu Gln Ser Leu Ile Tyr Asn Ile Asn Asn Thr Leu 1295 1300 1305 Val Asp Leu Glu Trp Leu Asn Arg Val Glu Thr Tyr Ile Lys Trp 1310 1315 1320 Pro Trp Trp Val Trp Leu Ile Val Phe Ile Val Leu Ile Phe Val 1325 1330 1335 Val Ser Leu Leu Val Phe Cys Cys Ile Ser Thr Gly Cys Cys Gly 1340 1345 1350 Cys Cys Gly Cys Cys Cys Ala Cys Phe Ser Gly Cys Cys Arg Gly 1355 1360 1365 Pro Arg Leu Gln Pro Tyr Glu Val Phe Glu Lys Val His Val Gln 1370 1375 1380 <210> 2 <211> 1388 <212> PRT <213> Porcine epidemic diarrhea virus <400> 2 Met Lys Ser Leu Thr Tyr Phe Trp Leu Phe Leu Pro Val Leu Ser Thr 1 5 10 15 Leu Ser Leu Pro Gln Asp Val Thr Arg Cys Ser Ala Asn Thr Asn Phe 20 25 30 Arg Arg Phe Phe Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val 35 40 45 Leu Gly Gly Tyr Leu Pro Ile Gly Glu Asn Gln Gly Val Asn Ser Thr 50 55 60[[ID=,37]] Trp Tyr Cys Ala Gly Gln His Pro Thr Ala Ser Gly Val His Gly Ile [[ID=,40]]65 70 75 80 Phe Val Ser His Ile Arg Gly Gly His Gly Phe Glu Ile Gly Ile Ser 85 90 95 Gln Glu Pro Phe Asp Pro Ser Gly Tyr Gln Leu Tyr Leu His Lys Ala 100 105 110 Thr Asn Gly Asn Thr Asn Ala Thr Ala Arg Leu Arg Ile Cys Gln Phe 115 120 125 Pro Ser Ile Lys Thr Leu Gly Pro Thr Ala Asn Asn Asp Val Thr Thr 130 135 140 Gly Arg Asn Cys Leu Phe Asn Lys Ala Ile Pro Ala His Met Ser Glu 145 150 155 160 His Ser Val Val Gly Ile Thr Trp Asp Asn Asp Arg Val Thr Val Phe 165 170 175 Ser Asp Lys Ile Tyr Tyr Phe Tyr Phe Lys Asn Asp Trp Ser Arg Val 180 185 190 Ala Thr Lys Cys Tyr Asn Ser Gly Gly Cys Ala Met Gln Tyr Val Tyr 195 200 205 Glu Pro Thr Tyr Tyr Met Leu Asn Val Thr Ser Ala Gly Glu Asp Gly 210 215 220 Ile Ser Tyr Gln Pro Cys Thr Ala Asn Cys Ile Gly Tyr Ala Ala Asn 225 230 235 240 Val Phe Ala Thr Glu Pro Asn Gly His Ile Pro Glu Gly Phe Ser Phe 245 250 255 Asn Asn Trp Phe Leu Leu Ser Asn Asp Ser Thr Leu Val His Gly Lys 260 265 270 Val Val Ser Asn Gln Pro Leu Leu Val Asn Cys Leu Leu Ala Ile Pro 275 280 285 Lys Ile Tyr Gly Leu Gly Gln Phe Phe Ser Phe Asn Gln Thr Ile Asp 290 295 300 Gly Val Cys Asn Gly Ala Ala Val Gln Arg Ala Pro Glu Ala Leu Arg 305 310 315 320 Phe Asn Ile Asn Asp Thr Ser Val Ile Leu Ala Glu Gly Ser Ile Val 325 330 335 Leu His Thr Ala Leu Gly Thr Asn Phe Ser Phe Val Cys Ser Asn Ser 340 345 350 Ser Asn Pro His Leu Ala Thr Phe Ala Ile Pro Leu Gly Ala Thr Gln 355 360 365 Val Pro Tyr Tyr Cys Phe Leu Lys Val Asp Thr Tyr Asn Ser Thr Val 370 375 380 Tyr Lys Phe Leu Ala Val Leu Pro Pro Thr Val Arg Glu Ile Val Ile 385 390 395 400 Thr Lys Tyr Gly Asp Val Tyr Val Asn Gly Phe Gly Tyr Leu His Leu 405 410 415 Gly Leu Leu Asp Ala Val Thr Ile Asn Phe Thr Gly His Gly Thr Asp 420 425 430 Asp Asp Val Ser Gly Phe Trp Thr Ile Ala Ser Thr Asn Phe Val Asp 435 440 445 Ala Leu Ile Glu Val Gln Gly Thr Ala Ile Gln Arg Ile Leu Tyr Cys 450 455 460 Asp Asp Pro Val Ser Gln Leu Lys Cys Ser Gln Val Ala Phe Asp Leu 465 470 475 480 Asp Asp Gly Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His Glu 485 490 495 Gln Pro Ile Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe 500 505 510 Val Asn Ile Thr Val Ser Ala Ser Phe Gly Gly His Ser Gly Ala Asn 515 520 525 Leu Ile Ala Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val 530 535 540 Asp Thr Arg Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn Ser 545 550 555 560 Tyr Gly Tyr Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu 565 570 575 Gln Ser Val Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr 580 585 590 Ser Leu Leu Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu 595 600 605 Phe Gly Ser Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys 610 615 620 Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr Asp 625 630 635 640 Val Ser Phe Met Thr Leu Asp Val Cys Thr Lys Tyr Thr Ile Tyr Gly 645 650 655 Phe Lys Gly Glu Gly Ile Ile Thr Leu Thr Asn Ser Ser Phe Leu Ala 660 665 670 Gly Val Tyr Tyr Thr Ser Asp Ser Gly Gln Leu Leu Ala Phe Lys Asn 675 680 685 Val Thr Ser Gly Ala Val Tyr Ser Val Thr Pro Cys Ser Phe Ser Glu 690 695 700 Gln Ala Ala Tyr Val Asp Asp Asp Ile Val Gly Val Ile Ser Ser Leu 705 710 715 720 Ser Ser Ser Thr Phe Asn Ser Thr Arg Glu Leu Pro Gly Phe Phe Tyr 725 730 735 His Ser Asn Asp Gly Ser Asn Cys Thr Glu Pro Val Leu Val Tyr Ser 740 745 750 Asn Ile Gly Val Cys Lys Ser Gly Ser Ile Gly Tyr Val Pro Ser Gln 755 760 765 Ser Gly Gln Val Lys Ile Ala Pro Thr Val Thr Gly Asn Ile Ser Ile 770 775 780 Pro Thr Asn Phe Ser Met Ser Ile Arg Thr Glu Tyr Leu Gln Leu Tyr 785 790 795 800 Asn Thr Pro Val Ser Val Asp Cys Ala Thr Tyr Val Cys Asn Gly Asn 805 810 815 Ser Arg Cys Lys Gln Leu Leu Thr Gln Tyr Thr Ala Ala Cys Lys Thr 820 825 830 Ile Glu Ser Ala Leu Gln Leu Ser Ala Arg Leu Glu Ser Val Glu Val 835 840 845 Asn Ser Met Leu Thr Ile Ser Glu Glu Ala Leu Gln Leu Ala Thr Ile 850 855 860 Ser Ser Phe Asn Gly Asp Gly Tyr Asn Phe Thr Asn Val Leu Gly Val 865 870 875 880 Ser Val Tyr Asp Pro Ala Ser Gly Arg Val Val Gln Lys Arg Ser Phe 885 890 895 Ile Glu Asp Leu Leu Phe Asn Lys Val Val Thr Asn Gly Leu Gly Thr 900 905 910 Val Asp Glu Asp Tyr Lys Arg Cys Ser Asn Gly Arg Ser Val Ala Asp 915 920 925 Leu Val Cys Ala Gln Tyr Tyr Ser Gly Val Met Val Leu Pro Gly Val 930 935 940 Val Asp Ala Glu Lys Leu His Met Tyr Ser Ala Ser Leu Ile Gly Gly 945 950 955 960 Met Val Leu Gly Gly Phe Thr Ser Ala Ala Ala Leu Pro Phe Ser Tyr 965 970 975 Ala Val Gln Ala Arg Leu Asn Tyr Leu Ala Leu Gln Thr Asp Val Leu 980 985 990 Gln Arg Asn Gln Gln Leu Leu Ala Glu Ser Phe Asn Ser Ala Ile Gly 995 1000 1005 Asn Ile Thr Ser Ala Phe Glu Ser Val Lys Glu Ala Ile Ser Gln 1010 1015 1020 Thr Ser Lys Gly Leu Asn Thr Val Ala His Ala Leu Thr Lys Val 1025 1030 1035 Gln Glu Val Val Asn Ser Gln Gly Ala Ala Leu Thr Gln Leu Thr 1040 1045 1050 Val Gln Leu Gln His Asn Phe Gln Ala Ile Ser Ser Ser Ile Asp 1055 1060 1065 Asp Ile Tyr Ser Arg Leu Asp Ile Leu Ser Ala Asp Val Gln Val 1070 1075 1080 Asp Arg Leu Ile Thr Gly Arg Leu Ser Ala Leu Asn Ala Phe Val 1085 1090 1095 Ala Gln Thr Leu Thr Lys Tyr Thr Glu Val Gln Ala Ser Arg Lys 1100 1105 1110 Leu Ala Gln Gln Lys Val Asn Glu Cys Val Lys Ser Gln Ser Gln 1115 1120 1125 Arg Tyr Gly Phe Cys Gly Gly Asp Gly Glu His Ile Phe Ser Leu 1130 1135 1140 Val Gln Ala Ala Pro Gln Gly Leu Leu Phe Leu His Thr Val Leu 1145 1150 1155 Val Pro Ser Asp Phe Val Asp Val Ile Ala Ile Ala Gly Leu Cys 1160 1165 1170 Val Asn Asp Glu Ile Ala Leu Thr Leu Arg Glu Pro Gly Leu Val 1175 1180 1185 Leu Phe Thr His Glu Leu Gln Asn His Thr Ala Thr Glu Tyr Phe 1190 1195 1200 Val Ser Ser Arg Arg Met Phe Glu Pro Arg Lys Pro Thr Val Ser 1205 1210 1215 Asp Phe Val Gln Ile Glu Ser Cys Val Val Thr Tyr Val Asn Leu 1220 1225 1230 Thr Arg Asp Gln Leu Pro Asp Val Ile Pro Asp Tyr Ile Asp Val 1235 1240 1245 Asn Lys Thr Leu Asp Glu Ile Leu Ala Ser Leu Pro Asn Arg Thr 1250 1255 1260 Gly Pro Ser Leu Pro Leu Asp Val Phe Asn Ala Thr Tyr Leu Asn 1265 1270 1275 Leu Thr Gly Glu Ile Ala Asp Leu Glu Gln Arg Ser Glu Ser Leu 1280 1285 1290 Arg Asn Thr Thr Glu Glu Leu Gln Ser Leu Ile Tyr Asn Ile Asn 1295 1300 1305 Asn Thr Leu Val Asp Leu Glu Trp Leu Asn Arg Val Glu Thr Tyr 1310 1315 1320 Ile Lys Trp Pro Trp Trp Val Trp Leu Ile Ile Phe Ile Val Leu 1325 1330 1335 Ile Phe Val Val Ser Leu Leu Val Phe Cys Cys Ile Ser Thr Gly 1340 1345 1350 Cys Cys Gly Cys Cys Gly Cys Cys Cys Ala Cys Phe Ser Gly Cys 1355 1360 1365 Cys Arg Gly Pro Arg Leu Gln Pro Tyr Glu Val Phe Glu Lys Val 1370 1375 1380 His Val Gln Cys Gly 1385 <210> 3 <211> 4152 <212> RNA <213> Artificial sequence <220> <223> Encoding PEDV S protein <400> 3 ucacugcacu cucacuuucu caaacaccuc agcgggcugg agccgggguc cucuacagca 60 gccgcugaag caggcgcagc agcagccgca gcagccgcag cagccggugg agaugcagca 120 gaacaccagc agggacacca cgaagaucag cacgaugaac acgaucagcc acacccacca 180 uggccacuug auguaggucu ccacucuguu cagccacucc agguccacca ggguguuguu 240 gauguuguag aucagggacu gcagcuccuc ggugguguuu cucagggacu cgcuucucug 300 360 caggcugggg ccgguucugu uuggcaggga ggccaggauc ucguccaggg ucuuguucac 420 gucgauguag ucugggauca cgucuggcag cuggucucug gucagguua cguaggucac 480 cacgcaggac ucgauucugca cgaagucgcu cacgguggc uuucuuggcu cgaacauccg 540 600 caggccgggc ucucucaggg ucagggcgau cucgucguuc acgcacaggc cggcgauggc 660 gaucacgucg augaagucgc cuggcaccag cacggugugc aggaacagca ggcccugugg 720 780 gcucugggac uucacgcacu cguucaccuu cugcugggcc agcuuucugg aggccugcac 840 cucgguguac uuggucaggg ucugggccac gaaggcguuc aggcggaca gucugccggu 900 960 1020 ggcgcccugg gaguucacca ccuccugcac cuuggucagg gcgugggcca cgguguucag 1080 gcccuuggag gucuggcuga uggccuccuu cacgcucucg aaggcggagg ugauguugcc 1140 gauggcgcug uugaagcucu cggccagcag cugcugguuu cucugcagca cgucggucug 1200 cagggccagg uaguucaguc uggccugcac ggcguagcug aagggcaggg cggcggcgga 1260 ggugaagccg cccagcacca ugccgccgau cagggaggcg cuguacaugu gcagcuucuc 1320 ggcguccacc acgccuggca gcaccaucac gccgcuguaa uacugggcgc acaccagguc 1380 ggccacggau cugccguugc ugcaucucuu guaguccucg uccacggugc ccaggccguu 1440 ggucaccacc uuguugaagg cggcguccuc gaugaagcuc cucuucugca ccacucugcc 1500 gcuggcuggg ucguacacgc ucacgcccag cacguuggug aaguuguagc cgucgccguu 1560 gaaggagcug augguggcca gcugcagggc cuccucggag auggucagca ugcuguucac 1620 cuccacggac uccagccugg cgcucagcug cagggcgcuc ucgauggucu ugcaggcggc 1680 gguguacugg gucagcagcu gcuugcaucu ggaguugccg uugcacacgu agguggcgca 1740 1800. 1800. 1800. 1800. 1800. 1800. 1800. 1800 guuggugggg auggagaugu ugccggucac gguggggggcg aucuucaccu ggccgcucug ggauggcacg uagccgaugg agccgcucuu gcacacgccg auguuggagu acaccagcac uggcucggug caguuggagc cgucguugcu gugguagaag aagccuggca gcucucuggu ggaguugaag gugcuggagg acaggcugga gaucacgccc acgaugucgu cguccacgua ggcggccugc ucgcugaagg agcagggg cacgcuguac acggcgccgg aggucacguu cuugaaggcc agcagcuggc cgcugucgga gguguaguac acgccggcca ggaaggagcu 2220. guuggucagg gugaugaugc ccucgcccuu gaagccguag augguguacu uggugcacac 2280. guccaggguc augaagcuca cgucggucac gcccuccagg ggcuuugggg ugccggugau 2340. cagcucgccc ucggugaacu ggaaguacag gcuggugaac uucacgccgg agccgaacuc uggguagccg aacaggucga uggugcaggc gcuggccagc aggcuggugg acacgcagaa 2460. 2460. 2460. 2460. 2460. 2460. 2460. 2460. 2460 gcucuugcuc acguagccgu agcuguag acguug ag aaggcuga agcuguag 2520 ccuggugucc acgcagaagc uggagaagcc gugauggug gugucggagg cgaucagguu 2580 ggcgccggag uggccgccga aggagggcu cacggugaug ucacgagg aguggucguu 2640 gaaggauggc agggucacga agcugauugg cugcucgugg cucagchaggu uccuggagcu 2700 gaugggguag aagccgucgu ccaggucgaa ggccaccugg cugcacuuca gcugggacac 2760 ugggucgucg caguacagga ugcgcuggau ggcggugccc ugcaccucg uggcggcguc 2820 cacgaaguug guggaggcga ugguccagaa gccgcucacg ucgucgucgg ugccguggcc 2880 ggugaaguug auggucacgg cguccagcag gcccaggugc agguagccga agccguucac 2940 guacacgucg ccguacuugg ugaucacgau cucucucacg guggguggca gcacggccag 3000 vibration oscillator oscillator oscillator oscillator 3060 gguggcgccc gggaggcugg gggaggggg gggaggcugg gghaggcuc 3120 gaagcucagg uuggccca gggcggug cagcacgaug cugcccucgg ccaggaucac 3180 ggaggugucg uugauguuga aucucagggc cucuggggcc cucugggcgg cggggcgccguu 3240 gcacacgccg uccauggucu gguugaagcu gaaacugg cccaggccgu agaucuuugg 3300 gauggccagc aggcaguuca ccagcagugg gugguggac accaccuugc cgugcagcag 3360 3420 guugcugucg guggcgaaca cguucacgg guagccgcug caguuggcgg ugcagggcuc 3480 guaguagaug ccguccucgc cggcgcuggu cacguucagc auguaguagg uugggggugua 3540 3600 guucuucagg uagaaguggu aguacuuguc ggcgaacacg guacucugu cguuguccca 3660 ggugaugccc accacgaugu ucuugccguc cugcauguag gcugggaugg ccuuguugaa 3720 caggcaguuu cugccggugg ucacgucguu cacggugggg cccagggucu uguuguuggg 3780 gaacuggcag auucucagcc uggcgauggc guuguguug ccguuggugg ccuugugcag 3840 guacagcugg uagccgcuug ggucgaaggg cuccuggcug augccgaucu cgaagcccug 3900 gccggcgucg auguagcuca ggaagaugcc gugcacgccg gaggcggucu ccaggccggu 3960 gccgcaguac caggagcugg aguucaugcu uggcagguag ccgcccagca ccaccacggc 4020 gggggccugc acguugaacu uggagaagaa ccgucugaag uugauugugg acuggcaucu 4080 ugugacaucc ugagggaggc ugagggugga gagcacgggg aggaagagcc agaaguaguu 4140 gagggauuuc au 4152 <210> 4 <211> 4155 <212> RNA <213> Artificial sequence <220> <223> Encoding PEDV S protein <400> 4 uuaucacugc acucucacuu ucucaaacac cucagcgggc uggagccggg guccucuaca 60 gcagccgcug aagcaggcgc agcagcagcc gcagcagccg cagcagccgg uggagaugca 120 gcagaacacc agcagggaca ccacgaagau cagcacgaug aacacgauca gccacaccca 180 ccauggccac uugauguagg ucuccacucu guucagccac uccaggucca ccaggguguu 240 guugauguug uagaucaggg acugcagcuc cucgguggug uuucucaggg acucgcuucu 300 cugcuccagg ucggcgaucu cgccggucag guucagguag guggcguuga acacguccag 360 gggcaggcug gggccgguuc uguuuggcag ggaggccagg aucucgucca gggucuuguu 420 cacgucgaug uagucuggga ucacgucugg cagcuggucu cuggucaggu ucacguaggu 480 caccacgcag gacucgaucu gcacgaaguc gcucacggug ggcuuucuug gcucgaacau 540 ccgucuggag cucacgaaau acucgguggc ggugugguuc ugcagcucgu gggugaacag 600 caccaggccg ggcucucuca gggucagggc gaucucgucg uucacgcaca ggccggcgau 660 ggcgaucacg ucgaugaagu cgccuggcac cagcacggug ugcaggaaca gcaggcccug 720 uggggcggcc ugcaccaggg agaagaugug cucgccgucg ccgccgcaga agccguaucu 780 cuggcucugg gacuucacgc acucguucac cuucugcugg gccagcuuuc uggaggccug 840 caccucggug uacuugguca gggucugggc cacgaaggcg uucagggcgg acagucugcc 900 ggugaucagu cuguccaccu gcacgucggc ggacaggaug uccagccugg aguagauguc 960 gucgauggag cuggagaugg ccuggaaguu gugcugcagc ugcacgguca gcugggucag 1020 ggcggcgccc ugggaguuca ccaccuccug caccuugguc agggcguggg ccacgguguu 1080 caggcccuug gaggucuggc ugauggccuc cucacgcuc ucgaggcgg aggugauguu 1140 gccgauggcg cugugaagc ucucggccag cagcugcugg uuucucugca gcacgucggu 1200 cugcaggggcc agguaguca gucuggccug cacggcguag cugaagggca gggcggcggc 1260 ggaggugaag ccgcccagca ccaugccgcc gaucagggag gcgcuguaca ugugcagcuu 1320 cucggcgucc accacgccug gcagcaccau cacgccgcug uaauacuggg cgcaccaccag 1380 gucggccacg gaucugccgu ugcugcaucu cuuguagucc ucguccacgg ugcccaggcc 1440 guuggucacc accuuguga aggcggcguc cucgaugaag cuccucuucu gcuccucucu 1500 gccgcuggcu gggucguaca cgcucacgcc cccacguug gugaguugu agccgucgcc 1560 guugaaggag cugauggugg ccagcugcag ggcuccucg gagaugguca gcaugcuguu 1620 cuckoogg cugcagcc cuckoogg cuckoogg cuckoog cuckoogg 1680 ggcgguguac ugggucagca gcugcuugca uccuggaguug ccguugcaca cguagguggc 1740 gcaguccacg gandacgggggg cough cough cough cough cough 1800 gaguuggg gggauggaga uguugccggu cacggugggg gcgaucuuca ccuggccgcu 1860 cugggauggc acguagccga uggagccgcu cuggcacacg ccgauguugg aguacaccag 1920 cacuggcucg gugcaguugg agccgucgug aagaagccug gcagcucucu 1980 gguggaguug aaggugcugg aggacaggcu ggagaucacg cccacgaugu cgucguccac 2040 guaggcggcc ugcucgcuga aggagcaggg ggucacgcug uacacggcgc cggaggucac 2100 guucuugaag gccagcagcu ggccgcuguc ggagguguag uacacgccgg ccaggaagga 2160 gcuguugguc agggugaga ggcccucgcc cuugaagccg 2220 cacguccagg cuaugaagc ucacgucggu cacgcccucc aggggcuuug gggugccggu 2280 gaucagcucg cccucgguga acuggaagua caggcuggug aacuucacgc cggagccgaa 2340 cucuggguag ccgaacaggu cgauggugca ggcgcuggcc agcaggcugg uggacacgca 2400 gaacugcug aaggaaggu agacguacc ggacugcagg gugaaggggc agacguc 2460 cuggcucuug cucacguagc cguagcuug ggucacguug uagaacaggc ugaugguga 2520 2580 guuggcgccg gaguggccgc cgaaggaggc gcuacggug auguucacga aggagugguc 2640 guugaaggau ggcagguga cgaagcugau uggcugcucg uggcucagca gguuucugga 2700 gcugaugggg uagaagccgu cguccagguc gaaggccacc uggcugcacu ucagcuggga 2760 2820 guccacgaag uugguggaggg cgauggucca gaagccgcuc acgucgucgu cggugccgug 2880 gccggugaag uugaugguca cggcguccag caggcccagg ugcagguagc cgaagccguu 2940 cacguacacg ucgccguacu uggugaucac gaucucucuc acgguggug gcagcacggc 3000 caggaacuug uacacguugc uguuguaggu guccaccuuc aggaaagcagu aguauggcac 3060 cggguggcg cccaguggga ugggaaggu ggccaggugggg gggucggagc uggugagca 3120 caggaagcuc agguggugc ccagggcggu gugcagcacg augcugcccu cggccaggau 3180 cacggggug ucguugaugu ugaucucag ggccucuggg gcccucuggg cggcggcgcc 3240 guugcacacg ccguccaugg ucugguugaa gcugaagaac uggcccaggc cguagaucuu 3300 ugggauggcc agcaggcagu ucaccagcag uggcuggguug gacaccaccu ugccgugcag 3360 caggguggag ucguugcuca gcaggaacca guuguugaag gagaagcccu cgggaugug 3420 gccguugcug ucgguggcga acacguucac ggcguagccg cugcaguugg cggugcaggg 3480 cucguaguag augccguccu cgccggcgcu ggucacguuc agcauguagu agguuggggu 3540 guacacguac ugcauggcgc agcuccgcuu guuguagcac cugguggcca cuugggacca 3600 3660 ccaggugaug cccaccacga uguucuugcc guccugcaug uaggcuggga uggccuuuguu 3720 gaacaggcag uuucugccgg uggucacguc guucacggug gggcccaggg ucuuguuguu 3780 ggggaacugg cagauucuca gccuggcgau ggcguugugg uugccguugg uggccuugug 3840 cagguacagc ugguagccgc uugggucgaa gggcuccugg cugaugccga ucucgaagcc 3900 cuggccggcg ucgauguagc ucaggaagau gccgugcacg ccggaggcgg ucuccaggcc 3960 ggugccgcag uaccaggagc uggaguucau gcuuggcagg uagccgccca gcaccaccac 4020 ggcgggggcc ugcacguuga acuuggagaa gaaccgucug aaguugauug uggacuggca 4080 ucuugugaca uccugaggga ggcugagggu ggagagcacg gggaggaaga gccagaagua 4140 guugagggau uucau 4155 <210> 5 <211> 4167 <212> RNA <213> Artificial sequence <220> <223> Encoding PEDV S protein <400> 5 ucagccgcac ugaacucuga ccuucucgaa caccucugcc gguugaagcc ucgggccucu 60 acagcauccu gagaaacagg cacagcagca accgcagcau ccacaacaac cggugcuuau 120 gcagcaaaac accagcaggg auacgacgaa aaucaggacg augaagauga ucagccaaac 180 ccaccaaggc cauuuaaugu auguuucgac ucgguugagc cauucgagau ccaccagggu 240 auuguugaug uuguagauca ggcucuggag cuccucggug guguuccuca gacuuucuga 300 ccguuguuca agaucggcga ucucuccggu cagauucagg uagguagcgu uaaacacguc 360 gaguggcaag cugggcccug uucuauuggg cagacuggcc aguauuucgu ccagagucuu 420 guugacgucg auguagucgg ggaugacauc gggcagcuga ucucuuguga gguugacaua 480 agucacgacg cagcucucga ucuguacgaa gucagacacg guuggcuuuc uggguucaaa 540 cauccggcgg cuggacacga aguacucagu ggcuguguga uucugcaguu caugggugaa 600 cagcaccagu ccuggcucuc ggaggguaag ggcuauuccg ucguucacgc acaaaccggc 660 gauggcgauc acguccacga agucugaagg cacaagcacc guguggagaa acagcagucc 720 cuggggagca gccuguacca gagagaauau augcucaccg uccccaccgc agaagccgua 780 gcgcuggcuu uggcucuuca cgcacucguu uaccuucugu ugggccaguu uccgggacgc 840 uugcaccucc guguauuuug ucagggucug cgccacgaac gcguucaggg cacugagucu 900 cccgguuauc aaucggucga ccugaacguc agcggacagu auguccaagc ggcuauagau 960 gucgucuaug gagcuagaga uggcuuggaa auugugcugc agcugaacgg ugaguugggu 1020 cagcgccgcg cccugugagu ucaccacuuc cuggacuuug gucagggcgu gagcgacggu 1080 guucagcccc uugcuggucu gggaaauggc cucuuucacg cuuucgaaug cggaaguaau 1140 guuuccgaug gcggaauuga aagacucgg cagaagcugc ugguucucu ggagaacauc 1200 cgucugcaga cgaagguaau ugagccgagc cuguacggca uagcuaaagg gaagggcgg 1260 ugcacucgua aacccgccca auaccauccc gccuaucagg cggcgcuau aaugugcag 1320 1380 caaguccgcg acggaccugc cguugggaaca gcguuuugag uccucaucca ccguacccag 1440 cccguuggug acaacuuuuau ugaaggcagc guccucgaug aaggaccucu uuugcacgac 1500 ccugccggaa gcgggaucgu acacgcuaac gccaaggaca uucguaaagu ugaagccguc 1560 gccguuaaag gagcuaaugg uugccaguug gagugccuu ucggagaugg uaagcaugcu 1620 guuaaccuca acagacucaa ggcgggcgga aagcugcagg gcagauucga ucgucuuaca 1680 ggcggcggua uacugugaca ggagcuguuu acagcgggaa uugccguugc acacauaggu 1740 ggcgcaguca acgcuuacgg gaguguugua cagcugcagg uauucggucc gaaugcucau 1800 ggagaaugu gucggaaugg aauguugcc ugucacugua ggugcgaucu ucacugacc 1860 gcuuugagag gggacauac cgaugcugcc acucuugcag accccaaugu uugaauagac 1920 gagaacgggu ucugugcaau uggaaccauc guuagagugg uagaagaacc cgggcaguuc 1980 ccguggugag uugaaggugc uugaugacaa ccuagagauc accccgacaa uaucgucauc 2040 uacauaggcc gccugcucug agaagcuaca aggggucacu gaguaaacgg cgccagaagu 2100 cacguucuug aaggccagga gggcccaga gucggaggug uaauacacac cggccaggaa 2160 acuggaguua gucagaguga ugaucccccuc gccuuugaag ccguagauag ugaacuuugu 2220 gcacacaucc agugucauaa agcugacauc agucacgccu ucgagugguu ucggaguucc 2280 ggugaugagc ucaccuuugg uaaacugaaa guacagggag gugaacuuca cgccgcuacc 2340 aaacucgggg uagccaaaca ggucgauggu acaagcacua gccagcagug acgugcucac 2400 gcagaauuug gaaaagcuca gguagucauu aacgcucugg agcguaaagg gacaauugga 2460 auccuggau uugcugacau agccguaaga auuagucacg uuauagaaca gggaaauggu 2520 aaacugucua gugucgacac agaagcuuga gaagccauua auggugguau cacucgcgau 2580 gagguuagcg ccagaguguc caccgaaaga ggcugacacg gugauguuca cgaagcugug aucguugaaa cugggcagcg ugacgaagcu gaucggcugc ucaugacuga gaaguccu acuggagaua ggguaaaagc cgucauccag aucgaaggcc accugagagc acuucaguug agacacuggg ucgucacagu acaaaauccu cuggauagca 2820. to cuggcuga ccucaaucag ggcauccacg aaauugguag aagcaauggu ccaaaacccu gagacgucgu cgucgguucc augcccugug aaguuaaucg ucacugcauc gagcaguccg aggugcaagu agccaaagcc 3000. auucacguac acgucuccau acuuaguaau gacgauuucc cgaacagucg guggcagcac ggcgaggaac uuguauacgg ugcuguugua gguauccacu uucagaaagc 3060. ggcgaggaac uuguauacgg caccugugua gcucccagag gaaucgcaaa aguggccaga uguggguuug accugugga gcagacaaaa cuaaaguag ugcccagugc ugugugcagc acaaugcugc cuucugccaa gaucacgcuu gugucauuaa uguuaaagcg cagggccuca ggagcgcgu ggacagcugc gccauugcac acuccaucga cover aaaggaaaag aauugcccca guccauagau cuuagguaua gccaggagac aauugaccaa caguggcuga uaacugacca ccuucccaug 3360 caccagcgug cugucguugg acaggaggaa ccaauuguug aagaaaauc cuucugggau 3420 guguccauug ggcucagugg cgaaaacauu ugcagcauac ccuaugcaau uggcgguaca 3480 gggcugguag cugaugccau cuucucucgc ugaugugacg uucagcaugu aauagguugg 3540 cucguacaca uacugcauag caaaccgcc agauguugag cauuugugg cuacgcggcu 3600 ccagucauuc uugaaguaga aguaauagau uuugucagag aacacaguga cccugucauu 3660 aucccacgua auuccgacca cacuaugcuc agacaugugu gcaggaauug ccuuguugaa 3720 caagcaauuc cucccugugg ucacgucguu auucgcagua ggcccgagug ucuugauaga 3780 uggaaacugg cauaugcgca aucgcgcggu agcguuggug uugccauuug uggccuuugug 3840 cagguaaagc uguaagccgc uagggucgaa cggcuccuga cugauuccaa ucucaaaccc 3900 guguccgccg cgaauguggc uaaaagau cccgugcacc ccacuugccg ugggaugcug 3960 uccugcacaa uaccaugugc uauucacgcc uugguucucc ccgauaggga gguauccgcc 4020 cagcaccaca acggcgggug ccuggacauu gaacuugcug aagaagcgcc gaaaguuggu 4080 auuggcggag caccgaguca cauccugugg caggcuaagc guugagagca caggcaggaa 4140 cagccaaaag uaugugagac uuuucau 4167 <210> 6 <211> 4242 <212> RNA <213> Artificial sequence <220> <223> Contains a sequence encoding the PEDV S protein <400> 6 aaguuuuuua uaaugaguuu agaaugauaa uuguugacug augcaggacu ggucuugaau 60 auuuaucacu gcacucucac uuucucaaac accucagcgg gcuggagccg ggguccucua 120 cagcagccgc ugaagcaggc gcagcagcag ccgcagcagc cgcagcagcc gguggagaug 180 cagcagaaca ccagcaggga caccacgaag aucagcacga ugaacacgau cagccacacc 240 caccauggcc acuugaugua ggucuccacu cuguucagcc acuccagguc caccagggug 300 uuguugaugu uguagaucag ggacugcagc uccucggugg uguuucucag ggacucgcuu 360 cucugcucca ggucggcgau cucgccgguc agguucaggu agguggcguu gaacacgucc 420 aggggcaggc uggggccggu ucuguuuggc agggaggcca gguacucguc cagggucuug 480 uucacgucga ugagucugg gaucacgucu ggcagcuggu cucuggucag guucacguag 540 gucaccacgc aggacucgau cugcacgaag ucgcucacgg ugggcuuucu uggcucgaac 600 660 agcaccaggc cgggcucucu cagggucagg gcgaucucgu cguucacgca caggccggcg 720 auggcgauca cgucgaugaa gucgccuggc accagcacgg aggcaggaa cagcaggccc 780 uggggggcgg ccugcaccag ggagaagaug ugcucgccgu cgccgccgca gaagccguau 840 cucuggcucu gggacuucac gcacucguuc accuucugcu gggccagcuu ucuggaggcc 900 ugcaccucgg ugacuuggu caggguucugg gccacgaagg cguucagggc ggacagucug 960 1020 1080p 1080p agggcggcgc ccgggaguu caccaccucc ugcaccuugg ucagggcgug ggccacggug 1140 uucaggcccu uggaggucug gcugauggcc uccuucacgc ucucgaaggc ggaggugaug 1200 uugccgaugg cgcuguugaa gcucucggcc agcagcugcu gguuucucug cagcacgucg 1260 gucugcaggg ccagguaguu cagucuggcc ugcacggcgu agcugaaggg cagggcggcg 1320 gcggagguga agccgcccag caccaugccg ccgaucaggg aggcgcugua caugugcagc 1380 uucucggcgu ccaccacgcc uggcagcacc aucacgccgc uguaauacug ggcgcacacc 1440 aggucggcca cggaucugcc guugcugcau cucuuguagu ccucguccac ggugcccagg 1500 ccguugguca ccaccuuguu gaaggcggcg uccucgauga agcuccucuu cugcaccacu 1560 cugccgcugg cugggucgua cacgcucacg cccagcacgu uggugaaguu guagccgucg 1620 ccguugaagg agcugauggu ggccagcugc agggccuccu cggagauggu cagcaugcug 1680 uucaccucca cggacuccag ccuggcgcuc agcugcaggg cgcucucgau ggucuugcag 1740 gcggcggugu acugggucag cagcugcuug caucuggagu ugccguugca cacguaggug 1800 gcgcagucca cggacacggg gguguuguac agcugcaggu acucgguucu gaugcucaug 1860 gagagoogg ugggaogga gauguugccg 1920s caccuggccg cucugggaug gcacguagcc gauggagccg cucuugcaca cgccgauguu ggaguacacc 1980 agcacuggcu cggugcaguu ggagccgucg ugcuguggu agagaagcc uggcagcucu 2040 cugguggagu ugaagggucccu ggaggacagg cuggagauca cgcccacgau gucgucgucc 2100 acguaggcgg ccugcucgcu gaaggagcag ggggucacgc uguacacggc gccggagguc 2160 acguucuuga agccagcag cuggccgcug ucggaggugu aguacacgcc ggccaggaag 2220 gagcuguugg ucagggugau gaugcccucg cccuugaagc cguagauggu guacuuggug 2280 cacacgucca gggucaugaa gcucacgucg gufcgcccu ccaggggcuu uggggugccg 2340 gugaucagcu cgcccucggu gaacuggaag uacaggcugg ugacuucac gccggagccg 2400 aacucugggu agccgacacg gucgauggug caggcgcugg ccagcaggcu gguggacacg 2460 cagaacuugc ugaaggacag guagucguuc acggacugca gggugaaggg gcaguoggag 2520 uccuggcucu ugcucacgua gccguagcug uuggucacgu uguagacag gcugauggug 2580 aacugccugg uguccacgca gaagcuggag aagccguuga uggugguguc ggaggcgauc agguuggcgc cggaguggcc gccgaaggag gcgcucacgg ugauguucac gaaggagugg 2760. 2760. 2760. 2760. 2760. 2760. 2760. 2760. 2760. 2760 gagcugaugg gguagaagcc gucguccagg ucgaaggcca ccuggcugca cuucagcugg gacacugggu cgucgcagua caggaugcgc uggauggcgg ugcccugcac cucgaucagg gcguccacga aguuggugga ggcgaugguc cagaagccgc ucacgucguc gucggugccg uggccgguga aguugauggu cacggcgucc agcaggccca ggugcaggua gccgaagccg 3060. uucacguaca cgucgccgua cuuggugauc acgaucucuc ucacgguggg uggcagcacg gccaggacu uguacacguu gcuguuguag guguccaccu ucaggaagca guaguauggc accugggugg cgcccagugg gauggugaag guggccaggu gggggucgga gcuguuggag 3180 3240. cacacgaagc ucagguuggu gcccagggcg gugugcagca cgaugcugcc cucggccagg aucacggagg ugucguugau guugaaucuc agggccucug gggcccucug ggcggcggcg 3360. ccguugcaca cgccguccau ggucugguug aagcugaaga acuggcccag gccguagauc uuugggaugg ccagcaggca guucaccagc aguggcuggu uggacaccac cuugccgugc agcagggugg agucggugcu cagcaggac caguuguuga aggagaagcc cucggggaug uggccguugc ugucgguggc gaacacguuc acggcguagc cgcugcaguu ggcggugcag ggcucguagu agaugccguc cucgccggcg cuggcacgu ucagcaugua guagguuggg 3660. snowflake snow snow snow snow snow snow snow snow cagucguucu ucagguagaa gugguagauc uugucggcga acacggucac ucugucguug 3780. ucccagguga ugcccaccac gauguucuug ccguccugca uguaggcugg gauggccuug 3840. uugaacaggc aguuucugcc gguggucacg ucguucacgg uggggcccag ggucuuguug uuggggacu ggcagauucu cagccuggcg auggcguugu gguugccguu gguggccuug ugcagguaca gcugguagcc gcuugggucg aagggcuccu ggcugaugcc gaucucgaag cccuggccgg cgucgaugua gcucaggaag augccgugca cgccggaggc ggucuccagg ccggugccgc aguaccagga gcuggaguuc augcuuggca gguagccgcc cagcaccacc 4080 acggcggggg ccugcacguu gaacuuggag aagaaccguc ugaaguugau uguggacugg 4140 caucuuguga cauccugagg gaggcugagg guggagagca cggggaggaa gagccagaag 4200 uaguugaggg auuucauggu gcugcuggac uaccugaguc cu 4242 <210> 7 <211> 4242 <212> RNA <213> Artificial sequence <220> <223> Contains a sequence encoding the PEDV S protein <400> 7 uuuuuuauaa ugaguuuaga augauaauug uugacugaug caggacuggu cuugaauauu 60 uaucacugca cucucacuuu cucaaacacc ucagcgggcu ggagccgggg uccucuacag 120 cagccgcuga agcaggcgca gcagcagccg cagcagccgc agcagccggu ggagaugcag 180 cagaacacca gcagggacac cacgaagauc agcacgauga acacgaucag ccacacccac 240 cauggccacu ugauguaggu cuccacucug uucagccacu ccagguccac caggguguug 300 uugauguugu agaucaggga cugcagcucc ucgguggugu uucucaggga cucgcuucuc 360 ugcuccaggu cggcgaucuc gccggucagg uucagguagg uggcguugaa cacguccagg 420 ggcaggcugg ggccgguucu guuuggcagg gaggccagga ucucguccag ggucuuguuc 480 540 600 cgucuggagc ucacgaaaua cucgguggcg guggguucu cgagcucgug ggugaacagc 660 accaggccgg gcucuccag ggucagggcg aucucgucgu ucagcacag gccggcgaug 720 gcgaucacgu cgaugaaguc gccuggcacc agcacggugu gcagaacaag caggcccugu 780 ggggcggccu gcaccaggga gaagaugugc ucgccgucgc cgccgcagaa gccguaucuc 840 uggcucuggg acuucacgca cucguucacc uucugcugg ccagcuuucu ggaggccugc 900 accucggugu acuuggucag ggucuggcc acgaaggcgu ucaggcgga cagucugccg 960 1020 1080p gcggcgcccu gggaguucac caccuccugc accuugguca gggcgugggc cacgguguuc 1140 aggcccuugg aggucuggcu gauggccucc uucacgcucu cgaaggcgga ggugauguug 1200 ccgauggcgc uguugaagcu cucggccagc agcugcuggu uucucugcag cacgucgguc 1260 ugcagggcca gguaguucag ucuggccugc acggcguagc ugaagggcag ggcggcggcg 1320 gaggugaagc cgcccagcac caugccgccg aucagggagg cgcuguacau gugcagcuuc 1380 ucggcgucca ccacgccugg cagcaccauc acgccgcugu aauacugggc gcacaccagg 1440 ucggccacgg aucugccguu gcugcaucuc uuguaguccu cguccacggu gcccaggccg 1500 uuggucacca ccuuguugaa ggcggcgucc ucgaugaagc uccucuucug caccacucug 1560 ccgcuggcug ggucguacac gcucacgccc agcacguugg ugaaguugua gccgucgccg 1620 uugaaggagc ugaugguggc cagcugcagg gccuccucgg agauggucag caugcuguuc 1680 accuccacgg acuccagccu ggcgcucagc ugcagggcgc ucucgauggu cuugcaggcg 1740 gcgguguacu gggucagcag cugcuugcau cuggaguugc cguugcacac guagguggcg 1800 caguccacgg acacgggggu guuguacagc ugcagguacu cgguucugau gcucauggag 1860 1920 ugggauggca cguagccgau ggagccgcuc uugcacacgc cgauguugga guacaccagc 1980 acuggcucgg ugcaguugga gccgucguug cugugguaga agaagccugg cagcucucug 2040 2100 2160 uucuugaagg ccagcagcug gccgcugucg gaggugagu acacgccggc caggaaggag 2220 2280 acguccaggg ucaugaagcu cacgucgguc acgcccucca ggggcuuugg ggugccggug 2340 2400 ucuggguagc cgaacagguc gauggugcag gcgcuggcca gcaggcuggu ggacacgcag 2460 aacuugcuga aggacaggua gucguucacg gacugcaggg ugaaggggca guuggagucc 2520 uggcucuugc ucacguagcc guagcuguug gucacguugu agaacaggcu gauggugaac ugccuggugu ccacgcagaa gcuggagaag ccguugaugg uggugucgga ggcgaucagg uuggcgccgg aguggccgcc gaaggaggcg cucacgguga uguucacgaa ggaguggucg uugaaggaug gcagggucac gaagcugauu ggcugcucgu ggcucagcag guuucuggag cugauggggu agaagccguc guccaggucg aaggccaccu ggcugcacuu cagcugggac 2880. acugggucgu cgcaguacag gaugcgcugg auggcggugc ccugcaccuc gaucagggcg 2940. uccacgaagu ugguggaggc gaugguccag aagccgcuca cgucgucguc ggugccgugg ccggugaagu ugauggucac ggcguccagc aggcccagg gcagguagcc gaagccguuc 3060. acguacacgu cgccguacuu ggugaucacg aucucucuca cggugggugg cagcacggcc aggacuugu acacguugcu guuguaggug uccaccuuca ggaagcagua guauggcacc uggguggcgc ccagugggau ggugaaggug gccagguggg ggucggagcu guuggagcac acgaagcuca gguuggugcc cagggcggug ugcagcacga ugcugcccuc ggccaggauc acggaggugu cguugauguu gaucucagg gccucuggg cccucugggc ggcggcgccgcc 3300 uugcacacgc cguccauggu cugguuugaag cugaagaacu ggcccaggcc guagaucuu 3360 gggauggcca gcaggcaguu caccagcagu ggcugguugg acaccaccuu gccgugcagc 3420 aggguggagu cguugcucag caggaaccag uuguugaagg agaagcccuc ggggaugugg 3480 ccguugcugu cgguggcgaa cacguucacg gcguagccgc ugcaguuggc ggugcagggc 3540 ucguaguaga ugccguccuc gccggcgcug gucacguuca gcauguagua gguuggggug 3600 3660 ucguucuuca gguagaagug guagaucuug ucggcgaaca cggucacucu gucguugucc 3720 caggugaugc ccaccacgau guucuugccg uccugcaugu aggcugggau ggccuuguug 3780 aacaggcagu uucugccggu ggucacgucg uucacggugg ggcccagggu cuuguuguug 3840 gggaacuggc agauucucag ccuggcgaug gcguuguggu ugccguuggu ggccuugugc 3900 agguacagcu gguagccgcu ugggucgaag ggcuccuggc ugaugccgau cucgaagccc 3960 uggccggcgu cgauguagcu caggaagaug ccgugcacgc cggaggcggu cuccaggccg 4020 gugccgcagu accaggagcu ggaguucaug cuuggcaggu agccgcccag caccaccacg 4080 gcgggggccu gcacguugaa cuuggagaag aaccgucuga aguugauugu ggacuggcau 4140 cuugugacau ccugagggag gcugagggug gagagcacgg ggaggaagag ccagaaguag 4200 uugagggauu ucauggugcu gcuggacuac cugaguccua ag 4242 <210> 8 <211> 4245 <212> RNA <213> Artificial sequence <220> <223> Sequence containing the coding sequence of PEDV S protein <400> 8 aaguuuuuua uaaugaguuu agaaugauaa uuguugacug augcaggacu ggucuugaau 60 auuuaucacu gcacucucac uuucucaaac accucagcgg gcuggagccg ggguccucua 120 cagcagccgc ugaagcaggc gcagcagcag ccgcagcagc cgcagcagcc gguggagaug 180 cagcagaaca ccagcaggga caccacgaag aucagcacga ugaacacgau cagccacacc 240 caccauggcc acuugaugua ggucuccacu cuguucagcc acuccagguc caccagggug 300 uuguuguugu ugaagaucag ggacugcagc uccucggugg uguuuucucag ggacucgcuu 360 cucugcucca ggucggcgau cucgccgguc aggucaggu aggggcgu gaacggucc 420 aggggcaggc uggggccggu ucuguuuggc agggaggcca gguacucguc cagggucuug 480 uucacgucga ugagucugg gaucacgucu ggcagcuggu cucuggucag guucacguag 540 gucaccacgc aggacucgau cugcacgaag ucgcucacgg ugggcuuucu uggcucgaac 600 660 agcaccaggc cgggcucucu cagggucagg gcgaucucgu cguucacgca caggccggcg 720 auggcgauca cgucgaugaa gucgccuggc accagcacgg aggcaggaa cagcaggccc 780 uggggggcgg ccugcaccag ggagaagaug ugcucgccgu cgccgccgca gaagccguau 840 cucuggcucu gggacuucac gcacucguuc accuucugcu gggccagcuu ucuggaggcc 900 ugcaccucgg ugacuuggu caggguucugg gccacgaagg cguucagggc ggacagucug 960 1020 ucgucgaugg agcuggagau ggccuggaag uugugcugca gcugcacggu cagcuggguc 1080 agggcggcgc ccugggaguu caccaccucc ugcaccuugg ucagggcgug ggccacggug 1140 uucaggcccu uggaggucug gcugauggcc uccuucacgc ucucgaaggc ggaggugaug 1200 uugccgaugg cgcuguugaa gcucucggcc agcagcugcu gguuucucug cagcacgucg 1260 gucugcaggg ccagguaguu cagucuggcc ugcacggcgu agcugaaggg cagggcggcg 1320 gcggagguga agccgcccag caccaugccg ccgaucaggg aggcgcugua caugugcagc 1380 uucucggcgu ccaccacgcc uggcagcacc aucacgccgc uguaauacug ggcgcacacc 1440 aggucggcca cggaucugcc guugcugcau cucuuguagu ccucguccac ggugcccagg 1500 ccguugguca ccaccuuguu gaaggcggcg uccucgauga agcuccucuu cugcaccacu 1560 cugccgcugg cugggucgua cacgcucacg cccagcacgu uggugaaguu guagccgucg 1620 ccguugaagg agcugauggu ggccagcugc agggccuccu cggagauggu cagcaugcug 1680 uucaccucca cggacuccag ccuggcgcuc agcugcaggg cgcucucgau ggucuugcag 1740 gcggcggugu gcggcug gcgggcug gcgggcug gcgggcug 1800 gccgcagucca cggacacgggg gguguuguac agcugcaggu accucguucu gaugcucaug 1860 gagagoogg ugggaogga gauguugccg 1920s caccuggccg cucugggaug gcacguagcc gauggagccg cucuugcaca cgccgauguu ggaguacacc 1980 agcacuggcu cggugcaguu ggagccgucg ugcuguggu agagaagcc uggcagcucu 2040 cugguggagu ugaagggucccu ggaggacagg cuggagauca cgcccacgau gucgucgucc 2100 acguaggcgg ccugcucgcu gaaggagcag ggggucacgc uguacacggc gccggagguc 2160 acguucuuga agccagcag cuggccgcug ucggaggugu aguacacgcc ggccaggaag 2220 gagcuguugg ucagggugau gaugcccucg cccuugaagc cguagauggu guacuuggug 2280 cacacgucca gggucaugaa gcucacgucg gufcgcccu ccaggggcuu uggggugccg 2340 gugaucagcu cgcccucggu gaacuggaag uacaggcugg ugacuucac gccggagccg 2400 aacucugggu agccgacacg gucgauggug caggcgcugg ccagcaggcu gguggacacg 2460 2520. cagaacuugc ugaaggacag guagucguuc acggacugca gggugaaggg gcaguuggag 2580. uccuggcucu ugcucacgua gccguagcug uuggucacgu uguagaacag gcugauggug aacugccugg uguccacgca gaagcuggag aagccguuga uggugguguc ggaggcgauc agguuggcgc cggaguggcc gccgaaggag gcgcucacgg ugauguucac gaaggagugg 2760. 2760. 2760. 2760. 2760. 2760. 2760. 2760. 2760. 2760 gagcugaugg gguagaagcc gucguccagg ucgaaggcca ccuggcugca cuucagcugg gacacugggu cgucgcagua caggaugcgc uggauggcgg ugcccugcac cucgaucagg gcguccacga aguuggugga ggcgaugguc cagaagccgc ucacgucguc gucggugccg uggccgguga aguugauggu cacggcgucc agcaggccca ggugcaggua gccgaagccg 3060. uucacguaca cgucgccgua cuuggugauc acgaucucuc ucacgguggg uggcagcacg gccaggacu uguacacguu gcuguuguag guguccaccu ucaggaagca guaguauggc accugggugg cgcccagugg gauggugaag guggccaggu gggggucgga gcuguuggag 3180 3240. cacacgaagc ucagguuggu gcccagggcg gugugcagca cgaugcugcc cucggccagg aucacggagg ugucguugau guugaaucuc agggccucug gggcccucug ggcggcggcg 3360. ccguugcaca cgccguccau ggucugguug aagcugaaga acuggcccag gccguagauc uuugggaugg ccagcaggca guucaccagc aguggcuggu uggacaccac cuugccgugc agcagggugg agucggugcu cagcaggac caguuguuga aggagaagcc cucggggaug uggccguugc ugucgguggc gaacacguuc acggcguagc cgcugcaguu ggcggugcag ggcucguagu agaugccguc cucgccggcg cuggcacgu ucagcaugua guagguuggg 3660. snowflake snow snow snow snow snow snow snow snow cagucguucu ucagguagaa gugguagauc uugucggcga acacggucac ucugucguug 3780. ucccagguga ugcccaccac gauguucuug ccguccugca uguaggcugg gauggccuug 3840. uugaacaggc aguuucugcc gguggucacg ucguucacgg uggggcccag ggucuuguug uuggggacu ggcagauucu cagccuggcg auggcguugu gguugccguu gguggccuug ugcagguaca gcugguagcc gcuugggucg aagggcuccu ggcugaugcc gaucucgaag 3960 cccuggccgg cgucgaugua gcucaggaag augccgugca cgccggaggc ggucuccagg 4020 ccggugccgc aguaccagga gcuggaguuc augcuuggca gguagccgcc cagcaccacc 4080 acggcggggg ccugcacguu gaacuuggag aagaaccguc ugaaguugau uguggacugg 4140 caucuuguga cauccugagg gaggcugagg guggagagca cggggaggaa gagccagaag 4200 uaguugaggg auuucauggu gcugcuggac uaccugaguc cuaag 4245 <210> 9 <211> 12291 <212> RNA <213> Canine distemper virus <400> 9 accagacaaa gcuggguaug auaacuuauu aauaaccguu guuuuuuuuc guauaaccaa 60 guuugauagc aaugaauagu agggggcuag gagccagacu aaccuguuag ugauuucuaa 120 ucagugcacu auaaccuaac aauuugaacc acuccuuuau cucuuuuguc ucaagcugaa 180 agagccaauu cuuuuugggg auugucguua ggaugagaga ccugucagau ccggacagau 240 uauccauaaa uaaguuacga ugcaagucga aaauuaugug guuggcuuuc agguuucgga 300 caauccuggu aauuucguau aagucucccg aguaaagcaa aauuagcca caguacuucu 360 uugcaaugau agauacgagc ucccuuuccu gacuugcgau uaacacaggg uaugcaugga 420 acauuccaug ugaagauugg ugguuauccu ugaaccuugc gaguucccgg uaaaggaucg 480 ugauagaucc uuucagcccu uccucgccug acgaauac auggugaagc agguucuuac 540 600 aaccuggag gugaggauug aagauucag caugaaaugg agguccgugc aaagacugca 660 cacaugcugc cugcuuugau gaaggaugu gcccuaccaa cccagguga guucgaauac 720 cgacucgcaa aaucuguugu uuaaucccu ccggauugac uagucucccu gcucuaagac 780 caguaaaaaac aagguaggcc ucuguugaca caaaauugcu guaucuuggg uaaacuauga 840 aacuucgaag aaaauguggg agugcauaua aaauaaaucc uugaacccag ucgccacuag 900 cuggcaugau cuuaauuacu aacacugacc cuaccuuccc uauauacaaa gucauugaua 960 auuaagcaga caauuccucc acuuuucga uuaugucuuu guccgguagu gaccuauau 1020 ccgagugaau caacccaaga cugcuagcag agaucuggcu caguauguac uuguaacaau 1140. 1140. 1140. gccaauuuau cgaguccuaa uugauguucc accagacuga ccucagaagg guaaggugaa aucucucguu 1260. snowflake snowflake snowflake gcucuuuaua uacugucaac auugcaccug aaccuucucc uaggaauaau ccguguucuu 1380. the sword of the sword of the sword of the sword of the sword of the sword of the sword of the sword of the sword of the sword of the sword of the sword of the sword aagugauccc aauucuucug aaugagugaa ccucauaguu ccggacuccu aauccuguaa 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500 1560. 1560. 1560. 1560. 1560. 1560. 1560. 1560. 1560. 1560 gccuuucuaa gcauccaaca gcaucaguga ugaauccggg auccacucuc agucuuaucu gcuugauga gccucuucua agauauguca gggaacauga auauugaucu auuaagauag 1740. snow snow snow snow snow snow snow snow snow auaacacagc acauuucugu snow acccacgaau snow ucacgagggu 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920 1980. 1980. 1980. 1980. 1980. 1980. 1980. 1980 gguuuuggga gucaagagag gguccaugaa uagguucaau caucccacug ucccaaaacc 2100. snowflake uuuaggaugg snowflake snowflake snowflake uucuacucag gaaagagaac aacaacucac ccauuuggua cuuuccagaa ggucggugau aaugaauuuc aaagccccag uugauugcag cacauuggcc uagauauaca guaaauaauc 2280. uaggcucaac uagaagaac ucagugauaa aacuauugau aucaucaucg ccaauuaacg cagagacuuc auuuaggugg clothes acuuuguaau caucucaacc auagacauag 2400. snow-white snow-white snow-white snow-white snow-white snow-white snow 2460. snowflake snowflake snowflake snowflake snowflake ugucauaaau caaaggauuu guacagauau uucuugguau gacgacauuu cugagcccug ggacucuugg auggucgcuc auggguauua cgcaacaauc uguuucaaca uguaaaugua auacgguauu agagucgccg gugguugaag acaaucuaaa uagugcuca aggaucccca ggcccaggag caucus ugauaaauaa aauuuguguc cacuucuug ucaucuauaa uaaaagaaag auuaucauuc gagauaguug cauaacgugc cacucugaug agagaggucc snowflake snowflake snowflake uuagucggug agcuagauua snowflake 2880. aaauuggggu aaucauccgu aauuccucaa gugagauguu cgcucucugu uuugccaagg uccaagccuc uugccaagau uccaucau caccauaggc ccaugaguac acaguugcua 3000. uucucacugc ugauuucaga gaccuacuag gagauugac gaaugcuagu uucaugucug uucuuucuuc uguuguggac ccuauguaug gcacccucag ugcagauguu cccucuguaa 3120. uacuauccaa uuggcaauuc gcugguacaa aaaaccaacc auaguuauga gagccugaug 3180. cacaaagcaa acaggauuca ugucuucuga ucauauaacc cuucauugau ucaaggauau ccgggacuuc uagaccauaa auaggacgacgaccuucgccag cuuggcccac augugguucc 3240 uuaaugcucu cgcuagcugg acggaacaug agucuugauc gaugagcgga ucaugcccccu 3300 ucccugacaa cagucugaua ccugcccuaa auuguucaua aucauaaguu gacaaacggg 3360 uuauuauucu agggguuaga ccuccucuuu ucaugcuugc ucguaucaac cccuuugugg 3420 3480 gugcagcccu ugggauaaua auuuuccuau ccauuaagaa agcugcuaaa gcuucauccu 3540 cauccugacu uucaucaugg aacaauccuc ucagcaucgg auuuggacug uugauaagga 3600 caugccuggc ugugauauuu uuaaggaguc ggguuaugcu cuggacacag ggcagauugg 3660 cagaauaagg gucacuugcc caaucuaaau aagaagaguc accuggguau ugggucauga 3720 ccugauguag aaucuccacu ccaagaaggc cugaucggau cauucguuug aggucagcaa 3780 uagaaugu cacgggaucc ccgauauucc ugacaaagag ccuacucaua uugagguaau 3840 uaagaccgcc aaugggugcg gggagaauug ccaucuuggu caagacag ugaucuugua 3900 cgaggggguuc uaucacaucc cgugucauag cugaauugau agugaauccu aaugaaauua 3960 auacuuguug aaugauuuuu aaaauguuca gugcguaggc uaauauacgg ucaaacccuu 4020 ucucaauggc uuucgcuaau guuguugaaa uguugcugca cgcggcucgg gucucaucca 4080 cuauuguuuc ugaccaaaaau acacaccuag cuauacucuu cagggauugu gagauuaaca 4140 ucccgucaua auagauccu uuugaguaua caaaaaagug ggagagauu auuguuucau 4200 uugcuuucaa augauguccg acaucaugua accucugucu caaggcuaua aaguauucug 4260 cggucacucg acuggcuuca gauuucuuca aggcauagga ccaggugcuu gguacucuuu 4320 uagugacagc aauaguuugg uuaucaccuu ggacaaguga ugcaauucug acaccgcucu 4380 4440 ccuccacccc ccccauuggg uauuugauga auauuugaga guuaggggcu guauucaagu 4500 4560 ccaaucuucu guguaaccau uggaaaaaug aggggagacc guagauuuca uuuaaucucu 4620 4680. gagcaaaaau acugaugguc ucauaacgcc aauucagaca guacuuuuug agauccguag uuauaaaugc snow snow snow snow snow snow snow snow aaaaauuuugg guuugggucu auauaucuac uacuugggga agagacggag ugaagugcuc cucgauaagg ugcagguuuc agggauuuac covering gaggccacga covering cover cggaaccccg gacacagcca gagugugca cover agaucguguu cauccuuugc caucccauug cauccuuug acuuccaau uccauuagau aucaagucu cugcuaugac cugacaggcu cgcauuuugu aggucauuuu agcgaauagc cucccuaccu 5100. 5100. 5100. 5100. 5100. 5100. 5100. 5100. 5100 5160. snow-white snow-white snow-white snow-white snow-white snow-white snow-white snow cauuaacaag ucuccgagac ucaguggagc gagguggau guaccugagg aauucuuuug 5280. snowflake 5280. snowflake 5280. snowflake 5340. 5340. 5340. 5340. 5340. 5340. 5340. 5340. 5340 5400. uauacauuga cuauagguga uucccucccc ugaggcauga gcauuucuga ugaugggaga ugcaugaaca ggaagaucca ucggaggcca aguuccccca ugucuauccc gauaaccguu aaugauuauc ccacagaaua uagcaugucc cuucaucaua cucucauaag agacaacuuu ggguugauuc auguguuucc guacguuuuc ugcugcuguu auugcuucua accuugggug accgaacuu cuaagaagg aaaagauuuc clothes uguauauccu 5700. 5700. 5700. 5700. 5700. 5700. 5700. 5700 agccauuguc cuguaaaauc clothes cagcaaagca gugacucaga aaagcacccc 5820. snow snow snow snow snow snow snow snow ccaccaauug auagguugaa uuuccccagau ccggggaaaaa uccgucaau agaucccaga gauaccugau ccugacaugc aaaguugagu aacguugauc aauugccaua gcaguaucag 6000. 6,000 sq. ft. 6000 sq. ft. 6000 sq. ft 6060. aaacauugug acuggugaga ucauaauac auacaagguc ccuagacacu agcacauuaa augauucacc uuuuacaaag acaggauucu gccuccgcuu gcgacaguug ugaguagagg 6120 auuuaaucac ugaucucauu ucuguuuuaa uuguaaacca uagaaggaaa gguucgaacc 6180 acugugagcu uugcauaauu augccugcuu caucaauuuu ggucccaaua gucuugucca 6240 gugcgccccc uaaaccaaua uuaagauuaa uaucguuuaa gcauuuuuug accccgucug 6300 uuauuuugcu auagaugcua uuuccucuuu ugaauauauu ucucagccuc agagagguga 6360 cucgauccug ugcaugaaau agaaguuugu ugcaauuugg guauaucaca ugguuguguu 6420 ugggauaaga uaacaagguc ugauuaauaa ugcucccgau uucgaugcag uuaaugauca 6480 ucugguuuga gaacccuucu gaaauucucu cuuugauauu acgcacuaau guuguaucaa 6540 ggaguugaua gcuaugucua auucgugcgu auucuaaaau agcuacuagc uuauugguua 6600 caauugggcu aucuagaugg accucagggu auagaaucug guucacugac acagagucca 6660 uggcuaaaag gauccuggau ccuuaguuuu uuuauaaugc uggagauggu uuaauucaau 6720 caucuguaag ggauuuuuca ccauacucau caugccuaag uccaauugag auguguauca 6780 uuauacuguc agggauuuga acgguuacau gagaaucuua uacggacuaa auucucaaca 6900. covered covered covered uaucuguaaa auuggugaca ccacaaauua ucaucccaca caaaacauuc aauccuuagg aaaucagguc uacccuuggu aguuagucua aaugagugcg uauaagaaau cguccggauu gggucauaaa cauaauaaac aaucgcauga 7080. aauuucgug auauaucaua cguugcuaug acauaucuaa aacucugugu aggcaacacc 7140. acuacauugg acucgaugag acuaucucua ucuauaauuu gagauguuug aauagguaaa 7200. uaacaauuuc cacaugauuc ccugggcgca aauguuaaua cuugggguau cacagugaac covercuccuc uacuuccuuu guuuaucaau ccaaggauug uuccguuuu aggaggaaug 7320. guaagccauc cggaguucaa aagugggcuu ucauaauaau ccauaccauc uccauucagu auaaccggac cguaugugaa cgauauguua aguugaaggu caacacuugc aucuagaggu aaugucaacc gcccauaaga uggcaacugu ccuccuccga aggguuccca ugacguuugg uugcacaugg gguagguuuu ucuuugacaa gcugacucca gccaaccuuu uuguucuucu uuuucucag aggccagggc aggcaccauc cagguugcaa uugaaucuuu uaaaaaacca 7560 cggugguuug uuuauuguau uuuccuccauu gaugggugag cgacagguau cacuuccuca 7620 auugaucca uagguguugc cccaaauac cccaguguca cuacuagaau accaucuugu 7680 gaaccccugc ugucauggua uaauauaca gugcucucuu cuacacacaa ggaagccagu 7740 gucaacucac ccacugcuau gguacauacc uuggcuuugg aauucuccgg gaggaccaua 7800 uaguugguug uuuggaguaa uggcauguca uucagccacc uuuuaaugaa cccuauuuca 7860 aagacucgaa ucucuugagu gucgaacucc cguucuauau caucaggcac uagcaaguaa 7920 guuuugccau acacgccguc ugagguagcg gucagcauau ugauuaucuc ugagguucuu 7980 gagaucaaag acauggauaa cgagacugau agggggaaaa cuuugccuac ugaaguagua 8040 gcuccacugc aucuguaugg ugggauaug ucacuccugc ccccagagag ggcugauaaa 8100 aggaugggau uugcugccga ugcaauagau uuucugaucc caauugucuc acaguaauuu 8160 guaaaauuca ccuugaccuu acuaggcggg uuaaugcacc aguggagauc gcggaaaucg 8220 aauucucugu ucggauugaa gaaauuuguc uuuugaagga uaaauuguuu gaucucguuu 8280 agcuuuugug gcaaccguaa cccaaucuca uccccaauaa ucuugaagag cggugucaag 8340 acaucuauga cuugaugaug uacggccucu gauuucucca uauccucuuu cagcaaucug 8400 cuaaauucca uauugcuagu ugauacuugg ugaaaucgaa cuccagugau agcaagcagg 8460 gccaggauuc caaccaauag gaugagaagg acaaacaaca aauaaggugg ucuccugccc 8520 ccaugcucuu cugucacugg ggacagcuug gaugaauugg cucuugcauu guccuuguag 8580 aaggcaccca ccuugucuug guaggagagc auugcuggac uaccugagcc cuaaguuuuc 8640 uuuaauuacg auaaucaugg ucagucuuuu ccaauguuua uugcaguuga gugacucuug 8700 aagaaaauug ggcgggguua auagauauca aaucuggcaa ucaagcgaga uauaugacca 8760 gaauacuuca gagugaucuc acauaggauu ucgaaguucc gguuagauca gguuuaaaug 8820 ccggaucgac cuuaguauuc cgcuugagug ucuguuggua gcgucuuuua caacaguaaa 8880 ucagcaacag caaagccagg gcuguaccac uuaauauagg aacgcugagg agacugccaa 8940 aauuaaagga agagcgccua acugucuça agagucugguu aggaggcu aucaguaccu 9000 uagcaucauc caguuucuua agggcguucc cuaauuugu acquacaucu aaccucucaa 9060 gugauauagc agggccuaag gcaacuuugc uuucauauac cauaucaggg uauugccugc 9120 cuccacuug gauaguaca cuccauuu caccagugg gcagguaucg gaggcauga 9180 augucagcaa cuaucagga cucugauaa uaauugugcu ugugcuauaa cacuacaua 9240 guauagacgc acaauuugcg acgauguuac cuuugacag aaaaauuug uugcccauag 9300 uccagauac caagguccgg gcacagaug aagugucgcc cuaaacau uguuguagaga 9360 guggggcucau gggguacagg gaguucuggc uacaaauggc ugacucugag acgaauacac 9420 agggaugacuc aucaaauua gauauuaagu aaccaauagu ugcauauac cucgggacag 9480 ugguguacca cucuugugau cucuugugu aagaaacugc uccugucug uggacuauaa 9540 cccccuugac ucugauaaa guggguaug agauacuuag gaugaugaau uucccgggaa 9600 uaucaacaug aguuauuuuu guuuuuaucc cccgacucuc caagauugca aucauaucac 9660 9720 gugcuugaau ugaauacucg gcugaaauag ggucacguaa acucgggcca aauaugaca 9780 9840 acauauguug cauagcaggg acgaguucgu uguuaacgua auccuggacu cccugaacgg 9900 caaugacggu uucuugggua gccucccuaa uuucuucaau agcuuuguua gacuguucaa 9960 ggcugguucu aagagauugg augcuugag cauugagguu ggauugaugu aaagcuauuc 10020 cugcagugau uugugcagcu guagccacuc cuaaagcugc accugcaagu accacuccug 10080 caaaacgccu uugucuccua gcugacccua augacugcaa gggcuucaca uucuugguca 10140 uuagagucag agcuugguug augguucga ggacugaauu caauauuuc ucauacucac 10200 cuaauucugc uuuggguacaa uuaucuauaa gugaaacauu aggcaucagu uuuaugacca 10260 aguacuggug acugggccua gccaugaucu uauaauggac acuaucaguc ccaauaaucc 10320 caauaguuga caaauuauuc caauguaucu gagccuugga acaaagaaag agacuggcua 10380 uuccgaggca ccacaggacu aaccaggagc acugagagcc ugaguugauu gcauuggguu 10440 gccgccuuuc gaucugggau cucgcuccuu uggagacacu cucuggcaug ugcuggauaa 10500 uagccucgug guuuccguga acugagaugu ucuccaaucu guagcugguu ugcuugcgag 10560 accugguccu guucauggug uaggagacgg gucuguccaa uguucgaga ucauaguucg 10620 uggaucgcug agcgugguu augcugugg gugcuggga gguccuggug uggggguc 10680 cggugcugg uugugggggg cgguuuuugu ggguaugugu guggguuuug gagcuuuugg 10740 ggauuuccuu gugcauggg cuuggcuguu uguggggguu ccugccuggc cucgggcugg 10800 uggacuuggu uggccuguug gcuugcuacg uccuggaccc uaaguuuuga uuaauuauua 10860 10920 cuugagauca ggcaagugcg ugggaguaua acuguuaaag ugagauuccu agaagcgaag 10980 cucaaaaccc caggcaucca uucauuucuu gguccgauaa ugaucaaccc aaucuuaagc 11040 aagaacuguu uugauucagc uauuuucaua uugaggcguc acuggaauug ugggcacgga 11100 rocking agaaaccuau agggccacgcu caaaugcag gagggaacuc rocking 11160 auauuuauac ccucauccu cgcuugcggg gaucaaggga ucuugggca ugcuacuaag 11220 gcguuugagu uuuaguucau gaacuauga uuuagauaa uugaaaga cccugaucau 11280 cgcugacgau aacaucaua uaaacucuga aacuugugg gacugauggu ugcaagacug 11340 cuggauccu uacuauuuug cucuauc uacuuagaga ucgauucaa ucuucauuga 11400 ucuccaugag cggguaacac aggauuuucu ugaaccuag cuggcauuc aaggccuugc 11460 ucaucuuacc aguacaucgu augugaagac uuguuccucc uuacccuccu agagcaaca 11520 cuauucccau cuuucaauu ucaguuuac aauaaucagc agaguagcu ugguuuucu 11580 uacgccugaa auugccgaua cggaccauga auguacuug gugaucuuug aacaugcuca 11640 auuuaccuccg gcuugaacag acaucucccu caacugaau ggugacuaaa auguaaaaug 11700 cuaaagcauu ccuggagcgg auuucaaca ucccgggggg auucuguaa cuccaucgu 11760 cugauagucg agugaugcuc auauauacca cccugaaucu uugugcuaug ucuaauggua 11820 uuagauugac ugcguacag acuugauuug cacugacac acuuccacuc guaaggaccu 11880 uuuuccacgg aguaagaug ugcaugggg uguuauaua aaaaaccagu uguuccuuga 11940 caccugcagu ucgccuugcc achaauaucca acaggguggc uucuuuchaau aacuccucag 12000 gucuggcugu aguacgccca acuccaag gcagcaaucc aauguucuu ccaauugggg 12060 guccgaggcc aucauugucu ucuauuauac ccaguagaa auauauacaug aagcaucau 12120 cuuccuauc gccgaguccu ggaucuauua cucugacuug ggguaugagc cuaccaucgg 12180 gauaaguggu aggcaaaua ggggccaaua agcccuuggu guccaagaa gacugaucga 12240 agucguacac cucagucauu uuuuaggaga ggacuuaggc ucuugugucc u 12291 <210> 10 <211> 3396 <212> RNA <213> sweet potatoes <400> 10 uuuuuuuaa ougcuuuuaaa gcgauagoga aggcagouuu gcgccgguua guagauagua 60 120. 120. 120. 120. 120. 120. 120. 120. 120. 120. 120 180. 180. 180. 180. 180. 180. 180. 180 ucugcuugau cugaucaaug augcaaguac agcuuuaga ggugcgguau ccuuugguuu 300. guauccgauu gccgagcuag acucuuuguc aauggguuuc agcuggaggu cucucaauag 360. uugaccuuuu gagcccagag uaauaccacu uuaccgcggg augaugcggg 420. cugcuugaga acuuccgcua gugcucuucc ugaaucccuc ccuaugauag ggcggagcuc uggauuaaug ucgacauuug ccguaggguc uccgugucc uuuccaaaac cagguauagc 540. uaucauaaug cuugauagau gccccucaau cguggaaauc gcauauuuu guuugcugau 600. 600. 600. 600. 600. 600. 600. 600. 600. 600 660. snow snow snow snow snow snow snow 720. gaaaagcuca ucaucguacu cacugucaga uuugaggucc uggagggag uugcguacca gacucgaguu ugcauuucug ggucaucuuu gcauucauug cagguuggcg 840. gacauucccc gcagacacac uuggcucuga ugauccccca guugacuuga gugcagauug 900. snowflake snowflake snowflake snow snow snow snow snow snow snow snow snow 960. uuaauggauc cacacuccgg aacccuuguc uuaccuucgg gauuaugugg 1020. 1020. 1020. 1020. 1020. 1020. 1020. 1020. 1020 agcacuuaau uccucuucca ucagcaugcu cacaucagcu gcccugucug guuuaaggcc gaaagaauau ccccaguuag augaagcauu clothes uaaucuucgc cagaauccuc 1200. 1200. 1200. 1200. 1200. 1200. 1200. 1200 agguaccacg agacugucag caucuucgau ucccuuaacc ucuucaccgc ugugaucaua aacaugauaa caucguauuc cagguccugg uuggaugucc ucuuuaggga gcugcucugc uuccacaagc gcagaguugc uuucuccaca ucccggauua uuuuggagua cauggccgac auaguuugau ccuuuuug gcucguguga uucaucgaga uucugagagu ccuccucuuc 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500 gaccuuga aucuccuaca ugucaggagg aucucucug agggcuuuga ggcauuuccag 1560 cccuuugcug acauggguagg ccuguuccuc ugccauuuag ggauagaacg gguggucgga 1620 ugaaugguug aucggguuug uuggacccgg guccuaaguu uuuuauaaug aguuuagaau 1680 gauaauuguu gacugaugca ggacuggucu ugaauauuuua auugaguagc ucucuaucau 1740 uauaacagg agacuaucu ucacuggucc cagguugacu gagcaucuua guaagcaucc 1800 ucaucuuggc gauugcuucc aucgauuucc ggucaucauc auuuccauca ucuuggguaa 1860 uuugggugc guggcguggc ucacuccguu cagagcuguu gaccucuggg gugugccug 1920 gaggccuuuc aucacugaag ugaauggggu aucugucucc ucccugguu ucggaccucu 1980 uguugauggu cggggguugu ugauuagcga cuucggaucu uuccgagugc aggaagguaa 2040 uuugggaug cuugggacca guagcucgaa ucguccgguc cucuguuguc uuggaugcua 2100 uuucugacac cagcugagcu uccuccuugg ugaugccaag cucggcagca agugcagagc 2160 uuacuuugcc ggcagaucgu cuaccauuu cuugcccgag ucugaaguag gcugggucaa 2220 aguaagaucg accgaaauuu aauccuccca uggaguuuuc aaguucaaca ccaaccccca 2280 uagcauaacu ccagagcaau ggguaggacc cugcacuaaaa uuuguuuuga acagaguuuu 2340 2400 caauaguugu uaauucuccg gaaaacucau gcaacccaag agccggauac auaguuuucaa 2460 2520 uaucacaaau cauuucagca auucuaggcu uguucccugg ggaucuuuug auguccaaaa 2580 ugagugccac caugaaucgc cucaaagaua gguccucagc aauccuguuu cuacaaaua 2640 caagccagau uuuguucauu cuaaauucuc cgaccacacg ucuuugcugg guauacuuaa 2700 2760 ggauccaaau uugagccaaa auggaagcua guauauauu gaauugcuca gcaucaucaa 2820 uuuucucca uauauucca accagccuaa uugcccuuga gcuuucgacc 2880 cuucgucuac aauuuugaag aacucaucug ccucagaauc cagacuugcu ccucuggaug 2940 caaauguaag accgcaaaca gaguugaugc uugguauuac cucuacuaac uugaugcuua 3000 caucaggguc gucuaugauc cucuggauca acuguccagg ggauuccacg aacaaggaga 3060 ggauacugau uaagauccca guuaauuuag ggccguugau uucuggauca ccaaccaacc 3120 uaacaagucu auccaauagu cgagaucuug uaacaaugcu ugaaucaccc gggauuagga 3180 cuauaaugac augcuuuauu ccucuuauug cucccccgga gccagaggca agaggggguu 3240 ggucccgagu ccucuugaac agugugaggc uuuuaagaag gcuagccaua uugguagguc 3300 ugaacccuga ccuuguucuc uaagguagga ucauugaccc uaaguuuuua auaaaauauu 3360 caauaauuua acuauccaua gccaacuuug ucuggu 3396 <210> 11 <211> 4152 <212> DNA <213> Porcine epidemic diarrhea virus <400> 11 atgaaatccc tcaactactt ctggctcttc ctccccgtgc tctccaccct cagcctccct 60 caggatgtca caagatgcca gtccacaatc aacttcagac ggttcttctc caagttcaac 120 gtgcaggccc ccgccgtggt ggtgctgggc ggctacctgc caagcatgaa ctccagctcc 180 tggtactgcg gcaccggcct ggagaccgcc tccggcgtgc acggcatctt cctgagctac 240 atcgacgccg gccagggctt cgagatcggc atcagccagg agcccttcga cccaagcggc 300 taccagctgt acctgcacaa ggccaccaac ggcaaccaca acgccatcgc caggctgaga 360 atctgccagt tccccaacaa caagaccctg ggccccaccg tgaacgacgt gaccaccggc 420 agaaactgcc tgttcaacaa ggccatccca gcctacatgc aggacggcaa gaacatcgtg 480 gtgggcatca cctgggacaa cgacagagtg accgtgttcg ccgacaagat ctaccacttc 540 tacctgaaga acgactggtc cagagtggcc accaggtgct acaacaagcg gagctgcgcc 600 atgcagtacg tgtacacccc aacctactac atgctgaacg tgaccagcgc cggcgaggac 660 ggcatctact acgagccctg caccgccaac tgcagcggct acgccgtgaa cgtgttcgcc 720 accgacagca acggccacat ccccgagggc ttctccttca acaactggtt cctgctgagc 780 aacgactcca ccctgctgca cggcaaggtg gtgtccaacc agccactgct ggtgaactgc 840 ctgctggcca tcccaaagat ctacggcctg ggccagttct tcagcttcaa ccagaccatg 900 gacggcgtgt gcaacggcgc cgccgcccag agggccccag aggccctgag attcaacatc 960 aacgacacct ccgtgatcct ggccgagggc agcatcgtgc tgcacaccgc cctgggcacc 1020 aacctgagct tcgtgtgctc caacagctcc gacccccacc tggccacctt caccatccca 1080 ctgggcgcca cccaggtgcc atactactgc ttcctgaagg tggacaccta caacagcaac 1140 gtgtacaagt tcctggccgt gctgccaccc accgtgagag agatcgtgat caccaagtac 1200 ggcgacgtgt acgtgaacgg cttcggctac ctgcacctgg gcctgctgga cgccgtgacc 1260 atcaacttca ccggccacgg caccgacgac gacgtgagcg gcttctggac catcgcctcc 1320 accaacttcg tggacgccct gatcgaggtg cagggcaccg ccatccagcg catcctgtac 1380 tgcgacgacc cagtgtccca gctgaagtgc agccaggtgg ccttcgacct ggacgacggc 1440 ttctacccca tcagctccag aaacctgctg agccacgagc agccaatcag cttcgtgacc 1500 ctgccatcct tcaacgacca ctccttcgtg aacatcaccg tgagcgcctc cttcggcggc 1560 cactccggcg ccaacctgat cgcctccgac accaccatca acggcttctc cagcttctgc 1620 gtggacacca ggcagttcac catcagcctg ttctacaacg tgaccaacag ctacggctac 1680 gtgagcaaga gccaggactc caactgcccc ttcaccctgc agtccgtgaa cgactacctg 1740 tccttcagca agttctgcgt gtccaccagc ctgctggcca gcgcctgcac catcgacctg 1800 ttcggctacc cagagttcgg ctccggcgtg aagttcacca gcctgtactt ccagttcacc 1860 gagggcgagc tgatcaccgg caccccaaag cccctggagg gcgtgaccga cgtgagcttc 1920 atgaccctgg acgtgtgcac caagtacacc atctacggct tcaagggcga gggcatcatc 1980 accctgacca acagctcctt cctggccggc gtgtactaca cctccgacag cggccagctg 2040 ctggccttca agaacgtgac ctccggcgcc gtgtacagcg tgaccccctg ctccttcagc 2100 gagcaggccg cctacgtgga cgacgacatc gtgggcgtga tctccagcct gtcctccagc 2160 accttcaact ccaccagaga gctgccaggc ttcttctacc acagcaacga cggctccaac 2220 tgcaccgagc cagtgctggt gtactccaac atcggcgtgt gcaagagcgg ctccatcggc 2280 tacgtgccat cccagagcgg ccaggtgaag atcgccccca ccgtgaccgg caacatctcc 2340 atccccacca acttctccat gagcatcaga accgagtacc tgcagctgta caacaccccc 2400 gtgtccgtgg actgcgccac ctacgtgtgc aacggcaact ccagatgcaa gcagctgctg 2460 acccagtaca ccgccgcctg caagaccatc gagagcgccc tgcagctgag cgccaggctg 2520 gagtccgtgg aggtgaacag catgctgacc atctccgagg aggccctgca gctggccacc 2580 atcagctcct tcaacggcga cggctacaac ttcaccaacg tgctgggcgt gagcgtgtac 2640 gacccagcca gcggcagagt ggtgcagaag aggagcttca tcgaggacgc cgccttcaac 2700 aaggtggtga ccaacggcct gggcaccgtg gacgaggact acaagagatg cagcaacggc 2760 agatccgtgg ccgacctggt gtgcgcccag tattacagcg gcgtgatggt gctgccaggc 2820 gtggtggacg ccgagaagct gcacatgtac agcgcctccc tgatcggcgg catggtgctg 2880 ggcggcttca cctccgccgc cgccctgccc ttcagctacg ccgtgcaggc cagactgaac 2940 tacctggccc tgcagaccga cgtgctgcag agaaaccagc agctgctggc cgagagcttc 3000 aacagcgcca tcggcaacat cacctccgcc ttcgagagcg tgaaggaggc catcagccag 3060 3120. acctccaagg gcctgaacac cgtggcccac gccctgacca aggtgcagga ggtggtgaac tcccagggcg ccgccctgac ccagctgacc gtgcagctgc agcacaactt ccaggccatc 3180. 3240. tccagctcca tcgacgacat ctactccagg ctggacatcc tgtccgccga cgtgcaggtg gacagactga tcaccggcag actgtccgcc ctgaacgcct tcgtggccca gaccctgacc aagtacaccg aggtgcaggc ctccagaaag ctggcccagc agaaggtgaa cgagtgcgtg aagtcccaga gccagagata cggcttctgc ggcggcgacg gcgagcacat cttctccctg 3420 gtgcaggccg ccccacaggg cctgctgttc ctgcacaccg tgctggtgcc aggcgacttc 3480 atcgacgtga tcgccatcgc cggcctgtgc gtgaacgacg agatcgccct gaccctgaga 3540 gagcccggcc tggtgctgtt cacccacgag ctgcagaacc acaccgccac cgagtatttc 3600. gtgagctcca gacggatgtt cgagccaaga aagcccaccg tgagcgactt cgtgcagatc gagtcctgcg tggtgaccta cgtgaacctg accagagacc agctgccaga cgtgatccca 3720 gactacatcg acgtgaacaa gaccctggac gagatcctgg cctccctgcc aaacagaacc ggccccagcc tgcccctgga cgtgttcaac gccacctacc tgaacctgac cggcgagatc 3840 gccgacctgg agcagagaag cgagtccctg agaaacacca ccgaggagct gcagtccctg 3900 atctacaaca tcaacaacac cctggtggac ctggagtggc tgaacagagt ggagacctac 3960 atcaagtggc catggtgggt gtggctgatc gtgttcatcg tgctgatctt cgtggtgtcc 4020 ctgctggtgt tctgctgcat ctccaccggc tgctgcggct gctgcggctg ctgctgcgcc 4080 tgcttcagcg gctgctgtag aggaccccgg ctccagcccg ctgaggtgtt tgagaaagtg 4140 agagtgcagt ga 4152 <210> 12 <211> 4155 <212> DNA <213> Porcine epidemic diarrhea virus <400> 12 atgaaatccc tcaactactt ctggctcttc ctccccgtgc tctccaccct cagcctccct 60 caggatgtca caagatgcca gtccacaatc aacttcagac ggttcttctc caagttcaac 120 gtgcaggccc ccgccgtggt ggtgctgggc ggctacctgc caagcatgaa ctccagctcc 180 tggtactgcg gcaccggcct ggagaccgcc tccggcgtgc acggcatctt cctgagctac 240 atcgacgccg gccagggctt cgagatcggc atcagccagg agcccttcga cccaagcggc 300 taccagctgt acctgcacaa ggccaccaac ggcaaccaca acgccatcgc caggctgaga 360 atctgccagt tccccaacaa caagaccctg ggccccaccg tgaacgacgt gaccaccggc 420 agaaactgcc tgttcaacaa ggccatccca gcctacatgc aggacggcaa gaacatcgtg 480 gtgggcatca cctgggacaa cgacagagtg accgtgttcg ccgacaagat ctaccacttc 540 tacctgaaga acgactggtc cagagtggcc accaggtgct acaacaagcg gagctgcgcc 600 atgcagtacg tgtacacccc aacctactac atgctgaacg tgaccagcgc cggcgaggac 660 ggcatctact acgagccctg caccgccaac tgcagcggct acgccgtgaa cgtgttcgcc 720 accgacagca acggccacat ccccgagggc ttctccttca acaactggtt cctgctgagc 780 aacgactcca ccctgctgca cggcaaggtg gtgtccaacc agccactgct ggtgaactgc 840 ctgctggcca tcccaaagat ctacggcctg ggccagttct tcagcttcaa ccagaccatg 900 gacggcgtgt gcaacggcgc cgccgcccag agggccccag aggccctgag attcaacatc 960 aacgacacct ccgtgatcct ggccgagggc agcatcgtgc tgcacaccgc cctgggcacc 1020 aacctgagct tcgtgtgctc caacagctcc gacccccacc tggccacctt caccatccca 1080 ctgggcgcca cccaggtgcc atactactgc ttcctgaagg tggacaccta caacagcaac 1140 gtgtacaagt tcctggccgt gctgccaccc accgtgagag agatcgtgat caccaagtac 1200 ggcgacgtgt acgtgaacgg cttcggctac ctgcacctgg gcctgctgga cgccgtgacc 1260 atcaacttca ccggccacgg caccgacgac gacgtgagcg gcttctggac catcgcctcc 1320 accaacttcg tggacgccct gatcgaggtg cagggcaccg ccatccagcg catcctgtac 1380 tgcgacgacc cagtgtccca gctgaagtgc agccaggtgg ccttcgacct ggacgacggc 1440 ttctacccca tcagctccag aaacctgctg agccacgagc agccaatcag cttcgtgacc 1500 ctgccatcct tcaacgacca ctccttcgtg aacatcaccg tgagcgcctc cttcggcggc 1560 cactccggcg ccaacctgat cgcctccgac accaccatca acggcttctc cagcttctgc 1620 gtggacacca ggcagttcac catcagcctg ttctacaacg tgaccaacag ctacggctac 1680 gtgagcaaga gccaggactc caactgcccc ttcaccctgc agtccgtgaa cgactacctg 1740 tccttcagca agttctgcgt gtccaccagc ctgctggcca gcgcctgcac catcgacctg 1800 ttcggctacc cagagttcgg ctccggcgtg aagttcacca gcctgtactt ccagttcacc 1860 gagggcgagc tgatcaccgg caccccaaag cccctggagg gcgtgaccga cgtgagcttc 1920 atgaccctgg acgtgtgcac caagtacacc atctacggct tcaagggcga gggcatcatc 1980 accctgacca acagctcctt cctggccggc gtgtactaca cctccgacag cggccagctg 2040 ctggccttca agaacgtgac ctccggcgcc gtgtacagcg tgaccccctg ctccttcagc 2100 gagcaggccg cctacgtgga cgacgacatc gtgggcgtga tctccagcct gtcctccagc 2160 accttcaact ccaccagaga gctgccaggc ttcttctacc acagcaacga cggctccaac 2220 tgcaccgagc cagtgctggt gtactccaac atcggcgtgt gcaagagcgg ctccatcggc 2280 tacgtgccat cccagagcgg ccaggtgaag atcgccccca ccgtgaccgg caacatctcc 2340 atccccacca acttctccat gagcatcaga accgagtacc tgcagctgta caacaccccc 2400 gtgtccgtgg actgcgccac ctacgtgtgc aacggcaact ccagatgcaa gcagctgctg 2460 acccagtaca ccgccgcctg caagaccatc gagagcgccc tgcagctgag cgccaggctg 2520 gagtccgtgg aggtgaacag catgctgacc atctccgagg aggccctgca gctggccacc 2580 atcagctcct tcaacggcga cggctacaac ttcaccaacg tgctgggcgt gagcgtgtac 2640 gacccagcca gcggcagagt ggtgcagaag aggagcttca tcgaggacgc cgccttcaac 2700 aaggtggtga ccaacggcct gggcaccgtg gacgaggact acaagagatg cagcaacggc 2760 agatccgtgg ccgacctggt gtgcgcccag tattacagcg gcgtgatggt gctgccaggc 2820 gtggtggacg ccgagaagct gcacatgtac agcgcctccc tgatcggcgg catggtgctg 2880 ggcggcttca cctccgccgc cgccctgccc ttcagctacg ccgtgcaggc cagactgaac 2940 tacctggccc tgcagaccga cgtgctgcag agaaaccagc agctgctggc cgagagcttc 3000 aacagcgcca tcggcaacat cacctccgcc ttcgagagcg tgaaggaggc catcagccag 3060 acctccaagg gcctgaacac cgtggcccac gccctgacca aggtgcagga ggtggtgaac 3120 tcccagggcg ccgccctgac ccagctgacc gtgcagctgc agcacaactt ccaggccatc 3180. 3240. tccagctcca tcgacgacat ctactccagg ctggacatcc tgtccgccga cgtgcaggtg gacagactga tcaccggcag actgtccgcc ctgaacgcct tcgtggccca gaccctgacc aagtacaccg aggtgcaggc ctccagaaag ctggcccagc agaaggtgaa cgagtgcgtg aagtcccaga gccagagata cggcttctgc ggcggcgacg gcgagcacat cttctccctg 3420 gtgcaggccg ccccacaggg cctgctgttc ctgcacaccg tgctggtgcc aggcgacttc 3480 atcgacgtga tcgccatcgc cggcctgtgc gtgaacgacg agatcgccct gaccctgaga 3540 gagcccggcc tggtgctgtt cacccacgag ctgcagaacc acaccgccac cgagtatttc 3600. gtgagctcca gacggatgtt cgagccaaga aagcccaccg tgagcgactt cgtgcagatc gagtcctgcg tggtgaccta cgtgaacctg accagagacc agctgccaga cgtgatccca 3720 gactacatcg acgtgaacaa gaccctggac gagatcctgg cctccctgcc aaacagaacc ggccccagcc tgcccctgga cgtgttcaac gccacctacc tgaacctgac cggcgagatc 3840 gccgacctgg agcagagaag cgagtccctg agaaacacca ccgaggagct gcagtccctg 3900 atctacaaca tcaacaacac cctggtggac ctggagtggc tgaacagagt ggagacctac 3960 atcaagtggc catggtgggt gtggctgatc gtgttcatcg tgctgatctt cgtggtgtcc 4020 ctgctggtgt tctgctgcat ctccaccggc tgctgcggct gctgcggctg ctgctgcgcc 4080 tgcttcagcg gctgctgtag aggaccccgg ctccagcccg ctgaggtgtt tgagaaagtg 4140 agagtgcagt gataa 4155 <210> 13 <211> 4245 <212> DNA <213> Artificial sequence <220> <223> DNA reverse complement of SEQ ID NO:8 <400> 13 cttaggactc aggtagtcca gcagcaccat gaaatccctc aactacttct ggctcttcct 60 ccccgtgctc tccaccctca gcctccctca ggatgtcaca agatgccagt ccacaatcaa 120 cttcagacgg ttcttctcca agttcaacgt gcaggccccc gccgtggtgg tgctgggcgg 180 ctacctgcca agcatgaact ccagctcctg gtactgcggc accggcctgg agaccgcctc 240 cggcgtgcac ggcatcttcc tgagctacat cgacgccggc cagggcttcg agatcggcat 300 cagccaggag cccttcgacc caagcggcta ccagctgtac ctgcacaagg ccaccaacgg 360 caaccacaac gccatcgcca ggctgagaat ctgccagttc cccaacaaca agaccctggg 420 ccccaccgtg aacgacgtga ccaccggcag aaactgcctg ttcaacaagg ccatcccagc 480 ctacatgcag gacggcaaga acatcgtggt gggcatcacc tgggacaacg acagagtgac 540 cgtgttcgcc gacaagatct accacttcta cctgaagaac gactggtcca gagtggccac 600 caggtgctac aacaagcgga gctgcgccat gcagtacgtg tacaccccaa cctactacat 660 gctgaacgtg accagcgccg gcgaggacgg catctactac gagccctgca ccgccaactg 720 cagcggctac gccgtgaacg tgttcgccac cgacagcaac ggccacatcc ccgagggctt 780 ctccttcaac aactggttcc tgctgagcaa cgactccacc ctgctgcacg gcaaggtggt 840 gtccaaccag ccactgctgg tgaactgcct gctggccatc ccaaagatct acggcctggg 900 ccagttcttc agcttcaacc agaccatgga cggcgtgtgc aacggcgccg ccgcccagag 960 ggccccagag gccctgagat tcaacatcaa cgacacctcc gtgatcctgg ccgagggcag 1020 catcgtgctg cacaccgccc tgggcaccaa cctgagcttc gtgtgctcca acagctccga 1080 cccccacctg gccaccttca ccatcccact gggcgccacc caggtgccat actactgctt 1140 cctgaaggtg gacacctaca acagcaacgt gtacaagttc ctggccgtgc tgccacccac 1200 cgtgagagag atcgtgatca ccaagtacgg cgacgtgtac gtgaacggct tcggctacct 1260 gcacctgggc ctgctggacg ccgtgaccat caacttcacc ggccacggca ccgacgacga 1320 cgtgagcggc ttctggacca tcgcctccac caacttcgtg gacgccctga tcgaggtgca 1380 gggcaccgcc atccagcgca tcctgtactg cgacgaccca gtgtcccagc tgaagtgcag 1440 ccaggtggcc ttcgacctgg acgacggctt ctaccccatc agctccagaa acctgctgag 1500 ccacgagcag ccaatcagct tcgtgaccct gccatccttc aacgaccact ccttcgtgaa 1560 catcaccgtg agcgcctcct tcggcggcca ctccggcgcc aacctgatcg cctccgacac 1620 caccatcaac ggcttctcca gcttctgcgt ggacaccagg cagttcacca tcagcctgtt 1680 ctacaacgtg accaacagct acggctacgt gagcaagagc caggactcca actgcccctt 1740 caccctgcag tccgtgaacg actacctgtc cttcagcaag ttctgcgtgt ccaccagcct 1800 gctggccagc gcctgcacca tcgacctgtt cggctaccca gagttcggct ccggcgtgaa 1860 gttcaccagc ctgtacttcc agttcaccga gggcgagctg atcaccggca ccccaaagcc 1920 cctggagggc gtgaccgacg tgagcttcat gaccctggac gtgtgcacca agtacaccat 1980 ctacggcttc aagggcgagg gcatcatcac cctgaccaac agctccttcc tggccggcgt 2040 gtactacacc tccgacagcg gccagctgct ggccttcaag aacgtgacct ccggcgccgt 2100 gtacagcgtg accccctgct ccttcagcga gcaggccgcc tacgtggacg acgacatcgt 2160 gggcgtgatc tccagcctgt cctccagcac cttcaactcc accagagagc tgccaggctt 2220 cttctaccac agcaacgacg gctccaactg caccgagcca gtgctggtgt actccaacat 2280 cggcgtgtgc aagagcggct ccatcggcta cgtgccatcc cagagcggcc aggtgaagat 2340 cgcccccacc gtgaccggca acatctccat ccccaccaac ttctccatga gcatcagaac 2400 cgagtacctg cagctgtaca acacccccgt gtccgtggac tgcgccacct acgtgtgcaa 2460 cggcaactcc agatgcaagc agctgctgac ccagtacacc gccgcctgca agaccatcga 2520 gagcgccctg cagctgagcg ccaggctgga gtccgtggag gtgaacagca tgctgaccat 2580 ctccgaggag gccctgcagc tggccaccat cagctccttc aacggcgacg gctacaactt 2640 caccaacgtg ctgggcgtga gcgtgtacga cccagccagc ggcagagtgg tgcagaagag 2700 gagcttcatc gaggacgccg ccttcaacaa ggtggtgacc aacggcctgg gcaccgtgga 2760 cgaggactac aagagatgca gcaacggcag atccgtggcc gacctggtgt gcgcccagta 2820 ttacagcggc gtgatggtgc tgccaggcgt ggtggacgcc gagaagctgc acatgtacag 2880 cgcctccctg atcggcggca tggtgctggg cggcttcacc tccgccgccg ccctgccctt 2940 cagctacgcc gtgcaggcca gactgaacta cctggccctg cagaccgacg tgctgcagag 3000 aaaccagcag ctgctggccg agagcttcaa cagcgccatc ggcaacatca cctccgcctt 3060 cgagagcgtg aaagggcca tcagccagac ctccaagggc ctgaacaccg tggcccacgc 3120 cctgaccaag gtgcaggagg tggtgaactc ccagggcgcc gccctgaccc agctgaccgt 3180 gcagctgcag cacaacttcc aggccatctc cagctccatc gacgacatct actccaggct 3240 ggacatcctg tccgccgacg tgcaggtgga cagactgatc accggcagac tgtccgccct 3300 gaacgccttc gtggcccaga ccctgaccaa gtacaccgag gtgcaggcct ccagaaagct 3360 ggcccagcag aaggtgaacg agtgcgtgaa gtcccagagc cagagatacg gcttctgcgg 3420 cggcgacggc gagcacatct tctccctggt gcaggccgcc ccacagggcc tgctgttcct 3480 gcacaccgtg ctggtgccag gcgacttcat cgacgtgatc gccatcgccg gcctgtgcgt 3540 gaacgacgag atcgccctga ccctgagaga gcccggcctg gtgctgttca cccacgagct 3600 gcagaaccac accgccaccg agtatttcgt gagctccaga cggatgttcg agccaagaaa 3660 gcccaccgtg agcgacttcg tgcagatcga gtcctgcgtg gtgacctacg tgaacctgac 3720 cagagaccag ctgccagacg tgatcccaga ctacatcgac gtgaacaaga ccctggacga 3780 gatcctggcc tccctgccaa acagaaccgg ccccagcctg cccctggacg tgttcaacgc 3840 cacctacctg aacctgaccg gcgagatcgc cgacctggag cagagaagcg agtccctgag 3900 aaacaccacc gaggagctgc agtccctgat ctacaacatc aacaacaccc tggtggacct 3960 ggagtggctg aacagagtgg agacctacat caagtggcca tggtgggtgt ggctgatcgt 4020 gttcatcgtg ctgatcttcg tggtgtccct gctggtgttc tgctgcatct ccaccggctg 4080 ctgcggctgc tgcggctgct gctgcgcctg cttcagcggc tgctgtagag gaccccggct 4140 ccagcccgct gaggtgtttg agaaagtgag agtgcagtga taaatattca agaccagtcc 4200 tgcatcagtc aacaattatc attctaaact cattataaaa aactt 4245 <210> 14 <211> 5153 <212> DNA <213> Artificial Sequence <220> <223> Contains SEQ ID NO:13 <400> 14 ccgcggtaat cggaaggaca gtggtattac tctgggctca aaaggtcaac tattgagaga 60 cctccagctg aaacccattg acaaagagtc tagctcggca atcggataca aaccaaagga 120 taccgcacct tctaaagctg tacttgcatc attgatcaga tcaagcagag ttgatcaaag 180 tcacaaacat aacatgctgg ttctgcttaa aaatatcaag ggagatgaca acctaaacga 240 gttctaccag atggtcaaga gtattactca tgcttaatct gtagcgttga ctaatctact 300 aaccggcgca aaactgcttt cactatcgct taaaagcaat tataaaaaac ttaggactca 360 ggtagtccag cagcaccatg aaatccctca actacttctg gctcttcctc cccgtgctct 420 ccaccctcag cctccctcag gatgtcacaa gatgccagtc cacaatcaac ttcagacggt 480 tcttctccaa gttcaacgtg caggcccccg ccgtggtggt gctgggcggc tacctgccaa 540 gcatgaactc cagctcctgg tactgcggca ccggcctgga gaccgcctcc ggcgtgcacg 600 gcatcttcct gagctacatc gacgccggcc agggcttcga gatcggcatc agccaggagc 660 ccttcgaccc aagcggctac cagctgtacc tgcacaaggc caccaacggc aaccacaacg 720 ccatcgccag gctgagaatc tgccagttcc ccaacaacaa gaccctgggc cccaccgtga 780 acgacgtgac caccggcaga aactgcctgt tcaacaaggc catcccagcc tacatgcagg 840 acggcaagaa catcgtggtg ggcatcacct gggacaacga cagagtgacc gtgttcgccg 900 acaagatcta ccacttctac ctgaagaacg actggtccag agtggccacc aggtgctaca 960 acaagcggag ctgcgccatg cagtacgtgt acaccccaac ctactacatg ctgaacgtga 1020 ccagcgccgg cgaggacggc atctactacg agccctgcac cgccaactgc agcggctacg 1080 ccgtgaacgt gttcgccacc gacagcaacg gccacatccc cgagggcttc tccttcaaca 1140 actggttcct gctgagcaac gactccaccc tgctgcacgg caaggtggtg tccaaccagc 1200 cactgctggt gaactgcctg ctggccatcc caaagatcta cggcctgggc cagttcttca 1260 gcttcaacca gaccatggac ggcgtgtgca acggcgccgc cgcccagagg gccccagagg 1320 ccctgagatt caacatcaac gacacctccg tgatcctggc cgagggcagc atcgtgctgc 1380 acaccgccct gggcaccaac ctgagcttcg tgtgctccaa cagctccgac ccccacctgg 1440 ccaccttcac catcccactg ggcgccaccc aggtgccata ctactgcttc ctgaaggtgg 1500 acacctacaa cagcaacgtg tacaagttcc tggccgtgct gccacccacc gtgagagaga 1560 tcgtgatcac caagtacggc gacgtgtacg tgaacggctt cggctacctg cacctgggcc 1620 tgctggacgc cgtgaccatc aacttcaccg gccacggcac cgacgacgac gtgagcggct 1680 tctggaccat cgcctccacc aacttcgtgg acgccctgat cgaggtgcag ggcaccgcca 1740 tccagcgcat cctgtactgc gacgacccag tgtcccagct gaagtgcagc caggtggcct 1800 tcgacctgga cgacggcttc taccccatca gctccagaaa cctgctgagc cacgagcagc 1860 caatcagctt cgtgaccctg ccatccttca acgaccactc cttcgtgaac atcaccgtga 1920 gcgcctcctt cggcggccac tccggcgcca acctgatcgc ctccgacacc accatcaacg 1980 gcttctccag cttctgcgtg gacaccaggc agttcaccat cagcctgttc tacaacgtga 2040 ccaacagcta cggctacgtg agcaagagcc aggactccaa ctgccccttc accctgcagt 2100 ccgtgaacga ctacctgtcc ttcagcaagt tctgcgtgtc caccagcctg ctggccagcg 2160 cctgcaccat cgacctgttc ggctacccag agttcggctc cggcgtgaag ttcaccagcc 2220 tgtacttcca gttcaccgag ggcgagctga tcaccggcac cccaaagccc ctggagggcg 2280 tgaccgacgt gagcttcatg accctggacg tgtgcaccaa gtacaccatc tacggcttca 2340 agggcgaggg catcatcacc ctgaccaaca gctccttcct ggccggcgtg tactacacct ccgacagcgg ccagctgctg gccttcaaga acgtgacctc cggcgccgtg tacagcgtga ccccctgctc cttcagcgag caggccgcct acgtggacga cgacatcgtg ggcgtgatct 2580. ccgcctgtc ctccagcacc ttcaactcca ccgagagct gccaggcttc ttctaccaca gcaacgacgg ctccaactgc accgagccag tgctggtgta ctccaacatc ggcgtgtgca agagcggctc catcggctac gtgccatccc agagcggcca ggtgaagatc gcccccaccg 2760. tgaccggcaa catctccatc cccaccaact tctccatgag catcagaacc gagtacctgc agctgtacaa caccccgtg tccgtggact gcgccaccta cgtgtgcaac ggcaactcca gatgcaagca gctgctgacc cagtacaccg ccgcctgcaa gaccatcgag agcgccctgc agctgagcgc caggctggag tccgtggagg tgaacagcat gctgaccatc tccgaggagg 2940 ccctgcagct ggccaccatc agctccttca acggcgacgg ctacaacttc accaacgtgc tgggcgtgag cgtgtacgac ccagccagcg gcagagtggt gcagaagagg agcttcatcg 3060. aggacgccgc cttcaacaag gtggtgacca acggcctggg caccgtggac gaggactaca 3120 agagatgcag caacggcaga tccgtggccg acctggtgtg cgcccagtat tacagcggcg 3180 tgatggtgct gccaggcgtg gtggacgccg agaagctgca catgtacagc gcctccctga 3240 tcggcggcat ggtgctgggc ggcttcacct ccgccgccgc cctgcccttc agctacgccg 3300 tgcaggccag actgaactac ctggccctgc agaccgacgt gctgcagaga aaccagcagc 3360 tgctggccga gagcttcaac agcgccatcg gcaacatcac ctccgccttc gagagcgtga 3420 aggaggccat cagccagacc tccaagggcc tgaacaccgt ggcccacgcc ctgaccaagg 3480 tgcaggaggt ggtgaactcc cagggcgccg ccctgaccca gctgaccgtg cagctgcagc 3540 acaacttcca ggccatctcc agctccatcg acgacatcta ctccaggctg gacatcctgt 3600 ccgccgacgt gcaggtggac agactgatca ccggcagact gtccgccctg aacgccttcg 3660 tggcccagac cctgaccaag tacaccgagg tgcaggcctc cagaaagctg gcccagcaga 3720 aggtgaacga gtgcgtgaag tcccagagcc agagatacgg cttctgcggc ggcgacggcg 3780 agcacatctt ctccctggtg caggccgccc cacagggcct gctgttcctg cacaccgtgc 3840 tggtgccagg cgacttcatc gacgtgatcg ccatcgccgg cctgtgcgtg aacgacgaga 3900 tcgccctgac cctgagagag cccggcctgg tgctgttcac ccacgagctg cagaaccaca 3960 ccgccaccga gtatttcgtg agctccagac ggatgttcga gccaagaaag cccaccgtga 4020 gcgacttcgt gcagatcgag tcctgcgtgg tgacctacgt gaacctgacc agagaccagc 4080 tgccagacgt gatcccagac tacatcgacg tgaacaagac cctggacgag atcctggcct 4140 ccctgccaaa cagaaccggc cccagcctgc ccctggacgt gttcaacgcc acctacctga 4200 acctgaccgg cgagatcgcc gacctggagc agagaagcga gtccctgaga aacaccaccg 4260 aggagctgca gtccctgatc tacaacatca acaacaccct ggtggacctg gagtggctga 4320 acagagtgga gacctacatc aagtggccat ggtgggtgtg gctgatcgtg ttcatcgtgc 4380 tgatcttcgt ggtgtccctg ctggtgttct gctgcatctc caccggctgc tgcggctgct 4440 gcggctgctg ctgcgcctgc ttcagcggct gctgtagagg accccggctc cagcccgctg 4500 aggtgtttga gaaagtgaga gtgcagtgat aaatattcaa gaccagtcct gcatcagtca 4560 acaattatca ttctaaactc attataaaaa acttaggaca caagagccta agtcctctcc 4620 taaaaaatga ctgaggtgta cgacttcgat cagtcttctt gggacaccaa gggcttattg 4680 gcccctattt tgcctaccac ttatcccgat ggtaggctca taccccaagt cagagtaata 4740 gatccaggac tcggcgatag gaaagatgaa tgcttcatgt atatttttct actgggtata 4800 atagaagaca atgatggcct cggaccccca attggaagaa catttggatt gctgcctttg 4860 ggagttgggc gtactacagc cagacctgag gagttattga aagaagccac cctgttggat 4920 attgtggtaa ggcgaactgc aggtgtcaag gaacaactgg tattttataa taacacccca 4980 ttgcacatct taactccgtg gaaaaaggtc cttacgagtg gaagtgtgtt cagtgcaaat 5040 caagtctgta acgcagtcaa tctaatacca ttagacatag cacaaagatt cagggtggta 5100 tatatgagca tcactcgact atcagacgat ggaagttaca gaattccccg cgg 5153 <210> 15 <211> 1388 <212> PRT <213> Porcine epidemic diarrhea virus <400> 15 Met Lys Ser Leu Thr Tyr Phe Trp Leu Phe Leu Pro Val Leu Ser Thr 1 5 10 15 Leu Ser Leu Pro Gln Asp Val Thr Arg Cys Ser Ala Asn Thr Asn Phe 20 25 30 Arg Arg Phe Phe Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val 35 40 45 Leu Gly Gly Tyr Leu Pro Ile Gly Glu Asn Gln Gly Val Asn Ser Thr 50 55 60 Trp Tyr Cys Ala Gly Gln His Pro Thr Ala Ser Gly Val His Gly Ile 65 70 75 80 Phe Val Ser His Ile Arg Gly Gly His Gly Phe Glu Ile Gly Ile Ser 85 90 95 Gln Glu Pro Phe Asp Pro Ser Gly Tyr Gln Leu Tyr Leu His Lys Ala 100 105 110 Thr Asn Gly Asn Thr Asn Ala Thr Ala Arg Leu Arg Ile Cys Gln Phe 115 120 125 Pro Ser Ile Lys Thr Leu Gly Pro Thr Ala Asn Asn Asp Val Thr Thr 130 135 140 Gly Arg Asn Cys Leu Phe Asn Lys Ala Ile Pro Ala His Met Ser Glu 145 150 155 160 His Ser Val Val Gly Ile Thr Trp Asp Asn Asp Arg Val Thr Val Phe 165 170 175 Ser Asp Lys Ile Tyr Tyr Phe Tyr Phe Lys Asn Asp Trp Ser Arg Val 180 185 190 Ala Thr Lys Cys Tyr Asn Ser Gly Gly Cys Ala Met Gln Tyr Val Tyr 195 200 205 Glu Pro Thr Tyr Tyr Met Leu Asn Val Thr Ser Ala Gly Glu Asp Gly 210 215 220 Ile Ser Tyr Gln Pro Cys Thr Ala Asn Cys Ile Gly Tyr Ala Ala Asn 225 230 235 240 Val Phe Ala Thr Glu Pro Asn Gly His Ile Pro Glu Gly Phe Ser Phe 245 250 255 Asn Asn Trp Phe Leu Leu Ser Asn Asp Ser Thr Leu Val His Gly Lys 260 265 270 Val Val Ser Asn Gln Pro Leu Leu Val Asn Cys Leu Leu Ala Ile Pro 275 280 285 Lys Ile Tyr Gly Leu Gly Gln Phe Phe Ser Phe Asn Gln Thr Ile Asp 290 295 300 Gly Val Cys Asn Gly Ala Ala Val Gln Arg Ala Pro Glu Ala Leu Arg 305 310 315 320 Phe Asn Ile Asn Asp Thr Ser Val Ile Leu Ala Glu Gly Ser Ile Val 325 330 335 Leu His Thr Ala Leu Gly Thr Asn Phe Ser Phe Val Cys Ser Asn Ser 340 345 350 Ser Asn Pro His Leu Ala Thr Phe Ala Ile Pro Leu Gly Ala Thr Gln 355 360 365 Val Pro Tyr Tyr Cys Phe Leu Lys Val Asp Thr Tyr Asn Ser Thr Val 370 375 380 Tyr Lys Phe Leu Ala Val Leu Pro Pro Thr Val Arg Glu Ile Val Ile 385 390 395 400 Thr Lys Tyr Gly Asp Val Tyr Val Asn Gly Phe Gly Tyr Leu His Leu 405 410 415 Gly Leu Leu Asp Ala Val Thr Ile Asn Phe Thr Gly His Gly Thr Asp 420 425 430 Asp Asp Val Ser Gly Phe Trp Thr Ile Ala Ser Thr Asn Phe Val Asp 435 440 445 Ala Leu Ile Glu Val Gln Gly Thr Ala Ile Gln Arg Ile Leu Tyr Cys 450 455 460 Asp Asp Pro Val Ser Gln Leu Lys Cys Ser Gln Val Ala Phe Asp Leu 465 470 475 480 Asp Asp Gly Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His Glu 485 490 495 Gln Pro Ile Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe 500 505 510 Val Asn Ile Thr Val Ser Ala Ser Phe Gly Gly His Ser Gly Ala Asn 515 520 525 Leu Ile Ala Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val 530 535 540 Asp Thr Arg Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn Ser 545 550 555 560 Tyr Gly Tyr Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu 565 570 575 Gln Ser Val Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr 580 585 590 Ser Leu Leu Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu 595 600 605 Phe Gly Ser Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys 610 615 620 Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr Asp 625 630 635 640 Val Ser Phe Met Thr Leu Asp Val Cys Thr Lys Tyr Thr Ile Tyr Gly 645 650 655 Phe Lys Gly Glu Gly Ile Ile Thr Leu Thr Asn Ser Ser Phe Leu Ala 660 665 670 Gly Val Tyr Tyr Thr Ser Asp Ser Gly Gln Leu Leu Ala Phe Lys Asn 675 680 685 Val Thr Ser Gly Ala Val Tyr Ser Val Thr Pro Cys Ser Phe Ser Glu 690 695 700 Gln Ala Ala Tyr Val Asp Asp Asp Ile Val Gly Val Ile Ser Ser Leu 705 710 715 720 Ser Ser Ser Thr Phe Asn Ser Thr Arg Glu Leu Pro Gly Phe Phe Tyr 725 730 735 His Ser Asn Asp Gly Ser Asn Cys Thr Glu Pro Val Leu Val Tyr Ser 740 745 750 Asn Ile Gly Val Cys Lys Ser Gly Ser Ile Gly Tyr Val Pro Ser Gln 755 760 765 Ser Gly Gln Val Lys Ile Ala Pro Thr Val Thr Gly Asn Ile Ser Ile 770 775 780 Pro Thr Asn Phe Ser Met Ser Ile Arg Thr Glu Tyr Leu Gln Leu Tyr 785 790 795 800 Asn Thr Pro Val Ser Val Asp Cys Ala Thr Tyr Val Cys Asn Gly Asn 805 810 815 Ser Arg Cys Lys Gln Leu Leu Thr Gln Tyr Thr Ala Ala Cys Lys Thr 820 825 830 Ile Glu Ser Ala Leu Gln Leu Ser Ala Arg Leu Glu Ser Val Glu Val 835 840 845 Asn Ser Met Leu Thr Ile Ser Glu Glu Ala Leu Gln Leu Ala Thr Ile 850 855 860 Ser Ser Phe Asn Gly Asp Gly Tyr Asn Phe Thr Asn Val Leu Gly Val 865 870 875 880 Ser Val Tyr Asp Pro Ala Ser Gly Arg Val Val Gln Lys Arg Ser Phe 885 890 895 Ile Glu Asp Ala Ala Phe Asn Lys Val Val Thr Asn Gly Leu Gly Thr 900 905 910 Val Asp Glu Asp Tyr Lys Arg Cys Ser Asn Gly Arg Ser Val Ala Asp 915 920 925 Leu Val Cys Ala Gln Tyr Tyr Ser Gly Val Met Val Leu Pro Gly Val 930 935 940 Val Asp Ala Glu Lys Leu His Met Tyr Ser Ala Ser Leu Ile Gly Gly 945 950 955 960 Met Val Leu Gly Gly Phe Thr Ser Ala Ala Ala Leu Pro Phe Ser Tyr 965 970 975 Ala Val Gln Ala Arg Leu Asn Tyr Leu Ala Leu Gln Thr Asp Val Leu 980 985 990 Gln Arg Asn Gln Gln Leu Leu Ala Glu Ser Phe Asn Ser Ala Ile Gly 995 1000 1005 Asn Ile Thr Ser Ala Phe Glu Ser Val Lys Glu Ala Ile Ser Gln 1010 1015 1020 Thr Ser Lys Gly Leu Asn Thr Val Ala His Ala Leu Thr Lys Val 1025 1030 1035 Gln Glu Val Val Asn Ser Gln Gly Ala Ala Leu Thr Gln Leu Thr 1040 1045 1050 Val Gln Leu Gln His Asn Phe Gln Ala Ile Ser Ser Ser Ile Asp 1055 1060 1065 Asp Ile Tyr Ser Arg Leu Asp Ile Leu Ser Ala Asp Val Gln Val 1070 1075 1080 Asp Arg Leu Ile Thr Gly Arg Leu Ser Ala Leu Asn Ala Phe Val 1085 1090 1095 Ala Gln Thr Leu Thr Lys Tyr Thr Glu Val Gln Ala Ser Arg Lys 1100 1105 1110 Leu Ala Gln Gln Lys Val Asn Glu Cys Val Lys Ser Gln Ser Gln 1115 1120 1125 Arg Tyr Gly Phe Cys Gly Gly Asp Gly Glu His Ile Phe Ser Leu 1130 1135 1140 Val Gln Ala Ala Pro Gln Gly Leu Leu Phe Leu His Thr Val Leu 1145 1150 1155 Val Pro Ser Asp Phe Val Asp Val Ile Ala Ile Ala Gly Leu Cys 1160 1165 1170 Val Asn Asp Glu Ile Ala Leu Thr Leu Arg Glu Pro Gly Leu Val 1175 1180 1185 Leu Phe Thr His Glu Leu Gln Asn His Thr Ala Thr Glu Tyr Phe 1190 1195 1200 Val Ser Ser Arg Arg Met Phe Glu Pro Arg Lys Pro Thr Val Ser 1205 1210 1215 Asp Phe Val Gln Ile Glu Ser Cys Val Val Thr Tyr Val Asn Leu 1220 1225 1230 Thr Arg Asp Gln Leu Pro Asp Val Ile Pro Asp Tyr Ile Asp Val 1235 1240 1245 Asn Lys Thr Leu Asp Glu Ile Leu Ala Ser Leu Pro Asn Arg Thr 1250 1255 1260 Gly Pro Ser Leu Pro Leu Asp Val Phe Asn Ala Thr Tyr Leu Asn 1265 1270 1275 Leu Thr Gly Glu Ile Ala Asp Leu Glu Gln Arg Ser Glu Ser Leu 1280 1285 1290 Arg Asn Thr Thr Glu Glu Leu Gln Ser Leu Ile Tyr Asn Ile Asn 1295 1300 1305 Asn Thr Leu Val Asp Leu Glu Trp Leu Asn Arg Val Glu Thr Tyr 1310 1315 1320 Ile Lys Trp Pro Trp Trp Val Trp Leu Ile Ile Phe Ile Val Leu 1325 1330 1335 Ile Phe Val Val Ser Leu Leu Val Phe Cys Cys Ile Ser Thr Gly 1340 1345 1350 Cys Cys Gly Cys Cys Gly Cys Cys Cys Ala Cys Phe Ser Gly Cys 1355 1360 1365 Cys Arg Gly Pro Arg Leu Gln Pro Ala Glu Val Phe Glu Lys Val 1370 1375 1380 Arg Val Gln Cys Gly 1385 <210> 16 <211> 1386 <212> PRT <213> Porcine epidemic diarrhea virus <400> 16 Met Lys Ser Leu Thr Tyr Phe Trp Leu Phe Leu Pro Val Leu Ser Thr 1 5 10 15 Leu Ser Leu Pro Gln Asp Val Thr Arg Cys Ser Ala Asn Thr Asn Phe 20 25 30 Arg Arg Phe Phe Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val 35 40 45 Leu Gly Gly Tyr Leu Pro Ile Gly Glu Asn Gln Gly Val Asn Ser Thr 50 55 60 Trp Tyr Cys Ala Gly Gln His Pro Thr Ala Ser Gly Val His Gly Ile 65 70 75 80 Phe Val Ser His Ile Arg Gly Gly His Gly Phe Glu Ile Gly Ile Ser 85 90 95 Gln Glu Pro Phe Asp Pro Ser Gly Tyr Gln Leu Tyr Leu His Lys Ala 100 105 110 Thr Asn Gly Asn Thr Asn Ala Thr Ala Arg Leu Arg Ile Cys Gln Phe 115 120 125 Pro Ser Ile Lys Thr Leu Gly Pro Thr Ala Asn Asn Asp Val Thr Thr 130 135 140 Gly Arg Asn Cys Leu Phe Asn Lys Ala Ile Pro Ala Tyr Met Ser Glu 145 150 155 160 His Ser Val Val Gly Ile Thr Trp Asp Asn Asp Arg Val Thr Val Phe 165 170 175 Ser Asp Lys Ile Tyr Tyr Phe Tyr Phe Lys Asn Asp Trp Ser Arg Val 180 185 190 Ala Thr Lys Cys Tyr Asn Ser Gly Gly Cys Ala Met Gln Tyr Val Tyr 195 200 205 Glu Pro Thr Tyr Tyr Met Leu Asn Val Thr Ser Ala Gly Glu Asp Gly 210 215 220 Ile Ser Tyr Gln Pro Cys Thr Ala Asn Cys Ile Gly Tyr Ala Ala Asn 225 230 235 240 Val Phe Ala Thr Glu Pro Asn Gly His Ile Pro Glu Gly Phe Ser Phe 245 250 255 Asn Asn Trp Phe Leu Leu Ser Asn Asp Ser Thr Leu Val His Gly Lys 260 265 270 Val Val Ser Asn Gln Pro Leu Leu Val Asn Cys Leu Leu Ala Ile Pro 275 280 285 Lys Ile Tyr Gly Leu Gly Gln Phe Phe Ser Phe Asn Gln Thr Ile Asp 290 295 300 Gly Val Cys Asn Gly Ala Ala Val Gln Arg Ala Pro Glu Ala Leu Arg 305 310 315 320 Phe Asn Ile Asn Asp Thr Ser Val Ile Leu Ala Glu Gly Ser Ile Val 325 330 335 Leu His Thr Ala Leu Gly Thr Asn Phe Ser Phe Val Cys Ser Asn Ser 340 345 350 Ser Gly Pro His Leu Ala Thr Phe Ala Ile Pro Leu Gly Ala Thr Gln 355 360 365 Val Pro Tyr Tyr Cys Phe Leu Lys Val Asp Thr Tyr Asn Ser Thr Val 370 375 380 Tyr Lys Phe Leu Ala Val Leu Pro Pro Thr Val Arg Glu Ile Val Ile 385 390 395 400 Thr Lys Tyr Gly Asp Val Tyr Val Asn Gly Phe Gly Tyr Leu His Leu 405 410 415 Gly Leu Leu Asp Ala Val Thr Ile Asn Phe Thr Gly His Gly Thr Asp 420 425 430 Gly Asp Val Ser Gly Phe Trp Thr Ile Ala Ser Thr Asn Phe Val Asp 435 440 445 Ala Leu Ile Glu Val Gln Gly Thr Ala Ile Gln Arg Ile Leu Tyr Cys 450 455 460 Asp Asp Pro Val Ser Gln Leu Lys Cys Ser Gln Val Ala Phe Asp Leu 465 470 475 480 Asp Asp Gly Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His Glu 485 490 495 Gln Pro Ile Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe 500 505 510 Val Asn Ile Thr Val Ser Ala Ser Phe Gly Gly His Ser Gly Ala Asn 515 520 525 Leu Ile Ala Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val 530 535 540 Asp Thr Arg Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn Ser 545 550 555 560 Tyr Gly Tyr Val Ser Asn Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu 565 570 575 Gln Ser Val Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr 580 585 590 Ser Leu Leu Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu 595 600 605 Phe Gly Ser Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys 610 615 620 Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr Asp 625 630 635 640 Val Ser Phe Met Thr Leu Asp Val Cys Thr Lys Tyr Thr Ile Tyr Gly 645 650 655 Phe Lys Gly Glu Gly Ile Ile Thr Leu Thr Asn Ser Ser Phe Leu Ala 660 665 670 Gly Phe Tyr Tyr Thr Ser Asp Ser Gly Gln Leu Leu Ala Phe Lys Asn 675 680 685 Val Thr Ser Gly Ala Val Tyr Ser Val Thr Pro Cys Ser Phe Ser Glu 690 695 700 Gln Ala Ala Tyr Val Asp Asp Asp Ile Val Gly Val Ile Ser Ser Leu 705 710 715 720 Ser Ser Ser Thr Phe Asn Ser Thr Arg Glu Leu Pro Gly Phe Phe Tyr 725 730 735 His Ser Asn Asp Gly Ser Asn Cys Thr Glu Pro Val Leu Val Tyr Ser 740 745 750 Asn Ile Gly Val Cys Lys Ser Gly Ser Ile Gly Tyr Val Pro Ser Gln 755 760 765 Ser Gly Gln Val Lys Ile Ala Pro Thr Val Thr Gly Asn Ile Ser Ile 770 775 780 Pro Thr Asn Phe Ser Met Ser Ile Arg Thr Glu Tyr Leu Gln Leu Tyr 785 790 795 800 Asn Thr Pro Val Ser Val Asp Cys Ala Thr Tyr Val Cys Asn Gly Asn 805 810 815 Ser Arg Cys Lys Gln Leu Leu Thr Gln Tyr Thr Ala Ala Cys Lys Thr 820 825 830 Ile Glu Ser Ala Leu Gln Leu Ser Ala Arg Leu Glu Ser Val Glu Val 835 840 845 Asn Ser Met Leu Thr Ile Ser Glu Glu Ala Leu Gln Leu Ala Thr Ile 850 855 860 Ser Ser Phe Asn Gly Asp Gly Tyr Asn Phe Thr Asn Val Leu Gly Val 865 870 875 880 Ser Val Tyr Asp Pro Ala Ser Gly Arg Val Val Gln Lys Arg Ser Phe 885 890 895 Ile Glu Asp Leu Leu Phe Asn Lys Val Val Thr Asn Gly Leu Gly Thr 900 905 910 Val Asp Glu Asp Tyr Lys Arg Cys Ser Asn Gly Arg Ser Val Ala Asp 915 920 925 Leu Val Cys Ala Gln Tyr Tyr Ser Gly Val Met Val Leu Pro Gly Val 930 935 940 Val Asp Ala Glu Lys Leu His Met Tyr Ser Ala Ser Leu Ile Gly Gly 945 950 955 960 Met Val Leu Gly Gly Phe Thr Ser Ala Ala Ala Leu Pro Phe Ser Tyr 965 970 975 Ala Val Gln Ala Arg Leu Asn Tyr Leu Ala Leu Gln Thr Asp Val Leu 980 985 990 Gln Arg Asn Gln Gln Leu Leu Ala Glu Ser Phe Asn Ser Ala Ile Gly 995 1000 1005 Asn Ile Thr Ser Ala Phe Glu Ser Val Lys Glu Ala Ile Ser Gln 1010 1015 1020 Thr Ser Lys Gly Leu Asn Thr Val Ala His Ala Leu Thr Lys Val 1025 1030 1035 Gln Glu Val Val Asn Ser Gln Gly Ala Ala Leu Thr Gln Leu Thr 1040 1045 1050 Val Gln Leu Gln His Asn Phe Gln Ala Ile Ser Ser Ser Ile Asp 1055 1060 1065 Asp Ile Tyr Ser Arg Leu Asp Ile Leu Ser Ala Asp Val Gln Val 1070 1075 1080 Asp Arg Leu Ile Thr Gly Arg Leu Ser Ala Leu Asn Ala Phe Val 1085 1090 1095 Ala Gln Thr Leu Thr Lys Tyr Thr Glu Val Gln Ala Ser Arg Lys 1100 1105 1110 Leu Ala Gln Gln Lys Val Asn Glu Cys Val Lys Ser Gln Ser Gln 1115 1120 1125 Arg Tyr Gly Phe Cys Gly Gly Asp Gly Glu His Ile Phe Ser Leu 1130 1135 1140 Val Gln Ala Ala Pro Gln Gly Leu Leu Phe Leu His Thr Val Leu 1145 1150 1155 Val Pro Gly Asp Phe Val Asp Val Ile Ala Ile Ala Gly Leu Cys 1160 1165 1170 Val Asn Asp Glu Ile Ala Leu Thr Leu Arg Glu Pro Gly Leu Val 1175 1180 1185 Leu Phe Thr His Glu Leu Gln Asn His Thr Ala Thr Glu Tyr Phe 1190 1195 1200 Val Ser Ser Arg Arg Met Phe Glu Pro Arg Lys Pro Thr Val Ser 1205 1210 1215 Asp Phe Val Gln Ile Glu Ser Cys Val Val Thr Tyr Val Asn Leu 1220 1225 1230 Thr Arg Asp Gln Leu Pro Asp Val Ile Pro Asp Tyr Ile Asp Val 1235 1240 1245 Asn Lys Thr Leu Asp Glu Ile Leu Ala Ser Leu Pro Asn Arg Thr 1250 1255 1260 Gly Pro Ser Leu Pro Leu Asp Val Phe Asn Ala Thr Tyr Leu Asn 1265 1270 1275 Leu Thr Gly Glu Ile Ala Asp Leu Glu Gln Arg Ser Glu Ser Leu 1280 1285 1290 Arg Asn Thr Thr Glu Glu Leu Gln Ser Leu Ile Tyr Asn Ile Asn 1295 1300 1305 Asn Thr Leu Val Asp Leu Glu Trp Leu Asn Arg Val Glu Thr Tyr 1310 1315 1320 Ile Lys Trp Pro Trp Trp Val Trp Leu Ile Ile Phe Ile Val Leu 1325 1330 1335 Ile Phe Val Val Ser Leu Leu Val Phe Cys Cys Ile Ser Thr Gly 1340 1345 1350 Cys Cys Gly Cys Cys Gly Cys Cys Cys Ala Cys Phe Ser Gly Cys 1355 1360 1365 Cys Arg Gly Pro Arg Leu Gln Pro Tyr Glu Ala Phe Glu Lys Val 1370 1375 1380 His Val Gln 1385 <210> 17 <211> 1386 <212> PRT <213> Porcine epidemic diarrhea virus <400> 17 Met Lys Ser Leu Thr Tyr Phe Trp Leu Phe Leu Pro Val Leu Ser Thr 1 5 10 15 Leu Ser Leu Pro Gln Asp Val Thr Arg Cys Ser Ala Asn Thr Asn Phe 20 25 30 Arg Arg Phe Phe Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val 35 40 45 Leu Gly Gly Tyr Leu Pro Ile Gly Glu Asn Gln Gly Val Asn Ser Thr 50 55 60 Trp Tyr Cys Ala Gly Gln His Pro Thr Ala Ser Gly Val His Gly Ile 65 70 75 80 Phe Val Ser His Ile Arg Gly Gly His Gly Phe Glu Ile Gly Ile Ser 85 90 95 Gln Glu Pro Phe Asp Pro Ser Gly Tyr Gln Leu Tyr Leu His Lys Ala 100 105 110 Thr Asn Gly Asn Thr Asn Ala Thr Ala Arg Leu Arg Ile Cys Gln Phe 115 120 125 Pro Ser Ile Lys Thr Leu Gly Pro Thr Ala Asn Asn Asp Val Thr Thr 130 135 140 Gly Arg Asn Cys Leu Phe Asn Lys Ala Ile Pro Ala Tyr Met Ser Glu 145 150 155 160 His Ser Val Val Gly Ile Thr Trp Asp Asn Asp Arg Val Thr Val Phe 165 170 175 Ser Asp Lys Ile Tyr Tyr Phe Tyr Phe Lys Asn Asp Trp Ser Arg Val 180 185 190 Ala Thr Lys Cys Tyr Asn Ser Gly Gly Cys Ala Met Gln Tyr Val Tyr 195 200 205 Glu Pro Thr Tyr Tyr Met Leu Asn Val Thr Ser Ala Gly Glu Asp Gly 210 215 220 Ile Ser Tyr Gln Pro Cys Thr Ala Asn Cys Ile Gly Tyr Ala Ala Asn 225 230 235 240 Val Phe Ala Thr Glu Pro Asn Gly His Ile Pro Glu Gly Phe Ser Phe 245 250 255 Asn Asn Trp Phe Leu Leu Ser Asn Asp Ser Thr Leu Val His Gly Lys 260 265 270 Val Val Ser Asn Gln Pro Leu Leu Val Asn Cys Leu Leu Ala Ile Pro 275 280 285 Lys Ile Tyr Gly Leu Gly Gln Phe Phe Ser Phe Asn Gln Thr Ile Asp 290 295 300 Gly Val Cys Asn Gly Ala Ala Val Gln Arg Ala Pro Glu Ala Leu Arg 305 310 315 320 Phe Asn Ile Asn Asp Thr Ser Val Ile Leu Ala Glu Gly Ser Ile Val 325 330 335 Leu His Thr Ala Leu Gly Thr Asn Phe Ser Phe Val Cys Ser Asn Ser 340 345 350 Ser Gly Pro His Leu Ala Thr Phe Ala Ile Pro Leu Gly Ala Thr Gln 355 360 365 Val Pro Tyr Tyr Cys Phe Leu Lys Val Asp Thr Tyr Asn Ser Thr Val 370 375 380 Tyr Lys Phe Leu Ala Val Leu Pro Pro Thr Val Arg Glu Ile Val Ile 385 390 395 400 Thr Lys Tyr Gly Asp Val Tyr Val Asn Gly Phe Gly Tyr Leu His Leu 405 410 415 Gly Leu Leu Asp Ala Val Thr Ile Asn Phe Thr Gly His Gly Thr Asp 420 425 430 Gly Asp Val Ser Gly Phe Trp Thr Ile Ala Ser Thr Asn Phe Val Asp 435 440 445 Ala Leu Ile Glu Val Gln Gly Thr Ala Ile Gln Arg Ile Leu Tyr Cys 450 455 460 Asp Asp Pro Val Ser Gln Leu Lys Cys Ser Gln Val Ala Phe Asp Leu 465 470 475 480 Asp Asp Gly Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His Glu 485 490 495 Gln Pro Ile Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe 500 505 510 Val Asn Ile Thr Val Ser Ala Ser Phe Gly Gly His Ser Gly Ala Asn 515 520 525 Leu Ile Ala Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val 530 535 540 Asp Thr Arg Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn Ser 545 550 555 560 Tyr Gly Tyr Val Ser Asn Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu 565 570 575 Gln Ser Val Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr 580 585 590 Ser Leu Leu Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu 595 600 605 Phe Gly Ser Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys 610 615 620 Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr Asp 625 630 635 640 Val Ser Phe Met Thr Leu Asp Val Cys Thr Lys Tyr Thr Ile Tyr Gly 645 650 655 Phe Lys Gly Glu Gly Ile Ile Thr Leu Thr Asn Ser Ser Phe Leu Ala 660 665 670 Gly Phe Tyr Tyr Thr Ser Asp Ser Gly Gln Leu Leu Ala Phe Lys Asn 675 680 685 Val Thr Ser Gly Ala Val Tyr Ser Val Thr Pro Cys Ser Phe Ser Glu 690 695 700 Gln Ala Ala Tyr Val Asp Asp Asp Ile Val Gly Val Ile Ser Ser Leu 705 710 715 720 Ser Ser Ser Thr Phe Asn Ser Thr Arg Glu Leu Pro Gly Phe Phe Tyr 725 730 735 His Ser Asn Asp Gly Ser Asn Cys Thr Glu Pro Val Leu Val Tyr Ser 740 745 750 Asn Ile Gly Val Cys Lys Ser Gly Ser Ile Gly Tyr Val Pro Ser Gln 755 760 765 Ser Gly Gln Val Lys Ile Ala Pro Thr Val Thr Gly Asn Ile Ser Ile 770 775 780 Pro Thr Asn Phe Ser Met Ser Ile Arg Thr Glu Tyr Leu Gln Leu Tyr 785 790 795 800 Asn Thr Pro Val Ser Val Asp Cys Ala Thr Tyr Val Cys Asn Gly Asn 805 810 815 Ser Arg Cys Lys Gln Leu Leu Thr Gln Tyr Thr Ala Ala Cys Lys Thr 820 825 830 Ile Glu Ser Ala Leu Gln Leu Ser Ala Arg Leu Glu Ser Val Glu Val 835 840 845 Asn Ser Met Leu Thr Ile Ser Glu Glu Ala Leu Gln Leu Ala Thr Ile 850 855 860 Ser Ser Phe Asn Gly Asp Gly Tyr Asn Phe Thr Asn Val Leu Gly Val 865 870 875 880 Ser Val Tyr Asp Pro Ala Ser Gly Arg Val Val Gln Lys Arg Ser Phe 885 890 895 Ile Glu Asp Ala Ala Phe Asn Lys Val Val Thr Asn Gly Leu Gly Thr 900 905 910 Val Asp Glu Asp Tyr Lys Arg Cys Ser Asn Gly Arg Ser Val Ala Asp 915 920 925 Leu Val Cys Ala Gln Tyr Tyr Ser Gly Val Met Val Leu Pro Gly Val 930 935 940 Val Asp Ala Glu Lys Leu His Met Tyr Ser Ala Ser Leu Ile Gly Gly 945 950 955 960 Met Val Leu Gly Gly Phe Thr Ser Ala Ala Ala Leu Pro Phe Ser Tyr 965 970 975 Ala Val Gln Ala Arg Leu Asn Tyr Leu Ala Leu Gln Thr Asp Val Leu 980 985 990 Gln Arg Asn Gln Gln Leu Leu Ala Glu Ser Phe Asn Ser Ala Ile Gly 995 1000 1005 Asn Ile Thr Ser Ala Phe Glu Ser Val Lys Glu Ala Ile Ser Gln 1010 1015 1020 Thr Ser Lys Gly Leu Asn Thr Val Ala His Ala Leu Thr Lys Val 1025 1030 1035 Gln Glu Val Val Asn Ser Gln Gly Ala Ala Leu Thr Gln Leu Thr 1040 1045 1050 Val Gln Leu Gln His Asn Phe Gln Ala Ile Ser Ser Ser Ile Asp 1055 1060 1065 Asp Ile Tyr Ser Arg Leu Asp Ile Leu Ser Ala Asp Val Gln Val 1070 1075 1080 Asp Arg Leu Ile Thr Gly Arg Leu Ser Ala Leu Asn Ala Phe Val 1085 1090 1095 Ala Gln Thr Leu Thr Lys Tyr Thr Glu Val Gln Ala Ser Arg Lys 1100 1105 1110 Leu Ala Gln Gln Lys Val Asn Glu Cys Val Lys Ser Gln Ser Gln 1115 1120 1125 Arg Tyr Gly Phe Cys Gly Gly Asp Gly Glu His Ile Phe Ser Leu 1130 1135 1140 Val Gln Ala Ala Pro Gln Gly Leu Leu Phe Leu His Thr Val Leu 1145 1150 1155 Val Pro Gly Asp Phe Val Asp Val Ile Ala Ile Ala Gly Leu Cys 1160 1165 1170 Val Asn Asp Glu Ile Ala Leu Thr Leu Arg Glu Pro Gly Leu Val 1175 1180 1185 Leu Phe Thr His Glu Leu Gln Asn His Thr Ala Thr Glu Tyr Phe 1190 1195 1200 Val Ser Ser Arg Arg Met Phe Glu Pro Arg Lys Pro Thr Val Ser 1205 1210 1215 Asp Phe Val Gln Ile Glu Ser Cys Val Val Thr Tyr Val Asn Leu 1220 1225 1230 Thr Arg Asp Gln Leu Pro Asp Val Ile Pro Asp Tyr Ile Asp Val 1235 1240 1245 Asn Lys Thr Leu Asp Glu Ile Leu Ala Ser Leu Pro Asn Arg Thr 1250 1255 1260 Gly Pro Ser Leu Pro Leu Asp Val Phe Asn Ala Thr Tyr Leu Asn 1265 1270 1275 Leu Thr Gly Glu Ile Ala Asp Leu Glu Gln Arg Ser Glu Ser Leu 1280 1285 1290 Arg Asn Thr Thr Glu Glu Leu Gln Ser Leu Ile Tyr Asn Ile Asn 1295 1300 1305 Asn Thr Leu Val Asp Leu Glu Trp Leu Asn Arg Val Glu Thr Tyr 1310 1315 1320 Ile Lys Trp Pro Trp Trp Val Trp Leu Ile Ile Phe Ile Val Leu 1325 1330 1335 Ile Phe Val Val Ser Leu Leu Val Phe Cys Cys Ile Ser Thr Gly 1340 1345 1350 Cys Cys Gly Cys Cys Gly Cys Cys Cys Ala Cys Phe Ser Gly Cys 1355 1360 1365 Cys Arg Gly Pro Arg Leu Gln Pro Ala Glu Ala Phe Glu Lys Val 1370 1375 1380 Arg Val Gln 1385 <210> 18 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Probe sequence <400> 18 acagagcctg tgttggtgta tagtaacat 29 <210> 19 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Probe sequence <400> 19 tatagtgggt gttatttcta gtt 23 <210> 20 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primer sequences <400> 20 gccaatactg ccagatttac a 21 <210> twenty one <211> 170 <212> DNA <213> Artificial sequence <220> <223> ultramer sequences <400> twenty one tgatgatata gtgggtgtta tttctagttt gtctagctcc acttttaaca gtactaggga 60 gttgcctggt ttcttctacc attctaatga tggctctaat tgtacagagc ctgtgttggt 120 gtatagtaac ataggtgttt gtaaatctgg cagtattggc tatgtcccat 170

Claims

1. A canine distemper virus vector comprising a heterologous nucleotide sequence of interest, wherein the heterologous nucleotide sequence of interest encodes porcine epidemic diarrhea virus S protein, wherein the porcine epidemic diarrhea virus S protein consists of the amino acid sequence shown in SEQ ID NO: 15 or SEQ ID NO: 17; or wherein the heterologous nucleotide sequence of interest is an RNA sequence as shown in any one of SEQ ID NOs: 3 to 5; in - the heterologous nucleotide sequence of interest is located between the P gene and the M gene of canine distemper virus; and - The heterologous nucleotide sequence is operably linked to the gene start sequence and / or genomic promoter of canine distemper virus located in the 3' direction of the heterologous nucleotide sequence.

2. The canine distemper virus vector according to claim 1, comprising the RNA sequence shown in SEQ ID NO: 6 or SEQ ID NO:

7.

3. The canine distemper virus vector according to claim 1, comprising the RNA sequence shown in SEQ ID NO:

8.

4. The canine distemper virus vector according to claim 3, further comprising: - an RNA sequence comprising the RNA sequence shown in SEQ ID NO: 9, wherein the RNA sequence is flanked at the 5′ end of the RNA sequence shown in SEQ ID NO: 8, and / or - an RNA sequence comprising the RNA sequence of SEQ ID NO: 10, wherein the RNA sequence is flanked at the 3' end of the RNA sequence of SEQ ID NO:

8.

5. A DNA molecule, wherein the molecule comprises the DNA sequence shown in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO:

14.

6. A mammalian host cell comprising the canine distemper virus vector according to any one of claims 1 to 4 or the DNA molecule according to claim 5.

7. Use of a canine distemper virus vector according to any one of claims 1 to 4 or a DNA molecule according to claim 5 in the preparation of a vaccine for inducing an immune response against porcine epidemic diarrhea virus in pigs or vaccinating pigs to resist diseases associated with porcine epidemic diarrhea virus in pigs and / or to reduce the incidence or severity of one or more clinical signs associated with porcine epidemic diarrhea virus or caused by porcine epidemic diarrhea virus.

8. A DNA construct comprising the DNA molecule according to claim 5.

9. A method for preparing a canine distemper virus vector according to any one of claims 1 to 4, wherein the method comprises the following steps: a. Providing a host cell expressing a heterologous RNA polymerase; b. transfecting the host cell with a DNA construct as claimed in claim 8, wherein the DNA molecule is transcribed by the heterologous RNA polymerase, and c. Isolating the virus produced by the cells.

10. An immunogenic composition comprising: The canine distemper virus vector according to any one of claims 1 to 4, wherein the vector is an attenuated and / or modified live virus.

11. An immunogenic composition comprising: A recombinant protein expressed by the canine distemper virus vector according to any one of claims 1 to 4.

12. The immunogenic composition of claim 10 or 11, further comprising: A pharmaceutically or veterinarily acceptable carrier or excipient.

13. A method for preparing an immunogenic composition or vaccine for reducing the incidence or severity of one or more clinical signs associated with or caused by an infection, the method comprising the steps of: a. infecting a mammalian host cell with a canine distemper virus vector as claimed in any one of claims 1 to 4, b. Cultivate infected cells under appropriate conditions, c. Harvest the infected cell culture.

14. The method of claim 13, further comprising the steps of: d. Purify the infected cell culture collected in step c).

15. The method of claim 14, further comprising the steps of: e. mixing the collected infected cell culture with a pharmaceutically acceptable carrier.

16. A kit for inducing an immune response against porcine epidemic diarrhea virus in pigs or vaccinating pigs to resist porcine epidemic diarrhea virus-associated disease in pigs and / or to reduce the incidence or severity of one or more clinical signs associated with or caused by porcine epidemic diarrhea virus, comprising: a) a syringe or dispenser capable of administering the vaccine to said pig; and b) The immunogenic composition according to any one of claims 10 to 12 or the immunogenic composition prepared by the method according to any one of claims 13 to 15.

17. The kit of claim 16, further comprising: c) Instruction manual.

Citation Information

Patent Citations

  • Polypeptides derived from the envelope gene of human immunodeficiency virus in recombinant baculovirus infected insect cells

    EP0265785A2

  • Acrylic acid polymer laxative compositions

    US2909462A

  • Brandt

    US382425A

  • Method of inserting DNA into living cells

    US4394448A

  • Modified vaccinia virus

    US4603112A