Oligonucleotide set and multiple amplicon library building method

Abstract

The invention provides an oligonucleotide set and a multiple amplicon library building method, and belongs to the technical field of biology. According to the method provided by the invention, a connection product or an extension product can be generated from a gene-specific multiple amplification primer and a library amplification primer in a system in a connection or complementary extension manner, and then the construction of the amplicon library is completed in one step by taking the connection product or the extension product as a long primer. Compared with a traditional multiple amplicon library building method, the method provided by the invention has the advantages that the uncovering operation step can be reduced, and the risk of cross contamination is avoided.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to an oligonucleotide set and a method for constructing a multiplex amplicon library. Background Art

[0002] Currently, for the construction of amplicon libraries, two rounds of PCR amplification are used to complete the construction of the library. In the first round of amplification, a gene-specific primer with a recognition sequence of the second-round primer (i.e., the index sequence) is used to amplify a specific region; in the second round of amplification, the product of the first round is amplified by a primer with a complementary sequence of the Index sequence to complete the library amplification. The problems brought by this most common method are as follows: 1. After the first round of amplification, purification and recovery are required, then the system of the second round is prepared, and the second round of amplification is carried out, and the final product is recovered. That is, a total of two rounds of amplification and two rounds of recovery are required, increasing the complexity of the operation. 2. Since the two ends of the product of the first round carry the universal sequence recognized by the second-round primer, when there are a relatively large number of samples amplified simultaneously, operations such as recovery and preparation of the system of the product of the first round are prone to cross-contamination through aerosols, thus affecting the authenticity of the identification fragment signals between samples. 3. Since there are many operation steps between the two rounds of amplification and it is necessary to open the lid for sample addition, it may cause cross-contamination between samples, thereby hindering the automated operation of targeted amplicon sequencing.

[0003] Chinese Patent CN104093890B and US Patent US10876108B2 disclose a method for constructing an amplicon library by first constructing a library and then amplifying a specific fragment using a specific primer at one end and a universal primer at the other end. This library construction mode still requires multiple rounds to complete the construction of the amplicon library, and there are still the situations of complex operation steps and aerosol cross-contamination. Especially in the application scenario of pathogen-targeted sequencing (tNGS), the cross-contamination between samples caused by aerosols seriously affects the automated application and large-scale promotion of the targeted pathogen detection technology.

[0004] Therefore, changing two rounds of amplification into one round of amplification is the trend of technological development and is also beneficial to solving the problem of cross-contamination between samples in the application of targeted pathogen detection. Summary of the Invention

[0005] The purpose of the present invention is to provide an oligonucleotide pair and a method for constructing a multiplex amplicon library. By means of ligation or complementary extension, a gene-specific multiplex amplification primer and a library amplification primer in the multiplex amplification system are generated into a ligation product or an extension product, and then the amplicon library can be constructed in one step by using the ligation product or the extension product as a long primer. Compared with the traditional method for constructing a multiplex amplicon library, the method provided by the present invention can reduce the lid-opening operation steps and avoid the risk of cross-contamination.

[0006] The first aspect of the present invention includes a set of oligonucleotides, which set of oligonucleotides comprises a first oligonucleotide primer and a second oligonucleotide primer. The first oligonucleotide primer sequentially comprises a sequencing adapter sequence, a tag sequence, and a sequencing primer sequence from the 5'-end to the 3'-end. The second oligonucleotide primer sequentially comprises the reverse complementary sequence of a gene-specific primer and the reverse complementary sequence of a sequencing primer from the 5'-end to the 3'-end.

[0007] In some embodiments, the first oligonucleotide primer and the second oligonucleotide primer are complementary paired through the sequencing primer sequence and the reverse complementary sequence of the sequencing primer.

[0008] In some embodiments, the "reverse complementary sequence" refers to a nucleotide sequence associated by the base pairing principle. For example, the reverse complementary sequence of the sequence "5'-ATCG-3'" is "5'-CGAT-3'".

[0009] In some embodiments, the tag sequence is a random sequence for distinguishing different samples to be tested. In some embodiments, the tag sequence is at least 3 nucleotides, such as 4-12 nucleotides, preferably 6-8 nucleotides, such as 8 nucleotides.

[0010] In some embodiments, the gene-specific primer sequence is a specific primer sequence designed according to the target fragment of the DNA sample to be tested. For example, the gene-specific primer sequence comprises at least 3 nucleotides, such as 3-50 nucleotides, such as 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 18, 20, 22, 25, 26, 28, 30, 32, 35, 38, 40, 42, 45, 48, and 50 nucleotides.

[0011] In some embodiments, one or more nucleotide sites of the reverse complementary sequence of the gene-specific primer contain RNA base modifications, and the modifications are at least one of rA (adenosine), rU (uridine), rG (guanosine), and rC (cytidine). In some embodiments, the number of the modifications is at least 1, such as 1, 2, 3, 5, 6, 7, 8, 9, 10, 12, or 15.

[0012] In some embodiments, when multiple nucleotide sites of the reverse complementary sequence of the gene-specific primer contain RNA base modifications, the multiple nucleotide sites are consecutive or non-consecutive, and each is independently one of rA, rU, rG, and rC.

[0013] In some embodiments, one or more nucleotide sites in the second oligonucleotide primer contain RNA base modifications, which are at least one of rA (adenosine ribonucleoside), rU (uridine ribonucleoside), rG (guanosine ribonucleoside), and rC (cytidine ribonucleoside), and the number of the modifications is at least 1, such as 1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 15, 16, 18, or 20.

[0014] In some embodiments, when multiple nucleotide sites in the second oligonucleotide primer contain RNA base modifications, the multiple nucleotide sites are consecutive or non-consecutive, and each is independently one of rA, rU, rG, and rC.

[0015] In some embodiments, the 3'-end of the second oligonucleotide primer contains a blocking modification, which functions to prevent the addition of dNTP to the 3'-end of the second oligonucleotide primer for extension. In some embodiments, the blocking modification is a 3'-phosphorylation modification or an inter-arm modification; preferably, the inter-arm modification is a Spacer C3 modification, a Spacer C6 modification, a Spacer C9 modification, a dSpacer modification, or a PC-linker modification.

[0016] In some embodiments, the first oligonucleotide primer includes at least a pair of an upstream first oligonucleotide primer and a downstream first oligonucleotide primer.

[0017] In some embodiments, the upstream first oligonucleotide primer sequentially includes an upstream sequencing adapter sequence, an upstream tag sequence, and an upstream sequencing primer sequence from the 5'-end to the 3'-end, and the downstream first oligonucleotide primer sequentially includes a downstream sequencing adapter sequence, a downstream tag sequence, and a downstream sequencing primer sequence from the 5'-end to the 3'-end.

[0018] In some embodiments, the upstream first oligonucleotide primer does not contain an (upstream) tag sequence, and / or the downstream first oligonucleotide primer does not contain a (downstream) tag sequence.

[0019] In some embodiments, the sequencing adapter sequence is a sequencing matrix-related sequence used by current or future sequencing platforms (including but not limited to the Iontorrent platform, the Illumina platform, and the BGI MGI platform).

[0020] In some embodiments, the sequencing adapter sequence includes an upstream sequencing adapter sequence and / or a downstream sequencing adapter sequence.

[0021] In some embodiments, the upstream sequencing adapter sequence is the P5 adapter sequence of the Illumina platform, and the downstream sequencing adapter sequence is the P7 adapter sequence of the Illumina platform; and vice versa.

[0022] In some embodiments, the upstream sequencing adapter sequence is the P1 adapter sequence of the iontorrent platform, and the downstream sequencing adapter sequence is the A adapter sequence of the iontorrent platform; and vice versa.

[0023] In some embodiments, the upstream sequencing adapter sequence is the single-end tag library construction upstream splint sequence of the MGI platform, and the downstream sequencing adapter sequence is the single-end tag library construction downstream splint sequence of the MGI platform; and vice versa. In some embodiments, the upstream sequencing adapter sequence is the paired-end tag library construction upstream splint sequence of the MGI platform, and the downstream sequencing adapter sequence is the paired-end tag library construction downstream splint sequence of the MGI platform; and vice versa.

[0024] In some embodiments, the upstream first oligonucleotide primer is the i5 primer of the Illumina platform, and the downstream first oligonucleotide primer is the i7 primer of the illumina platform; and vice versa.

[0025] In some embodiments, the second oligonucleotide primer includes at least a pair of upstream second oligonucleotide primers and downstream second oligonucleotide primers.

[0026] In some embodiments, the upstream second oligonucleotide primer sequentially includes the reverse complementary sequence of the gene-specific upstream primer and the reverse complementary sequence of the upstream sequencing primer from the 5'-end to the 3'-end.

[0027] In some embodiments, the downstream second oligonucleotide primer sequentially includes the reverse complementary sequence of the gene-specific downstream primer and the reverse complementary sequence of the downstream sequencing primer from the 5'-end to the 3'-end.

[0028] In some embodiments, the upstream first oligonucleotide primer and the upstream second oligonucleotide primer are complementary paired through the upstream sequencing primer sequence and the reverse complementary sequence of the upstream sequencing primer.

[0029] In some embodiments, the downstream first oligonucleotide primer and the downstream second oligonucleotide primer are complementary paired through the downstream sequencing primer sequence and the reverse complementary sequence of the downstream sequencing primer.

[0030] The second aspect of the present invention provides a composition, which comprises a DNA polymerase, a ribonuclease, dNTPs, buffer components, metal salts and a primer combination; wherein, the primer combination comprises the first oligonucleotide primer and the second oligonucleotide primer described in the first aspect, in particular, at least one pair of upstream first oligonucleotide primers and downstream first oligonucleotide primers and at least one pair of upstream second oligonucleotide primers and downstream second oligonucleotide primers.

[0031] In some embodiments, the first oligonucleotide primer and the second oligonucleotide primer can be complementary paired through the sequencing primer sequence and the reverse complementary sequence of the sequencing primer. In some embodiments, the first oligonucleotide primer and the second oligonucleotide primer each exist in the composition in a single-stranded form. In some embodiments, the first oligonucleotide primer and the second oligonucleotide primer exist in the composition in the form of a partial double-stranded structure formed by the sequencing primer sequence and the reverse complementary sequence of the sequencing primer.

[0032] In some embodiments, the first oligonucleotide primer comprises at least one pair of upstream first oligonucleotide primers and downstream first oligonucleotide primers described in the first aspect, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0033] In some embodiments, the difference between each pair of the upstream first oligonucleotide primer and the downstream first oligonucleotide primer lies in that the tag sequences are different.

[0034] In some embodiments, the second oligonucleotide primer comprises at least one pair of upstream second oligonucleotide primers and downstream second oligonucleotide primers described in the first aspect, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0035] In some embodiments, the difference between each pair of the upstream second oligonucleotide primer and the downstream second oligonucleotide primer lies in that the gene-specific primer sequences are different.

[0036] In some embodiments, the composition further comprises a DNA sample.

[0037] In some embodiments, the DNA sample is gDNA or cDNA.

[0038] In some embodiments, the DNA polymerase comprises at least one heat-resistant DNA polymerase.

[0039] In some embodiments, the DNA polymerase comprises at least one thermostable DNA polymerase and one room-temperature DNA polymerase.

[0040] In some embodiments, the thermostable DNA polymerase is Taq DNA polymerase, Pfu DNA polymerase, Vent DNA polymerase, Deep Vent DNA polymerase or KOD DNA polymerase.

[0041] In some embodiments, the thermostable polymerase is a hot-start polymerase, such as an antibody-blocked polymerase or a ligand-blocked polymerase.

[0042] In some embodiments, the DNA polymerase comprises at least one non-hot-start polymerase and one hot-start polymerase.

[0043] In some embodiments, the room-temperature DNA polymerase is Klenow DNA polymerase, Bst DNA polymerase or Phi 29 DNA polymerase.

[0044] In some embodiments, the "room-temperature polymerase" as used in the present invention refers to a polymerase that can exhibit polymerase activity at room temperature, such as below 45°C.

[0045] In some embodiments, the ribonuclease recognizes an RNA / DNA hybrid strand and cleaves the RNA strand.

[0046] In some embodiments, the ribonuclease is an endonuclease capable of recognizing ribonucleotide sites and excising phosphodiester bonds; preferably, the ribonuclease is RNase H2.

[0047] In some embodiments, the ribonuclease is a homologous protein of RNase H2.

[0048] In some embodiments, the buffering component is one or more of Tris, Tris-HCl, Tris base or HEPES, preferably Tris.

[0049] In some embodiments, the metal salt is Mg 2+ salt, preferably MgCl2.

[0050] In some embodiments, the metal salt is Mg 2+ salt, and one or more of K + salt, Mn 2+ salt, Cs + salt, Na + salt and Ca 2+ salt.

[0051] In some embodiments, the composition further comprises other components well-known in the art that can help DNA polymerase and ribonuclease to function, such as glycerol.

[0052] In some embodiments, the composition further comprises a surfactant, such as one or more of an anionic surfactant, a cationic surfactant, and a nonionic surfactant.

[0053] The third aspect of the present invention provides a method for constructing a multiplex amplicon library, the method comprising the following steps:

[0054] (1) Prepare a reaction system comprising at least one pair of first oligonucleotide primers, at least one pair of second oligonucleotide primers, and a sample nucleic acid; wherein, the first oligonucleotide primer sequentially comprises a sequencing adapter sequence, a tag sequence, and a sequencing primer sequence from the 5'-end to the 3'-end, the second oligonucleotide primer sequentially comprises the reverse complementary sequence of a gene-specific primer and the reverse complementary sequence of a sequencing primer from the 5'-end to the 3'-end, and the second oligonucleotide primer contains a cleavable group;

[0055] (2) Make the 3'-ends of the first oligonucleotide primer and the second oligonucleotide primer complementary in the reverse direction, and extend the first oligonucleotide primer along the 5'-3' direction to obtain an extension product;

[0056] (3) Cut the reverse complementary sequence of the gene-specific primer in the second oligonucleotide primer;

[0057] (4) Use the extension product in step (2) as a primer to perform PCR amplification on the sample nucleic acid.

[0058] In some embodiments, the tag sequence is a random sequence for distinguishing different samples. In some embodiments, the tag sequence is at least 3 nucleotides, such as 4-12 nucleotides, preferably 6-8 nucleotides, such as 8 nucleotides.

[0059] In some embodiments, the gene-specific primer sequence is a specific primer sequence designed according to the target fragment of the DNA sample to be tested. For example, the gene-specific primer sequence contains at least 3 nucleotides, such as 3-50 nucleotides, such as 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 18, 20, 22, 25, 26, 28, 30, 32, 35, 38, 40, 42, 45, 48, and 50 nucleotides.

[0060] In some embodiments, the 3'-end of the second oligonucleotide primer contains a blocking modification that prevents the addition of dNTPs to the 3'-end of the second oligonucleotide primer for extension. In some embodiments, the blocking modification is a 3'-phosphorylation modification or a spacer modification; preferably, the spacer modification is a Spacer C3 modification, a Spacer C6 modification, a Spacer C9 modification, a dSpacer modification, or a PC-linker modification.

[0061] In some embodiments, the at least one pair of first oligonucleotide primers includes at least one pair of upstream first oligonucleotide primers and downstream first oligonucleotide primers.

[0062] In some embodiments, the upstream first oligonucleotide primer sequentially includes an upstream sequencing adapter sequence, an upstream tag sequence, and an upstream sequencing primer sequence from the 5'-end to the 3'-end, and the downstream first oligonucleotide primer sequentially includes a downstream sequencing adapter sequence, a downstream tag sequence, and a downstream sequencing primer sequence from the 5'-end to the 3'-end.

[0063] In some embodiments, the upstream first oligonucleotide primer does not contain an (upstream) tag sequence, and / or the downstream first oligonucleotide primer does not contain a (downstream) tag sequence.

[0064] In some embodiments, the sequencing adapter sequence is a sequencing matrix-related sequence used by current or future sequencing platforms (including but not limited to the Ion Torrent platform, the Illumina platform, and the BGI MGI platform).

[0065] In some embodiments, the sequencing adapter sequence includes an upstream sequencing adapter sequence and a downstream sequencing adapter sequence.

[0066] In some embodiments, the upstream sequencing adapter sequence is the P5 adapter sequence of the Illumina platform, and the downstream sequencing adapter sequence is the P7 adapter sequence of the Illumina platform; vice versa.

[0067] In some embodiments, the upstream sequencing adapter sequence is the P1 adapter sequence of the Ion torrent platform, and the downstream sequencing adapter sequence is the A adapter sequence of the Ion torrent platform; vice versa.

[0068] In some embodiments, the upstream sequencing adapter sequence is the single-end tag library construction upstream splint sequence of the MGI platform, and the downstream sequencing adapter sequence is the single-end tag library construction downstream splint sequence of the MGI platform; vice versa. In some embodiments, the upstream sequencing adapter sequence is the paired-end tag library construction upstream splint sequence of the MGI platform, and the downstream sequencing adapter sequence is the paired-end tag library construction downstream splint sequence of the MGI platform; vice versa.

[0069] In some embodiments, the upstream first oligonucleotide primer is the i5 primer of the Illumina platform, and the downstream first oligonucleotide primer is the i7 primer of the Illumina platform; vice versa.

[0070] In some embodiments, the at least one pair of second oligonucleotide primers includes at least one pair of upstream second oligonucleotide primers and downstream second oligonucleotide primers.

[0071] In some embodiments, the upstream second oligonucleotide primer sequentially includes the reverse complementary sequence of the gene-specific upstream primer and the reverse complementary sequence of the upstream sequencing primer from the 5'-end to the 3'-end.

[0072] In some embodiments, the downstream second oligonucleotide primer sequentially includes the reverse complementary sequence of the gene-specific downstream primer and the reverse complementary sequence of the downstream sequencing primer from the 5'-end to the 3'-end.

[0073] In some embodiments, the upstream first oligonucleotide primer and the upstream second oligonucleotide primer are complementary paired through the upstream sequencing primer sequence and the reverse complementary sequence of the upstream sequencing primer.

[0074] In some embodiments, the downstream first oligonucleotide primer and the downstream second oligonucleotide primer are complementary paired through the downstream sequencing primer sequence and the reverse complementary sequence of the upstream sequencing primer.

[0075] In some embodiments, the first oligonucleotide primer includes at least one pair of the upstream first oligonucleotide primer and the downstream first oligonucleotide primer as described in the first aspect, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs, and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0076] In some embodiments, the difference between each pair of the upstream first oligonucleotide primer and the downstream first oligonucleotide primer is that the tag sequences are different.

[0077] In some embodiments, the second oligonucleotide primer includes at least one pair of the upstream second oligonucleotide primer and the downstream second oligonucleotide primer as described in the first aspect, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs, and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0078] In some embodiments, the difference between each pair of the upstream second oligonucleotide primer and the downstream second oligonucleotide primer is that the gene-specific primer sequences are different.

[0079] In some embodiments, the sample nucleic acid is DNA. For example, the DNA is gDNA or cDNA.

[0080] In some embodiments, the cleavable group refers to a nucleotide substrate that can be recognized and cleaved by an endonuclease or an exonuclease.

[0081] In some embodiments, the cleavable group is deoxyuridine triphosphate (dUTP) or deoxyinosine triphosphate (dITP). In some embodiments, when the cleavable group is dUTP, the reaction system further comprises uracil DNA glycosylase (UDG enzyme) or single-strand selective monofunctional uracil DNA glycosylase (SMUG enzyme); when the cleavable group is dITP, the reaction system further comprises alkyladenine DNA glycosylase (AAG enzyme) or endonuclease V.

[0082] In some embodiments, the cleavable group is an RNA base, and the RNA base is at least one of rA (adenosine ribonucleoside), rU (uridine ribonucleoside), rG (guanosine ribonucleoside), and rC (cytidine ribonucleoside). In some embodiments, the number of the RNA bases is at least 1, such as 1, 2, 3, 5, 6, 7, 8, 9, 10, 12, or 15. In all embodiments, when the cleavable group is an RNA base, the reaction system further comprises an endoribonuclease, and the endoribonuclease is an endonuclease that can recognize ribonucleotide sites and excise phosphodiester bonds; preferably, the endoribonuclease is RNase H2 or a homologous protein of RNase H2.

[0083] In some embodiments, the cleavable group is located in the reverse complementary sequence of the gene-specific primer and / or the reverse complementary sequence of the sequencing primer in the second oligonucleotide primer.

[0084] In some embodiments, step (3) is to cleave the cleavable group on the reverse complementary sequence of the gene-specific primer in the second oligonucleotide primer under the action of an endonuclease or an exonuclease. For example, under the action of an endoribonuclease, the ribonucleotide site on the reverse complementary sequence of the gene-specific primer is recognized and cleaved.

[0085] In some embodiments, the first oligonucleotide primer comprises at least one pair of the upstream first oligonucleotide primer and the downstream first oligonucleotide primer, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs, and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0086] In some embodiments, the difference between each pair of the upstream first oligonucleotide primer and the downstream first oligonucleotide primer lies in that the tag sequences are different.

[0087] In some embodiments, the second oligonucleotide primer comprises at least one pair of the upstream second oligonucleotide primer and the downstream second oligonucleotide primer, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs, and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0088] In some embodiments, the difference between each pair of the upstream second oligonucleotide primer and the downstream second oligonucleotide primer lies in that the gene-specific primer sequences are different.

[0089] In some embodiments, the reaction system further comprises a DNA polymerase.

[0090] In some embodiments, the DNA polymerase comprises at least one heat-resistant DNA polymerase.

[0091] In some embodiments, the DNA polymerase comprises at least one heat-resistant DNA polymerase and one room-temperature DNA polymerase.

[0092] In some embodiments, the heat-resistant polymerase is a hot-start polymerase, such as an antibody-blocked polymerase or a ligand-blocked polymerase.

[0093] In some embodiments, the DNA polymerase comprises at least one non-hot-start polymerase and one hot-start polymerase.

[0094] In some embodiments, the heat-resistant DNA polymerase is Taq DNA polymerase, Pfu DNA polymerase, Vent DNA polymerase, Deep Vent DNA polymerase, or KOD DNA polymerase.

[0095] In some embodiments, the room-temperature DNA polymerase is Klenow DNA polymerase, Bst DNA polymerase, or Phi 29 DNA polymerase.

[0096] In some embodiments, the reaction of step (2) is carried out under the action of a non-thermostart polymerase; the reaction of step (4) is carried out under the action of a thermostart polymerase.

[0097] In some embodiments, the reaction of step (2) is carried out under the action of a room temperature polymerase; the reaction of step (4) is carried out under the action of a heat-resistant polymerase.

[0098] In some embodiments, the reaction temperature of step (2) is 20 - 50 °C, preferably 25 - 40 °C, such as 25 °C, 26 °C, 27 °C, 28 °C, 29 °C, 30 °C, 31 °C, 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C or 40 °C.

[0099] In some embodiments, the reaction time of step (2) is 5 - 40 minutes, preferably 10 - 30 minutes, such as 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes or 30 minutes.

[0100] In some embodiments, the reaction conditions of step (2) are incubation at 25 - 40 °C for 10 - 30 minutes, incubation at 25 - 40 °C for 10 - 25 minutes, incubation at 25 - 40 °C for 10 - 20 minutes or incubation at 30 °C for 10 - 20 minutes, including but not limited to any combination of the reaction temperature and reaction time of step (2) described above.

[0101] In some embodiments, the reaction temperature of step (3) is 40 - 80 °C, preferably 60 - 80 °C, such as 60 °C, 61 °C, 62 °C, 63 °C, 64 °C, 65 °C, 66 °C, 67 °C, 68 °C, 69 °C, 70 °C, 71 °C, 72 °C, 73 °C, 74 °C, 75 °C, 76 °C, 77 °C, 78 °C, 79 °C or 80 °C.

[0102] In some embodiments, the reaction time of step (3) is 5 - 30 minutes, preferably 5 - 20 minutes, such as 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 5 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes or 20 minutes.

[0103] In some embodiments, the reaction conditions for step (3) are incubation at 60 - 80°C for 10 - 20 minutes, incubation at 65 - 80°C for 10 - 20 minutes, incubation at 70 - 80°C for 10 - 20 minutes, incubation at 70 - 80°C for 10 - 15 minutes, incubation at 70 - 75°C for 10 - 15 minutes, incubation at 72°C for 10 - 15 minutes, or incubation at 72°C for 10 minutes, including but not limited to any combination of the reaction temperature and reaction time of step (3) as described above.

[0104] In some embodiments, during the reaction of step (2), the extension product generated by the complementary extension of the first oligonucleotide primer and the second oligonucleotide primer under the action of DNA polymerase is an Index - Panel long primer, and the Index - Panel long primer sequentially includes a sequencing adapter sequence - a tag sequence - a sequencing primer sequence - a gene - specific primer sequence from the 5' end to the 3' end.

[0105] In some embodiments, the reaction system further includes a buffering component. In some embodiments, the buffering component is one or more of Tris, Tris - HCl, Tris base, or HEPES, preferably Tris.

[0106] In some embodiments, the reaction system further includes a metal salt. In some embodiments, the metal salt is Mg 2+ salt, preferably MgCl2. In some embodiments, the metal salt is Mg 2+ salt, and K + salt, Mn 2+ salt, Cs + salt, Na + salt, and Ca 2+ salt, or one or more thereof.

[0107] In some embodiments, the reaction system further contains dNTP.

[0108] In some embodiments, the reaction system further contains other components well - known in the art that can help DNA polymerase and ribonuclease play their roles, such as glycerol.

[0109] In some embodiments, the reaction system further contains a surfactant, such as one or more of an anionic surfactant, a cationic surfactant, and a non - ionic surfactant.

[0110] In some embodiments, the PCR amplification in step (4) includes one or more cycles (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40 cycles) of denaturation, annealing, and extension; preferably, the PCR amplification includes pre-denaturation and multiple cycles (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40 cycles) of denaturation, annealing, and extension.

[0111] In some embodiments, the denaturation is high-temperature denaturation, and the high-temperature denaturation is at least 90°C high-temperature denaturation, such as 90°C, 91°C, 92°C, 93°C, 94°C, and 95°C high-temperature denaturation.

[0112] In some embodiments, the denaturation simultaneously achieves: (1) denaturing the sample DNA from double-stranded to single-stranded; (2) inactivating the RNase H2 protein.

[0113] In some embodiments, the PCR amplification is one-round PCR amplification.

[0114] In some embodiments, the conditions for the PCR amplification can be any conventional PCR amplification conditions known to those of ordinary skill in the art.

[0115] In some embodiments, the method further includes step (5) of purifying the amplification product of the sample nucleic acid.

[0116] In some embodiments, the purification is performed by the magnetic bead method, high-salt precipitation method, centrifugal column method, or phenol-chloroform extraction method, preferably the magnetic bead method.

[0117] The fourth aspect of the present invention provides an oligonucleotide primer, which sequentially includes a sequencing adapter sequence - a tag sequence - a sequencing primer sequence - a gene-specific primer sequence from the 5' end to the 3' end.

[0118] The fifth aspect of the present invention provides an oligonucleotide combination, which includes a first oligonucleotide primer, a third oligonucleotide primer, and a bridge primer. The first oligonucleotide primer sequentially includes a sequencing adapter sequence, a tag sequence, and a sequencing primer sequence from the 5' end to the 3' end. The third oligonucleotide primer sequentially includes a universal sequence and a gene-specific primer sequence from the 5' end to the 3' end. The bridge primer sequentially includes the reverse complementary sequence of the universal sequence and the reverse complementary sequence of the sequencing primer from the 5' end to the 3' end.

[0119] In some embodiments, the tag sequence is a random sequence for differentiating different samples. In some embodiments, the tag sequence is at least 3 nucleotides, such as 4 - 12 nucleotides, preferably 6 - 8 oligonucleotides, such as 8 nucleotides.

[0120] In some embodiments, the gene - specific primer sequence is a specific primer sequence designed according to the target fragment of the DNA sample to be tested. For example, the gene - specific primer sequence contains at least 3 nucleotides, such as 3 - 50 nucleotides, such as 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 18, 20, 22, 25, 26, 28, 30, 32, 35, 38, 40, 42, 45, 48, and 50 nucleotides.

[0121] In some embodiments, the reverse - complementary sequence of the universal sequence refers to the sequence that is partially or fully reverse - complementary to the universal sequence, and the reverse - complementary sequence of the sequencing primer refers to the sequence that is partially or fully reverse - complementary to the sequencing primer.

[0122] In some embodiments, the 5' end of the third oligonucleotide primer contains or does not contain phosphorylation modification.

[0123] In some embodiments, the 3' end of the bridge primer contains a blocking modification, which functions to prevent the addition of dNTPs to the 3' end of the bridge primer for extension. In some embodiments, the blocking modification is 3' phosphorylation modification or inter - arm modification; preferably, the inter - arm modification is Spacer C3 modification, Spacer C6 modification, Spacer C9 modification, dSpacer modification, or PC - linker modification.

[0124] In some embodiments, the universal sequence is a random sequence, and the universal sequence is not the same as or complementary - paired with the sequencing adapter sequence, the tag sequence, and / or the sequencing primer sequence.

[0125] In some embodiments, the universal sequence is a fixed sequence, which functions to connect the first oligonucleotide primer and the third oligonucleotide primer by complementary pairing with the bridge primer, and the universal sequence is not the same as or complementary - paired with the sequencing adapter sequence, the tag sequence, and / or the sequencing primer sequence.

[0126] In some embodiments, the universal sequence is not the same as or complementary - paired with the target gene sequence.

[0127] In some embodiments, the base composition of the universal sequence is balanced.

[0128] In some embodiments, the length of the universal sequence is 5 - 200 bp, such as 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 15 bp, 20 bp, 25 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 120 bp, 150 bp, 160 bp, 180 bp, and 200 bp.

[0129] In some embodiments, the first oligonucleotide primer includes at least a pair of upstream first oligonucleotide primers and downstream first oligonucleotide primers.

[0130] In some embodiments, the upstream first oligonucleotide primer sequentially includes an upstream sequencing adapter sequence, an upstream tag sequence, and an upstream sequencing primer sequence from the 5'-end to the 3'-end, and the downstream first oligonucleotide primer sequentially includes a downstream sequencing adapter sequence, a downstream tag sequence, and a downstream sequencing primer sequence from the 5'-end to the 3'-end.

[0131] In some embodiments, the upstream first oligonucleotide primer does not include (the upstream) tag sequence, and / or the downstream first oligonucleotide primer does not include (the downstream) tag sequence.

[0132] In some embodiments, the sequencing adapter sequence is a sequencing matrix-related sequence used by current or future sequencing platforms (including but not limited to the iontorrent platform, the Illumina platform, and the BGI MGI platform).

[0133] In some embodiments, the sequencing adapter sequence includes an upstream sequencing adapter sequence and a downstream sequencing adapter sequence.

[0134] In some embodiments, the upstream sequencing adapter sequence is the P5 adapter sequence of the Illumina platform, and the downstream sequencing adapter sequence is the P7 adapter sequence of the Illumina platform; vice versa.

[0135] In some embodiments, the upstream sequencing adapter sequence is the P1 adapter sequence of the Ion torrent platform, and the downstream sequencing adapter sequence is the A adapter sequence of the Ion torrent platform; vice versa.

[0136] In some embodiments, the upstream sequencing adapter sequence is the single-end tag library construction upstream splint sequence of the MGI platform, and the downstream sequencing adapter sequence is the single-end tag library construction downstream splint sequence of the MGI platform; vice versa. In some embodiments, the upstream sequencing adapter sequence is the paired-end tag library construction upstream splint sequence of the MGI platform, and the downstream sequencing adapter sequence is the paired-end tag library construction downstream splint sequence of the MGI platform; vice versa.

[0137] In some embodiments, the upstream first oligonucleotide primer is the i5 primer of the Illumina platform, and the downstream first oligonucleotide primer is the i7 primer of the Illumina platform; vice versa.

[0138] In some embodiments, the third oligonucleotide primer comprises at least a pair of upstream third oligonucleotide primers and downstream third oligonucleotide primers.

[0139] In some embodiments, the upstream third oligonucleotide primer sequentially comprises an upstream universal sequence and a gene-specific upstream primer sequence from the 5'-end to the 3'-end.

[0140] In some embodiments, the downstream third oligonucleotide primer sequentially comprises a downstream universal sequence and a gene-specific downstream primer sequence from the 5'-end to the 3'-end.

[0141] In some embodiments, the bridge primer comprises at least a pair of upstream bridge primers and downstream bridge primers.

[0142] In some embodiments, the upstream bridge primer sequentially comprises the reverse complementary sequence of the upstream universal sequence and the reverse complementary sequence of the upstream sequencing primer from the 5'-end to the 3'-end.

[0143] In some embodiments, the downstream bridge primer sequentially comprises the reverse complementary sequence of the downstream universal sequence and the reverse complementary sequence of the downstream sequencing primer from the 5'-end to the 3'-end.

[0144] In some embodiments, the upstream sequencing primer is sequencing primer 1 of the TruSeq library structure, and the downstream sequencing primer is sequencing primer 2 of the TruSeq library structure; vice versa.

[0145] In some embodiments, the upstream sequencing primer is sequencing primer 1 of the Nextera library structure, and the downstream sequencing primer is sequencing primer 2 of the Nextera library structure; vice versa.

[0146] In some embodiments, the upstream sequencing primer is sequencing primer 1 of the TruSeq library structure, and the downstream sequencing primer is sequencing primer 2 of the Nextera library structure; vice versa.

[0147] In some embodiments, the upstream sequencing primer is sequencing primer 1 of the Nextera library structure, and the downstream sequencing primer is sequencing primer 2 of the TruSeq library structure; vice versa.

[0148] The sixth aspect of the present invention provides a composition, which comprises a DNA polymerase, a T4 DNA ligase, ATP, dNTPs, buffer components, metal salts and a primer combination; the primer combination comprises the first oligonucleotide primer, the third oligonucleotide primer and the bridge primer described in the fifth aspect.

[0149] In some embodiments, the first oligonucleotide primer, the third oligonucleotide primer and the bridge primer each exist in the composition in a single-stranded form respectively. In some embodiments, the first oligonucleotide primer and the bridge primer are complementary through the sequencing primer sequence, and the third oligonucleotide primer and the bridge primer are complementary through the universal primer sequence to form a three-primer double-stranded complementary structure and exist in the composition.

[0150] In some embodiments, the first oligonucleotide primer comprises at least one pair of the upstream first oligonucleotide primer and the downstream first oligonucleotide primer described in the fourth aspect, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0151] In some embodiments, the difference between each pair of the upstream first oligonucleotide primer and the downstream first oligonucleotide primer lies in that the tag sequences are different.

[0152] In some embodiments, the third oligonucleotide primer comprises at least one pair of the upstream third oligonucleotide primer and the downstream third oligonucleotide primer described in the fifth aspect, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0153] In some embodiments, the difference between each pair of the upstream third oligonucleotide primer and the downstream third oligonucleotide primer lies in that the gene-specific primer sequences are different.

[0154] In some embodiments, the bridge primer comprises at least one pair of the upstream bridge primer described in the fifth aspect and the downstream bridge primer described in the fourth aspect, such as at least 1 pair or 2 pairs.

[0155] In some embodiments, the difference between each pair of the upstream bridge primer and the downstream bridge primer lies in that the sequencing primers are different.

[0156] In some embodiments, the composition further comprises a DNA sample.

[0157] In some embodiments, the DNA sample is gDNA or cDNA.

[0158] In some embodiments, the 5'-end of the third oligonucleotide primer contains or does not contain a phosphorylation modification.

[0159] In some embodiments, when the 5'-end of the third oligonucleotide primer does not contain a phosphorylation modification, and the composition further comprises a substance capable of phosphorylating the 5'-end of the third oligonucleotide primer, such as T4 Polynucleotide Kinase (T4 PNK).

[0160] In some embodiments, the mass ratio or molar ratio of the first oligonucleotide primer to the third oligonucleotide primer is N:1, where N is a constant greater than or equal to 1 and less than or equal to 5, such as 1, 2, 3, 4, and 5.

[0161] In some embodiments, the DNA polymerase is any thermostable DNA polymerase known in the art. In some embodiments, the thermostable DNA polymerase is one or more of Taq DNA polymerase, Pfu DNA polymerase, Vent DNA polymerase, DeepVent DNA polymerase, and KOD DNA polymerase.

[0162] In some embodiments, the buffer component is one or more of Tris, Tris-HCl, Tris base, or HEPES, preferably Tris.

[0163] In some embodiments, the metal salt is Mg 2+ salt, preferably MgCl2.

[0164] In some embodiments, the metal salt is Mg 2+ salt, and one or more of K + salt, Mn 2+ salt, Cs + salt, Na + salt, and Ca 2+ salt.

[0165] In some embodiments, the composition further comprises other substances that can help the components in the composition, such as enzymes, to function, such as glycerol.

[0166] In some embodiments, the composition further comprises a surfactant, such as one or more of an anionic surfactant, a cationic surfactant, and a nonionic surfactant.

[0167] The seventh aspect of the present invention provides a method for constructing a multiplex amplicon library, the method comprising the following steps:

[0168] (1) Prepare a reaction system containing at least a pair of first oligonucleotide primers, at least a pair of third oligonucleotide primers, at least a pair of bridge primers, and sample nucleic acids; wherein, the first oligonucleotide primer sequentially includes a sequencing adapter sequence, a tag sequence, and a sequencing primer sequence from the 5'-end to the 3'-end, the third oligonucleotide primer sequentially includes a universal sequence and a gene-specific primer sequence from the 5'-end to the 3'-end, and the bridge primer sequentially includes the reverse complementary sequence of the universal sequence and the reverse complementary sequence of the sequencing primer from the 5'-end to the 3'-end;

[0169] (2) Make the 3'-ends of the first oligonucleotide primer and the bridge primer be reverse complementary and paired, make the 5'-ends of the third oligonucleotide primer and the bridge primer be reverse complementary and paired, and connect the first oligonucleotide primer and the third oligonucleotide primer to obtain a ligation product;

[0170] (3) Use the ligation product in step (2) as a primer to perform PCR amplification on the sample nucleic acids.

[0171] In some embodiments, the tag sequence is a random sequence for distinguishing different samples. In some embodiments, the tag sequence is at least 3 nucleotides, such as 4 - 12 nucleotides, preferably 6 - 8 nucleotides, such as 8 nucleotides.

[0172] In some embodiments, the gene-specific primer sequence is a specific primer sequence designed according to the target fragment of the DNA sample to be tested. For example, the gene-specific primer sequence contains at least 3 nucleotides, such as 3 - 50 nucleotides, such as 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 18, 20, 22, 25, 26, 28, 30, 32, 35, 38, 40, 42, 45, 48, and 50 nucleotides.

[0173] In some embodiments, the reverse complementary sequence of the universal sequence refers to a sequence that is partially or completely reverse complementary to the universal sequence, and the reverse complementary sequence of the sequencing primer refers to a sequence that is partially or completely reverse complementary to the sequencing primer.

[0174] In some embodiments, the 5'-end of the third oligonucleotide primer contains or does not contain phosphorylation modification.

[0175] In some embodiments, the 3'-end of the bridge primer contains a blocking modification that prevents the addition of dNTPs to the 3'-end of the bridge primer for extension. In some embodiments, the blocking modification is a 3'-phosphorylation modification or a spacer modification; preferably, the spacer modification is a Spacer C3 modification, a Spacer C6 modification, a Spacer C9 modification, a dSpacer modification, or a PC-linker modification.

[0176] In some embodiments, the universal sequence is a random sequence, and the universal sequence is not the same as or complementary to the sequencing adapter sequence, the tag sequence, and / or the sequencing primer sequence.

[0177] In some embodiments, the universal sequence is a fixed sequence that functions to connect the first oligonucleotide primer and the third oligonucleotide primer by complementary pairing with the bridge primer, and the universal sequence is not the same as or complementary to the sequencing adapter sequence, the tag sequence, and / or the sequencing primer sequence.

[0178] In some embodiments, the universal sequence is not the same as or complementary to the target gene sequence.

[0179] In some embodiments, the base composition of the universal sequence is balanced.

[0180] In some embodiments, the length of the universal sequence is 10-200 bp, such as 10 bp, 15 bp, 20 bp, 25 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 120 bp, 150 bp, 160 bp, 180 bp, and 200 bp.

[0181] In some embodiments, the at least one pair of first oligonucleotide primers includes at least one pair of upstream first oligonucleotide primers and downstream first oligonucleotide primers.

[0182] In some embodiments, the upstream first oligonucleotide primer sequentially includes an upstream sequencing adapter sequence, an upstream tag sequence, and an upstream sequencing primer sequence from the 5'-end to the 3'-end, and the downstream first oligonucleotide primer sequentially includes a downstream sequencing adapter sequence, a downstream tag sequence, and a downstream sequencing primer sequence from the 5'-end to the 3'-end.

[0183] In some embodiments, the upstream first oligonucleotide primer does not include an (upstream) tag sequence, and / or the downstream first oligonucleotide primer does not include a (downstream) tag sequence.

[0184] In some embodiments, the sequencing adapter sequence is a sequencing matrix-related sequence used by current or future sequencing platforms (including but not limited to the Ion Torrent platform, the Illumina platform, and the BGI MGI platform).

[0185] In some embodiments, the at least one pair of sequencing adapter sequences includes at least one pair of upstream sequencing adapter sequences and downstream sequencing adapter sequences.

[0186] In some embodiments, the upstream sequencing adapter sequence is the P5 adapter sequence of the Illumina platform, and the downstream sequencing adapter sequence is the P7 adapter sequence of the Illumina platform; vice versa.

[0187] In some embodiments, the upstream sequencing adapter sequence is the P1 adaptor sequence of the Ion Torrent platform, and the downstream sequencing adapter sequence is the A adaptor sequence of the Ion Torrent platform; vice versa.

[0188] In some embodiments, the upstream sequencing adapter sequence is the single-end tag library construction upstream splint sequence of the MGI platform, and the downstream sequencing adapter sequence is the single-end tag library construction downstream splint sequence of the MGI platform; vice versa. In some embodiments, the upstream sequencing adapter sequence is the paired-end tag library construction upstream splint sequence of the MGI platform, and the downstream sequencing adapter sequence is the paired-end tag library construction downstream splint sequence of the MGI platform; vice versa.

[0189] In some embodiments, the upstream first oligonucleotide primer is the i5 primer of the Illumina platform, and the downstream first oligonucleotide primer is the i7 primer of the Illumina platform; vice versa.

[0190] In some embodiments, the third oligonucleotide primer includes at least one pair of upstream third oligonucleotide primers and downstream third oligonucleotide primers.

[0191] In some embodiments, the upstream third oligonucleotide primer sequentially includes an upstream universal sequence and a gene-specific upstream primer sequence from the 5'-end to the 3'-end.

[0192] In some embodiments, the downstream third oligonucleotide primer sequentially includes a downstream universal sequence and a gene-specific downstream primer sequence from the 5'-end to the 3'-end.

[0193] In some embodiments, the at least one pair of bridge primers includes at least one pair of upstream bridge primers and downstream bridge primers.

[0194] In some embodiments, the upstream bridge primer sequentially includes the reverse complementary sequence of the upstream universal sequence and the reverse complementary sequence of the upstream sequencing primer from the 5'-end to the 3'-end.

[0195] In some embodiments, the downstream bridge primer sequentially includes a reverse complementary sequence of a downstream universal sequence and a reverse complementary sequence of a downstream sequencing primer from the 5'-end to the 3'-end.

[0196] In some embodiments, the upstream sequencing primer is sequencing primer 1 of the TruSeq library structure, and the downstream sequencing primer is sequencing primer 2 of the TruSeq library structure; and vice versa.

[0197] In some embodiments, the upstream sequencing primer is sequencing primer 1 of the Nextera library structure, and the downstream sequencing primer is sequencing primer 2 of the Nextera library structure; and vice versa.

[0198] In some embodiments, the upstream sequencing primer is sequencing primer 1 of the TruSeq library structure, and the downstream sequencing primer is sequencing primer 2 of the Nextera library structure; and vice versa.

[0199] In some embodiments, the upstream sequencing primer is sequencing primer 1 of the Nextera library structure, and the downstream sequencing primer is sequencing primer 2 of the TruSeq library structure; and vice versa.

[0200] In some embodiments, the at least one pair of first oligonucleotide primers includes at least one pair of the upstream first oligonucleotide primers and the downstream first oligonucleotide primers, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs, and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0201] In some embodiments, the difference between each pair of the upstream first oligonucleotide primers and the downstream first oligonucleotide primers lies in that the tag sequences are different.

[0202] In some embodiments, the at least one pair of third oligonucleotide primers includes at least one pair of the upstream third oligonucleotide primers and the downstream third oligonucleotide primers, such as at least 1 pair, 5 pairs, 10 pairs, 20 pairs, 50 pairs, 100 pairs, 200 pairs, 300 pairs, and 500 pairs, including but not limited to any natural number between 1 and 1000.

[0203] In some embodiments, the difference between each pair of the upstream third oligonucleotide primers and the downstream third oligonucleotide primers lies in that the gene-specific primer sequences are different.

[0204] In some embodiments, the at least one pair of bridge primers includes at least one pair of the upstream bridge primers and the downstream bridge primers, such as at least 1 pair or 2 pairs.

[0205] In some embodiments, each pair of the upstream bridge primers and the downstream bridge primers differ in the sequencing primers.

[0206] In some embodiments, the reaction temperature in step (2) is 20 - 50 °C, preferably 25 - 45 °C, such as 25 °C, 26 °C, 27 °C, 28 °C, 29 °C, 30 °C, 31 °C, 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, 42 °C, 43 °C, 44 °C or 45 °C.

[0207] In some embodiments, the reaction time in step (2) is 1 - 60 minutes, preferably 5 - 40 minutes, such as 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 31 minutes, 32 minutes, 33 minutes, 34 minutes, 35 minutes, 36 minutes, 37 minutes, 38 minutes, 39 minutes or 40 minutes.

[0208] In some embodiments, the reaction conditions in step (2) are incubation at 20 - 50 °C for 1 - 60 minutes, incubation at 20 - 50 °C for 5 - 40 minutes, incubation at 25 - 45 °C for 5 - 40 minutes, incubation at 25 - 40 °C for 5 - 40 minutes, incubation at 25 - 40 °C for 5 - 35 minutes, incubation at 25 - 35 °C for 5 - 35 minutes, incubation at 25 - 35 °C for 5 - 30 minutes or incubation at 37 °C for 5 - 30 minutes, including but not limited to any combination of the aforementioned incubation temperatures and incubation times.

[0209] In some embodiments, the reaction system further includes a DNA ligase, preferably T4 DNA ligase. In some embodiments, during the incubation in step (2), the ligation product generated by the first oligonucleotide primer and the third oligonucleotide primer under the action of the bridge primer and T4 DNA ligase is an Index - T4 - Panel long primer, and the Index - T4 - Panel long primer sequentially includes a linker sequence - tag sequence - sequencing primer sequence - universal sequence - gene - specific primer sequence from the 5' end to the 3' end.

[0210] In some embodiments, the sample nucleic acid is DNA. For example, the DNA is gDNA or cDNA.

[0211] In some embodiments, the 5' end of the third oligonucleotide primer contains or does not contain a phosphorylation modification.

[0212] In some embodiments, when the 5'-end of the third oligonucleotide primer does not contain a phosphorylation modification, the composition further includes a substance capable of phosphorylating the 5'-end of the third oligonucleotide primer, such as T4 Polynucleotide Kinase (T4 PNK).

[0213] In some embodiments, the mass ratio or molar ratio of the first oligonucleotide primer to the third oligonucleotide primer is N:1, where N is a constant greater than or equal to 1 and less than or equal to 5, such as 1, 2, 3, 4, and 5.

[0214] In some embodiments, the reaction system further includes a DNA polymerase. In some embodiments, the DNA polymerase is any heat-resistant DNA polymerase known in the art. In some embodiments, the heat-resistant DNA polymerase is one or more of Taq DNA polymerase, Pfu DNA polymerase, Vent DNA polymerase, Deep Vent DNA polymerase, and KOD DNA polymerase.

[0215] In some embodiments, the reaction system further includes a buffering component. In some embodiments, the buffering component is one or more of Tris, Tris-HCl, Tris base, or HEPES, preferably Tris.

[0216] In some embodiments, the reaction system further includes a metal salt. In some embodiments, the metal salt is Mg 2+ salt, preferably MgCl2. In some embodiments, the metal salt is Mg 2+ salt, and K + salt, Mn 2+ salt, Cs + salt, Na + salt, and Ca 2+ salt, or one or more of them.

[0217] In some embodiments, the reaction system further contains dNTP.

[0218] In some embodiments, the reaction system further contains other components known in the art that can help DNA polymerase and ribonuclease function, such as glycerol.

[0219] In some embodiments, the reaction system further contains a surfactant, such as one or more of an anionic surfactant, a cationic surfactant, and a nonionic surfactant.

[0220] In some embodiments, the PCR amplification includes one or more (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40 cycles) of denaturation, annealing, and extension; preferably, the PCR amplification includes pre-denaturation and multiple cycles (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40) of denaturation, annealing, and extension.

[0221] In some embodiments, the PCR amplification is one round of PCR amplification.

[0222] In some embodiments, the conditions for the PCR amplification can be any conventional PCR amplification conditions known to those of ordinary skill in the art.

[0223] In some embodiments, the method further includes step (4) of purifying the amplification product of the sample nucleic acid.

[0224] In some embodiments, the purification is performed by the magnetic bead method, high-salt precipitation method, centrifugal column method, or phenol-chloroform extraction method, preferably the magnetic bead method.

[0225] The eighth aspect of the present invention provides an oligonucleotide primer, which sequentially includes a linker sequence - tag sequence - sequencing primer sequence - universal sequence - gene-specific primer sequence from the 5' end to the 3' end.

[0226] The ninth aspect of the present invention provides the application of the method of the third aspect or the seventh aspect in multiplex amplicon library construction.

[0227] In the present invention, between a sequence and its reverse complementary sequence, it can be completely complementary or partially complementary, as long as subsequent extension and amplification can be achieved.

[0228] "Completely complementary" means that all nucleotide bases of this sequence can pair with all nucleotide bases of the corresponding reverse complementary sequence.

[0229] "Partially complementary" means that at least 30% (e.g., 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%) of the continuous sequence of this sequence, but not all bases, hybridize with the same number of bases in the entire continuous sequence of the corresponding reverse complementary sequence.

[0230] The composition of the present invention is used in a multiplex amplification system. Brief Description of the Drawings

[0231] Figure 1 : Schematic diagram of the existing two-round multiplex amplicon library construction;

[0232] Figure 2 : Schematic diagram of one-step multiplex amplicon library construction based on reverse Panel primers;

[0233] Figure 3 : Schematic diagram of one-step multiplex amplicon library construction based on bridge primers and T4 DNA ligase;

[0234] Figure 4 : Denaturing polyacrylamide gel electrophoresis pattern of primer extension for test group 1-14 in Example 1;

[0235] Figure 5 : Denaturing polyacrylamide gel electrophoresis pattern of primer extension for test group 1-20 in Example 2;

[0236] Figure 6 : Denaturing polyacrylamide gel electrophoresis pattern of primer extension for test group 1-6 in Example 3;

[0237] Figure 7 : Gel electrophoresis pattern of amplification products for test group 1-10 in Example 4;

[0238] Figure 8 : Denaturing polyacrylamide gel electrophoresis pattern after primer ligation for test group 1-11 in Example 5;

[0239] Figure 9 : Gel electrophoresis pattern of amplification products for test group 1-10 in Example 6;

[0240] Figure 10 : Final library structures of the 5TS-7NT group and the 5NT-7TS group;

[0241] Figure 11 : Gel electrophoresis pattern of amplification products for test group 1-4 in Example 7;

[0242] Figure 12 : T4-panel-16 primer sequences for constructing the 5NT-7TS library structure in Example 8;

[0243] Figure 13 : T4-panel-16 primer sequences for constructing the 5TS-7NT library structure in Example 8;

[0244] Figure 14 : Panel-16 primer sequences containing only specific sequences in Example 8;

[0245] Figure 15 : Gel electrophoresis pattern of 16-plex panel one-step amplification products for test group 1-13 in Example 8;

[0246] Figure 16: Gel electrophoresis diagrams of the amplification products of primers P5 and P7 for test groups 1 - 13 in Example 8;

[0247] Figure 17 : Reverse panel primer sequences for constructing the library in Example 9;

[0248] Figure 18 : Panel primer sequences for constructing the library in Example 9;

[0249] Figure 19 : Gel electrophoresis diagrams of the amplification products for test groups 1 - 10 in Example 9;

[0250] Figure 20 : Peak shape diagrams of the target products of the one - tube one - step and two - step libraries in Example 11;

[0251] Figure 21 : Number of reads detected by library sequencing of the one - tube one - step and two - step methods in Example 11;

[0252] Figure 22 : Number of dimers detected by library sequencing of the one - tube one - step and two - step methods in Example 11;

[0253] Figure 23 : Number of reads detected by library sequencing of the one - tube one - step and two - step methods in Example 10;

[0254] Figure 24 : Number of dimers detected by library sequencing of the one - tube one - step and two - step methods in Example 10.

[0255] Detailed implementation manners (Examples)

[0256] The technical solutions of the present invention will be further described below in conjunction with the accompanying drawings and through specific implementation manners. However, the following examples are merely simple examples of the present invention and do not represent or limit the scope of the protection of the rights of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0257] In the following examples, unless otherwise specified, the reagents and consumables used are purchased from conventional reagent manufacturers in the art; unless otherwise specified, the experimental methods and technical means used are conventional methods and means in the art.

[0258] Example 1

[0259] Index primers and reverse Panel primers are extended by DNA polymerase to generate Index - panel long primers.

[0260] Using the conventional Vazyme #NA301 multiplex amplification system, add the upstream and downstream Index primers (Vazyme #TD202) and the corresponding upstream and downstream reverse Panel primers (Panel-Rp) to the system, and further add Phanta DNA polymerase (Vazyme #P501) without antibody blocking. The amplification system and component volumes are shown in Table 1, and the primer types and lengths in the system and the products are shown in Table 2. Among them, Vazyme #NA301 contains a hot-start polymerase, and Vazyme #P501 is a non-hot-start polymerase. Among them, the primer sequences of Panel-Rp are respectively (direction: 5'-3', the same below):

[0261] Panel-Rp-Forward (SEQ ID NO.1): TGCTTATCAATGGATTTATATTTGT GACTGTCTCTTATACACATCTGACGCTGCCGACGA-C3 spacer

[0262] Panel-Rp-Reverse (SEQ ID NO.2): CCCATTAGGATATTTCAAAGGTATA TAAAGCTGTCTCTTATACACATCTCCGAGCCCACGAGAC-C3 spacer

[0263] Set up test groups 1-14 with different reaction temperatures and reaction times as shown in Table 3, and carry out reactions according to the corresponding reaction temperatures and times. Perform denaturing polyacrylamide gel electrophoresis on the products after each group of reactions, and the results are as Figure 4 shown.

[0264] Table 1

[0265]

[0266] Table 2

[0267]

[0268] Table 3

[0269]

[0270] As Figure 4 , the extension of the Index-panel long primers can be efficiently completed at 25°C to 65°C, indicating that the replication and generation of the Index-panel long primers can be efficiently completed through the reverse Panel primers.

[0271] In this example, the Index primer (Vazyme#TD202) of the Vazyme transposon library structure was used for testing. At the same time, this method is also suitable for the Index primers of conventional traditional Illumina library structures, such as Vazyme#N321 / N322. It only needs to design the corresponding complementary sequence on the reverse panel primer according to the sequence at the 3' end of the Index primer. Further, for the sequencing library structure of the BGI MGI platform or the library structures of other sequencing platforms known in the art, the same similar method is adopted, that is, the complementary sequence on the reverse panel primer can be designed according to the difference in the primer sequence at the 3' end of the Index primer used, so as to realize one-tube one-step multiplex amplicon library construction.

[0272] Example 2

[0273] Reverse panel primer for RNase H2 to remove RNA base modifications.

[0274] To further test the scheme of inactivating the reverse panel primer after generating the Index-panel long primer through the reverse panel primer, we selected the upstream and downstream reverse panel primers carrying RNA modifications (Panel-Rp-R) and combined them with heat-activated RNase H2 (IDT#11-03-02-03, which is an endoribonuclease that functions at high temperatures and can specifically recognize single-base RNA on double-stranded DNA and excise it) to inactivate the reverse panel primer. To test the optimal reaction conditions of RNase H2, which need to ensure that the DNA polymerase first completes the synthesis of the Index-panel long primer, and then RNase H2 can remove the reverse panel primer. The test groups 1-20 with different extension temperatures and reaction times are shown in Table 5. The amplification system was prepared as shown in Table 5 and reacted according to the reaction procedure shown in Table 4. The sequences of Panel-Rp-R are as follows:

[0275] Panel-Rp-R-Forward (SEQ ID NO.3):

[0276] TGCTTAT / rC / AATGGATTTA / rU / ATTTGTG / rA / CTGTCTCTTATACACATCTGACGCTGCCGACGA-C3 spacer

[0277] Panel-Rp-R-Reverse (SEQ ID NO.4):

[0278] CCCATTA / rG / GATATTTCAAAGG / rU / ATATAAA / rG / CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-C3 spacer

[0279] The reaction products were subjected to denaturing polyacrylamide gel electrophoresis, and the results are as Figure 5 shown.

[0280] Table 4

[0281]

[0282] Table 5

[0283]

[0284]

[0285] As described above, in this example, the optimal working conditions of RNase H2 were tested. It is necessary to ensure that RNase H2 is inactive during the process of DNA polymerase generating long primers. As can be seen from the Figure 5 results, under the reaction conditions of test groups 1-9, whether RNase H2 was added or not, there was no or only very weak digestion products of the reverse panel primer, indicating that RNase H2 basically did not exert its activity when the first-step reaction temperature was less than 40°C. Therefore, 25-40°C can be selected as the temperature for the DNA polymerase extension reaction, which can not only allow the DNA polymerase to efficiently generate Index-Panel long primers but also ensure that RNase H2 is in an inactivated state. After the reaction temperature is higher than 40°C, as shown in Figure 5 test groups 10-18, RNase H2 can already exert its RNA base cleavage activity. Therefore, there will be a situation where the reverse panel primer is cleaved by RNase H2 before the Index primer is fully extended into a long primer, resulting in the Index-panel long primer terminating at the position of the RNA-modified base, ultimately generating incomplete Index-panel long primers and causing non-specific amplification in the subsequent steps. In summary, the complementary extension reaction of the Panel-Rp-R primer and the Index primer can be carried out at 25-40°C, and the reaction of RNase H2 cleaving the Panel-Rp-R primer can be carried out at 40-72°C.

[0286] Example 3

[0287] Test on the primer extension and reverse panel primer clearance effects of a DNA polymerase.

[0288] To test the generation of Index-panel long primers and the elimination effect of reverse panel primers under the condition that only one heat-resistant DNA polymerase is contained in the amplification system, we selected the amplification system of Vazyme#PM202 combined with one heat-resistant DNA polymerase (Vazyme#PM202) and heat-activated RNase H2 (IDT#11-03-02-03) to set up the test groups shown in Table 6; the Index and Panel-Rp-R primer sequences used in the test were the same as those in Example 2; the prepared system was as shown in Table 7; the reaction was carried out according to the conditions described in the table, and the reaction products were subjected to denaturing polyacrylamide gel electrophoresis. The results are as Figure 6 shown.

[0289] Table 6

[0290]

[0291] Table 7

[0292] Component Volume 2×PCR buffer (Vazyme#PM202) 15 μL DNA polymerase (Vazyme#PM202) 1 μL / - i5 + i7 (Vazyme#TD202) 4 μL + 4 μL Panel - Rp (10 μM) 2 μL + 2 μL RNaseH2 3 U / 10 U / 30 U / - <![CDATA[ddH2O]]> to 30 μL

[0293] As Figure 6 shown, the extension of Index-panel long primers can also be efficiently completed in the amplification system containing only one heat-resistant DNA polymerase.

[0294] Example 4

[0295] Primer extension-mediated one-step amplification test.

[0296] Ten groups of amplification experiments were further set up, namely GSP primers (GSP-F / R), panel primers, Index primers + panel primers, Index primers + reverse panel primers containing RNA base modifications (Panel-RP-R), and Index primers + reverse panel primers without RNA base modifications (Panel-RP). The specific settings such as the enzyme addition amount and primer addition amount for each group are shown in Table 8. The components and addition amounts of the amplification system are shown in Table 9. The amplification reaction program is shown in Table 10. The meanings and lengths of different primer groups are shown in Table 11. The sequences of some of the primers are as follows:

[0297] Panel-Rp-Forward (SEQ ID NO.1): TGCTTATCAATGGATTTATATTTGT GACTGTCTCTTATACACATCTGACGCTGCCGACGA-C3 spacer

[0298] Panel-Rp-Reverse(SEQ ID NO.2): CCCATTAGGATATTTCAAAGGTATA TAAAGCTGTCTCTTATACACATCTCCGAGCCCACGAGAC-C3 spacer

[0299] Panel-Rp-R-Forward(SEQ ID NO.3):

[0300] TGCTTAT / rC / AATGGATTTA / rU / ATTTGTG / rA / CTGTCTCTTATACACATCTGACGCTGCCGACGA-C3 spacer

[0301] Panel-Rp-R-Reverse(SEQ ID NO.4):

[0302] CCCATTA / rG / GATATTTCAAAGG / rU / ATATAAA / rG / CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-C3 spacer

[0303] GSP-Forward(SEQ ID NO.5): TCACAAATATAAATCCATTGATAAGCAGSP-Reverse(SEQID NO.6): CTTTATATACCTTTGAAATATCCTAATGGGPanel-Forward(SEQ ID NO.7): TCGTCGGCAGCGTCAGATGTGTATAA GAGACAGTCACAAATATAAATCCATTGATAAGCA

[0304] Panel-Reverse(SEQ ID NO.8): GTCTCGTGGGCTCGGAGATGTGTATA AGAGACAGCTTTATATACCTTTGAAATATCCTAATGGG

[0305] The amplified products were subjected to agarose gel electrophoresis, and the results are as Figure 7 shown.

[0306] Table 8

[0307]

[0308] Table 9

[0309] Component Volume Vazyme#NA301 15 μL Index, i5 + i7 (Vazyme#TD202) 4 μL / - Panel - Rp - R (10 μM) 1 μL / 2 μL / - Panel - Rp (10 μM) 1 μL / 2 μL / - Panel (10 μM) 2 μL / - GSP - F / R (10 μM) 2 μL / - Phanta DNA polymerase (Vazyme#P501) 1U RNaseH2 (IDT#11 - 03 - 02 - 03) 3U / - 293TgDNA 10 ng <![CDATA[ddH2O]]> To 30 μL

[0310] Table 10

[0311]

[0312]

[0313] Table 11

[0314]

[0315] Such as Figure 7 In Test Group 1, it was shown that if the reverse panel primer was not removed by RNase H2, amplification would not occur. In the test groups with RNase H2 added, as the proportion of the Index primer increased, the output of the target product could be increased, as shown in Test Groups 3 and 4. In Test Groups 5 and 6, the Index and panel primers were directly added to the system for amplification, and a large amount of non-specific products would be generated under the action of phanta DNA polymerase.

[0316] Example 5

[0317] Test for generating Index-T4-panel long primers dependent on T4 DNA ligase.

[0318] To generate Index-T4-panel long primers by ligating the Index and T4-panel primers with a ligase, we designed a method using T4 DNA ligase. The Index primer and T4-panel primer were ligated to generate Index-T4-panel long primers through a bridging primer (Splint Oligo, carrying RNA base modifications and a blocked base at the 3' end, such as C3-Spacer) and T4 DNA ligase. The T4-Panel primer contains a universal sequence and a gene-specific primer sequence, and the Panel primer contains a sequencing primer sequence and a gene-specific primer sequence. To explore the optimal ligation conditions of T4 DNA ligase, Test Groups 1-11 were set up according to Table 12. The components and contents of the amplification system are shown in Table 13, the amplification program is shown in Table 14, and the meanings and lengths of each primer are shown in Table 15. Some of the primer sequences are as follows:

[0319] Panel-Forward (SEQ ID NO.7): TCGTCGGCAGCGTCAGATGTGTATAA GAGACAGTCACAAATATAAATCCATTGATAAGCA

[0320] Panel-Reverse(SEQ ID NO.8): GTCTCGTGGGCTCGGAGATGTGTATA AGAGACAGCTTTATATACCTTTGAAATATCCTAATGGG

[0321] Splint-Forward(SEQ ID NO.9): TCTTGAGT / rG / AGACGCT / rG / CCGAC-C3 spacer

[0322] Splint-Reverse(SEQ ID NO.10): GCTGTTG / rA / TGCCGA / rG / CCCAC-C3spacer

[0323] T4-Panel-Forward(SEQ ID NO.11): 5p-TCACTCAAGAAGATGTGTATA AGAGACAGTCACAAATATAAATCCATTGATAAGCA

[0324] T4-Panel-Reverse(SEQ ID NO.12): 5p-CATCAACAGCAGATGTGTATA AGAGACAGCTTTATATACCTTTGAAATATCCTAATGGG

[0325] The amplified products were subjected to denaturing polyacrylamide gel electrophoresis, and the results are as Figure 8 shown.

[0326] Table 12

[0327]

[0328] Table 13

[0329]

[0330]

[0331] Table 14

[0332]

[0047] 3>

[0333] Table 15

[0334]

[0335] as Figure 8, in this example, the usage amounts of different ligases and different ligation conditions were tested. Through denaturing PAGE gel detection, the results showed that T4 DNA ligase could well ligate the Index primer and the T4-Panel primer under several tested conditions.

[0336] Example 6

[0337] Amplification test mediated by T4 DNA ligase in one-step method

[0338] To test the amplification efficiency of the Index-T4-panel long primer generated by the T4 DNA ligase protocol we designed, 10 groups of amplification experiments were further set up, namely Index primer + Splint Oligo (bridging primer) + T4-Panel primer, T4-Panel primer, Panel primer + Index primer. The specific settings such as the enzyme addition amount and primer addition amount for each group are shown in Table 16. The components and addition amounts of the amplification system are shown in Table 17. The amplification reaction procedure is shown in Table 18. The meanings and lengths of different primer groups are shown in Table 19. The sequences of the primers are the same as those in Example 5.

[0339] Agarose gel electrophoresis was performed on the amplification products, and the results are as Figure 9 shown.

[0340] Table 16

[0341]

[0342] Table 17

[0343] Component Added amount Vazyme#NA301 15 μL Index (i5 + i7, Vazyme#TD202) 4 μL + 4 μL SplintOligo (10 μM) 2 μL T4 - Panel (10 μM) 2 μL Panel (10 μM) 2 μL / - RNaseH2 (IDT#11 - 03 - 02 - 03) 3U / - T4Ligase (Vazyme#C301) 5 μg / - ATP 0.25 mM 293TgDNA 10 ng <![CDATA[ddH2O]]> To 30 μL

[0344] Table 18

[0345]

[0346]

[0347] Table 19

[0348]

[0349] Result analysis: In this example, the amplification efficiency of the Index-T4-panel long primer formed by ligation with T4 DNA ligase under different conditions was further tested. As Figure 9As shown, it can be seen that the amplification product (456bp) of the Index-T4-Panel long primer after ligation is larger than that of the unligated Panel primer (367bp). The amplification efficiency of the Index-T4-Panel long primer can be judged to reach the same level as that of the Panel primer by the brightness level of the amplification product band. At the same time, the electrophoresis bands of Test Group 1-2 and Test Group 3 indicate that inactivating the bridge primer by RNase H2 has no effect on the amplification result, that is, the bridge primer will not have other effects on the amplification system. In summary, it is feasible to first ligate the Index primer and the T4-Panel primer with T4 DNA ligase to form a long primer and then perform amplification.

[0350] Example 7

[0351] Testing of different library structures by one-step amplification mediated by T4 DNA ligase.

[0352] To verify that the final library constructed by the one-tube library construction amplicon library construction scheme provided by the present invention meets the requirements of the Illumia sequencing platform, we designed a hybrid library structure. Specifically, one end is the TruSeq library structure and the other end is the Nextera library structure, so that normal compatible sequencing can be achieved on the Illumia sequencer. The bridge primers of the 5NT-7TS group (i5 is the Nextera structure and i7 is the TruSeq structure) are Splint-1 and Splint-2, the first oligonucleotide primer is the N5xx primer of Vazyme#TD202 + the DM7xx primer of Vazyme#N321, and the third oligonucleotide primer is T4-Panel-F1 and T4-Panel-F2; the bridge primers of the 5TS-7NT group (i5 is the TruSeq structure and i7 is the Nextera structure) are Splint-3 and Splint-4, the first oligonucleotide primer is the Vazyme#N321-DM5xx primer and the Vazyme#TD204-N9xx primer, and the third oligonucleotide primer is T4-Panel-F3 and T4-Panel-F4; the corresponding primer sequences are as follows:

[0353] Splint-1 (SEQ ID NO.13): TCTTATACACATCTGACGCTGCCG-C3 Spacer

[0354] Splint-2 (SEQ ID NO.14): GACAGGATGCAGATCGGAAGAGC-C3 Spacer

[0355] Splint-3 (SEQ ID NO.15): CTAGGGACTTAGATCGGAAGAGC-C3 Spacer

[0356] Splint-4 (SEQ ID NO.16): TCTTATACACATCTCCGAGCCCAC-C3 Spacer

[0357] T4-Panel-F1 (SEQ ID NO.17): 5p-AGATGTGTATAAGAGACAGTCACAAATATAAATCCATTGATAAGCA

[0358] T4-Panel-F2 (SEQ ID NO.18): 5p-GCATCCTGTCCTTTATATACCTTTGAAATATCCTAATGGG

[0359] T4-Panel-F3 (SEQ ID NO.19): 5p-AAGTCCCTAGTCACAAATATAAATC CATTGATAAGCA

[0360] T4-Panel-F4 (SEQ ID NO.20): 5p-AGATGTGTATAAGAGACAGCTTTATATACCTTTGAAATATCCTAATGGG

[0361] The primer addition settings for each group are shown in Table 20. The components and addition amounts of the amplification system for the 5NT-7TS group are shown in Table 21, and those for the 5TS-7NT group are shown in Table 22. The amplification reaction program is shown in Table 23. The final library structures of the 5NT-7TS group and the 5TS-7NT group are as Figure 10 shown. Agarose gel electrophoresis was performed on the amplification products, and the results are as Figure 11 shown.

[0362] Table 20

[0363]

[0364] Table 21

[0365] Component Volume Vazyme#NA301 15 μL Index i5, Vazyme#TD202N5xx 4 μL Index i7, Vazyme#N321DM7xx 4 μL SplintOligo (10 μM) 2 μL T4 - Panel (10 μM) 2 μL T4Ligase (Vazyme#C301) 5 μg / - 293TgDNA 10 ng ATP 0.25 mM / - <![CDATA[ddH2O]]> To 30 μL

[0366] Table 22

[0367] Component Volume Vazyme#NA301 15 μL Index i5, Vazyme#TD202 - N7xx 4 μL Index i7, Vazyme#N321 - DM5xx 4 μL SplintOligo (10 μM) 2 μL T4 - Panel (10 μM) 2 μL T4Ligase (Vazyme#C301) 5 μg / - 293TgDNA 10 ng ATP 0.25 mM / - <![CDATA[ddH2O]]> To 30 μL

[0368] Table 23

[0369]

[0370] As Figure 11 shown, the bridge primers for designing the library structures of 5NT-7TS and 5NT-7TS can effectively ligate the corresponding T4-Panel and Index primers into Index-T4-panel long primers, and can efficiently complete the amplification of the complete library structure in one step.

[0371] Example 8

[0372] T4 DNA ligase-mediated one-step multiplex panel amplification test.

[0373] To verify the one-tube one-step amplification protocol for constructing a multiplex amplicon library in the present invention, we further designed 16-plex panel primers for testing. Among them, the T4-panel-16 primer sequences for constructing the 5NT-7TS library structure are as Figure 12 shown, the T4-Panel-16 primer sequences for constructing the 5TS-7NT library structure are as Figure 13 shown, and the Panel-16 primer sequences containing only specific sequences are as Figure 14 shown. The sequence of the bridge primer used in the test is the same as that in Example 7. Set up the test groups according to Table 24, prepare the one-tube one-step amplification system according to Table 25, and perform the reaction according to the amplification procedure in Table 26. Detect the amplification effect by running a gel electrophoresis diagram of the amplification results. The results are as Figure 15 shown.

[0374] Recover the products of the one-step amplification of the above 16-plex panel, and use the P5 and P7 sequences of the library to perform amplification to verify whether the one-step amplification products all contain the effective libraries of the 16-plex panel. Take 50 ng of the recovered product, prepare the amplification system according to Table 27, perform the amplification according to Table 28, and detect the bands of the amplification products by agarose gel. The results are as Figure 16 shown. The sequences of the P5 primer and the P7 primer are as follows:

[0375] P5 (SEQ ID NO.21): AATGATACGGCGACCACCGAGA

[0376] P7 (SEQ ID NO.22): CAAGCAGAAGACGGCATACGAG

[0377] Table 24

[0378]

[0379] Table 25

[0380]

[0381]

[0382] Table 26

[0383]

[0384] Table 27

[0385]

[0386] Table 28

[0387]

[0388] As Figure 15 shown, whether it is the library structure type of 5NT-7TS or 5TS-7NT, the primers of the 16-fold T4-panel can complete the extension of long primers and the amplification of target fragments, and the electrophoresis bands of the amplification products are enhanced with the increase in the usage amount of the Index primers. When the Index primers are further increased, the target amplification of the multiplex panel will be inhibited.

[0389] As Figure 16 shown, for the one-step amplification products, further amplification was carried out with P5 and P7 primers. The results showed that the amplification products of the one-step test groups could all be amplified with P5 and P7 primers (test groups 1-4, 7-10), while the products of the non-one-step amplification system could not be amplified with P5 and P7 primers (test groups 5, 6, 11, 12, and 13). And with the increase in the content of Index primers in the system, the products amplified by P5 and P7 also increased. However, when the Index primers were further increased, the amplification of the target products was inhibited, indicating that in the one-step amplification system mediated by T4 DNA ligase, the usage ratio of Index primers to T4-panel primers can be from 1:1 to 4:1, and the condition of 2:1 to 3:1 is the best.

[0390] Example 9

[0391] One-step multiplex panel amplification test mediated by reverse complementary panel primers containing RNA modifications.

[0392] To verify the one-step amplification protocol for constructing a multiplex amplicon library mediated by reverse complementary primers containing RNA modifications in the present invention, we further designed a 14-fold reverse panel primer containing RNA modifications (Panel-Rp-R-14) for testing. The sequences of the 14-fold reverse panel primer containing RNA modifications (Panel-Rp-R-14) and the sequences of the normal panel primers are respectively as Figure 17 and Figure 18As shown, set up test groups according to Table 29, prepare a one-tube one-step amplification system according to Table 30, and perform reactions according to the amplification procedure in Table 31. Detect the amplification effect by running gel electrophoresis on the amplification results. The results are as Figure 19 shown.

[0393] Table 29

[0394]

[0395] Table 30

[0396]

[0397]

[0398] Table 31

[0399]

[0400] As Figure 19 shown, when the molar ratio of the Index primer to the reverse panel primer containing RNA modification is 1:1, the effect of one-tube one-step multiplex amplification mediated by the reverse panel primer containing RNA modification is the best, while the target characteristic products obtained by direct amplification of the conventional panel primer and Index mixture are fewer, and the proportion of the final effective library is low. In summary, the test results of the 14-plex reverse panel containing RNA modification show that the one-tube one-step method mediated by the reverse panel primer containing RNA modification can be applied to multiplex amplification.

[0401] Example 10

[0402] Test on one-step multiplex panel amplification mediated by reverse complementary panel primer containing RNA modification.

[0403] To verify the protocol for constructing a multiplex amplicon library by one-step amplification mediated by the reverse complementary primer containing RNA modification in the present invention, we further designed 223-plex reverse panel primers containing RNA modification, (Panel-Rp-R-223) for testing, among which 100-plex target the Escherichia coli genome, 100-plex target the Staphylococcus aureus genome, and another 23-plex target the Komagataella pastoris genome. The sequences of the 223-plex reverse panel primers containing RNA modification are respectively:

[0404] SEQ ID NO.27(Panel-Rp-223-F1): CAGCCA / rU / TTGAC / rA / CGTCTC / rG / CTGTCTCTTATACACATCTGACGCTGCCGACGA

[0405] SEQ ID NO.28(Panel-Rp-223-F2): TACCGA / rU / TTGCG / rU / CGTACC / rA / CTGTCTCTTATACACATCTGACGCTGCCGACGA

[0406] There are 223 pairs in total. Two upstream primers are listed here exemplarily, and other sequences are shown in the attached table.

[0407] The primer sequences of the 223-plex normal panel are as follows:

[0408] SEQ ID NO.25(Panel-TD-223-F1): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGAGACGTGTCAAATGGCTG

[0409] SEQ ID NO.26(Panel-TD-223-F2): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTGGTACGACGCAAATCGGTA

[0410] There are 223 pairs in total. The 5'-ends are all the same sequencing primer sequences, and different gene-specific sequences are designed according to the target sites (two upstream sequences are listed here exemplarily, and other sequences are shown in the attached table).

[0411] The pathogen templates are 293T gDNA and genomic DNAs of Escherichia coli, Staphylococcus aureus, and Komagataella pastoris. The pathogen mock sample DNA is obtained by mixing them at a ratio of 1000 / 1 (1 μg of 293T + 1 ng of Escherichia coli, 1 ng of Escherichia coli, and 1 ng of Komagataella pastoris). The system preparation of the two-step method is shown in Tables 38 and 39, and the one-tube preparation system of the reverse panel primer with RNA modification is shown in Table 40; the amplification procedures of the two-step method are shown in Tables 42 and 43 below, and the one-tube amplification procedure is shown in Table 41. The reads detected by sequencing analysis of the amplified library are as Figure 20 shown, and the number of dimers is as Figure 21 shown.

[0412] Table 38

[0413]

[0414] Table 39

[0415]

[0416] Table 40

[0417] Component Volume Vazyme#NA301 15 μL Index, i5+i7 (Vazyme#TD202) 10 μL Panel-Rp-R-223 (50 μM) 3 μL Phanta DNA Polymerase (Vazyme#P501) 1U RNaseH2 (IDT#11-03-02-03) 3U Pathogen-mimicking sample DNA (1 ng) 1 μL <![CDATA[ddH2O]]> To 50 μL

[0418] Table 41

[0419]

[0420] Table 42

[0421]

[0422]

[0423] Table 43

[0424]

[0425] As Figure 23 and Figure 24 shown, the one-tube library construction protocol mediated by 223 reverse panel primers containing RNA modifications can also detect the target reads. The detected species target reads are slightly lower than those of the two-step method, and the primer dimers are slightly higher than those of the two-step method. However, the target can still be effectively amplified, indicating that the multiplex amplicon library construction method mediated by reverse complementary panel primers containing RNA modifications can effectively amplify and construct the target fragments into a library.

[0426] Example 11

[0427] T4 DNA ligase-mediated one-step 223-plex panel amplification test.

[0428] To verify the ability of the T4 ligase-mediated one-step amplification in the present invention to construct a multiplex amplicon library under ultra-multiplex conditions, we further designed a T4-panel primer (T4-Panel-223) with a 223-plex 5TS-7NT library structure for testing. Among them, 100 plexes target the Escherichia coli genome, 100 plexes target the Staphylococcus aureus genome, and another 23 plexes target the genome of Komagataella pastoris. The panel primer sequences of the 223-plex 5TS-7NT library structure are as follows:

[0429] SEQ ID NO.23 (T4-Panel-223-F1):

[0430] 5P-GCATCCTGTCCGAGACGTGTCAAATGGCTG

[0431] SEQ ID NO.24 (T4-Panel-223-F2):

[0432] 5P-GCATCCTGTCTGGTACGACGCAAATCGGTA

[0433] There are 223 pairs in total. The 5' ends all have the same universal sequence, and different gene-specific sequences are designed according to the targeting sites (two upstream sequences are listed here as examples, and other sequences are shown in the attached table).

[0434] The primer sequences of the 223-plex normal panel are as follows:

[0435] SEQ ID NO.25 (TD-Panel-223-F1): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGAGACGTGTCAAATGGCTG

[0436] SEQ ID NO.26 (TD-Panel-223-F2): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTGGTACGACGCAAATCGGTA

[0437] There are 223 pairs in total. The 5' ends all have the same sequencing primer sequence, and different gene-specific sequences are designed according to the targeting sites (two upstream sequences are listed here as examples, and other sequences are shown in the attached table).

[0438] The sequences of the bridge primers Splint 3 and Splint 4 are as shown in Example 7. The pathogenic templates are 293TgDNA and genomic DNAs of Escherichia coli, Staphylococcus aureus, and Komagataella pastoris, which are mixed according to the ratio of 293T 10 μg + 1 ng Escherichia coli, 1 ng Escherichia coli, and 1 ng Komagataella pastoris to obtain the pathogenic mock sample DNA. Prepare the amplification system according to Table 32 and perform amplification according to the amplification program in Table 35. The amplification systems of the conventional two-step method are prepared according to Tables 33 and 34, and the reaction procedures are carried out according to Tables 36 and 37 respectively. Recover the amplified results, measure the concentration with Qubit, detect the product peak shape with Qseq, and perform on-machine sequencing. The Qseq peak pattern of the library is as shown in Figure 20 shown, and the number of reads detected by sequencing analysis is as shown in Figure 21 shown, and the number of dimers is as shown in Figure 22 shown.

[0439] Table 32

[0440]

[0441]

[0442] Table 33

[0443]

[0444] Table 34

[0445]

[0446] Table 35

[0447]

[0448] Table 36

[0449]

[0450]

[0451] Table 37

[0452]

[0453] As shown in Figure 20 shown, the target product peak shape of the T4 DNA ligase-mediated one-tube targeted multiplex amplicon library is clear. Further Figure 20 and Figure 21The data of high-throughput sequencing showed that the target reads detected by the one-tube method and the two-step method were consistent for these three pathogens, and the primer dimers in the library construction of the one-tube one-step method mediated by T4 DNA ligase were slightly higher than those of the two-step method.

Claims

1. An oligonucleotide set, comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein the first oligonucleotide primer comprises a sequencing adapter sequence, a tag sequence and a sequencing primer sequence in sequence from the 5' end to the 3' end, and the second oligonucleotide primer comprises a reverse complementary sequence of a gene-specific primer and a reverse complementary sequence of a sequencing primer in sequence from the 5' end to the 3' end.

2. The oligonucleotide set according to claim 1, wherein: One or more nucleotide sites of the reverse complementary sequence of the gene-specific primer contain RNA base modifications.

3. The oligonucleotide set according to claim 1, wherein: The 3' end of the second oligonucleotide primer contains a blocking modification, preferably a 3' phosphorylation modification or a spacer modification, more preferably a Spacer C3 modification, a Spacer C6 modification, a Spacer C9 modification, a dSpacer modification or a PC-linker modification.

4. The oligonucleotide set according to claim 2, wherein: The first oligonucleotide primer comprises an upstream first oligonucleotide primer and a downstream first oligonucleotide primer, wherein the upstream first oligonucleotide primer comprises an upstream sequencing adapter sequence, an upstream tag sequence and an upstream sequencing primer sequence in sequence from the 5' end to the 3' end, and the downstream first oligonucleotide primer comprises a downstream sequencing adapter sequence, a downstream tag sequence and a downstream sequencing primer sequence in sequence from the 5' end to the 3' end; the second oligonucleotide primer comprises an upstream second oligonucleotide primer and a downstream second oligonucleotide primer, wherein the upstream second oligonucleotide primer comprises a reverse complementary sequence of a gene-specific upstream primer and a reverse complementary sequence of an upstream sequencing primer in sequence from the 5' end to the 3' end, and the downstream second oligonucleotide primer comprises a reverse complementary sequence of a gene-specific downstream primer and a reverse complementary sequence of a downstream sequencing primer in sequence from the 5' end to the 3' end; preferably, the upstream sequencing adapter sequence is the P5 adapter sequence of the Illumina platform, and the downstream sequencing adapter sequence is the P7 adapter sequence of the Illumina platform.

5. The oligonucleotide set according to claim 4, wherein: The first oligonucleotide primers include at least one pair of an upstream first oligonucleotide primer and a downstream first oligonucleotide primer, and the second oligonucleotide primers include at least one pair of an upstream second oligonucleotide primer and a downstream second oligonucleotide primer.

6. A composition comprising a DNA polymerase, an endoribonuclease, dNTPs, a buffer component, a metal salt and a primer combination; wherein: The primer combination comprises the oligonucleotide set according to claim 5.

7. The composition of claim 6, wherein The composition further comprises a DNA sample; preferably, the DNA sample is gDNA or cDNA.

8. The composition of claim 6, wherein The DNA polymerase comprises at least one thermostable DNA polymerase. Preferably, the DNA polymerase comprises at least one thermostable DNA polymerase and one room-temperature DNA polymerase.

9. The composition of claim 6, wherein The endoribonuclease is an endoribonuclease that can recognize ribonucleotide sites and remove phosphodiester bonds; preferably, the endoribonuclease is RNase H2 or a homologous protein of RNase H2.

10. A method for constructing a multiplex amplicon library, the method comprising the following steps: (1) preparing a reaction system comprising at least one pair of first oligonucleotide primers, at least one pair of second oligonucleotide primers and a sample nucleic acid; wherein: The first oligonucleotide primer comprises a sequencing adapter sequence, a tag sequence and a sequencing primer sequence in sequence from the 5' end to the 3' end, the second oligonucleotide primer comprises a reverse complementary sequence of a gene-specific primer and a reverse complementary sequence of a sequencing primer in sequence from the 5' end to the 3' end, and the second oligonucleotide primer comprises a cleavable group; (2) making the 3' end of the first oligonucleotide primer and the 3' end of the second oligonucleotide primer reversely complementary to each other, and extending the first oligonucleotide primer along the 5'-3' direction to obtain an extension product; (3) cutting the reverse complementary sequence of the gene-specific primer in the second oligonucleotide primer; (4) Performing PCR amplification on the sample nucleic acid using the extension product of step (2) as a primer.

11. The method of claim 10, wherein: The 3' end of the second oligonucleotide primer contains a blocking modification, preferably a 3' phosphorylation modification or a spacer modification, more preferably a Spacer C3 modification, a Spacer C6 modification, a Spacer C9 modification, a dSpacer modification or a PC-linker modification.

12. The method of claim 10, wherein: The at least one pair of first oligonucleotide primers comprises at least one pair of upstream first oligonucleotide primers and downstream first oligonucleotide primers, wherein the upstream first oligonucleotide primers sequentially comprise an upstream sequencing adapter sequence, an upstream tag sequence and an upstream sequencing primer sequence from the 5' end to the 3' end, and the downstream first oligonucleotide primers sequentially comprise a downstream sequencing adapter sequence, a downstream tag sequence and a downstream sequencing primer sequence from the 5' end to the 3' end; the at least one pair of second oligonucleotide primers comprises at least one pair of upstream second oligonucleotide primers and downstream second oligonucleotide primers, wherein the upstream second oligonucleotide primers sequentially comprise a reverse complementary sequence of a gene-specific upstream primer and a reverse complementary sequence of an upstream sequencing primer from the 5' end to the 3' end, and the downstream second oligonucleotide primers sequentially comprise a reverse complementary sequence of a gene-specific downstream primer and a reverse complementary sequence of a downstream sequencing primer from the 5' end to the 3' end; preferably, the upstream sequencing adapter sequence is the P5 adapter sequence of the Illumina platform, and the downstream sequencing adapter sequence is the P7 adapter sequence of the Illumina platform.

13. The method of claim 10, wherein: The sample nucleic acid is DNA; preferably, the DNA is gDNA or cDNA.

14. The method of claim 10, wherein: The cleavable group is an RNA base, and the RNA base is at least one of rA (adenine ribonucleoside), rU (uridine ribonucleoside), rG (guanine ribonucleoside), and rC (cytosine ribonucleoside).

15. The method of claim 14, wherein: The reaction system further comprises an endoribonuclease, which is an endoribonuclease capable of recognizing ribonucleotide sites and removing phosphodiester bonds; preferably, the endoribonuclease is RNase H2 or a homologous protein of RNase H2.

16. The method of claim 15, wherein: The reaction system also includes a DNA polymerase; preferably, the DNA polymerase includes at least one thermostable DNA polymerase.

17. The method of claim 16, wherein: The DNA polymerase at least comprises a heat-resistant DNA polymerase and a room-temperature DNA polymerase.

18. The method of claim 16, wherein: The DNA polymerase comprises at least one non-hot-start polymerase and one hot-start polymerase.

19. The method of claim 17, wherein: The reaction in step (2) is carried out under the action of a polymerase at room temperature; the reaction in step (4) is carried out under the action of a thermostable polymerase.

20. The method of claim 18, wherein: The reaction in step (2) is carried out under the action of a non-hot-start polymerase; and the reaction in step (4) is carried out under the action of a hot-start polymerase.

21. The method according to any one of claims 19 and 20, wherein: The reaction conditions of step (2) are incubation at 25-40° C. for 10-30 min, and the PCR amplification of step (4) includes denaturation, annealing and extension.

22. The method of claim 15, wherein: The reaction condition of step (3) is incubation at 60-80° C. for 10-20 min.

23. The method of claim 10, wherein: The reaction system further comprises one or more of a metal salt, a buffer component and dNTP.

24. An oligonucleotide primer, which comprises a sequencing adapter sequence-a tag sequence-a sequencing primer sequence-a gene-specific primer sequence in order from the 5' end to the 3' end.

25. An oligonucleotide combination, comprising a first oligonucleotide primer, a third oligonucleotide primer and a bridge primer, wherein the first oligonucleotide primer comprises a sequencing adapter sequence, a tag sequence and a sequencing primer sequence in sequence from the 5' end to the 3' end, the third oligonucleotide primer comprises a universal sequence and a gene-specific primer sequence in sequence from the 5' end to the 3' end, and the bridge primer comprises a reverse complementary sequence of the universal sequence and a reverse complementary sequence of the sequencing primer in sequence from the 5' end to the 3' end.

26. The oligonucleotide combination according to claim 25, wherein The 3' end of the bridge primer contains a blocking modification, preferably a 3' phosphorylation modification or a spacer modification, more preferably a Spacer C3 modification, a Spacer C6 modification, a Spacer C9 modification, a dSpacer modification or a PC-linker modification.

27. The oligonucleotide combination according to claim 26, wherein: The first oligonucleotide primer comprises an upstream first oligonucleotide primer and a downstream first oligonucleotide primer, wherein the upstream first oligonucleotide primer comprises an upstream sequencing adapter sequence, an upstream tag sequence and an upstream sequencing primer sequence in sequence from the 5' end to the 3' end, and the downstream first oligonucleotide primer comprises a downstream sequencing adapter sequence, a downstream tag sequence and a downstream sequencing primer sequence in sequence from the 5' end to the 3' end; the third oligonucleotide primer comprises an upstream third oligonucleotide primer and a downstream third oligonucleotide primer, wherein the upstream third oligonucleotide primer comprises an upstream universal sequence and a gene-specific upstream primer sequence in sequence from the 5' end to the 3' end, and the downstream third oligonucleotide primer comprises a downstream universal sequence and a gene-specific downstream primer sequence in sequence from the 5' end to the 3' end; the bridge primer comprises an upstream bridge primer and a downstream bridge primer, wherein the upstream bridge primer comprises a reverse complementary sequence of the upstream universal sequence and a reverse complementary sequence of the upstream sequencing primer in sequence from the 5' end to the 3' end, and the downstream bridge primer comprises a reverse complementary sequence of the downstream universal sequence and a reverse complementary sequence of the downstream sequencing primer in sequence from the 5' end to the 3' end.

28. The oligonucleotide combination according to claim 27, wherein The first oligonucleotide primers include at least one pair of an upstream first oligonucleotide primer and a downstream first oligonucleotide primer, the third oligonucleotide primers include at least one pair of an upstream third oligonucleotide primer and a downstream third oligonucleotide primer, and the bridge primers include at least one pair of an upstream bridge primer and a downstream bridge primer.

29. A composition comprising DNA polymerase, T4 DNA ligase, ATP, dNTP, a buffer component, a metal salt and a primer combination; the primer combination comprises the oligonucleotide combination of claim 28.

30. The composition of claim 29, wherein The composition further comprises a DNA sample; preferably, the DNA sample is gDNA or cDNA.

31. The composition of claim 29, wherein The 5' end of the third oligonucleotide primer contains phosphorylation modification, or the 5' end of the third oligonucleotide primer does not contain phosphorylation modification, and the composition further includes T4 polynucleotide kinase.

32. The composition of claim 29, wherein The mass ratio or molar ratio of the first oligonucleotide primer to the third oligonucleotide primer is N:1, where N is a constant greater than or equal to 1 and less than or equal to 5.

33. A method for constructing a multiplex amplicon library, the method comprising the following steps: (1) preparing a reaction system comprising at least one pair of first oligonucleotide primers, at least one pair of third oligonucleotide primers, at least one pair of bridge primers and a sample nucleic acid; wherein: The first oligonucleotide primer comprises a sequencing adapter sequence, a tag sequence and a sequencing primer sequence in sequence from the 5' end to the 3' end, the third oligonucleotide primer comprises a universal sequence and a gene-specific primer sequence in sequence from the 5' end to the 3' end, and the bridge primer comprises a reverse complementary sequence of the universal sequence and a reverse complementary sequence of the sequencing primer in sequence from the 5' end to the 3' end; (2) making the 3' end of the first oligonucleotide primer and the 3' end of the bridge primer reversely complementary and making the 5' end of the third oligonucleotide primer and the 5' end of the bridge primer reversely complementary, and connecting the first oligonucleotide primer and the third oligonucleotide primer to obtain a connection product; (3) Performing PCR amplification on the sample nucleic acid using the ligation product described in step (2) as a primer.

34. The method of claim 33, wherein: The 3' end of the bridge primer contains a blocking modification, preferably a 3' phosphorylation modification or a spacer modification, more preferably a Spacer C3 modification, a Spacer C6 modification, a Spacer C9 modification, a dSpacer modification or a PC-linker modification.

35. The method of claim 33, wherein: The sample nucleic acid is DNA, preferably gDNA or cDNA.

36. The method of claim 33, wherein: The 5' end of the third oligonucleotide primer contains phosphorylation modification, or the 5' end of the third oligonucleotide primer does not contain phosphorylation modification, and the reaction system also includes T4 polynucleotide kinase.

37. The method of claim 33, wherein: The mass ratio or molar ratio of the first oligonucleotide primer to the third oligonucleotide primer is N:1, where N is a constant greater than or equal to 1 and less than or equal to 5.

38. The method of claim 36, wherein: The at least one pair of first oligonucleotide primers includes at least one pair of upstream first oligonucleotide primers and downstream first oligonucleotide primers, wherein the upstream first oligonucleotide primers sequentially comprise an upstream sequencing adapter sequence, an upstream tag sequence and an upstream sequencing primer sequence from the 5' end to the 3' end, and the downstream first oligonucleotide primers sequentially comprise a downstream sequencing adapter sequence, a downstream tag sequence and a downstream sequencing primer sequence from the 5' end to the 3' end; the at least one pair of third oligonucleotide primers includes at least one pair of upstream third oligonucleotide primers and downstream third oligonucleotide primers, wherein the upstream third oligonucleotide primers sequentially comprise a downstream sequencing adapter sequence, a downstream tag sequence and a downstream sequencing primer sequence from the 5' end to the 3' end. The at least one pair of bridge primers comprises at least one pair of upstream bridge primers and downstream bridge primers, the upstream bridge primer comprises the reverse complementary sequence of the upstream universal sequence and the reverse complementary sequence of the upstream sequencing primer from the 5' end to the 3' end, and the downstream bridge primer comprises the reverse complementary sequence of the downstream universal sequence and the reverse complementary sequence of the downstream sequencing primer from the 5' end to the 3' end.

39. The method of claim 33, wherein: The reaction conditions of step (2) are incubation at 20-50° C. for 1-60 min.

40. The method of claim 38, wherein: The reaction system also includes DNA ligase, preferably T4 DNA ligase.

41. The method of claim 40, wherein: The reaction system also includes a DNA polymerase, preferably a thermostable DNA polymerase, and more preferably a Taq DNA polymerase.

42. The method of claim 33, wherein: The reaction system further comprises one or more of a metal salt, a buffer component and dNTP.

43. An oligonucleotide primer, comprising, from the 5' end to the 3' end, a linker sequence-a tag sequence-a sequencing primer sequence-a universal sequence-a gene-specific primer sequence.

44. Use of the method according to any one of claims 10 to 23 and claims 33 to 42 in the construction of a multiplex amplicon library.

Images