Oligonucleotide-based modulation of pore-forming peptides to increase pore size, membrane affinity, stability, and antimicrobial activity

Abstract

Pore-forming peptides or proteins modified by DNA nanotechnology can determine and control the size of the pores, increase stability after insertion into the lipid membrane, and have membrane affinity. Compounds can be easily chemically modified by hybridization with oligonucleotides connected to peptides or proteins. The compound can be hybridized with a DNA template to determine the number of monomers assembled into the pore, thereby determining the size of the pore formed. The range of DNA templates can be a unique single strand composed of multiple hybridization sites separated by a flexible connector, or a complex rigid DNA nanoconstruct, such as a ring based on DNA origami, as a scaffold for pore formation. Hydrophilic modifications at the transmembrane segment or end of the peptide provide long-lived pores and keep the compound in a transmembrane conformation. The compound can be combined with various groups and hydrophilic modifications on the transmembrane end (inserted into the lipid membrane during pore formation), and there are many possible connection positions.

Description

Technical Field

[0001] The present invention relates to pore-forming peptides or proteins modified by DNA nanotechnology, which provide determination and control of pore size, increase stability when inserted into lipid membranes, and membrane affinity. Compounds can be easily chemically modified by hybridization with oligonucleotides connected to peptides or proteins. The compound can be hybridized with a DNA template to determine the number of monomers assembled into the pore, thereby determining the size of the pore formed. The range of DNA templates can be a unique single strand composed of hybridization sites separated by multiple flexible linkers, to a complex rigid DNA nanostructure, such as a ring based on DNA origami, as a scaffold for the formation of the pore. Hydrophilic modification of the transmembrane segment or end of the peptide provides a long-lived pore and keeps the compound in a membrane-spanning conformation. When this hydrophilic modification is combined with a molecule on the template on the transmembrane side (such as a DNA oligonucleotide or biotin for biotin / streptavidin interactions), the stability of the pore is further increased. This compound can be combined with a variety of groups and hydrophilic modifications on the transmembrane end (which inserts into the lipid membrane during pore formation), with many possible attachment locations. Templated pore-forming peptides or proteins can also be used for targeted cell killing. Since cytotoxicity is related to the size of the pore, forming larger pores through DNA templates can kill cells at lower concentrations of pore-forming molecules. Targeting molecules such as folic acid (for the folate receptor overexpressed on many cancer cells) can be attached to the formed pores to increase the targeting of the pores. Background Art

[0002] Resistive pulse sensing using nanopores allows the detection, characterization, and, in the case of DNA or RNA, sequencing of single molecules. Most of these experiments have utilized protein nanopores, such as aerolysin, Mycobacterium smegmatis porin A (MspA), cytolysin A (ClyA), the bacteriophage Phi29 DNA packaging motor, Fragaceatoxin (FraC), and especially α-hemolysin (αHL). While site-directed mutagenesis enables fine-tuning of the function of protein pores—for example, presenting amino acid side chains with desired functional groups at precisely defined positions within the nanopore lumen—the diameter of these protein pores can only be manipulated over a small range.

[0003] The advent of DNA nanotechnology has allowed the molecular arrangement of components to be freely designed and easily transformed into complex and well-defined structures. Several groups have demonstrated self-assembled DNA pores; these constructs typically carry hydrophobic groups, such as cholesterol, which insert into the hydrophobic bilayer membrane, forcing the hydrophilic DNA channel into the bilayer membrane. In a seminal study, Henning-Knechtel et al. demonstrated the templated assembly of monomers of the normally heptameric α-hemolysin protein by DNA nanotechnology to assemble 12, 20, or 26 monomers to form large pores. More recently, the Hagan Bayley group scaffolded monomers of the polysaccharide transporter Wza to obtain stable octameric pores in lipid bilayer membranes.

[0004] An engineered molecule designed to form a nanopore for resistive pulse sensing experiments will need to be long-lived: the monomers forming the nanopore need to remain in the transmembrane conformation for at least a few minutes to enable sufficient data to be collected for analysis.

[0005] Therefore, the problem to be solved by the present invention is to provide a nanopore that has a long life in the membrane and an adjustable diameter.

[0006] Compared to solid-state pores, protein and peptide pores are attractive for resistive pulse sensing because they can be directly produced in large quantities by biotechnology, are not easily clogged by analytes, and their size is well defined. Their main disadvantage for the analysis of large target molecules is the small available size range of the commonly used natural pore formers or ion channel proteins. The largest of these commonly used pores is ClyA, which has an internal pore diameter of 3.3-3.8 nm. Engineering of protein sequences has allowed the formation of slightly larger pores (4.2 nm) by forming 14-meric pores instead of the native 12-meric pores.

[0007] Using DNA nanostructures, it is possible to form synthetically designed biological nanopores with designable diameters ranging from 0.3 to 25 nanometers. DNA nanotechnology uses the well-defined geometry and sequence-specific programmability of nucleic acids to design and fabricate nanoscale objects. Current techniques, such as DNA origami, can produce rigid objects of almost arbitrary shapes up to 100 nanometers. Such constructs have also been designed to form artificial bilayer spanning nanopores. These previously proposed constructs consist of a hydrophilic channel formed by DNA and a few hydrophobic groups, usually cholesterol. These hydrophobic groups insert into the hydrophobic part of the lipid bilayer and force the hydrophilic channel formed by the DNA into a transmembrane configuration. Using these approaches, only a limited range of pore sizes can be achieved: in most cases, the inner diameter of the pore is about 2 nanometers. 1-5 The DNA construct itself is permeable to ions, resulting in a leaky flow through the construct. Fluctuations in the DNA duplex can lead to gating behavior.

[0008] Recently, two groups demonstrated that nucleic acid templates for proteins or peptides 6,7 . The first study by Henning-Knechtel et al. focused on the use of well-defined, circular DNA nanostructures to arrange precise numbers of α-hemolysin pore-forming protein monomers. DNA / α-HL hybrid nanopores composed of 12, 20, or 26 monomers were developed, which resulted in insertion into lipid bilayers instead of the usual heptameric α-HL nanopores. Another study by Spruijt et al. used DNA nanostructures as scaffolds to arrange peptides from the octameric polysaccharide transporter Wza. The study revealed that scaffolding of the peptides transformed the short-lived octameric channels (average 3.0 s at +150 mV) into stable pores that remained open for at least 1 h (between -100 and +100 mV). The size of the pore could not be increased beyond the native octameric pore, and templating of smaller assemblies did not result in improved lifetimes.

[0009] Henning-Knechtel et al. showed that the diameter of α-hemolysin nanopores can be tuned, however, the synthesis and modification of such large protein monomers is not easy and expensive. The invention proposed in this application takes advantage of the small size of the pore-forming peptides, which can be easily modified and synthesized on a large scale by peptide synthesis companies. To our knowledge, no one has yet achieved the following construction of peptide nanopores: it has a long life in the membrane and can also have an adjustable diameter at the same time.

[0010] WO2016 / 144973 relates to compositions and methods for conjugating pore-forming proteins (such as α-hemolysin) to biomolecules (such as antibodies, receptors and enzymes (such as DNA polymerase)) based on fast and efficient chemical reactions, and the use of such pore-forming protein conjugates in nanopore devices and methods. Summary of the invention

[0011] In view of the above, there is still a need in the art for an easily modifiable pore-forming peptide or protein that can be manufactured to have variable pore size, relatively high affinity to membranes, and long life or stability. Such tunable pores are also desirable for cell-killing applications, as many pore-forming peptides show antibacterial activity.

[0012] These needs and other needs are met and the problems in the prior art are solved by the hybrid pore-forming compounds described in the present application. Natural pore-forming compounds are provided by attaching nucleic acid oligonucleotides to one or both of the N-terminus and C-terminus of a peptide or protein.

[0013] In one embodiment, the compound includes a DNA oligonucleotide containing a binding region covalently linked to the N-terminus of a peptide, such as ceratotoxin A (CtxA). This combination allows for the attachment of chemical modifications directly to the compound by hybridization with the oligonucleotide. Attachment of membrane binding agents, such as cholesterol, via cholesterol-modified oligonucleotides provides higher membrane affinity and increased pore-forming activity. The DNA-peptide can hybridize to a single-stranded DNA template, limiting the number of monomers assembled into the pore - from 3 to more than 40 peptide monomers - and the size of the pore formed.

[0014] In another embodiment, the hybrid pore-forming compound is provided with a hydrophilic segment or tail, such as a DNA strand composed of a poly-thymine strand, which is bound to the C-terminus of the peptide. After the peptide is inserted from the cis side of the bilayer, the hydrophilic tail remains on the trans side of the membrane and keeps the peptide in a transmembrane conformation, resulting in a long-lived pore. For comparison, native CtxA pores show a lifetime of less than one second in experiments, while hybrid pore-forming compounds with a hydrophilic DNA tail remain stable for many minutes. Adding a template structure of the desired size on the trans side of the bilayer can hybridize with the hydrophilic DNA tail to produce a pore templated from both sides, which further improves the stability of the pore. Pores are usually optimized for rapid and easy insertion into membranes, so adding a charged and hydrophilic DNA oligonucleotide to the transmembrane segment of a peptide would be counter-intuitive because it would hinder insertion into a hydrophobic membrane. In fact, it does reduce the frequency of hole insertion, but leads to the more important feature as described above, namely longer-lived holes.

[0015] In another embodiment, pore-forming compounds are templated by complex rigid DNA nanostructures. In particular, DNA origami-based rings are disclosed as scaffolds for pore formation. While single-stranded templates with a large number of attachment sites are difficult to generate, the origami approach enables the direct addition of many attachment sites. The number of compound binding sites can be specifically selected to form pores with a desired diameter, particularly pores with large diameters. Other functional moieties, such as hydrophobic cholesterol, can be attached at desired locations on the origami structure. The formation of pores with large conductance is provided. The stability of the pores is significantly better than that of native peptide pores.

[0016] The adaptability of hybrid pore-forming compounds enables the incorporation of affinity groups and additional C-terminal hydrophilic modifications. Compared with strategies that employ one or a few template strands at geometrically well-defined positions, modular origami scaffolds offer more possible attachment sites for functional groups.

[0017] In another embodiment, the templated pore-forming compound kills cells at a lower concentration of the pore-forming molecule by forming a larger pore than the native pore-forming compound (theoretically, a large enough pore can be sufficient to kill one cell). Groups can be added at specific locations on the templated pore to target defined cells, such as pathogen cells or cancer cells.

[0018] The compound was directly synthesized by a peptide synthesis company, which linked a DNA oligonucleotide (ssDNA-CtxA) or contained an azide group (Azide-CtxA) at its N-terminus to a dibenzocyclooctane (DBCO)-containing oligonucleotide through click chemistry. CtxA with a hydrophilic tail was formed by ssDNA-CtxA modified with an azide group on its C-terminus (ssDNA-CtxA-Azide) or with Azide-CtxA having a thiol group on its C-terminus (Azide-CtxA-Thiol). ssDNA-CtxA-Azide and Azide-CtxA-Thiol were then reacted with excess 12T-DBCO or 12T-maleimide to form ssDNA-CtxA-12T.

[0019] Therefore, in one embodiment, a hybrid pore-forming compound is disclosed, which includes a pore-forming peptide or protein having a first end and a second end, wherein a first oligonucleotide is attached to the first end, the first oligonucleotide is derived from DNA, RNA, LNA, BNA or PNA, wherein a first functional group is attached to the second end, and wherein the first functional group is hydrophilic.

[0020] In another embodiment, the second functional group of the compound is linked to a second oligonucleotide, which is hybridized and linked to the first oligonucleotide bonded to the first end of the peptide, wherein the second oligonucleotide is derived from DNA, RNA, LNA, BNA or PNA, wherein the second functional group is a hydrophobic membrane binder, a receptor, a drug molecule, an antibody, an aptamer, a metabolite, or a fluorescent marker.

[0021] In another embodiment, a hydrophobic membrane binder is present and comprises a cholesterol group.

[0022] In another embodiment, the first functional group of the compound bonded to the second end of the peptide is a third oligonucleotide or a fluorophore, wherein the third oligonucleotide is derived from DNA, RNA, LNA, BNA or PNA.

[0023] In yet another embodiment, a template strand having a plurality, preferably 4, 6, 8 or 12, of complementary hybridization sites is hybridized to a portion of the first oligonucleotide attached to the first terminus.

[0024] In another embodiment, there are multiple pore-forming peptides or proteins, wherein each first oligonucleotide attached to a first terminus hybridizes to a template strand, thereby allowing the compound to form a larger pore.

[0025] In another embodiment, there are a plurality of pore-forming peptides or proteins, wherein each first oligonucleotide attached to a first terminus hybridizes to a template strand such that the compound has a tetrameric, hexameric, octameric, or dodecamer pore configuration.

[0026] In another embodiment, a pore forming peptide is present and the pore forming peptide is Ceratotoxin A (CtxA).

[0027] In another embodiment of the compound, the first functional group is a third oligonucleotide, and wherein the second membrane binding agent is attached to the third oligonucleotide to help stabilize the pore formed by the compound.

[0028] In another embodiment, the peptide or protein is functionalized differently at the first terminus than at the second terminus.

[0029] In another embodiment, a method for forming the hybrid pore-forming compound described in any of the above paragraphs is disclosed, comprising the following steps: obtaining i) a pore-forming peptide or protein, ii) a first oligonucleotide and iii) a first functional group; and forming the pore-forming compound by self-assembly of i), ii) and iii).

[0030] In another embodiment, the method further comprises reacting the template strand having multiple complementary hybridization sites with an excess pore-forming compound comprising i), ii), iii) in solution; and removing excess unreacted pore-forming compound, preferably by high pressure liquid chromatography.

[0031] In another embodiment, the method further comprises the step of hybridizing the first oligonucleotide to a second oligonucleotide, wherein the second oligonucleotide is present in excess compared to the first oligonucleotide.

[0032] In another embodiment, a membrane is disclosed, comprising a substrate and a compound according to any one of the above configurations, wherein the compound provides pores between a first side of the substrate and a second side of the substrate.

[0033] In another embodiment, a compound according to any of the above descriptions is provided, wherein an extended, preferably rigid, nucleic acid nanostructure is used as a template for assembling a plurality, preferably 20 or 40, pore formers into a pore, wherein the nucleic acid nanostructure preferably comprises a second functional group directly attached thereto, and wherein the nucleic acid nanostructure is preferably a DNA origami structure or a single-stranded tile assembly or an RNA origami structure.

[0034] It shall be understood that the present invention encompasses all possible combinations of the embodiments described in this application. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The present invention will be better understood and other features and advantages will become apparent by reading the detailed description of the present invention in conjunction with the accompanying drawings, in which:

[0036] Figure 1 Schematic diagram of DNA-assembled peptide pores with programmable pore size. (a) Schematic diagram of the assembly scheme mediated by DNA hybridization and the planar lipid bilayer setup used to record the pore-forming activity and single-channel conductance of the template-assembled versions of CtxA and CtxA-DNA. The pore-forming peptide CtxA carries a covalently linked single-stranded DNA with two domains at its N-terminus. The terminal domain binds to the template strand presenting 4, 6, 8, or 12 complementary hybridization sites. An additional DNA strand is bound to the compound, carrying a hydrophobic group to increase membrane affinity. An additional hydrophilic polythymine segment is bound to the C-terminus of the peptide, which keeps the peptide in a transmembrane conformation, resulting in a long-lived pore. Four thymine bases, acting as flexible linkers, separate the DNA segments. (be) Schemes, projections, and top views of possible specific arrangements of (b) tetrameric, (c) hexameric, (d) octameric, or (e) dodecameric pores, where the fully occupied template strand contains 4, 6, 8, or 12 binding sites for CtxA-DNA monomers.

[0037] Figure 2 The increased pore-forming activity of CtxA-DNA after the addition of cholesterol chains is shown. Experiments at 5 nM peptide concentration for (a) native CtxA, (b) ssDNA-CtxA, and (c) dsDNA-CtxA do not show frequent pore formation. (d) Pore formation is drastically increased for Chol-dsDNA-CtxA carrying cholesterol groups, which increases affinity for lipid membranes. The expanded view of the current recording in (d) (e) shows the typical stepwise current fluctuations of native CtxA.

[0038] All recordings were performed at an applied potential difference of +180 mV.

[0039] Figure 3 Shown is a record of conductance versus time for a typical pore-forming activity of native CtxA. The record shows clear, step-like increases and decreases in conductance associated with the uptake or release of peptide monomers from assembled pores. All recordings were made with an applied potential difference of +180 mV and in the presence of 20 nM peptide.

[0040] Figure 4Ill-defined conductance fluctuations caused by ssDNA-CtxA are shown. The top panel corresponds to a 5-minute continuous recording in the presence of 5 nM ssDNA-CtxA and shows little pore-forming activity, as expected due to the low concentration used. The other panels show different magnifications, showing noisy and unstable conductance levels instead of the usual well-defined conductance levels of native CtxA. All recordings were performed at an applied potential difference of +180 mV.

[0041] Figure 5 This is a scheme of a DNA-modified CtxA peptide pore. When the DNA portion of the peptide is single-stranded, the oligonucleotide can move freely in solution and potentially cover the pore or be pulled into it. But when the DNA is double-stranded, the increased rigidity prevents the DNA strand from covering the pore or being pulled into it.

[0042] Figure 6 It is shown that templated DNA-modified CtxA peptides lead to preferential pore sizes. Conductance traces are shown next to the corresponding histograms as a function of time. a) Typical CtxA conductance levels observed for Chol-dsDNA-CtxA. (b) In the presence of a 4-mer template, the conductance value of the 4-mer pore (O2) fluctuates rapidly. Using an 8-mer template (c) and a 12-mer template (d), the current steps directly to the conductance value of the 8-mer pore (O6), and in the case of the 12-mer, even larger fluctuations are observed. The colored boxes in the background of the conductance trace of each panel correspond to the conductance levels of 4-mer (O2), 8-mer (O6), and 12-mer (O10). These values ​​are calculated by taking the average conductance values ​​(for O2 and O6) from multiple experiments using native CtxA, and by extrapolating the values ​​of the open state of the native CtxA conductance to find an estimate of the 12-mer conductance. All recordings were performed in the presence of 5 nM (a, b, c) or 20 nM (d) CtxA-dsDNA-chol concentrations and applied potential differences of +180 mV (a and d), +160 mV (b) and +140 mV (c). The experiments in a, b and c were performed in 1 M NaCl, 10 mM HEPES in water, whereas the experiment in d was performed in 3 M CsCl, 10 mM HEPES in a 30 / 70 v / v glycerol / water mixture to increase the stability of the membrane. The conductance values ​​in the latter case have been scaled down to correspond to those obtained in 1 M NaCl in water, thus facilitating a valid comparison of the different experiments.

[0043] Figure 7The 60-second current trace of the experiment in which the template strand-4-mer was added to the solution containing Chol-dsDNA-CtxA. Figure 6 b. The recordings were made at an applied potential difference of +160 mV and a Chol-dsDNA-CtxA concentration of 5 nM. In inset 1, conventional Chol-dsDNA-CtxA can be observed, while Figure 2 shows a clear increase in conductance from baseline to the second open state, corresponding to the addition of the tetramer pore to the bilayer, with all four binding sites of the template strand-4-mer being occupied. Figure 3 An increased pore-forming activity was shown that did not correspond to the usual CtxA open-state conductance and could not be defined.

[0044] Figure 8 Figure 60 is a 60-second current trace of an experiment in which the template strand-8-mer was added to a solution containing Chol-dsDNA-CtxA. The enlarged dashed rectangle is shown in Figure 60. Figure 6 c. The recording was performed at an applied potential difference of +140 m and a Chol-dsDNA-CtxA concentration of 5 nM. Figure 1 and 2 In Figure 5, we can see a repetitive and clear increase in conductance from baseline to the sixth open state, corresponding to the addition of the octameric pore to the bilayer with all eight binding sites of the template strand-8-mer being occupied.

[0045] Fig. 9 Represents the current traces corresponding to experiments with incompletely occupied template strand-8-mer. (A) Templated pores consisting of four (dash-dotted lines) or five (dashed lines) monomers were directly inserted into a planar lipid bilayer. (B) Templated pores consisting of six (dash-dotted lines) monomers were directly inserted into a planar lipid bilayer. An increase in the current is observed, probably due to the addition of the seventh monomer to the template assembly, resulting in a larger pore (dashed lines). These two current traces correspond to experiments in which the template strand-8-mer was added to a solution containing 0.1 nM concentration of Chol-dsDNA-CtxA. The recordings were performed at an applied potential difference of +200 mV.

[0046] Fig.10The effect of the purification process on the hexameric assembly shown is shown. The conductivity traces versus time are shown next to the corresponding histograms. Conductance changes were observed for CtxA-dsDNA-chol in the presence of the 6-mer template: (a) without purification or (b) after purification. (a) Without purification, different conductance fluctuations are observed, resulting in smaller or larger pore structures. Inset: The zoomed-in view shows a direct increase in conductance to the open state O4, most likely accompanied by a monomer fluctuation in and out of the membrane. (b) After purification, the removal of the free monomers results in a major population of pores, whose sizes are close to the expected values ​​using the 6-mer template. Recordings were performed at CtxA-dsDNA-chol concentrations of (a) 1 nM and (b) 4 nM and an applied potential difference of +200 mV.

[0047] Fig.11 Shown in the presence of Chol-dsDNA-CtxA, the addition of 8-mer template leads to high pore formation. This representative current trace shows intermittent pore formation due to Chol-dsDNA-CtxA (added at a concentration of 0.1 nM), accompanied by an increase in conductance, reaching the saturation value of the amplifier (dashed line, >16 nA). The inset shows a zoomed-in view at the beginning of the trace, where the first three open states of Chol-dsDNA-CtxA can be observed. The recording was performed under an applied potential difference of +180 mV.

[0048] Fig.12 A DNA origami-based template ring is shown. (a) 3D model of a DNA nanostructure that templates 20 compounds. The DNA double helix is ​​depicted as cylinders. Double-stranded DNA links (large radial cylinders) connect the pore-forming peptides that make up the final pore (thin cylinder in the center of the ring). The block structure attached to the ring does not play any role in the pore formation process, but it is needed to avoid long single-stranded scaffold loops that could obstruct the pore. (b) TEM positive stain images of DNA origami rings.

[0049] Fig.13Figure 1 is a plot of the current versus time for a DNA origami templated CtxA pore. After the pore is inserted into the lipid membrane, the pore current initially fluctuates until it reaches a stable value of around 5 nA after about 15 minutes. Even after polarity reversal, the pore remains in the bilayer with the same conductance value. The pore is stable for more than an hour. Two zoomed-in traces show in detail the process of pore insertion into the membrane. The current increases at several discrete levels to a maximum of 15 nA. In this experiment, 20 DNA strands, each carrying 2 CtxA monomers, were attached to the DNA origami ring. A concentration of 20 pM of the origami construct was used in this experiment, corresponding to a peptide concentration of 0.8 nM.

[0050] Fig.14 Long-lived pores formed by DNA-double-modified CtxA peptides are shown. (a) Current-voltage relationship of a long-lived single channel formed by a DNA-double-modified CtxA monomer. The red curve represents a linear fit, resulting in a conductance G = 6.4nS. (b) An apparent single-step insertion of a single pore from a DNA-double-modified peptide at an applied potential of -180mV (I = -1512 ± 108pA). (c) The same pore as in (b) remains in the membrane after the voltage polarity is reversed from -20mV to +20mV. (d) A 5-minute current trace shows the presence of a pore formed by a DNA-double-modified CtxA monomer (+20mV), with a measured current of I = 124 ± 7.55pA.

[0051] Figures 15A-15G The chemical structures of the different compounds used are shown. Fig.15A is commercially synthesized ssDNA-CtxA; Fig. 15B ssDNA-CtxA is obtained after an overnight click chemistry reaction between azide-CtxA and DBCO-ssDNA; Fig. 15C ssDNA-CtxA-12T was obtained by overnight click chemistry reaction between commercially synthesized ssDNA-CtxA-azide and 12T-DBCO oligonucleotide; Fig.15D ssDNA-CtxA-peg4-12T was obtained by overnight click chemistry reaction between commercially synthesized ssDNA-CtxA-azide and 12T-peg4-DBCO oligonucleotide; Fig.15E ssDNA-CtxA-12T was obtained after an overnight click chemistry reaction between azide-CtxA-Thiol and DBCO-ssDNA. The resulting ssDNA-DNA-CtxA-Thiol was then reacted with 12T-maleimide oligonucleotide via a thiol-maleimide reaction overnight; Fig.15FssDNA-CtxA for origami structure experiments was obtained by overnight click chemistry reaction between azide-CtxA and DBCO oligonucleotide; and Figure 15G The double-labeled ssDNA-CtxA used for origami structure experiments was obtained after an overnight click chemistry reaction between azide-CtxA and an oligonucleotide with two DBCO groups.

[0052] Fig.16 Schematic diagrams corresponding to different macromolecular constructs based on the disclosed compounds. Left: Templated Chol-ds-DNA-CtxA-T 12 The cholesterol chain increases the membrane affinity of the construct by inserting into the bilayer. In the transmembrane configuration, the hydrophilic poly-T segment prevents the peptide from flipping back to the membrane. (1) Templated Chol-ds-DNA-CtxA, (2) Templated Chol-ds-DNA-CtxA-T 12 , (3) CtxA-T 12 , (4) templated ss-DNA-CtxA, (5) templated ds-DNA-CtxA, (6) templated Chol-ds-DNA-CtxA-T from both sides 12 The strand that joins the trans-acting DNA segment to the template on the trans side (ie, the strand showing the 90 degree junction) may or may not contain a lipid anchor (such as cholesterol) to stabilize the assembly.

[0053] Fig.17 Schemes corresponding to proposed constructs based on the disclosed compounds. (a) The peptide is permanently locked in the transmembrane conformation by hybridizing a complementary sequence to a second oligonucleotide at the transmembrane terminus. The oligonucleotide to be hybridized can be functionalized with a membrane binding agent like cholesterol to localize the oligonucleotide on the membrane. (b) Receptor binding groups are used as affinity increasers to target the membrane of cells expressing that specific receptor. (d) Affinity groups can also be attached to templated strands or structures. We created an embodiment of this principle by attaching cholesterol groups to DNA origami templates. (d) Compounds containing multiple pore formers are covalently attached to a single DNA strand, allowing the creation of pores with a higher number of constituent peptides with the same number of DNA strands. We have disclosed this concept in a DNA-origami based embodiment, in which we used a compound consisting of two CtxA peptides attached to one DNA strand. (e) A compound that does not carry a linker region but only a template binding region. This simplified compound is used in the DNA origami based embodiment.

[0054] Fig.18Schematic diagram of another DNA-assembled peptide pore with a programmable pore size, templated from both sides of the membrane (i.e., from cis and from trans) to increase the stability of the pore. The design can be the same as used in the previous figure, or slightly different, with shorter oligonucleotides covalently linked to the peptide to force the DNA template to lay flat on the membrane in three dimensions, rather than extending above the pore. The flat orientation parallel to the plane of the membrane will circumvent possible temporary or permanent blockage of the hole entrance by the DNA strands from the template. If such blockage occurs, the probability of analyte translocate through the pore may be reduced. (a) Side view, (b) top view, and (c) front view of an octameric CtxA pore templated from both sides (similar dual-templating methods can be implemented to have different pore sizes, such as tetrameric pores, dodecameric pores, and larger). (d) Assembly diagram showing a DNA-peptide pore hybridized from both sides.

[0055] Fig.19 Current versus time recordings are shown, illustrating the pore-forming behavior of two different peptide-DNA structures. Panels (a) and (b) show the pore-forming behavior of a CtxA peptide modified with DNA at both ends (dsDNA-CtxA-T) in the presence of an 8-mer template only on the cis side. 12 ) with an applied potential of (a) +180 mV or (b) +50 mV. Although the recorded currents showed current fluctuations between the 7-mer and 8-mer levels at the high voltage used (+180 mV), lowering the voltage to +50 mV resulted in improved stability of the octameric pore at the expected current (i.e., conductance) level for an octameric pore (as shown in the shaded area). The electrolyte solution consisted of 1 M NaCl, 10 mM HEPES, pH 7.3. Panels (c) and (d) illustrate the improvement in the stability of this DNA-peptide pore when the 8-mer template is present on both sides of the membrane. Although the voltage applied (+100 mV) was higher than that in panel (b), the resulting pore showed significantly improved stability with almost no current fluctuations during the several hours of recording. The pore remained open for more than 4 hours. The electrolyte solution consisted of 150 mM NaCl, 10 mM HEPES, pH 7.3.

[0056] Fig. 20Shown are resistive pulses consistent with translocation events of macromolecules through DNA peptide pores templated from both sides. The macromolecular analytes consisted of a mixture of PEG 4000, PEG 1500, PEG 200 molecules and dextrane sulfate 8000 molecules and were added to the recording chamber to final concentrations of 461 μM, 922 μM, 69 μM and 31 μM, respectively. (a) The measured currents suggest the presence of an octameric pore contained in the lipid membrane. After the addition of the macromolecular analyte mixture, multiple current drops can be observed. The relatively unstable baseline may be due to the fact that the template on the trans side is not attached to the pore, resulting in an unstable pore, such as Fig.19 a. Fig.19 (b) Another explanation could be the frequent translocation of small PEG 200 molecules resulting in an apparently unstable baseline. The horizontal dashed line corresponds to a current of 0 pA. (b) The current values ​​suggest the presence of multiple pores in the bilayer simultaneously. After the last addition step, in the presence of the analyte mixture, a resistive pulse begins to appear, consistent with the translocation of a macromolecular analyte. This experiment was performed with the same analyte mixture as used in panel a).

[0057] Fig.21 The effect of DNA template on the cell killing activity of ssDNA-CtxA peptide on A549 cells is shown. The figure shows the change of A549 cell confluence over time as a function of the concentration of templated and non-templated CtxA peptides. For the native CtxA peptide, a concentration of 50 to 100 μM is necessary to reduce cell viability. In the case of DNA templated pores (tetramers, hexamers, octamers and dodecamers), a total concentration of CtxA of less than 2-5 μM is sufficient to completely stop the replication of the same cells, so the concentration is more than 20 times lower than that of the native CtxA peptide. DETAILED DESCRIPTION

[0058] The present invention encompasses hybrid pore-forming compounds comprising various functional groups, which allow, among other things, customization of pore size, stability and membrane affinity. The hybrid pore-forming compounds include peptides or proteins having covalently linked nucleic acid oligonucleotides at both ends. The method of making hybrid pore-forming compounds is straightforward. The hybrid pore-forming compounds of the present invention provide many advantages.

[0059] A particular advantage of the present invention is the straightforward attachment of chemical modifications. The compounds presented here do not require additional chemical synthesis and can be prepared from off-the-shelf ingredients.

[0060] In one embodiment, cholesterol is attached to the construct as a hydrophobic group to increase the affinity of the compound for the lipid bilayer of the membrane. At concentrations more than ten times lower than in the absence of cholesterol, pore formation was observed. This result was achieved without changing the peptide sequence, which is one way to increase the potency of antimicrobial peptides. However, the peptide sequence can also be modified if desired.

[0061] Other modifications can be accomplished by hybridizing to the DNA strand using non-limiting examples such as additional fluorescent labels, drug molecules, receptors, antibodies, aptamers, metabolites, etc. These modifications can be used for drug delivery as well as targeted cell killing.

[0062] Modification of polypeptides or proteins by covalent attachment of ligands to specific sites allows the creation of biosensors. Such sensors based on resistive pulse sensing allow the detection of specific target molecules. Due to the modularity of the invention, additional functionalizations are straightforward to add or exchange.

[0063] Another advantage provided by the hybrid pore-forming compounds is the increased lifetime of the pore from the peptides that form the short-lived channel. Resistive pulse sensing requires long-lived pores in order to be able to collect enough data for subsequent analysis. By providing hybrid compounds with long-lived pores, the efficiency of the molecules to kill pathogen cells or be used for drug delivery is increased.

[0064] As described in this application, single-stranded DNA on the membrane-inserted portion of the peptide successfully increases the time that the peptide is in the transmembrane conformation, from tens of milliseconds to seconds or even minutes.

[0065] Another important advantage of the compound is that customized pore sizes can be obtained by using DNA templates. The range of DNA templates can range from unique single strands consisting of multiple hybridization sites separated by flexible connectors to complex rigid DNA nanostructures, such as rings based on DNA origami, as scaffolds for pore formation. Rigid nanostructures used as templates, such as the origami rings shown, enable the formation of significantly enlarged peptide pores. Disclosed in the present application is a simple "one pot" template structure assembly with a large number of peptide monomer binding sites. Compared with flexible templates from double-stranded DNA, the disclosed relatively rigid templates lead to more stable peptide pores.

[0066] The compounds of the present invention provide specific advantages for resistive pulse sensing. For example, stable pores are provided, wherein the pores are generally stable for several minutes. Except for translocation events, if the current fluctuations are caused by changes in pore size, data analysis is impractical. Increased affinity makes the formation of single pores easy. DNA assemblies allow simple adjustment of pore size and allow large pore sizes. Larger pores facilitated by the compounds of the present invention can be used to analyze larger target molecules.

[0067] The compounds of the present invention also provide various advantages for targeted cell killing and drug delivery. The compound is a pore former with increased affinity and is active at low concentrations. Pathogen-specific binding groups, such as receptor binding groups, antibodies, aptamers, etc., allow for selected cells, such as pathogens or other target cells. In general, DNA assemblies allow for the combination of several different binding groups and stimulus response compounds with little effort. The compound is useful for applications such as delivery of macromolecules, such as siRNA, DNA, proteins, carbohydrates, etc., where a minimum pore size is required, which is larger than the analyte size. Larger pores can also kill cells more effectively because they disrupt the homeostasis of the cells.

[0068] The compounds of the present invention utilize the barrel-stave assembly mechanism of a pore-forming peptide (eg, CtxA), which is advantageous because various peptides such as CtxA are intrinsically capable of forming pores with a wide range of numbers of monomers and pore sizes.

[0069] When using peptides to create compounds with alpha-helical structures, such as CtxA, design flexibility exists in assembly and remodeling, such as adding functionality to stabilize the pore. Typically, for example in natural ion channel proteins, alpha-helical proteins are more flexible and have more functionality than pores made of beta sheets.

[0070] The compound utilizes peptides that can be modified at their termini, and depending on the peptide utilized, one or both of the C-terminus and N-terminus can be modified without impeding its ability to self-assemble into a well-defined pore. The modification of the C-terminus can be orthogonal in chemical reactivity to the modification on the N-terminus, meaning that the two ends can be modified and functionalized differently using selective chemical reactions.

[0071] In one embodiment, the C-terminal modification of the peptide includes a thiol group (-SH), and the compound binds to the membrane more readily than the native peptide (eg, CtxA) and fits into the pore, suggesting that binding can be facilitated and controlled.

[0072] On the trans side of the membrane, the side opposite to the cis side to which the compound is added, chemicals or reagents that physically interact or chemically react with the C-terminus of a peptide such as CtxA can add functionality and stabilize the pore.

[0073] Hybrid pore forming compounds utilize peptides that can be incorporated into lipid or polymer membranes by themselves. Binding to membranes is quite practical because no reconstitution into the membrane is required.

[0074] When using peptides such as CtxA, the pore can be formed on demand and closed on demand, taking advantage of voltage-dependent binding.

[0075] It has also been demonstrated here that templating increases the local concentration of pore-forming peptides and therefore also increases the probability of forming a pore. This effect biases the assembly towards large diameter pores. Designed compounds with spacer strands, template strands, and short flexible thymine regions between these segments enable self-assembly of the desired pore size, reducing steric issues. Alternatively, a neutral PEG linker can be inserted. This is no small task, as many templated alternative designs may have steric limitations, low yields of fully assembled bodies, and inactive pore assemblies, etc.

[0076] The open design of the compounds in the scaffold enables templating and assembling pores without increasing pore resistance.

[0077] The assembly of the pore can occur prior to the experiment combined with purification of the assembled pore, or the pore assembly can be performed in situ by stepwise addition of the various components and molecules used for assembly. This flexibility in the molecules used is advantageous to mitigate possible problems of limited solubility of individual components or the entire assembly. Sequential, in situ assembly from one or both sides of the membrane also makes it possible to assemble pores with complex functionality.

[0078] For example, a variety of pore-forming peptides are suitable for the present invention. Examples include, but are not limited to, ceratotoxin A, alamethicin, MelP5, melittin, magainin, cecropin, etc., or any synthetic evolutionary variants of these peptides. Preferably, pore-forming peptides that do not contain post-translational modifications or unnatural amino acids can be used because they are simple to synthesize and can be easily chemically modified to connect DNA oligonucleotides.

[0079] Oligonucleotides can be composed of nucleotide sequences, including but not limited to DNA, RNA, PNA, LNA, BNA and non-natural nucleic acids. N-terminal oligonucleotides without spacers can be used, although the templates should have different geometries to take into account steric hindrance. Such templates can present longer connectors between each hybridization site while presenting hydrophobic groups, receptors, etc. directly on the membrane surface. In another variation, multiple pore-forming peptides can be bound to one oligonucleotide, thereby enabling the number of monomers to be multiplied in one hole while keeping the template chain short.

[0080] The groups on the spacer chain can be anchoring moieties, such as diacyl chains, cholesterol, receptor binders, aptamers, antibodies, metabolites, etc. These groups can also be elements that enhance the detection of the construct, such as fluorescent dyes, proteins (or genes encoding them) or aptamers, metabolic nanoparticles, radioactive labels, quantum dots, etc.

[0081] The formation and disassembly of the pore can be triggered by chemical, mechanical, optical or other signals mediated by DNA hybridization (toehold-mediated strand displacement, photoswitchable bases, aptamers, etc.).

[0082] C-terminal groups can be added to obtain long-lived pores. These groups are hydrophilic or become hydrophilic once they reach the trans side of the membrane (e.g. due to pH changes). These groups can be oligonucleotide sequences (DNA, RNA, PNA, LNA, BNA and non-natural nucleic acids), amino acids or any other hydrophilic group (thiol, azide, biotin, etc.). Anchoring can also be achieved by templating the pore-forming peptide on the trans side of the membrane.

[0083] The membrane can be a lipid membrane (phospholipid membrane, archaea membrane, etc.), a synthetic membrane (block copolymer, etc.), and can be charged, uncharged or zwitterionic. The pore can also be used to form solid-state hybrid pores. Thus, the pore is inserted into an existing solid-state nanopore to change its properties.

[0084] Here, we describe a modular DNA assembly system based on the Ceratotoxin A (CtxA) peptide to increase membrane affinity, geometric arrangement of monomers and increase pore lifetime. Like alamethicin, the 36-amino acid peptide CtxA forms short barrel-plate-like pores whose diameter increases or decreases due to association or dissociation of peptide monomers. To this end, we covalently attached ssDNA to the N-terminus of the CtxA peptide, aiming for hybridization of complementary oligonucleotide sequences. Linking the peptide-DNA hybrid with DNA-coupled hydrophobic groups increased membrane affinity. By adding a templated DNA strand with a defined number of binding sites, we favored pore sizes for 4-, 6-, 8- or 12-mer assemblies. We demonstrate that the introduction of a hydrophilic DNA domain on the C-terminal side of CtxA, which is thought to be inserted into the lipid bilayer, results in a novel pore assembly with enhanced membrane affinity. 1 The modification converts the short-lived CtxA pore with a dynamically fluctuating diameter into a long-lasting pore with a defined diameter, which may be beneficial for sensing applications.

[0085] A feature of this construct is the absence of solid, ion-blocking structures, similar to the large αHL cap domain containing a vestibule. In contrast, our proposed assembly is a short membrane-spanning channel geometrically arranged as a loosely packed, open DNA structure, circumventing the additional contribution to resistance from a vestibule or tightly packed templated structure. Other significant advantages of this minimalist design of artificial ion channels are the use of solid-phase synthesis of all components, the potential for large-scale production, and the possibility to modify the sequence and number of amino acids of the peptide at any position, which provides great flexibility for high-throughput screening. DNA-assembled peptide pores can also be used for applications beyond sensing, such as drug delivery or targeted killing of pathogens.

[0086] Results and discussion

[0087] Assembly of CtxA-DNA hybrid construct. We designed a novel peptide-DNA hybrid based on the 36-amino acid peptide CtxA. A 55-base-long ssDNA oligonucleotide was linked at its 5′ end to the N-terminal side of the peptide, as Figure 1As shown. Its sequence consists of two parts: a spacer and a template binding domain. A flexible linker consisting of 4 thymine (T) bases connects all domains of the construct. The spacer chain hybridizes to the 25-nucleotide-long spacer to form a rigid doublet. In order to increase its affinity for lipid membranes, the spacer chain is modified with a cholesterol group at its 3' end, henceforth referred to as a cholesterol chain. The template binding region consisting of 18 nucleobases allows the peptide-DNA hybrid to bind to single-stranded DNA templates with 4, 6, 8 or 12 hybridization sites, separated by a linker of 4 thymine bases.

[0088] To obtain a more rigid and defined DNA template, we constructed a toroidal origami structure with a diameter of 33.4 nm (20.6 nm inner diameter). The ring was formed by bending a DNA helix into a circle. A block structure of 82 × 15 × 11 nm was attached to the ring. The block did not serve for the assembly of the pore, but used up the remaining scaffold to avoid the influence of the large single-stranded DNA loop close to the pore. Twenty staples distributed on the bottom side of the ring carried extensions ready to hybridize with a DNA conjugate peptide with a 20-nucleotide long complementary linker sequence (instead of the 55-base long sequence of other designs). Since the 20-meric peptide will form a much smaller pore of about 8.7 nm in diameter, a linker is necessary. Therefore, the peptide-DNA conjugate was hybridized to the structure in the distal conformation, where the linker DNA doublet served as a 6.1 nm linker between the origami structure and the peptide. Two additional thymine bases were inserted on both sides of this double-stranded linker to serve as a flexible linker. To further avoid steric and electrostatic repulsions of the double-stranded DNA linker that could hinder peptide pore assembly, we attached the peptide to the oligonucleotide linker via an uncharged PEG linker. Alternatively, chains carrying two reactive DBCO groups attached via a PEG linker were used to form peptide pores up to 40-meric.

[0089] Similar to the previously described designs, additional functional groups can be easily attached via the staple extensions. We added eight more extensions with orthogonal linker sequences at the base of the ring, which can carry cholesterol groups to increase the membrane affinity of the origami structure.

[0090] We used the CtxA peptide for this study because pores assembled from small peptides have attractive features, such as the formation of barrel-shaped pores with well-defined conductance levels and the formation of channels with pore lengths of ≤5 nm, which may improve the resolution of sensing applications. Its low molecular weight allows for large-scale synthesis of peptides, as well as chemical functionalization of peptides. In addition, because the peptide is positively charged, it tends to bind more strongly to the negatively charged outer membranes of many pathogens than to mammalian cells. This feature makes CtxA-based pore assemblies attractive for targeted cell killing applications.

[0091] Figure 1 be illustrates the loose and open molecular design of our designed DNA-assembled peptide pore. Ions can flow between the strands of the DNA-based scaffold, with the advantage that the scaffold does not significantly increase the access resistance of the transmembrane segment of the pore. This design concentrates the voltage drop to the transmembrane peptide portion of the pore, making it sensitive to conductance changes and thus improving the signal-to-noise ratio for applications such as resistive pulse sensing.

[0092] Hydrophobic functionalization to increase pore-forming activity. We introduced cholesterol groups to increase the affinity of DNA-assembled peptide pores for membranes. Figure 2 The activity of different DNA-assembled peptide pores was compared to pores from native CtxA peptide, using the same 5 nM total peptide concentration in single-channel recordings from planar lipid bilayer experiments. Typically, native CtxA, CtxA-DNA without any attached strands (ssDNA-CtxA), and CtxA-DNA with a spacer strand (dsDNA-CtxA) showed little or no pore formation at these low peptide concentrations ( Figure 2 ac). In contrast, CtxA-DNA hybridized to cholesterol chains (Chol-dsDNA-CtxA) exhibited frequent pore formation events ( Figure 2 d). Amplification of current recordings of this molecule revealed a well-defined conductance gradient, similar to that observed for native CtxA at concentrations exceeding 10 nM ( Figure 3 ).

[0093] These results suggest that the N-terminal dsDNA modification of the CtxA peptide does not inhibit its insertion into the membrane, but rather facilitates its insertion when this modification exposes hydrophobic groups. Furthermore, the conductance behavior of the resulting pores is also very similar to that from native CtxA, with its value increasing nonlinearly with the size of the pore. In addition to this nonlinear increase in conductance, the amplification of the current trace induced by Chol-dsDNA-CtxA, as shown in Figure 2 Figure 2 e also shows a step-like increase in isoconductance values, indicating the simultaneous presence of multiple pores of the same size in the transmembrane conformation.

[0094] While native CtxA required a minimum concentration of 10-20 nM to show significant pore formation, for Chol-dsDNA-CtxA, concentrations as low as 1 nM were sufficient to observe frequent pore formation events.

[0095] Interestingly, control experiments using ssDNA-CtxA spiked at concentrations exceeding 10 nM produced ambiguous conductance fluctuations rather than the usual well-defined behavior of native CtxA ( Figure 4). The N-terminal overhanging ssDNA may cover the pore or enter its lumen, resulting in variable conductance levels. Addition of complementary cholesterol chains restored Figure 2 d. Figure 2 The clear step-like conductance behavior shown in e is probably because the increased stiffness of the dsDNA strand generated at the N-terminal entrance of the pore reduces the probability of it covering or entering the pore ( Figure 5 ).

[0096] Table 1: Comparison of open state conductance values ​​of native CtxA and Chol-dsDNA-CtxA, measured at an applied potential difference of +180 mV.

[0097]

[0098] a The conductance values ​​for O8 to O10 were inferred from a fitting function of the experimental data for the first seven open states, which assumed a geometric arrangement of monomers, a peptide diameter of 1.2 nm, and a pore length of 2.7–4 nm.

[0099] b The diameter was estimated from the measured and extrapolated conductance G of Chol-dsDNA-CtxA. The error was calculated as the standard deviation of the mean. The equation we used is that of Cruickshank et al., Biophysical Journal 73, 1925-1931 (1997) and takes into account two access resistances (one into the pore and one out of the pore) and the channel resistance:

[0100]

[0101] The channel length (l) is between 2.7 nm, the shortest channel length based on the amino acid sequence of the transmembrane segment of the peptide, and 4 nm, assuming that the transmembrane channel spans the entire bilayer, and the buffer resistivity (ρ) is 0.1130 Ωm (derived from the measured conductivity σ = 8.85 Sm -1 Experiments with templated 12-mers were performed in 3M CsCl, 10 mM HEPES in 30% (v / v) glycerol in water to increase the stability of the lipid membrane (measured conductivity σ = 13.99 Sm -1 ).

[0102] Table 1 shows that the conductance values ​​of the first six open states (O1 to O6) of native CtxA and Chol-dsDNA-CtxA were not significantly different (paired-sample t-test, p = 0.36). This result means that adding dsDNA to the N-terminus of CtxA does not significantly change the diameter of the pore formed.

[0103] Traditionally, pore-forming peptides are engineered by modifying the amino acid sequence of the peptide to increase its pore-forming activity at low concentrations. 3-5 We show here that the addition of a DNA strand with a hydrophobic cholesterol group achieves the same effect without requiring sequence changes that would affect peptide function.

[0104] Pores of defined size are formed by DNA templating.

[0105] To further explore the binding potential of the binding DNA strand and the pore-forming peptide, we introduced a DNA template strand consisting of a repeating sequence that is complementary to the template binding region sequence of CtxA-DNA. Our goal is to form a pore consisting of a defined and constant number of monomers, which is compared to the number of hybridization sites on the template. To demonstrate feasibility, we show the effect of template strands containing 4, 6, 8, or 12 CtxA-DNA hybridization sites ("4-mer template", "6-mer template", "8-mer template", and "12-mer template"). As shown in Table 1, based on the measured O2, O4, and O6 conductance values ​​of Chol-dsDNA-CtxA and the extrapolation of these measured values ​​to find the estimated O10 conductance value, such tetramer, hexamer, octamer, and dodecamer assemblies lead to pores with diameters of 0.5±0.3nm, 1.4±0.4nm, 2.3±0.5nm, and 3.9±0.5nm.

[0106] Figure 6 a shows a current trace across a planar lipid bilayer recorded in the presence of 5 nM Chol-dsDNA-CtxA at a constant +180 mV applied potential difference before addition of the template strand, with discrete and recurring step sizes that dynamically change the conductance level and correlate with pore formation. 6 The results are consistent with the barrel plate model and are represented by distinct peaks in the corresponding histograms. A dramatic change in the relative frequency of conductance levels was observed upon addition of the 4-mer template. Figure 6 b shows a distribution of conductance that is strongly biased toward the 4-mer, as expected. At the temporal resolution of our recordings (~20 μs), we observed single-step conductance changes of 330 ± 26 pS, reaching levels corresponding to those expected for a tetrameric pore ( Figure 6 b and Figure 7 ). The O2 level is interrupted only by very brief conductance drops. We hypothesize that when a monomer changes from a transmembrane to a membrane-laying conformation, it cannot escape the assembly due to its high local concentration and rapidly inserts back into the lipid membrane. The conductance rarely increases above the level of the tetrameric pore, further suggesting that the pore is linked together by four monomers, as free monomers lead to dynamic fluctuations in conductance levels, such as Figure 6 As shown in a.

[0107] However, dynamic fluctuations in pore diameter still occur ( Figure 7 , Panel 1), the conductivity increases from baseline to O1, O2, and O3. We attribute these results to the presence of free Chol-dsDNA-CtxA hybrids that interact with themselves to form trimers or with the templated CtxA-DNA assembly to form off-target pores.

[0108] Further increasing the length of the template to eight or twelve hybridization sites allowed for the formation of larger pores. Figure 6 A two-second recording of such an octameric assembly is shown in c ( Figure 8 The full 60-second current tracking Figure 6 A two-second recording of a dodecameric assembly is shown in d. When using an 8-mer template, we can resolve several discrete transitions to a conductance value of 8470 ± 700 pS, corresponding to a large pore structure inserted into the bilayer. Despite the low concentration (5 nM) of the DNA-assembled peptide, however, we also observed conductance changes for smaller pores (average conductance value: 1460 ± 270 pS), resulting in a non-stationary current baseline, leading to discrete conductance steps with a difference of 7010 ± 700 pS. This value is consistent with a pore consisting of 8 monomers that migrate in and out of the bilayer. The histogram of the full 60-second current trace shows this dominant population corresponding to the 8-mer (O6), as expected using the template strand - 8-mer. Using a template with 12 hybridization sites, we observed larger transitions in conductance values, reaching conductance values ​​closest to the 11-mer and 12-mer based on the values ​​in Table 1.

[0109] Although we are Figure 6The current traces shown in show the formation of a pore of the expected size, but this result was not obtained in every attempt and we often observed fluctuations in the conductance values, which could be attributed to smaller or larger CtxA open states. We attribute the smaller pore to structures where the template strand is not fully occupied by the peptide-DNA hybrid. Alternatively, a fully occupied template strand but with one or more monomers not adopting a transmembrane conformation would also result in a smaller than expected pore. Fig. 9 In , we show two examples when we use an 8-mer template that is directly inserted into a bilayer pore consisting of 4, 5, and 6 monomers. The occasional observed increase in conductance from a predominantly open state to a higher state may correspond to the incorporation of free peptide-DNA monomers into the templated pore. Fig. 9 The current trace shown in b reflects this possibility. Peptide monomers from different template strands, whether fully occupied or not, can also aggregate to form larger structures. For example, two template pores can combine to form a larger pore. Using a large excess of DNA-modified monomers compared to the template strands and removing unbound monomers by purification can potentially reduce the possibility of free peptide-DNA monomers incorporating into the templated pore.

[0110] We are Fig.10 Two representative experiments are compared in which the pore-forming activity of the assembly before and after purification was demonstrated following addition of Chol-dsDNA-CtxA in the presence of a 6-mer template. Fig.10 The current tracking shown in a is in Figure 6 Same experimental conditions as those recorded without purification. Fig.10 As shown in the panel of a, the initial current transition appears to be associated with pentamer activity, followed by conductance fluctuations between the O3 (5-mer) and O4 (6-mer) open states. Since the first increase in conductance is from baseline to the O4 conductance value, we attribute these events to a fully templated 6-mer template with a single monomer fluctuating in and out of the bilayer. The conductance value later increases by ΔG = 1 ± 0.1 nS—possibly due to the formation of a single pore—but fluctuations between the 5-mer and 6-mer continue to occur, as depicted by the dashed line. Fig.10 b shows a 1 s portion of the current trace of the same construct, but after purification of the fully assembled 6-mer template. We now observe a major conductance state with values ​​intermediate between those of the pentamer and hexamer. While we also observe tetrameric activity, the purified template assembly circumvents the possibility of free monomer incorporation into the construct, leading to a more defined structure. The smaller assemblies observed here are likely caused by monomers that have not adopted a transmembrane conformation.

[0111] In addition to biasing the size of the pores formed toward the desired size, the presence of the template strand also resulted in increased pore formation at lower concentrations than in the absence of the template. In nearly 50% of the experiments, the addition of the 8-mer template resulted in the incorporation of many parallel pores, sometimes exceeding the current limit of the amplifier (approximately 16 nA). Fig.11 An example is presented in which the presence of an 8-mer template increases the pore-forming activity in a solution containing Chol-dsDNA-CtxA (0.1 nM). At the beginning of this current trace, we observe regular Chol-dsDNA-CtxA conductance states with various levels, followed by a rapid increase in conductance beyond the amplifier limit, while the bilayer remains intact. In the absence of template chains, we observe little similar extensive pore-forming activity, even at peptide concentrations that are 200-fold higher (20 nM). This high activity clearly indicates that the template and cholesterol chains have a strong enhancing effect on pore formation, especially considering the low peptide-DNA concentration (0.1 nM) used in these experiments.

[0112] Pores of defined size are formed by DNA templating.

[0113] For the assembly of size-tunable pores for resistive pulse sensing, discrete and well-defined DNA objects are required. By employing several partially complementary strands, flexible structures of only limited complexity can be formed, as shown in Henning-Knechtel et al. 7 and Spruijt et al. 6 In contrast, DNA origami technology allows the assembly of large, relatively rigid and geometrically well-defined templates with desired shapes and atomic precision. The readily available tools for simple design, production and purification facilitate the development of these macromolecular constructs. Made up of a scaffold chain of about 8000 bases and about 200 spikes, the origami structure can provide a large number of attachment sites for pore formers and other functional groups, for example through affinity groups, thereby enhancing binding to membranes or groups to capture target analytes for enhanced detection. Similar extended nucleic acid structures can also be used using other methods, such as single-stranded tiling assembly or RNA origami. 8,9 get. Fig.12 Shown are the 3D diagram and TEM image of this DNA origami-templated CtxA pore. Fig.13Current tracking of compounds across a planar lipid bilayer is shown. The pore is formed by an origami ring carrying 20 DNA binding sites. Each attached DNA oligonucleotide carries two CtxA monomers connected by a PEG linker, resulting in a maximum of 40 templated CtxA peptides. The pore insertion occurs at several discrete levels, which may be due to the presence of different numbers of peptide monomers in the transmembrane conformation. The first level, with a current of 0.45±0.25nA, corresponds to the insertion of 5-8 CtxA monomers, followed quickly (about 10ms later) by a second level with a current of 3.6±0.8nA. This level, corresponding to about 16 CtxA assembling monomers to form a pore, is interrupted by a smaller current (1.3±0.4nA) level, which we interpret as a few monomers flipping out of the pore, resulting in a small pore consisting of about 13 monomers. The current keeps rising, reaching a maximum of 13.8±0.6nA corresponding to about 30 monomers after 15 seconds. After 15 seconds, the pore current began to decrease and eventually stabilized at a current value of 5.4 ± 0.1 nA corresponding to about 19 peptide monomers in the pore. The pore was then stable for more than an hour, and the voltage could be reduced to 80 mV and even reversed to -100 mV without losing the insertion state of the pore in the membrane. In this experiment, we did not use cholesterol anchors to increase the affinity of the constructs because they are already active at very low concentrations. In other experiments, we observed the formation of long-lived large pores from single-labeled DNA-CtxA conjugates with or without the use of cholesterol anchors.

[0114] We inferred the number of monomers in the pore from the conductance values ​​of the first six open states of native CtxA by fitting a polynomial to the experimental data.

[0115] A hydrophilic modification of the C-terminus of CtxA results in a long-lived open state.

[0116] Applications such as sensing require long-lived, stable pores in lipid or polymer membranes. To design CtxA-DNA hybrids that form longer-lasting pores, we added an additional hydrophilic segment consisting of 12 thymine bases to the C-terminal portion of the peptide, creating a CtxA covalently linked to DNA strands at both ends. We hypothesized that this segment might trap CtxA in a transmembrane conformation once the C-terminal segment spans the membrane. This transmembrane DNA sequence allows hybridization of a complementary 12 adenine base oligonucleotide that was added on the trans side of the membrane. After hybridization, this double-stranded segment is less likely to flip back to the cis side of the membrane and may further stabilize the pore. Modification of this 12 adenine base oligonucleotide with cholesterol groups anchors the polyA sequence to the bilayer, thereby increasing the probability that the C-terminal portion of the peptide will hybridize to the 12 thymine bases.

[0117] Fig.14a shows the current-voltage curve of a single channel inserted into the membrane, which behaves relatively linearly. This behavior is unusual for voltage-gated peptides like CtxA, for which pore formation typically occurs only above a threshold voltage. This result supports the hypothesis that the peptide is 12 The hydrophilic C-terminal modification stabilizes it in the transmembrane conformation. Fig.14 bd shows the insertion of a pore formed by a DNA-double-modified CtxA monomer into a lipid membrane (b) and its presence in the bilayer at voltages as low as -20 mV. We speculate that the hydrophilic T 12 The tail prevents the peptide from returning to a conformation that is peripherally associated with the membrane like native CtxA. Fig.14 As shown in cd, the nanopore remained open further within the lipid membrane after polarity reversal and remained open for at least 20 min without changing its conductance value (d). In contrast, native CtxA pores or DNA-assembled CtxA pores without the C-terminal T 12 The modifications typically result in pore lifetimes in the range of hundreds of milliseconds, about three orders of magnitude shorter.

[0118] In order to explore the C-terminal T 12 To programmatically assemble modified CtxA peptides into long-lived pores of desired sizes, we repeated the 8-mer template ( Fig.19 a,b). Although the recorded currents showed current fluctuations between 7-mer and 8-mer levels at the high voltage used (+180 mV, Fig.19 a), lowering the voltage to +50mV results in improved stability of the octagonal hole ( Fig.19 b). We obtained this persistent octamer in 30% of experiments involving 8-mer templates (N>10); in the remainder, we observed persistent pores consisting of fewer monomers than expected. Occasionally, we also observed brief, transient conductance fluctuations, which we again attributed to one or a few peptide monomers leaving and joining the assembly.

[0119] Overall, these results support the hypothesis that 12 The hydrophilic C-terminal modification of stabilizes the peptide in the transmembrane conformation. The addition of the template chain additionally allows the determination of the size of the pore. Modification of the transmembrane portion of the CtxA peptide thus provides a strategy to prolong the open state of the pore-forming peptide, which otherwise dynamically fluctuates between different conductance levels.

[0120] Using T present on the trans side of the membrane 12 To the tail, we designed another oligonucleotide sequence with two hybridization regions, one that binds to the template and the other that binds to the T of CtxA. 12We first prepared and purified constructs consisting of an 8-mer template and eight of these new oligonucleotide sequences (see Fig.18 d, bottom part), which is called the trans-template structure. 12 After the pore is formed, the trans-template structure passes through its T 12 The tail was hybridized with CtxA peptide ( Fig.18 d), and leads to an improvement in pore stability ( Fig.19 c, d). Fig.19 The pores shown in the examples in c, d remained open in the membrane for more than 4 hours.

[0121] By modifying the transmembrane portion of the CtxA peptide, we provide a route to form long-lived pores from pore-forming peptides, which otherwise result in dynamic fluctuations between different conductance levels.

[0122] After obtaining long-lived stable pores, we added a mixture of analytes (PEG 4000, PEG 1500, PEG 200, and Dextrane Sulfate 8000, with final concentrations of 461 μM, 922 μM, 69 μM, and 31 μM, respectively) to the compartments on both sides of the membrane. Fig. 20 Shown in FIG. 1 are current traces from two different experiments after adding analytes to an octameric pore formed by a CtxA peptide modified with DNA at both ends. Fig. 20 a shows multiple current drops from the baseline corresponding to an open octameric pore. Fig. 20 b also shows several current drops that may correspond to molecular translocation. The current first increases in multiple steps, which we attribute to the insertion of multiple holes in the membrane. However, potential translocation only begins to appear after the last current step, suggesting that the analyte can only pass through this hole. Another hypothesis is that the hole grows in steps, and translocation occurs when the hole is large enough to allow the molecule to pass through it.

[0123] Assembling CtxA pores with 4-mer, 6-mer, 8-mer, or 12-mer templates blocked cancer cell replication at lower concentrations than native CtxA.

[0124] DNA templated CtxA pores can be used to enhance the toxicity of the pores in applications of targeted cell killing. In biology, the antimicrobial peptide CtxA is produced by the Mediterranean fruit fly (Ceratitis capitata) to protect its eggs. 10 Since the cytotoxicity of pore-forming antimicrobial peptides is related to the pore size and peptide concentration 11 We speculate that templated CtxA will kill pathogens or cancer cells at lower concentrations than native CtxA because it is more potent than non-templated CtxA.11 , templating leads to high local concentration and larger pores.

[0125] To investigate the cytotoxic activity of the templated DNA peptides, we monitored the growth of the epithelial lung cancer cell line A549 after addition of 4-mer, 6-mer, 8-mer, or 12-mer templated CtxA peptides and compared this to the addition of native CtxA as a control. As a measure of cell viability, we determined the change in confluence over time for each peptide concentration. Fig.21 It was shown that 50 to 100 μM of native CtxA was necessary to reduce cell viability. In the case of the DNA-templated pores of CtxA, a total CtxA concentration of less than 5 μM was sufficient to completely stop replication of the same cells. Similar toxicity required 100 μM of native CtxA, thus a concentration more than 20-fold higher than that of the templated CtxA peptide.

[0126] in conclusion

[0127] A modular assembly platform based on the 36-amino acid pore-forming peptide CtxA is disclosed using DNA nanotechnology. Covalent attachment of the peptide to a single-stranded DNA oligonucleotide also allows for simple functionalization of the peptide-DNA hybrid with a cholesterol-containing DNA strand, greatly improving the peptide's affinity for membranes and its propensity to form a well-defined conductance state. Employing a DNA template strand with a defined number of binding sites for the DNA-modified peptide monomers preferentially results in pores of predetermined sizes. We demonstrate tetrameric, hexameric, octameric, and dodecamer assemblies with estimated inner diameters ranging from approximately 0.5 nm to 3.9 nm based on conductance values. While these templated assemblies still form short-lived pores like native CtxA, the addition of a hydrophilic DNA domain on the transmembrane side of the CtxA peptide traps the peptide monomer in a transmembrane conformation. This modification results in the formation of long-lived pores that persist for up to 30 minutes at a stable and constant conductance level. Alternatively, the rigid DNA origami structure allows for the templating of more monomers (up to 40 in this proposed attempt), resulting in larger pores. These origami pores were also stable longer than native CtxA, with pores persisting for more than 80 minutes.

[0128] DNA-mediated pore-forming peptide assemblies offer several distinct advantages over conventional pores for nanopore sensing: (i) subnanometer fine-tuning of pore size in single monomer increments by using a template structure; (ii) the presence of a loose and open DNA-based framework without the additional drag caused by a vestibule; (iii) sequence-specific orthogonal hybridization chemistry to target defined locations in the structure; (iv) straightforward design, available in three different varieties; (v) the potential to open new avenues for the addition of specific functionalities, such as receptors, antibodies, or aptamers; and (vi) the potential to kill cancer cells at more than 20-fold lower total peptide concentrations compared to non-templated CtxA peptides. This result in principle makes it possible to exploit the addition of DNA templates to trigger pore formation in situ using low DNA-CtxA peptide concentrations that would be too low to be useful for killing prior to template addition. Future extensions of this work could potentially target specific cell types by hybridizing ssDNA-tagged ligands, antibodies, or aptamers to the constructs. 12 , pathogens or analytes.

[0129] In summary, DNA engineering of the CtxA monomer using a straight-line design makes it possible to form persistent, well-defined pores with constant single-channel conductance, which can be potentially used in sensing, drug delivery, and pathogen cell killing applications.

[0130] method

[0131] DNA modified peptide preparation

[0132] These compounds are synthesized commercially from CtxA (ssDNA-CtxA) derivatives with DNA oligonucleotides or reacted in-house. Thus, CtxA (Azide-CtxA) containing an azide group on its N-terminus is reacted overnight by click chemistry to become a dibenzocyclooctyne (DBCO)-containing oligonucleotide of the desired sequence. CtxA with a hydrophilic tail is formed from ssDNA-CtxA (ssDNA-CtxA-Azide) modified with an azide group on its C-terminus, or Azide-CtxA (Azide-CtxA-Thiol) with a thiol group on its C-terminus. ssDNA-CtxA-Azide and Azide-CtxA-Thiol are then reacted with excess 12T-DBCO or 12T-maleimide to form ssDNA-CtxA-12T. The excess, unreacted species were then removed by high pressure liquid chromatography (HPLC), and the ssDNA-CtxA-12T monomers were added in large excess to the solution containing the template strand, the complete assembly was collected by HPLC, and the excess ssDNA-CtxA-12T monomers were removed. We confirmed successful conjugations by HPLC peptide mapping, SEC or SAX. The chemicals were dissolved in pure water or TE buffer. Figure 15 shows the chemical structures of the linkers used for the different compounds we used.

[0133] Lipid preparation / planar lipid bilayer membrane formation

[0134] The lipid composition of the bilayer membranes consisted of POPC, DOPE, and POPS in a ratio (PC / PE / PS) of 7:3:1 (weight / weight (w / w)), or diphytanoyl phosphatidylcholine (DiPhyPC) for origami structures. We dissolved the resulting lipid mixture in pentane (total lipid concentration: 10 mg / mL). The buffered electrolyte solution consisted of 1 M NaCl, 10 mM HEPES, pH 7.4 or 3 M CsCl, 10 mM HEPES, pH 7.4 in 30% glycerol.

[0135] We designed a Teflon chamber with a large compartment (containing a maximum volume of 1.5 mL) and a small compartment (containing a maximum volume of 200 μL). We pretreated a Teflon membrane with 50-μm pores (Eastern Scientific LLC, Rockville, MD) by pipetting 1 μL of a pretreatment solution - 2.5% (v / v) hexadecane in n-hexane - onto both sides of the pores of the Teflon membrane. Then, using high-vacuum grease (Dow Corning Corporation), we mounted the Teflon membrane in the Teflon chamber, separating the two compartments of the Teflon chamber. The only connection between the compartments was the pores in the Teflon membrane, on which we formed a substantially solvent-free planar lipid bilayer membrane using the technique described by Montal and Mueller 10 Briefly, we added electrolyte solution to both compartments (1.2 mL in the large compartment and 160 μL in the small compartment) and spread 1 - 2 μL of lipid solution onto the surface of the buffered electrolyte solution. After the solvent evaporated, a lipid monolayer membrane (Langmuir membrane) was formed at the air-water interface. We raised and lowered the electrolyte solution until the baseline current we measured (-3 pA < I < 3 pA) indicated that the bilayer membrane had formed. Then, we thinned the membrane by raising and lowering the electrolyte solution in one compartment until the capacitance we measured was 60 ± 10 pF. To monitor the capacitance, we applied a triangular voltage, and the capacitance was calculated by the amplifier or visually determined using the manual capacitance compensation of the amplifier. Before adding the peptide, we checked the stability of the bilayer membrane (no leakage current, expected noise level) by applying a transmembrane voltage of up to 200 mV for 5 minutes across both polarities. We used one of two different amplifiers, the EPC7 (HEKA Instruments Inc., Holliston, MA, USA) or the BC-535 (Warner Instruments, Hamden, CT, USA), and connected the two compartments to the amplifier through two Ag / AgCl plate electrodes (Warner Instruments, Hamden, CT, USA). We placed the Teflon chamber inside Faraday cages, the BM4 vibration isolation platform (Minus Technologies, Inglewood, CA, USA (Minus We performed all experiments at room temperature (22 ± 1 °C) and tested all setups with different model units to confirm the proper functionality of the amplifier and function generator. We sampled the currents at 50 kHz and low-pass at 10 kHz. We analyzed the data using OriginLab (OriginLab Corporation, Northampton, MA, USA) and pClamp (Molecular Devices, Sunnyvale, CA, USA) software.

[0136] Flexible template experiment

[0137] We performed experiments with peptide-DNA hybrids in two different ways. (i) We added all components sequentially—first ssDNA-CtxA and then the template strand, one after the other—or (ii) we mixed ssDNA-CtxA with the spacer strand (with or without cholesterol) and the template strand in DNA LoBind tubes (Eppendorf Tubes, Hamburg, Germany) and let them react overnight at room temperature (preincubation experiments). We also performed preincubation experiments with and without HPLC-SEC purification. In the case of unpurified assemblies, we added the DNA-modified peptide and the spacer strand stoichiometrically and then added n-mer templates (n equals 4, 6, or 8) at 1 mol:n mol DNA-modified peptide. When purifying the assemblies, we added an excess of peptide-DNA monomers compared to the template chain (at least 5 nmoles of peptide for 1 mol of n-mer template) and removed the excess monomers using HPLC-SEC purification (Agilent SEC3 column, 300 mm, 300 nm pore size, 4.6 mm inner diameter). We then stored the collected assemblies at +4°C for later use and added an excess of spacer chain before the experiment. When the cholesterol groups were bound to the spacer chain, we heated the chain at +60°C for 5 minutes to avoid aggregation of the cholesterol groups. For experiments with sequential addition, we added the various components at concentrations in the nanomolar range, while for pre-incubation experiments, we added all components at micromolar concentrations and then diluted the samples before adding them to the buffered electrolyte solution.

[0138] Origami structure assembly plan

[0139] To fold the origami structure, we mixed 50 nM scaffold with a 4-fold molar excess of staple strand in a 20 mM MgCl2 solution containing TE buffer. We heated the structure to 90 °C and slowly cooled it from 57 °C to 49 °C over 18 h. Subsequently, we removed the excess staples from the folded structure by PEG precipitation as described elsewhere here 11 Within the PEG purification we changed the buffer to TE containing 1 M NaCl.

[0140] To attach CtxA to the origami constructs, we added the peptide-oligonucleotide conjugate to the construct at a 5-fold molar excess and incubated at room temperature for at least one hour. Finally, we removed unbound peptide and peptide-DNA conjugate using HPLC size exclusion chromatography (Agilent SEC 3 column, 300 mm, 300 nm pore size, 4.6 mm i.d.).

[0141] We heated the cholesterol oligonucleotides to 60°C for 5 min before ligating them to the origami constructs. When required, we added cholesterol chains to a final concentration of 1 μM directly to the origami constructs without further purification before use.

[0142] Cell culture experiments.

[0143] We grew lung epithelial A549 cells in RPMI 1640 medium containing 25 mM HEPES, 1% L-glutamine, 10% fetal bovine serum, and added 1% penicillin-streptomycin to prevent bacterial contamination of cell cultures. We seeded cells in 96-well plates (TPP, Trasadingen, Switzerland) at 10,000 cells per well in a total volume of 50 uL per well. We placed the plates in an IncuCyte Zoom imaging system (Essen Bioscience, Ann Arbor, MI, USA) in an incubator set to 37°C and 5% CO2 to monitor cell growth by monitoring confluence over time. We seeded the cells and allowed them to adhere and replicate for 20 hours before adding templated CtxA-DNA assemblies or native CtxA as a control. We then measured cell confluence every 2 hours. To estimate the effect of different peptide assemblies on confluence over time, we fitted the observed confluence levels after peptide addition linearly.

[0144] DNA and amino acid sequences

[0145] FIG. 15 further illustrates the linker chemistry of the compounds.

[0146] The amino acid sequence of CtxA is shown in SEQ ID NO:1.

[0147] The nucleotide sequences of the oligonucleotides used with the flexible template are shown in SEQ ID NOs 2 to 4.

[0148] The sequence generated by the design software cadnano goes from 5` to 3`.

[0149] The sequences of the bulk component staples are shown in SEQ ID NOs 5 to 148. The sequences of the unmodified ring staples are shown in SEQ ID NOs 149 to 165. The sequences of the cholesterol chain and the chain for linking the CtxA peptide are shown in SEQ ID NOs 166 and 167. The sequences of the peptide attachment sites are shown in SEQ ID NOs 168 to 188. The sequences of the cholesterol attachment sites are shown in SEQ ID NOs 189 to 196. The scaffold sequence is shown in SEQ ID NO 197.

[0150] For the avoidance of doubt, the compositions of the present invention encompass all possible combinations of components disclosed herein, including various ranges of the components. It is further noted that the term "comprising" does not exclude the presence of other elements. However, it should also be understood that a description of a product or composition comprising certain components also discloses a product consisting of the components. Similarly, it should also be understood that a description of a method comprising certain steps also discloses a method consisting of the steps.

[0151] In accordance with the patent statutes, the best mode and preferred embodiment have been set forth; the scope of the invention is not limited thereto, but rather by the scope of the appended claims.

[0152] References:

[0153] 1Langecker, M. et al. Synthetic lipid membrane channels formed by designed DNAnanostructures. Science 338,932-936, doi:10.1126 / science.1225624(2012).

[0154] 2Krishnan,S.et al.Molecular transport through large-diameter DNAnanopores.Nat Commun7,12787,doi:10.1038 / ncomms12787(2016).

[0155] 3Burns,J.R.,Stulz,E.&Howorka,S.Self-assembled DNA nanopores that spanlipid bilayers.Nano Lett 13,2351-2356,doi:10.1021 / nl304147f(2013).

[0156] 4Burns,J.R.et al.Lipid-bilayer-spanning DNA nanopores with abifunctional porphyrin anchor.Angewandte Chemie(International ed.in English)52,12069-12072,doi:10.1002 / anie.201305765(2013).

[0157] 5Burns,J.R.,Seifert,A.,Fertig,N.&Howorka,S.A biomimetic DNA-basedchannel for the ligand-controlled transport of charged molecular cargo acrossa biological membrane.Nature Nanotechnology 11,152,doi:10.1038 / nnano.2015.279 https: / / www.nature.com / articles / nnano.2015.279#supplementary- information (2016).

[0158] 6Spruijt,E.,Tusk,S.E.&Bayley,H.DNA scaffolds support stable anduniform peptide nanopores.Nature Nanotechnology,doi:10.1038 / s41565-018-0139-6(2018).

[0159] 7Henning-Knechtel,A.,Knechtel,J.&Magzoub,M.DNA-assistedoligomerization of pore-forming toxin monomers into precisely-controlledprotein channels.Nucleic Acids Research,gkx990-gkx990,doi:10.1093 / nar / gkx990(2017).

[0160] 8Ke,Y.,Ong,L.L.,Shih,W.M.&Yin,P.Three-Dimensional Structures Self-Assembled from DNA Bricks.Science 338,1177-1183,doi:10.1126 / science.1227268(2012).

[0161] 9Wei,B.,Dai,M.&Yin,P.Complex shapes self-assembled from single-stranded DNA tiles.Nature 485,623,doi:10.1038 / nature11075 https: / / www.nature.com / articles / nature11075#supplementary-information (2012).

[0162] 10Marchini,D.,Marri,L.,Rosetto,M.,Manetti,A.G.&Dallai,R.Presence ofAntibacterial Peptides on the Laid Egg Chorion of the Medfly Ceratitiscapitata.Biochemical and biophysical research communications 240,657-663(1997).

[0163] 11Saint,N.,Marri,L.,Marchini,D.&Molle,G.The antibacterial peptideceratotoxin A displays alamethicin-like behavior in lipid bilayers.Peptides24,1779-1784,doi: http: / / dx.doi.org / 10.1016 / j.peptides.2003.09.015(2003).

[0164] 12Majd,S.et al.Applications of biological pores in nanomedicine,sensing,and nanoelectronics.Current Opinion in Biotechnology 21,439-476,doi: http: / / dx.doi.org / 10.1016 / j.copbio.2010.05.002 (2010).

[0165] 13Montal, M. & Mueller, P. Formation of bimolecular membranes from lipid monolayers and a study of their electrical properties. Proceedings of the National Academy of Sciences 69, 3561-3566 (1972).

[0166] 14Stahl, E., Martin, TG, Praetorius, F. & Dietz, H. Facile and Scalable Preparation of Pure and Dense DNA Origami Solutions. Angewandte Chemie International Edition 53, 12735-12740, doi:doi:10.1002 / anie.201405991(2014). Sequence Listing <110> Adolf Merkle Institute, University of Fribourg <120> Oligonucleotide-based modulation of pore-forming peptides to increase pore size, membrane affinity, stability, and antimicrobial activity <130> AMI-M <160> 197 <170> PatentIn version 3.5 <210> 1 <211> 36 <212> PRT <213> Artificial sequence <220> <223> Synthetic peptides <400> 1 Ser Ile Gly Ser Ala Leu Lys Lys Ala Leu Pro Val Ala Lys Lys Ile 1 5 10 15 Gly Lys Ile Ala Leu Pro Ile Ala Lys Ala Ala Leu Pro Val Ala Ala 20 25 30 Gly Leu Val Gly 35 <210> 2 <211> 55 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 2 tttttcagca atttaagatc cacccacgtt tttgtcactt ccgcgcacca gtttt 55 <210> 3 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 3 ttttacgtgg gtggatctta aattgctgat ttt 33 <210> 4 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 4 ctggtgcgcg gaagtgactt tt 22 <210> 5 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 5 gcagaagccg cctgcaacag tgagatct 28 <210> 6 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 6 taagaatata gtgagagcaa aagaagat 28 <210> 7 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 7 ttatagtggg tgcctaatga gtgagctt 28 <210> 8 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 8 ttaaatccct tataaatcgg ttccgaaatc ggcatt 36 <210> 9 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 9 ttaccagtaa taaaagggat tcaccagtca cacgtt 36 <210> 10 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 10 ggaagcctcc acactcgcta tgcactccag gaacgccatc aa 42 <210> 11 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 11 atttatccaa tccattatcc ggtattctaa aataa 35 <210> 12 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 12 ttcattgaat ccccttaaac aattgcataa gcatagggcg at 42 <210> 13 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 13 ctcaaactca tcgagaacaa gttaaacc 28 <210> 14 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 14 gcttcaactt caaatccaag aacgggta 28 <210> 15 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 15 tatcgcgtta tcatatgcgt ttcggctgtc tttccgtagg aa 42 <210> 16 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 16 gtcagtttac gtggcacaga cgaacaaacg gcgtacctac at 42 <210> 17 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 17 ttttataatc agtgaggcca ccgagataag ag 32 <210> 18 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 18 aaaagaatag cccgccggaa agcaactgag agaatcgatg aa 42 <210> 19 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 19 caaaatatttttattttcat cttatcat 28 <210> 20 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 20 aatattttca atcaatatct gcctttgc 28 <210> twenty one <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> twenty one ctcaacaaat ttttagaacc ctcatatt 28 <210> twenty two <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> twenty two acaataaatt agttaatctt accaacgctg taaatatatt tt 42 <210> twenty three <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> twenty three gttgagtgtt gttctttccg gcggtgcgcc tgaga 35 <210> twenty four <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> twenty four tagagctgcg cgtactatgg tcgttaga 28 <210> 25 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 25 aataaccaag gcaaagaatt aggagcgg 28 <210> 26 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 26 agccctaaaa tctaaagcat ctatcatttt taaattaatg cc 42 <210> 27 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 27 ttttagagcc gtcaatagac taacaactaa tagatt 36 <210> 28 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 28 tgcgtaggca cgtaaaacag aaaaattcta ctaatagtag taaattcat 49 <210> 29 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 29 aattatctta ttaacaaacc cttgaatggc tattaaaccc gt 42 <210> 30 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 30 ggttgataat cagagcaaac attgggaa 28 <210> 31 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 31 ttaacctacc atatcaaaat aatggaaggg ttagtt 36 <210> 32 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 32 agatagggcg aaaatcctgtttgatggt 28 <210> 33 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 33 ccggcttcta atttccgact tgcggggagga acgcg 35 <210> 34 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 34 tattaaaaga gagttgcagc aagctgca 28 <210> 35 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 35 ttagtttgac cattgatgaa acaaacatac agtgccc 37 <210> 36 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 36 aactatataa cgagagcctt aaatcaagac aacat 35 <210> 37 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 37 tttcgccatt caggctgccc aggcaaagcg ccattt 36 <210> 38 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 38 acgacgtgat ccccgggtac ccgctcaa 28 <210> 39 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 39 ggaaacgata ccaagcgcgg acagcctttc gag 33 <210> 40 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 40 gagagacaaa cagccgaggc gttttagcat agatatttaa ca 42 <210> 41 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 41 ttagtaacag taccttttac atcggcaaat ccaatcgcaa gacatt 46 <210> 42 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 42 tagtaatacc gttggaggcc gattaaag 28 <210> 43 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 43 tcacaatcga aagaagcgaa caattttctt tgaattacct tt 42 <210> 44 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 44 aatcatgttc ttaactaatta cttaagacgc tgaga 35 <210> 45 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 45 acgaaggcac caaccttaaa cg 22 <210> 46 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 46 cgttctagct gagcggaaca aggaatca 28 <210> 47 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 47 ttaaagtaat tctgtccaag taccgacaaa aggttt 36 <210> 48 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 48 gtaagaaggc aaatcaacag tattcgac 28 <210> 49 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 49 gttttgacgt ctttccagag caggttgg 28 <210> 50 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 50 agatacataa gcaataaagc ctcagagc 28 <210> 51 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 51 acattctata tctttaggag cataatacat ttgag 35 <210> 52 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 52 ttccaatact gcggaatcgt caatgacc 28 <210> 53 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 53 aagccaagag ctcggggttt tcgcatcgtg tgagcgagta ac 42 <210> 54 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 54 tttgataaga ggtcattttt gagtgaataa ccgggtaat 39 <210> 55 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 55 aagtgtaact gcccgctttc cccagcag 28 <210> 56 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 56 tcaaaaggaa gcctgtacgg tgtctggatt taatgcgtcg ct 42 <210> 57 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 57 aacgccaaat tcgttgggcg ccagggtggt ttttataacg tgctttcct 49 <210> 58 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 58 gtgaatttaa ggctccaaaa ggagcattta ac 32 <210> 59 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 59 aaaggtggca tctaaagaaa tgattcgc 28 <210> 60 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 60 cttctgaatt atttattttc aggtttaacg tcagatgaat atactt 46 <210> 61 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 61 gtacccctaa attgtaaacg ttaatatt 28 <210> 62 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 62 ttggtgtccc taaaacgagc acgtcttttc accag 35 <210> 63 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 63 tagcaatact gcatgcctgc aatcagagcg ggagc 35 <210> 64 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 64 caaaagcggt cagtgtcatt gggcctct 28 <210> 65 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 65 gaacctcgcc agttacaaaa ttaccttttg aaatatatca gaattaaat 49 <210> 66 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 66 agggaaggcg taaccaccac aggattttca tcacg 35 <210> 67 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 67 cccgccggtg gcgagaaagg accattgcct tgcctagact tt 42 <210> 68 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 68 acgtcaagcc cttcaccgcc taacgcgcgg ggagaggcgg tt 42 <210> 69 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 69 tgttttaaat atgcatcaat atatgtgcgg atggc 35 <210> 70 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 70 gtctttatga acctcaaata tttttaaa 28 <210> 71 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 71 ccgaccgcgccataagtcctgaacaaga 28 <210> 72 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 72 ttaagaacgc gagaaaactt taatataaga cgacg 35 <210> 73 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 73 gaacaagagt ccacgaagat ctacgccaac aaagg 35 <210> 74 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 74 atcgcccagc agggagttaa tgataa 26 <210> 75 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 75 gcactaaatc ggaaagatgg gcccagtcag tttga 35 <210> 76 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 76 acggggtcag gtttatcagc ttg 23 <210> 77 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 77 agtctctggg taaaatacgt aatgc 25 <210> 78 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 78 taaagatgtc tggaaaagcc caagattgta taagctgtta aatctggtg 49 <210> 79 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 79 caccgcttca gctcattttt taaccaatag ccagc 35 <210> 80 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 80 ggcgaaccgc ttaatgcgcc gtaaacag 28 <210> 81 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 81 aactaaatta tttcaacgca agtgtagg 28 <210> 82 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 82 ttttgttagc aaatcagata tttacgag 28 <210> 83 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 83 gagacagccc tgtattccat ataacagtaa tttcacctta ga 42 <210> 84 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 84 cagtgccaag ctttctttga taactcgt 28 <210> 85 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 85 acaaacatga aaggtctgac ctgaaagctt tgacgaaaac gc 42 <210> 86 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 86 ttcatttcat ccaataaatc a 21 <210> 87 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 87 aaaatactga gagccagcag cggagaggtg caaggctgtt tcctgtgtg 49 <210> 88 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 88 tctgacccaa tataatcctg attgtttgga ttatagattt ag 42 <210> 89 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 89 ggtcgactga gaattgtgat ataggtctaa ttatcattt ca 42 <210> 90 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 90 ttctacaatt ttatcctggc tattttgcac ccagtt 36 <210> 91 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 91 agtttcaata cttttgcggg a 21 <210> 92 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 92 cagaagcaga gtacctttaa ttgctccttt tt 32 <210> 93 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 93 tttaggccaa attaaacatc aaacaggact caatcgtctg aa 42 <210> 94 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 94 caaaagaagttttgccagag gttgcttcca ggtca 35 <210> 95 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 95 gctggcgtat ccgcttaatg aatcggcc 28 <210> 96 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 96 cagtttgcac gctggtttgc cagtcgggga gccgg 35 <210> 97 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 97 tctatcatga gacgggcaac atgcgtat 28 <210> 98 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 98 tacaaactcc atcgttgacccccagtagca a 31 <210> 99 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 99 tcattaccgc gccctcaata aatacaaa 28 <210> 100 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 100 cgttaaacag taggtatccc atcctaat 28 <210> 101 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 101 accagaagca aaattttcgc aaatggtcat tacct 35 <210> 102 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 102 gaggcgcaga cagcaaaatg tatcatcgcc aggccg 36 <210> 103 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 103 gctgattagg gcgaaaaacc ggcatctggt tgggt 35 <210> 104 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 104 caaaaagact ccaatgtaaa tgaaacagta cataa 35 <210> 105 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 105 caagccggcg agaggctttt gattaattca gaccg 35 <210> 106 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 106 gcttaattct agagtgtaaa aggtcacgcg gattctccgt gg 42 <210> 107 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 107 aaattgtaaa gggagtatc gtcgcgtctg gcctt 35 <210> 108 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 108 taaatttcat gtaacctgtt tatcaaca 28 <210> 109 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 109 ttgctggcaa gtgtagcggt ccgccagaat cctgagaagt gttttt 46 <210> 110 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 110 agaaggcaat aagaaacgat tagagtcaaa acacc 35 <210> 111 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 111 tgatggcgca ttaaggggcg cgagctgata ccaag 35 <210> 112 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 112 aagaacgcat attatttatc caaaatcaaa taagg 35 <210> 113 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 113 aaggccgcta tcagattaac aataaaacag aggtgagaca gg 42 <210> 114 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 114 agtagatata aagctaaatc gattcaac 28 <210> 115 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 115 atctaaaggc caacagagat aatggattcc gccag 35 <210> 116 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 116 gtcatagcga ttaaccagtt tccagctttc atcaa 35 <210> 117 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 117 agaaaccgta acataccttg catgcgcgaa ctgatcatta aataaccgt 49 <210> 118 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 118 gagtagagtc tgtcagacag gaacggta 28 <210> 119 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 119 ttagcatgtc aatcatatcg gtaatcgtaa aacttt 36 <210> 120 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 120 atcatattac aggctgttta gctatattag aggcg 35 <210> 121 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 121 taattacctt taattgtatc gtgccttgag tacaagaaa 39 <210> 122 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 122 ataaataagt aaaatgttta gactggatag cgttt 35 <210> 123 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 123 ttgtctttac cctgactaat aaatcaaaaa tcagtt 36 <210> 124 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 124 ctacaggtga cggggaaagc ctcatggaaa gattgaccgt aa 42 <210> 125 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 125 tttaactcac attaattgcg ttgcgctcaa gcctg 35 <210> 126 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 126 acgctgcaaa gcgaaaggag cgggcgctag ggctt 35 <210> 127 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 127 tgattcccaaaaacattatg atcaaatc 28 <210> 128 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 128 aaaaatggct tagatagaaa aagcctgttt agtttaattc gaaccatca 49 <210> 129 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 129 gccagtataa aagaagaact caatattaatttacattggc ag 42 <210> 130 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 130 ggtgagagaa gcaaattaag aaagtaccgc atgct 35 <210> 131 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 131 atatgatgtt gtaccaattc tgcgaacgac aaaatagcga ta 42 <210> 132 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 132 agaggcattc atctgttata tctgattgct ttgaa 35 <210> 133 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 133 ttcaaatgct gatggagaaa caataacg 28 <210> 134 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 134 agttaatttttcgagttcag ctaatgca 28 <210> 135 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 135 gaaccctaat tgaggaaggt taagtatt 28 <210> 136 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 136 ggccctggaa cgtggactcc acgacgacga tgtgcgtagc ta 42 <210> 137 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 137 ttttttgtta aaattcgcat taaattttaa atatt 35 <210> 138 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 138 ggattagaaa gcgggttcag aaaacgag 28 <210> 139 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 139 tttggtaata tccagaacaa actatcggcc ttgctt 36 <210> 140 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 140 aaatgaaaaa catcgccatt acctgtagga gggga 35 <210> 141 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 141 aacatacaaa cctgtcgtgc cagcggtc 28 <210> 142 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 142 tgctttgggg agcccccgat ttgggatacg acggcccgaa cg 42 <210> 143 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 143 tttattttaa atgcaatgcc tgagtaatgg ataaa 35 <210> 144 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 144 tttttgagcc acgccgaacg aaccaccaaa ataatgcctc ag 42 <210> 145 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 145 acgccaaaat ggttttaacc tttacaaaat cgcgc 35 <210> 146 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 146 aaaatagcag acgataaaaa catccttgaa aacat 35 <210> 147 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 147 ttgaatataa tgctgtagtt agagcttaat tgcttt 36 <210> 148 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 148 cagtatacat gtagaaacca aaatagcata acgtccataa aaac 44 <210> 149 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 149 caagaaacac caccctcccc ctttccctca gagcagccac c 41 <210> 150 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 150 aaaggaatgt ctttccagac gttattgcga ataataattt 40 <210> 151 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 151 cgggagaatg taacactaat cagcactaaa acactttgag 40 <210> 152 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 152 gcaacactgc gtaaccatta ccaagtacaa cgggtcacc 39 <210> 153 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 153 caaagtcaag cccaataagt ttaaagaggc aaattcatg 39 <210> 154 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 154 tatcttaccc gtactcaatc tttccaccac cggagccacc a 41 <210> 155 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 155 attgagttag aaccgccggc atccctcaga cact 34 <210> 156 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 156 aacaaataaa tcctccgggg ttttccaccc tcaagcccaa t 41 <210> 157 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 157 attaaagcca gaatggaaag cgctcctcaa gaagagccac agagataac 49 <210> 158 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 158 taccacattc aactaataat tttctcggaa cattgt 36 <210> 159 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 159 cagtatacat gtagaaacca aaatagcata acgtccataa aaac 44 <210> 160 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 160 gacgattggc cttgataagt gcctagtacc gatgaaata 39 <210> 161 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 161 aatttaccgttccagcatgaaaggatagca 30 <210> 162 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 162 attttgctaa acaactttat aggtgtatca cgaagccc 38 <210> 163 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 163 tttttaaatc agttgagatt taggaattac aggtagaaag attcgaaaag 50 <210> 164 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 164 gtcgaagagg cttcgcataa ccgatatatt agcattgaca ggaggttgag 50 <210> 165 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 165 gagccgccgc ccggtcgcta tccgcgacca ccggaa 36 <210> 166 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 166 cgctgttcct cacgataatt 20 <210> 167 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 167 tttagcttcc ataccacctg 20 <210> 168 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 168 atcggaacga gggcgatttc accagtgaat tcaggtggta tggaagcta 49 <210> 169 <211> 56 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 169 cttaaacctc agcagcgaaa aaacaattag cccgacttca ggtggtatgg aagcta 56 <210> 170 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 170 accgccaccc tcagcgccat ttcgggttta ttcaggtggt atggaagcta 50 <210> 171 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 171 aagttttacg gctacagagg ctcatctata gcaggaaatt ttcaggtggt atggaagcta 60 <210> 172 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 172 tattcacaac cctcagagcc accgccatta gcaatagatt caggtggtat ggaagcta 58 <210> 173 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 173 caccctcaga ctgtagcgcg acaaattcag gtggtatgga agcta 45 <210> 174 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 174 tgatacagga ctaaagactt tagaatatag cgacgaaggt ttcaggtggt atggaagcta 60 <210> 175 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 175 taagcgtcag gaagtttcca taaaacggcc tttacaaccg ttcaggtggt atggaagcta 60 <210> 176 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 176 ttgcgccctt ttgcgggatc agatttcacc aggggaattt caggtggtat ggaagcta 58 <210> 177 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 177 ggaagaaaaa tctaccgcat agtagagccg gtcaatcatt tcaggtggta tggaagcta 59 <210> 178 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 178 gcaggtcaga accacccacca ccagagtcat aatttatttt caggtggtat ggaagcta 58 <210> 179 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 179 agacgccttt acagacttat gcgattttaa caagaactta tcattcaggt ggtatggaag 60 cta 63 <210> 180 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 180 aacgaactaa cggaacaacg gtaagggttc aggtggtatg gaagcta 47 <210> 181 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 181 gcaataataa cggaatacgt agccagcgtt caggtggtat ggaagcta 48 <210> 182 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 182 tcattatacc agtcatcatc aattgagctt caggtggtat ggaagcta 48 <210> 183 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 183 ttgggcttga gatggagctg caaatattca ggtggtatgg aagcta 46 <210> 184 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 184 taagcagata gccgaagaaa cttgtcttca ggtggtatgg aagcta 46 <210> 185 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 185 agaactggca tgattattac gcagggcgtt caggtggtat ggaagcta 48 <210> 186 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 186 taccagaagg aaaccgaaag gtaaattttc aggtggtatg gaagcta 47 <210> 187 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 187 caactttaat cattgaccca aattcattca ggtggtatgg aagcta 46 <210> 188 <211> 55 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 188 gagggtaaga aacaccagaa cgaaaggcta ttgagttcag gtggtatgga agcta 55 <210> 189 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 189 gagtgtactg gtaatgtata aactcaccag agggaagctt ttatcgtgag gaacagcg 58 <210> 190 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 190 atacatggct tttgatattt cggatgtacc taactgaatt ttatcgtgag gaacagcg 58 <210> 191 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 191 gacaatgaca acaaccctaa aggaagtaaa tggcagatac ttttatcgtg aggaacagcg 60 <210> 192 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 192 agcttgatac cgatagtttc acgtgttttg tctacgaggc ttttatcgtg aggaacagcg 60 <210> 193 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 193 ccgtcaaagg ccacagccct catagttaat cataaccttt tatcgtgagg aacagcg 57 <210> 194 <211> 69 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 194 attaaagcca gaatggaaag cgctcctcaa gaagagccac agagataact tttatcgtga 60 ggaacagcg 69 <210> 195 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 195 aacaaataaa tcctccgggg ttttccaccc tcaagcccaa tttttatcgt gaggaacagc 60 g 61 <210> 196 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 196 gacgattggc cttgataagt gcctagtacc gatgaaatattttatcgtga ggaacagcg 59 <210> 197 <211> 7249 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 197 aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat 60 atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact 120 cgttcgcaga attgggaatc aactgttata tggaatgaaa cttccagaca ccgtacttta 180 gttgcatatt taaaacatgt tgagctacag cattatattc agcaattaag ctctaagcca 240 tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg 300 ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag 360 tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctatatagt cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct aaacatttta ctattacccc ctctggcaaa acttctttttg caaaagcctc tcgctatttt 600. ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt 660 aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg 720 atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagattttt 840. tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca 900. 900. 900. 900. 900. 900. 900. 900. 900. 900. 900 ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc 1020 tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc 1080 gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat 1140 caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctggggt 1200 caaagatgag tgttttagtg tattcttttg cctctttcgt tttaggttgg tgccttgta 1260 gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct 1320 caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga 1380 cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta 1440 tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa 1500 attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt 1560 ttttggagat tttcaacgtg aaaaaattat tattcgcaat tcctttagtt gttcctttct 1620 attctcactc cgctgaaact gttgaaagtt gtttagcaaa atcccataca gaaaattcat 1680 ttactaacgt ctggaaagac gacaaaactt tagatcgtta cgctaactat gagggctgtc 1740 tgtggaatgc tacaggcgtt gtagtttgta ctggtgacga aactcagtgt tacggtacat 1800 gggttcctat tgggcttgct atccctgaaa atgagggtgg tggctctgag ggtggcggtt 1860 ctgagggtgg cggttctgag ggtggcggta ctaaacctcc tgagtacggt gatacaccta 1920 ttccgggcta tacttatatc aaccctctcg acggcactta tccgcctggt actgagcaaa 1980 accccgctaa tcctaatcct tctcttgagg agtctcagcc tcttaatact ttcatgtttc 2040 agaataatag gttccgaaat aggcaggggg cattaactgt ttatacgggc actgttactc 2100 aaggcactga ccccgttaaa acttattacc agtacactcc tgtatcatca aaagccatgt 2160 atgacgctta ctggaacggt aaattcagag actgcgcttt ccattctggc tttaatgagg 2220 atttatttgt ttgtgaatat caaggccaat cgtctgacct gcctcaacct cctgtcaatg 2280 ctggcggcgg ctctggtggt ggttctggtg gcggctctga gggtggtggc tctgagggtg 2340 gcggttctga gggtggcggc tctgagggag gcggttccgg tggtggctct ggttccggtg 2400 attttgatta tgaaaagatg gcaaacgcta ataagggggc tatgaccgaa aatgccgatg 2460 aaaacgcgct acagtctgac gctaaaggca aacttgattc tgtcgctact gattacggtg 2520 ctgctatcga tggtttcatt ggtgacgttt ccggccttgc taatggtaat ggtgctactg 2580 gtgatttgc tggctctaat tcccaaatgg ctcaagtcgg tgacggtgat aattcacctt 2640 taatgaataa tttccgtcaa tatttacctt ccctccctca atcggttgaa tgtcgccctt 2700 ttgtctttgg cgctggtaaa ccatatgaat tttctattga ttgtgacaaa ataaacttat 2760 tccgtggtgt ctttgcgttt cttttatatg ttgccacctt tatgtatgta ttttctacgt 2820 ttgctaacat actgcgtaat aaggagtctt aatcatgcca gttctttttgg gtattccgtt 2880 attattgcgt ttcctcggtt tccttctggt aactttgttc ggctatctgc ttactttct 2940 taaaaagggc ttcggtaaga tagctattgc tatttcattg tttcttgctc ttattattgg 3000 gcttaactca attcttgtgg gttatctctc tgatattagc gctcaattac cctctgactt 3060 tgttcagggt gttcagttaa ttctcccgtc taatgcgctt ccctgttttt atgttattct 3120 ctctgtaaag gctgctattt tcatttttga cgttaaacaa aaaatcgttt cttatttgga 3180 ttgggataaa tatatggct gtttattttg taactggcaa attaggctct ggaaagacgc 3240 tcgttagcgt tggtaagatt caggataaaa ttgtagctgg gtgcaaaata gcaactaatc 3300 ttgatttaag gcttcaaaac ctcccgcaag tcgggaggtt cgctaaaacg cctcgcgttc 3360 ttagaatacc ggataagcct tctatatctg atttgcttgc tattgggcgc ggtaatgatt 3420 cctacgatga aaataaaaac ggcttgcttg ttctcgatga gtgcggtact tggtttaata 3480 cccgttcttg gaatgataag gaaagacagc cgattattga ttggttctcta catgctcgta 3540 aattaggatg ggatattatt tttcttgttc aggacttatc tattgttgat aaacaggcgc 3600 gttctgcatt agctgaacat gttgtttatt gtcgtcgtct ggacagaatt actttacctt 3660 ttgtcggtac tttatattct cttattactg gctcgaaaat gcctctgcct aaattacatg 3720 ttggcgttgt taaatatggc gattctcaat taagccctac tgttgagcgt tggctttata 3780 ctggtaagaa tttgtataac gcatatgata ctaaacaggc tttttctagt aattatgatt 3840 ccggtgttta ttcttattta acgccttatt tatcacacgg tcggtatttc aaaccattaa 3900 atttaggtca gaagatgaaa ttaactaaaa tatatttgaa aaagttttct cgcgttcttt 3960 gtcttgcgat tggattgca tcagcattta catatagtta tataacccaa cctaagccgg 4020 aggttaaaaa ggtagtctct cagacctag attttgataa attcactatt gactctctc 4080 agcgtcttaa tctaagctat cgctatgttt tcaggattc taagggaaaa tattaata 4140 gcgacgattt acagaagcaa gcttattcac tcacatatat tgattgt actgttttcca 4200 ttaaaaaagg taattcaat gaattgtta aatgtatta atttgtttt cttgatgtttt 4260 gttcatcat cttcttttgc tcaggtatt gaaatgaata attcgcctct gcgcgatttt 4320 gtaacttggt attcaaagca atcaggcgaa tccgttattg ttctccccga tgtaaaggt 4380 actgttactg tatattcatc tgacgttaaa cctgaaaatc tacgcaattt ctttattct 4440 gttttacgtg caataattt tgatatgta gttctaacc cttccattat tcagaagtat 4500 aatccaaaca atcaggatta tattgatgaa ttgccatcat ctgataatca ggaatatgat 4560 gataattccg ctccttctgg tggttcttt gttccgcaact atgataatgt tactcaact 4620 tttaaaatta ataacgttcg ggcaaaggat ttaatacgag ttgtcgaatt gtttgtaaag 4680 tctaatactt ctaaatcctc aaatgtatta tctattgacg gctctaatct attagttgtt 4740 agtgctccta aagatatttt agataacctt cctcaattcc tttcaactgt tgatttgcca 4800 actgaccaga tattgattga gggtttgata tttgaggttc agcaaggtga tgctttagat 4860 ttttcatttg ctgctggctc tcagcgtggc actgttgcag gcggtgttaa tactgaccgc 4920 ctcacctctg tttatcttc tgctggtggt tcgttcggta tttttaatgg cgatgtttta 4980 gggctatcag ttcgcgcatt aaagactaat agccattcaa aaatattgtc tgtgccacgt 5040 attcttacgc tttcaggtca gaagggttct atctctgttg gccagaatgt cccttttatt 5100 actggtcgtg tgactggtga atctgccaat gtaataatc catttcagac gattgagcgt 5160 caaaatgtag gtatttccat gagcgttttt cctgttgcaa tggctggcgg taatattgtt 5220 ctggatatta ccagcaaggc cgatagtttg agttcttcta ctcaggcaag tgatgttatt 5280 actaatcaaa gaagtattgc tacaacggtt aatttgcgtg atggacagac tcttttactc 5340 ggtggcctca ctgattataa aaacacttct caggattctg gcgtaccgtt cctgtctaaa 5400 atccctttaa tcggcctcct gtttagctcc cgctctgatt ctaacgagga aagcacgtta 5460 tacgtgctcg tcaaagcaac catagtacgc gccctgtagc ggcgcattaa gcgcggcggg 5520 tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc ccgctccttt 5580 cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg 5640 ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga 5700 tttgggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc gccctttgac 5760 gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa cactcaaccc 5820 tatctcgggc tattcttttg atttataagg gattttgccg atttcggaac caccatcaaa 5880 caggattttc gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc 5940 caggcggtga agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg 6000 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 6060 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 6120 cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 6180 6240 cggtacccgg ggatcctcta gagtcgacct gcaggcatgc aagcttggca ctggccgtcg 6300 ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc cttgcagcac 6360 atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac 6420 agttgcgcag cctgaatggc gaatggcgct ttgcctggtt tccggcacca gaagcggtgc 6480 cggaaagctg gctggagtgc gatcttcctg aggccgatac tgtcgtcgtc ccctcaaact 6540 ggcagatgca cggttacgat gcgcccatct acaccaacgt gacctatccc attacggtca 6600 atccgccgtt tgttcccag gagaatccga cgggttgtta ctcgctcaca tttaatgttg 6660 atgaaagctg gctacaggaa ggccagacgc gaattatttt tgatggcgtt cctattggtt 6720 aaaaaatgag ctgatttaac aaaaatttaa tgcgaatttt aacaaaatat taacgtttac 6780 aatttaaata tttgcttata caatcttcct gtttttgggg cttttctgat tatcaaccgg 6840 ggtacatatg attgacatgc tagttttacg attaccgttc atcgattctc ttgtttgctc 6900 cagactctca ggcaatgacc tgatagcctt tgtagatctc tcaaaaatag ctaccctctc 6960 cggcattaat ttatcagcta gaacggttga atatcatatt gatggtgatt tgactgtctc 7020 cggcctttct cacccttttg aatctttacc tacacattac tcaggcattg catttaaaat 7080 atatgagggt tctaaaaatt tttatccttg cgttgaaata aaggcttctc ccgcaaaagt 7140 attacagggt cataatgttt ttggtacaac cgatttagct ttatgctctg aggctttatt 7200 gcttaatttt gctaattctt tgccttgcct gtatgattta ttggatgtt 7249

Claims

1. A hybrid pore-forming compound comprising: A pore-forming peptide having a first end and a second end, wherein a first oligonucleotide is attached to the first end, wherein the first oligonucleotide is from DNA, RNA, LNA, BNA or PNA, wherein a first functional group is attached to the second end, wherein the first functional group is hydrophilic, the first end is an N-terminus, the second end is a C-terminus, and The pore-forming peptide is Ceratotoxin A (CtxA), The first oligonucleotide is a single strand, the single strand comprises a spacer region and a template binding domain and a flexible linker connecting the spacer region and the template binding domain, the spacer chain hybridizes to the spacer region to form a rigid doublet, the template binding domain hybridizes to a template having a plurality of complementary hybridization sites, the spacer chain is a second oligonucleotide, the second oligonucleotide is derived from DNA, RNA, LNA, BNA or PNA, the flexible linker is a flexible linker composed of thymine, The first functional group is a third oligonucleotide, and the third oligonucleotide is a DNA chain composed of a polythymine chain, Wherein a second functional group is attached to the second oligonucleotide, and wherein the second functional group is a hydrophobic membrane binding agent, and the hydrophobic membrane binding agent comprises a cholesterol group.

2. The compound according to claim 1, wherein the polythymine chain is T 12 .

3. The hybrid pore-forming compound according to any one of claims 1 to 2, wherein the template is a template strand in which the plurality of complementary hybridization sites are separated by a flexible linker.

4. The hybrid pore-forming compound of claim 3, wherein the template strand has 4, 6, 8 or 12 complementary hybridization sites. 5 . The hybrid pore-forming compound according to claim 3 , wherein there are a plurality of said pore-forming peptides, and each first oligonucleotide connected to the first end hybridizes with the template strand, thereby allowing the compound to form a larger pore.

6. The hybrid pore-forming compound according to claim 4, wherein there are a plurality of said pore-forming peptides, and each first oligonucleotide attached to the first end is hybridized to the template strand, so that the compound has a tetramer, hexamer, octamer or dodecamer pore configuration.

7. The hybrid pore-forming compound of claim 1, wherein the second functional group is attached to the third oligonucleotide to help stabilize the pore formed by the compound.

8. The hybrid pore-forming compound of claim 3, wherein the plurality of complementary hybridization sites of the template strand hybridize to a portion of the first oligonucleotide attached to the first end.

9. The hybrid pore-forming compound of claim 1, wherein the template is an extended, rigid nucleic acid nanostructure for assembling a plurality of pore formers into a pore, and wherein the nucleic acid nanostructure is a DNA origami structure or a single-stranded patchwork assembly or an RNA origami structure.

10. The hybrid pore-forming compound of claim 9, wherein the plurality of pore formers comprises 20 or 40 pore formers.

11. A hybrid pore-forming compound comprising: A pore-forming peptide having a first end and a second end, wherein a first oligonucleotide is attached to the first end, wherein the first oligonucleotide is from DNA, RNA, LNA, BNA or PNA, wherein a first functional group is attached to the second end, wherein the first functional group is hydrophilic, the first end is the N-terminus, and the second end is the C-terminus, wherein the pore-forming peptide is Ceratotoxin A, wherein the first oligonucleotide is a single strand, the single strand comprises a template binding domain, the template binding domain is hybridized to a template, the template is an extended, rigid nucleic acid nanostructure, and wherein the nucleic acid nanostructure is a DNA origami structure or a single stranded splicing assembly or an RNA origami structure, and The first functional group is a DNA chain composed of a polythymine chain.

12. The hybrid pore-forming compound of claim 11, wherein the nucleic acid nanostructure comprises a second functional group directly attached thereto, and wherein the second functional group is a hydrophobic membrane binder, a receptor, a drug molecule, an antibody, an aptamer, a metabolite, or a fluorescent marker.

13. The hybrid pore-forming compound of claim 12, wherein the hydrophobic membrane binding agent comprises a cholesterol group.

14. A method for forming the hybrid pore-forming compound according to claim 1, comprising the steps of: Obtaining i) the pore-forming peptide, ii) the first oligonucleotide, iii) the third oligonucleotide, iv) the second oligonucleotide and v) the template having a plurality of complementary hybridization sites; Self-assembly i), ii), iii) to form a pore-forming compound; reacting a template having a plurality of complementary hybridization sites with an excess of the pore-forming compound comprising i), ii), and iii) in a solution; removing excess unreacted pore-forming compound; as well as The first oligonucleotide is hybridized to the second oligonucleotide, wherein the second oligonucleotide is present in excess compared to the first oligonucleotide.

15. The method of claim 14, wherein the excess unreacted pore-forming compound is removed by high pressure liquid chromatography.

16. A membrane comprising a substrate and a hybrid pore-forming compound according to any one of claims 1 to 13, wherein the hybrid pore-forming compound provides pores between a first side of the substrate and a second side of the substrate.

Images