Immunogenic composition

Abstract

The present invention provides an immunogenic composition comprising OMVs and (a) acellular pertussis antigen, (b) tetanus toxoid, and (c) diphtheria toxoid, wherein the OMVs are derived from Bordetella pertussis. The present invention also provides a composition for use in a method of generating an immune response in a patient, the method comprising the step of administering to the patient the composition of the present invention.

Description

Field of the Invention

[0001] The present invention is in the field of combination vaccines, which are vaccines that are mixtures of immunogens from more than one pathogen, such that administration of the vaccine can immunize a subject against more than one pathogen simultaneously. More specifically, the present invention relates to a booster vaccine for diphtheria, tetanus and pertussis. Background of the Invention

[0003] Vaccines that contain antigens from more than one pathogenic organism in a single dose are referred to as "multivalent" or "combination" vaccines. Combination vaccines offer the advantage to patients of receiving fewer injections, which can lead to the clinical advantage of increased compliance (see, for example, chapter 29 of reference 1). Various combination vaccines have been approved for human use in Europe and the United States, including trivalent vaccines for protection against diphtheria, tetanus and pertussis. Such vaccines may be referred to as DTaP and Tdap. Although both DTaP and TdaP are combination vaccines against diphtheria, tetanus and pertussis, the DTaP vaccine is used for primary immunization, while the TdaP vaccine is used for subsequent booster vaccination. The difference between the primary and booster vaccine compositions lies in the dose. More specifically, with respect to booster vaccines, generally these vaccines contain lower doses of some antigen combinations. For example, the diphtheria toxoid content of BOOSTRIX is 10 times lower than the diphtheria toxoid content of INFANRIX. This is indicated by using the lower case letter 'd' (which refers to a lower amount of diphtheria toxoid).

[0004] The ratio of the antigen components can also be altered. For example, the ratio of diphtheria and tetanus toxoids is 2.5:1 in INFANRIX, but 1:2 in BOOSTRIX. Thus, these booster vaccines show a significant reduction in the dose of diphtheria toxoid both in absolute amount and relative to the tetanus toxoid content.

[0005] However, in recent years, even in countries with high vaccine coverage, a recurrence of the disease caused by Bordetella pertussis has been observed. Although the exact cause of this recurrence is unclear, potential causes include waning immunity and epidemiological changes in the circulating strains.

[0006] Accordingly, an object of the present invention is to provide a further and improved combination vaccine for protection against Corynebacterium diphtheriae, Clostridium tetani and Bordetella pertussis. Another object of the present invention is to provide a further and improved TdaP vaccine suitable for human use as a booster in adults, adolescents and children four years of age and older who have previously received childhood immunization. Summary of the Invention

[0008] This invention is based on the research of combination vaccines comprising outer membrane vesicles (OMVs) from Bordetella pertussis. The inventors have found that these combination vaccines elicit specific antibody titers against the corresponding antigens, with little or no immune interference among the various antigens. The presence of OMVs from Bordetella pertussis provides an enhanced antibody response against Bordetella, and surprisingly also enhances the antibody response against other antigens in the composition.

[0009] Accordingly, in a first aspect, there is provided an immunogenic composition comprising (a) outer membrane vesicles (OMVs), (b) acellular pertussis antigens, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMVs are derived from Bordetella pertussis. Specifically, the OMVs are derived from a Bordetella pertussis strain that expresses a genetically detoxified pertussis toxoid. More specifically, the OMVs are derived from a Bordetella pertussis strain that expresses the genetically detoxified pertussis toxoid PT 9K / 129G.

[0010] Thus, the present invention provides an immunogenic composition comprising (a) outer membrane vesicles (OMVs) from Bordetella pertussis, (b) acellular pertussis antigens, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMVs are derived from a Bordetella pertussis strain that expresses a genetically detoxified pertussis toxoid, particularly the genetically detoxified pertussis toxoid PT 9K / 129G.

[0011] The present invention further provides an immunogenic composition comprising (a) outer membrane vesicles (OMVs) from Bordetella pertussis that comprise a genetically detoxified pertussis toxoid, particularly PT 9K / 129G, (b) acellular pertussis antigens, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0012] The present invention further provides an immunogenic composition comprising (a) outer membrane vesicles (OMVs) from Bordetella pertussis that comprise a genetically detoxified pertussis toxoid, particularly PT 9K / 129G, wherein the lipid A in the OMVs has a modified structure that lacks glucosamine (GlcN) substitution on the distal phosphate group of the core structure, (b) acellular pertussis antigens, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0013] The PT-9K / 129G genetically detoxified pertussis toxoid contains two amino acid substitutions within the S1 subunit, specifically R9K and E129G (see, for example, EP0396964). Thus, still more specifically, the OMVs are derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G. Even more specifically, 100% of the pertussis toxoid in the outer membrane vesicles is the genetically detoxified PT, specifically PT 9K / 129G.

[0014] In some embodiments, the Bordetella pertussis OMVs used in the present invention have a modified lipid A structure that lacks glucosamine (GlcN) substitution on the distal phosphate group of the core structure. In some embodiments, the Bordetella pertussis strain from which the OMVs are obtained contains a knockout of ArnT, specifically a deletion of the ArnT-encoding gene (∆ArnT). Thus, the OMVs used in the present invention and derived from such strains can have a modified lipid A structure that lacks glucosamine (GlcN) substitution on the distal phosphate group of the core structure.

[0015] Specifically, the OMVs used in the present invention are not treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, or a combination thereof. More specifically, the OMVs used in the present invention are not chemically detoxified by treatment with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, or a combination thereof.

[0016] Suitable acellular pertussis antigens include detoxified pertussis toxin (PT), filamentous hemagglutinin (FHA), pertactin (PRN), fimbriae 2 (FIM2), fimbriae 3 (FIM3), and combinations thereof. In certain embodiments, the acellular pertussis antigen comprises at least two, such as at least three, antigens selected from detoxified pertussis toxin (PT), filamentous hemagglutinin (FHA), pertactin (PRN), fimbriae 2 (FIM2), and fimbriae 3 (FIM3). Specific combinations of acellular pertussis antigens for use in the present invention include: (1) PT, FHA, and PRN; (2) PT, FHA, PRN, FIM2, and FIM3; (3) PT and FHA; and (4) PT, FHA, FIM2, and FIM3.

[0017] Specifically, the immunogenic composition is a vaccine. More specifically, the vaccine is for administration to humans. The vaccine can be used for primary immunization. Even more specifically, the vaccine is used as a booster, for example, in a secondary immunization. Still even more specifically, the diphtheria toxoid is present at a concentration of about 4 Lf / ml to about 8 Lf / ml. More specifically, the diphtheria toxoid is present at a concentration of about 2 Lf per 0.5 ml dose, about 2.5 Lf per 0.5 ml dose, about 3 Lf per 0.5 ml dose, about 3.5 Lf per 0.5 ml dose, or about 4 Lf per 0.5 ml dose. The tetanus toxoid can be present at a concentration of about 5 Lf per 0.5 ml dose.

[0018] Specifically, the tetanus toxoid and diphtheria toxoid are present at a tetanus toxoid:diphtheria toxoid ratio of 1.5:1 to 2.5:1 (measured in Lf units), such as about 2:1 (measured in Lf units).

[0019] The immunogenic composition can comprise an adjuvant, particularly an aluminum salt adjuvant.

[0020] In a second aspect of the invention, there is provided an immunogenic composition for use in a method of generating an immune response in a patient, the method comprising the step of administering to the patient an immunogenic composition according to the invention.

[0021] In a third aspect of the invention, there is provided a method for preparing an immunogenic composition according to the invention, which comprises mixing a first component comprising outer membrane vesicles (OMV) and a second component comprising acellular pertussis antigen, tetanus toxoid, and diphtheria toxoid. In certain embodiments of the third aspect of the invention, the OMV in the first component is lyophilized, and the second component comprises the antigen in aqueous form. Accordingly, the method can further comprise the step of reconstituting the lyophilized OMV in the first component with the aqueous antigen of the second component.

[0022] In a fourth aspect of the invention, there is provided a kit for preparing an immunogenic composition according to the invention, which contains a first component comprising the OMV and a second component comprising acellular pertussis antigen, tetanus toxoid, and diphtheria toxoid, wherein the two components are in separate containers. In certain embodiments of the fourth aspect of the invention, the OMV in the first component is lyophilized, and the second component comprises the antigen in aqueous form. Brief Description of the Drawings

[0024] Figure 1 : In vitro reactogenicity of W28 9K / 129G ΔarnT compared to the W28 9K / 129G vaccine strain. Figure 1(a) Results from luciferase reporter gene assays of hTLR4 activation by WTL 9K / 129G (Bp WT) and W28 9K / 129G arn tKO (BpΔarnT). HEK293 cells were stimulated with different concentrations of bacteria, and the fold induction compared to PBS was reported. Figure 1 (b) : ELISA for detection of IL-6 in human PBMC supernatants after stimulation with different concentrations of bacteria.

[0025] Figure 2 : OMVs prepared from vaccine strains contain FHA, 69K, and PT acellular pertussis antigens. Western blot of titration standards of purified FHA, 69K, and PT acellular pertussis antigen subunits loaded in the indicated amounts together with 1 μg of OMVs from W28PT 9K / 129G (WT) and W28 PT 9K / 129G arnTKO (Δarnt) strains, immunostained with anti-FHA; anti-69K, and anti-PT antisera.

[0026] Figure 3: Immunization with OMVs results in low levels of anti-aP antigen antibodies in mice. Mice were immunized intraperitoneally 3 times with 2.5 μg of OMVs from W28 PT9K / 129G (Bp-OMV (WT)) and W28 PT 9K / 129G arnTKO (BP-OMV (ΔArnt)), 3 weeks apart. Although anti-69K antibodies could only be detected after the first immunization, low levels of all 3 antigens (FHA, 69K, and PT) were detectable by Luminex assay after the second and third doses. Figure 3(a): Anti-FHA IgG titers; Figure 3(b): Anti-69K IgG titers; Figure 3(c): Anti-PT IgG titers.

[0027] Figure 4 : Immunization with the combination of TdaP and OMVs results in significantly higher levels of antibodies against most vaccine antigens compared to TdaP alone

[0028] Mice were immunized intramuscularly with Tdap (1 / 5 human dose) with or without the combination of 2.5 mg of OMVs from W28 PT 9K / 129G arnTKO strain, and sera were collected after two immunizations and analyzed by Luminex assay to measure antibody levels against each TdaP antigen. ***p<0.001, **p<0.01, *p<0.05.

[0029] Figure 5: Similar to the wP vaccine, OMV elicits antibodies that inhibit the adhesion of Bordetella pertussis to epithelial cells in vitro. Serum from each group of 10 mice immunized with OMV (from W28 9K / 129G arn tKO), whole bacteria (from W28 9K / 129G arn tKO), TdaP vaccine, or aluminum hydroxide (nil) as a control was pooled, serially diluted in infection medium, and incubated with labeled wild-type Bordetella pertussis BP536 for 1 h. A549 cells were then infected with the bacteria / serum mixture for 1 h, and after extensive washing to remove unbound bacteria, cell-associated bacteria were quantified by fluorescence readings at Ex / Em 485 / 535 nm. Results represent the mean + / − S.D. of one representative of three independent experiments performed in triplicate for each.

[0030] Figure 6 : OMV elicits an effective protective response against intracranial challenge with Bordetella pertussis in the Kendrick test similar to that of the wP vaccine standard. Mice were immunized intraperitoneally once with a whole-cell vaccine or an OMV preparation and challenged 2 weeks after immunization with a suspension of Bordetella pertussis strain 18323 administered intracranially. The survival rate of the mice was reported 2 weeks after challenge according to the Kendrick intracranial challenge efficacy test. Vaccine preparations included 1 / 10, 1 / 50, and 1 / 250 human doses of wP whole-cell pertussis vaccine (standard) and the designated doses of OMV from strain W28 9K / 129G (OMV).

[0031] Figure 7: Serum titers of FHA-specific total IgG (Figure 7(a)) and IgG2c (Figure 7(b)) are proportional to the OMV vaccine dose. FHA-specific antibodies present in the sera of immunized mice on the day of challenge were analyzed by ELISA. ***p < 0.001, **p < 0.01, *p < 0.05, n.s. = not significant. Figure 7(c) Single immunization with OMV promotes a Bordetella pertussis-specific Th1 / Th17 response. Splenocytes (2x10 6 / mL) from vaccinated C57BL6 mice were cultured in the presence of sonicated Bordetella pertussis (SBP, 5 μg / mL). After 72 h, the concentrations of IFNγ (TH1-indicator), IL-13 (TH2-indicator), and IL-17 (TH17-indicator) in the supernatant were analyzed by ELISA. ***p < 0.001.

[0032] Figure 8: The rate of clearance of Bordetella pertussis from the lungs is proportional to the OMV vaccine dose. Three weeks before challenge, C57BL6 mice were immunized with PBS, wP, OMV 0.4, OMV 2, or OMV 10. Mice were then infected with a virulent strain of Bordetella pertussis (Bp338), and bacterial load in the lungs was evaluated by CFU counting of serial dilutions of lung homogenates at the indicated time points. The dotted line indicates the limit of detection. ***p < 0.001 wP vs OMV 0.4, p < 0.001, # p < 0.05 wP vs OMV 10, ◆◆◆ p < 0.001, ◆p < 0.05 wP vs OMV 2.

[0033] Figure 9 : aP formulated with OMV promotes FHA-specific serum IgG2c. FHA-specific antibodies present in the sera of immunized mice on the day of challenge were analyzed by ELISA. ***p < 0.001, *p < 0.05.

[0034] Figure 10 : Immunization with wP, aP, aP+OMV, and OMV alone confers protection against Bordetella pertussis challenge. Three weeks before challenge, C57BL6 mice were immunized with PBS, wP, aP, aP+OMV, or OMV alone. Mice were then infected with a virulent strain of Bordetella pertussis (Bp338), and bacterial load in the lungs was evaluated by CFU counting of serial dilutions of lung homogenates at the indicated time points. ***p < 0.001, **p < 0.01, *p < 0.05.

[0035] Figure 11 : Addition of OMV to the aP vaccine drives a favorable TH1 response. Splenocytes (2x10 6 / mL) from vaccinated C57BL6 mice were cultured in the presence of sonicated Bordetella pertussis (SBP, 5 μg / mL). After 72 hours, the concentration of IFNγ in the supernatant was analyzed by ELISA. **p < 0.01, ***p < 0.001.

[0036] Figure 12 An aP+OMV booster promotes antigen-specific IFNγ production in aP-primed mice.

[0037] Splenocytes (2x10 6(in mL). After 72 hours, the concentrations of IFNγ, IL-17, and IL-13 in the supernatant were analyzed by ELISA. *p < 0.05, **p < 0.01, ***p < 0.001. DETAILED DESCRIPTION OF THE INVENTION

[0039] The present invention is based on studies of compositions comprising outer membrane vesicles (OMVs) derived from Bordetella pertussis. The inventors have found that immunogenic compositions comprising both OMVs and an antigen, such as acellular pertussis antigen, are capable of inducing an immune response greater than that seen after immunization with either OMVs alone or acellular pertussis antigen alone. In addition, OMVs also enhance the immune response to other non-Bordetella antigens, such as tetanus toxoid and diphtheria toxoid. The use of the term "derived from" refers to the source of the OMVs as being from Bordetella pertussis, i.e., the bacterial strain from which the OMD is produced or sourced. Accordingly, the present invention provides an immunogenic composition comprising (a) Bordetella pertussis OMVs, (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0040] The term "immunogenic composition" broadly refers to any composition that can be administered to elicit an immune response, such as an antibody or cellular immune response, against an antigen present in the composition. Thus, the compositions of the present invention are immunogenic. When an immunogenic composition prevents, ameliorates, alleviates, or eliminates a disease in a subject, such a composition can be referred to as a vaccine. The vaccine according to the present invention is preferably prophylactic (i.e., prevents infection). A prophylactic vaccine does not guarantee complete protection from disease, as there may be a lag or delay before the immune system can repel the infection even if the patient has generated antibodies. Thus, and for the sake of clarity, the term prophylactic vaccine can also refer to a vaccine that, for example, improves the effect of a future infection by reducing the severity or duration of such an infection. The terms "protection against infection" and / or "providing protective immunity" mean that the immune system of a subject has been primed (e.g., by vaccination) to trigger an immune response and reject an infection. Specifically, the triggered immune response is capable of rejecting an infection against a number of pathogens, such as different bacterial strains. Thus, a vaccinated subject may be infected, but is able to reject the infection better than a control subject.

[0041] OMV

[0042] OMV is well known in the art and is spontaneously released by bacteria into the culture medium. OMV contains components of the bacterial outer membrane of the cultured bacteria, such as protein and lipid components. Both 'native OMV' ('nOMV' [2]) and detergent-extracted OMV (dOMV) form part of the present invention and are collectively referred to herein as OMV. The term "universal module of membrane antigens" can also be used to refer to OMV obtained from mutant bacteria. In some embodiments of the present invention, the OMV is native OMV.

[0043] OMV can be obtained from a culture of Bordetella pertussis. OMV is prepared from the outer membrane of cultured bacteria. Vesicles can be obtained by disrupting the outer membrane of the bacteria or by natural 'blebbing' from the outer membrane of the bacteria to form vesicles therefrom.

[0044] They can be obtained from bacteria grown in liquid or solid media, for example, by separating the bacterial cells from the medium (e.g., by filtration or by low-speed centrifugation to pellet the cells), lysing the cells (without using detergents), and separating the outer membrane fraction from the cytoplasmic molecules (e.g., by filtration, by differential precipitation or aggregation of the outer membrane and / or OMV, by affinity separation methods using ligands that specifically recognize outer membrane molecules, or by high-speed centrifugation to pellet the outer membrane and / or OMV).

[0045] OMV can also be prepared artificially from Bordetella pertussis, for example, using detergent treatment (e.g., with deoxycholate or sarkosyl) or by non-detergent means (e.g., see reference 3). Techniques for the artificial formation of OMV include: treatment of bacteria with bile salt detergents (e.g., salts of lithocholic acid, chenodeoxycholic acid, ursodeoxycholic acid, deoxycholic acid, cholic acid, ursolic acid, etc., together with sodium deoxycholate [4 and 5]) at a sufficiently high pH such that the detergent does not precipitate [6]. Other techniques can be carried out essentially in the absence of detergents [3] using techniques such as sonication, homogenization, microfluidization, cavitation, osmotic shock, grinding, French press, mixing, etc.

[0046] A useful method for OMV preparation is described in reference 7 and involves ultrafiltration of crude OMV, rather than replacing high-speed centrifugation. The method can involve a step of ultracentrifugation after the ultrafiltration is carried out.

[0047] Preparations of OMV used in the present invention will generally be substantially free of whole bacteria, whether alive or dead. The size of the vesicles means that they can be easily separated from whole bacteria by filtration, such as is commonly used for filter sterilization.

[0048] When administered to a mammal, the OMVs are capable of eliciting an immune response against Bordetella pertussis. The immune response can be a cellular or a humoral immune response. Specifically, the immune response is an antibody response. Even more specifically, the immune response is a T-cell immune response that can neutralize the infection and / or virulence of Bordetella pertussis. The immune response elicited by the OMVs can be directed against one or more Bordetella pertussis protein antigens present in the OMVs.

[0049] Although a secreted toxin, pertussis toxin is present in the OMVs, for example, derived from the periplasmic space. As a result, OMVs used in the art have been treated with chemical reagents, such as formalin, to chemically detoxify any PT. In addition to the problem of removing residual formalin, the chemical treatment can also negatively affect the immunogenicity of the OMVs, for example, by protein crosslinking.

[0050] Therefore, it is advantageous to use OMVs derived from Bordetella pertussis strains expressing a genetically detoxified pertussis toxoid, and this has not been proposed in the art. Particularly advantageous are OMVs derived from Bordetella pertussis strains expressing the genetically detoxified pertussis toxoid PT9K / 129G. Specifically, for use in the present invention, the inventors have isolated OMVs from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G. Thus, chemical detoxification of the OMVs by treatment with chemicals, such as formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations thereof, is not necessary. Specifically, the OMVs of the present invention are not chemically detoxified, and even more specifically, the OMVs of the present invention are not chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations thereof.

[0051] It is also advantageous to use Bordetella pertussis strains in which the ArnT gene has been knocked out or deleted. OMVs derived from such strains contain lipid A that has a modified structure with no glucosamine (GlcN) substitution on the distal phosphate group of the core structure. As a result, these OMVs exhibit a reduced level of TLR4 activation compared to OMVs derived from strains with a functional ArnT gene.

[0052] The immunogenic composition of the present invention comprises both an OMV component (a) and an acellular pertussis antigen component (b). The outer membrane vesicle component (a) contains a number of proteins associated with the membrane or contained within the OMVs, including, for example, small amounts of PT, FHA, or Bordetella adhesin. However, these OMV-associated components should not be construed as the acellular pertussis antigen component (b) described below, which will typically be provided separately from the OMVs in purified form, for example, as isolated recombinant protein antigens.

[0053] In some embodiments of the present invention, compositions comprising OMVs derived from Bordetella pertussis are excluded from the present invention.

[0054] Diphtheria toxoid

[0055] Diphtheria is caused by Corynebacterium diphtheriae ( Corynebacterium diphtheriae ), a Gram-positive, non-spore-forming, aerobic bacterium. This organism expresses a prophage-encoded ADP-ribosylating exotoxin (‘diphtheria toxin’), which can be treated (e.g. using formaldehyde) to give a toxoid that is no longer toxic but retains antigenicity and is capable of stimulating the production of specific antitoxin antibodies after injection. Diphtheria toxoid is disclosed in more detail in chapter 13 of reference 8. Preferred diphtheria toxoids are those prepared by formaldehyde treatment. Diphtheria toxoid can be obtained by growing Corynebacterium diphtheriae ( C.diphtheriae ) in a growth medium (e.g. Fenton medium, or Linggoud & Fenton medium) supplemented with bovine extract, followed by formaldehyde treatment, ultrafiltration and precipitation. The toxoided material can then be treated by methods including sterile filtration and / or dialysis.

[0056] The quantity of diphtheria toxoid can be expressed in International Units (IU). For example, NIBSC [9] provides the ‘Diphtheria Toxoid Adsorbed Third International Standard 1999’ [10,11], which contains 160 IU per ampoule. As an alternative to the IU system, the ‘Lf’ unit (‘flocculation unit’, ‘border flocculation dose’ or ‘flocculation limit’) is defined as the amount of toxoid that, when mixed with one international unit of antitoxin, produces an optimally flocculated mixture

[12] . For example, NIBSC provides the ‘Diphtheria Toxoid, Plain’

[13] , which contains 300 lf per ampoule; the ‘The 1st International Reference Reagent For Diphtheria Toxoid For Flocculation Test’

[14] , which contains 900 Lf per ampoule. The conversion between the IU and Lf systems depends on the particular toxoid preparation.

[0057] In the case of using bovine materials in cultures of Corynebacterium diphtheriae, they should be obtained from sources free of bovine spongiform encephalopathy (BSE) or other transmissible spongiform encephalopathies (TSE).

[0058] The diphtheria toxoid in the immunogenic composition of the present invention is usually present in an amount capable of eliciting an immune response upon administration. Ideally, the diphtheria toxoid can elicit a protective immune response. The amount of diphtheria toxoid in the immunogenic composition of the present invention is usually 1 - 50 Lf / dose. Booster vaccines for adolescents and adults usually contain 4 Lf / ml to 8 Lf / ml of diphtheria toxoid, for example 2.5 Lf per 0.5 ml dose, preferably 4 Lf. Pediatric vaccines usually contain 20 to 50 Lf / ml of diphtheria toxoid, for example 10 Lf or 25 Lf per 0.5 ml dose.

[0059] For pediatric combination vaccines, the ratio of diphtheria toxoid to tetanus toxoid is usually greater than 1 (i.e., pediatric vaccines usually have an excess of diphtheria toxoid), and is usually 2:1 to 3:1 (measured in Lf units), for example 2.5:1. In contrast, for booster vaccines for adolescents or adults (who have usually received at least one pediatric combination vaccine containing diphtheria toxoid and tetanus toxoid), the ratio of tetanus toxoid to diphtheria toxoid is usually greater than 1 (i.e., booster vaccines usually have an excess of tetanus toxoid), and is usually 1.5:1 to 2.5:1, for example 2:1. The diphtheria toxoid is usually unconjugated.

[0060] The total amount of diphtheria toxoid can be equivalent to 1 - 50 Lf / dose, for example, at a concentration of 4 Lf / ml to 8 Lf / ml in booster vaccines, for example 2.5 Lf per 0.5 ml dose or 4 Lf per 0.5 ml dose; at a concentration of 20 to 50 Lf / ml in pediatric vaccines, for example 10 Lf per 0.5 ml dose or 25 Lf per 0.5 ml dose. In specific embodiments where there is no chemically detoxified diphtheria toxoid, the amount of genetically detoxified diphtheria toxoid, particularly CRM197, present can be equivalent to 1 - 50 Lf / dose, for example at a concentration of 4 Lf / ml to 8 Lf / ml in booster vaccines, for example 2.5 Lf per 0.5 ml dose or 4 Lf per 0.5 ml dose, and at a concentration of 20 to 50 Lf / ml in pediatric vaccines, for example 10 Lf per 0.5 ml dose or 25 Lf per 0.5 ml dose.

[0061] The diphtheria toxoid can be adsorbed onto aluminum hydroxide adjuvant.

[0062] Generally, immunogenic compositions containing diphtheria toxoid antigen are substantially free of any mercury preservatives.

[0063] Tetanus toxoid

[0064] Tetanus is caused by Clostridium tetani ( Clostridium tetani)(caused by a Gram - positive, spore - forming bacillus). This organism expresses an endopeptidase (“tetanus toxin”), which can be processed to obtain a toxoid that is no longer toxic but retains antigenicity and is capable of stimulating the production of specific antitoxin antibodies after injection. Tetanus toxoid is more detailedly disclosed in Chapter 27 of Reference 1. Preferred tetanus toxoids are those prepared by formaldehyde treatment. Tetanus toxoid can be obtained by growing Clostridium tetani ( C.tetani ) in a growth medium (e.g., Latham medium derived from bovine casein), followed by formaldehyde treatment, ultrafiltration, and precipitation. The material can then be processed by methods including sterile filtration and / or dialysis.

[0065] The quantity of tetanus toxoid can be expressed in International Units (IU). For example, NIBSC

[15] provides the ‘Tetanus Toxoid Adsorbed Third International Standard 2000’ [16,17], which contains 469 IU per ampoule. As an alternative to the IU system, the ‘Lf’ unit is defined as the amount of toxoid that, when mixed with one international unit of antitoxin, produces an optimal flocculated mixture

[18] . For example, NIBSC provides the ‘The 1st International Reference Reagent for Tetanus Toxoid For Flocculation Test’

[19] , which contains 1000 LF per ampoule. The conversion between the IU and Lf systems depends on the specific toxoid preparation.

[0066] In the case of using bovine materials in the culture of Clostridium tetani, they should be obtained from sources free of bovine spongiform encephalopathy (BSE) or other transmissible spongiform encephalopathies (TSEs).

[0067] The tetanus toxoid in the immunogenic composition of the present invention is generally present in an amount capable of eliciting an immune response upon administration. Ideally, the tetanus toxoid can elicit a protective immune response. The amount of tetanus toxoid in the immunogenic composition of the present invention is generally 1 - 20 Lf / dose. Booster vaccines for adolescents and adults usually contain 5 Lf of tetanus toxoid per 0.5 ml dose. Pediatric vaccines usually contain 5 to 10 Lf of tetanus toxoid per 0.5 ml dose.

[0068] It will be apparent to those skilled in the art that in some embodiments, the tetanus toxoid can exist in free (unconjugated) and conjugated forms or predominantly in conjugated form, that is, greater than 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% of the tetanus toxoid exists in conjugated form. Thus, the amount of tetanus toxoid in the immunogenic composition of the present invention can refer to the unconjugated tetanus toxoid alone, the conjugated tetanus toxoid alone, or the sum of unconjugated and conjugated tetanus toxoids. However, preferably, the tetanus toxoid is free and unconjugated. In a preferred embodiment, the amount of tetanus toxoid in the immunogenic composition of the present invention refers to the unconjugated tetanus toxoid alone.

[0069] The tetanus toxoid can be adsorbed onto an aluminum hydroxide adjuvant, but this is not necessary (e.g., 0 - 10% adsorption of the total tetanus toxoid can be used).

[0070] Typically, the immunogenic composition containing tetanus toxoid is substantially free of any mercury preservatives.

[0071] acellular pertussis antigen

[0072] Bordetella pertussis is a Gram - negative, non - spore - forming, aerobic bacterium that causes whooping cough. As described in more detail in Chapter 21 of Reference 1, vaccines against Bordetella pertussis have been available for many years and are divided into two categories: whole - cell (wP) and acellular (aP). Whole - cell vaccines contain whole Bordetella pertussis cells that have been killed and inactivated (e.g., by treatment with formalin and / or heat), while acellular vaccines contain specific purified Bordetella pertussis antigens that are purified from natural bacteria or after expression in a recombinant host.

[0073] The present invention can use more than one acellular pertussis (aP) antigen in a single vaccine, for example at least two or at least three of the following well-known and well-characterized Bordetella pertussis antigens: (1) detoxified pertussis toxin (pertussis toxoid or 'PT'); (2) filamentous hemagglutinin ('FHA'); (3) pertactin ('PRN', also known as '69 kDa outer membrane protein' or '69K'). Most preferably, all three of these antigens should be used. These three antigens are preferably prepared by isolation from a Bordetella pertussis culture grown, for example, in a modified Stainer-Scholte liquid medium, and PT and FHA can be isolated from the fermented liquid medium (for example, by adsorption onto hydroxyapatite gel), while pertactin can be extracted from cells by heat treatment and flocculation (for example, using barium chloride). The antigens can be purified in successive chromatographic and / or precipitation steps. PT and FHA can be purified by hydrophobic chromatography, affinity chromatography, and size exclusion chromatography. Pertactin can be purified by ion exchange chromatography, hydrophobic chromatography, and size exclusion chromatography. The methods for purifying PT, FHA, and pertactin are known in the art.

[0074] FHA and pertactin can be treated with formaldehyde before use according to the present invention. PT can be detoxified by treatment with formaldehyde and / or glutaraldehyde. As an alternative to this chemical detoxification procedure, in a preferred embodiment, PT can be a mutant PT in which the enzymatic activity has been reduced by mutagenesis

[20] (for example, the 9K / 129G double mutant). When gene-detoxified PT is included, a reduced amount can be used. For example, the concentration of gene-detoxified pertussis toxoid in the composition can be < 5 μg / ml, for example <4, <3, <2.5, <2, <1 μg / ml, etc. Thus, in a typical 0.5 ml unit dose volume, the amount of gene-detoxified pertussis toxoid is less than 2.5 μg, for example <2, <1.5, <1, <0.5 μg, for example, about 0.5 μg to about 2.5 μg.

[0075] Additional acellular pertussis antigens that can be used include fimbriae (for example, agglutinogens 2 and 3, also known as FIM2 and FIM3).

[0076] The aP antigens can be used in an unadsorbed state, but they are preferably adsorbed onto one or more aluminum salt adjuvants before use. The aP antigens are preferably adsorbed onto an aluminum hydroxide adjuvant.

[0077] Generally, the immunogenic composition containing the aP antigen is substantially free of mercury preservatives (such as thimerosal).

[0078] A cell-free pertussis antigen is typically present in the immunogenic composition of the present invention in an amount capable of eliciting an immune response upon administration. Ideally, the cell-free pertussis antigen can elicit a protective immune response. The amount of the cell-free pertussis antigen is typically expressed in micrograms. The concentration of PT in the vaccine is typically 5 to 50 μg / ml. Typical PT concentrations are 5 μg / ml, 16 μg / ml, 20 μg / ml, or 50 μg / ml. The concentration of FHA in the vaccine is typically 10 to 50 μg / ml. Typical FHA concentrations are 10 μg / ml, 16 μg / ml, or 50 μg / ml. The concentration of Bordetella pertussis adhesin in the vaccine is typically 5 to 16 μg / ml. Typical Bordetella pertussis adhesin concentrations are 5 μg / ml, 6 μg / ml, or 16 μg / ml. For example, a booster vaccine for adolescents and adults typically contains 2.5 to 8 μg PT, 4 to 8 μg FHA (e.g., 4 to 8 μg FHA), and 2.5 to 8 μg Bordetella pertussis adhesin (e.g., 2.5 to 8 μg Bordetella pertussis adhesin) per 0.5 ml dose. Generally, the booster vaccine contains 4 μg PT, 4 μg FHA, and 8 μg Bordetella pertussis adhesin per 0.5 ml dose, more preferably 5 μg PT, 2.5 μg FHA, and 2.5 μg Bordetella pertussis adhesin. An infant vaccine typically contains 7 μg PT, 10 μg FHA, and 10 μg Bordetella pertussis adhesin per 0.5 ml dose.

[0079] When the aqueous component includes each of PT, FHA, and Bordetella pertussis adhesin, their weight ratios can be different, but can be, for example, about 16:16:5, about 5:10:6, about 20:20:3, about 25:25:8, or about 10:5:3 (PT:FHA:PRN).

[0080] The specific immunogenic composition of the present invention

[0081] Specifically contemplated immunogenic compositions of the present invention comprise:

[0082] • (i) Bordetella pertussis OMV, (ii) diphtheria toxoid, (iii) tetanus toxoid, (iv) cell-free pertussis antigen.

[0083] • (i) Bordetella pertussis OMV, (ii) diphtheria toxoid, (iii) tetanus toxoid, (iv) detoxified pertussis toxin, (v) filamentous hemagglutinin, and (vi) Bordetella pertussis adhesin.

[0084] • (i) Bordetella pertussis OMV, (ii) diphtheria toxoid, (iii) tetanus toxoid, (iv) genetically detoxified pertussis toxin, (v) filamentous hemagglutinin, and (vi) Bordetella pertussis adhesin.

[0085] • (i) Bordetella pertussis OMV, (ii) diphtheria toxoid, (iii) tetanus toxoid, (iv) detoxified pertussis toxin, (v) filamentous hemagglutinin, (vi) pertactin, (vii) antigen from poliovirus type 1 strain, (viii) antigen from poliovirus type 2 strain, and (ix) antigen from poliovirus type 3 strain.

[0086] The immunogenic composition of the invention elicits enhanced TH1 and enhanced TH2 responses, i.e., both IgG1 and IgG2a production are increased. More specifically, relative to immunization with OMV alone or TdaP alone, the composition elicits an increased TH1 immune response and / or an increased TH2 immune response.

[0087] Pharmaceutical methods and uses

[0088] The immunogenic composition of the invention may further comprise a pharmaceutically acceptable carrier. Typical 'pharmaceutically acceptable carriers' include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers are generally large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, sucrose

[21] , trehalose

[22] , lactose, and lipid aggregates (such as oil droplets or liposomes). Such carriers are well known to those of ordinary skill in the art. Vaccines may also contain diluents such as water, saline, glycerol, etc. Additionally, adjuvant substances such as wetting agents or emulsifying agents, pH buffering substances, etc. may be present. Sterile pyrogen-free phosphate buffered saline is a typical carrier. A detailed discussion of pharmaceutically acceptable excipients can be found in reference 23.

[0089] The composition of the invention can be in aqueous form (i.e., solution or suspension) or in dry form (e.g., lyophilized). If a dry vaccine is used, it is reconstituted into a liquid medium prior to injection. Lyophilization of vaccines is known in the art, for example, the Menjugate™ product is presented in lyophilized form. When the immunogenic composition of the invention includes lyophilized components, the components are typically prepared separately, mixed and then lyophilized. To stabilize the antigen during lyophilization, inactive components can be added prior to freeze-drying, for example, as stabilizers. Preferred stabilizers for inclusion are lactose, sucrose, and mannitol, and mixtures thereof, such as lactose / sucrose mixtures, sucrose / mannitol mixtures, etc. The final vaccine obtained by aqueous reconstitution of the lyophilized material can thus contain lactose and / or sucrose. Amorphous excipients and / or amorphous buffers

[24] are preferably used when preparing lyophilized vaccines.

[0090] It is preferable to include, for example, sugar alcohols (such as mannitol) and / or disaccharides (such as sucrose or trehalose) in the composition at a concentration of 1 mg / ml to 30 mg / ml (such as about 25 mg / ml).

[0091] The compositions can be presented in vials, or they can be presented in filled syringes. The syringes can be provided with or without needles. The syringe will contain a single dose of the composition, while the vial can contain a single dose or multiple doses.

[0092] The compositions of the present invention are preferably administered to a patient in a unit dose of 0.5 ml. The mention of a 0.5 ml dose is to be understood as including normal variations, such as 0.5 ml ± 0.05 ml. For multiple-dose cases, the amounts of multiple doses will be withdrawn and packaged together in a single container, such as 5 ml (or 5.5 ml, 10% overfill) for a 10-dose multiple-dose container.

[0093] The aqueous compositions of the present invention are also suitable for reconstituting other vaccines from a lyophilized form. In cases where the compositions of the present invention are used for such immediate reconstitution, the present invention provides kits, which can contain two vials, or can contain a filled syringe and a vial, wherein the contents of the syringe are used to reactivate the contents of the vial before injection.

[0094] The vaccine can also be prepared in a form in which the vaccine can be prepared immediately at the time / point of use by mixing two components together. Such two-component embodiments include liquid / liquid mixing and liquid / solid mixing, such as by mixing an aqueous material with a lyophilized material.

[0095] Thus, the kits useful in the present invention contain a first component comprising an OMV component and a second component comprising (a) acellular pertussis antigen, (b) tetanus toxoid, and (c) diphtheria toxoid; wherein the two components are in separate containers (such as vials and / or syringes). The OMV component in the first component is lyophilized. In some embodiments, the first component does not contain an adjuvant. The second component can contain an aqueous antigen. In some embodiments, the second component contains an adjuvant, such as an aluminum salt adjuvant.

[0096] The present invention also provides a method for preparing the immunogenic composition of the present invention, which includes mixing a first component comprising the OMV and a second component comprising (a) acellular pertussis antigen, (b) tetanus toxoid, and (c) diphtheria toxoid. The OMV in the first component can be lyophilized. The second component can contain an aqueous antigen. The method can further include the step of reconstituting the lyophilized OMV in the first component with the aqueous antigen of the second component. The first component can not contain an adjuvant. The second component can contain an adjuvant, such as an aluminum salt adjuvant.

[0097] The compositions of the present invention can be packaged in unit dosage form or in multiple dosage form. For multiple dosage form, vials are preferred over pre-filled syringes. An effective dosage volume can be routinely established, but a typical human dosage of the composition has a volume of 0.5 ml, for example, for intramuscular injection.

[0098] The pH of the composition is preferably from 6 to 8, more preferably about 7. A stable pH can be maintained by using a buffer. An aqueous composition administered to a patient can have a pH of 5.0 to 7.5, and more typically 5.0 to 6.0 for optimal stability; in the presence of diphtheria toxoid and / or tetanus toxoid, the pH is desirably 6.0 to 7.0.

[0099] The immunogenic compositions of the present invention generally comprise a potassium dihydrogen phosphate buffer. The potassium dihydrogen phosphate buffer can comprise about 1 - 10 mM potassium dihydrogen phosphate, such as 1.25 mM, 2.5 mM or 5.0 mM. If the composition comprises an aluminum hydroxide salt, a histidine buffer

[25] is preferably used. The composition can be sterile and / or pyrogen-free. The compositions of the present invention can be isotonic with respect to humans.

[0100] The compositions of the present invention are immunogenic, and more preferably are vaccine compositions. The vaccines according to the present invention can be prophylactic (i.e., prevent infection) or therapeutic (i.e., treat infection), but will generally be prophylactic. A prophylactic vaccine does not guarantee complete protection from disease, since there may be a lag or delay before the immune system can repel the infection even if the patient has generated antibodies. Thus, and for the avoidance of doubt, the term prophylactic vaccine can also refer to a vaccine that, for example, improves the outcome of a future infection by reducing the severity or duration of such infection.

[0101] The terms "protection against infection" and / or "providing protective immunity" mean that the immune system of a subject has been triggered (e.g., by vaccination) to trigger an immune response and reject infection. Specifically, the triggered immune response is capable of rejecting infection against many pathogens, such as different bacterial strains. Thus, a vaccinated subject may be infected, but is able to reject the infection better than a control subject. An immunogenic composition used as a vaccine contains an immunologically effective amount of an antigen and any other components as needed. An 'immunologically effective amount' means that administering this amount to an individual, either as a single dose or as part of a series of doses, is effective for treatment or prevention. Generally, the desired result is to generate an antigen (e.g., pathogen)-specific immune response that can or helps to protect the subject against the pathogen. This amount varies depending on the health and physical condition of the individual to be treated, the age of the individual to be treated, the taxonomic group (e.g., non-human primate, primate, etc.), the ability of the individual's immune system to synthesize antibodies, the desired degree of protection, the vaccine formulation, the treating physician's evaluation of the medical condition, and other relevant factors. It is expected that the amount will fall within a relatively wide range that can be determined by routine testing.

[0102] The compositions of the present invention can be prepared in various forms. For example, the compositions can be prepared as injectables, as liquid solutions or suspensions. The compositions can be prepared for pulmonary administration using fine powders or sprays, such as an inhalant. The compositions can be prepared as suppositories or pessaries. The compositions can be prepared for nasal, otic or ophthalmic administration, such as as sprays, drops, gels or powders [e.g., references 26 and 27]. The successful nasal administration of pneumococcal saccharides [28, 29], Hib saccharides

[30] , MenC saccharides

[31] , and mixtures of Hib and MenC saccharide conjugates

[32] has been reported.

[0103] The compositions of the present invention can include antimicrobial agents, especially when packaged in multi-dose forms.

[0104] The compositions of the present invention can contain detergents such as Tween (polysorbate), such as Tween 80. Detergents are typically present at low levels, such as <0.01%.

[0105] The compositions of the present invention can include sodium salts (e.g., sodium chloride) to provide tonicity. 10 + A concentration of 2 mg / ml NaCl is typical. In some embodiments, concentrations of 4 - 10 mg / ml NaCl can be used, e.g., 9.0, 7.0, 6.75 or 4.5 mg / ml.

[0106] The composition will generally have an osmolality of from 200 mOsm / kg to 400 mOsm / kg, preferably from 240 - 360 mOsm / kg, and more preferably in the range of 280 - 320 mOsm / kg. It has previously been reported that osmolality has no effect on pain caused by vaccination

[33] , but nevertheless it is preferred to maintain the osmolality within this range.

[0107] The composition of the present invention will generally include a buffer. Phosphate buffers are typical.

[0108] The composition of the present invention can be administered in combination with other immunomodulators. Specifically, the composition can include one or more adjuvants. Such adjuvants include, but are not limited to, compositions containing minerals.

[0109] Mineral-containing compositions suitable as adjuvants in the present invention include mineral salts such as aluminum salts and calcium salts (or mixtures thereof). Calcium salts include calcium phosphate (e.g., "CAP" particles as disclosed in reference 34). Aluminum salts include hydroxides, phosphates, sulfates, etc., where the salts are in any suitable form (e.g., gels, crystals, amorphous, etc.). Adsorption to these salts is preferred. The mineral-containing compositions can also be formulated as particles of metal salts

[35] .

[0110] Adjuvants known as aluminum hydroxide and aluminum phosphate can be used. These names are conventional but are for convenience only as neither is an accurate description of the actual chemical compounds present (e.g., see chapter 9 of reference 36). Any "hydroxide" or "phosphate" adjuvant commonly used as an adjuvant can be used in the present invention. The adjuvant called "aluminum hydroxide" is typically aluminum oxyhydroxide salts (usually at least partially crystalline). The adjuvant known as "aluminum phosphate" is typically aluminum hydroxyphosphate and often also contains small amounts of sulfate (i.e., aluminum hydroxyphosphate sulfate). They can be obtained by precipitation, and the reaction conditions and concentrations during precipitation affect the degree of phosphate substitution for the hydroxyl groups in the salts.

[0111] The fibrous morphology (e.g., as seen in transmission electron micrographs) is typical for aluminum hydroxide adjuvants. The pI of aluminum hydroxide adjuvants is typically about 11, i.e., the adjuvant itself has a surface positive charge at physiological pH. An adsorption capacity of 1.8 - 2.6 mg protein / mg Al +++ has been reported for aluminum hydroxide adjuvants at pH 7.4.

[0112] The PO4 / Al molar ratio of aluminum phosphate adjuvants is generally from 0.3 to 1.2, preferably from 0.8 to 1.2, and more preferably 0.95 +0.1. The aluminum phosphate will generally be amorphous, especially for hydroxyphosphates. A typical adjuvant is amorphous aluminum hydroxyphosphate with a PO4 / Al molar ratio of 0.84 to 0.92 (included in 0.6 mg Al 3+ / ml). The aluminum phosphate will generally be particulate (e.g., plate-like morphology as seen in transmission electron micrographs). After adsorption of any antigen, the typical diameter of the particles is in the range of 0.5 - 20 μm (e.g., about 5 - 10 μm). For aluminum phosphate adjuvants, an adsorption capacity of 0.7 - 1.5 mg protein / mg Al +++ has been reported at pH 7.4.

[0113] The point of zero charge (PZC) of aluminum phosphate is negatively correlated with the degree of substitution of phosphate groups for hydroxyl groups, and this degree of substitution can vary depending on the reaction conditions and reactant concentrations used to prepare the salt by precipitation. The PZC is also altered by changing the concentration of free phosphate ions in the solution (more phosphate = more acidic PZC) or by adding a buffer such as a histidine buffer (making the PZC more basic). The aluminum phosphate used according to the present invention will generally have a PZC of 4.0 to 7.0, more preferably 5.0 to 6.5, e.g., about 5.7.

[0114] The aluminum salt suspension for preparing the composition of the present invention may contain a buffer (e.g., phosphate or histidine or Tris buffer), but this is not always necessary. The suspension is preferably sterile and pyrogen-free. The suspension may include free aqueous phosphate ions, e.g., present at a concentration of 1.0 to 20 mM, preferably 5 to 15 mM, and more preferably about 10 mM. The suspension may also contain sodium chloride.

[0115] A mixture of both aluminum hydroxide and aluminum phosphate can be used in the present invention. In this case, there can be more aluminum phosphate than aluminum hydroxide, e.g., a weight ratio of at least 2:1, e.g., ≥5:1, ≥6:1, ≥7:1, ≥8:1, ≥9:1, etc.

[0116] The concentration of Al +++ in the composition for administration to a patient is preferably less than 10 mg / ml, e.g., ≤5 mg / ml, ≤4 mg / ml, ≤3 mg / ml, ≤2 mg / ml, ≤1 mg / ml, etc. The preferred range is 0.3 - 1 mg / ml. A maximum of 0.85 mg / dose is preferred.

[0117] A typical adjuvant aluminum phosphate adjuvant is amorphous aluminum hydroxyphosphate with a PO4 / Al molar ratio of 0.84 to 0.92 (included in 0.6 mg Al 3+ / ml). For example, adsorption with aluminum phosphate at a low dose (e.g., 50 to 100 μg Al per dose 3+ ) can be used.

[0118] The use of aluminum salts as adjuvants is particularly preferred, and antigens are generally adsorbed to such salts. In the compositions of the present invention, some antigens may be adsorbed to aluminum hydroxide, while other antigens are associated with aluminum phosphate. However, in general, it is preferred to use only a single salt, such as the hydroxide or phosphate, but not both simultaneously. Not all antigens need to be adsorbed, i.e., some or all may be free in solution.

[0119] Therapeutic methods

[0120] The present invention also provides an immunogenic composition for generating an immune response in a mammal, which comprises administering the immunogenic composition of the present invention to the mammal. The immunogenic composition is preferably capable of generating an immune response in a mammal. The immune response is preferably protective and preferably involves antibodies, and more preferably is a vaccine. In some embodiments, the vaccine is used in a primary vaccination. The immunogenic composition can generate a booster response. The composition of the present invention is preferably administered to a patient in a 0.5 ml dose (as discussed above).

[0121] The present invention also provides a method for generating an immune response in a mammal, which comprises administering the immunogenic composition of the present invention to the mammal. The immune response is preferably protective and preferably involves antibodies. The method can generate a booster response. The composition of the present invention is preferably administered to a patient in a 0.5 ml dose (as discussed above).

[0122] The mammal is preferably a human. In the case where the vaccine is for prophylactic use, the human is preferably a child (such as a young child or an infant, especially a newborn) or an adolescent. A vaccine intended for use in children can also be administered to adults, for example, to evaluate safety, dosage, immunogenicity, etc. The preferred category of humans for treatment is women of childbearing age (such as adolescents and above). Another preferred category is pregnant women.

[0123] In some embodiments, the patient has been pre-immunized with diphtheria toxoid or a derivative thereof. In other embodiments, the patient has been pre-immunized with tetanus toxoid or a derivative thereof. In some embodiments, the patient has been pre-immunized with both diphtheria toxoid or a derivative thereof and tetanus toxoid or a derivative thereof.

[0124] The present invention also provides the composition of the present invention for use as a medicament.

[0125] The present invention also provides the use of the composition of the present invention in the preparation of a medicament for generating an immune response in a mammal.

[0126] These uses and methods are preferably used for preventing and / or treating diseases caused by one or more of Corynebacterium diphtheriae, Clostridium tetani, and Bordetella pertussis. Corynebacterium diphtheriae can cause diphtheria; Clostridium tetani can cause tetanus; Bordetella pertussis can cause whooping cough.

[0127] The subjects for preventing the disease can be different from the subjects receiving the immunogenic composition of the present invention. For example, the immunogenic composition (before or during pregnancy) can be administered to a female to protect the offspring (so-called'maternal immunity' [37 - 39]). The immunity of a pregnant female provides antibody-mediated immunity to the infant through passive maternal immunity. Passive immunity occurs naturally when maternal antibodies are transferred to the fetus through the placenta. Passive immunity is particularly important for infants because they are born without any actively acquired immunity. Administering the composition of the present invention to a pregnant female enhances the immunity in the female, and the antibodies are passed to the newborn through the placenta, conferring passive maternal immunity to the infant. However, the passive immunity in the infant is only temporary and begins to decline after the first few weeks or months of life. Since passive immunity is only temporary, it may be important for the infant to receive the administration of the composition of the present invention before the passive immunity wanes to induce active immunity in the infant. Administering a second immunogenic composition to the infant after birth induces active immunity in the infant and prolongs the immunity transferred from the mother during pregnancy.

[0128] As used herein, an infant is an individual less than one year old (e.g., less than one day old, 1 week old, 2 weeks old, 3 weeks old, 4 weeks old, 2 months old, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months old, 9 months old, 10 months old, 11 months old, less than 12 months old).

[0129] The composition of the present invention can be administered to a pregnant female at any time during her pregnancy. For example, the composition can be administered to the female during the first, second, or third trimester of her pregnancy. In some embodiments, the composition is administered to the female during the last 6 - 12 weeks of pregnancy (e.g., 28 weeks of gestation, 29 weeks of gestation, 30 weeks of gestation, 31 weeks of gestation, 32 weeks of gestation, 33 weeks of gestation, 34 weeks of gestation, 35 weeks of gestation, 36 weeks of gestation, 37 weeks of gestation, 38 weeks of gestation, 39 weeks of gestation). Specifically, the composition of the present invention is administered to a pregnant female at least four weeks before delivering the infant. In some embodiments, a single-dose regimen is administered to a pregnant female between 32 and 36 weeks of gestation. In other embodiments, a two-dose regimen is administered to a pregnant female, where the first dose is administered at approximately 32 weeks of gestation and the second dose is administered at approximately 36 weeks of gestation.

[0130] The composition can be administered to the infant at any time during the first year of life and thereafter (if desired). Generally, the composition is administered to the infant one, two, three, four or more times during the first year of life. For example, the composition of the present invention can be administered to the infant one or more times selected from: at birth, at 2 weeks of age, 4 weeks of age, 6 weeks of age, 2 months of age, 3 months of age, 4 months of age, 6 months of age, 9 months of age and 12 months of age. Specifically, the composition of the present invention is administered to the infant at a time before the maternal antibodies have decreased to a non-protective titer. Subsequent administrations can be carried out according to any desired schedule.

[0131] In one embodiment, there is provided a method of protecting an infant against a disease caused by one or more of Corynebacterium diphtheriae, Clostridium tetani and Bordetella pertussis, comprising the steps of: (a) administering the composition of the present invention to a female during pregnancy with the infant; and (b) optionally administering the composition of the present invention to the infant born from the pregnancy.

[0132] Accordingly, there is also provided a method of protecting an infant against one or more of diphtheria, tetanus and pertussis, comprising the steps of: (a) administering the composition of the present invention to a female during pregnancy with the infant; and (b) optionally administering the composition of the present invention to the infant born from the pregnancy.

[0133] The preferred composition of the present invention can confer an antibody titer in a patient that is superior to the standard of serum protection of each antigen component for an acceptable percentage of human subjects. Antigens with relevant antibody titers are well known, above which the host is considered to be seroconverted against the antigen, and such titers are published by organizations such as the WHO. Preferably, serum conversion occurs in samples of more than 80%, more preferably more than 90%, still more preferably more than 93% and most preferably 96 - 100% of the statistically significant subjects.

[0134] The composition of the present invention will generally be administered directly to the patient. Direct delivery can be accomplished by parenteral injection (e.g., subcutaneous, intraperitoneal, intravenous, intramuscular or into tissue spaces), or by rectal, oral, vaginal, topical, transdermal, intranasal, ophthalmic, otic, pulmonary or other mucosal administration. Intramuscular administration to the leg or upper arm is preferred. Injection can be carried out via a needle (e.g., a subcutaneous needle), but alternatively needleless injection can be used. A typical intramuscular dose is 0.5 ml.

[0135] The present invention can be used to elicit systemic and / or mucosal immunity.

[0136] The immunogenic composition of the present invention can be administered in a single dose or multiple doses. Administration of a single dose is preferred in the present invention. Alternatively, a further single unit dose may be effective after one unit dose. Generally, the second (or third, fourth, fifth, etc.) unit dose is the same as the first unit dose. Generally, the immunogenic composition of the present invention is administered in three unit doses. Generally, the immunogenic composition of the present invention will be administered intramuscularly, for example, by intramuscular injection into the leg or upper arm.

[0137] Multiple doses can be used in the primary immunization schedule / or booster immunization schedule. The primary dose schedule can be followed by a booster dose schedule. The appropriate timing between priming doses (e.g., between 4 - 16 weeks) and between priming and boosting can be determined routinely.

[0138] For full efficacy, a typical primary immunization schedule (especially for children) may involve administration of more than one dose. For example, the doses can be at: 0 and 6 months (time 0 being the first dose); at 0, 1, 2, and 6 months; on day 0, day 21, and then a third dose between 6 and 12 months; at 2, 4, and 6 months; at 3, 4, and 5 months; at 6, 10, and 14 weeks; at 2, 3, and 4 months; or at 0, 1, 2, 6, and 12 months. The pediatric composition can also be used as a booster dose, for example, for children, during the second year of life.

[0139] The composition can also be used as a booster dose, for example, for children, during the second year of life. The adolescent booster vaccine composition of the present invention is administered in a single dose to persons 10 years of age and older. The immunogenic composition of the present invention can be administered as a booster vaccine to patients who have been previously vaccinated against diphtheria and tetanus and preferably also against pertussis. These patients can be distinguished from the general population by having an immunological memory response to the previous vaccine. The patients may have received their most recent diphtheria and / or tetanus vaccine at least five years prior to receiving the vaccine of the present invention. The patients receiving the vaccine may be 4 to 65 years of age, for example, 11 - 64 years of age, 10 - 18 years of age, etc.

[0140] Any suitable route of administration can be used. For example, the composition can be administered intramuscularly, intraperitoneally, subcutaneously, transdermally, or intradermally. If desired, the composition can be administered by the mucosal route, such as intraorally, intranasally, intravaginally, and rectally. Administration to pregnant females and infants can be by the same or different routes. The composition of the present invention can be administered by intramuscular injection, for example, injection into the arm or leg.

[0141] The vaccine produced by the present invention can be administered to a patient simultaneously with a separate vaccine, for example, simultaneously with a pneumococcal conjugate vaccine (such as PREVNAR™), with an influenza vaccine, with a rotavirus vaccine, with an MMR vaccine, etc.

[0142] In the case where the composition of the present invention comprises an aluminum-based adjuvant, sedimentation of the components may occur during storage. The composition should therefore be shaken before administration to a patient. The shaken composition will be a turbid white suspension.

[0143] Embodiments

[0144] Embodiment 1. An immunogenic composition comprising (a) outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from Bordetella pertussis.

[0145] Embodiment 2. An immunogenic composition comprising (a) outer membrane vesicles (OMV) of Bordetella pertussis, (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0146] Embodiment 3. The immunogenic composition according to Embodiment 1 or Embodiment 2, wherein the acellular pertussis antigen is selected from (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN).

[0147] Embodiment 4. The immunogenic composition according to Embodiment 3, wherein the acellular pertussis antigen comprises PT, FHA, and PRN.

[0148] Embodiment 5. The immunogenic composition according to Embodiment 4, wherein PT, FHA, and PRN are present in a ratio of 16:16:5 (measured by weight).

[0149] Embodiment 6. The immunogenic composition according to any one of the preceding embodiments, wherein the diphtheria toxoid is present at a concentration of 4 Lf / ml to 8 Lf / ml, such as 4 Lf per 0.5 ml dose.

[0150] Embodiment 7. The immunogenic composition according to any one of Embodiments 1 to 6, wherein the diphtheria toxoid is present at a concentration of 20 to 50 Lf / ml, such as 25 Lf per 0.5 ml dose.

[0151] Embodiment 8. The immunogenic composition according to any one of the preceding embodiments, wherein the tetanus toxoid is present at a concentration of about 5 Lf per 0.5 ml dose.

[0152] Embodiment 9. The immunogenic composition according to any one of Embodiments 1 to 8, wherein the tetanus toxoid is present at a concentration of 5 to 10 Lf per 0.5 ml dose.

[0153] Embodiment 10. The immunogenic composition according to any one of Embodiments 1 to 9, wherein the diphtheria toxoid and the tetanus toxoid are present in a ratio of diphtheria toxoid:tetanus toxoid greater than 1, such as 2:1 to 3:1 (measured in Lf units), such as 2.5:1.

[0154] Embodiment 11. The immunogenic composition according to any one of Embodiments 1 to 9, wherein the tetanus toxoid and the diphtheria toxoid are present in a ratio of tetanus toxoid:diphtheria toxoid greater than 1, such as 1.5:1 to 2.5:1 (measured in Lf units), such as 2:1.

[0155] Embodiment 12. The immunogenic composition according to any one of the foregoing embodiments, wherein the immunogenic composition contains an adjuvant.

[0156] Embodiment 13. The immunogenic composition according to any one of the foregoing embodiments, wherein the immunogenic composition contains an aluminum salt adjuvant.

[0157] Embodiment 14. The immunogenic composition according to any one of the foregoing embodiments, wherein the composition is an injectable liquid solution or suspension.

[0158] Embodiment 15. The immunogenic composition according to any one of Embodiments 1 to 14, wherein the composition is lyophilized.

[0159] Embodiment 16. The immunogenic composition according to any one of the foregoing embodiments, wherein the composition is preservative-free.

[0160] Embodiment 17. The immunogenic composition according to any one of the foregoing embodiments, wherein the composition is a vaccine.

[0161] Embodiment 18. The immunogenic composition according to any one of the foregoing embodiments, wherein the composition is for administration to a human.

[0162] Embodiment 19. The immunogenic composition according to any one of the foregoing embodiments, wherein the composition is used as a medicament.

[0163] Embodiment 20. A method for generating an immune response in a patient, which comprises the step of administering to the patient a composition according to any one of the foregoing embodiments.

[0164] Embodiment 21. A method for generating an immune response in a patient, comprising the step of administering to the patient a composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0165] Embodiment 22. A method for preparing an immunogenic composition according to any one of Embodiments 1-19, comprising mixing a first component comprising outer membrane vesicles (OMV) and a second component comprising acellular pertussis antigen, tetanus toxoid, and diphtheria toxoid.

[0166] Embodiment 23. The method according to Embodiment 22, wherein the OMV in the first component is lyophilized.

[0167] Embodiment 24. The method according to Embodiment 22 or Embodiment 23, wherein the second component comprises an aqueous antigen.

[0168] Embodiment 25. The method according to Embodiment 24, further comprising the step of reconstituting the lyophilized OMV in the first component with the aqueous antigen of the second component.

[0169] Embodiment 26. The method according to any one of Embodiments 22-25, wherein the first component does not contain an adjuvant.

[0170] Embodiment 27. The method according to any one of Embodiments 22-26, wherein the second component contains an adjuvant, such as an aluminum salt adjuvant.

[0171] Embodiment 28. A kit for preparing an immunogenic composition according to any one of Embodiments 1-19, comprising a first component comprising the OMV and a second component comprising acellular pertussis antigen, tetanus toxoid, and diphtheria toxoid, wherein the two components are in separate containers.

[0172] Embodiment 29. The kit of Embodiment 28, wherein the OMV in the first component is lyophilized.

[0173] Embodiment 30. The kit according to Embodiment 28 or Embodiment 29, wherein the second component comprises an aqueous antigen.

[0174] Embodiment 31. The kit according to any one of Embodiments 28-30, wherein the first component does not contain an adjuvant.

[0175] Embodiment 32. The kit according to any one of Embodiments 28-31, wherein the second component contains an adjuvant, such as an aluminum salt adjuvant.

[0176] Embodiment 33. An immunogenic composition comprising (a) outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain expressing a genetically detoxified pertussis toxoid, in particular the genetically detoxified pertussis toxoid PT 9K / 129G.

[0177] Embodiment 34. An immunogenic composition comprising (a) outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain expressing the genetically detoxified pertussis toxoid PT9K / 129G.

[0178] Embodiment 35. An immunogenic composition comprising (a) outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain comprising an S1 gene that has been modified to include the mutations R9K and E129G and expressing the genetically detoxified pertussis toxoid PT-9K / 129G.

[0179] Embodiment 36. An immunogenic composition comprising (a) outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain comprising an S1 gene that has been modified to include the mutations R9K and E129G and expressing the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the OMV is not chemically detoxified.

[0180] Embodiment 37. An immunogenic composition comprising (a) outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain comprising an S1 gene that has been modified to include the mutations R9K and E129G and expressing the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the OMV is not chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0181] Embodiment 38. An immunogenic composition comprising (a) outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure.

[0182] Embodiment 39. An immunogenic composition comprising (a) outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV is not chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0183] Embodiment 40. An immunogenic composition comprising (a) outer membrane vesicles (OMV); (b) acellular pertussis antigen selected from (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G.

[0184] Embodiment 41. An immunogenic composition comprising (a) outer membrane vesicles (OMV); (b) acellular pertussis antigen selected from (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV is not chemically detoxified.

[0185] Embodiment 42. An immunogenic composition comprising (a) outer membrane vesicles (OMV); (b) acellular pertussis antigens selected from (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxin PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV is not chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0186] Embodiment 43. An immunogenic composition comprising (a) outer membrane vesicles (OMV); (b) (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxin PT-9K / 129G.

[0187] Embodiment 44. An immunogenic composition comprising (a) outer membrane vesicles (OMV); (b) (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxin PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV is not chemically detoxified.

[0188] Embodiment 45. An immunogenic composition comprising (a) outer membrane vesicles (OMV); (b) (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that does not have glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV is not chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0189] Embodiment 46. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that expresses a genetically detoxified pertussis toxoid, particularly the genetically detoxified pertussis toxoid PT 9K / 129G.

[0190] Embodiment 47. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that expresses the genetically detoxified pertussis toxoid PT 9K / 129G.

[0191] Embodiment 48. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G.

[0192] Embodiment 49. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the OMV is not chemically detoxified.

[0193] Embodiment 50. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the OMV is not chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0194] Embodiment 51. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the lipid A in the OMV has a modified structure that does not have glucosamine (GlcN) substitution on the distal phosphate group of the core structure.

[0195] Embodiment 52. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the ArnT gene has been knocked out or deleted, and wherein the lipid A in the OMV has a modified structure that does not have glucosamine (GlcN) substitution on the distal phosphate group of the core structure.

[0196] Embodiment 53. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that does not have glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV is not chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0197] Embodiment 54. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the ArnT gene has been knocked out or deleted, wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV has not been chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0198] Embodiment 55. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV); (b) acellular pertussis antigen selected from (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G.

[0199] Embodiment 56. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV); (b) acellular pertussis antigen selected from (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV has not been chemically detoxified.

[0200] Embodiment 57. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV); (b) acellular pertussis antigens selected from (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G, and wherein the ArnT gene has been knocked out or deleted, and the Bordetella pertussis strain expresses the gene detoxified pertussis toxoid PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV has not been chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0201] Embodiment 58. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV); (b) (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the gene detoxified pertussis toxoid PT-9K / 129G.

[0202] Embodiment 59. An immunogenic composition comprising (a) Bordetella pertussis outer membrane vesicles (OMV); (b) (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the gene detoxified pertussis toxoid PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that has no glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV has not been chemically detoxified.

[0203] Embodiment 60. An immunogenic composition comprising (a) outer membrane vesicles (OMV) of Bordetella pertussis; (b) (i) detoxified pertussis toxin (PT), (ii) filamentous hemagglutinin (FHA), and (iii) pertactin (PRN); (c) tetanus toxoid; and (d) diphtheria toxoid, wherein the OMV is derived from a Bordetella pertussis strain that contains an S1 gene that has been modified to include the mutations R9K and E129G and expresses the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the ArnT gene has been knocked out or deleted, wherein the lipid A in the OMV has a modified structure that lacks glucosamine (GlcN) substitution on the distal phosphate group of the core structure, and wherein the OMV is not chemically detoxified and / or treated with formaldehyde, formalin, glutaraldehyde, hydrogen peroxide, and combinations or derivatives thereof.

[0204] Embodiment 61. An immunogenic composition comprising (a) outer membrane vesicles (OMV) of Bordetella pertussis that contain a genetically detoxified pertussis toxoid, (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0205] Embodiment 62. An immunogenic composition comprising (a) outer membrane vesicles (OMV) of Bordetella pertussis that contain a genetically detoxified pertussis toxoid, wherein the lipid A in the OMV has a modified structure that lacks glucosamine (GlcN) substitution on the distal phosphate group of the core structure, (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0206] Embodiment 63. An immunogenic composition comprising (a) outer membrane vesicles (OMV) of Bordetella pertussis that contain the genetically detoxified pertussis toxoid PT-9K / 129G, (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0207] Embodiment 64. An immunogenic composition comprising (a) outer membrane vesicles (OMV) of Bordetella pertussis that contain the genetically detoxified pertussis toxoid PT-9K / 129G, wherein the lipid A in the OMV has a modified structure that lacks glucosamine (GlcN) substitution on the distal phosphate group of the core structure, (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid.

[0208] Embodiment 65. The immunogenic composition of Embodiments 61 to 64, wherein 100% of the pertussis toxoid in the outer membrane vesicles is genetically detoxified PT.

[0209] Embodiment 66. The immunogenic composition of embodiments 61 to 65, wherein 100% of the pertussis toxoid in the outer membrane vesicles is the genetically detoxified pertussis toxoid PT 9K / 129G.

[0210] General

[0211] The term "comprising" encompasses "including", e.g., a composition "comprising" X can include additional substances, e.g., X + Y. The word "substantially" does not exclude "completely", e.g., a composition "substantially free" of Y may be completely free of Y. In some embodiments, the term "comprising" means including the indicated active agent, such as the polypeptide described, and including other active agents, as well as pharmaceutically acceptable carriers, excipients, emollients, stabilizers, etc., as known in the pharmaceutical industry. In some embodiments, the term "consisting essentially of" means a composition whose only active ingredient is the indicated active ingredient, e.g., an antigen; however, other compounds may be included for the stabilization, preservation, etc. of the formulation, but do not directly relate to the therapeutic effect of the indicated active ingredient. The use of the transitional phrase "consisting essentially of" is intended to mean that the scope of the claim should be interpreted to cover the specified materials or steps recited in the claim, as well as materials or steps that do not materially affect the basic and novel characteristics of the claimed invention. See In re Herz, 537 F.2d 549, 551-52, 190 USPQ 461, 463 (CCPA 1976) (emphasis in original); see also MPEP § 2111.03. Thus, when used in the claims of the present invention, the term "consisting essentially of" is not intended to be interpreted as equivalent to "comprising". Unless otherwise clearly stated, the term "consisting of" and variations thereof mean "limited to". In certain fields, the term "comprising the active ingredient consisting of" may be used in place of "consisting essentially of". Related to a numerical x value, the term "about" means, e.g., x ± 10%, x ± 5%, x ± 4%, x ± 3%, x ± 2%, x ± 1%. The word "substantially" does not exclude "completely", e.g., a composition "substantially free" of Y may be completely free of Y. When necessary, the word "substantially" may be omitted from the definitions of the present invention. In cases where a method refers to administration steps as, e.g., (a), (b), (c), etc., these steps are intended to be sequential, i.e., step (c) follows step (b), and step (b) follows step (a). Antibodies will generally be specific for their target, i.e., their affinity for the target will be greater than their affinity for an irrelevant control protein, such as bovine serum albumin.

[0212] Unless otherwise specified, methods that include the step of mixing two or more components do not require any particular order of mixing. Thus, the components can be mixed in any order. In the case of three components, two components can be combined with each other, and then the combination can be combined with the third component, and so on.

[0213] Antibodies will generally be specific for their target. Thus, their affinity for the target will be greater than their affinity for an irrelevant control protein such as bovine serum albumin.

[0214] In cases where a component is described as "adsorbed" to an adjuvant, it is preferred that at least 50% (by weight), such as 50%, 60%, 70%, 80%, 90%, 95%, 98% or more of the antigen is adsorbed. If the component is completely adsorbed, no component should be detectable in the supernatant of the composition after centrifugation.

[0215] The amount of the conjugate is usually given as the mass of the sugar (i.e., the dose of the conjugate (carrier + sugar) as a whole will be higher than the said dose) to avoid variations due to carrier selection.

[0216] In cases where animal (and especially bovine) materials are used in cell culture, they should be obtained from sources free of infectious spongiform encephalopathy (TSE), especially free of bovine spongiform encephalopathy (BSE).

[0217] Ways to implement the present invention

[0218] Materials and methods

[0219] TdaP vaccine

[0220] A commercially available TdaP vaccine was used. The TdaP vaccine was adjuvanted with aluminum hydroxide and contained tetanus toxoid, diphtheria toxoid, and acellular pertussis antigens (PT, FHA, and 69K, also known as Bordetella pertussis adhesin or PRN).

[0221] Bacterial strains and growth conditions

[0222] The following Bordetella pertussis strains were used in this study: W28 PT 9K / 129G carrying the gene-detoxified pertussis toxin (Pizza et al., 1989), and its derivative lacking the arnT gene arnTKnockout (KO) derivatives. Bacteria were generally stored and grown as described by Gasperini et al., 2018 and briefly as follows: Bacteria were stored at 80 °C and were revived by plating on Bordet - Gengou (BG) agar plates supplemented with 15% (v / v) sheep blood at 37 °C for 3 days. Then, bacteria were inoculated at an initial optical density at 600 nm (OD600) of 0.05–0.1 in Stainer - Scholte medium supplemented with 0.4% (w / v) L - cysteine monohydrochloride, 0.1% (w / v) FeSO4, 0.2% (w / v) ascorbic acid, 0.04% (w / v) nicotinic acid, 1% (w / v) reduced glutathione. The cultures were grown at 37 °C in a rotary shaker. The recombinant DH5 Escherichia coli strain was stored at 80 °C and was revived by plating on LB agar plates supplemented with 20 μg / ml chloramphenicol at 37 °C for 16 h. For liquid culture, bacteria were inoculated in LB medium supplemented with 20 μg / ml chloramphenicol and were grown at 37 °C in a rotary shaker for 16 h.

[0223] arnT Construction of KO

[0224] To construct Bordetella pertussis arnT mutant strains, similar to that described by Geurtsen et al., 2009, we amplified a part of the DNA upstream of GAATTC using primers 5′ - ATA GGATCC ACGCGGTGCGGCGCCAGCGC - 3′ (SEQ ID NO:1) and 5′ - ATA arnT GCCAGGACCTGGCCTGGCC - 3′ (SEQ ID NO: 2) containing EcoRI and BamHI sites (underlined) from Bordetella pertussis strain W28 PT - 9K / 129G. Additionally, a DNA fragment downstream of GGATCC was obtained by PCR with primers 5′ - ATA AAGCTT GGACGAAGCCTTCAAGGGGC - 3′ (SEQ ID NO: 3) and 5′ - ATA arnT CGTCCAGGCGCGCCAGCGC - 3′ (SEQ ID NO: 4) containing BamHI and HindIII sites (underlined). The two PCR products were cloned into pUC19 together with a kanamycin resistance cassette (KanR) containing BamHI sites at both ends. The resulting plasmid pUC19 - arnT 上-KanR- arnT 下 , and the resulting EcoRI-HindIII fragment was ligated into the EcoRI-HindIII restricted suicide vector pSORTP1. The final construct, designated pSORTP1- arnT KO , was used to construct Bordetella pertussis (strain W28 PT 9K / 129G ) arnT mutants by allelic exchange. Transformants were screened by PCR using various primer pairs.

[0225] OMV purification

[0226] OMVs were generated from W28 PT 9K / 129G and its arnT KO derivative. After 3 days of growth in 250 mL baffled flasks, the liquid cultures of Bordetella pertussis were harvested. The liquid-to-gas volume ratio was crucial for OMV production yield and was maintained at a 1:5 ratio. The bacteria were then pelleted by centrifugation at 5,000 x g for 30 min. The cell-free supernatant was recovered and filtered through a 0.22 μm Stericups filter (Millipore). After ultracentrifugation at 175,000 x g for 2 h, the resulting OMV pellet was washed with Dulbecco's phosphate-buffered saline (D-PBS) and further ultracentrifuged at 175,000 x g for 2 h and finally resuspended in 100 μl D-PBS. Following the manufacturer's instructions, the OMVs were quantified for total protein content by the Lowry assay (DC Protein Assay, BioRad).

[0227] Results

[0228] Outer membrane vesicle preparations were made from two detoxified vaccine strains of Bordetella pertussis: the W28 PT 9K / 129G strain expressing the gene-detoxified pertussis toxin, and a derivative of the W28 PT 9K / 129G arnTKO strain with a genetically modified lipid A structure by deletion of the ArnT-encoding gene, the genetically modified lipid A structure lacking glucosamine substitution on the distal phosphate group of the core structure. The arnT KO mutant of W28 PT 9K / 129G (Bp-Δarnt) showed 10-fold lower TLR4 engagement than the W28 PT 9K / 129G (Bp-WT) strain ( Figure 1 (a)), and induced significantly less IL-6 secretion from PBMCs than the W28 PT 9K / 129G (Bp-WT) strain ( Figure 1 (b)).

[0229] Showing both OMVs from the W28 9K / 129G (Bp WT) and W28 9K / 129G arn tKO (Bp ΔarnT) vaccine strains contained small amounts of FHA, 69K, and pertussis toxin components ( Figure 2 ). And mice immunized with both OMVs elicited detectable levels of antibodies against all three acellular pertussis components (Figure 3).

[0230] Mouse immunization was used to generate mouse antisera

[0231] BALB / c mice (female, 6 weeks old) (Charles River Laboratories International Inc., Wilmington, MA) were immunized intraperitoneally (IP) three times at three-week intervals or intramuscularly (IM) twice at four-week intervals with 100 μl of the preparation (50 µL / leg). Serum was collected 2 weeks after each immunization. The OMVs were formulated in 2 mg / mL Al(OH)3 at the doses specified for each study. For the combined preparation, the OMVs were formulated in 2 mg / mL Al(OH)3 at doses of 0.1, 0.5, and 2.5 µg with 1 / 5 human dose of TdaP antigen (see below) in a total volume of 100 μl.

[0232]

[0233] Luminex immunoassay of mouse antisera

[0234] Total IgG titers against all vaccine antigens were analyzed by a Luminex multiplex immunoassay as described by (Agnolon et al., 2015) and as follows. Titers were expressed as relative Luminex units per ml (RLU / ml), which were generated from the median fluorescence intensity (MFI) registered by transformation with hyperimmune reference antiserum. A MagPlex microsphere-based Luminex multiplex immunoassay was developed according to the manufacturer's instructions to quantify anti-TdaP antibody titers in mouse sera. After incubation of antigen-conjugated microspheres with diluted sera (1:10,000 after the first time; 1:20,000 after the second time), IgG titers in individual animals were determined. A phycoerythrin-conjugated secondary antibody was used for detection (1:400). IgG measurements were determined as median fluorescence intensity (MFI) on a Luminex FLEXMAP 3D analyzer (Luminex Corporation, Austin, TX) using Bio-Plex Manager 5.0 software (Bio-Rad, Hercules, CA). Anti-sera specific for each antigen were used as a reference in order to transform the MFI values of total IgG into RLU / ml (relative Luminex units). The limit of quantification (LOQ) of each antigen assay was determined and was considered the threshold for a positive result. The results are shown in Figure 4 In.

[0235] Adhesion inhibition assay

[0236] For the Bordetella pertussis adhesion inhibition assay, bacteria were grown in liquid culture for 16 h and then pelleted at 8,000 × g for 5 min and resuspended in d-PBS at OD 600 0.5. For fluorescence labeling of Bordetella pertussis cells, 445 μl of the bacterial suspension was then mixed with 50 μl of 1 M NaHCO3 and 5 μl of Alexa Fluor 488 carboxylic acid, succinimidyl ester (Life Technologies, Waltham, MA) and incubated at 37 °C for 15 min. After centrifugation at 8,000 x g for 5 min at room temperature, the supernatant was removed and the pellet was washed once with 1 ml d-PBS to remove unbound dye, and finally the bacteria were resuspended at OD 6000.2 was resuspended in F12-K medium. The pooled mouse sera were serially diluted four-fold in F-12K medium containing 1% (v / v) naive mouse serum and incubated with labeled Bordetella pertussis at a 1:1 ratio for 1 h at 37 °C. One hundred microliters of the bacteria / serum mixture was transferred in triplicate onto plated A549 cells. The infected cells were incubated at 37 °C for 1 h. After thorough washing to remove unbound bacteria, fluorescence was measured at excitation / emission 485 / 535 nm by a Tecan Infinite F200PRO microplate reader.

[0237] Immunization of mice with wP or three different OMV doses resulted in the induction of antibodies that could inhibit the ability of Bordetella pertussis to adhere to epithelial A549 cell in vitro cell cultures. Sera from mice immunized with inactivated whole bacteria had the highest levels of bacterial adhesion inhibition, and the bacterial adhesion inhibition induced by the OMV vaccines was proportional to the antigen dose. The TdaP vaccine did not induce antibodies in mice that inhibited the adhesion of fluorescently labeled bacteria, and only low serum dilutions (1 / 40 and lower) resulted in a decrease in fluorescence in the assay. The highest dose of OMV, 10 μg, was found to induce antibodies after vaccination that conferred the highest level of bacterial adhesion inhibition, which was comparable to that induced by the whole bacteria control ( Figure 5 ).

[0238] Kendrick Intracranial Challenge Efficacy Test

[0239] CD1 mice (6 weeks old) were vaccinated once intraperitoneally (i.p.) with 500 μL of the vaccine preparation and challenged 2 weeks after immunization with an intracranial administration of a 30 μl suspension of Bordetella pertussis strain 18323, and the survival of the mice was followed for 2 weeks according to the Kendrick Intracranial Challenge Efficacy Test (Kendrick et al., 1947) and according to the European Pharmacopoeia guidelines. Three doses (1 / 10, 1 / 50, and 1 / 250 human doses) of the NIBSC reference standard were used as positive controls, and OMVs were formulated at 0.4, 2, and 10 μg doses in 2 mg / mL Al(OH)3.

[0240] The intracerebral mouse protection test (Kendrick test) is valid for determining the efficacy of whole-cell pertussis vaccines and is the only test that has shown a correlation with protection in children (Xing et al., 2014). Immunization of mice with increasing doses (at 0.4, 2, and 10 μg doses) of OMVs conferred increasing levels of protection against intracranial challenge with Bordetella pertussis ( Figure 6), which is comparable to the wP NIBSC reference preparation. The protection induced by the OMV vaccine was proportional to the antigen dose and successfully elicited a protective response comparable to that of wP( Figure 6 ).

[0241] Aerosol challenge

[0242] Female C57BL / 6 mice (10 weeks old) were vaccinated once intraperitoneally (i.p.) with 100 μl of the vaccine preparation and challenged 3 weeks later as described previously (Misiak et al., 2017a) and below. As shown, the whole-cell pertussis (wP) vaccine was used as a positive control at 1 / 5 or 1 / 10 of the human dose. OMVs were formulated at doses of 0.4, 2, and 10 μg as shown in 2 mg / mL Al(OH)3. For the combination preparation, OMVs at a dose of 2.5 μg were formulated with 1 / 5 of the human dose of TdaP antigen (see below) in a total volume of 100 μl in 2 mg / mL Al(OH)3.

[0243]

[0244] One day before challenge, 3 weeks after vaccination, sera and spleens were collected from immunized mice (4 mice per group). Antigen-specific cytokine production of splenocytes and serum antibodies were analyzed by ELISA. The remaining mice were then challenged with the virulent strain of Bordetella pertussis as described below, and lung CFUs were evaluated at 1, 3, 7, and 14 days post-infection.

[0245] Respiratory tract infection of the mice was performed as follows: Using a PARI TurboBOY SX nebulizer, the mice were exposed to Bordetella pertussis aerosol (BP338 strain; 1 × 10 9 CFU / ml) for 10 min, followed by a 10-min rest. After the course of Bordetella pertussis infection, lung CFUs were counted at intervals after challenge for groups of three to four mice. Lungs were aseptically removed and homogenized in 1 ml of sterile physiological saline containing 1% casein. Undiluted and serially diluted homogenates (100 μl) from individual lungs were plated in duplicate on Bordet-Gengou agar plates and bacterial colonies were counted after incubation at 37 °C for 6 days.

[0246] As previously described (Misiak et al., 2017b) and as measured by ELISA below. FHA-specific antibodies were quantified by ELISA using plate-bound FHA (1 µg / mL), biotin-conjugated anti-mouse IgG1 or IgG2a, and peroxidase-conjugated streptavidin (BD Pharmingen, Franklin Lakes, NJ). Antibody levels were expressed as mean endpoint titers ± SEM, which were determined by extrapolating the linear portion of the titration curve to 2 SE above the background value obtained with non-immune serum.

[0247] Immunization of mice with wP and three different OMV doses resulted in the induction of Bordetella pertussis-specific antibody production. wP promoted the highest total IgG titers against FHA, which were significantly greater compared to all three OMV doses (Figure 7). Vaccination with wP was found to promote the highest TH1 response and thus the highest anti-FHA IgG2c titers (Figure 7). Anti-FHA IgG2c was detected in the sera of 1 out of 4 mice vaccinated with OMV 2 and 3 out of 4 mice vaccinated with OMV 10. FHA-specific IgG2c was not detected in mice immunized with OMV 0.4. The differences in FHA-specific responses when compared to wP indicated a much lower FHA content in OMV.

[0248] High protective antibody titers and the induction of a TH1 response are key for protection against Bordetella pertussis. Single-dose immunization with wP, OMV 0.4, OMV 2, and OMV 10 conferred different levels of protection against respiratory challenge with Bordetella pertussis ( Figure 8 ). Mice immunized with the wP vaccine had the highest level of protection, and most of them cleared the infection by day 7 post-challenge. Additionally, the CFU counts of wP-immunized mice were significantly lower at all time points post-infection compared to mice receiving all three tested concentrations of the OMV vaccine. The protection induced by the OMV vaccine was proportional to the antigen dose. However, the protection induced by OMV 10 was not as effective as that induced by vaccination with wP. The area under the clearance curve confirmed that wP best protected mice against Bordetella pertussis aerosol challenge. The highest dose of OMV, 10 µg, was found to confer the highest level of protection in a mouse model challenged with Bordetella pertussis. However, its efficacy was still found to be significantly lower than that of the wP vaccine. It was also found that the FHA-specific IgG2c response was highest in mice receiving the wP vaccine, and FHA-specific serum IgG2c did increase with the OMV vaccine dose.

[0249] The data presented here show that the level of protection conferred by the OMV vaccine is proportional to the antigen dose used. It also emphasizes that even at the highest dose selected, the OMV vaccine was not as protective as wP.

[0250] To compare the protective efficacy of OMV against Bordetella pertussis challenge when combined and added to a cell-free pertussis preparation, cell-free pertussis vaccines formulated with alum or alum + OMV were used in an aerosol challenge model, with a whole-cell vaccine as the positive control. Immunization of mice with wP, aP, and aP + OMV induced high total anti-FHA IgG titers ( Figure 9 ). In addition, high total IgG titers were detected in the OMV-only group. No significant differences were observed among the four vaccine groups. High anti-FHA IgG1 titers were detected in all vaccine groups, with the highest IgG1 titers detected in the sera of mice vaccinated with aP and aP + OMV ( Figure 9 ). However, no significant differences were detected among the groups. FHA-specific IgG2c was detected in the sera of 2 out of 4 mice vaccinated with wP, 4 out of 4 mice vaccinated with aP + OMV, and 1 out of 4 mice vaccinated with OMV ( Figure 9 c). Anti-FHA IgG2c was not detected in the aP group. The IgG2c response to aP alone was significantly enhanced by the addition of OMV.

[0251] Single-dose immunization of mice with wP, aP, aP + OMV, and with OMV alone was found to confer protection against respiratory challenge with Bordetella pertussis ( Figure 10 ). Mice immunized with the wP vaccine had the highest level of protection and cleared the infection by day 7 post-challenge. Vaccination with aP and OMV conferred similar levels of protection. However, the efficacy of these vaccines was significantly lower than that of the wP vaccine. In contrast, the aP + OMV combination was found to confer a level of protection comparable to that induced by the wP vaccine. No significant differences were detected between the two vaccines at any time point tested. The area under the clearance curve confirmed that wP and aP + OMV were the most effective among the tested vaccines.

[0252] Thus, single immunization with all tested vaccine preparations at 1 / 5 the human dose induced protective immunity against Bordetella pertussis in C57BL6 mice. It was also found that immunization with OMV alone conferred significant protection, which was comparable to that induced by the aP vaccine.

[0253] A strong Th1 response was detectable in wP, aP+OMV, and OMV alone, but not in mice vaccinated with aP. The enhanced Th1 response in mice vaccinated with aP+OMV, as compared to those receiving the aP vaccine, was associated with high anti-FHA IgG2c titers, which were virtually absent in aP-immunized mice. The data presented here show that addition of OMV to the aP vaccine strongly enhances its protective efficacy and induces a switch to anti-FHA IgG2c production and a TH1 response during both primary and booster vaccinations( Figure 11 ).

[0254] Booster vaccination

[0255] In previous experiments, naive mice were used for immunization. This was also the case for primary vaccination (i.e., pediatric vaccines). However, booster vaccination is also required later in life, and most subjects in developed countries will already have received currently available vaccines that induce more TH2-biased responses. This scenario was mimicked using a commercially available pediatric vaccine (Infanrix Hexa) (for first (primary) immunization) and different commercially available or experimental booster preparations (including TdaP+OMV) (for secondary immunization).

[0256] Addition of OMV to the TdaP vaccine significantly enhanced the TH1 response, while different TdaP vaccines did not alter the TH balance even in the presence of a TH1-inducing adjuvant (Alum-TLR7)( Figure 12 ).

[0257] Conclusion

[0258] Regarding the immunogenicity of the vaccine preparations studied, the following observations were made:

[0259] • OMV, diphtheria, tetanus, and pertussis vaccines elicited specific antibody titers against the respective antigens in mice immunized with all study preparations.

[0260] • No immune interference was observed between OMV and the tetanus / diphtheria / pertussis vaccine combination.

[0261] • The titers obtained for IgG and functional antibody responses to vaccination with the combination of OMV / diphtheria / tetanus / pertussis antigens were significantly higher than those observed after vaccination with OMV alone or the TdaP vaccine.

[0262] • Addition of OMV to the aP vaccine induced a switch to anti-FHA IgG2c production, and a Th1 response was detectable in wP, aP+OMV, and OMV alone, but not in mice vaccinated with aP.

[0263] Relative to the OMV or aP protective responses when administered alone, the addition of OMV to the aP vaccine in the combination vaccine strongly enhances its protective efficacy. In summary, there is no evidence of strong interference between any of the vaccines studied. Immunization with OMV alone was found to confer significant protection in the Kendricks efficacy test and aerosol challenge models. The addition of OMV to the acellular pertussis vaccine resulted in greater protection than either the aP or OMV vaccine alone. Without wishing to be bound by theory, this may be due to additional protective antigens contained within the vesicles and / or due to the induction of a favorable TH1 profile upon both primary and booster vaccination.

[0264] It should be understood that the present invention has been described by way of example only and modifications may be made while still within the scope and spirit of the present invention.

[0265] References

[0266]

[0267]

Claims

1. An immunogenic composition comprising (a) outer membrane vesicles (OMVs), (b) acellular pertussis antigen, (c) tetanus toxoid, and (d) diphtheria toxoid, wherein the OMVs are derived from a Bordetella pertussis strain in which the S1 gene has been modified, and the modification is the mutations R9K and E129G, and the Bordetella pertussis strain expresses the genetically detoxified pertussis toxoid PT-9K / 129G, and wherein the ArnT gene has been knocked out or deleted, and wherein the acellular pertussis antigen comprises detoxified pertussis toxin (PT), filamentous hemagglutinin (FHA), and pertactin (PRN).

2. The immunogenic composition according to claim 1, wherein PT, FHA, and PRN are present in a ratio of 16:16:5 by weight measurement.

3. The immunogenic composition according to claim 1 or 2, wherein the diphtheria toxoid is present at a concentration of 4 Lf / ml to 8 Lf / ml per 0.5 ml dose.

4. The immunogenic composition according to claim 3, wherein the diphtheria toxoid is present at a concentration of 4 Lf per 0.5 ml dose.

5. The immunogenic composition according to claim 1 or 2, wherein the diphtheria toxoid is present at a concentration of 20 to 50 Lf / ml per 0.5 ml dose.

6. The immunogenic composition according to claim 5, wherein the diphtheria toxoid is present at a concentration of 25 Lf per 0.5 ml dose.

7. The immunogenic composition according to claim 1 or 2, wherein the tetanus toxoid is present at a concentration of 5 to 10 Lf per 0.5 ml dose.

8. The immunogenic composition according to claim 1 or 2, wherein the diphtheria toxoid and the tetanus toxoid are present in a diphtheria toxoid:tetanus toxoid ratio greater than 1 measured in Lf units.

9. The immunogenic composition according to claim 8, wherein the diphtheria toxoid and the tetanus toxoid are present in a diphtheria toxoid:tetanus toxoid ratio of 2:1 to 3:1 measured in Lf units.

10. The immunogenic composition according to claim 9, wherein the diphtheria toxoid and the tetanus toxoid are present in a diphtheria toxoid:tetanus toxoid ratio of 2.5:1 measured in Lf units.

11. The immunogenic composition according to claim 1 or 2, wherein the diphtheria toxoid and the tetanus toxoid are present in a tetanus toxoid:diphtheria toxoid ratio greater than 1 measured in Lf units.

12. The immunogenic composition according to claim 11, wherein the diphtheria toxoid and the tetanus toxoid are present in a tetanus toxoid:diphtheria toxoid ratio of 1.5:1 to 2.5:1 measured in Lf units.

13. The immunogenic composition according to claim 12, wherein the diphtheria toxoid and the tetanus toxoid are present in a tetanus toxoid:diphtheria toxoid ratio of 2:1 measured in Lf units.

14. The immunogenic composition according to claim 1 or 2, wherein the immunogenic composition contains an adjuvant.

15. The immunogenic composition according to claim 1 or 2, wherein the immunogenic composition contains an aluminum salt adjuvant.

16. The immunogenic composition according to claim 1 or 2, wherein the composition is an injectable liquid solution or suspension.

17. The immunogenic composition according to claim 1 or 2, wherein the composition is lyophilized.

18. The immunogenic composition according to claim 1 or 2, wherein the composition is preservative-free.

19. The immunogenic composition according to claim 1 or 2, wherein the composition is a vaccine.

20. The immunogenic composition according to claim 1 or 2, wherein the composition is for administration to humans.

21. Use of the immunogenic composition according to any one of the preceding claims in the manufacture of a medicament for generating an immune response against Corynebacterium diphtheriae, Clostridium tetani and Bordetella pertussis in a patient.

Images