Compositions and methods for improving library enrichment

Abstract

The present disclosure describes hybridization buffers including crowding agents, methods including use of the hybridization buffers, and kits including the hybridization buffers. The present disclosure also describes blocking agents for use in hybridization capture methods, methods using the blocking agents, and kits including the blocking agents. Additionally, the present disclosure describes methods of hybridization capture that do not include amplifying library members using PCR prior to sequencing the library members.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 62 / 764,753, filed on August 15, 2018, the entire contents of which are incorporated herein by reference. Summary of the invention

[0003] Although the throughput of next-generation sequencing (NGS) is rapidly increasing, classical library preparation and enrichment methods are still time consuming and may lead to throughput-limiting bottlenecks. The present disclosure describes compositions comprising blockers and / or hybridization buffers, methods of using these compositions, and methods of improving nucleic acid selection efficiency before sequencing.

[0004] In one aspect, the disclosure describes a hybridization buffer comprising human Cot-1 DNA, a destabilizing agent, at least one of a salt and a blocking agent, and a crowding agent.

[0005] In another aspect, the disclosure describes methods comprising the use of a hybridization buffer. The disclosure also describes kits comprising a hybridization buffer.

[0006] In another aspect, the disclosure describes a blocker comprising an oligonucleotide, wherein the blocker is capable of binding to an adaptor. The adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI). The region of the blocker capable of binding to the index region and / or the UMI of the adaptor comprises: at least three thymine bases or universal bases and at least one non-universal base.

[0007] In yet another aspect, the disclosure describes a blocker comprising two unligated oligonucleotides. The blocker is capable of binding to at least a portion of an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI). The unligated oligonucleotide comprises a base that does not correspond to the index region and / or the UMI of the adaptor.

[0008] The disclosure also describes methods comprising use of the blocking agents described herein and kits comprising the blocking agents described herein.

[0009] In another aspect, the disclosure describes a method comprising contacting a library with a blocking agent in the presence of a hybridization buffer; and contacting the library with a probe, wherein the probe hybridizes to a region of interest within a member of the library. The method does not include amplifying the library members using PCR prior to sequencing the library members.

[0010] As used herein, the term "nucleic acid" is intended to be consistent with its use in the art, and includes naturally occurring circular nucleic acids or functional analogs thereof. Particularly useful functional analogs can hybridize with nucleic acids in a sequence-specific manner, or can be used as templates for replication of specific nucleotide sequences. Naturally occurring nucleic acids generally have a backbone containing a phosphodiester bond. Analog structures can have alternative backbone connections, including various backbone connections known in the art. Naturally occurring nucleic acids generally have deoxyribose (e.g., found in deoxyribonucleic acid (DNA)) or ribose (e.g., found in ribonucleic acid (RNA)). Nucleic acids can contain any of a variety of analogs of these sugar moieties known in the art. Nucleic acids can include natural or non-natural bases. In this regard, natural deoxyribonucleic acids can have one or more bases selected from the group consisting of adenine, thymine, cytosine or guanine, and ribonucleic acids can have one or more bases selected from the group consisting of uracil, adenine, cytosine or guanine. Useful non-natural bases that can be included in nucleic acids are known in the art. The term "target" when applied to nucleic acids is intended in the context of the methods or compositions described herein as a semantic identifier for the nucleic acid and does not necessarily limit the structure or function of the nucleic acid unless otherwise expressly indicated.

[0011] As used herein, the term “ m ” refers to the temperature at which half of the DNA strands in the sample are in a double helix state and half of the DNA strands in the sample are in a random coil state.

[0012] As used herein, the term "adapter" and its derivatives (e.g., universal adaptors, non-target adaptors, etc.) generally refer to any linear, single-stranded oligonucleotide that can be connected (ligated) to the nucleic acid molecules of the present disclosure. In some embodiments, the adaptor is substantially non-complementary to the 3' end or 5' end of any target sequence present in the sample. In some embodiments, the length of a suitable adaptor is 10-100 nucleotides, 12-60 nucleotides, and 15-50 nucleotides. Typically, the adaptor may include any combination of nucleotides and / or nucleic acids. In some aspects, the adaptor may include one or more cleavable groups at one or more positions. On the other hand, the adaptor may include a sequence that is substantially identical or substantially complementary to at least a portion of a primer (e.g., a universal primer). In some embodiments, the adaptor may include an index or tag to assist downstream error correction, identification, or sequencing.

[0013] As used herein, the term "universal sequence" refers to a sequence region shared by two or more nucleic acid molecules (e.g., adapter-target adapter molecules), wherein the molecules also have sequence regions that are different from each other. Universal sequences present in different members of a molecular set can allow the use of a population of universal capture nucleic acids complementary to a portion of the universal sequence (e.g., a universal extension primer binding site) to capture multiple different nucleic acids. Non-limiting examples of universal extension primer binding sites include sequences identical or complementary to P5 and P7 primers. Similarly, universal sequences present in different members of a molecular set can allow the use of a population of universal primers complementary to a portion of the universal sequence (e.g., a universal primer binding site) to replicate or amplify multiple different nucleic acids. Therefore, universal capture nucleic acids or universal primers include sequences that can specifically hybridize with universal sequences. As described herein, target nucleic acid molecules can be modified to, for example, connect universal adapters at one or both ends of different target sequences.

[0014] When referring to amplification primers such as universal primer extension primers, the terms "P5" and "P7" may be used. The terms "P5'" (P5prime) and "P7'" (P7prime) refer to the complementary sequences of P5 and P7, respectively. It should be understood that any suitable amplification primer can be used in the method proposed herein, and the use of P5 and P7 is only an exemplary embodiment. The use of amplification primers such as P5 and P7 on a flow cell is known in the art, as exemplified in the disclosures of WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO2015 / 106941, WO 1998 / 044151, and WO 2000 / 018957. For example, any suitable forward amplification primer, whether fixed or in solution, can be used in the method proposed herein to hybridize with a complementary sequence and amplify the sequence. Similarly, any suitable reverse amplification primer, whether immobilized or in solution, can be used in the methods proposed herein to hybridize with complementary sequences and amplify sequences. Those skilled in the art will understand how to design and use primer sequences suitable for capturing and amplifying nucleic acids described herein.

[0015] As used herein, "amplify", "amplifying" or "amplification reaction" and their derivatives generally refer to any action or process in which at least a portion of a nucleic acid molecule is replicated or copied into at least one additional nucleic acid molecule. The additional nucleic acid molecule optionally includes a sequence that is substantially identical or substantially complementary to at least some portion of the template nucleic acid molecule. The template nucleic acid molecule can be single-stranded or double-stranded, and the additional nucleic acid molecules can independently be single-stranded or double-stranded. Amplification optionally includes linear or exponential replication of the nucleic acid molecule. In some embodiments, such amplification can be performed using isothermal conditions; in other embodiments, such amplification can include thermal cycling. In some embodiments, amplification is a multiplex amplification, which includes simultaneously amplifying multiple target sequences in a single amplification reaction. In some embodiments, "amplification" includes amplifying at least some portions of DNA- and RNA-based nucleic acids, either individually or in combination. The amplification reaction may include any amplification method known to those of ordinary skill in the art. In some embodiments, the amplification reaction includes a polymerase chain reaction (PCR).

[0016] As used herein, "amplification conditions" and its derivatives generally refer to conditions suitable for amplifying one or more nucleic acid sequences. Such amplification can be linear or exponential. In some embodiments, the amplification conditions may include isothermal conditions or may alternatively include thermal cycling conditions, or a combination of isothermal and thermal cycling conditions. In some embodiments, conditions suitable for amplifying one or more nucleic acid sequences include polymerase chain reaction (PCR) conditions. Generally, amplification conditions refer to a reaction mixture sufficient to amplify nucleic acids (e.g., one or more target sequences), or to amplify amplified target sequences connected to one or more adapters (e.g., amplified target sequences connected to adapters). Generally, amplification conditions include a catalyst for amplification or for nucleic acid synthesis, such as a polymerase; a primer having a certain degree of complementarity with the nucleic acid to be amplified; and nucleotides, such as deoxyribonucleotide triphosphates (dNTPs), once hybridized with the nucleic acid, for promoting the extension of the primer. Amplification conditions may require hybridization or annealing of primers to nucleic acids, primer extension, and denaturation steps, in which the extended primers are separated from the nucleic acid sequences being amplified. Generally, but not necessarily, amplification conditions may include thermal cycling; in some embodiments, amplification conditions include multiple cycles in which annealing, extension, and separation steps are repeated. Typically, amplification conditions include cations (such as Mg 2+ or Mn 2+ ), and may also include various ionic strength modifiers.

[0017] As used herein, the term "polymerase chain reaction" ("PCR") refers to methods such as those described in U.S. Pat. Nos. 4,683,195 and 4,683,202, which describe a method for increasing the concentration of polynucleotide fragments of interest in a genomic DNA mixture without cloning or purification. The method for amplifying polynucleotides of interest consists of introducing a large excess of two oligonucleotide primers into a DNA mixture containing the desired polynucleotide of interest, and then performing a series of thermal cycles in the presence of a DNA polymerase. The two primers are complementary to the chains of their respective double-stranded polynucleotides of interest. The mixture is first denatured at a higher temperature, and then the primers are annealed to the complementary sequences within the polynucleotide molecule of interest. After annealing, the primers are extended with a polymerase to form a pair of new complementary chains. The steps of denaturation, primer annealing, and polymerase extension can be repeated multiple times (referred to as thermal cycles) to obtain a high concentration of amplified fragments of the desired polynucleotide of interest. The length of the amplified fragment (amplicon) of the desired polynucleotide of interest is determined by the relative position of the primers relative to each other, and therefore, the length is a controllable parameter. By repeating this process, the method is referred to as "polymerase chain reaction" (hereinafter referred to as "PCR"). Because the desired amplified segments of the polynucleotide of interest become the predominant nucleic acid sequences (in terms of concentration) in the mixture, they are referred to as "PCR amplified." In a refinement of the methods discussed above, multiple different primer pairs can be used to PCR amplify target nucleic acid molecules, in some cases one or more primer pairs per target nucleic acid molecule of interest, thereby forming a multiplex PCR reaction.

[0018] As defined herein, "multiplex amplification" refers to the simultaneous amplification of two or more target sequences in a sample. In some embodiments, multiplex amplification is performed so that some or all of the target sequences are amplified in a single reaction vessel. The "multiplexity" or "plex" of a given multiplex amplification generally refers to the number of different target-specific sequences amplified during the single multiplex amplification. The amplified target sequences can also be detected by several different methods (e.g., gel electrophoresis, followed by optical density determination, quantification with a bioanalyzer or quantitative PCR, hybridization with a labeled probe; incorporation of biotinylated primers, followed by avidin-enzyme conjugate detection; incorporation of 32P-labeled deoxynucleotide triphosphates into the amplified target sequence).

[0019] As used herein, the term "primer" and its derivatives generally refer to any polynucleotide that can hybridize with a target sequence of interest. Typically, a primer is a substrate on which a nucleotide can be polymerized by a polymerase; however, in some embodiments, a primer can be incorporated into a synthetic nucleic acid chain and provide a site to which another primer can hybridize to initiate the synthesis of a new chain complementary to the synthetic nucleic acid molecule. A primer can be composed of any combination of nucleotides or their analogs. In some embodiments, a primer is a single-stranded oligonucleotide or a polynucleotide. The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein and refer to a polymeric form of nucleotides of any length, and may include ribonucleotides, deoxyribonucleotides, their analogs, or mixtures thereof. The term should be understood to include analogs of DNA or RNA made from nucleotide analogs as equivalents, and is applicable to single-stranded (e.g., sense or antisense) and double-stranded polynucleotides. The term used herein also encompasses cDNA, which is a complementary or copy DNA produced by an RNA template, for example, by the action of a reverse transcriptase. The term refers only to the primary structure of the molecule. Thus, the term includes triple-, double-, and single-stranded deoxyribonucleic acid ("DNA"), and triple-, double-, and single-stranded ribonucleic acid ("RNA").

[0020] As used herein, the terms "ligating," "ligation," and their derivatives generally refer to the process of covalently linking two or more molecules together, such as covalently linking two or more nucleic acid molecules to each other. In some embodiments, the connection includes nicks between adjacent nucleotides of the connecting nucleic acids. In some embodiments, the connection includes forming a covalent bond between the end of a first nucleic acid molecule and the end of a second nucleic acid molecule. In some embodiments, the connection may include forming a covalent bond between a 5' phosphate group of a nucleic acid and a 3' hydroxyl of a second nucleic acid, thereby forming a connected nucleic acid molecule. In some embodiments, a target sequence can be connected to an adapter to produce an adapter-target sequence. The skilled person will recognize that a ligation reaction does not result in the connection of all molecules present in the reaction.

[0021] As used herein, "ligase" and its derivatives generally refer to any reagent capable of catalyzing the connection of two substrate molecules. In some embodiments, ligases include enzymes capable of catalyzing the nick connection between adjacent nucleotides of a nucleic acid. In some embodiments, ligases include enzymes capable of catalyzing the formation of a covalent bond between a 5' phosphate of one nucleic acid molecule and a 3' hydroxyl of another nucleic acid molecule to form a connected nucleic acid molecule. Suitable ligases may include, but are not limited to, T4 DNA ligase, T4 RNA ligase, thermostable T4 DNA ligase, and E. coli DNA ligase.

[0022] As used herein, the term "flow cell" refers to a chamber comprising a solid surface through which one or more fluid reagents can flow. Examples of flow cells and associated fluid systems and detection platforms that can be readily used in the methods of the present disclosure are described in, for example, Bentley et al., Nature [Natural] 456: 53-59 (2008); WO 04 / 018497; WO 91 / 06678; WO 07 / 123744; U.S. Patent No. 7,057,026; U.S. Patent No. 7,211,414; U.S. Patent No. 7,315,019; U.S. Patent No. 7,329,492; U.S. Patent No. 7,405,281; and U.S. Patent Publication No. 2008 / 0108082.

[0023] As used herein, the term "library" refers to a collection of members. In one embodiment, the library includes a collection of nucleic acid members, such as a collection of whole genomes, subgenomic fragments, cDNAs, cDNA fragments, RNAs, RNA fragments, or a combination thereof. In some embodiments, some or all of the library members include non-target adapter sequences. The adapter sequence can be located at one end or both ends. The adapter sequence can be used, for example, for sequencing methods (e.g., NGS methods), for amplification, for reverse transcription, or for cloning into a vector.

[0024] As used herein, "member" or "library member" or other similar terms refer to a nucleic acid molecule, such as DNA, RNA, or a combination thereof, that is a member of a library. Typically, a member is a DNA molecule, such as genomic DNA or cDNA. A member can be fragmented, such as sheared or enzymatically prepared genomic DNA. Members include sequences from the subject, and may also include sequences that are not derived from the subject, such as non-target sequences, such as adapter sequences, primer sequences, and / or other sequences that allow identification, such as indexes.

[0025] As used herein, "index" (also referred to as "index region" or "index adapter") refers to a nucleic acid tag that can be used to identify a sample or source of a nucleic acid material. When a nucleic acid sample is derived from a plurality of sources, the nucleic acid in each nucleic acid sample can be labeled with different nucleic acid tags so that the source of the sample can be identified. Any suitable index or set of indexes can be used, as known in the art and as illustrated by the disclosures of U.S. Patent No. 8,053,192, PCT Publication No. WO 05 / 068656 and U.S. Patent Publication No. 2013 / 0274117. In certain embodiments, the index may include a six-base index 1 (i7) sequence, an eight-base index 1 (i7) sequence, an eight-base index 2 (i5) sequence, a ten-base index 1 (i7) sequence, or a ten-base index 2 (i5) sequence from Illumina, Inc. (Illumina, San Diego, California).

[0026] As used herein, the term "unique molecular identifier" or "UMI" or "barcode" refers to a molecular tag that can be attached to a nucleic acid molecule. When incorporated into a nucleic acid molecule, a UMI can correct for subsequent amplification bias by directly counting unique molecular identifiers (UMIs) sequenced after amplification.

[0027] As used herein, the term "tagmentation" refers to the modification of DNA by a transposome complex comprising a transposase complexed with an adapter comprising a double-stranded recognition sequence (hybridized transposon end sequence). Tag fragmentation causes the fragmentation of DNA and the connection of the adapter to the 5' ends of the two chains of the duplex fragment to occur simultaneously. After purification to remove the transposase, gap filling and connection, a complete double-stranded product is obtained. Additional sequences can be added to the ends of the connected fragments, for example, by PCR, connection or any other suitable method known to those skilled in the art. See, for example, U.S. Patent Publication No. 2017 / 0044525.

[0028] The term "and / or" refers to one or more of the listed elements or a combination of any two or more of the listed elements.

[0029] The words "preferred" and "preferably" refer to embodiments of the present invention that may provide certain benefits in certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. In addition, the recitation of one or more preferred embodiments does not mean that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the present invention.

[0030] The terms "comprises" and variations thereof do not have a limiting meaning where these terms appear in the description and claims.

[0031] It should be understood that anywhere an embodiment is described herein using the language "include," "includes," or "including," other similar embodiments described using "consisting of" and / or "consisting essentially of" are also provided. The term "consisting of" is limited to whatever follows the phrase "consisting of." That is, "consisting of" means that the listed elements are required or mandatory, and other elements may not be present. The term "consisting essentially of" means including any elements listed after the phrase, and may include other elements in addition to those listed elements, provided that those other elements do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements.

[0032] Unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one.

[0033] As used herein, the term "each," when used to refer to a collection of items, is intended to identify a single item in the collection, but not necessarily every item in the collection unless the context clearly indicates otherwise.

[0034] The recitation of numerical ranges by endpoints includes all numbers subsumed within that range (eg, 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0035] For any method disclosed herein comprising discrete steps, the steps may be performed in any practicable order. Also, any combination of two or more steps may be performed simultaneously, where appropriate.

[0036] The above summary of the present invention is not intended to describe each disclosed embodiment or each implementation of the present invention. The following description more specifically illustrates exemplary embodiments. In many places throughout the application, guidance is provided by lists of examples, which can be used in various combinations. In each case, the enumerated lists are used only as representative groups and should not be interpreted as exclusive lists.

[0037] References throughout this specification to "one embodiment," "an embodiment," "certain embodiments," or "some embodiments," etc., mean that a particular feature, configuration, composition, or characteristic described in connection with that embodiment is included in at least one embodiment of the present disclosure. Thus, the appearances of these phrases in various places throughout this specification are not necessarily referring to the same embodiment of the present disclosure. Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.

[0038] Unless otherwise indicated, all numerical values ​​used in the specification and claims to indicate the amount of components, molecular weight, etc. should be understood as being modified by the term "about" in all cases. Therefore, unless otherwise indicated to the contrary, the numerical parameters listed in the specification and claims are approximate values, which may vary depending on the desired properties sought to be obtained by the present invention. At least, without attempting to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be interpreted in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0039] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading unless otherwise indicated.

[0040] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values ​​set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain ranges necessarily resulting from the standard deviation found in their respective testing measurements. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1A-1B is a schematic diagram showing an exemplary embodiment of hybridization capture during enrichment and comparative off-target capture. Figure 1A The probe includes a region designed to hybridize to a region of interest within the target genome and a ligand (e.g., a biotin group) that allows for subsequent capture of the probe. Once hybridization is complete and a DNA template-probe hybrid is formed, a capture device (i.e., a component with affinity for the probe, including, for example, streptavidin-coated magnetic beads) is used to bind the probe hybridized to the DNA target and remove the target from the oligonucleotide pool. Figure 1B Unwanted or off-target oligonucleotides can be recovered during hybridization capture due to interactions between terminal adapter sequences in the target sequence and terminal adapter sequences in off-target library preparation products.

[0042] Figure 2 An exemplary mechanism by which a blocker prevents hybridization of adaptor sequences and prevents off-target capture is shown.

[0043] Figure 3A-Figure 3I Schematic representation of exemplary blocking agents is shown. Figure 3A. Schematic representation of Nextera blockers with bases complementary to the 8- or 10-base index region of the adaptor. Figure 3B . Schematic representation of Nextera blockers modified with 8 or 10 deoxyinosine bases in the region of the blocker corresponding to the index region of the adaptor. Figure 3C . Schematic representation of TruSeq blockers modified with 6, 8, or 10 deoxyinosine bases in the region of the blocker corresponding to the index region of the adaptor. Figure 3D . Graphical representation of Nextera and TruSeq blockers with 6 or 8 thymines in the region of the blocker corresponding to the index region of the adaptor. Figure 3E . Schematic representation of a split Nextera blocker that includes a component corresponding to the region 5' to the 8- or 10-base index region and a component corresponding to the region 3' to the index region. These constructs do not include any bases corresponding to the index region of the adaptor (indicated by the 8- or 10-base gap corresponding to the index region). Figure 3F . Illustration of a split TruSeq blocker that includes a component corresponding to the region 5' to the 8- or 10-base index region and a component corresponding to the region 3' to the index region. These constructs do not include any bases corresponding to the index region of the adaptor (indicated by the 8- or 10-base gap corresponding to the index region). Figure 3G . Illustration of the Nextera blocker corresponding to only a portion of the region 3' to the index region of the adaptor. Figure 3H . Illustration of a TruSeq blocker that pairs only with a portion of the region 3' to the index region of an adaptor. Fig. 3I . Illustration of a Nextera or TruSeq blocker corresponding to only a portion of the region 5' to the index region of an adaptor (eg, a p5 or p7 sequence).

[0044] Figure 4 is a graph of the fill-in read enrichment results (a measure of the amount of captured on-target DNA) obtained using the blocking reagent described in Example 2.

[0045] Figure 5 A representation of a blocker comprising a modified G (+G) or a random (A, T, G, or C) (N) nucleotide at the fifth position of the portion of the blocker sequence corresponding to the index sequence, as described in Example 3 is shown.

[0046] Figure 6A-6B Blocker constructs and results described in Example 4 are shown. Fig. 6ASchematic representations of various blocker constructs are shown, including (1) a pair of split blockers having a first sequence complementary to the 5' 25-30-mer region of the index region and a second sequence complementary to the 3' 34-35-mer region of the index region, (2) a blocker that pairs only with the 3' portion of the adaptor ("inner" blocker), (3) a blocker that pairs only with the 5' portion of the adaptor ("outer" blocker), and (4) a short (8 nucleotides) blocker corresponding to the index region ("short 8nt"). Figure 6B Shown are fill-in read enrichment results obtained using xGen blocking oligonucleotides (Integrated DNA Technologies, Coralville, IA), split blockers, or blockers that bind to only a portion of the adaptor.

[0047] Figure 7A-7F Results are shown for use of an enhanced hybridization buffer including dextran sulfate, as described in Example 5. Fig. 7A Shown are the enrichment results for fill-in reads obtained using different concentrations of dextran sulfate in the hybridization buffer. Figure 7B Shown are fill-in read enrichment results obtained using a 100 μL hybridization volume with four different probe sets and three different buffer conditions (IDT hybridization buffer, Illumina non-enhanced hybridization buffer, and Illumina enhanced hybridization buffer). Figure 7C The enrichment of fill-in reads and uniformity of coverage for all four probe sets at different hybridization incubation times and with and without an additional temperature ramp step are shown. The black dashed line in the left panel indicates the results of hybridization in buffer without dextran sulfate. Three sets of sequencing results are shown, including NovaSeq ( Fig.7D )、NextSeq( Fig. 7E ) and iSeq( Figure 7F ) (percent reads identified (PF) for NovaSeq and NextSeq, percent indexed (%) for iSeq) and the associated coefficient of variation (CV) when run using dextran sulfate hybridization buffer and 30 μL library volume.

[0048] Figure 8A-8C The results of the hybridization assay described in Example 6 are shown. Fig. 8A Shown are fill-in read enrichment results when modified blocking agents, increased wash temperatures, and / or crowding agents (dextran sulfate) were used in the hybridization buffer. Figure 8BShown are fill-in read enrichment results obtained using the method described in Example 6 for nine probe sets using enhanced hybridization buffer with xGEN blocker compared to the IDT Exome Panel results using the IDT xGen Lockdown Kit protocol. Figure 8C Shown is the detection of somatic variants by a single-hybrid enrichment protocol using a 12-gene, 535-probe set to enrich a library generated with the Horizon Discover HD701 quantitative multiplex (QM) DNA standard.

[0049] Figure 9A-9D A schematic diagram of an exemplary workflow is shown. eBBN denotes bead-based tag fragmentation using bead-bound transposome complexes; H denotes hybridization; C denotes capture; W denotes wash; E denotes elution; PCR denotes PCR amplification; S denotes sequencing; Q denotes quantification; SpVac denotes rapid vacuum concentration. Fig.9A A schematic diagram of an exemplary workflow for hybridization capture is shown, showing library preparation using a bead-based tag fragmentation protocol; any suitable library preparation method can be used prior to enrichment. Of note, only one round of hybridization and capture is included. Fig. 9B A schematic diagram of an exemplary workflow for hybridization capture is shown. Fig. 9C A schematic diagram of an exemplary workflow for PCR-free hybridization capture is shown. Fig.9D A schematic diagram of an exemplary workflow for PCR-free hybridization capture with shortened hybridization times is shown.

[0050] Fig.10 Shown are fill-in read enrichment results obtained using BN001 and BN002 (unmodified blockers); BX003 and BX007 (G-clamp modified blockers); BN007 and BN008 (blockers modified with BNA and deoxyinosine); BN005 and BN006 (BNA and modified sequence-specific blockers); or BN023, BN024, BN025 and BN026 (split blockers modified with LNA), as described in Example 8.

[0051] Fig.11 Shown are the enrichment results for filled reads obtained using BN001 and BN002 (unmodified blockers) or BN023, BN024, BN025 and BN026 (LNA-modified split blockers) when the corresponding adapters contained an 8-nucleotide index or a 10-nucleotide index, as described in Example 9. DETAILED DESCRIPTION

[0052] The present disclosure describes compositions including blocking agents and / or hybridization buffers, and methods for improving nucleic acid selection efficiency prior to sequencing, including methods using these compositions and methods including hybridization capture.

[0053] Hybridization capture enrichment

[0054] A variety of methods can be used to enrich the desired sequence from a complex nucleic acid pool. These methods include polymerase chain reaction (PCR), molecular inversion probe (MIP) or sequence capture by hybridization formation ("hybridization capture"). See, for example, Mamanova et al., Nat. Methods [Natural Methods] 7: 111-118 (2010)); U.S. Patent Publication No. 2014 / 0031240; and U.S. Patent Publication No. 2017 / 0114404.

[0055] Next-generation sequencing (NGS) applications often use enrichment hybridization capture methods. A prepared pool of NGS templates (library) is heat denatured and mixed with a pool of capture probe oligonucleotides ("probes"). The probes are designed to hybridize to regions of interest within the target genome, are typically 60 to 200 bases in length, and are further modified to contain ligands that allow for subsequent capture of bound probes. A common capture method is to incorporate a biotin group (or groups) on the probes. Once hybridization to form a DNA template-probe hybrid is complete, capture is performed using components that have affinity only for the probes, such as Figure 1A As shown in one embodiment of the present invention. For example, streptavidin-coated magnetic beads can be used to bind the biotin portion of a biotinylated probe hybridized to a desired DNA target from a library. Washing removes unbound nucleic acids, reducing the complexity of the retained material. The retained material is then eluted from the magnetic beads and introduced into an automated sequencing process.

[0056] Although hybridization of DNA to the probe may be very specific, unwanted sequences remain in the enriched pool after the hybrid capture method is completed. The largest portion of these unwanted sequences are present due to undesired hybridization events between library members that do not have complementarity with the probe and library members that have complementarity with the probe (i.e., on-target library members). In the hybrid capture method, two types of sequences can lead to undesired hybridization: (1) highly repetitive DNA elements found in endogenous genomic DNA; and (2) terminal adapter sequences engineered into each library member.

[0057] Repeated endogenous DNA elements (such as Alu sequences or long interspersed nuclear elements (LINE) sequences) present in a DNA fragment in a complex pool can hybridize with another similar element present in another unrelated DNA fragment. These fragments that may originally originate from very different positions in the genome are connected during the hybridization process of the hybridization capture method. If one of these DNA fragments represents the desired fragment containing the binding site of the probe, the unwanted fragment will be captured together with the desired fragment. Such off-target library members can be reduced by adding excessive repetitive elements to the hybridization buffer of the hybridization reaction. Most commonly, human Cot-1 DNA (which binds Alu, LINE and other repetitive sites in the target and the ability to interact with each other based on this closed NGS template) is added to the hybridization buffer.

[0058] Due to the interaction between the terminal adapter sequences in each library member, off-target (also called non-target) library members can also be captured. Typically, library members include sequence fragments from a gene of interest, such as fragments used for sequencing. If a member is on target, the sequence from the gene of interest forms a duplex with the capture probe. The on-target sequence may include, for example, exons or introns (or fragments thereof), coding regions or non-coding regions, enhancers, untranslated regions, specific SNPs, etc. Typically, library members also include one or more non-target sequences. These non-target sequences typically do not include the target sequence of interest, but include, for example, adapters. Because the library member pool typically contains at least some of the same terminal adapter sequences, the adapter sequences are present in the hybridization solution at very high effective concentrations. Therefore, library members containing off-target sequences can anneal to the captured target sequence through portions of their attached adapter sequences, resulting in the off-target sequences being captured together with the on-target library members (e.g., by a series connection or "daisy chain" of sequences connected together), such as Figure 1B As shown in one embodiment of . Because the annealed target sequence includes the binding site of the probe, the entire daisy chain can be captured. In this way, the capture of a single desired fragment will bring a large number of undesirable fragments, thereby reducing the overall efficiency of enrichment of the desired fragment.

[0059] In some aspects, the disclosure describes methods and compositions for minimizing the selection of off-target nucleic acids by hybridization capture.

[0060] Blocker Oligonucleotide

[0061] In one aspect, the disclosure describes "blocker oligonucleotides" (also referred to herein as "blockers") and methods for preventing selection of off-target nucleic acids during hybridization capture by using a blocker to bind to (e.g., form a duplex with) at least a portion of an adaptor sequence. Figure 2 As shown in one embodiment of , when used, the binding of the blocking agent to the adapter sequence prevents interactions (including, for example, the formation of chain-like chains) between adapter sequences in off-target library preparation products, which interactions can lead to the recovery of unwanted library members during hybridization capture.

[0062] In some embodiments, at least two blocking agents can be used, wherein a first blocking agent binds to a first adapter sequence (e.g., forms a duplex with the first adapter sequence) and a second blocking agent binds to a second adapter sequence (e.g., forms a duplex with the second adapter sequence). In some embodiments, the first adapter sequence can be at the 5' end of the library member and the second adapter sequence can be at the 3' end of the library member. In some embodiments, a plurality of different blocking agents can be used.

[0063] In some embodiments, the blocking oligonucleotide forms a duplex with the adaptor sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100, or at least 200 library members, and the T of the resulting duplex is m is higher than the T of the duplex formed by the adaptor sequence and the background nucleic acid including, for example, the complement of the adaptor sequence. m .

[0064] In some embodiments, the blocker-adaptor complex exhibits a greater T than the adaptor-adaptor complex. m This increase in T m This means that the blocker-adaptor complex is more likely to form before the adaptor-adaptor complex, which can prevent off-target capture (e.g., by preventing the formation of daisy chains). In some embodiments, the T of the blocker-adaptor oligonucleotide duplex is m T than the T of the adapter duplex with its fully complementary sequence m In some embodiments, the T of the blocker-adapter oligonucleotide duplex is at least 1.5°C, at least 2°C, at least 3°C, at least 4°C, at least 5°C, at least 10°C, at least 15°C, at least 20°C, or at least 25°C higher. m T than the T of the adapter duplex with its fully complementary sequence m High by up to 2°C, up to 3°C, up to 4°C, up to 5°C, up to 10°C, up to 15°C, up to 20°C, up to 25°C or up to 30°C.

[0065] In some embodiments, the association rate of the blocking oligonucleotide with the adapter sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100, or at least 200 library members is greater than the association rate of the adapter sequence with background nucleic acids, including, for example, the complement of the adapter sequence. In some embodiments, the association rate is at least 2 times higher, at least 4 times higher, at least 6 times higher, at least 8 times higher, or at least 10 times higher. In some embodiments, the association rate is up to 4 times higher, up to 6 times higher, up to 8 times higher, up to 10 times higher, or up to 12 times higher.

[0066] In some embodiments, the dissociation rate of the blocking oligonucleotide from the adapter sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100, or at least 200 library members is lower than the dissociation rate of the adapter sequence from background nucleic acids, including, for example, the complement of the adapter sequence. In some embodiments, the dissociation rate is at least 2-fold lower, at least 4-fold lower, at least 6-fold lower, at least 8-fold lower, or at least 10-fold lower. In some embodiments, the dissociation rate is up to 4-fold lower, up to 6-fold lower, up to 8-fold lower, up to 10-fold lower, or up to 12-fold lower.

[0067] In some embodiments, the duplex formed between the blocking oligonucleotide and the adapter sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100, or at least 200 library members is longer than the duplex formed between the adapter sequence and its complement (including, for example, between the Watson and Crick strands of a double-stranded adapter). In some embodiments, the duplex between the blocking oligonucleotide and the adapter sequence is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 nucleotides longer than the duplex formed between the adapter sequence and its complement.

[0068] In some embodiments, the blocking agent preferably includes a modification that increases the T of the blocking agent relative to an oligonucleotide having the same sequence as the blocking agent that does not include the modification. m For example, in some embodiments, the blocking agent may be "T m An "enhanced oligonucleotide" is an oligonucleotide comprising at least one modified group, which provides an increased thermal melting temperature value for a double-stranded nucleic acid comprising the oligonucleotide as a hybridization partner relative to a double-stranded nucleic acid comprising an oligonucleotide having the same nucleobase composition and an unmodified group as a hybridization partner. "Tm Enhanced oligonucleotides" are further described in U.S. Patent Publication No. 2014 / 0031240.

[0069] In some embodiments, the blocking agent comprises one or more non-naturally occurring nucleotides. In some embodiments, the value of a parameter associated with a binding interaction (e.g., affinity, association rate, inverse of dissociation rate, or T) of a duplex formed between a blocking oligonucleotide having a non-naturally occurring nucleotide and an adaptor sequence of at least 1, at least 2, at least 5, at least 10, at least 20, at least 50, at least 100, or at least 200 library members. m ) is higher than the value for non-target nucleic acid sequences and background nucleic acids, such as other complementary non-target nucleic acid sequences.

[0070] In some embodiments, the blocking agent includes a modified base. Any suitable modified base may be included in the blocking agent. In some embodiments, the modification preferably includes an enhancement of T m , i.e., relative to the T of a blocker-adapter complex having the same sequence but not including the modified base. m , increasing the T of the blocker-adapter complex including the modified base m This enhancement of T mModifications of can include, for example, DNA or RNA oligonucleotides modified to capture low GC regions; cross-linked oligonucleotides; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridged nucleic acid (bridged nucleic acid, also known as bicyclic nucleic acid or BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5 modified pyrimidine base; propynyl pyrimidine; morpholino; phosphoramidite; 5'-pyrene cap, etc. In some embodiments, LNA includes a ribose portion of a nucleotide modified with an additional bridge connecting the 2' oxygen and the 4' carbon. Exemplary BNAs are disclosed in, e.g., U.S. Pat. No. 7,399,845, U.S. Pat. No. 7,427,672, U.S. Pat. No. 7,547,684, U.S. Pat. No. 7,696,345, U.S. Pat. No. 7,741,457, U.S. Pat. No. 8,022,193, U.S. Pat. No. 8,268,980, U.S. Pat. No. 8,278,425, U.S. Pat. No. 8,278,426, U.S. Pat. No. 8,846,637, U.S. Pat. No. 8,846,639, and U.S. Pat. No. 9,546,368. In some embodiments, BNAs may include constrained ethylnucleic acid from Ionis Pharmaceuticals (Carlsbad, Calif.) or 2'-0,4'-aminoethylene bridged nucleic acid from Biosynthesis, Inc. (Lewisville, Texas). In some embodiments, PNAs include repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In some embodiments, tricyclic nucleic acids include, for example, tricyclic nucleic acids disclosed in U.S. Pat. No. 9,221,864.Exemplary phosphoramidites include 1-[5'-O-(4,4'-dimethoxytrityl)-β-D-2'-deoxyribofuranosyl]-9-(2-trifluoroacetamidoethoxy)-1,3-diaza-2-oxophenoxazine, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite (AP-dC-CE phosphoramidite), 5'-dimethoxytrityl-uridine, 2'-O-methyl, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (2' -OMe-U-CE phosphoramidite), 5'-dimethoxytrityl-N-acetyl-5-methyl-cytidine, 2'-O-methyl, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (2'-OMe-5-Me-C-CE phosphoramidite), 5'-dimethoxytrityl-N-acetyl-cytidine, 2'-O-methyl, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (2'-OMe-Ac-C-CE phosphoramidite), etc.

[0071] In some embodiments, the T of the blocking agent is increased relative to an oligonucleotide having the same sequence as the blocking agent without the modification. m The modification may include non-basic modification. Such modifications may include, for example, a minor grove binder (MGB), spermine, a G-clamp or a Uaq anthraquinone cap.

[0072] In some embodiments, the blocking oligonucleotide is at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100 nucleotides in length. In some embodiments, the blocking oligonucleotide is up to 45, up to 50, up to 55, up to 60, up to 70, up to 80, up to 90, up to 100, up to 150, or up to 200 nucleotides in length.

[0073] In some embodiments, the blocking oligonucleotide will include an increased blocking agent T m In some embodiments, the preferred number of modifications is that which provides an optimal T of at least about 1.4° C. under stringent conditions (0.1×SSC) for duplex DNA containing the modification(s) as one complementary strand. m value increase (“optimally enhanced T m In some embodiments, at T m The preferred number of modifications in the enhanced blocking oligonucleotide increases the T of the blocker-adapter oligonucleotide duplex tom T than the T of the adapter duplex with its exact complementary sequence m In some embodiments, at T m The preferred number of modifications in the enhanced blocking oligonucleotide increases the T of the blocker-adapter oligonucleotide duplex to m T than the T of the adapter duplex with its exact complementary sequence m Up to 2°C high, up to 3°C high, up to 4°C high, up to 5°C high, up to 10°C high, up to 15°C high, up to 20°C high, up to 25°C high or up to 30°C high.

[0074] In some embodiments, the blocking oligonucleotide will include modifications of at least 2% (%), at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the bases in the blocking oligonucleotide. In some embodiments, the blocking oligonucleotide will include modifications of up to 5%, up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, up to 70%, up to 80%, up to 90%, or up to 100% of the bases in the blocking oligonucleotide.

[0075] In some embodiments, the modification of the blocking agent will be included in a specific pattern. For example, every 2 bases (see, e.g., Table 2A, BN021 and BN022), every 3 bases (see, e.g., Table 2A, BN035 and BN036), every 4 bases or every 5 bases or some combination thereof (see, e.g., Table 2A, BN036) may include a modified base. In some embodiments, each base in the blocking agent may be modified (see, e.g., Table 2A, BN027 and BN028). In some embodiments, guanine (which has a higher affinity than other nucleotides when modified) may be preferentially modified. For example, in some embodiments, an LNA or BNA form of guanine may be included in the blocking agent.

[0076] In some embodiments, the blocking agent may include a terminal modification. For example, the blocking agent may include a 3' terminal group that prevents the blocking agent from being useful as a primer for DNA synthesis. Such a 3' terminal group may include, for example, 3'-dC, 2', 3'-ddC (also referred to herein as 3ddc), inverted dT, 3'-spacer C3 (also referred to herein as 3SpC3), etc.

[0077] The blocker can bind to any suitable adaptor sequence (including any portion thereof) (e.g., form a duplex). As used herein, the portion of the blocker sequence that binds to (e.g., forms a duplex with) a portion of the adaptor sequence is referred to as the portion of the blocker sequence that "corresponds to" the portion of the adaptor sequence. In some embodiments, the corresponding sequence can be the exact complement of the adaptor sequence. However, in some embodiments, up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 bases in the corresponding sequence may not be complementary.

[0078] In some exemplary embodiments, the blocking agent can bind to the adapters shown in Table 1. (Adapter sequences are shown in Table 1A, and additional information about sequence components is shown in Table 1B.) In some exemplary embodiments, the blocking agent can bind to an adapter comprising a sequence disclosed in Illumina adapter sequences (available on the World Wide Web at support.illumina.com / content / dam / illumina-support / documents / documentation / chemistry_documentation / experiment-design / illumina-adapter-sequences-1000000002694-07.pdf).

[0079] In some embodiments, the blocker is bound to an adaptor, wherein the adaptor comprises a universal sequence, which comprises, for example, a universal adaptor and / or a universal primer sequence. In some embodiments, the universal primer sequence may comprise P5, P7, P5' and / or P7'. In some embodiments, the universal primer sequence may comprise a V2.A14.METS sequence, a V2.B15.METS sequence, a complementary sequence of a V2.A14.METS sequence, and / or a complementary sequence of a V2.B15.METS sequence. For example, as shown in Table 2A, BN001 comprises P5 and a V2.A14.METS sequence; as shown in Table 2A, BN002 comprises P7 and a V2.B15.METS sequence; as shown in Table 2A, BN003 comprises P5' and a reverse complementary sequence of a V2.A14.METS sequence; as shown in Table 2A, BN004 comprises P7' and a reverse complementary sequence of a V2.B15.METS sequence.

[0080] In some sequencing applications, it is desirable that library members include at least one index and / or UMI sequence. Thus, in some embodiments, a blocker is bound to an adaptor, wherein the adaptor includes at least one of an index and a UMI. U.S. Patent Publication No. 2014 / 0031240 describes "three methods that can be used to prepare blocking oligonucleotides" for adaptors that include an index (referred to as a "barcode domain" in U.S. Patent Publication No. 2014 / 0031240): "1) synthesizing a series of blockers that perfectly match each adaptor, 2) synthesizing a single blocker having an N-mer domain that pairs with the barcode domain of the adaptor, or 3) synthesizing a single blocker having a universal base domain that pairs with the barcode domain of the adaptor." Since each different index and / or UMI has a unique sequence, a fully complementary blocker as in method 1 would be a sequence that includes a perfect complementary match to each index and / or UMI sequence present (see Figure 3A ). However, if many different indexes and / or UMIs are used, including blockers with perfect complementary matches would require dozens or hundreds of unique blockers for multiplex amplification - an approach that is not cost-effective.

[0081] In some aspects, the disclosure describes blockers for adapters that include indexes and / or UMIs, and methods of using such blockers, e.g., blockers that include thymine in a blocker region corresponding to an index and / or UMI. Figure 3D and Example 2);

[0082] A blocking agent comprising a universal base and at least one non-universal base ( Figure 5 and Example 3); or a blocking agent that does not include an index region (including, for example, a "split blocker" or a blocking agent that pairs with only a portion of an adaptor) ( Figure 3E-Figure 3I , Fig. 6A and Examples 4, 8 and 9).

[0083] In some embodiments, the blocking agent comprises at least one of the sequences of Table 2A, Table 2B, Table 2C, or Table 3. In some embodiments, the sequences of Table 2A can be used after tag fragmentation (e.g., Nextera) library preparation (Illumina, San Diego, California). In some embodiments, the sequences of Table 2B can be used after ligation-based library preparation and / or TruSeq preparation (Illumina, San Diego, California). In some embodiments, the sequences of Table 2C can be used after tag fragmentation (e.g., Nextera) library preparation (Illumina, San Diego, California). In some embodiments, if the sequences of Table 2 comprise BNA-modified nucleic acids, the BNA-modified nucleic acids can comprise 2'-0,4'-aminoethylene bridged nucleic acids from Biosynthesis, Inc. (Lewisville, Texas). In some embodiments, if the sequences of Table 2 comprise LNA-modified nucleic acids, the LNA-modified nucleic acids can comprise LNA-containing oligonucleotides from Qiagen (Hilden, Germany). Additional information regarding the components of the sequences of Table 2A, Table 2B, and Table 2C can be found in Table 1B and Table 2D.

[0084] On the other hand, the present disclosure describes a test kit including a blocking oligonucleotide. The blocking oligonucleotide may include a blocking agent as described herein. In certain embodiments, the blocking oligonucleotide is a plurality of blocking oligonucleotides. The test kit may further include one or more of the following: a hybridization buffer, a probe, a panel of probes, and a flow cell. The hybridization buffer may include a hybridization buffer as described elsewhere in the present disclosure. In certain embodiments, the probe is as described elsewhere in the present disclosure. In certain embodiments, components may be provided in separate containers. For example, a blocking oligonucleotide may be provided in a first container, and another component (such as a hybridization buffer or a probe or a probe group) may be provided in different containers. Alternatively, a blocking oligonucleotide and a hybridization buffer may be provided in a first container, and a probe or a probe group may be provided in different containers.

[0085]

[0086]

[0087]

[0088]

[0089]

[0090] Blocking agents with thymine

[0091] In some embodiments, the blocker may include at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases in a blocker region corresponding to an index region of an adaptor and / or a UMI of an adaptor (e.g., a blocker region that binds to an index region and / or a UMI of an adaptor).

[0092] In some embodiments, a blocker region corresponding to an index region of an adaptor and / or a UMI of an adaptor (e.g., a blocker region that binds to an index region and / or a UMI of an adaptor) includes as many thymine bases as the number of bases in the index region of the adaptor and / or the UMI of the adaptor.

[0093] In some embodiments, the blocking agent comprises at least one sequence of Table 2A, Table 2B, Table 2C, or Table 3. Some exemplary embodiments of such blocking agents are described in Example 2.

[0094] Blocker with universal base and at least one non-universal base

[0095] In some embodiments, the sealant may include a universal base and at least one non-universal base in the sealant region corresponding to the index region. As used herein, a "universal base" is a modified nucleobase that hybridizes with at least two common bases (e.g., deoxyadenosine (A), deoxythymidine (T), deoxycytidine (C), deoxyguanosine (G), and uridine (U)). In some embodiments, a universal base hybridizes with any common base. As used herein, a "non-universal base" is a nucleobase (including a modified nucleobase in some embodiments) that hybridizes only in traditional Watson-Crick base pair interactions (e.g., deoxyadenosine (A)-deoxythymidine (T) or deoxyguanosine (G)-deoxycytidine (C)).

[0096] In some embodiments, every third base of the sealant sequence corresponding to the index region may include at least one non-universal base. In some embodiments, at least one non-universal base may be at the third and / or fifth position (starting from the 5' end) of the sealant sequence corresponding to the index region. In some embodiments, at least one non-universal base may be at the second and / or fourth position of the sealant sequence corresponding to the index region. In some embodiments, at least one non-universal base includes modified guanine. In some embodiments, the modified guanine may be LNA-modified or BNA-modified. In some embodiments, at least one non-universal base includes random (A, T, G or C) nucleotides.

[0097] Without wishing to be bound by theory, it is believed that modified guanine or random nucleotides (such as Figure 5 In one embodiment (shown in Figure 3), the affinity of the blocking agent to the library members is increased. Some exemplary embodiments of such blocking agents are described in Example 3.

[0098] The universal base may include any known universal base. In some embodiments, the universal base used in the index region may include, for example, 2'-deoxyinosine, 2'-deoxynebularine, 3-nitropyrrole 2'-deoxynucleoside, or 5-nitroindole 2'-deoxynucleoside. In some embodiments, a combination of universal bases may be used in the index region.

[0099] The modified guanine can be guanine modified in any suitable manner, including, for example, LNA-modified guanine, BNA-modified guanine, etc. In some embodiments, the modified guanine is preferably LNA-modified guanine.

[0100] In some embodiments, the blocking agent comprises at least one sequence of Table 2A, Table 2B, Table 2C, or Table 4.

[0101] Split sealer

[0102] In some embodiments, the blocking agent may include at least two unligated oligonucleotides, wherein the unligated oligonucleotides include bases that do not correspond to the index region and / or UMI of the adaptor (e.g., include bases that do not bind to the index region and / or UMI of the adaptor) or include bases that only partially correspond to the index region and / or UMI of the adaptor (e.g., include bases that only bind to a portion of the index region and / or UMI of the adaptor). In some embodiments, the blocking agent includes four unligated oligonucleotides.

[0103] In some embodiments, at least two unligated oligonucleotides hybridize to the same strand of a target sequence. In some embodiments, at least a portion of the blocking agent will correspond to the 5' end of the adaptor, and at least a portion of the blocking agent will correspond to the 3' end of the same adaptor. In some embodiments, including, for example, when the blocking agent includes four unligated oligonucleotides, two unligated oligonucleotides may hybridize to the same strand of a first target sequence, and two unligated oligonucleotides may hybridize to the same strand of a second target sequence. An exemplary embodiment of such a blocking agent is shown in Figure 3E-Figure 3I and Fig. 6A and described in Examples 4, 8 and 9.

[0104] In some embodiments, at least a portion of the blocking agent will correspond to the universal extension primer. In some embodiments, at least a portion of the blocking agent will correspond to P5, P7, P5' and / or P7'. In some embodiments, at least a portion of the blocking agent will correspond to V2.A14.METS, V2.B15.METS, the complement of V2.A14.METS and / or the complement of V2.B15.METS.

[0105] In some embodiments, the blocker will include the same number of bases as the adapter excluding the bases of the index region and / or UMI comprising the adapter. In some embodiments, the blocker will be one base less, two bases less, three bases less, four bases less, or five bases less than the number of bases that make up the adapter portion excluding the bases of the index region and / or UMI comprising the adapter.

[0106] In some embodiments, including, for example, when increased enrichment performance is desired, a blocking agent comprising more bases may be preferred. In some embodiments, including, for example, when the cost, synthetic purity and / or yield of the blocking agent are factors, a blocking agent comprising fewer bases may be preferred.

[0107] In some embodiments, up to five bases of the blocker, up to four bases of the blocker, up to three bases of the blocker, up to two bases of the blocker, only one base of the blocker, or no bases in the blocker will pair with the index region of the adaptor and / or the UMI of the adaptor.

[0108] In some embodiments, the blocking agent comprises at least one sequence (or a portion of a sequence) of Table 2A, Table 2B, Table 2C, or Table 5. In some embodiments, the blocking agent comprises at least one of BN023, BN024, BN025, and BN026 of Table 2A. In some embodiments, the blocking agent comprises BN023 and BN025 of Table 2A. In some embodiments, the blocking agent comprises BN024 and BN026 of Table 2A.

[0109] Hybridization buffer

[0110] In another aspect, the disclosure describes hybridization buffers comprising crowding agents and methods of using the hybridization buffers. As used herein, "crowding agents" include compounds that allow, enhance, or promote molecular crowding. In some embodiments, crowding agents include inert macromolecules used at concentrations that alter DNA-protein interactions. "Hybridization buffer" is defined as any buffer in which nucleotide-probe hybrids can be formed as part of a hybridization capture assay.

[0111] In some embodiments, the crowding agent may include at least one of dextran, dextran sulfate, polyethylene glycol (PEG), Ficoll, glycerol, betaine, etc. Dextran and dextran sulfate may include high molecular weight dextran (e.g., dextran having a molecular weight of at least 500,000 Da) and / or low molecular weight dextran (e.g., dextran having a molecular weight of up to 10,000 Da, up to 50,000 Da, or up to 100,000 Da). In some embodiments, the crowding agent preferably includes dextran sulfate.

[0112] In some embodiments, the crowding agent can be included in the hybridization buffer in an amount of at least 0.5% weight / volume (w / v), at least 1% (w / v), at least 1.5% (w / v), at least 2% (w / v), at least 3% (w / v), or at least 4% (w / v). In some embodiments, the crowding agent can be included in the hybridization buffer in an amount of up to 1% (w / v), up to 1.5% (w / v), up to 2% (w / v), up to 3% (w / v), up to 4% (w / v), up to 5% (w / v), up to 6% (w / v), up to 8% (w / v), or up to 10% (w / v).

[0113] As described in some embodiments of Example 5 (see, e.g., Figure 7D-7F ), in some embodiments, the inclusion of a crowding agent (e.g., dextran sulfate) in the hybridization buffer can allow for reduced hybridization times and / or hybridization in a larger volume (e.g., a higher dilution of the target oligonucleotide) than a hybridization buffer without a crowding agent. For example, the inclusion of dextran sulfate in the hybridization buffer can reduce the hybridization time from overnight to about 80 minutes at a single temperature, or 60 minutes with an additional temperature ramping step.

[0114] In some embodiments, inclusion of a crowding agent can improve enrichment specificity. For example, one embodiment is shown in Example 5 (see Fig. 8A ), wherein the enrichment specificity is increased from 45% to 80%-95%. In some embodiments, the improvement in enrichment specificity due to the inclusion of a crowding agent is more pronounced at shorter incubation times.

[0115] In some embodiments, the inclusion of a crowding agent in the hybridization buffer allows the enrichment reaction to occur faster at a lower concentration of DNA (including, for example, in a larger relative volume of hybridization buffer). Such an increase can be used to promote "pooling-by-volume" and / or eliminate the sample concentration step. Typically, in order to achieve a rapid hybridization reaction, it is necessary to use a high concentration of DNA and a high concentration of probes produced by library preparation, and therefore, in certain embodiments, it is necessary to use a correspondingly small volume of hybridization buffer (e.g., less than 20 μL). Achieving this small volume requires a sample concentration step after library preparation (resulting in an increase in the time and cost of the entire assay). In the case of a crowding agent included in the hybridization buffer, the enrichment reaction can be achieved faster at a lower DNA concentration and / or probe concentration (and in some embodiments in a larger volume). In some embodiments, the inclusion of a crowding agent in the hybridization buffer allows the combination of multiple library preparation samples before hybridization without a concentration step. In some embodiments, samples prepared by different libraries can be combined by volume, as further described in the present disclosure, to allow multiple enrichments. The "multiplicity" or "multiplicity" of a given multiplex enrichment refers to the number of different library preparations combined prior to enrichment (e.g., hybridization and capture). In some embodiments, the multiplicity of the multiplex enrichment can be up to 2-fold, up to 4-fold, up to 6-fold, up to 12-fold, up to 24-fold, up to 48-fold, up to 96-fold or higher.

[0116] In some embodiments, the hybridization buffer comprising a crowding agent further comprises at least one of human Cot-1 DNA, a destabilizing agent, a salt, and a blocking agent. In some embodiments, components of the hybridization buffer, such as Cot-1 DNA and a blocking agent, are kept separate from components of the hybridization buffer comprising a destabilizing agent and a crowding agent until the hybridization reaction is performed.

[0117] In some embodiments, the hybridization buffer may contain human Cot-1 DNA in an amount of at least 0.05 mg / mL, at least 0.1 mg / mL, at least 0.2 mg / mL, or at least 0.3 mg / mL. In some embodiments, the hybridization buffer may contain human Cot-1 DNA in an amount of up to 0.1 mg / mL, up to 0.2 mg / mL, up to 0.3 mg / mL, or up to 0.5 mg / mL. In some embodiments, the hybridization buffer may preferably contain human Cot-1 DNA in an amount of 0.2 mg / mL.

[0118] In some embodiments, the hybridization buffer may include a destabilizing agent. In some embodiments, the destabilizing agent may include formamide and / or urea. In some embodiments, the hybridization buffer may include at least 1% (v:v), at least 5% (v:v) or at least 10% (v:v) formamide. In some embodiments, the hybridization buffer may include up to 5% (v:v), up to 10% (v:v) or up to 15% (v:v) formamide. In some embodiments, the hybridization buffer may include at least 1M urea, at least 2M urea or at least 4M urea. In some embodiments, the hybridization buffer may include up to 2M urea, up to 4M urea or up to 6M urea. In some embodiments, the hybridization buffer may preferably include 10% formamide.

[0119] In some embodiments, the hybridization buffer may include a buffer. Any suitable buffer may be used. In some embodiments, the buffer may include phosphate, including, for example, potassium phosphate or sodium phosphate; Tris-HCl; piperazine-N, N'-bis(2-ethanesulfonic acid) (PIPES); piperazine-N, N'-bis(3-propanesulfonic acid) (PIPPS); 2-(N-morpholino)ethanesulfonic acid (MES); (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES) and the like. In some embodiments, the hybridization buffer may include at least 40 mM, at least 50 mM, at least 55 mM, at least 60 mM, at least 65 mM, or at least 70 mM phosphate. In some embodiments, the hybridization buffer may include up to 50 mM, up to 55 mM, up to 60 mM, up to 65 mM, up to 70 mM, up to 75 mM, or up to 80 mM phosphate. In some embodiments, the phosphate-containing buffer may include monobasic dihydrogen phosphate and / or dibasic monohydrogen phosphate. In some embodiments, the phosphate-containing buffer may include KH2PO4-K2HPO. In some embodiments, the hybridization buffer may preferably include 66.6 mM KH2PO4-K2HPO4.

[0120] In certain embodiments, hybridization buffer can comprise salt. Any suitable salt can be included. In certain embodiments, salt can be for example NaCl or sodium citrate (for example trisodium citrate) etc. In certain embodiments, hybridization buffer can comprise at least 0.1M, at least 0.2M, at least 0.3M, at least 0.4M, at least 0.5M, at least 0.6M, at least 0.7M, at least 0.8M, at least 0.9M or at least 1M salt. In certain embodiments, hybridization buffer can comprise up to 0.2M, up to 0.3M, up to 0.4M, up to 0.5M, up to 0.6M, up to 0.7M, up to 0.8M, up to 0.9M, up to 1M, up to 2M, up to 3M or up to 4M salt. In certain embodiments, hybridization buffer can preferably comprise 0.8M NaCl.

[0121] In some embodiments, the hybridization buffer may contain a detergent, including, for example, an anionic detergent (e.g., sodium dodecyl sulfate, sulfonate, alcohol sulfate, alkylbenzene sulfonate, phosphate or carboxylate), a nonionic detergent (e.g., a polyoxyethylene or glycoside detergent, such as Tween, Triton or Brij detergent), a cationic detergent (e.g., a quaternary ammonium cationic surfactant), or a zwitterionic detergent (e.g., CHAPS). In some embodiments, the detergent is an anionic detergent. In some embodiments, the detergent is a nonionic detergent. In some embodiments, the detergent is Tween 20, Tween 80, sodium dodecyl sulfate (SDS), etc. In some embodiments, the detergent may comprise at least 0.001% volume / volume (v / v), at least 0.01% (v / v), at least 0.05% (v / v), at least 0.1% (v / v), at least 1% (v / v), or at least 5% (v / v) of the hybridization buffer. In some embodiments, the detergent may comprise up to 0.01% (v / v), up to 0.05% (v / v), up to 0.1% (v / v), up to 1% (v / v), up to 5% (v / v), or up to 10% (v / v) of the hybridization buffer. In some embodiments, the hybridization buffer may preferably comprise 0.04% (v / v) Tween 20.

[0122] For example, in some embodiments, the hybridization buffer may contain 0.5% to 10% dextran sulfate, 0.05 mg / mL to 0.5 mg / mL human Cot-1 DNA, 1% to 15% (v / v) formamide, 40 mM to 80 mM KH2PO4-K2HPO4, 0.1 M to 4 M NaCl, and 0.001% to 10% (v / v) Tween 20. In some embodiments, the hybridization buffer may contain (e.g., in the final reaction) 1.5% dextran sulfate, 0.2 mg / mL Cot-1, 10% (v / v) formamide, 66.6 mM KH2PO4-K2HPO4, 0.8 M NaCl, and 0.04% (v / v) Tween 20.

[0123] In some embodiments, the hybridization buffer may include a blocking agent. In some embodiments, the blocking agent is as described elsewhere in this disclosure. In some embodiments, the blocking agent is present at a concentration of at least 0.001 mM, at least 0.005 mM, at least 0.01 mM, at least 0.05 mM, or at least 0.1 mM. In some embodiments, the blocking agent is present at a concentration of up to 0.01 mM, up to 0.05 mM, up to 0.1 mM, up to 0.2 mM, or up to 0.5 mM.

[0124] On the other hand, the present disclosure describes a test kit, which includes hybridization buffer such as described herein. In one embodiment, the test kit further includes at least one of a sealant and a probe. In an embodiment, the components are provided in separate containers. For example, the hybridization buffer can be provided in a first container, and another component (such as a sealant or a probe) can be provided in a different container. In certain embodiments, the sealant and / or the probe are as described elsewhere in the present disclosure.

[0125] Hybridization capture

[0126] On the other hand, the present disclosure describes a hybrid capture method. In some embodiments, the method includes the step of hybridizing the probe with a library member and capturing the probe. In some embodiments, the method also includes merging (pooling) libraries before the hybridization probe. In some embodiments, the method also includes amplifying the captured sequence after capture. In some embodiments, the method can be used in combination with the blocker oligonucleotide described in the present disclosure. In some embodiments, the method may include using a hybridization buffer containing a crowding agent as described in the present disclosure.

[0127] Pooling Libraries

[0128] In some embodiments, samples produced by different library preparations are combined prior to hybridization.In some embodiments, each library to be combined preferably includes a sequence having an index region that is distinguishable from the index region of a sequence in any other library to be combined.

[0129] In some embodiments, samples produced by different library preparations can be combined by volume to allow multiple enrichment. The "multiplicity" or "multiplicity" of a given multiple enrichment refers to the number of different library preparations combined before enrichment (e.g., hybridization and capture). In some embodiments, the multiplicity of multiple enrichment can be up to 2-fold, up to 4-fold, up to 6-fold, up to 12-fold, up to 24-fold, up to 48-fold, up to 96-fold or higher.

[0130] In some embodiments, the sample produced by the library preparation is produced by a tag fragmentation reaction. See, e.g., U.S. Patent No. 9,574,226. In some embodiments, the sample produced by the library preparation is produced by a Nextera library preparation (Illumina, San Diego, California). In some embodiments, the library preparation can be added directly to the hybridization reaction.

[0131] In some embodiments, the combined DNA concentration of each sample resulting from the library preparation will be at least 0.1 ng / μL, at least 0.3 ng / μL, at least 0.4 ng / μL, at least 0.5 ng / μL, at least 1 ng / μL, at least 2 ng / μL, at least 4 ng / μL, at least 6 ng / μL, at least 8 ng / μL, at least 10 ng / μL, at least 12 ng / μL, at least 20 ng / μL, at least 50 ng / μL, at least 60 ng / μL, at least 100 ng / μL, or at least 200 ng / μL. In some embodiments, the combined DNA concentration of each sample generated by the library preparation will be up to 0.4 ng / μL, up to 0.5 ng / μL, up to 1 ng / μL, up to 2 ng / μL, up to 4 ng / μL, up to 6 ng / μL, up to 8 ng / μL, up to 10 ng / μL, up to 12 ng / μL, up to 15 ng / μL, up to 20 ng / μL, up to 50 ng / μL, up to 100 ng / μL, up to 120 ng / μL, up to 200 ng / μL, up to 300 ng / μL, or up to 400 ng / μL. For example, in some embodiments, the DNA concentration of each sample generated by the library preparation will be in the range of 0.3 ng / μL to 400 ng / μL. For example, in some embodiments, the DNA concentration of each sample generated by the library preparation will be in the range of 0.1 ng / μL to 120 ng / μL. For example, in some embodiments, the DNA concentration of the combination of samples produced by library preparation will be in the range of 0.1 ng / μL to 120 ng / μL (e.g., in 100 μL). For example, in some embodiments, the DNA concentration of each sample produced by library preparation will be in the range of 0.5 ng / μL to 12 ng / μL. In some embodiments, the DNA concentration of the combination of samples produced by library preparation will be in the range of 0.5 ng / μL to 12 ng / μL (e.g., in 100 μL). For example, in some embodiments, the DNA concentration of each sample produced by library preparation will be in the range of 0.5 ng / μL to 120 ng / μL. In some embodiments, the DNA concentration of the combination of samples produced by library preparation will be in the range of 0.5 ng / μL to 120 ng / μL (e.g., in 100 μL).

[0132] In some embodiments, at least 1 μL, at least 2 μL, at least 3 μL, at least 5 μL, at least 10 μL, at least 15 μL, at least 20 μL, or at least 25 μL of each sample generated by library preparation is combined. In some embodiments, up to 2 μL, up to 3 μL, up to 5 μL, up to 10 μL, up to 15 μL, up to 20 μL, up to 25 μL, up to 30 μL, up to 40 μL, or up to 50 μL of each sample generated by library preparation is combined.

[0133] In some embodiments, at least 10 ng, at least 15 ng, at least 25 ng, at least 50 ng, at least 100 ng, at least 200 ng, at least 500 ng, at least 1,000 ng, or at least 5,000 ng of DNA from each library preparation is combined. In some embodiments, up to 15 ng, up to 25 ng, up to 50 ng, up to 100 ng, up to 200 ng, up to 500 ng, up to 1,000 ng, up to 5,000 ng, up to 10,000 ng, or up to 12,000 ng of DNA from each library preparation is combined. For example, in some embodiments, 10 ng to 12,000 ng of DNA from each library preparation can be combined.

[0134] Hybridization probe

[0135] In some aspects, the hybrid capture method comprises contacting the library with a probe, wherein the probe hybridizes to a region of interest within a member of the library. The region of interest is separated from the adapter region and includes genomic material of interest. The probe includes a ligand that allows subsequent capture of the probe. In some embodiments, the ligand preferably includes a biotin group.

[0136] The library is contacted with the probe in the presence of a hybridization buffer. In some embodiments, the hybridization buffer may comprise a crowding agent, such as described in the present disclosure. In some embodiments, the hybridization buffer may comprise a blocking agent, such as described in the present disclosure.

[0137] In some embodiments, the hybridization capture method includes a heat denaturation step. For example, the hybridization mixture containing library members, blocking agents and probes in the hybridization buffer can be heated to at least 90°C, at least 92°C, or at least 95°C. In some embodiments, the hybridization mixture can be heated to up to 92°C, up to 95°C, up to 97°C, or up to 100°C. In some embodiments, the hybridization mixture preferably further comprises Cot-1 DNA. In some embodiments, the hybridization buffer can include a blocking agent before being added to the hybridization mixture; in some embodiments, the blocking agent can be added to the hybridization mixture independently of the hybridization buffer.

[0138] In some embodiments, the concentration of DNA in the hybridization mixture (e.g., the final hybridization reaction) will be at least 0.1 ng / μL, at least 0.3 ng / μL, at least 0.4 ng / μL, at least 0.5 ng / μL, at least 1 ng / μL, at least 2 ng / μL, at least 4 ng / μL, at least 6 ng / μL, at least 8 ng / μL, at least 10 ng / μL, at least 12 ng / μL, at least 15 ng / μL, at least 20 ng / μL, at least 50 ng / μL, at least 75 ng / μL, at least 100 ng / μL, at least 120 ng / μL, at least 150 ng / μL, at least 200 ng / μL. In some embodiments, the concentration of DNA in the hybridization mixture (e.g., the final hybridization reaction) will be up to 0.3 ng / μL, up to 0.4 ng / μL, up to 0.5 ng / μL, up to 1 ng / μL, up to 2 ng / μL, up to 4 ng / μL, up to 6 ng / μL, up to 8 ng / μL, up to 10 ng / μL, up to 12 ng / μL, up to 15 ng / μL, up to 20 ng / μL, up to 50 ng / μL, up to 75 ng / μL, up to 100 ng / μL, up to 120 ng / μL, up to 150 ng / μL, up to 200 ng / μL, or up to 500 ng / μL. For example, in some embodiments, the concentration of DNA in the hybridization mixture (e.g., the final hybridization reaction) will be in the range of 0.1 ng / μL to 120 ng / μL.

[0139] In some embodiments, the method may include using a hybridization mixture of up to 150 μL, up to 140 μL, up to 130 μL, up to 120 μL, up to 110 μL, up to 100 μL, up to 90 μL, up to 80 μL, up to 70 μL, up to 60 μL, or up to 50 μL. In some embodiments, the method may include using a hybridization mixture of at least 10 μL, at least 20 μL, at least 30 μL, at least 40 μL, at least 50 μL, at least 60 μL, or at least 70 μL.

[0140] In some embodiments, the hybridization mixture can be heated at a rate of at least 1°C / minute, at least 1.5°C / minute, at least 2°C / minute, at least 2.5°C / minute, at least 3°C / minute, or at least 5°C / minute. In some embodiments, the hybridization mixture can be heated at a rate of up to 1.5°C / minute, up to 2°C / minute, up to 2.5°C / minute, up to 3°C / minute, up to 5°C / minute, or up to 10°C / minute. In some embodiments, the hybridization mixture can be kept at a temperature of thermal denaturation for at least 1 minute, at least 2 minutes, at least 5 minutes, at least 10 minutes, or at least 20 minutes. In some embodiments, the hybridization mixture can be kept at a temperature of thermal denaturation for up to 2 minutes, up to 5 minutes, up to 10 minutes, up to 20 minutes, or longer.

[0141] After the heat denaturation step, the hybridization capture method includes cooling the hybridization mixture. When the hybridization mixture is cooled from the heat denaturation step temperature to the hybridization temperature, probe: target hybrids (i.e., probe: library member hybrids) will be formed.

[0142] In some embodiments, the hybridization temperature may be at least 50°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C, or at least 70°C. In some embodiments, the hybridization temperature may be up to 56°C, up to 58°C, up to 60°C, up to 61°C, up to 62°C, up to 63°C, up to 64°C, up to 65°C, or up to 70°C. In some embodiments, hybridization may include a decrease in temperature from the denaturation temperature to the hybridization temperature. In some embodiments, the temperature ramp may include a rate of at least -5°C / min, at least -2°C / min, at least -1°C / min, at least -0.5°C / min, or at least -0.2°C / min.

[0143] In some embodiments, the method may include keeping the library in contact with the probe and / or keeping the hybridization mixture at the hybridization temperature for up to 3 days, up to 2 days, up to 24 hours, up to 20 hours, up to 16 hours, up to 12 hours, up to 6 hours, up to 3 hours, up to 2 hours, up to 90 minutes, up to 1 hour, or up to 30 minutes. In some embodiments, the method may include keeping the library in contact with the probe and / or keeping the hybridization mixture at the hybridization temperature for at least 30 minutes, at least 45 minutes, at least 1 hour, at least 90 minutes, at least 2 hours, at least 3 hours, at least 6 hours, at least 12 hours, at least 16 hours, at least 20 hours, or at least 24 hours. In some embodiments, the method may include keeping the library in contact with the probe and / or keeping the hybridization mixture at the hybridization temperature for at least 30 minutes, at least 45 minutes, at least 1 hour, at least 90 minutes, at least 2 hours, at least 3 hours, at least 6 hours, at least 12 hours, at least 16 hours, at least 20 hours, or at least 24 hours. m Tm When the blocker:adapter hybrid is formed, the blocker:adapter hybrid will form before the adapter:adapter hybrid is formed, thereby preventing the formation of "daisy chains" or the concatenation of adapter:adapter hybrids.

[0144] capture

[0145] In some aspects, the hybrid capture method includes capturing the probe using a capture device once the probe is hybridized to a library member. The probe can be captured by any suitable device. For example, when the probe includes a biotin group, streptavidin beads (including, for example, streptavidin-coated magnetic beads) can be used to capture the probe. In some embodiments, the probe can include FITC, and the capture device can include anti-FITC (anti-FITC). In some embodiments, the probe can include a hapten, and the capture device can include a molecule (e.g., an antibody) that binds the hapten. Other capture devices can be used, such as isotachophoresis, size exclusion chromatography, liquid chromatography, magnetic devices, etc.

[0146] In some embodiments, including, for example, when the capture device comprises streptavidin-coated beads, the method can include forming a capture mixture comprising the probe (including, for example, a probe:target hybrid) and the capture device.

[0147] In some embodiments, the method may include maintaining the capture mixture at the capture temperature. In some embodiments, the capture temperature may be at least 50°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C, or at least 70°C. In some embodiments, the capture temperature may be up to 56°C, up to 58°C, up to 60°C, up to 61°C, up to 62°C, up to 63°C, up to 64°C, up to 65°C, or up to 70°C. In some embodiments, the capture mixture may be maintained at the capture temperature for at least 2 minutes, at least 5 minutes, at least 10 minutes, or at least 15 minutes. In some embodiments, the capture mixture may be maintained at the capture temperature for up to 5 minutes, up to 10 minutes, up to 15 minutes, up to 20 minutes, up to 30 minutes, up to 45 minutes, or more. In some embodiments, and / or shaking mixing may be added every 5 or 10 minutes.

[0148] In some embodiments, the method can further include washing the captured probe (the captured probe can include, for example, a probe: target hybrid and / or a captured library member). In some embodiments, the captured probe can be washed at least once, at least twice, at least three times, or more. In some embodiments, the captured probe can be washed up to once, up to twice, up to three times, or up to five times.

[0149] In some embodiments, washing the captured library members may include heating the captured probes to a washing temperature in a wash buffer. In some embodiments, the wash buffer may include a detergent. Any suitable buffer may be used, including, for example, Tris-HCl; piperazine-N, N'-bis(2-ethanesulfonic acid) (PIPES); piperazine-N, N'-bis(3-propanesulfonic acid) (PIPPS); 2-(N-morpholino)ethanesulfonic acid (MES); (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES), etc. Any suitable detergent may be used, including, for example, Tween 20, Tween 80, sodium dodecyl sulfate (SDS), etc. In some embodiments, the wash buffer may include compounds intended to reduce the formation of secondary structures in GC-rich regions, including, for example, betaine. In some embodiments, the wash buffer may include an iron chelator, including, for example, deferoxamine mesylate, EGTA, EDTA, etc.

[0150] The wash temperature may be at least 20° C., at least 23° C., at least 25° C., at least 30° C., at least 35° C., at least 40° C., at least 45° C., at least 50° C., at least 55° C., at least 56° C., at least 57° C., at least 58° C., at least 59° C., at least 60° C., at least 61° C., at least 62° C., at least 63° C., at least 64° C., at least 65° C., or at least 70° C. In some embodiments, the wash temperature may be up to 30° C., up to 35° C., up to 40° C., up to 45° C., up to 50° C., up to 55° C., up to 56° C., up to 60° C., up to 61° C., up to 62° C., up to 63° C., up to 64° C., up to 65° C., or up to 70° C.

[0151] In some embodiments, the method may further include eluting the captured library members from the capture device and / or probe. For example, the captured library members can be eluted from streptavidin beads and / or from biotinylated probes. In embodiments where the streptavidin beads include magnetic streptavidin beads, elution may include the use of a magnet. In some embodiments, elution may include the use of a strong base, including, for example, NaOH, KOH, Ca(OH)2, etc.

[0152] In some embodiments, a solid support medium can be used as a capture device, including, for example, a solid support medium comprising streptavidin. In some embodiments, the probe: target T can be below the estimated m value and / or higher than the T m The capture device is washed under successively more stringent conditions at a temperature greater than the threshold value.

[0153] In some embodiments, captured library members can be eluted from the ligand (e.g., eluted from a biotinylated probe) or capture device (e.g., eluted from streptavidin beads) and loaded directly onto a flow cell.

[0154] In some embodiments, at least 60 femtomoles, at least 80 femtomoles, at least 90 femtomoles, at least 100 femtomoles, or at least 150 femtomoles of DNA can be eluted. In some embodiments, up to 150 femtomoles, up to 500 femtomoles, up to 1 picomole, up to 2 picomoles, or up to 3 picomoles of DNA can be eluted. For example, in some embodiments, 100 femtomoles to 2 picomoles of DNA can be eluted.

[0155] In some embodiments, the eluted library members can be loaded onto the flow cell in a volume of less than 100 μL, less than 90 μL, less than 80 μL, less than 70 μL, or less than 60 μL. In some embodiments, the captured library members can be loaded onto the flow cell in a volume of about 55 μL.

[0156] In some embodiments, after elution, the eluent may have a DNA concentration of at least 1.1 picomolar (pM), at least 1.2 pM, at least 1.3 pM, at least 10 pM, or at least 100 pM. In some embodiments, the eluent may have a DNA concentration of up to 100 pM, up to 200 pM, up to 250 pM, or up to 300 pM. For example, in some embodiments, the eluent may have a DNA concentration in the range of 1.3 pM to 250 pM. In some embodiments, the eluent may be loaded onto the flow cell without further dilution and / or without changing the DNA concentration.

[0157] Amplification

[0158] On the other hand, the disclosure describes a method comprising amplifying library members using PCR after hybrid capture but before sequencing the captured library members. Alternatively, the disclosure describes a method that does not include exposing the captured library members to amplification conditions after hybrid capture before sequencing the library members (e.g., does not include exposing the captured library members to a PCR step to amplify the captured library members before sequencing the library members). The method of sequencing the captured library members typically includes amplifying the library members (e.g., using a PCR step) before sequencing the library members.

[0159] The amount of DNA captured during hybridization and hybridization capture may be too low to be directly quantified by fluorescence or analytical methods (e.g., Bioanalyzer). Amplification of the library enables quantification and quality control of the process.

[0160] In addition, samples that have been amplified using PCR are typically diluted after hybridization capture and before sequencing. For example, typical quantification of Illumina's Nextera Rapid Capture samples after PCR is in the mid-nanomolar range, while sequencing concentrations are in the low picomolar range. Therefore, amplification of captured library members produces several orders of magnitude more molecules than required for sequencing.

[0161] In some embodiments, the disclosure describes a method for sequencing captured library members after hybrid capture. Such a method may include loading captured library members and / or eluted library members directly onto a flow cell (e.g., using a direct flow cell loading jig, such as described in U.S. Provisional Patent Application No. 62 / 564,466, filed September 28, 2017).

[0162] In some embodiments, the method may further comprise sequencing the captured library members after hybridization capture.

[0163] Example

[0164] Exemplary Blocking Agent Examples

[0165] 1. A blocking agent, comprising an oligonucleotide;

[0166] wherein the blocker is capable of binding to an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI);

[0167] and wherein the region of the blocker capable of binding to the index region and / or UMI of the adaptor comprises:

[0168] at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or

[0169] a universal base and at least one non-universal base.

[0170] 2. The blocking agent of Blocking Agent Embodiment 1, wherein the region of the blocking agent capable of binding to the index region or the UMI of the adaptor comprises as many thymine bases as the number of bases in the index region and / or the UMI of the adaptor.

[0171] 3. The blocker of Blocker Embodiment 1, wherein the at least one non-universal base is located in a region of the blocker sequence corresponding to the index region and / or UMI and wherein the non-universal base is located at the third position or the fifth position or both positions of the blocker sequence relative to the 5' end of the index region.

[0172] 4. The blocker of Blocker Embodiment 1 or Blocker Embodiment 3, wherein the at least one non-universal base comprises a modified guanine.

[0173] 5. The blocking agent of any one of blocking agent embodiments 1, 3 or 4, wherein the at least one non-universal base comprises a random nucleotide.

[0174] 6. The blocking agent of any one of blocking agent embodiments 1, 3, 4 or 5, wherein the universal base comprises 2'-deoxyinosine, 2'-deoxyhygrosine, 3-nitropyrrole 2'-deoxynucleoside or 5-nitroindole 2'-deoxynucleoside.

[0175] 7. A blocking agent as described in any of the above blocking agent embodiments, wherein the universal primer sequence includes at least one of P5, P7, P5', P7', V2.A14.METS, V2.B15.METS, the complementary sequence of V2.A14.METS and the complementary sequence of V2.B15.METS.

[0176] 8. The blocking agent of any of the preceding blocking agent embodiments, wherein the blocking agent comprises a modification that increases the T of the blocking agent relative to the same blocking agent not comprising the modification. m .

[0177] 9. A blocking agent as described in any of the above blocking agent embodiments, wherein the blocking agent includes at least one of a DNA or RNA oligonucleotide modified to capture low GC regions; a cross-linked oligonucleotide; a modified 5-methyldeoxycytidine (5-methyl-dc); a 2,6-diaminopurine; a locked nucleic acid (LNA); a bridged nucleic acid (BNA); a tricyclic nucleic acid; a peptide nucleic acid (PNA); a C5-modified pyrimidine base; a propynyl pyrimidine; a morpholino; a phosphoramidite; and a 5'-pyrene cap.

[0178] 10. The blocking agent of any of the preceding blocking agent embodiments, wherein the blocking agent comprises a modified base at every base, at least every 2 bases, at least every 3 bases, at least every 4 bases, or at least every 5 bases.

[0179] 11. The blocking agent of any preceding blocking agent embodiment, wherein the blocking agent comprises a 3' terminal group that prevents the availability of the blocking agent as a primer for DNA synthesis.

[0180] 12. The blocking agent of blocking agent embodiment 11, wherein the 3' terminal group comprises 3'-dC, 2',3'-ddC, inverted dT or 3'-spacer C3.

[0181] 13. The blocking agent of any of the preceding blocking agent embodiments, wherein the blocking agent comprises a sequence of Table 2A, Table 2B, Table 2C, or Table 3.

[0182] 14. A kit comprising a blocking agent as described in any one of the above blocking agent embodiments.

[0183] Exemplary Split Blocker Examples

[0184] 1. A blocking agent comprising two unlinked oligonucleotides;

[0185] wherein the blocker is capable of binding to at least a portion of an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI);

[0186] And wherein the unligated oligonucleotide includes a base that does not correspond to the index region of the adaptor and / or the UMI.

[0187] 2. The blocker of Split Blocker Embodiment 1, wherein the unligated oligonucleotide does not include a base corresponding to the index region of the adaptor and / or the UMI.

[0188] 3. A blocker as described in any of the above split blocker embodiments, wherein the universal primer sequence includes at least one of P5, P7, P5', P7', V2.A14.METS, V2.B15.METS, the complementary sequence of V2.A14.METS and the complementary sequence of V2.B15.METS.

[0189] 4. The blocking agent of any of the preceding split blocking agent embodiments, wherein the blocking agent comprises a modification that increases the T of the blocking agent relative to the same blocking agent not comprising the modification. m .

[0190] 5. A blocker as described in any of the above split blocker embodiments, wherein the blocker includes at least one of a DNA or RNA oligonucleotide modified to capture a low GC region; a cross-linked oligonucleotide; a modified 5-methyldeoxycytidine (5-methyl-dc); a 2,6-diaminopurine; a locked nucleic acid (LNA); a bridged nucleic acid (BNA); a tricyclic nucleic acid; a peptide nucleic acid (PNA); a C5-modified pyrimidine base; a propynyl pyrimidine; a morpholino; a phosphoramidite; and a 5'-pyrene cap.

[0191] 6. The blocker of any of the preceding split blocker embodiments, wherein the blocker comprises a modified base at every base, at least every 2 bases, at least every 3 bases, at least every 4 bases, or at least every 5 bases.

[0192] 7. The blocking agent of any preceding cleavage blocking agent embodiment, wherein the blocking agent comprises a 3' terminal group that prevents the availability of the blocking agent as a primer for DNA synthesis.

[0193] 8. The blocking agent of embodiment 11 of the split blocking agent, wherein the 3' terminal group comprises 3'-dC, 2',3'-ddC, inverted dT or 3'-spacer C3.

[0194] 9. The blocking agent of any of the preceding split blocking agent embodiments, wherein the blocking agent comprises a sequence of Table 2A, Table 2B, Table 2C, or Table 3.

[0195] 10. The blocking agent of any of the preceding split blocking agent embodiments, wherein the blocking agent comprises at least one of BN023, BN024, BN027, and BN028 of Table 2A.

[0196] 11. A kit comprising a blocking agent as described in any one of the above embodiments of the cleavage blocking agent.

[0197] Exemplary Hybridization Buffer Examples

[0198] 1. A hybridization buffer comprising a crowding agent.

[0199] 2. The hybridization buffer of hybridization buffer embodiment 1, wherein the crowding agent comprises at least one of dextran, dextran sulfate, polyethylene glycol (PEG), Ficoll, glycerol and betaine.

[0200] 3. The hybridization buffer of any of the preceding hybridization buffer embodiments, wherein the crowding agent is contained in the hybridization buffer in an amount of at least 0.5%, at least 1%, at least 1.5%, at least 2%, at least 3% or at least 4%.

[0201] 4. The hybridization buffer of any of the preceding hybridization buffer embodiments, wherein the crowding agent is included in the hybridization buffer in an amount of up to 1%, up to 1.5%, up to 2%, up to 3%, up to 4%, up to 5%, up to 6%, up to 8% or up to 10%.

[0202] 5. The hybridization buffer as described in any one of the above hybridization buffer embodiments, wherein the hybridization buffer comprises at least one of human Cot-1 DNA, a destabilizing agent, a salt and a blocking agent.

[0203] 6. The hybridization buffer of hybridization buffer embodiment 5, wherein the hybridization buffer comprises Cot-1 DNA in an amount of at least 0.05 mg / mL, at least 0.1 mg / mL, at least 0.2 mg / mL or at least 0.3 mg / mL.

[0204] 7. The hybridization buffer of hybridization buffer embodiment 5 or 6, wherein the hybridization buffer comprises Cot-1 DNA in an amount of up to 0.1 mg / mL, up to 0.2 mg / mL, up to 0.3 mg / mL or up to 0.5 mg / mL.

[0205] 8. The hybridization buffer of any one of Hybridization Buffer Embodiments 5 to 7, wherein the destabilizing agent accounts for at least 1% (v / v), at least 5% (v / v) or at least 10% (v / v) of the hybridization buffer.

[0206] 9. The hybridization buffer of any one of hybridization buffer embodiments 5 to 8, wherein the destabilizing agent comprises up to 5% (v / v), up to 10% (v / v), or up to 15% (v / v) of the hybridization buffer.

[0207] 10. The hybridization buffer of any one of hybridization buffer embodiments 5 to 9, wherein the destabilizing agent comprises formamide.

[0208] 11. A hybridization buffer as described in any of Hybridization Buffer Embodiments 5 to 10, wherein the hybridization buffer comprises at least 0.1 M, at least 0.2 M, at least 0.3 M, at least 0.4 M, at least 0.5 M, at least 0.6 M, at least 0.7 M, at least 0.8 M, at least 0.9 M or at least 1 M salt.

[0209] 12. A hybridization buffer as described in any of Hybridization Buffer Embodiments 5 to 11, wherein the hybridization buffer comprises up to 0.2M, up to 0.3M, up to 0.4M, up to 0.5M, up to 0.6M, up to 0.7M, up to 0.8M, up to 0.9M, up to 1M, up to 2M, up to 3M or up to 4M salt.

[0210] 13. The hybridization buffer of any one of hybridization buffer embodiments 5 to 11, wherein the salt comprises NaCl.

[0211] 14. The hybridization buffer of any of the preceding hybridization buffer embodiments, wherein the hybridization buffer comprises phosphate.

[0212] 15. The hybridization buffer of hybridization buffer embodiment 14, wherein the hybridization buffer comprises at least 40 mM, at least 50 mM, at least 55 mM, at least 60 mM, at least 65 mM or at least 70 mM phosphate.

[0213] 16. The hybridization buffer of hybridization buffer embodiment 14 or 15, wherein the hybridization buffer comprises up to 50 mM, up to 55 mM, up to 60 mM, up to 65 mM, up to 70 mM, up to 75 mM, or up to 80 mM phosphate.

[0214] 17. The hybridization buffer of any one of hybridization buffer embodiments 14 to 16, wherein the phosphate comprises KH2PO4-K2HPO4.

[0215] 18. The hybridization buffer of any of the preceding hybridization buffer embodiments, wherein the hybridization buffer comprises a detergent.

[0216] 19. The hybridization buffer of hybridization buffer embodiment 18, wherein the hybridization buffer comprises at least 0.001% (v / v), at least 0.01% (v / v), at least 0.05% (v / v), at least 0.1% (v / v), at least 1% (v / v) or at least 5% (v / v) detergent.

[0217] 20. A hybridization buffer as described in hybridization buffer embodiment 18 or 19, wherein the hybridization buffer comprises up to 0.01% (v / v), up to 0.05% (v / v), up to 0.1% (v / v), up to 1% (v / v), up to 5% (v / v) or up to 10% (v / v) of a detergent.

[0218] 21. The hybridization buffer of any one of hybridization buffer embodiments 18 to 20, wherein the detergent comprises Tween 20.

[0219] 22. A hybridization buffer as described in any one of the aforementioned hybridization buffer embodiments, wherein the hybridization buffer comprises

[0220] 0.5% to 10% dextran sulfate,

[0221] 0.05mg / mL to 0.5mg / mL human Cot-1 DNA,

[0222] 1% to 15% (v / v) formamide,

[0223] 40mM to 80mM KH2PO4-K2HPO4,

[0224] 0.1M to 4M NaCl, and

[0225] 0.001% to 10% (v / v) Tween 20.

[0226] 23. A hybridization buffer as described in any one of the aforementioned hybridization buffer embodiments, wherein the hybridization buffer comprises

[0227] 1.5% Dextran sulfate,

[0228] 0.2mg / mL human Cot-1 DNA,

[0229] 10% (v / v) formamide,

[0230] 66.6mM KH2PO4-K2HPO4,

[0231] 0.2mM Enhanced Adapter Blocker, (0.1mM for each adapter)

[0232] 0.8M NaCl and

[0233] 0.04% (v / v) Tween 20.

[0234] 24. The hybridization buffer of any of the preceding hybridization buffer embodiments, wherein the hybridization buffer comprises a blocking agent.

[0235] 25. The hybridization buffer of hybridization buffer embodiment 24, wherein the blocking agent comprises T m Enhanced oligonucleotides.

[0236] 26. A hybridization buffer as described in hybridization buffer embodiment 24 or 25, wherein the blocking agent comprises a plurality of enhancing T m modification.

[0237] 27. The hybridization buffer of hybridization buffer embodiment 26, wherein increasing the T of the blocking agent m The multiple modifications include at least one of cross-linked oligonucleotides; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridged nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5 modified pyrimidine base; propynyl pyrimidine; morpholino; phosphoramidite; and 5'-pyrene cap.

[0238] 28. The hybridization buffer of any one of the aforementioned hybridization buffer embodiments, wherein the hybridization buffer comprises a blocking agent,

[0239] wherein the blocking agent comprises an oligonucleotide;

[0240] wherein the blocker is capable of binding to an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI);

[0241] and wherein the region of the blocker capable of binding to the index region and / or UMI of the adaptor comprises:

[0242] at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or

[0243] a universal base and at least one non-universal base.

[0244] 29. The hybridization buffer of any one of the aforementioned hybridization buffer embodiments, wherein the hybridization buffer comprises a blocking agent,

[0245] wherein the blocking agent comprises two unligated oligonucleotides;

[0246] wherein the blocker is capable of binding to at least a portion of an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI);

[0247] And wherein the unligated oligonucleotide includes a base that does not correspond to the index region of the adaptor and / or the UMI of the adaptor.

[0248] 30. A hybridization buffer as described in hybridization buffer embodiment 28 or 29, wherein the blocking agent comprises a plurality of enhancing T m modification.

[0249] 31. A kit comprising a hybridization buffer as described in any of the above hybridization buffer embodiments. Exemplary methods using hybridization buffers (buffer method embodiments)

[0250] 1. A method comprising hybridizing a capture using a hybridization buffer comprising a crowding agent.

[0251] 2. The method of buffer method embodiment 1, wherein the crowding agent comprises at least one of dextran, dextran sulfate, polyethylene glycol (PEG), Ficoll, glycerol and betaine.

[0252] 3. A method as described in any of the above buffer method embodiments, wherein the crowding agent is included in the hybridization buffer in an amount of at least 0.5% (w / v), at least 1% (w / v), at least 1.5% (w / v), at least 2% (w / v), at least 3% (w / v) or at least 4% (w / v).

[0253] 4. The method of any of the preceding buffer method embodiments, wherein the crowding agent is included in the hybridization buffer in an amount of up to 1%, up to 1.5% (w / v), up to 2% (w / v), up to 3% (w / v), up to 4% (w / v), up to 5% (w / v), up to 6% (w / v), up to 8% (w / v) or up to 10% (w / v).

[0254] 5. The method of any one of the aforementioned buffer method embodiments, wherein the hybridization buffer comprises at least one of human Cot-1 DNA, a destabilizing agent and a salt.

[0255] 6. The method of buffer method embodiment 5, wherein the hybridization buffer comprises human Cot-1 DNA in an amount of at least 0.05 mg / mL, at least 0.1 mg / mL, at least 0.2 mg / mL or at least 0.3 mg / mL.

[0256] 7. The method of buffer method embodiment 5 or 6, wherein the hybridization buffer comprises human Cot-1 DNA in an amount of up to 0.1 mg / mL, up to 0.2 mg / mL, up to 0.3 mg / mL or up to 0.5 mg / mL.

[0257] 8. The method of any one of Buffer Method Embodiments 5 to 7, wherein the destabilizing agent comprises at least 1% (v / v), at least 5% (v / v), or at least 10% (v / v) of the hybridization buffer.

[0258] 9. The method of any one of buffer method embodiments 5 to 8, wherein the destabilizing agent comprises up to 5% (v / v), up to 10% (v / v), or up to 15% (v / v) of the hybridization buffer.

[0259] 10. The method of any one of Buffer Method Embodiments 5 to 9, wherein the destabilizing agent comprises formamide.

[0260] 11. The method of any one of buffer method embodiments 5 to 10, wherein the hybridization buffer comprises at least 0.1 M, at least 0.2 M, at least 0.3 M, at least 0.4 M, at least 0.5 M, at least 0.6 M, at least 0.7 M, at least 0.8 M, at least 0.9 M or at least 1 M salt.

[0261] 12. The method of any one of buffer method embodiments 5 to 11, wherein the hybridization buffer comprises up to 0.2 M, up to 0.3 M, up to 0.4 M, up to 0.5 M, up to 0.6 M, up to 0.7 M, up to 0.8 M, up to 0.9 M, up to 1 M, up to 2 M, up to 3 M or up to 4 M salt.

[0262] 13. The method of any one of Buffer Method Embodiments 5 to 12, wherein the salt comprises NaCl.

[0263] 14. The method of any of the preceding buffer method embodiments, wherein the hybridization buffer comprises phosphate.

[0264] 15. The method of buffer method embodiment 14, wherein the hybridization buffer comprises at least 40 mM, at least 50 mM, at least 55 mM, at least 60 mM, at least 65 mM or at least 70 mM phosphate.

[0265] 16. The method of buffer method embodiment 14 or 15, wherein the hybridization buffer comprises up to 50 mM, up to 55 mM, up to 60 mM, up to 65 mM, up to 70 mM, up to 75 mM or up to 80 mM phosphate.

[0266] 17. The method of any one of buffer method embodiments 14 to 16, wherein the phosphate comprises KH2PO4-K2HPO4.

[0267] 18. The method of any of the preceding buffer method embodiments, wherein the hybridization buffer comprises a detergent.

[0268] 19. A method as described in buffer method embodiment 17, wherein the hybridization buffer comprises at least 0.001% (v / v), at least 0.01% (v / v), at least 0.05% (v / v), at least 0.1% (v / v), at least 1% (v / v) or at least 5% (v / v) detergent.

[0269] 20. A method as described in buffer method embodiment 18 or 19, wherein the hybridization buffer comprises up to 0.01% (v / v), up to 0.05% (v / v), up to 0.1% (v / v), up to 1% (v / v), up to 5% (v / v) or up to 10% (v / v) of detergent.

[0270] 21. The method of any one of buffer method embodiments 18 to 20, wherein the hybridization buffer comprises Tween 20.

[0271] 22. The method of any one of the aforementioned buffer method embodiments, wherein the hybridization buffer comprises

[0272] 0.5% to 10% dextran sulfate,

[0273] 0.05mg / mL to 0.5mg / mL Cot-1,

[0274] 1% to 15% (v / v) formamide,

[0275] 40mM to 80mM KH2PO4-K2HPO4,

[0276] 0.1M to 4M NaCl, and

[0277] 0.001% to 10% (v / v) Tween 20.

[0278] 23. A method as described in any one of the aforementioned buffer method embodiments, wherein the hybridization buffer comprises

[0279] 1.5% Dextran sulfate,

[0280] 0.2mg / mL Cot-1,

[0281] 10% (v / v) formamide,

[0282] 66.6mM KH2PO4-K2HPO4,

[0283] 0.8M NaCl and

[0284] 0.04% (v / v) Tween 20.

[0285] 24. The method of any of the preceding buffer method embodiments, wherein the hybridization buffer comprises a blocking agent.

[0286] 25. The method of buffer method embodiment 24, wherein the blocking agent is present at a concentration of at least 0.001 mM, at least 0.005 mM, at least 0.01 mM, at least 0.05 mM, or at least 0.1 mM.

[0287] 26. The method of buffer method embodiment 24 or 25, wherein the blocking agent is present in a concentration of up to 0.01 mM, up to 0.05 mM, up to 0.1 mM, up to 0.2 mM, or up to 0.5 mM.

[0288] 27. The method of any of the preceding buffer method embodiments, wherein the method comprises forming a hybridization buffer from a first composition comprising human Cot-1 DNA and a blocking agent and a second composition comprising formamide and dextran sulfate.

[0289] 28. The method of any of the preceding buffer method embodiments, wherein the method comprises contacting the library with the hybridization buffer, wherein the hybridization buffer comprises a blocking agent.

[0290] 29. The method of buffer method embodiment 28, wherein the method comprises combining samples from at least two library preparations before contacting the libraries with the blocking agent in the presence of the hybridization buffer.

[0291] 30. The method of buffer method embodiment 29, wherein at least 1 μL, at least 2 μL, at least 3 μL, at least 5 μL, at least 10 μL, at least 15 μL, or at least 20 μL of sample generated from each library preparation is combined.

[0292] 31. A method as described in buffer method embodiment 29 or 30, wherein up to 2 μL, up to 3 μL, up to 5 μL, up to 10 μL, up to 15 μL, up to 20 μL, up to 25 μL, up to 30 μL, up to 40 μL or up to 50 μL of sample generated by each library preparation is combined.

[0293] 32. The method of any one of buffer method embodiments 29 to 31, wherein at least 10 ng, at least 15 ng, at least 25 ng, at least 50 ng, at least 100 ng, at least 200 ng, at least 500 ng, at least 1,000 ng, or at least 5,000 ng of DNA from each library preparation is combined.

[0294] 33. The method of any of buffer method embodiments 29 to 32, wherein up to 15 ng, up to 25 ng, up to 50 ng, up to 100 ng, up to 200 ng, up to 500 ng, up to 1,000 ng, up to 5,000 ng, up to 10,000 ng, or up to 12,000 ng of DNA from each library preparation is combined.

[0295] 34. The method of any one of buffer method embodiments 29 to 33, wherein the combined DNA concentration of each sample produced by the library preparation is at least 0.1 ng / μL, at least 0.3 ng / μL, at least 0.4 ng / μL, at least 0.5 ng / μL, at least 1 ng / μL, at least 2 ng / μL, at least 4 ng / μL, at least 6 ng / μL, at least 8 ng / μL, at least 10 ng / μL, at least 12 ng / μL, at least 20 ng / μL, at least 50 ng / μL, at least 60 ng / μL, at least 100 ng / μL or at least 200 ng / μL.

[0296] 35. The method of any one of buffer method embodiments 29 to 34, wherein the combined DNA concentration of each sample resulting from the library preparation is up to 0.4 ng / μL, up to 0.5 ng / μL, up to 1 ng / μL, up to 2 ng / μL, up to 4 ng / μL, up to 6 ng / μL, up to 8 ng / μL, up to 10 ng / μL, up to 12 ng / μL, up to 15 ng / μL, up to 20 ng / μL, up to 50 ng / μL, up to 100 ng / μL, up to 120 ng / μL, up to 200 ng / μL, up to 300 ng / μL or up to 400 ng / μL.

[0297] 36. The method of any one of buffer method embodiments 29 to 35, wherein the DNA concentration after pooled library preparation is in the range of 0.3 ng / μL to 400 ng / μL.

[0298] 37. The method of any one of Buffer Method Embodiments 29 to 36, wherein the method further comprises contacting the library member with a probe, wherein the probe hybridizes to a region of interest within the library member, and wherein the probe comprises a ligand.

[0299] 38. The method of buffer method embodiment 37, wherein the ligand comprises a biotin group.

[0300] 39. The method of any one of buffer method embodiments 29 to 38, wherein the method comprises forming a hybridization mixture comprising library members, the hybridization buffer (wherein the hybridization buffer comprises a blocking agent), and a probe.

[0301] 40. The method of buffer method embodiment 39, wherein the hybridization mixture further comprises human Cot-1 DNA.

[0302] 42. A method as described in buffer method embodiment 39 or 40, wherein the method includes using a hybridization mixture of up to 150 μL, up to 140 μL, up to 130 μL, up to 120 μL, up to 110 μL, up to 100 μL, up to 90 μL, up to 80 μL, up to 70 μL, up to 60 μL or up to 50 μL.

[0303] 42. The method of any of buffer method embodiments 39 to 41, wherein the method comprises using a hybridization mixture of a volume of at least 10 μL, at least 20 μL, at least 30 μL, at least 40 μL, at least 50 μL, at least 60 μL, or at least 70 μL.

[0304] 43. A method as described in any of buffer method embodiments 39 to 42, wherein the DNA concentration in the hybridization mixture is at least 0.1 ng / μL, at least 0.3 ng / μL, at least 0.4 ng / μL, at least 0.5 ng / μL, at least 1 ng / μL, at least 2 ng / μL, at least 4 ng / μL, at least 6 ng / μL, at least 8 ng / μL, at least 10 ng / μL, at least 12 ng / μL, at least 15 ng / μL, at least 20 ng / μL, at least 50 ng / μL, at least 75 ng / μL, at least 100 ng / μL, at least 120 ng / μL, at least 150 ng / μL, at least 200 ng / μL.

[0305] 44. The method of any one of buffer method embodiments 39 to 43, wherein the DNA concentration in the hybridization mixture is up to 0.3 ng / μL, up to 0.4 ng / μL, up to 0.5 ng / μL, up to 1 ng / μL, up to 2 ng / μL, up to 4 ng / μL, up to 6 ng / μL, up to 8 ng / μL, up to 10 ng / μL, up to 12 ng / μL, up to 15 ng / μL, up to 20 ng / μL, up to 50 ng / μL, up to 75 ng / μL, up to 100 ng / μL, up to 120 ng / μL, up to 150 ng / μL, up to 200 ng / μL or up to 500 ng / μL.

[0306] 45. The method of any one of buffer method embodiments 37 to 44, wherein the library is contacted with the probe for up to 3 days, up to 2 days, up to 24 hours, up to 20 hours, up to 16 hours, up to 12 hours, up to 6 hours, up to 3 hours, up to 2 hours, up to 90 minutes, up to 1 hour, or up to 30 minutes.

[0307] 46. ​​The method of any one of buffer method embodiments 37 to 45, wherein the library is contacted with the probe for at least 30 minutes, at least 45 minutes, at least 1 hour, at least 90 minutes, at least 2 hours, at least 3 hours, at least 6 hours, at least 12 hours, at least 16 hours, at least 20 hours, or at least 24 hours.

[0308] 47. The method of any one of buffer method embodiments 39 to 46, wherein the method comprises maintaining the hybridization mixture at a hybridization temperature, and wherein the hybridization temperature is at least 50°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C or at least 70°C.

[0309] 48. The method of any one of buffer method embodiments 39 to 47, wherein the method comprises maintaining the hybridization mixture at a hybridization temperature, and wherein the hybridization temperature is up to 56°C, up to 58°C, up to 60°C, up to 61°C, up to 62°C, up to 63°C, up to 64°C, up to 65°C or up to 70°C.

[0310] 49. The method of any one of buffer method embodiments 39 to 48, wherein the method comprises maintaining the hybridization mixture at the hybridization temperature for up to 3 days, up to 2 days, up to 24 hours, up to 20 hours, up to 16 hours, up to 12 hours, up to 6 hours, up to 3 hours, up to 2 hours, up to 90 minutes, up to 1 hour, or up to 30 minutes.

[0311] 50. The method of any one of buffer method embodiments 39 to 49, wherein the method comprises maintaining the hybridization mixture at the hybridization temperature for at least 30 minutes, at least 45 minutes, at least 1 hour, at least 90 minutes, at least 2 hours, at least 3 hours, at least 6 hours, at least 12 hours, at least 16 hours, at least 20 hours, or at least 24 hours.

[0312] 51. The method of any one of buffer method embodiments 37 to 50, wherein the method further comprises capturing the probe using a capture device after probe hybridization.

[0313] 52. The method of buffer method embodiment 51, wherein capturing the probe comprises using streptavidin beads.

[0314] 53. The method of any one of buffer method embodiments 37 to 52, wherein the method comprises forming a capture mixture comprising the probe and the capture device.

[0315] 54. The method of buffer method embodiment 53, wherein the method comprises maintaining the capture mixture at a capture temperature of at least 50°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C or at least 70°C.

[0316] 55. The method of buffer method embodiment 53 or 54, wherein the method comprises maintaining the capture mixture at a capture temperature of up to 56°C, up to 58°C, up to 60°C, up to 61°C, up to 62°C, up to 63°C, up to 64°C, up to 65°C or up to 70°C.

[0317] 56. The method of any one of buffer method embodiments 53 to 55, wherein the method comprises maintaining the capture mixture at the capture temperature for at least 2 minutes, at least 5 minutes, at least 10 minutes, or at least 15 minutes.

[0318] 57. The method of any of buffer method embodiments 53 to 56, wherein the method comprises maintaining the capture mixture at the capture temperature for up to 5 minutes, up to 10 minutes, up to 15 minutes, up to 20 minutes, up to 30 minutes, or up to 45 minutes.

[0319] 58. The method of any one of buffer method embodiments 53 to 57, wherein the method comprises washing the captured probe.

[0320] 59. The method of any one of buffer method embodiments 53 to 58, wherein the method further comprises eluting the captured library members from the capture device into an eluent.

[0321] 60. The method of any one of buffer method embodiments 53 to 59, wherein the method further comprises eluting the captured library members from the probe into an eluent.

[0322] 61. The method of buffer method embodiment 60, wherein at least 60 femtomoles, at least 80 femtomoles, at least 90 femtomoles, at least 100 femtomoles, or at least 150 femtomoles of DNA is eluted.

[0323] 62. The method of buffer method embodiment 60 or 61, wherein up to 150 femtomoles, up to 500 femtomoles, up to 1 picomoles, up to 2 picomoles, or up to 3 picomoles of DNA is eluted.

[0324] 63. The method of any one of buffer method embodiments 60 to 62, wherein the DNA concentration of the eluate is at least 1.1 pM, at least 1.2 pM, at least 1.3 pM, at least 10 pM, or at least 100 pM.

[0325] 64. The method of any one of buffer method embodiments 60 to 63, wherein the DNA concentration of the eluate is up to 100 pM, up to 200 pM, up to 250 pM, or up to 300 pM.

[0326] 65. The method of any one of buffer method embodiments 60 to 64, wherein the DNA concentration of the eluate is in the range of 1.3 pM to 250 pM.

[0327] 66. The method of any one of buffer method embodiments 37 to 65, wherein the method further comprises sequencing the library members.

[0328] 67. A method as described in buffer method embodiment 66, wherein the method includes amplifying the library members before sequencing the library members.

[0329] 68. The method of buffer method embodiment 66, wherein the method does not comprise amplifying the library members prior to sequencing the library members.

[0330] 69. The method of any one of buffer method embodiments 24 to 68, wherein the blocking agent comprises T m Enhanced oligonucleotides.

[0331] 70. The method of any one of buffer method embodiments 24 to 69, wherein the blocking agent comprises a plurality of enhancing T m modification.

[0332] 71. The method of embodiment 70 of the buffer method, wherein increasing the T of the blocking agent m The multiple modifications include at least one of cross-linked oligonucleotides; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridged nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5 modified pyrimidine base; propynyl pyrimidine; morpholino; phosphoramidite; and 5'-pyrene cap.

[0333] 72. The method of any one of buffer method embodiments 24 to 71, wherein the blocking agent comprises an oligonucleotide;

[0334] wherein the blocker is capable of binding to an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI);

[0335] and wherein the region of the blocker capable of binding to the index region and / or UMI of the adaptor comprises:

[0336] at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or

[0337] a universal base and at least one non-universal base.

[0338] 73. The method of any one of buffer method embodiments 24 to 72, wherein the blocking agent comprises two unligated oligonucleotides;

[0339] wherein the blocker is capable of binding to at least a portion of an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI);

[0340] And wherein the unligated oligonucleotide includes a base that does not correspond to the index region of the adaptor and / or the UMI of the adaptor.

[0341] Exemplary Methods of PCR-Free Hybridization Capture (Capture Method Example)

[0342] 1. A method comprising:

[0343] contacting the library with a blocking agent in the presence of a hybridization buffer;

[0344] and contacting the library with a probe, wherein the probe hybridizes to a region of interest within a member of the library;

[0345] Wherein the method does not comprise amplifying the library members using PCR prior to sequencing the library members.

[0346] 2. The method of capture method embodiment 1, wherein the probe further comprises a ligand, and wherein the library member is eluted from the ligand before sequencing the library member.

[0347] 3. The method of capture method embodiment 2, wherein the ligand comprises biotin.

[0348] 4. The method of any one of Capture Method Embodiments 2 or 3, comprising loading the library members onto a flow cell after elution from the ligand.

[0349] 5. The method of any one of capture method embodiments 1 to 4, wherein the method further comprises capturing the probe using a capture device after probe hybridization.

[0350] 6. The method of capture method embodiment 5, wherein the capture device comprises streptavidin.

[0351] 7. The method of any one of capture method embodiments 5 or 6, comprising loading the library members onto a flow cell after elution from the capture device.

[0352] 8. The method of capture method embodiment 4 or 7, comprising loading the library members onto a flow cell in a volume of less than 100 μL, less than 90 μL, less than 80 μL, less than 70 μL, or less than 60 μL.

[0353] 9. The method of capture method embodiment 4 or 7, comprising loading the library members onto the flow cell at a concentration of at least 1.1 pM, at least 1.2 pM, at least 1.3 pM, at least 10 pM or at least 100 pM.

[0354] 10. The method of capture method embodiment 4, 7 or 9, comprising loading the library members onto a flow cell at a concentration of up to 100 pM, up to 200 pM, up to 250 pM or up to 300 pM.

[0355] 11. The method of any one of capture method embodiments 4, or 7-10, comprising loading the library members onto a flow cell using a direct flow cell loading fixture.

[0356] 12. The method of any of the preceding capture method embodiments, wherein the hybridization buffer comprises a crowding agent.

[0357] 13. The method of capture method embodiment 12, wherein the hybridization buffer comprises

[0358] 0.5% to 10% dextran sulfate,

[0359] 0.05mg / mL to 0.5mg / mL human Cot-1 DNA,

[0360] 1% to 15% (v / v) formamide,

[0361] 40mM to 80mM KH2PO4-K2HPO4,

[0362] 0.1M to 4M NaCl, and

[0363] 0.001% to 10% (v / v) Tween 20.

[0364] 14. The method of any one of the preceding capture method embodiments, wherein the blocking agent comprises T m Enhanced oligonucleotides.

[0365] 15. The method of any one of the preceding capture method embodiments, wherein the blocking agent comprises a plurality of enhanced T m modification.

[0366] 16. The method of capture method embodiment 15, wherein increasing the T of the blocking agent m The multiple modifications include at least one of cross-linked oligonucleotides; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; locked nucleic acid (LNA); bridged nucleic acid (BNA); tricyclic nucleic acid; peptide nucleic acid (PNA); C5 modified pyrimidine base; propynyl pyrimidine; morpholino; phosphoramidite; and 5'-pyrene cap.

[0367] 17. The method of any of the preceding capture method embodiments, wherein the blocking agent comprises an oligonucleotide;

[0368] wherein the blocker is capable of binding to an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI);

[0369] and wherein the region of the blocker capable of binding to the index region and / or UMI of the adaptor comprises:

[0370] at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or

[0371] a universal base and at least one non-universal base.

[0372] 18. The method of any of the preceding capture method embodiments, wherein the blocking agent comprises two unligated oligonucleotides;

[0373] wherein the blocker is capable of binding to at least a portion of an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI);

[0374] And wherein the unligated oligonucleotide comprises a base that does not correspond to the index region of the adaptor and / or the UMI of the adaptor.

[0375] The present invention is illustrated by the following examples. It should be understood that the specific examples, materials, amounts and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

[0376] Example

[0377] The following numbered items provide examples described herein, but the examples described herein are not limiting.

[0378] Item 1. A hybridization buffer comprising human Cot-1 DNA, a destabilizing agent, at least one of a salt and a blocking agent, and a crowding agent.

[0379] Item 2. The hybridization buffer according to Item 1, wherein the crowding agent comprises at least one of dextran, dextran sulfate, polyethylene glycol (PEG), Ficoll, glycerol and betaine.

[0380] Item 3. A hybridization buffer as described in any of the preceding items, wherein the hybridization buffer comprises: 0.5% to 10% dextran sulfate, 0.05 mg / mL to 0.5 mg / mL Cot-1, 1% to 15% (v / v) formamide, 40 mM to 80 mM KH2PO4-K2HPO4, 0.1 M to 4 M NaCl, and 0.001% to 10% (v / v) Tween 20.

[0381] Item 4. A hybridization buffer as described in any of the preceding items, wherein the blocking agent comprises a plurality of enhancing T m modification.

[0382] Item 5. A method comprising using the hybridization buffer as described in any one of the preceding items.

[0383] Item 6. The method of Item 5, comprising forming a hybridization mixture comprising a library member, a hybridization buffer, human Cot-1 DNA, a blocking agent, and a probe.

[0384] Item 7. A method as described in Item 6, wherein the hybridization mixture includes samples from at least two library preparations, wherein at least 10 ng, at least 25 ng, at least 50 ng, at least 100 ng, at least 200 ng, or at least 500 ng of DNA from each library preparation is combined.

[0385] Item 8. The method of Item 6 or Item 7, wherein the DNA concentration of the hybridization mixture is in the range of 0.1 ng / μL to 120 ng / μL.

[0386] Item 9. The method of any one of Items 6 to 8, wherein the method comprises: contacting the library member with the probe, wherein the probe hybridizes to a region of interest within the library member, and wherein the probe comprises a ligand; capturing the probe using a capture device after hybridization of the probe, and eluting the captured library member from the capture device into an eluent, wherein the DNA concentration of the eluent is in the range of 1.3 pM to 250 pM.

[0387] Item 10. The method of any one of Items 6 to 9, wherein the method further comprises sequencing the library members, and wherein the method does not comprise amplifying the library members prior to sequencing the library members.

[0388] Item 11. The method of Item 10, wherein the method comprises loading the library members onto a flow cell using a direct flow cell loading fixture.

[0389] Item 12. A blocker comprising an oligonucleotide; wherein the blocker is capable of binding to an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI); and wherein the region of the blocker capable of binding to the index region and / or UMI of the adaptor comprises: at least three thymine bases, at least four thymine bases, at least five thymine bases, at least six thymine bases, at least seven thymine bases, at least eight thymine bases, at least nine thymine bases, or at least ten thymine bases; or a universal base and at least one non-universal base.

[0390] Item 13. A blocker comprising two unligated oligonucleotides; wherein the blocker is capable of binding to at least a portion of an adaptor, wherein the adaptor comprises a universal primer sequence, and at least one of an index region or a unique molecular identifier (UMI); and wherein the unligated oligonucleotide comprises a base that does not correspond to the index region and / or the UMI of the adaptor.

[0391] Item 14. The blocker of Item 12 or 13, wherein the universal primer sequence comprises at least one of P5, P7, P5', P7', V2.A14.METS, V2.B15.METS, the complementary sequence of V2.A14.METS, and the complementary sequence of V2.B15.METS.

[0392] Item 15. The blocking agent of any one of Items 12 to 14, wherein the blocking agent comprises a modification that increases the T of the blocking agent relative to the same blocking agent not comprising the modification. m .

[0393] Item 16. A blocking agent as described in any one of Items 12 to 15, wherein the blocking agent includes at least one of a DNA or RNA oligonucleotide modified to capture low GC regions; a cross-linked oligonucleotide; a modified 5-methyldeoxycytidine (5-methyl-dc); a 2,6-diaminopurine; a locked nucleic acid (LNA); a bridged nucleic acid (BNA); a tricyclic nucleic acid; a peptide nucleic acid (PNA); a C5-modified pyrimidine base; a propynyl pyrimidine; a morpholino; a phosphoramidite; and a 5'-pyrene cap.

[0394] Item 17. A method comprising contacting a library with a blocking agent in the presence of a hybridization buffer; and contacting the library with a probe, wherein the probe hybridizes to a region of interest within a member of the library; wherein the method does not include amplifying the library member using PCR prior to sequencing the library member.

[0395] Item 18. The method of Item 17, wherein the method comprises loading the library members onto a flow cell at a concentration of at least 1.1 pM, at least 1.2 pM, at least 1.3 pM, at least 10 pM, or at least 100 pM, and at a concentration of up to 100 pM, up to 200 pM, up to 250 pM, or up to 300 pM.

[0396] Item 19. The method of Item 17 or 18, wherein the sealant comprises a plurality of reinforcing T m modification.

[0397] Item 20. The method of any one of Items 17 to 19, wherein the hybridization buffer comprises a crowding agent.

[0398] Item 21. The method of any one of Items 17 to 20, wherein the hybridization buffer comprises 0.5% to 10% dextran sulfate, 0.05 mg / mL to 0.5 mg / mL human Cot-1 DNA, 1% to 15% (v / v) formamide, 40 mM to 80 mM KH2PO4-K2HPO4, 0.1 M to 4 M NaCl, and 0.001% to 10% (v / v) Tween 20.

[0399] Item 22. The method of any one of items 17 to 21, comprising loading the library members onto a flow cell using a direct flow cell loading fixture.

[0400] Item 23. A kit comprising the hybridization buffer according to any one of items 1 to 4.

[0401] Item 24. A kit comprising the blocking agent according to any one of items 12 to 16.

[0402] Examples

[0403] Example 1 - Hybridization and capture

[0404] Hybridization

[0405] The non-enhanced hybridization buffer contained the following components / final concentrations in a 100 μL hybridization reaction: human Cot-1 0.2 mg / ml, formamide 10% (v / v), KH2PO4-K2HPO4 66.6 mM, NaCl 0.8 M, Tween 20 0.04% (v / v).

[0406] Enhanced hybridization buffer contained the following components / final concentrations in a 100 μL hybridization reaction: dextran sulfate 1.5% (w / v), human Cot-1 0.2 mg / ml, formamide 10% (v / v), KH2PO4-K2HPO4 66.6 mM, NaCl 0.8 M, Tween 20 0.04% (v / v).

[0407] In each case, the 100 μL final reaction also contained: probes (with at least 500 probes and up to 500,000 probes) at a concentration of 125 pM / probe (total probe concentration of at least 30 nM), and up to 30 μL (50 ng-6 μg) of DNA sample. If included, the blocking agent was present at 0.2 mM.

[0408] Hybridization reactions were performed in a thermal cycler or HYBEX system with precise temperature control. After denaturation at 95°C for 5 minutes, the hybridization reactions were incubated at 58°C or 62°C for 90 minutes (total hybridization time about (~) 100 minutes) or up to 24 hours. The samples were ramped down from 95°C to 58°C or 62°C at 2°C / min (another 20 minutes), and then, depending on the probe design, incubated at 58°C or 62°C. (For the experiments described herein, the samples were incubated at 62°C).

[0409] capture

[0410] At the hybridization incubation temperature (e.g., if the hybridization reaction is incubated at 62°C for 90 minutes, use 62°C), for each 100 μL hybridization reaction, 250 μL of Streptavidin beads SMB (Streptavidin magnetic beads, Illumina, San Diego, CA) are used to capture the target DNA for 15 minutes. The target DNA is then washed with wash buffer EEW (Enhanced Enrichment Wash Buffer, Illumina, San Diego, CA (Tris-HCL, deferoxamine methanesulfonic acid (DFO), betaine and Tween20)) at the same temperature (e.g., 62°C) for 5 minutes, for a total of 4 times. Targeted DNA was eluted using fresh denaturing solution (0.1% (v / v) Tween 20 (EE1) and 2N NaOH (HP3)), neutralized with ET2 (Elution Target Buffer 2, Illumina, San Diego, CA (Tris Base, Tris Acetate)), and further amplified with primer mix (PPC; sequencing adapter primer set including 5 μM P5 and P7 primers, Illumina) and Enhanced PCR Mix (EPM) (Illumina, San Diego, CA), and cleaned up using 0.9x Solid Phase Reversible Immobilization (SPRI) beads.

[0411] Example 2 - Blocking agents containing thymine

[0412] This example describes a blocker that includes thymine in the region of the blocker corresponding to the index and / or UMI (see Figure 3D ).

[0413] Hybridization and capture were performed as described in Example 1 using enhanced hybridization buffer and 0.2 mM blocking reagent using the blocking reagents of Table 3. The resulting captured DNA was sequenced and Padded Read Enrichment was calculated using the Enrichment v3.0 BASE SPACE App (Illumina, San Diego, CA).

[0414] Blockers that include a stretch of Ts at the index sequence position require at least 8 or 10 modified nucleotides in the region of the blocker that does not correspond to the index to achieve high capture of the target DNA (as measured by enrichment of filled reads).

[0415] Oligonucleotides with sequences complementary to the index region required fewer modified nucleotides (8 and 10 nucleotides were tested) and showed higher enrichment of filled reads. The results are shown in Figure 4 With the same number of modifications in the blocker (8 or 10 nucleotides), the blocker with a sequence complementary to the index region (last column) showed a higher yield than the blocker with a stretch of T in the index region ( Figure 4 The enrichment of fill-in reads was higher (marked as "10 modifications and (T)8" in Figure 5 ).

[0416]

[0417]

[0418] Example 3 - Blockers Comprising Universal Bases and Modified Bases

[0419] Hybridization and capture were performed as described in Example 1 using 0.2 mM of the blocking agents of Table 4 in enhanced hybridization buffer. As shown in Table 4, the region of the blocking agent corresponding to the index region included a universal base (deoxyinosine) and LNA-modified guanine or random nucleotides.

[0420] Without wishing to be bound by theory, it is believed that at every third base of the blocker sequence corresponding to the index region (e.g., at the third and / or fifth position (starting from the 5' end) of the blocker sequence corresponding to the index region, such as Figure 5As shown in one embodiment, inclusion of a modified G or random nucleotide at the second and / or fourth position of the blocker sequence corresponding to the index region increases the affinity of the blocker for the library member.

[0421] Example 4 - Split Blocker

[0422] This example shows that the split LNA blocker works well with a library containing an 8-nucleotide index.

[0423] Hybridization and capture as described in Example 1 were performed using the blockers of Table 5 using an enhanced hybridization buffer. As shown in Table 5, blockers TiLNAS1 (BN025), TiLNAS2 (BN026), P5LNA (BN023) and P7LNA (BN024) do not include a region corresponding to the index region. P5LNA (BN023) and P7LNA (BN024) each include 8 LNA-modified bases. TiLNAS1 (BN025) and TiLNAS2 (BN026) each include 10 LNA-modified bases. TiLNA17 (BN027) and TiLNA18 (BN028) include a universal base (deoxyinosine) in the region of the blocker corresponding to the index region, but include a shortened region of the blocker corresponding to other regions of the adaptor.

[0424] The resulting captured DNA was sequenced and fill-in read enrichment was calculated using the Enrichment v3.0 BaseSpace App (Illumina, San Diego, CA). Fig. 6A and Figure 3E-Figure 3I The results are shown in Figure 6BThe sample "Split 4pc" contains TiLNAS1 (BN025), TiLNAS2 (BN026), P5LNA (BN023) and P7LNA (BN024) in Table 5; the sample "Inner" contains TiLNAS1 (BN025) and TiLNAS2 (BN026) in Table 5; the sample "Outer" contains P5LNA (BN023) and P7LNA (BN024) in Table 5; the sample Short8nt contains TiLNA17 (BN027) and TiLNA18 (BN028) in Table 5. Two two-part blockers ("split blockers"), including BN023, BN024, BN025, and BN026, worked as well as xGen blocking oligonucleotides (Integrated DNA Technologies, Coralville, IA), as measured by enrichment of filled reads; experiments using blockers that only blocked a portion of the adaptor did not work as well.

[0425] Example 5 - Hybridization Buffer

[0426] This example shows a comparison of on-target capture using non-enhanced hybridization buffer and enhanced hybridization buffer.

[0427] The xGen blocking oligonucleotides (Integrated DNA Technologies, Coralville, IA) and Fig. 7A Hybridization and capture were performed as described in Example 1 using enhanced hybridization buffer with the indicated dextran sulfate concentrations. The resulting captured DNA was sequenced and the enrichment of filled reads was calculated using the Enrichment v3.0 BaseSpace App (Illumina, San Diego, CA). The results are shown in Fig. 7A The inclusion of dextran sulfate allows for rapid hybridization (60 min to 90 min) in large volumes (100 μL) of hybridization buffer.

[0428] Enrichment using a 100 μL hybridization buffer volume was evaluated using four different probe sets: Coding Exome Oligos (CEX) (Illumina, San Diego, CA), IDT Exome Research Panel (IDT Exome) (Integrated DNA Technologies, Coralville, IA), TruSight Cancer Panel (TRUSIGHT Cancer Panel) (Illumina, San Diego, CA), and TruSight One Sequencing Panel (TRUSIGHT One Sequencing Panel, TSO) (Illumina, San Diego, CA). Hybridization in three hybridization buffers was tested as described in Example 1: IDT buffer from the xGenLockdown kit (Integrated DNA Technologies, Coralville, IA), and hybridization buffer with and without dextran sulfate. The results are shown in Figure 7B For all four probe sets (ranging from 4,000 to 450,000 probes), Enhanced Hybridization Buffer provided similar or higher on-target results compared to IDT Buffer.

[0429] Two key enrichment metrics (filler read enrichment and uniformity of coverage) were obtained for four panels (CEX, IDT Exome, Cancer, and TSO) using Illumina Enhanced Hybridization Buffer with IDT xGen Blocker at different hybridization incubation times and with and without an additional temperature ramp step. The results are shown in Figure 7C The black dashed line in the left panel indicates the results of hybridization in the buffer without dextran sulfate.

[0430] The 3 rounds of 12-plex library input were combined by volume to a total of 30 μL and enriched using Illumina Enhanced Hybridization Buffer with IDT xGen Blocker. Samples were run on various Illumina sequencers (NovaSeq, NextSeq, and iSeq). No sample concentration step was required. Results are shown in Figure 7D-7F The results showed that when using the enhanced hybridization buffer containing dextran sulfate, up to 30 μL of sample can be accommodated in the hybridization reaction (e.g., a single 15 μL sample or a 12-plex run of 2.5 μL each). The use of the enhanced hybridization buffer allowed the enrichment of up to 12 samples in one reaction without the use of speed vacuum, spin columns, or SPRI beads to further reduce the pool volume.

[0431] Example 6 - Improved Adapter + Enhanced Hybridization Buffer

[0432] The enrichment performance of the IDT exome panel (Cat. No. 1056114, Integrated DNA Technologies, Coralville, IA) was tested using the following: (1) Lockdown kit (Integrated DNA Technologies, Coralville, IA) with IDT buffer (17 μL); (2) non-enhanced hybridization buffer with non-enhanced adapter blockers (Nextera Blocker 1i5 (BN001) and Nextera Blocker 2i7 (BN002) in Table 2) in a small (11 μL) reaction volume (TiE0); (3) non-enhanced hybridization buffer with enhanced adapter blockers (xGen Blockers) in a small (11 μL) reaction volume (TiE3); (4) non-enhanced hybridization buffer with enhanced adapter blockers (xGen Blockers) in a large (100 μL) reaction volume (TiE4); and (5) enhanced hybridization buffer with enhanced adapter blockers (xGen Blockers) in a large (100 μL) reaction volume (TiE9). The results are shown in Fig. 8A It was also shown that enrichment performance was improved when modified blocking agents, increased wash temperatures, and / or crowding agents (dextran sulfate) were used in the hybridization buffer.

[0433] Enrichment performance (as measured using fill-in read enrichment) was evaluated in nine probe sets using the IDT enrichment assay (Cat. No. 1080584, Integrated DNA Technologies, Coralville, IA) and in the Illumina enrichment assay using enhanced hybridization buffer. High fill-in read enrichment was achieved in a 100 μL reaction volume using various probe sets (500-450,000 probes). The probe sets included: (1) xGen Exome Research Panel (IDT Exome) (Catalog No. 1056114, Integrated DNA Technologies, Coralville, Iowa); (2) Twist Human Core Exome (Twist Bioscience, Inc., Catalog No. 100254); (3) Coding Exome Oligonucleotides (CEX) (Catalog No. 15034575, Illumina, San Diego, California); (4) TruSight One (Illumina, San Diego, California, Catalog No. FC-141-1007; probe catalog No. 15046658); (5) TruSight OneExpanded (Illumina, San Diego, catalog number FC-141-2007; probe catalog number 20015656); (6) TruSight Cancer (Illumina, San Diego, California, catalog number FC-121-0202; probe catalog number 15035642); (7) TruSight Cardio (Illumina, San Diego, California, catalog number FC-141-1010; probe catalog number 15069654); (8) TruSight RNA Fusion Panel (TruSight RNA Fusion Panel, Illumina, San Diego, California, catalog number 20000906); (9) Oncology DNA Probes Master Pool (OPD1) (Oncology DNA Probes Master Pool, Illumina, catalog number OP-101-1004; probe catalog number 20001565). The results are shown in Figure 8BThe white columns (column 1) show the performance of the IDT exome panel in the IDT lockdown enrichment workflow with Nextera rapid capture library preparation (Illumina, San Diego, CA). The gray columns show the performance of each group using the Illumina enrichment assay with enhanced hybridization buffer and IDT xGEN adapter blocker. The black horizontal line shows the comparative results obtained for the corresponding groups using the Twist enrichment assay (Twistenrichment assay, Twist Biosciences) (column 3), Nextera rapid capture library preparation (columns 4-8), or the TruSight Tumor 170 workflow (in the case of the OPD1 group) (column 10). The performance of each group in the Illumina enrichment assay using enhanced hybridization buffer was evaluated in at least three independent experiments; error bars represent standard deviations.

[0434] Somatic variants were detected using a single-hybrid enrichment protocol for a 12-gene, 535-probe set using enhanced hybridization buffer and xGen blocker to enrich libraries generated from the Horizon Discover HD701 quantitative multiplex (QM) DNA standard. Figure 8C The data presented in show the expected variant frequency (x-axis) compared to the called variant frequency (y-axis). Figure 8C Each graph in represents different concentrations of high-affinity adapter blockers (IDT xGen adapter blockers, 0.1x (0.02mM) and 0.5x (0.1mM) and negative control (no high-affinity adapter blocker). Each point represents a somatic variant call, colored by read depth. The red dashed line represents the predicted perfect correlation between the known variant frequency and the called variant frequency. The blue and gray shades represent the best fit line and 95% confidence interval of the called variant frequency compared to the known variant frequency, respectively. For IDT xGen adapter blockers (0.1X (0.02mM), 0.5X (0.1mM)), the expected variant frequency (x-axis) is correlated with the known (called) variant frequency (y-axis), but not for the negative control (no high-affinity adapter blocker).

[0435] Example 7A - PCR-free hybridization capture using TruSeq adapter-ligated libraries

[0436] This example shows PCR-free hybridization capture.

[0437] Hybridization was performed using xGen Lockdown reagents (Integrated DNA Technologies, Coralville, IA) according to the package instructions (with the following modifications). Targeted DNA was prepared using the TruSeq adapter ligation method and captured using 100 μL Dynabeads M-270 Streptavidin (Integrated DNA Technologies, Coralville, IA). Hybridizations were incubated for only 30 min, rather than the recommended 4 h. The following protocol was then followed:

[0438] 1. Incubate the beads with 10 μL 0.1 N NaOH to denature the captured library from the probes and release them into solution.

[0439] 2. Remove captured library solution from beads (using magnet) and neutralize with 10 μL 200 mM Tris.HCl pH 7.0.

[0440] 3. (Optional) Add denatured PhiX Control v3 (Illumina, San Diego, CA) to the sample, up to 7.5 μL of Resuspension Buffer (RSB) (Illumina, San Diego, CA).

[0441] 4. Add 27.5uL 2x HT1 (hybridization buffer, Illumina, San Diego, CA).

[0442] The obtained samples (in 55 μL 1x HT1 buffer) were directly loaded onto the flow cell using a pipette or using a flow cell loading fixture, such as described in U.S. Provisional Patent Application No. 62 / 564,466 filed on September 28, 2017. The results are shown in Table 6A. The control (column 1) was run using the same conditions as the PCR-free method, except that PCR was performed after capture. The initial attempt to perform PCR-free enrichment was shown in column 2, and it was shown that too few reads resulted in an inability to reach an acceptable coverage level for the exon group. Only about 18x ​​average target coverage was achieved, and the goal was to exceed about 50x. For the second attempt (column 3), a direct flow cell loading fixture was used, and the DNA input increased in the display hybridization increased the sequencing yield of the PCR-free enrichment method to about 140x, much greater than about 40x target. The PCR-free data was downsampled to 70 million reads (column 4), and the indicators obtained were similar to the control (or even better).

[0443] Example 7B - Improving exome quality from short hybridization times using bead-based PCR-free hybridization capture of Nextera libraries

[0444] A control experiment was performed using similar conditions as in Example 7A, but using libraries generated using a bead-based tagmentation library preparation method and using corresponding blocking oligonucleotides. In this experiment, both hybridization duration and PCR amplification were variable. The recommended 4-hour hybridization reaction protocol (with post-PCR capture (about 7.5 hours in total, see IDT xGen protocol) and sequencing using a NextSeq instrument without direct flow cell loading) was used as a control (a schematic diagram of this workflow is shown in Fig. 9B ), and compared to two conditions using only 30 min hybridization (with and without post-PCR capture) and with direct flow cell loading ( Fig. 9C ). Shortening the duration of hybridization and eliminating PCR allows the enrichment protocol to be performed in only about 2 hours. Fig.9D A schematic diagram of this workflow with shortened hybridization time and no PCR is shown.

[0445] The results are shown in Table 6B. All data were downsampled to about 23 million clusters. In the first column (control), the data represent high-quality exomes, but the workflow is about 7.5 hours long. When hybridization is shortened to 30 minutes, the protocol duration is reduced to about 4 hours in total (column 2); however, compared with the control, the number of PCR repeats (PCR duplicates) increases. The increased PCR repeats also reduce the diversity of the library and the corresponding coverage of about 20x. When PCR is removed from the 30-minute workflow (column 3), the PCR repeat number is greatly reduced, the diversity is increased to a level higher than the control, and the workflow is much shorter (2 hours compared to 7.5 hours). This example emphasizes that the removal of PCR can improve the quality of hybridization capture reactions by minimizing the duplication of templates during PCR.

[0446]

[0447] Example 8 - Blocker Comparison

[0448] Hybridization and capture were performed as described in Example 1 using 0.2 mM blockers BN001 and BN002; BX003 and BX007; BN007 and BN008; BN005 and BN006; or BN023, BN024, BN025, and BN026 (as described in Table 2A) in enhanced hybridization buffer. "Unmodified" blockers BN001 and BN002 include thymine in the region of the blocker corresponding to the index region of the adaptor and include a base complementary to the adaptor in the region of the blocker corresponding to the non-index region of the adaptor; blockers BN001 and BN002 do not contain a modified base and include a 3'-ddC terminal group. Blockers BX003 and BX007 are modified versions of BN001 and BN002, each having two AP-dC-CE phosphoramidite (G-clamp) substitutions in the region of the blocker corresponding to the non-index region of the adaptor. Blockers BN007 and BN008 are modified versions of BN001 and BN002, having a universal base (deoxyinosine) in the region of the blocker corresponding to the index region of the adaptor and a BNA-modified base in the region of the blocker corresponding to the non-index region of the adaptor. Blockers BN023 and BN025 are modified versions of the region of BN001 corresponding to the non-index region of the adaptor and include LNA-modified bases; the blockers also include a 3'-spacer C3 instead of 3'-ddC. Blockers BN024 and BN026 are modified versions of the region of BN002 corresponding to the non-index region of the adaptor and include LNA-modified bases; the blockers also include a 3'-spacer C3 instead of 3'-ddC.

[0449] The resulting captured DNA was sequenced and the fill-in read enrichment (a measure of the amount of captured on-target DNA) was calculated. The results are shown in Fig.10 and showed that various modifications of the “unmodified” blocker improved fill-in read enrichment in hybridization assays.

[0450] Example 9 - Comparison of Splitting Blockers

[0451] Hybridization and capture were performed as described in Example 1 using 0.2 mM BN001 and BN002; or BN023, BN024, BN025, and BN026 (as described in Table 2A) in an enhanced hybridization buffer. The corresponding adapters included either an 8-nucleotide index or a 10-nucleotide index. The resulting captured DNA was sequenced and the filler read enrichment was calculated. The results are shown in Fig.11 In, it was shown that the use of a "split blocker" (i.e., a blocker that does not include bases corresponding to the index region of an adaptor) allows the same blocker to be used with adaptors having a variety of index sequences and index lengths. These results suggest that split blockers can be used in situations where it is unfavorable to accommodate changes in index design.

[0452] The complete disclosures of all patents, patent applications, and publications, as well as electronically available materials (including, for example, nucleotide sequence submissions in GenBank and RefSeq, and amino acid sequence submissions in, for example, SwissProt, PIR, PRF, PDB, and translations of annotated coding regions from GenBank and RefSeq) are incorporated herein by reference. In the event of any inconsistency between the disclosure of the present application and the disclosure of any document incorporated herein by reference, the disclosure of the present application shall prevail. The foregoing detailed description and examples are given only for clear understanding. No unnecessary limitations should be construed. The present invention is not limited to the exact details shown and described, and variations obvious to those skilled in the art will be included in the present invention defined by the claims. Sequence Listing <110> ILLUMINA, INC. ILLUMINA CAMBRIDGE LIMITED SLATTER, Andrew F., et al. <120> Compositions and methods for improving library enrichment <130> 01243-0009-00PCT <150> US 62 / 764,753 <151> 2018-08-15 <160> 123 <170> PatentIn version 3.5 <210> 1 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TN001, Nextera 8nt Adaptor-i5 <220> <221> misc_feature <222> (30)..(37) <223> n is a, c, g, or t <400> 1 aatgatacgg cgaccaccga gatctacacn nnnnnnntcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 2 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TN002, Nextera 8nt Adaptor-i7 <220> <221> misc_feature <222> (25)..(32) <223> n is a, c, g, or t <400> 2 caagcagaag acggcatacg agatnnnnnn nngtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 3 <211> 72 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TN003, Nextera 10nt Adaptor-i5 <220> <221> misc_feature <222> (30)..(39) <223> n is a, c, g, or t <400> 3 aatgatacgg cgaccaccga gatctacacn nnnnnnnnnt cgtcggcagc gtcagatgtg 60 tataagagac ag 72 <210> 4 <211> 68 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TN004, Nextera 10nt Adaptor-i7 <220> <221> misc_feature <222> (25)..(34) <223> n is a, c, g, or t <400> 4 caagcagaag acggcatacg agatnnnnnn nnnngtctcg tgggctcgga gatgtgtata 60 agagacag 68 <210> 5 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TN005, Nextera Short Adaptor - i5 <400> 5 tcgtcggcag cgtcagatgt gtataagaga cagt 34 <210> 6 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TN006, Nextera Short Adaptor - i7 <400> 6 ctgtctctta tacacatctc cgagcccacg agac 34 <210> 7 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TN007, Nextera nrUMI Adaptor-i5 <220> <221> misc_feature <222> (35)..(40) <223> n is a, c, g, or t <400> 7 tcgtcggcag cgtcagatgt gtataagaga cagtnnnnnn t 41 <210> 8 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TN008, Nextera nrUMI Adaptor-i7 <220> <221> misc_feature <222> (1)..(6) <223> n is a, c, g, or t <400> 8 nnnnnnctgt ctcttataca catctccgag cccacgagac 40 <210> 9 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL001, TruSeq Universal Adapter- i5 <400> 9 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58 <210> 10 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL002, TruSeq 6nt Adapter-i7 <220> <221> misc_feature <222> (34)..(39) <223> n is a, c, g, or t <400> 10 gatcggaaga gcacacgtct gaactccagt cacnnnnnna tctcgtatgc cgtcttctgc 60 ttg 63 <210> 11 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL003, TruSeq 8nt Adaptor-i5 <220> <221> misc_feature <222> (30)..(37) <223> n is a, c, g, or t <400> 11 aatgatacgg cgaccaccga gatctacacn nnnnnnnaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 12 <211> 65 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL004, TruSeq 8nt Adaptor-i7 <220> <221> misc_feature <222> (34)..(41) <223> n is a, c, g, or t <400> 12 gatcggaaga gcacacgtct gaactccagt cacnnnnnnn natctcgtat gccgtcttct 60 gcttg 65 <210> 13 <211> 72 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL005, TruSeq 10nt Adaptor-i5 <220> <221> misc_feature <222> (30)..(39) <223> n is a, c, g, or t <400> 13 aatgatacgg cgaccaccga gatctacacn nnnnnnnnna cactctttcc ctacacgacg 60 ctcttccgat ct 72 <210> 14 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL006, TruSeq 10nt Adapter- i7 <220> <221> misc_feature <222> (34)..(43) <223> n is a, c, g, or t <400> 14 gatcggaaga gcacacgtct gaactccagt cacnnnnnnn nnnatctcgt atgccgtctt 60 ctgcttg 67 <210> 15 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL007, TruSeq Short Adapter- i5 <400> 15 acactctttc cctacacgac gctcttccga tct 33 <210> 16 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL008, TruSeq Short Adapter- i7 <400> 16 gatcggaaga gcacacgtct gaactccagt cac 33 <210> 17 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL009, TruSeq nrUMI Adapter-i5 <220> <221> misc_feature <222> (34)..(39) <223> n is a, c, g, or t <400> 17 acactctttc cctacacgac gctcttccga tctnnnnnnnt 40 <210> 18 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TL010, TruSeq nrUMI Adaptor-i5 <220> <221> misc_feature <222> (1)..(6) <223> n is a, c, g, or t <400> 18 nnnnnagat cggaagagca cacgtctgaa ctccagtcac 40 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic: p5 sequence <400> 19 aatgatacgg cgaccaccga 20 <210> 20 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic: p7 sequence <400> 20 tcgtatgccg tcttctgctt g 21 <210> twenty one <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic: P7 reverse complement (P7') <400> twenty one caagcagaag acggcatacg a 21 <210> twenty two <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TruSeq i7 Adapter Region <400> twenty two gatcggaaga gcacacgtct gaactccagt cac 33 <210> twenty three <211> 32 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TruSeq i5 adapter region <400> twenty three acactctttc cctacacgac gctcttccga tc 32 <210> twenty four <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthesized: V2.A14.METS sequence <400> twenty four tcgtcggcag cgtcagatgt gtataagaga cag 33 <210> 25 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic: V2.B15.METS sequence <400> 25 gtctcgtggg ctcggagatg tgtataagag acag 34 <210> 26 <211> 6 <212> DNA <213> Artificial sequence <220> <223> Synthetic: N-mer domains (e.g., UMI) <220> <221> misc_feature <222> (1)..(6) <223> n is a mixture of 25% each of A, T, C or G <400> 26 nnnnnn 6 <210> 27 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN001, Nextera Blocker 1 i5 <400> 27 aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 28 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN002, Nextera Blocker 2 i7 <400> 28 caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 29 <211> 71 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN003, NRCBLK1PrimeRC <400> 29 gctgtctctt atacacatct gacgctgccg acgatttttt ttgtgtagat ctcggtggtc 60 gccgtatcat t 71 <210> 30 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN004, NRCBLK2PrimeRC <400> 30 gctgtctctt atacacatct ccgagcccac gagacttttt tttatctcgt atgccgtctt 60 ctgcttg 67 <210> 31 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN005, TiS517 with base-paired index sequence examples <400> 31 aatgatacgg cgaccaccga gatctacacg cgtaagatcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 32 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN006, TiS701 with base-paired index sequence examples <400> 32 caagcagaag acggcatacg agattcgcct tagtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 33 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN007, TiBNA7 <400> 33 aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagagac 60 ag 62 <210> 34 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN008, TiBNA8 <400> 34 caagcagaag acggcatacg agatgtctcg tgggctcgga gatgtgtata agagacag 58 <210> 35 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN009, TiLNA7 <400> 35 aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagagac 60 ag 62 <210> 36 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN010, TiLNA8 <400> 36 caagcagaag acggcatacg agatgtctcg tgggctcgga gatgtgtata agagacag 58 <210> 37 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN011, TiBNA11 <400> 37 aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagagac 60 ag 62 <210> 38 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN012, TiBNA12 <400> 38 caagcagaag acggcatacg agatgtctcg tgggctcgga gatgtgtata agagacag 58 <210> 39 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN013, TiBNA15G <400> 39 aatgatacgg cgaccaccga gatctacacg tcgtcggcag cgtcagatgt gtataagaga 60 cag 63 <210> 40 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN014, TiBNA16G <400> 40 caagcagaag acggcatacg agatggtctc gtgggctcgg agatgtgtat aagagacag 59 <210> 41 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN015, TiBNA15N <220> <221> misc_feature <222> (30)..(30) <223> n is a, c, g, or t <400> 41 aatgatacgg cgaccaccga gatctacacn tcgtcggcag cgtcagatgt gtataagaga 60 cag 63 <210> 42 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN016, TiBNA16N <220> <221> misc_feature <222> (25)..(25) <223> n is a, c, g, or t <400> 42 caagcagaag acggcatacg agatngtctc gtgggctcgg agatgtgtat aagagacag 59 <210> 43 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN017, TiLNA11 <400> 43 aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagagac 60 ag 62 <210> 44 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN018, TiLNA12 <400> 44 caagcagaag acggcatacg agatgtctcg tgggctcgga gatgtgtata agagacag 58 <210> 45 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN019, TiLNA15G <400> 45 aatgatacgg cgaccaccga gatctacacg tcgtcggcag cgtcagatgt gtataagaga 60 cag 63 <210> 46 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN020, TiLNA16G <400> 46 caagcagaag acggcatacg agatggtctc gtgggctcgg agatgtgtat aagagacag 59 <210> 47 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN021, TiLNA15N <220> <221> misc_feature <222> (30)..(30) <223> n is a, c, g, or t <400> 47 aatgatacgg cgaccaccga gatctacacn tcgtcggcag cgtcagatgt gtataagaga 60 cag 63 <210> 48 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN022, TiLNA16N <220> <221> misc_feature <222> (25)..(25) <223> n is a, c, g, or t <400> 48 caagcagaag acggcatacg agatngtctc gtgggctcgg agatgtgtat aagagacag 59 <210> 49 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN023, P5LNA <400> 49 aatgatacgg cgaccaccga gatctacac 29 <210> 50 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN024, P7LNA <400> 50 caagcagaag acggcatacg agat 24 <210> 51 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN025, TiLNAS1 <400> 51 tcgtcggcag cgtcagatgt gtataagaga cag 33 <210> 52 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN026, TiLNAS2 <400> 52 gtctcgtggg ctcggagatg tgtataagag acag 34 <210> 53 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN027, TiLNA17 <400> 53 ggcgaccacc gagatctaca ctcgtcggca gcgtcagatg tg 42 <210> 54 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN028, TiLNA18 <400> 54 ggcatacgag atgtctcgtg ggctcggaga tgtgtataag ag 42 <210> 55 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN029, P5BNA-all <400> 55 aatgatacgg cgaccaccga gatctacac 29 <210> 56 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN030, P7BNA-all <400> 56 caagcagaag acggcatacg agat 24 <210> 57 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN031, TiBNAS1-all <400> 57 tcgtcggcag cgtcagatgt gtataagaga cag 33 <210> 58 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN032, TiBNAS2-all <400> 58 gtctcgtggg ctcggagatg tgtataagag acag 34 <210> 59 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN033, P5BNA-half <400> 59 aatgatacgg cgaccaccga gatctacac 29 <210> 60 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN034, P7BNA-half <400> 60 caagcagaag acggcatacg agat 24 <210> 61 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN035, TiBNAS1-half <400> 61 tcgtcggcag cgtcagatgt gtataagaga cag 33 <210> 62 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN036, TiBNAS2-half <400> 62 gtctcgtggg ctcggagatg tgtataagag acag 34 <210> 63 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN037, P5BNA-Alt <400> 63 aatgatacgg cgaccaccga gatctacac 29 <210> 64 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN038, P7BNA-Alt <400> 64 caagcagaag acggcatacg agat 24 <210> 65 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN039, TiBNAS1-Alt <400> 65 tcgtcggcag cgtcagatgt gtataagaga cag 33 <210> 66 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN040, TiBNAS2-Alt <400> 66 gtctcgtggg ctcggagatg tgtataagag acag 34 <210> 67 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN041, TiBNA3 <400> 67 aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 68 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN042, TiBNA4 <400> 68 caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 69 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN043, TiBNA1 <400> 69 aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 70 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN044, TiBNA2 <400> 70 caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 71 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL001, CT3 Blocker 1 i7 <400> 71 caagcagaag acggcatacg agattttttt gtgactggag ttcagacgtg tgctcttccg 60 atc 63 <210> 72 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL002, CT3 Blocker 2 i5 <400> 72 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatc 57 <210> 73 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL003, TSLTLNA13 <400> 73 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatc 57 <210> 74 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL004, TSLTLNA14 <400> 74 caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57 <210> 75 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL005, TSHTLNA13 <400> 75 aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg ctcttccgat 60 c 61 <210> 76 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL006, TSHTLNA14 <400> 76 caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57 <210> 77 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL007, TSHTLNA15 <400> 77 aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg ctcttccgat 60 c 61 <210> 78 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL008, TSHTLNA16 <400> 78 caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57 <210> 79 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL009, TSHTLNA15G <400> 79 aatgatacgg cgaccaccga gatctacacg acactctttc cctacacgac gctcttccga 60 tc 62 <210> 80 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL010, TSHTLNA16G <400> 80 caagcagaag acggcatacg agatggtgac tggagttcag acgtgtgctc ttccgatc 58 <210> 81 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL011, TSHTLNA15N <220> <221> misc_feature <222> (30)..(30) <223> n is a, c, g, or t <400> 81 aatgatacgg cgaccaccga gatctacacn acactctttc cctacacgac gctcttccga 60 tc 62 <210> 82 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL012, TSHTLNA16N <220> <221> misc_feature <222> (25)..(25) <223> n is a, c, g, or t <400> 82 caagcagaag acggcatacg agatngtgac tggagttcag acgtgtgctc ttccgatc 58 <210> 83 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL013, TSLTBNA13 <400> 83 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatc 57 <210> 84 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL014, TSLTBNA14 <400> 84 caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57 <210> 85 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL015, TSHTBNA13 <400> 85 aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg ctcttccgat 60 c 61 <210> 86 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL016, TSHTBNA14 <400> 86 caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57 <210> 87 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL017, TSHTBNA15 <400> 87 aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg ctcttccgat 60 c 61 <210> 88 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL018, TSHTBNA16 <400> 88 caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatc 57 <210> 89 <211> 68 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX001, Nextera Blocker 1_2X <400> 89 aatgataggc gaccaccgag atctacactttttttttcgt cggcagcgtc agatgtgtat 60 aagagaag 68 <210> 90 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX002, Nextera Blocker 1_3X <400> 90 aatgataggc gaccaccgag attacactttttttttcgtc ggcagcgtca gatgtgtata 60 agagaag 67 <210> 91 <211> 68 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX003, Nextera Blocker 1_2Xalt <400> 91 aatgatacgg cgaccaccga gattacactttttttttcgt cggcagcgtc agatgtgtat 60 aagagaag 68 <210> 92 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX004, Nextera Blocker 1_3Xalt <400> 92 aatgatacgg cgaccaccga gattacactttttttttgtc ggcagcgtca gatgtgtata 60 agagaag 67 <210> 93 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX005, Nextera Blocker 2_2X <400> 93 caagagaaga cggcatacga gatttttttt tgtctcgtgg gctcggagat gtgtataaga 60 gaag 64 <210> 94 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX006, Nextera Blocker 2_3X <400> 94 caagagaaga cggcatagag attttttttt gtctcgtggg ctcggagatg tgtataagag 60 aag 63 <210> 95 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX007, Nextera Blocker 2_2Xalt <400> 95 caagcagaag acggcatacg agatttttttttgttcgtgg gctcggagat gtgtataaga 60 gaag 64 <210> 96 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX008, Nextera Blocker 2_3Xalt <400> 96 caagcagaag acggcatacg agattttttt ttgttcgtgg gctggagatg tgtataagag 60 aag 63 <210> 97 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX009, Nextera Blocker 1_5X4Y <400> 97 aatgataggc gacaccgaga ttacactttt tttttcgtcg gagcgtcaga ggaaagagaa 60 g 61 <210> 98 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX010, Nextera Blocker 2_5X4Y <400> 98 caagagaaga ggcatagaga tttttttttg tctcgtgggt cggagaggaa agagaag 57 <210> 99 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX011, Nextera Blocker 1_5X4Y-External <400> 99 aatgataggcgacaccgagattacac 26 <210> 100 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX012, Nextera Blocker 1_5X4Y-In-house <400> 100 tcgtcggagc gtcagaggaa agagaag 27 <210> 101 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX013, Nextera Blocker 2_5X4Y-External <400> 101 caagagaaga ggcatagaga t 21 <210> 102 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BX014, Nextera Blocker 2_5X4Y-In-house <400> 102 gtctcgtggg tcggagagga aagagaag 28 <210> 103 <211> 8 <212> DNA <213> Artificial sequence <220> <223> Synthetic: Thymine base at the indexed position of the oligonucleotide <400> 103 tttttttt 8 <210> 104 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: Nextera Blocker 1 (15016424) i5, Illumina Nextera i5 Sealing agent <400> 104 aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 105 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: Nextera Blocker 2 (15016425) i7, Illumina Nextera i7 Sealing agent <400> 105 caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 106 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TiBNA1, Nextera Blocker 1_3XCG <400> 106 aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 107 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TiBNA2, Nextera Blocker 2_3XCG <400> 107 caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 108 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TiBNA3, Nextera Blocker 1_6XCG <400> 108 aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 109 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TiBNA4, Nextera Blocker 2_6XCG <400> 109 caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 110 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TiBNA5, Nextera Blocker 1_10XCG <400> 110 aatgatacgg cgaccaccga gatctacact ttttttttcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 111 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TiBNA6, Nextera Blocker 2_10XCG <400> 111 caagcagaag acggcatacg agattttttt ttgtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 112 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TiS517, S-specific blocking agent 517 <400> 112 aatgatacgg cgaccaccga gatctacacg cgtaagatcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 113 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic: TiS701, S-specific blocking agent 701 <400> 113 caagcagaag acggcatacg agattcgcct tagtctcgtg ggctcggaga tgtgtataag 60 agacag 66 <210> 114 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL007, TSHTLNA15G <400> 114 aatgatacgg cgaccaccga gatctacacg acactctttc cctacacgac gctcttccga 60 tc 62 <210> 115 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL008, TSHTLNA16G <400> 115 caagcagaag acggcatacg agatggtgac tggagttcag acgtgtgctc ttccgatc 58 <210> 116 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL009, TSHTLNA15N <220> <221> misc_feature <222> (30)..(30) <223> n is a, c, g, or t <400> 116 aatgatacgg cgaccaccga gatctacacn acactctttc cctacacgac gctcttccga 60 tc 62 <210> 117 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BL010, TSHTLNA16N <220> <221> misc_feature <222> (25)..(25) <223> n is a, c, g, or t <400> 117 caagcagaag acggcatacg agatngtgac tggagttcag acgtgtgctc ttccgatc 58 <210> 118 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN023, P5LNA <400> 118 aatgatacgg cgaccaccga gatctacac 29 <210> 119 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN024, P7LNA <400> 119 caagcagaag acggcatacg agat 24 <210> 120 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN025, TiLNAS1 <400> 120 tcgtcggcag cgtcagatgt gtataagaga cag 33 <210> 121 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN026, TiLNAS2 <400> 121 gtctcgtggg ctcggagatg tgtataagag acag 34 <210> 122 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN027, TiLNA17 <400> 122 ggcgaccacc gagatctaca ctcgtcggca gcgtcagatg tg 42 <210> 123 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic: BN028, TiLNA18 <400> 123 ggcatacgag atgtctcgtg ggctcggaga tgtgtataag ag 42

Claims

1. A hybridization buffer, comprising: 0.5% to 10% dextran sulfate, 0.05 mg / mL to 0.5 mg / mL human Cot-1 DNA, 1% to 15% (v / v) formamide, 40 mM to 80 mM KH2PO4-K2HPO4, 0.1 M to 4 M NaCl, 0.001% to 10% (v / v) Tween 20 and a blocking agent, wherein the blocking agent is capable of binding to an adaptor, wherein the adaptor includes at least one of an index region or a unique molecular identifier (UMI) and a universal primer sequence; and wherein the region of the blocking agent capable of binding to the index region and / or the unique molecular identifier (UMI) of the adaptor includes at least three thymine bases.

2. A hybridization buffer, comprising: 0.5% to 10% dextran sulfate, 0.05 mg / mL to 0.5 mg / mL human Cot-1 DNA, 1% to 15% (v / v) formamide, 40 mM to 80 mM KH2PO4-K2HPO4, 0.1 M to 4 M NaCl, 0.001% to 10% (v / v) Tween 20, and a blocking agent, wherein the blocking agent comprises at least one of the following: (a) Multiple Enhanced T m modification; (b) increasing the T of the blocking agent m Multiple modifications, including cross-linked oligonucleotides; modified 5-methyldeoxycytidine (5-methyl-dc); 2,6-diaminopurine; Locked nucleic acid (LNA); Bridged nucleic acid (BNA); Tricyclic nucleic acid; Peptide nucleic acid (PNA); C5 modified pyrimidine base; Propynyl pyrimidine; Morpholino; at least one of a phosphoramidite; and a 5'-pyrene cap; (c) an oligonucleotide; wherein the blocker is capable of binding to an adaptor, wherein the adaptor comprises at least one of an index region or a unique molecular identifier (UMI) and a universal primer sequence; and wherein the region of the blocker capable of binding to the index region and / or the unique molecular identifier (UMI) of the adaptor comprises: at least three thymine bases; or (d) two unligated oligonucleotides; wherein the blocker is capable of binding to at least a portion of an adaptor, wherein the adaptor comprises at least one of an index region or a unique molecular identifier (UMI) and a universal primer sequence; and wherein the unligated oligonucleotide comprises a base that does not correspond to the index region and / or the unique molecular identifier (UMI) of the adaptor.

3. A method for preparing an enriched library, the method comprising forming a hybridization mixture comprising library members, a hybridization buffer as described in any one of claims 1 to 2, and a probe to form the hybridization mixture under conditions sufficient to allow the probe to hybridize to a region of interest within the library member, wherein the probe comprises a ligand.

4. The method of claim 3, comprising: capturing the probe using a capture device after hybridization of the probe, and The captured library members are eluted from the capture device into an eluate comprising enriched library members, wherein the eluate has a DNA concentration in the range of 1.3 pM to 250 pM.

5. The method of claim 3, wherein the hybridization mixture comprises samples from at least two library preparations, wherein at least 10 ng of DNA from each library preparation is combined. The method of claim 3 , wherein the DNA concentration of the hybridization mixture is in the range of 0.1 ng / μL to 120 ng / μL.

7. The method of any one of claims 3 to 6, comprising sequencing the enriched library members, and wherein the method does not comprise amplifying the library members prior to capturing the library members.

8. The method of claim 7, wherein the sequencing occurs on a flow cell and the method comprises loading the enriched library members onto the flow cell at a concentration of at least 1.1 pM and up to 300 pM.

9. The method of claim 8, comprising loading the enriched library members onto a flow cell using a direct flow cell loading fixture.

10. A kit comprising the hybridization buffer according to any one of claims 1 to 2, and instructions for use.

Images