Rapamycin derivatives

By developing compounds of formula (I) that bind to FKBP12, FKBP51 and/or FKBP52, the low bioavailability and poor stability of rapamycin analogs in the treatment of age-related disorders and diseases have been addressed, providing a more potent mTORC1 inhibitor suitable for the treatment of a variety of diseases.

CN113260619BActive Publication Date: 2026-02-03NOVARTIS AG
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
CN201980087363.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2018-12-18
Filing Date
2019-12-17
Publication Date
2026-02-03
Estimated Expiration
2039-12-17

AI Technical Summary

Technical Problem

Existing rapamycin analogues suffer from low bioavailability, poor stability, and significant side effects when treating age-related disorders and diseases, making it difficult to achieve a balance between good efficacy, stability, and bioavailability.

Method used

Compounds of formula (I) were developed that significantly enhanced the inhibitory effect on mTORC1 by binding to FKBP12, FKBP51 and/or FKBP52, exhibiting higher affinity and selectivity, and were able to effectively inhibit mTORC1 in different cell types.

Benefits of technology

Achieving a good balance in efficacy, stability and bioavailability, it provides a more effective mTORC1 inhibitor suitable for the treatment of a variety of age-related disorders and diseases, including cancer, mitochondrial myopathy, etc.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113260619B_ABST
    Figure CN113260619B_ABST
Patent Text Reader

Abstract

The present disclosure provides 32-deoxy-rapamycin derivatives of Formula (I) or pharmaceutically acceptable salts thereof, pharmaceutical compositions and pharmaceutical combinations comprising compounds of Formula (I), and methods of making the same. Also provided herein are methods of using compounds of Formula (I) or pharmaceutically acceptable salts thereof to treat diseases and disorders described herein.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] priority

[0002] This application claims priority to USSN 62 / 781,242, filed December 18, 2018, which is incorporated herein by reference in its entirety.

[0003] sequence list

[0004] This application contains a sequence list, which has been electronically submitted in ASCII format and is hereby incorporated in its entirety by reference. The ASCII copy was created on May 19, 2021, and is named PAT058371_SL.txt, with a size of 1,868 bytes. Technical Field

[0005] This disclosure provides 32-deoxy-rapamycin derivatives, relating to their preparation and methods of use. Background Technology

[0006] In mammalian cells, the target of rapamycin (mTOR) kinase exists in two distinct multiprotein complexes (called the mTORC1 and mTORC2 complexes), both of which sense nutrient and energy utilization and integrate inputs from growth factors and stress signals. mTORC1 integrates signals from growth factors and nutrients and controls cell growth and metabolism (Laplante M. et al., Cell. [Cell] (2012) 149(2):274-93), and is a key regulator of protein translation and autophagy. The mTORC1 complex is sensitive to allosteric mTOR inhibitors, such as rapamycin and rapamycin analogs (so-called "rapalogs"). Rapamycin and previously produced rapamycin analogs act by forming an intracellular complex with an FK506-binding protein (e.g., FKBP12, FKBP12.6, FKBP13, FKBP25, FKBP51, or FKBP52 (these FKBPs will be referred to as “FKBPs” or “FKBPs”)) and the formation of the intracellular complex of the binding protein, followed by the binding of the FKBP-rapamycin analog complex to the FRB (FK506-rapamycin-binding) domain of mTOR. AM et al., Mol Cell Biol. [Molecular Cell Biology] (2013) 33(7):1357-1367. This interaction between the FKBP-rapamycin analog complex and mTORC1 leads to allosteric inhibition of the complex. Rapamycin and rapamycin analogs (such as RAD001 (everolimus); Clinical relevance was obtained by inhibiting the activity of mTORC1, which is associated with both benign and malignant proliferative disorders. Royce ME et al. Breast Cancer (Auckl). (2015) 9:73-79; Pleniceanu O. et al. Kidney Int Rep. (International Kidney Reports) (2018) 3(1):155-159.

[0007] Rapamycin is a known macrolide antibiotic produced by *Streptomyces hygoscopius*, see, for example, McAlpine, JB et al., *Journal of Antibiotics* (1991) 44:688; Schreiber, SL et al., *Journal of the American Chemical Society* (1991) 113:7433; U.S. Patent No. 3,929,992. The following numbering conventions apply to rapamycin and its derivatives as used in this document:

[0008]

[0009] Rapamycin is a potent immunosuppressant and has also been shown to possess antitumor and antifungal activities. It has been shown to be useful for the prevention or treatment of systemic lupus erythematosus, lung inflammation, insulin-dependent diabetes mellitus, skin disorders such as psoriasis, smooth muscle cell proliferation and endothelial thickening following vascular injury, adult T-cell leukemia / lymphoma, malignant cancer, inflammatory cardiac diseases, anemia, and neurogenesis. However, its practicality as a medicine is limited by its extremely low and variable bioavailability. Furthermore, the formulation of rapamycin is challenging, making it difficult to obtain stable galenic compositions.

[0010] In animal models, rapamycin analogues prolong lifespan and delay the onset of age-related diseases. Like other biological processes, aging is regulated by signaling pathways such as the TOR pathway (in this case, named "TOR" to encompass the systems of yeast and *C. elegans*), and in mammals by the mTORC1 pathway. Regulation of TOR and mTORC1 signaling prolongs lifespan and delays the onset of age-related diseases in a variety of organisms from flies to mammals. For example, inhibition of the TOR pathway through gene mutations has prolonged the lifespan of yeast, *C. elegans*, and fruit flies, while inhibition of the mTORC1 pathway has prolonged the lifespan of mice (Kaeberlein et al., *Science* (2005) 310:1193-1196; Kapahi et al., *Curr Biol* (2004) 14:885-890; Selman et al., *Science* (2009) 326:140-144; Velai et al., *Nature* (2003) 426:620). Furthermore, the mTORC1 inhibitor rapamycin has prolonged the lifespan of mice, even in later years (Harrison et al., *Nature* (2009) 460(7253):392-395). These data increase the possibility that drugs targeting the mammalian TOR (mTOR) pathway will have therapeutic effects on human aging and age-related diseases. M. Leslie described a clinical trial report of the use of rapamycin in older men in Science, 2013, 342. J. Mannick et al. described mTOR inhibition as improving immune function in older adults in Sci Transl Med. (2014) 6(268):268ra179. However, researchers have been cautious about using currently available mTOR inhibitors in human aging trials due to their side effects, including immunosuppression, cytopenia, stomatitis, gastrointestinal discomfort, and interstitial pneumonia.

[0011] Pharmacological inhibition of the mTOR pathway, either before or immediately after nerve injury, can prevent pathological changes in the animal brain and the progression of spontaneous recurrent seizures in acquired epilepsy models (Zeng et al., The mammalian target of rapamycin signaling pathway mediates epileptogenesis in a model of temporal lobe epilepsy; J. Neurosci., (2009) 6964-6972). Therefore, rapamycin and rapamycin analogues are considered to have potential value in such indications.

[0012] Rapamycin analogues have been shown to be effective for symptoms of liver fibrosis in humans. See, for example, Liver Int. (2014) 34(10):1513-21.

[0013] Mitochondrial myopathy (MM) is the most common manifestation of adult-onset mitochondrial disease and exhibits multifaceted tissue-specific stress responses: (1) transcriptional responses, including the metabolic cytokines FGF21 and GDF15; (2) remodeling of one-carbon metabolism; and (3) mitochondrial unfolded protein responses. These processes, described by Khan et al. in Cell Metabolism 26, 419-428, August 1, 2017, are part of an integrated mitochondrial stress response (ISRmt) controlled by mTORC1 in skeletal muscle. Defective mtDNA replication activates mTORC1, which drives the integrated mitochondrial stress response via ATF4 activation, thereby inducing de novo synthesis of nucleotides and serines, the 1C cycle, and the production of FGF21 and GDF15. Inhibition of mTORC1 by rapamycin downregulated all components of the ISRmt (integrated mitochondrial stress response), improved all MM markers, and even reversed the progression of late MM without inducing mitochondrial biogenesis. Therefore, rapamycin and rapamycin analogues are considered to have potential value in this type of indication.

[0014] Therefore, there is still a need to develop new mTOR inhibitors that are good candidates that demonstrate a good balance in terms of efficacy, stability and bioavailability. Summary of the Invention

[0015] Compounds having formula (I) are mTORC1 inhibitors and can be used to treat disorders, particularly age-related disorders, or diseases and disorders currently approved for treatment with rapamycin analogs. As described herein, complete reduction of the ketone at C32 and substitution of the methoxy group at C16 provide compounds exhibiting a balance in terms of good potency, stability, and bioavailability.

[0016] Without being bound by theory, compounds of formula (I) can effectively inhibit mTORC1 by binding to FKBP12 when FKBP12 levels are sufficient to inhibit mTORC1. When FKBP12 levels are insufficient to inhibit mTORC1, but FKBP25, FKBP51, and / or FKBP52 are sufficient to inhibit mTORC1, compounds of formula (I) can also effectively inhibit mTORC1 by binding to FKBP25, FKBP51, and / or FKBP52. Therefore, FKBP levels may differ in certain cell types (e.g., and therefore in different potential indications, such as diseases and disorders as described herein). Thus, RAD001 may be effective for such cell types with sufficient FKBP12 levels. However, compounds of formula (I) may be effective in certain cell types with either sufficient or insufficient FKBP12 levels.

[0017] On the one hand, this disclosure provides compounds having formula (I) or pharmaceutically acceptable salts thereof, wherein:

[0018]

[0019] R 1 Choose freely - OR a The group consisting of 5- to 6-membered heteroaryl groups;

[0020] R 2 and R 3 Each independently selects from the following groups: H, C 1-6 alkyl,

[0021] -OR b -C 0-6 Alkylene-SO2R 4 and -C(O)OR 5 ;

[0022] R 4 Yes - OR 5 C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, heterocyclic C 1-6 Alkyl, C 1-6 Hydroxyalkyl, C 3-8 cycloalkyl C 0-6 alkyl;

[0023] R 5 Is it H or C? 1-6 alkyl;

[0024] R a Choose from the following groups: H, -P(O)(R b )2、-C(O)R c -C(O)OR c C 1-6 Alkyl and C 1-6 Hydroxyalkyl;

[0025] Each R b Independently choose H and C 1-6 The group consisting of alkyl groups; and

[0026] Each R c Independently select H and C 1-6 Alkyl and C 1-6 The group consisting of hydroxyalkyl groups.

[0027] In one embodiment, this disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.

[0028] In one embodiment, this disclosure provides a pharmaceutical combination comprising a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, and one or more therapeutically active agents.

[0029] On the other hand, this disclosure provides a method for treating a disorder or disease mediated by the mTOR pathway in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I), or a pharmaceutical composition, or a combination thereof.

[0030] On the other hand, this disclosure provides a method for treating a disease or disorder in a subject, wherein a target tissue, organ, or cell associated with the pathology of the disease or disorder has an insufficient level of FKBP12 to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition described herein, or a combination of pharmaceuticals described herein.

[0031] In one embodiment, for example, compared to rapamycin or RAD001, a compound having formula (I) or a pharmaceutically acceptable salt thereof has a higher affinity for binding to FKBP12, FKBP51 and / or FKBP52, sufficient to inhibit mTORC1.

[0032] In one embodiment, a compound having formula (I) or a pharmaceutically acceptable salt thereof may be complexed with FKBP12, FKBP25, FKBP51 and / or FKBP52 to more effectively bind to and inhibit mTORC1 compared to rapamycin or RAD001.

[0033] In one embodiment, for example, it has a higher affinity for FKBP12, FKBP25, FKBP51 and / or FKBP52 compared to rapamycin or RAD001, thereby producing greater efficacy.

[0034] In one embodiment, the therapeutic efficacy is determined empirically, for example, compared to rapamycin or RAD001.

[0035] On the other hand, this disclosure provides a method for treating a subject with or determined to have an insufficient level of FKBP12 to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition described herein, or a combination of pharmaceuticals described herein.

[0036] In one embodiment, the subject has or is determined to have FKBP12 levels in target tissues, organs, or cells associated with the pathology of the disease or disorder that are insufficient to inhibit mTORC1.

[0037] In one embodiment, for example, compared to rapamycin or RAD001, a compound having formula (I) or a pharmaceutically acceptable salt thereof has a higher affinity for binding to FKBP12, FKBP25, FKBP51 and / or FKBP52, sufficient to inhibit mTORC1.

[0038] In one embodiment, the therapeutic efficacy is determined empirically, for example, compared to rapamycin or RAD001.

[0039] On the other hand, this disclosure provides a method for treating a subject with or previously determined to have FKBP12 levels sufficient to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition described herein, or a combination of pharmaceuticals described herein.

[0040] On the other hand, this disclosure provides a method for treating an age-related disease or disorder in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition described herein, or a combination of pharmaceuticals described herein.

[0041] In one embodiment, the disease or disorder is selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, and hypertension. Pressure), erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment (e.g., weakness), cognitive decline, tendon stiffness, cardiac dysfunction (e.g., cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as kidney failure, blindness, and neuropathy).

[0042] On the other hand, this disclosure provides a method for treating a disease or disorder in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition, or a combination of pharmaceuticals thereof, wherein the disorder or disease is selected from:

[0043] - Acute or chronic organ or tissue transplant rejection;

[0044] - Transplant vascular disease;

[0045] - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration;

[0046] - Autoimmune diseases and inflammatory conditions;

[0047] -asthma;

[0048] - Multidrug resistance (MDR);

[0049] - Fungal infection;

[0050] -Inflammation;

[0051] -Infect;

[0052] - Age-related diseases;

[0053] - Neurodegenerative diseases;

[0054] - Proliferative disorders, such as cancer;

[0055] - Seizures and disorders associated with seizures; and

[0056] - Mitochondrial myopathy and mitochondrial stress.

[0057] On the other hand, this disclosure provides a method for treating cancer in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition described herein, or a combination of pharmaceuticals described herein.

[0058] In one embodiment, the method further includes a PD-1 / PDL-1 inhibitor.

[0059] In one embodiment, the cancer is selected from kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and cervical cancer.

[0060] In one embodiment, the impairment is a liver impairment that includes fibrotic and / or inflammatory processes, such as liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis.

[0061] In one embodiment, the disorder is a renal disorder that includes a fibrotic or inflammatory process in the kidney, such as renal fibrosis, which occurs as a result of acute kidney injury, leading to chronic kidney disease and diabetic nephropathy.

[0062] In one embodiment, the impairment is a cardiac dysfunction, such as myocardial infarction or cardiac hypertrophy. In one embodiment, the cardiac dysfunction is systolic and / or diastolic dysfunction. In one embodiment, the cardiac dysfunction is hypertension. In one embodiment, the cardiac dysfunction results in a reduced ejection fraction.

[0063] In one embodiment, the obstacle is oncogenic immune aging due to reduced immune surveillance.

[0064] In one embodiment, the barrier is cancer, including tumors treated with immunotherapy and those previously treated with rapamycin, RAD001, or another rapamycin analog. In one embodiment, the cancer includes tumors showing activation of the mTOR pathway, including cases where a mutation is present in the Tsc1 gene, or cases where the tumor microenvironment has been appropriately treated with a rapamycin analog.

[0065] This document sets forth details of one or more embodiments of the present disclosure. Other features, objectives, and advantages of this disclosure will become apparent from the accompanying drawings, detailed description, examples, and claims. Attached Figure Description

[0066] Figure 1 The X-ray eutectic structure of compound 2 and FKBP12 was depicted. The C16 substituent is in the (S)- configuration.

[0067] Figure 2 The X-ray eutectic structure of compound 29 and FKBP12 was depicted. The C16 substituent is in the (R)- configuration.

[0068] Figure 3A Line graphs showing the plasma concentrations of RAD001 in rats after intravenous (iv) and oral (po) administration were plotted. Y-axis - plasma concentration of RAD001 (nM). X-axis - time of blood collection (hours) after RAD001 administration. Data are presented as mean ± standard deviation from 3 rats.

[0069] Figure 3B Line graphs were plotted showing the plasma concentrations of compound 2 in rats following intravenous (iv) and oral (po) administration. Y-axis – plasma concentration of compound 2 (nM). X-axis – time of blood collection (hours) after administration of compound 2. Data are presented as mean ± standard deviation from 3 rats.

[0070] Figure 4A and 4B Compound 2 was shown to inhibit the mTORC1 pathway in rat liver. Rats were administered a single oral dose of compound 2 at doses of 1, 3, or 10 mg / kg, and liver samples were collected 3 hours after administration. Rats treated with the carrier were used as controls. Figure 4A Immunoblot images of phosphorylated (p-) and total (t-)S6 protein in rat livers treated with the medium or compound 2 at 1, 3, or 10 mg / kg and analyzed 3 hours post-treatment are shown. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as a protein loading control. Figure 4B The histogram in the image shows the quantification of optical density from p-S6 to t-S6. Figure 4B In the histograms depicted, each bar shows an arbitrary value representing the p-S6 / t-S6 ratio. The X-axis represents the oral dose (1, 3, or 10 mg / kg). The Y-axis represents arbitrary units. Six rats were used in each experimental group. Data are presented as mean ± standard deviation. Data were analyzed using one-way ANOVA followed by Dunnett's multiple comparison test, where the means of all groups were compared to the mediator treatment group. ****P < 0.001.

[0071] Figures 5A-5D The image depicts the results of treatment with compound 2 (solid line) or RAD001 (dashed line) on the wild-type ( Figure 5A FKBP12 knockout Figure 5B ), FKBP12 / 12.6 / 13 / 52 / 51 knockout ( Figure 5C ) and FKBP12 / 12.6 / 25 / 52 / 51 knockout ( Figure 5D Line graph showing S6K1 (Thr389) inhibition in 293T cells. Cells were treated in triplicate. The Y-axis represents the percentage inhibition of S6K1 (Thr389) levels relative to cells treated with DMSO medium. The X-axis represents the concentration of compound 2 or RAD001. Detailed Implementation

[0072] The compounds disclosed in this article are mTORC1 inhibitors that can be used to treat disorders, particularly age-related disorders, or disorders that are currently approved for treatment with rapamycin analogs (such as RAD001).

[0073] definition

[0074] Unless otherwise specified, the terms “compounds of the disclosure” or “compound of the disclosure” mean compounds having formula (I), sub-formulas (I)-A, (I)-B, (I)-C, (I)-D, (I)-E, (I)-F, example compounds and their salts, and all stereoisomers (including diastereomers and enantiomers), rotational isomers, tautomers and isotopically labeled compounds (including deuterium-substituted compounds) and the inherently formed moieties.

[0075] The term "therapeuticly effective amount" for compounds disclosed herein refers to the amount of the compound disclosed herein that will elicit a biological or medical response in a subject (e.g., reduction or inhibition of enzyme or protein activity, or improvement of symptoms, relief of condition, slowing or delaying disease progression, or prevention of disease, etc.). In one embodiment, the term "therapeuticly effective amount" refers to an amount of the compound disclosed herein that, when administered to a subject, effectively (1) at least partially relieves or improves a condition or disorder or disease (i) mediated by the mTOR pathway, or (ii) is associated with mTOR activity, or (iii) is characterized as mTOR activity (normal or abnormal); or (2) reduces or inhibits mTOR activity; or (3) reduces or inhibits mTOR expression. In one embodiment, the term "therapeuticly effective amount" refers to an amount of the compound disclosed herein that, when administered to cells, or tissues, or non-cellular biological materials, or media, effectively reduces or inhibits mTOR activity; or at least partially reduces or inhibits mTOR expression.

[0076] As used herein, the term "subject" refers to a primate (e.g., a human (male or female)), dog, cat, rabbit, guinea pig, pig, rat, and mouse. In some embodiments, the subject is a primate. In still other embodiments, the subject is a human.

[0077] As used herein, the term "administer (administering or administration)" means the introduction of the compound of the present invention or a pharmaceutical composition thereof into the body by means of implantation, absorption, ingestion, injection, inhalation or other means.

[0078] As used herein, the term “inhibit (inhibition or inhibiting)” means the reduction or suppression of a given condition, symptom or disorder, or disease, or a significant reduction in baseline activity of a biological activity or process.

[0079] As used herein, the term "treatment" for any disease or disorder means the relief, delay of onset, or improvement of the disease or disorder (i.e., slowing or halting the development of the disease or at least one of its clinical symptoms); or the relief or improvement of at least one physical parameter or biomarker associated with said disease or disorder, including those that the patient may not be able to identify. In one embodiment, "treatment" requires the development or observation of signs or symptoms of a disease, disorder, or condition. In other embodiments, treatment may be administered in the absence of signs or symptoms of a disease or condition. For example, treatment may be administered to a susceptible individual before the onset of symptoms (e.g., based on a history of symptoms and / or based on genetic or other susceptibility factors). Treatment may also continue after symptoms have subsided, for example, to delay or prevent recurrence.

[0080] As used herein, the term “prevent, preventing, or prevention” for any disease or disorder refers to preventive treatment of the disease or disorder; or delaying the onset or progression of the disease or disorder.

[0081] As used herein, “age-related disease or disorder” refers to any disease or disorder whose prevalence in a population or severity in an individual is associated with the progression of age. More specifically, an age-related disease or disorder is one whose prevalence is at least 1.5 times higher in individuals aged 65 and older than in individuals aged 25-35. Examples of age-related disorders include, but are not limited to: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic disorders, renal vascular disease, hearing loss, mobility impairment (e.g.) Examples include: weakness, cognitive decline, tendon stiffness, cardiac dysfunction (such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as kidney failure, blindness, and neuropathy).

[0082] As used in this article, a subject is considered "needing" treatment if the subject will benefit from it biologically, medically, or in terms of quality of life.

[0083] As used herein, the terms “a”, “the”, and similar terms used in the context of this disclosure (particularly in the context of the claims) should be interpreted as encompassing both the singular and the plural, unless otherwise indicated or clearly contradicted by the context.

[0084] The term "alkyl" refers to a group having a straight-chain or branched saturated hydrocarbon group having 1 to 6 carbon atoms ("C"). 1-6 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 5 carbon atoms (“C”). 1-5 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 4 carbon atoms (“C”). 1-4 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 3 carbon atoms (“C”).1-3 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 2 carbon atoms (“C”). 1-2 Alkyl group (“C1 alkyl”). In some embodiments, the alkyl group has 1 carbon atom (“C1 alkyl”). In some embodiments, the alkyl group has 2 to 6 carbon atoms (“C1 alkyl”). 2-6 Alkyl group). C 1-6 Examples of alkyl groups include methyl (C1), ethyl (C2), propyl (C3) (e.g., n-propyl, isopropyl), butyl (C4) (e.g., n-butyl, tert-butyl, sec-butyl, isobutyl), pentyl (C5) (e.g., n-pentyl, 3-pentyl, pentylyl, neopentyl, 3-methyl-2-butylyl, tert-pentyl), and hexyl (C6) (e.g., n-hexyl).

[0085] "alkylene" refers to a divalent group of an alkyl group, such as -CH2-, -CH2CH2-, and -CH2CH2CH2-.

[0086] "Heteroalkyl" refers to an alkyl group that further includes at least one heteroatom selected from oxygen, nitrogen, or sulfur (e.g., 1, 2, 3, or 4 heteroatoms) located at one or more terminal positions of the parent chain (i.e., inserted between adjacent carbon atoms) and / or at one or more terminal positions of the parent chain. In some embodiments, the heteroalkyl group is a saturated group ("heteroalkyl") having 1 to 6 carbon atoms and 1 or more heteroatoms within the parent chain. 1-6 Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group (“heteroalkyl”) having 1 to 5 carbon atoms and 1 or 2 heteroatoms within the parent chain. 1-5 Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group (“heteroalkyl”) having 1 to 4 carbon atoms and 1 or 2 heteroatoms within the parent chain. 1-4 Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group (“heteroalkyl”) having 1 to 3 carbon atoms and 1 heteroatom within the parent chain. 1-3 Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group (“heteroalkyl”) having 1 to 2 carbon atoms and 1 heteroatom in the parent chain. 1-2 Alkyl group”). In some embodiments, the heteroalkyl group is a saturated group having one carbon atom and one heteroatom (“hetero-C1 alkyl”). In some embodiments, the heteroalkyl group is a saturated group having two to six carbon atoms and one or two heteroatoms within the parent chain (“hetero-C1 alkyl”). 2-6 alkyl").

[0087] "Haloalkyl" refers to a substituted alkyl group in which one or more hydrogen atoms are independently replaced by a halogen (e.g., fluorine, bromine, chlorine, or iodine), and includes an alkyl moiety in which all hydrogen atoms are replaced by a halogen group (e.g., perfluoroalkyl). In some embodiments, the haloalkyl moiety has 1 to 6 carbon atoms ("C60-C60").1-6 (Halogenated alkyl group). In some embodiments, the halogenated alkyl group has 1 to 4 carbon atoms ("C10"). 1-4 (Halogenated alkyl group). In some embodiments, the halogenated alkyl group has 1 to 3 carbon atoms ("C10"). 1-3 (Halogenated alkyl group). In some embodiments, the halogenated alkyl group has 1 to 2 carbon atoms ("C10"). 1-2 Haloalkyl groups”). Examples of haloalkyl groups include -CF3, -CF2CF3, -CF2CF2CF3, -CCl3, -CH2CH2Cl, -CH2CH2CH2Cl, -CFCl2, -CF2Cl, etc.

[0088] Hydroxy C 1-6 "Alkyl" refers to an alkyl group that has been substituted by one or more -OH groups. Hydroxyl group (C) 1-6 Examples of alkyl groups include HO-CH2-, HO-CH2CH2-, and -CH2-CH(OH)CH3.

[0089] "Cycloalkyl" refers to a cyclic, bicyclic, tricyclic, or polycyclic non-aromatic hydrocarbon group having 3 to 12 carbon atoms. In one embodiment, a cycloalkyl group is a monocyclic ring having 3 to 6 carbon atoms. The cycloalkyl group may contain a fused ring or a spirocyclic ring. A fused ring is a ring sharing a single carbon atom. Examples of cycloalkyl moieties include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, adamantyl, and norbenzeneyl.

[0090] "Cycloalkylalkyl" refers to a (cycloalkyl)-alkyl group, wherein the cycloalkyl and alkyl groups are as disclosed herein. The "cycloalkylalkyl" is bonded to the parent molecule structure via an alkyl group. In one embodiment, the cycloalkylalkyl moiety is a C3 cycloalkyl C3 cycloalkyl group. 1-6 Alkyl group. In one embodiment, the cycloalkyl group is a C4 cycloalkyl group. 1-6 Alkyl group. In one embodiment, the cycloalkyl group is a C5 cycloalkyl group. 1-6 Alkyl group. In one embodiment, the cycloalkyl group is a C6 cycloalkyl group. 1-6 Alkyl group. In one embodiment, the cycloalkyl group is a C3 cycloalkyl group. 1-3 Alkyl group. In one embodiment, the cycloalkyl group is a C4 cycloalkyl group. 1-3 Alkyl group. In one embodiment, the cycloalkyl group is a C5 cycloalkyl group. 1-3 Alkyl group. In one embodiment, the cycloalkyl group is a C6 cycloalkyl group. 1-3 Alkyl groups.

[0091] "Heteroaryl" refers to a stable aromatic monocyclic or bicyclic group having a specified number of ring atoms and containing one or more heteroatoms individually selected from nitrogen, oxygen, and sulfur. Heteroaryl groups can be bonded via carbon atoms or heteroatoms. In one embodiment, the heteroaryl is a 5- or 6-membered heteroaryl. In one embodiment, the heteroaryl is a 5-membered heteroaryl. In one embodiment, the heteroaryl is a 6-membered heteroaryl. Examples of heteroaryl groups include, but are not limited to, furanyl, pyrroleyl, thiopheneyl, pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, triazolyl, tetrazolyl, pyrazinyl, pyridazinyl, pyrimidinyl, quinolinyl, isoquinolinyl, indolyl, inzolyl, oxadiazolyl, benzothiazolyl, quinoxalinyl, and so on.

[0092] As used in this article, "hydroxyl" (hydroxy or hydroxyl) refers to -OH.

[0093] As used herein, when each expression (e.g., alkyl, m, n, etc.) appears more than once in any structure, its definition is intended to be independent of its definition in other positions in the same structure.

[0094] The following describes the definitions of specific functional groups and chemical terms in more detail. Chemical elements are identified according to the periodic table, CAS version, Handbook of Chemistry and Physics, 75th edition, inside cover, and specific functional groups are generally defined as described therein. In addition, general principles of organic chemistry, as well as descriptions of specific functional parts and reactivity, are found in Thomas Sorrell, Organic Chemistry, University Science Books, Sosalito, 1999; Smith and March, March's Advanced Organic Chemistry, 5th ed., John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3rd ed., Cambridge University Press, Cambridge, 1987.

[0095] Certain compounds disclosed herein may exist in specific geometric or stereoisomeric forms. For example, if a specific enantiomer of a disclosed compound is desired, it may be prepared by asymmetric synthesis or by derivatization with a chiral auxiliary agent, wherein the resulting mixture of diastereomers is separated and the auxiliary group is cleaved to provide the desired pure enantiomer. Alternatively, in the case where the molecule contains a basic functional group (e.g., amino) or an acidic functional group (e.g., carboxyl), the diastereomers formed are separated by forming a diastereomeric salt with a suitable optically active acid or base, followed by stepwise crystallization or chromatographic methods well known in the art, and subsequently the pure enantiomers are recovered.

[0096] Unless otherwise stated, the structures described herein also imply the inclusion of geometric (or conformational) forms of the structure; for example, R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers of the disclosed compounds, as well as enantiomers, diastereomers, and mixtures of geometric (or conformations), are all within the scope of this disclosure. Unless otherwise stated, all tautomer forms of the disclosed compounds are within the scope of this disclosure. Additionally, unless otherwise stated, the structures described herein are also intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the structures disclosed herein include those with hydrogen replaced by deuterium or tritium, or those enriched with... 13 C- or 14 Carbon substitutions for carbon in C- are all within the scope of this disclosure. Such compounds may be used, for example, as analytical tools, as probes in biological assays, or as therapeutic agents according to this disclosure.

[0097] The “enantiomer excess” or “% enantiomer excess” of the composition can be calculated using the equation shown below. In the example shown below, the composition contains 90% of one enantiomer (e.g., the S enantiomer) and 10% of another enantiomer (i.e., the R enantiomer).

[0098] ee=(90-10) / 100*100%=80%.

[0099] Therefore, a composition containing 90% of one enantiomer and 10% of the other enantiomer is believed to have an 80% enantiomer excess. The compounds or compositions described herein may contain at least 50%, 75%, 90%, 95%, or 99% enantiomer excess of one form of the compound (S-enantiomer). In other words, such compounds or compositions contain an enantiomer excess of the S enantiomer in greater quantities than the R enantiomer.

[0100] Where a particular enantiomer is preferred, in some embodiments it may be substantially free of the corresponding enantiomer and may also be provided as “optically enriched.” As used herein, “optically enriched” means that the compound consists of a significantly larger proportion of one enantiomer. In some embodiments, the compound consists of at least about 90% by weight of the preferred enantiomer. In other embodiments, the compound consists of at least about 95%, 98%, or 99% by weight of the preferred enantiomer. The preferred enantiomers can be separated from the racemic mixture by any method known to those skilled in the art, including chiral high-performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts, or prepared by asymmetric synthesis. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); Wilen, Tables of Resolving Agents and Optical Resolutions, p. 268 (Ellie Liel, ed., Univ. of Notre Dame Press, Notre Dame, IN 1972).

[0101] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise obviously contradicted by the context. Any and all instances or exemplary language (such as "for example") provided herein are intended only to better illustrate this disclosure and do not limit the scope of this disclosure as otherwise claimed.

[0102] Any resulting mixture of isomers can be separated into pure or substantially pure geometric or optical isomers, diastereomers, racemates, for example by chromatography and / or fractional crystallization, based on the physicochemical differences of the components.

[0103] Racemic derivatives of any resulting end product or intermediate can be resolved into optical enantiomers using known methods, such as by separating their diastereomer salts obtained with optically active acids or bases and releasing the optically active acidic or basic compounds. In particular, the compounds disclosed herein can therefore be resolved into their optical enantiomers using a basic moiety, for example by fractional crystallization with salts formed from optically active acids, such as tartaric acid, dibenzoyltartaric acid, diacetyltartaric acid, di-O,O'-p-toluyltartaric acid, mandelic acid, malic acid, or camphor-10-sulfonic acid. Racemic products can also be resolved by chiral chromatography, such as high-performance liquid chromatography (HPLC) using chiral adsorbents.

[0104] The compounds disclosed herein may also contain atomic isotopes in non-natural proportions at one or more atoms constituting such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as deuterium (…). 2 H), tritium ( 3 H), carbon-13 ( 13 C) or carbon-14 ( 14 C). All isotopic variants of the compounds disclosed herein, whether radioactive or not, are intended to be covered within the scope of this disclosure. Furthermore, all tautomeric forms of the compounds described herein are intended to fall within the scope of this disclosure.

[0105] The term "tautomer" refers to a specific compound structure that has interchangeable forms and varies in terms of hydrogen atom and electron shifts. Thus, the two structures can be in equilibrium through the movement of π electrons and atoms (usually H). For example, enols and ketones are tautomers because they rapidly interconvert by treatment with an acid or base. Another example of tautomerism is the acid- and nitro-forms of phenylnitromethane, which are also formed by treatment with an acid or base. Tautomerism can be associated with obtaining optimal chemical reactivity and biological activity of the desired compound.

[0106] compound

[0107] On the one hand, this disclosure provides compounds having formula (I) or pharmaceutically acceptable salts thereof, wherein:

[0108]

[0109] R 1 Choose freely - OR a The group consisting of 5- to 6-membered heteroaryl groups;

[0110] R 2 and R 3 Each independently selects from the following groups: H, C 1-6 Alkyl, -ORb -C 0-6 Alkylene-SO2R 4 and -C(O)OR 5 ;

[0111] R 4 Yes - OR 5 C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, heterocyclic C 1-6 Alkyl, C 1-6 Hydroxyalkyl, C 3-8 cycloalkyl C 0-6 alkyl;

[0112] R 5 Is it H or C? 1-6 alkyl;

[0113] R a Choose from the following groups: H, -P(O)(R b )2、-C(O)R c -C(O)OR c C 1-6 Alkyl and C 1-6 Hydroxyalkyl;

[0114] Each R b Independently choose H and C 1-6 The group consisting of alkyl groups; and

[0115] Each R c Independently select H and C 1-6 Alkyl and C 1-6 The group consisting of hydroxyalkyl groups.

[0116] In one embodiment, R 1 Yes - OR a In one embodiment, R 1 It is a 5- to 6-membered heteroaryl group, for example, a 5-membered heteroaryl group. In one embodiment, R 1 Select free hydroxyl groups, A group that is formed.

[0117] In one embodiment, R 2 and R 3 Each can independently choose H and -OR. b A group consisting of [various components]. In one embodiment, R 2 and R 3 Each independently chooses H and C. 1-6 Alkyl and -C 0-6 Alkylene-SO2R 4 A group consisting of [various components]. In one embodiment, R 2 and R 3Each is independently selected from H, hydroxyl, and -C. 0-6 Alkylene-SO2R 4 and -C(O)OR 5 A group that is formed.

[0118] In one embodiment, the compound is a compound having formula (I) or a pharmaceutically acceptable salt thereof, wherein:

[0119] R 1 Choose from the following groups: hydroxyl,

[0120] R 2 and R 3 Each is independently selected from H, hydroxyl, and -C. 0-6 Alkylene-SO2R 4 and -C(O)OR 5 The group formed;

[0121] R 4 Yes - OR 5 C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Hydroxyalkyl, C 3-8 cycloalkyl C 0-6 Alkyl; and

[0122] R 5 Is it H or C? 1-6 Alkyl group. In one embodiment, R 2 Is it H, hydroxyl, or C? 1-6 Alkyl; and R 3 It is -C 0-6 Alkylene-SO2R 4 or -C(O)OR 5 .

[0123] In one embodiment, the compound is a compound having formula (I) or a pharmaceutically acceptable salt thereof, wherein:

[0124] R 1 It is a hydroxyl group;

[0125] R 2 and R 3 Each is independently selected from H and -C. 0-6 Alkylene-SO2R 4 The group formed; and

[0126] R 4 It is C 1-6 Alkyl group. In one embodiment, R 2 and R 3 One is H and the other is -C0-6 Alkylene-SO2R 4 .

[0127] In one embodiment, the compound is a compound having the structural formula (I)-A or (I)-B:

[0128]

[0129] In one embodiment, the compound is a compound having the structural formula (I)-C or (I)-D:

[0130]

[0131] In one embodiment, the compound is a compound having the structural formula (I)-E or (I)-F:

[0132]

[0133] In one embodiment, the compound or a pharmaceutically acceptable salt thereof is selected from Table 1:

[0134] Table 1

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147] Pharmaceutically acceptable salts

[0148] Pharmaceutically acceptable salts of these compounds may also be considered for use in the purposes described herein. As used herein, the term "salt" (or "salts") refers to an acid addition salt or a base addition salt of the compounds disclosed herein. "Salt" specifically includes "pharmaceutically acceptable salts." The term "pharmaceutically acceptable salt" means a salt that retains the bioavailability and properties of the compounds disclosed herein, and these salts are typically not biologically or otherwise undesirable. In many cases, the compounds disclosed herein are capable of forming acid and / or base salts due to the presence of amino and / or carboxyl groups or similar groups.

[0149] Pharmaceutically acceptable acid addition salts can be formed from inorganic and organic acids.

[0150] Inorganic acids that can form salts include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid.

[0151] Organic acids that can be used to derive salts include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicylic acid, etc.

[0152] Pharmaceutically acceptable base addition salts can be formed using inorganic and organic bases.

[0153] Inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I through XII of the periodic table. In some embodiments, salts are derived from sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium salts, potassium salts, sodium salts, calcium salts, and magnesium salts.

[0154] Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines; substituted amines (including naturally occurring substituted amines); cyclic amines; and basic ion exchange resins. Some organic amines include isopropylamine, benzylamine, choline salts, diethanolamine, diethylamine, lysine, meglumine, piperazine, and tromethamine.

[0155] On the other hand, this disclosure provides compounds in the following forms having formulas (I), (I)-A, (I)-B, (I)-C, (I)-D, (I)-E, and (I)-F: acetates, ascorbic acid salts, adipates, aspartates, benzoates, benzenesulfonates, bromides / hydrobromates, bicarbonates / carbonates, bisulfates / sulfates, camphorsulfonates, decanoates, chlorides / hydrochlorides, chlortheophyllonates, citrates, ethanedisulfonates, fumarates, glucohepanoates, glucuronates, and glutamic acid. Salts, glutarate, glycolic acid, hippurate, hydroiodide / iodide, hydroxyethyl sulfonate, lactate, lacturonate, dodecyl sulfate, malate, maleate, malonate, mandelate, methanesulfonate, methyl sulfate, mucilage, naphthate, naphthalenesulfonate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, dihydroxynaphthalate, phosphate / hydrogen phosphate / dihydrogen phosphate, polygalacturonate, propionate, sebate, stearate, succinate, sulfosalicylate, sulfate, tartrate, toluenesulfonate, trifluoromethanesulfonate, trifluoroacetate, or sine in the form of naphthate.

[0156] Pharmaceutical Composition

[0157] On the other hand, this disclosure provides a pharmaceutical composition comprising one or more compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharmaceutically acceptable salts thereof, and one or more pharmaceutically acceptable carriers. The term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or medium relating to carrying or transporting any composition or component of the present invention, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulation material. Each carrier must be "acceptable" in the sense of compatibility with the subject composition and its components and harmlessness to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered astragalus gum; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, Soybean oil, etc.; (10) glycols, such as propylene glycol; (11) polyols, such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) phosphate buffer; and (21) other non-toxic compatible substances used in pharmaceutical preparations.

[0158] The compositions disclosed herein can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or via an implanted reservoir. As used herein, the term “parenterally” includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intraosseous, intrasheathic, intrahepatic, intralesional, and intracranial injection or infusion techniques. In some embodiments, the compositions disclosed herein are administered orally, intraperitoneally, or intravenously. The sterile injectable form of the compositions disclosed herein can be an aqueous or oily suspension. These suspensions can be formulated using suitable dispersants or wetting agents and suspending agents according to techniques known in the art. The sterile injectable formulation can also be a sterile injectable solution or suspension in a non-toxic, parenterally acceptable diluent or solvent (e.g., a solution in 1,3-butanediol). Water, Ringer's solution, and isotonic sodium chloride solution are acceptable media and solvents. In addition, sterile, non-volatile oils can routinely be used as solvents or suspension media.

[0159] For this purpose, any mild, non-volatile oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids (such as oleic acid and its glyceride derivatives) are pharmaceutically acceptable oils (such as olive oil or castor oil) because they are natural, and especially their polyoxyethylene forms, can also be used to prepare injectable formulations. These oil solutions or suspensions may also contain long-chain alcohol diluents or dispersants (such as carboxymethyl cellulose or similar dispersants), which are commonly used to formulate pharmaceutically acceptable dosage forms (including emulsions and suspensions). Other commonly used surfactants, such as..., can also be used for formulation purposes. Spans and other emulsifiers or bioavailability enhancers are commonly used to prepare pharmaceutically acceptable solid, liquid or other dosage forms.

[0160] The pharmaceutically acceptable compositions disclosed herein can be administered orally in any orally acceptable dosage form, including but not limited to capsules, tablets, aqueous suspensions, or solutions. For tablets used orally, common carriers include lactose and corn starch. Lubricants, such as magnesium stearate, are typically added. For oral administration in capsule form, useful diluents include lactose and dried corn starch. When an oral aqueous suspension is required, the active ingredient is mixed with an emulsifier and a suspending agent. Sweeteners, flavoring agents, or coloring agents may also be added if desired.

[0161] Alternatively, the pharmaceutically acceptable compositions disclosed herein may be administered rectally in suppository form. These can be prepared by mixing the pharmaceutical preparation with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature, and thus melts in the rectum to release the drug. These materials include cocoa butter, beeswax, and polyethylene glycol.

[0162] The pharmaceutically acceptable compositions disclosed herein can also be applied topically, particularly when the target of treatment includes areas or organs easily accessible by topical application (including eye, skin, or lower bowel diseases). Suitable topical formulations are readily prepared for each of these areas or organs. Topical application to the lower bowel can be performed using rectal suppository formulations (see above) or as suitable enema formulations. Topical transdermal patches may also be used.

[0163] For topical application, pharmaceutically acceptable compositions may be formulated into suitable ointments containing an active ingredient suspended or dissolved in one or more carriers. Carriers for the topical application of the disclosed compounds include, but are not limited to, mineral oils, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsified waxes, and water. Alternatively, pharmaceutically acceptable compositions may be formulated into suitable lotions or creams containing an active ingredient suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include, but are not limited to, mineral oils, sorbitan monostearate, polysorbate 60, cetyl wax, cetearyl alcohol, 2-octyldodecanool, benzyl alcohol, and water.

[0164] The pharmaceutically acceptable compositions disclosed herein can also be administered via nasal spray or inhalation. Such compositions are prepared according to techniques well known in the field of pharmaceutical formulation and can be prepared in the form of a saline solution using benzyl alcohol or other suitable preservatives, bioavailability enhancers, fluorocarbons, and / or other conventional solubilizers or dispersants. The amount of the disclosed compounds that can be combined with a carrier material to produce a single dosage form of the composition will vary depending on the host being treated and the specific route of administration. Preferably, the compositions should be formulated such that an inhibitor can be administered to a patient receiving these compositions at a dose of 0.01-100 mg / kg body weight / day.

[0165] Isotope-labeled compounds

[0166] Compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharmaceutically acceptable salts thereof, are also intended to represent both unlabeled and isotopically labeled forms of the compound. Isotopically labeled compounds have structures represented by the formulas given herein, except that one or more atoms are replaced by atoms having a selected atomic mass or mass number. Examples of isotopes that may be incorporated into the compounds disclosed herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, for example, […]. 2 H, 3 H, 11 C 13 C 14 C 15 N、 18 F, 31 P, 32 P, 35 S, 36 Cl、 123 I, 124 I, 125 I. This disclosure includes compounds labeled with various isotopes as defined herein, such as those containing radioactive isotopes (e.g., 3 H and 14Those compounds in C), or those containing non-radioactive isotopes (e.g. 2 H and 13 Those compounds in C). These isotopically labeled compounds can be used for metabolic studies (using...) 14 C) Reaction kinetic studies (e.g., using...) 2 H or 3 H), detection or imaging techniques (such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT), including drug or substrate tissue distribution assays), or for use in the patient's radiation therapy. Specifically, 18 F or labeled compounds may be particularly desirable for PET or SPECT studies. Isotopically labeled compounds having formula (I), (Ia), or (Ib) or pharmaceutically acceptable salts thereof can generally be prepared by conventional techniques known to those skilled in the art or by methods similar to those described in the appended examples and preparations, using an appropriate isotopically labeled reagent instead of an unlabeled previously used reagent.

[0167] In addition, heavier isotopes, especially deuterium (i.e., 2 H or D substitution can provide certain therapeutic advantages derived from greater metabolic stability (e.g., prolonged in vivo half-life, reduced dose requirement, or improved therapeutic index). It should be understood that, in this context, deuterium is considered to be a substituent of compounds having formulas (I), (I)-A, (I)-B, (I)-C, (I)-D, (I)-E, and (I)-F, or a pharmaceutically acceptable salt thereof. The concentration of such heavier isotopes (particularly deuterium) can be defined by an isotope enrichment factor. As used herein, the term "isotope enrichment factor" refers to the ratio between the isotope abundance and the natural abundance of a particular isotope. If the substituents in the compounds disclosed herein indicate deuterium, such compounds have an isotopic enrichment factor for each specified deuterium atom of at least 3500 (52.5% deuterium doping on each specified deuterium atom), at least 4000 (60% deuterium doping), at least 4500 (67.5% deuterium doping), at least 5000 (75% deuterium doping), at least 5500 (82.5% deuterium doping), at least 6000 (90% deuterium doping), at least 6333.3 (95% deuterium doping), at least 6466.7 (97% deuterium doping), at least 6600 (99% deuterium doping), or at least 6633.3 (99.5% deuterium doping).

[0168] dose

[0169] The toxicity and therapeutic efficacy of the disclosed compounds (including pharmaceutically acceptable salts and deuterated variants) can be determined in cell cultures or laboratory animals using standard pharmaceutical methods. LD 50ED50 is the lethal dose for 50% of the population. ED50 is the therapeutically effective dose for 50% of the population. The dose ratio between toxicity and therapeutic effect (LD50) 50 / ED 50 The therapeutic index is the highest possible value. Compounds exhibiting a high therapeutic index are preferred. Although compounds exhibiting toxic side effects can be used, delivery systems for targeting such compounds to affected tissue sites should be carefully designed to minimize potential damage to uninfected cells and thereby reduce side effects.

[0170] Data obtained from cell culture assays and animal studies can be used to formulate a range of dosages for human use. Dosages of these compounds are in the range including ED (Extracorporeal Therapy). 50 The dose is within a range of circulating concentrations with very low or no toxicity. This dose may vary within this range depending on the dosage form and route of administration. For any compound, the therapeutically effective dose can be initially estimated based on cell culture assays. Doses can be formulated in animal models to achieve the range of circulating plasma concentrations determined in cell culture, including the IC50 range. 50 (That is, the concentration at which the test compound achieves half-maximal symptom inhibition). This type of information can be used to more accurately determine the dosage that is useful in humans. The level in plasma can be measured, for example, by high-performance liquid chromatography.

[0171] It should also be understood that the specific dosage and treatment regimen for any particular patient will depend on a variety of factors, including the activity of the specific compound used, age, weight, general health condition, sex, diet, timing of administration, excretion rate, drug combination, the judgment of the treating physician, and the severity of the specific disease being treated. The amount of the disclosed compounds in the composition will also depend on the specific compounds in the composition.

[0172] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise obviously contradicted by the context. Any and all instances or exemplary language (such as "for example") provided herein are intended only to better illustrate this disclosure and do not limit the scope of this disclosure as otherwise claimed.

[0173] Any asymmetric atom (e.g., carbon, etc.) of one or more compounds disclosed herein may be present in a racemic or enantiomerically enriched form, such as (R)-, (S)-, or (R,S)- configuration. In some embodiments, each asymmetric atom has an enantiomerically abundant (R)- or (S)- configuration of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% enantiomerically abundant. If possible, substituents on atoms having unsaturated double bonds may be present in cis-(Z)- or trans-(E)- form.

[0174] Therefore, as used herein, the compounds disclosed herein may be in the form of one of the following possible stereoisomers, rotational isomers, tautomers, tautomers or mixtures thereof, for example, as substantially pure geometric (cis or trans) stereoisomers, diastereomers, optical isomers (enantiomers), racemates or mixtures thereof.

[0175] Any resulting mixture of stereoisomers can be separated into pure or substantially pure geometric or optical isomers, diastereomers, or racemates based on the physicochemical differences of the components, for example by chromatography and / or fractional crystallization.

[0176] Any racemic mixture of the compounds or intermediates of this disclosure can be resolved into optically active enantiomers by known methods, for example, by separating their diastereomer salts obtained with optically active acids or bases, releasing optically active acidic or basic compounds. In particular, the compounds of this disclosure can therefore be resolved into their optical enantiomers using basic fractions, for example, by fractional crystallization with salts formed from optically active acids, such as tartaric acid, dibenzoyltartaric acid, diacetyltartaric acid, di-O,O'-p-toluyltartaric acid, mandelic acid, malic acid, or camphor-10-sulfonic acid. The racemic compounds or racemic intermediates of this disclosure can also be resolved by chiral chromatography (e.g., high-performance liquid chromatography (HPLC) using chiral adsorbents).

[0177] Diseases and Disabilities

[0178] Compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F may be used to treat age-related diseases or disorders selected from the following:

[0179] Acute or chronic organ or tissue transplant rejection;

[0180] Transplant vascular disease;

[0181] It leads to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and proliferation and migration of smooth muscle cells.

[0182] Autoimmune diseases and inflammatory conditions;

[0183] asthma;

[0184] Multidrug resistance (MDR);

[0185] Fungal infection;

[0186] Inflammation;

[0187] Infect;

[0188] Age-related diseases;

[0189] Neurodegenerative diseases;

[0190] Proliferative disorders, such as cancer;

[0191] Seizures and disorders associated with seizures; and

[0192] Mitochondrial myopathy and mitochondrial stress.

[0193] On the other hand, the compounds disclosed herein can be used to treat conditions that have been shown to increase the likelihood of age-related diseases, such as an increase in aging-inducing cytokines (e.g., IL6).

[0194] On the other hand, the compounds disclosed herein can be used to treat disorders including fibrosis and / or inflammatory processes, such as liver and kidney disorders. Examples include liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis. Another example is kidney fibrosis, which occurs as a result of acute kidney injury leading to chronic kidney disease. Diabetic nephropathy can induce kidney fibrosis and inflammation. Kidney disease often causes heart failure due to elevated blood pressure; this may also be associated with cardiac fibrosis.

[0195] On the other hand, the compounds disclosed herein can be used to treat heart failure. (Buss, SJ et al. Beneficial effects of Mammalian target of rapamycin inhibition on left ventricular remodeling after myocardial infarction. J Am Coll Cardiol. (2009) 54(25):2435-46; Buss, SJ et al. Augmentation of autophagy by mTOR-inhibition inmyocardial infarction: When size matters. Autophagy. (2010) 6(2):304-6).

[0196] On the other hand, the compounds disclosed herein can be used to treat liver fibrosis in patients who have undergone liver transplantation. (Villamil, FG et al. Fibrosis progression in maintenance liver transplant patients with hepatitis C recurrence: a randomized study of RAD001 vs. calcineurin inhibitors. Liver Int. (2014) 34(10): 1513-21).

[0197] Treatment for acute or chronic organ or tissue transplant rejection includes treating recipients of transplants such as heart, lung, cardiopulmonary bypass, liver, kidney, pancreas, skin, or cornea. The compounds disclosed herein are also indicated for the prevention of graft-versus-host disease, such as after bone marrow transplantation.

[0198] Transplant vascular disease includes atherosclerosis.

[0199] Autoimmune diseases and inflammatory conditions specifically include inflammatory conditions with etiologies including autoimmune components such as arthritis (e.g., rheumatoid arthritis, chronic progressive arthritis, and osteoarthritis) and rheumatic diseases. Specific autoimmune diseases that may utilize compounds of formulas (I), (I)-A, (I)-B, (I)-C, (I)-D, (I)-E, and (I)-F include autoimmune hematologic disorders (including, for example, hemolytic anemia, aplastic anemia, simple erythrocytic anemia, and idiopathic thrombocytopenic purpura), systemic lupus erythematosus, polychondritis, scleroderma, Wegener granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, psoriasis, Steven-Johnson syndrome, idiopathic diarrhea, autoimmune inflammatory bowel diseases (including, for example, ulcerative colitis and Crohn's disease), endocrine ophthalmopathy, and Graves' disease. Diseases including sarcoidosis, multiple sclerosis, primary biliary cirrhosis, juvenile diabetes (type 1 diabetes), uveitis (anterior and posterior uveitis), keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial pulmonary fibrosis, psoriatic arthritis, glomerulonephritis (with and without nephrotic syndrome, including idiopathic nephrotic syndrome or minimal change disease), and juvenile dermatomyositis.

[0200] The disclosed compounds can also be used to treat multidrug resistance (MDR), including enhancing the efficacy of other chemotherapeutic agents in treating and controlling MDR conditions such as multidrug-resistant cancer or multidrug-resistant AIDS. MDR is particularly problematic in cancer patients and AIDS patients who do not respond to conventional chemotherapy because the drug is pumped out of the cells via Pgp.

[0201] The compounds disclosed herein may also be used to treat infections, including those caused by pathogens with Mip or Mip-like factors.

[0202] Age-related diseases also include: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic disorders, renal vascular disease, hearing loss, and mobility impairment (e.g., weakness). Weakness, cognitive decline, tendon stiffness, cardiac dysfunction (such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as renal failure, blindness, and neuropathy).

[0203] Neurodegenerative diseases include Huntington's disease, Parkinson's disease, spinocerebellar ataxia type 3, Alzheimer's disease, motor neuron disease, and peripheral neuropathy.

[0204] Proliferative disorders include cancers. These include those listed in U.S. Patent No. 9,669,032, such as kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, stomach cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or cervical cancer.

[0205] Seizures and seizure-related disorders include Wester syndrome, focal cortical dysplasia (FCD), tuberous sclerosis (TSC), childhood absence epilepsy, benign focal epilepsy of childhood, juvenile myoclonic epilepsy (JME), temporal lobe epilepsy, frontal lobe epilepsy, refractory epilepsy, Lennox-Gastaut syndrome, occipital lobe epilepsy, Protes syndrome, hemimegaencephaly syndrome (HMEG), megalencephaly syndrome (MEG), megalencephalic-capillary malformation (MCAP), and megalencephaly-polymicrogyri-polydactyly-hydrocephalus syndrome (MPPH).

[0206] Mitochondrial myopathy and mitochondrial stress are mitochondrial disorders, as described in the following literature: Chinnery, PF (2015); EMBO Mol. Med. [Molecular Medicine Journal of the European Society for Molecular Biology] 7, 1503-1512; Koopman, WJ et al. (2016); EMBO Mol. Med. [Molecular Medicine Journal of the European Society for Molecular Biology] 8, 311-327; and Young, MJ, and Yound and Copeland, WC (2016); Curr. Opin. Genet. Dev. [Recent Perspectives on Genetics and Development] 38, 52-62.

[0207] Treatable conditions that have been shown to increase the likelihood of age-related diseases include aging, such as immunosenescence. This can be diagnosed by: (i) an increase in circulating cytokines (such as IL-6); (ii) senescent cells found in muscles, kidneys, liver, brain, neurons, pancreas, or heart; or (iii) a decline in DNA repair efficiency, which can be demonstrated by an increase in the transcription of repetitive elements, including transposon-encoding genes.

[0208] Treatment

[0209] This disclosure provides for the use of compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the treatment of the diseases and disorders described herein, such as age-related disorders, or diseases and disorders currently approved for treatment with rapamycin analogs (e.g., RAD001).

[0210] On the one hand, this disclosure provides a method for treating a disorder or disease mediated by the mTOR pathway in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or a pharmaceutically acceptable salt thereof.

[0211] On the other hand, this disclosure provides a method for treating a disease or disorder in a subject, wherein a target tissue, organ, or cell associated with the pathology of the disease or disorder has an insufficient level of FKBP12 to inhibit mTORC1, the method comprising administering to a subject in need a therapeutically effective amount of a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof.

[0212] In one embodiment, for example, compounds of formula (I) or pharmaceutically acceptable salts thereof have a higher affinity for binding to FKBP12, FKBP25, FKBP51 and / or FKBP52 compared to rapamycin or RAD001.

[0213] In one embodiment, a compound having formula (I) or a pharmaceutically acceptable salt thereof has a high affinity for FKBP12, FKBP25, FKBP51 and / or FKBP52, sufficient to inhibit mTORC1.

[0214] In one embodiment, the therapeutic efficacy is determined empirically, for example, compared to rapamycin or RAD001.

[0215] On the other hand, this disclosure provides a method for treating a subject with or determined to have insufficient levels of FKBP12 to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or a pharmaceutically acceptable salt thereof.

[0216] In one embodiment, for example, compounds of formula (I) or pharmaceutically acceptable salts thereof have a higher affinity for binding to FKBP12, FKBP25, FKBP51 and / or FKBP52 compared to rapamycin or RAD001.

[0217] In one embodiment, the subject has or is determined to have FKBP12 levels in the target tissue, organ, or cell that are insufficient to inhibit mTORC1.

[0218] In one embodiment, the therapeutic efficacy is determined empirically, for example, compared to rapamycin or RAD001.

[0219] On the other hand, this disclosure provides a method for treating a subject with or previously determined to have FKBP12 levels sufficient to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition described herein, or a combination of pharmaceuticals described herein.

[0220] In one embodiment, the disease or disorder is selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, and cognitive impairment. Decreased cognition, tendon stiffness, cardiac dysfunction (such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to decreased immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications of diabetes such as kidney failure, blindness, and neuropathy.

[0221] In one embodiment, the obstacle is liver fibrosis.

[0222] On the other hand, this disclosure provides a method for treating a disease or disorder in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof; a pharmaceutical composition comprising a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof; or a pharmaceutical composition comprising a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof, wherein the disorder or disease is selected from:

[0223] - Acute or chronic organ or tissue transplant rejection;

[0224] - Transplant vascular disease;

[0225] - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration;

[0226] - Autoimmune diseases and inflammatory conditions;

[0227] -asthma;

[0228] - Multidrug resistance (MDR);

[0229] - Fungal infection;

[0230] -Inflammation;

[0231] -Infect;

[0232] - Age-related diseases;

[0233] - Neurodegenerative diseases;

[0234] - Proliferative disorders, especially cancer;

[0235] - Seizures and disorders associated with seizures; and

[0236] - Mitochondrial myopathy and mitochondrial stress.

[0237] In one embodiment, the barrier is an obstacle that includes fibrosis and / or inflammatory processes.

[0238] In one embodiment, the disorder is selected from liver and kidney disorders.

[0239] In one embodiment, the liver disorder is selected from: liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis.

[0240] In one embodiment, the kidney disorder is renal fibrosis.

[0241] In one embodiment, the renal fibrosis occurs as a result of acute kidney injury.

[0242] In one embodiment, the kidney disorder is a chronic kidney disorder.

[0243] In one embodiment, the kidney disorder is diabetic nephropathy.

[0244] On the other hand, this disclosure provides a method for treating an age-related disorder or disease in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof; a pharmaceutical composition comprising a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof; or a pharmaceutical composition comprising a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof, wherein the disorder or disease is selected from: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, cerebral atrophy, atherosclerosis. Arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction (such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications of diabetes such as kidney failure, blindness, and neuropathy.

[0245] In another aspect, this disclosure provides a method for treating a subject with cancer, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or a pharmaceutically acceptable salt thereof; a pharmaceutical composition comprising a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or a pharmaceutically acceptable salt thereof; or a pharmaceutical composition comprising a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or a pharmaceutically acceptable salt thereof.

[0246] In one embodiment, the method further includes a PD-1 / PDL-1 inhibitor.

[0247] In one embodiment, the cancer is selected from kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and cervical cancer.

[0248] On the other hand, this disclosure provides compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for use as pharmaceuticals.

[0249] On the other hand, this disclosure provides compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the prevention or treatment of disorders or diseases mediated by the mTOR pathway.

[0250] On the other hand, this disclosure provides compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharmaceutically acceptable salts thereof, pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharmaceutically acceptable salts thereof, for the prevention or treatment of disorders or diseases selected from:

[0251] - Acute or chronic organ or tissue transplant rejection;

[0252] - Transplant vascular disease;

[0253] - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration;

[0254] - Autoimmune diseases and inflammatory conditions;

[0255] -asthma;

[0256] - Multidrug resistance (MDR);

[0257] - Fungal infection;

[0258] -Inflammation;

[0259] -Infect;

[0260] - Age-related diseases;

[0261] - Neurodegenerative diseases;

[0262] - Proliferative disorders, especially cancer;

[0263] - Seizures and disorders associated with seizures; and

[0264] - Mitochondrial myopathy and mitochondrial stress.

[0265] On the other hand, this disclosure provides compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the prevention or treatment of disorders or diseases including fibrosis and / or inflammatory processes.

[0266] In one embodiment, the disorder is selected from liver and kidney disorders.

[0267] In one embodiment, the liver disorder is selected from: liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis.

[0268] In one embodiment, the kidney disorder is renal fibrosis, which occurs as a result of acute kidney injury.

[0269] In one embodiment, the kidney disorder is a chronic kidney disorder.

[0270] In one embodiment, the kidney disorder is diabetic nephropathy.

[0271] On the other hand, this disclosure provides a pharmaceutical composition comprising a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or a pharmaceutically acceptable salt thereof, for the prevention or treatment of age-related disorders or diseases selected from: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, and osteoporosis. Diseases, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment (e.g., weakness), cognitive decline, tendon stiffness, cardiac dysfunction (e.g., cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as kidney failure, blindness, and neuropathy).

[0272] On the other hand, this disclosure provides compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof; pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof; or pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the treatment of cancer.

[0273] On the other hand, this disclosure provides compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharmaceutically acceptable salts thereof; pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharmaceutically acceptable salts thereof; or pharmaceutical compositions comprising compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-F, or pharmaceutically acceptable salts thereof. Combinations of compounds of formula (I)-C, (I)-D, (I)-E and (I)-F, or pharmaceutically acceptable salts thereof, for the treatment of renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or cervical cancer.

[0274] On the other hand, this disclosure provides the use of compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the preparation of medicines.

[0275] On the other hand, this disclosure provides the use of compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the preparation of medicaments for treating disorders or diseases mediated by the mTOR pathway.

[0276] On the other hand, this disclosure provides the use of compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the preparation of medicaments for treating disorders or diseases selected from:

[0277] - Acute or chronic organ or tissue transplant rejection;

[0278] - Transplant vascular disease;

[0279] - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration;

[0280] - Autoimmune diseases and inflammatory conditions;

[0281] -asthma;

[0282] - Multidrug resistance (MDR);

[0283] - Fungal infection;

[0284] -Inflammation;

[0285] -Infect;

[0286] - Age-related diseases;

[0287] - Neurodegenerative diseases;

[0288] - Proliferative disorders, such as cancer;

[0289] - Seizures and disorders associated with seizures; and

[0290] - Mitochondrial myopathy and mitochondrial stress.

[0291] On the other hand, this disclosure provides the use of compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the preparation of medicaments for treating disorders or diseases including fibrosis or inflammatory processes.

[0292] In one embodiment, the disorder is selected from liver and kidney disorders.

[0293] In one embodiment, the liver disorder is selected from: liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis.

[0294] In one embodiment, the kidney disorder is renal fibrosis, which occurs as a result of acute kidney injury.

[0295] In one embodiment, the kidney disorder is a chronic kidney disorder.

[0296] In one embodiment, the kidney disorder is diabetic nephropathy.

[0297] On the other hand, this disclosure provides the use of compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharmaceutically acceptable salts thereof, for the preparation of medicaments for the prevention or treatment of age-related disorders or diseases selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, and diabetes-related kidney disease. Impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction (such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as renal failure, blindness, and neuropathy).

[0298] On the other hand, this disclosure provides the use of compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the preparation of medicaments for the prevention or treatment of cancer.

[0299] On the other hand, this disclosure provides the use of compounds having formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E and formula (I)-F, or pharmaceutically acceptable salts thereof, for the preparation of medicaments for treating the following cancers: renal cell carcinoma, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or cervical cancer.

[0300] Method for preparing compounds having formula (I)

[0301] On the other hand, this disclosure provides methods for preparing the compounds disclosed according to schemes 1, 2 and 3.

[0302] Option 1:

[0303]

[0304] Compounds having formula (I) (where R) 2 and R 3 As defined in formula (I), it can be obtained through C32-deoxyrapamycin (intermediate 1) and (R 2 (R) 3 )NH (where R 2 and R 3 As defined in formula (I), the substance is obtained by reacting it in the presence of a suitable solvent (e.g., dichloromethane) and a suitable reagent for substitution reactions (e.g., zinc chloride (II)). Suitable conditions are as follows:

[0305] 1)(R 2 (R) 3 NH, p-toluenesulfonic acid-H2O, dichloromethane, room temperature

[0306] 2)(R 2 (R) 3 NH, trifluoroacetic acid, -40℃, dichloromethane (see EP 1212331 B1)

[0307] 3)(R 2 (R) 3 NH, 5M LiClO4, Et2O (0.1M), room temperature (see TL, 1995, 43, 7823)

[0308] 4)(R 2 (R) 3 NH, Cp2HfCl2-AgClO4 (Suzuki's catalyst), 4A MS, dichloromethane, room temperature (see TL, 1995, 43, 7823)

[0309] 5)(R 2 (R) 3 NH, BF3-OEt2 or Zn(OTf)2, THF, 0℃ (see TL, 1994, 37, 6835)

[0310] 6)(R 2 (R) 3 NH, ZnCl2, dichloromethane, 0℃ (see JOC, 1994, 59, 6512).

[0311] 7)(R 2 (R) 3 NH, methanesulfonic acid, dichloromethane, room temperature

[0312] 8)(R 2 (R) 3 NH, phosphoric acid, dichloromethane, room temperature

[0313] 9)(R2 (R) 3 NH, polyphosphate, dichloromethane, room temperature

[0314] C32-deoxyrapamycin, which can be used as a starting material, can be prepared by methods known in the art, for example, as described in WO2007 / 085400.

[0315] Option 2:

[0316]

[0317] Compounds having formula (I)-A, wherein R 1 Yes - OR a ;R a Choose from the following groups: H, -P(O)(R b 2. C 1-6 Alkyl and C 1-6 Hydroxyalkyl; and R 2 and R 3 As defined in equation (I), intermediate 1 and R can be used. 1 -H or R 1 -X reaction, then with (R 2 (R) 3 The intermediate is obtained by reacting NH. In one embodiment, intermediate 1 is reacted with R1-H or R under alkylation, phosphation, or esterification conditions. 1 -X reaction to provide intermediate 1-A. In one embodiment, intermediate 1-A reacts with (R) under substitution reaction conditions (e.g., as provided herein) 2 (R) 3 The NH reaction is used to give a compound having formula (I)-A. Compounds having formula (I)-C and formula (I)-D can also be prepared by a synthetic route similar to that shown in Scheme 2.

[0318] Option 3:

[0319]

[0320] Compounds having formula (I)-B, wherein R 1 yes And R 2 and R 3 As defined in equation (I), it can be obtained through intermediate 1-B and R 1 -H reaction, then with (R 2 (R) 3The intermediate 1-B is obtained by the reaction of NH. In one embodiment, intermediate 1-B is activated and reacted under nucleophilic conditions to provide intermediate 1-B. In one embodiment, intermediate 1-B is reacted with (R) under substitution reaction conditions (e.g., as provided herein) 2 (R) 3 The NH reaction is used to provide compounds having formula (I)-B. Compounds having formula (I)-E and formula (I)-F can also be prepared by a synthetic route similar to that shown in Scheme 3.

[0321] Example

[0322] This disclosure sets forth the following examples. Synthetic and biological examples described herein are provided to illustrate the compounds, pharmaceutical compositions, and methods presented herein, and these examples should not be construed as limiting their scope in any way.

[0323] The compounds provided herein can be prepared from readily available starting materials using modifications of the specific synthetic schemes listed below, as is well known to those skilled in the art. It should be recognized that, unless otherwise stated, other process conditions may be used, given typical or preferred process conditions (i.e., reaction temperature, time, molar ratio of reactants, solvent, pressure, etc.). Optimal reaction conditions may vary depending on the specific reactants or solvents used, but such conditions can be determined by those skilled in the art through conventional optimization procedures.

[0324] Furthermore, as will be apparent to those skilled in the art, conventional protecting groups are essential for protecting certain functional groups from undesirable reactions. The selection of suitable protecting groups for specific functional groups, as well as suitable conditions for protection and deprotection, is well known in the art. For example, numerous protecting groups and their introduction and removal are described in Greene et al., Protecting Groups in Organic Synthesis, 2nd ed., Wiley Publishers, New York, 1991, and the references cited therein.

[0325] Rapamycin and its derivatives, such as compounds having formula (I), exist in solvent- and pH-dependent equilibrium hexa- and hepta-ketals, as shown in E and F below (schemes 4 and 5). See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-90; and Tetrahedron Letters (1992) 33(33):4139-4142. Rapamycin and its derivatives also exist in mixtures of cis- and trans-amides as shown in E, H, J, and K below (schemes 4 and 5). [See Mierke, DF, Schmieder, P., Karuso, P., and Kessler, H. (1991), Conformational Analysis of the cis-and trans-Isomers of FK506 by NMR and Molecular Dynamics. Helvetica Chimica Acta, 74:1027-1047]. The NMR characterization data shown in the examples correspond only to the major equilibrium forms observed under the reported deuterated solvent conditions.

[0326] Option 4:

[0327]

[0328] in:

[0329] R 1 Yes - OR a ;

[0330] R a Choose from the following groups: H, -P(O)(R b 2. C 1-6 Alkyl and C 1-6 Hydroxyalkyl;

[0331] R 2 and R 3 Each independently selects from the following groups: H, C 1-6 Alkyl, OR b -C 0-6 Alkylene-SO2R 4 and -C(O)OR 5 ;

[0332] Each R b Independently choose H and C 1-6 Groups composed of alkyl groups;

[0333] R 4 Yes - OR 5 C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, heterocyclic C 1-6 Alkyl, C 1-6 Hydroxyalkyl, C 3-8 cycloalkyl C 0-6 Alkyl; and

[0334] R 5 Is it H or C? 1-6 alkyl.

[0335] Option 5:

[0336]

[0337] in:

[0338] R 1 It is a heteroaryl group, such as a 5-membered heteroaryl group, for example...

[0339] R 2 and R 3 Each independently selects from the following groups: H, C 1-6 Alkyl, OR b -C 0-6 Alkylene-SO2R 4 and -C(O)OR 5 ;

[0340] Each R b Independently choose H and C 1-6 Groups composed of alkyl groups;

[0341] R 4 Yes - OR 5 C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, heterocyclic C 1-6 Alkyl, C 1-6 Hydroxyalkyl, C 3-8 cycloalkyl C 0-6 Alkyl; and

[0342] R 5 Is it H or C? 1-6 alkyl.

[0343] In one embodiment, compounds having formula (I), formula (I)-A, and formula (I)-B exist as hexa- and heptacetal forms in solvent and pH-dependent equilibrium, hereinafter shown as E-1 and F-1 (Scheme 6). In one embodiment, compounds having formula (I), formula (I)-A, and formula (I)-B exist as a mixture of cis- and trans-amides E-1 and H-1.

[0344] Option 6:

[0345]

[0346] R 1 Yes - OR a ;

[0347] R a Choose from the following groups: H, -P(O)(R b 2. C 1-6 Alkyl and C 1-6 Hydroxyalkyl;

[0348] R 2 and R 3 Each independently selects from the following groups: H, C 1-6 Alkyl, OR b -C 0-6 Alkylene-SO2R 4 and -C(O)OR 5 ;

[0349] Each R b Independently choose H and C 1-6 Groups composed of alkyl groups;

[0350] R 4 Yes - OR 5 C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, heterocyclic C 1-6 Alkyl, C 1-6 Hydroxyalkyl, C 3-8 cycloalkyl C 0-6 Alkyl; and

[0351] R 5 Is it H or C? 1-6 alkyl.

[0352] Preparation of compounds

[0353] The compounds disclosed herein can be prepared as described in the following examples.

[0354] List of abbreviations

[0355] The following abbreviations used below have their corresponding meanings:

[0356] A

[0357] d Double peak

[0358] dd double peak

[0359] DCM dichloromethane

[0360] DMSO (dimethyl sulfoxide)

[0361] ESIMS Electrospray Ionization Mass Spectrometry

[0362] EtOAc (ethyl acetate)

[0363] eq equivalent

[0364] FA Formic acid

[0365] HSQC NMR Heteronuclear Single Quantum Coherent Nuclear Magnetic Resonance

[0366] HPLC (High Performance Liquid Chromatography)

[0367] Hz Hertz

[0368] MeCN Acetonitrile

[0369] MeOH (methanol)

[0370] M Moore

[0371] m multiplet

[0372] mg

[0373] MHz

[0374] mL

[0375] mmol millimole

[0376] NMR (Nuclear Magnetic Resonance)

[0377] PEI (Polyethyleneimine)

[0378] PPU propylpyridylurea

[0379] q Quadruple Peak

[0380] μL

[0381] μM micromolar

[0382] s single peak

[0383] SFC Supercritical Fluid Chromatography

[0384] t triple peak

[0385] Methods used in the purification of the instance

[0386] The intermediates and final products are purified by normal-phase or reversed-phase chromatography.

[0387] Rapid chromatography

[0388] Normal phase chromatography uses pre-packed SiO2 columns (e.g., from Teledyne Isco, Inc.). Rf column), eluted with a gradient of appropriate solvent systems (e.g., hexane and ethyl acetate; DCM and MeOH; or unless otherwise indicated).

[0389] Reversed-phase chromatography uses pre-packed C18 columns (e.g., from Teledyne Isco, Inc.). Rf column), eluted with a gradient of a suitable solvent system (e.g., acetonitrile and water; or unless otherwise indicated).

[0390] SFC is performed using the method described below:

[0391] Method 1: Reprospher PEI 5μm (100A) column (30x250mm); CO2 / MeOH

[0392] Method 2: Princeton PPU 5μm (100A) column (30x250mm); CO2 / MeOH

[0393] Method 3: Kinetex BiPhenyl 5μm (100A) column (30x250mm); CO2 / MeOH

[0394] Gradient selection is based on analytical separation.

[0395] The following methods were used for reverse preparative HPLC:

[0396] Method 1 Phenomenex Luna C18; 5 μm column (30 x 250 mm); 0.1% formic acid and 5% water in acetonitrile; 0.1% formic acid and 5% acetonitrile in water. Gradient selection based on analytical separation method.

[0397] Method 2 YMC Actus Triart C18; 5 μm column (20 x 150 mm); acetonitrile / water. Gradient selection based on analytical separation method.

[0398] Method 3 YMC Actus Triart C18 ExRS; 5 μm column (20 x 150 mm); 0.1% formic acid and 5% water in acetonitrile; 0.1% formic acid and 5% acetonitrile in water. Gradient selection based on analytical separation method.

[0399] Method 4YMC Actus Triart C8; 5 μm column (20 x 150 mm); 0.1% formic acid and 5% water in acetonitrile; 0.1% formic acid and 5% acetonitrile in water. Gradient selection based on analytical separation method.

[0400] Preparation of intermediates

[0401] Preparation of intermediates 1 to 9

[0402] Intermediate 1: C32-deoxy-rapamycin

[0403]

[0404] Intermediate 1 was prepared according to methods known in the literature, including those disclosed in WO 2007 / 085400 A1, each of which is incorporated herein by reference in its entirety.

[0405] Intermediate 2:

[0406]

[0407] Intermediate 1 (4.37 g, 4.86 mmol) was dissolved in anhydrous dichloromethane (20 mL). Anhydrous toluene (20 mL) was added. The reaction mixture was evaporated to dryness using a rotary evaporator. This azeotropic drying process was repeated twice.

[0408] Combine the dried starting material with 2,6-dimethylpyridine (1.39 mL, 11.9 mmol) in anhydrous dichloromethane (58 mL). Cap the flask and purge the mixture twice with nitrogen. Cool the mixture to -30 °C in an acetonitrile / dry ice bath.

[0409] Trifluoromethanesulfonic anhydride (1.20 ml, 7.16 mmol) was added dropwise via syringe over a four-minute period. The reaction mixture was stirred at -30°C for 30 minutes. The reaction mixture was then transferred to an ice-water bath at 0°C and stirred at 0°C for 20 minutes.

[0410] The reaction mixture was placed on a rotary evaporator and concentrated without heating. Isopropyl acetate (22 mL) was added. Tetrazol (1.17 g, 16.7 mmol) was added in a single dose. The flask was quickly capped and purged twice under nitrogen vacuum. After a period of one minute, N,N-diisopropylethylamine (4.18 mL, 23.9 mmol) was added via syringe. The reaction mixture was stirred overnight at room temperature.

[0411] The reaction mixture was concentrated using a rotary evaporator. The concentrate was purified by normal-phase silica gel rapid column chromatography (0 to 40% acetone-heptane gradient elution, 80 g silica column, TLC 40% acetone-heptane, UV visible).

[0412] The second elution fraction (as determined by UV absorbance at 279 nm) was combined and concentrated to give intermediate 2 as a white solid (2.19 g, 2.30 mmol, 47.4% yield).

[0413] Intermediate 2: ESIMS[M+NH4] + 969.8, ESIMS[MH] - 950.8.

[0414] 1 H NMR(400MHz, DMSO-d6)δ9.33(d,J=6.4Hz,1H),6.58-6.41(m,2H),6.35-6.14(m,2H),6.09-5.98(m,1H),5.55-5.43(m,1H),5.19(m, 1H),5.05(m,1H),5.00-4.93(m,1H),4.87-4.79(m,1H),4.67-4.56(m,1H),3.98-3.87(m,1H),3.87(d,J=6.9Hz,1H),3.61(m,2H),3 .55(dd,J=11.8,1.9Hz,1H),3.49-3.38(m,1H),3.31-3.17(m,4H),3.10(m,4H),3.04(s,3H),2.88-2.75(m,1H),2.29-2.09(m,3H), 2.07-1.86(m,3H),1.88-1.60(m,9H),1.59-1.44(m,7H),1.43-1.01(m,11H),0.96(t,J=7.1Hz,5H),0.95-0.77(m,7H),0.72(m,4H).

[0415] Intermediate 3:

[0416]

[0417] Intermediate 1 (0.233 g, 0.259 mmol) was combined with 2,6-di-tert-butyl-4-methylpyridine (0.424 g, 2.07 mmol) in anhydrous dichloromethane (2.6 mL). The reaction mixture was purged once under nitrogen vacuum. The reaction mixture was cooled to 0 °C in an ice-water bath. Solid dimethylphosphonochloride (0.145 g, 1.29 mmol) was added in a single addition. The reaction mixture was stirred at 0 °C for 80 minutes.

[0418] The reaction mixture was diluted with a saturated aqueous solution of NaHCO3 and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated to give a colorless crude tar product (0.77 g).

[0419] The crude product was purified by rapid silica gel column chromatography (0-80% acetone-heptane gradient elution, 24 g silica column, TLC with 80% EtOAc-heptane, visible under UV). The fractions containing the product were combined and concentrated to give intermediate 3 (0.09 g, 0.09 mmol, 34.4% yield) as a white solid.

[0420] Intermediate 3: ESIMS[M+NH4] + 993.7, ESIMS[MH] - 974.7.

[0421] HRMS: Calculated value: 999.5812 (Na) + (Adduct). Measured value: 999.5807.

[0422] 1¹H NMR (600MHz, chloroform-d) δ 6.47–6.26 (m, 2H), 6.22–6.08 (m, 1H), 6.02–5.83 (m, 1H), 5.54 (m, 1H), 5.35–5.26 (m, 1H), 5.21 (m, 1H), 4.85–4.76 (m, 1H), 4.12 (m, 2H), 3.93–3.8 1(m,1H),3.67(t,J=7.7Hz,1H),3.62(d,J=6.7Hz,1H),3.60-3.53(m,1H),3.53-3. 44(m,1H),3.42-3.36(m,3H),3.32(m,3H),3.28-3.18(m,1H),3.13(m,3H),3.05(m ,1H),2.82(m,1H),2.42-2.21(m,3H),2.16-2.08(m,3H),1.99(m,1H),1.95-1.83( m,1H),1.83-1.72(m,4H),1.71-1.57(m,9H),1.57-1.43(m,12H),1.39(m,1H),1.3 4-1.20(m,4H),1.20-1.10(m,1H),1.05(m,4H),1.00(d,J=6.5Hz,3H),0.95(dd,J= 6.6, 2.1Hz, 3H), 0.92 (d, J = 6.6Hz, 3H), 0.91-0.84 (m, 4H), 0.77 (q, J = 12.1Hz, 1H).

[0423] Intermediate 4:

[0424]

[0425] In a reaction vessel, 0.471 g (2.67 mmol) of 2-(tert-butyldimethylsilyl)oxy)ethanol was dissolved in 0.95 mL of anhydrous toluene. The vessel was capped and purged under nitrogen vacuum. N,N-diisopropylethylamine (DIPEA) (0.490 mL, 2.81 mmol) was added via syringe. The mixture was cooled to 0 °C in an ice-water bath. At 0 °C, trifluoromethanesulfonic anhydride (Tf₂O) (0.438 mL, 2.59 mmol) was added dropwise over a period of approximately two minutes. The reaction mixture was stirred at 0 °C for 30 minutes.

[0426] Remove the vial from the cold bath. Add DIPEA (0.490 ml, 2.81 mmol) via syringe. Open the vial and quickly add solid intermediate 1 (0.600 g, 0.667 mmol) in one go. Quickly recap the vial and purge the mixture under nitrogen vacuum. Add toluene (0.5 mL).

[0427] The reaction was stirred overnight at 40°C under nitrogen. The reaction mixture was diluted with saturated aqueous NaHCO3. The quenched mixture was extracted five times with EtOAc. The organic extracts were combined, dried over Na2SO4, filtered through diatomaceous earth under vacuum, and concentrated to give a waxy white solid crude product.

[0428] The crude product was purified by silica gel rapid column chromatography (0-35% acetone-heptane, gradient elution, 40 g silica column, TLC with 35% acetone-heptane, visible under UV) to give the desired intermediate 4 (0.245 g, 0.231 mmol, 34.7% yield) in a glassy state, which was immediately used "as is" for the next step.

[0429] Intermediate 4: ESIMS[M+NH4] + 1076.1, ESIMS[MH] - 1056.0.

[0430] Intermediate 5: C16-(1,1-dioxane-1,2-thiazazonyl-2-yl)-C32-deoxy-rapamycin

[0431] (Diabeta-isomer 1)

[0432] Intermediate 6: C16-(1,1-dioxane-1,2-thiazazonyl-2-yl)-C32-deoxy-rapamycin

[0433] (Diabeta-isomer 2)

[0434]

[0435] *Absolute stereochemistry of C16 is undetermined

[0436] Zinc(II) chloride (0.5 mL, 0.5 mmol) was added to a solution of intermediate 1 (150 mg, 0.167 mmol) and 1,1-dioxide of 1,2-thiazazacyclobutane (891 mg, 0.833 mmol) in DCM (3 mL) at 0 °C. The reaction mixture was stirred at room temperature for two hours. The mixture was diluted with H₂O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure. The crude product of the diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 100:0).

[0437] The first eluted diastereomer was finally purified by preparative HPLC (Method 2) to produce intermediate 5 (18 mg, 10% yield) as a white solid.

[0438] Intermediate 5: ESIMS[M+NH4] + 992.6, [M+FA-H] - 1019.6.

[0439] 1 H NMR (400MHz, chloroform-d) δ6.39(dd,J=14.8,9.8Hz,1H),6.34(dd,J=14.8,10.3Hz,1H),6.18-6.10(m,1H),6.02(d,J=10.3, 1.5Hz,1H),5.66(dd,J=15.1,8.6Hz,1H),5.38(s,1H),5.32(dd,J=6.4,1.8Hz,1H),5.23(d,J=9.6Hz,1H),4.87-4.76 (m,1H),4.12-4.06(m,1H),3.99(ddd,J=12.0,8.2,6.2Hz,1H),3.92-3.86(m,1H),3.84(dd,J=10.7,4.4Hz,1H),3.81 -3.74(m,1H),3.63-3.59(m,2H),3.59(d,J=3.6Hz,1H),3.46(d,J=7.6Hz,1H),3.43(s,3H),3.40-3.37(m,1H),3.32(s ,3H),3.04(ddd,J=8.2,5.8,3.8Hz,1H),3.00-2.94(m,1H),2.94-2.89(m,1H),2.88-2.84(m,1H),2.64(d,J=6.7Hz,1 H),2.47-2.38(m,1H),2.36-2.27(m,2H),2.21-2.12(m,1H),2.03-1.97(m,1H),1.95-1.77(m,7H),1.76-1.67(m,5H) ,1.65(s,3H),1.60-1.50(m,6H),1.47-1.39(m,2H),1.38-1.27(m,4H),1.25-1.10(m,3H),1.08-1.04(m,1H),1.03-1 .01(m,3H),1.00(d,J=1.4Hz,3H),0.99-0.97(m,3H),0.97(d,J=6.6Hz,3H),0.93(d,J=6.8Hz,3H),0.75-0.66(m,1H).

[0440] The second eluted diastereomer was finally purified using SFC chromatography (Method 2) to produce intermediate 6 (16 mg, 9.2% yield) as a white solid.

[0441] Intermediate 6: ESIMS[M+NH4] + 992.7, [M+FA-H] - 1019.6.

[0442] 1 H NMR (400MHz, chloroform-d) δ6.46 (dd, J=14.2, 10.9Hz, 1H), 6.22 (dd, J=14.2, 10.6Hz, 1H), 6.14 (dd, J=14.5, 10. 6Hz,1H),6.00(d,J=10.9Hz,1H),5.38(dd,J=14.5,9.6Hz,1H),5.27-5.19(m,1H),5.12-5.05(m,1H),4. 66-4.59(m,1H),4.59-4.53(m,1H),4.25(d,J=1.8Hz,1H),4.17-4.06(m,3H),4.02(ddd,J=11.8,8.0,3. 5Hz,1H),3.66(d,J=7.0Hz,1H),3.60-3.52(m,2H),3.43-3.34(m,4H),3.28(s,3H),3.17-3.07(m,1H),3. 03-2.95(m,1H),2.95-2.89(m,1H),2.84-2.73(m,1H),2.65-2.62(m,1H),2.35-2.26(m,1H),2.27-2.21 (m,1H),2.21-2.12(m,3H),2.12-2.05(m,1H),2.02-1.98(m,1H),1.97-1.95(m,3H),1.91-1.83(m,1H), 1.82-1.70(m,3H),1.70-1.51(m,10H),1.50-1.17(m,10H),1.11-1.06(m,1H),1.06-1.02(m,6H),1.01- 0.96 (m, 1H), 0.93 (d, J = 6.8Hz, 4H), 0.89 (d, J = 6.6Hz, 3H), 0.86 (d, J = 6.8Hz, 3H), 0.64 (q, J = 11.9Hz, 1H).

[0443] Intermediates 7 and 8:

[0444]

[0445] *Absolute stereochemistry of C16 is undetermined

[0446] 4-Methylbenzenesulfonic acid hydrate (5.3 mg, 0.028 mmol) was added to a mixture of intermediate 1 (500 mg, 0.555 mmol) and tert-butyl carbamate (976 mg, 8.33 mmol) in DCM (4 mL). The reaction mixture was stirred at room temperature for 18 hours. The entire reaction mixture was directly separated by rapid chromatography (silica; MeCN / DCM 0:100 to 25:75). After separation of the first eluted diastereomer, intermediate 7 (105 mg, 15.4% yield) was given as a yellow solid.

[0447] Intermediate 7: ESIMS[M+Na] + 1008.0, ESIMS[MH] - 984.0.

[0448] The second eluted diastereomer was separated to give intermediate 8 (220 mg, 36.2% yield) as a yellow solid.

[0449] Intermediate 8: ESIMS[M+Na] + 1008.1, ESIMS[MH] - 984.7.

[0450] HRMS: Calculated value of C55H89N2O13: -985.6365. Measured value: -985.6379.

[0451] Intermediate 9 and Intermediate 10:

[0452]

[0453] *Absolute stereochemistry of C16 is undetermined

[0454] Zinc(II) chloride (0.57 mL, 0.57 mmol) was added to a solution of intermediate 4 (120 mg, 0.113 mmol) and 1,1-dioxide of 1,2-thiazazacyclobutane (121 mg, 1.13 mmol) in DCM (4 mL). The reaction mixture was stirred at room temperature for three hours. The reaction mixture was diluted with a saturated aqueous solution of NaHCO3 and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 40:60).

[0455] The first eluted diastereomer was purified by SFC chromatography (Method 2) to give intermediate 9 as a white solid (18.3 mg, 13.5% yield).

[0456] Intermediate 9: ESIMS[M+NH4] + 1151.1, [M+FA-H] - 1178.2

[0457] 1 H NMR(400MHz, DMSO-d6)δ:6.57-6.37(m,2H),6.32-6.12(m,2H),6.04(dd,J=22.7,10. 9Hz,1H),5.60-5.48(m,1H),5.06(d,J=9.1Hz,1H),4.98-4.91(m,1H),4.90-4.83(m, 1H),4.68-4.59(m,1H),4.17-3.99(m,3H),3.92-3.86(m,1H),3.69-3.61(m,3H),3.5 9-3.49(m,3H),3.49-3.41(m,1H),3.34(s,3H),3.28(d,J=8.9Hz,1H),3.17-3.09(m,4 H),3.09-3.03(m,1H),3.01-2.93(m,2H),2.91-2.80(m,1H),2.29-2.12(m,2H),2.12 -2.00(m,2H),1.99-1.88(m,3H),1.82(s,3H),1.78-1.62(m,6H),1.58-1.54(m,1H),1 .53-1.32(m,10H),1.34-1.20(m,3H),1.18-1.09(m,3H),1.06-0.94(m,7H),0.92-0. 83(m,13H),0.80(d,J=6.7Hz,3H),0.77-0.68(m,4H),0.68-0.59(m,1H),0.03(s,6H).

[0458] The second eluted diastereomer was purified by SFC chromatography (Method 2) to give intermediate 10 (7.3 mg, 5.5% yield) as a white solid.

[0459] Intermediate 10: ESIMS[M+NH4] + 1151.3, [M+FA-H] - 1178.4

[0460] 1H NMR(400MHz,DMSO-d6)δ:6.44(dd,J=13.9,11.0Hz,1H),6.26-6.12(m,2H),6.10-6.05(m,1H) ,5.98(s,1H),5.52(dd,J=14.1,9.4Hz,1H),5.15-5.04(m,1H),5.04-5.00(m,1H),4.96(d,J= 9.7Hz,1H),4.67-4.57(m,1H),4.20-4.00(m,4H),3.98-3.89(m,1H),3.65(t,J=5.2Hz,2H),3 .58-3.49(m,4H),3.42-3.35(m,1H),3.33(s,3H),3.22-3.16(m,1H),3.16-3.09(m,4H),3.09- 3.03(m,1H),3.00-2.92(m,1H),2.75-2.65(m,1H),2.27-2.12(m,2H),2.12-2.01(m,2H),2.0 0-1.88(m,3H),1.83(s,3H),1.78-1.66(m,2H),1.64-1.57(m,3H),1.56-1.48(m,7H),1.48-1 .34(m,3H),1.32-1.23(m,3H),1.22-1.03(m,5H),1.01-0.95(m,4H),0.93-0.88(m,4H),0.87 -0.84(m,12H),0.83-0.77(m,4H),0.75(d,J=6.7Hz,3H),0.62(q,J=11.9Hz,1H),0.03(s,6H).

[0461] Example 1. Synthesis of Compound 1 and Compound 2

[0462]

[0463] Zinc(II) chloride (0.69 mL, 0.69 mmol) was added to a solution of intermediate 1 (125 mg, 0.139 mmol) and methanesulfonamide (264 mg, 2.78 mmol) in DCM (8 mL). The reaction mixture was stirred at room temperature for 30 minutes. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by reversed-phase preparative HPLC (Method 1).

[0464] The first eluted diastereomer was separated to give compound 1 (6.5 mg, 4.6% yield) as a white solid.

[0465] Compound 1: ESIMS[MH] - 961.6

[0466] 1 H NMR(400MHz, DMSO-d6)δ:7.30(d,J=7.9Hz,1H),6.47(s,1H),6.39(dd,J=13.7 ,11.2Hz,1H),6.22-6.08(m,2H),6.05(d,J=11.0Hz,1H),5.54(dd,J=14.2,8. 8Hz,1H),5.07-4.98(m,3H),4.69-4.62(m,1H),4.59(d,J=4.6Hz,1H),4.00-3 .96(m,1H),3.96-3.87(m,1H),3.80-3.69(m,2H),3.62(d,J=14.5Hz,1H),3.31 (d,J=1.7Hz,3H),3.23-3.10(m,5H),2.89(s,3H),2.86-2.76(m,1H),2.58-2. 52(m,1H),2.28-2.19(m,1H),2.19-1.98(m,3H),1.94-1.86(m,1H),1.82-1.7 0(m,5H),1.70-1.34(m,17H),1.34-1.11(m,6H),1.10-0.88(m,6H),0.87-0.8 1(m,6H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.6Hz,3H),0.54(q,J=11.8Hz,1H).

[0467] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 2 as a white solid (7.5 mg, 5.3% yield).

[0468] Compound 2: ESIMS[MH] - 961.7

[0469] 1H NMR(400MHz, DMSO-d6)δ:7.49(d,J=9.3Hz,1H),6.60(s,1H),6.44(dd,J=14.3,11.0Hz,1H),6.31-6.11(m,2H),5.98(d,J=11.0Hz,1H),5.51(dd,J =14.5,9.5Hz,1H),5.05(s,1H),4.99-4.92(m,1H),4.87-4.77(m,1H),4. 66-4.53(m,2H),3.95-3.85(m,2H),3.77-3.68(m,1H),3.68-3.57(m,1H), 3.49-3.39(m,1H),3.39-3.28(m,3H),3.26-3.14(m,2H),3.12(s,3H),2. 91-2.78(m,2H),2.71(s,3H),2.22(s,1H),2.17-1.83(m,6H),1.81(s,3H) ,1.79-1.57(m,5H),1.56-1.08(m,17H),1.06-0.89(m,8H),0.86(d,J=6. 6Hz, 4H), 0.79 (d, J = 6.7Hz, 3H), 0.74 (d, J = 6.7Hz, 3H), 0.65-0.54 (m, 2H).

[0470] The absolute configuration of the C16 substituent in compound 2 was determined by co-crystallization with FKBP12 via X-ray crystallography. [See Stuart L. Schrieber and Jon Clardy et al., Atomic Structure of the Rapamycin HumanoImmunophilin FKBP-12 Complex, J. Am. Chem. Soc., 1991, 113, 7433-7434.] The crystal structure was described in... Figure 1 middle.

[0471] Pure FKBP12(1-108) protein was concentrated to 9 mg / mL in 50 mM Tris pH 8.0, 150 mM NaCl, 1 mM EDTA, and 1 mM MTCEP. A complex for co-crystallization was prepared by mixing the protein with 3 mM of a compound (from a 50 mM stock solution prepared in 90% dDMSO and 10% D2O). The complex was incubated at 4 °C for two hours and then centrifuged at 10,000 rpm for 2 minutes before crystallization to remove any potential precipitation. The co-crystallization was obtained at 20 °C by a sitting-drop vapor diffusion method using a microseed matrix screening method [Allan D'Arcy et al., An automated microseed matrix-screening method for protein crystallization, Acta Cryst, (2007) D63, 550-554]. The droplet consisted of 200 nmL of protein solution, 160 nmL of pore solution, and 40 nmL of seed stock solution. Crystals appeared within a few days under A1 conditions using commercially available ammonium sulfate sieves from Qiagen. The stock solution consisted of 2.2 M ammonium sulfate. The crystals were cryoprotected in a stock solution supplemented with 20% ethylene glycol, and then rapidly frozen into liquid nitrogen. Data were acquired via beamline X10SA at the Swiss Light Source Facility (SLS, Villigen, Switzerland).

[0472] The data were processed using XDS (Kabsch, W. (2010), XDS. Acta Cryst. D, 66: 125-132). The structure was determined by molecular substitution using the previous FKBP12 X-ray structure as a search model (Collaborative Computational Project, Vol. 4, (1994) Acta Cryst. D50, 760-763). The programs REFMAC (Murshudov GN, Skubák P, Lebedev AA et al., REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallographica Section D: Biological Crystallography. 2011; 67(Pt 4):355-367) and COOT (Emsley P, Lohkamp B, Scott WG, Cowtan K. Features and development of Coot. Acta Crystallographica Section D: Biological Crystallography. 2010; 66(Pt 4):486-501) were used for refinement and model (re)construction.

[0473] Based on the X-ray eutectic structure, the C16 substituent in compound 2 has a (S)- configuration. The crystal structure is depicted on... Figure 1 middle.

[0474] Example 2. Compounds 3 and 4

[0475]

[0476] Zinc(II) chloride (0.67 mL, 0.67 mmol) was added to a solution of intermediate 1 (120 mg, 0.133 mmol) and ethanesulfonamide (218 mg, 2.00 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 14 min. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 50:50).

[0477] The first eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 3 as a white solid (13.4 mg, 10.1% yield).

[0478] Compound 3: ESIMS[M+NH4] + 994.7, [M+FA-H] - 1021.7

[0479] 1 H NMR(400MHz, DMSO-d6)δ:7.52(d,J=9.3Hz,1H),6.59(s,1H),6.43(dd,J=14.2,11.0Hz,1H),6.24(dd,J=14.2, 10.6Hz,1H),6.17(dd,J=14.2,10.7Hz,1H),5.96(d,J=10.9,1.6Hz,1H),5.50(dd,J=14.4,9.6Hz,1H),5.04(d ,J=4.7Hz,1H),4.96-4.89(m,1H),4.87-4.78(m,1H),4.69-4.54(m,2H),4.00-3.91(m,1H),3.88(dd,J=9.3,4 .7Hz,1H),3.76-3.67(m,1H),3.67-3.58(m,1H),3.50-3.40(m,1H),3.31(s,3H),3.25-3.15(m,2H),3.12(s,3H ),2.92-2.79(m,3H),2.77-2.65(m,1H),2.29-2.17(m,1H),2.17-2.10(m,1H),2.10-1.98(m,2H),1.97-1.86( m,3H),1.82(s,3H),1.80-1.76(m,1H),1.74-1.68(m,2H),1.67-1.60(m,2H),1.55-1.49(m,3H),1.48(s,3H), 1.46-1.33(m,4H),1.32-1.24(m,1H),1.22-1.11(m,6H),1.09(t,J=7.3Hz,3H),1.07-1.01(m,1H),1.01-0.94 (m,7H),0.89-0.82(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.63(m,1H),0.63-0.54(m,1H).

[0480] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 4 as a white solid (28.6 mg, 21.5% yield).

[0481] Compound 4: ESIMS[M+NH4] + 994.8, [MH] - 976.0

[0482] 1 H NMR(400MHz, DMSO-d6)δ:7.30(d,J=7.9Hz,1H),6.42(s,1H),6.41-6.34(m,1H),6.19-6.10(m,2H),6.10 -6.04(m,1H),5.54(dd,J=14.2,8.9Hz,1H),5.06-5.00(m,3H),4.66(ddd,J=9.4,6.0,2.5Hz,1H),4.59(d ,J=4.5Hz,1H),4.03-3.96(m,1H),3.96-3.85(m,1H),3.75(d,J=5.3Hz,1H),3.74-3.68(m,1H),3.62(dd ,J=9.9,6.3Hz,1H),3.31(s,3H),3.23-3.10(m,5H),3.03-2.90(m,2H),2.82(ddd,J=11.0,8.7,4.3Hz,1H ),2.52-2.48(m,1H),2.29-2.19(m,1H),2.19-2.12(m,1H),2.12-2.07(m,1H),2.06-1.98(m,1H),1.97- 1.86(m,1H),1.80-1.70(m,5H),1.69-1.64(m,1H),1.64-1.56(m,4H),1.56-1.50(m,6H),1.50-1.43(m,2 H),1.43-1.33(m,3H),1.30-1.23(m,2H),1.21-1.12(m,7H),1.11-1.01(m,1H),0.98(d,J=6.4Hz,3H),0. 96-0.87(m,2H),0.87-0.81(m,7H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.6Hz,3H),0.54(q,J=11.8Hz,1H).

[0483] Example 3. Synthesis of Compounds 5 and 6

[0484]

[0485] Zinc(II) chloride (0.67 mL, 0.67 mmol) was added to a solution of intermediate 1 (120 mg, 0.133 mmol) and propane-1-sulfonamide (328 mg, 2.67 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 10 min. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 100:0 to 50:50).

[0486] The first eluted diastereomer was purified by rapid chromatography (silica; MeCN / DCM 0:100 to 40:60) followed by reversed-phase preparative HPLC (method 2) to give compound 5 as a white solid (2.5 mg, 1.8% yield).

[0487] Compound 5: ESIMS[M+NH4] + 1008.8, [M+FA-H] - 1035.8

[0488] 1H NMR(400MHz, DMSO-d6)δ:7.53(d,J=9.4Hz,1H),6.59(s,1H),6.43(dd,J=14.2,11.0Hz,1H),6.25(dd,J=14.2,10 .5Hz,1H),6.18(dd,J=14.4,10.6Hz,1H),6.01-5.92(m,1H),5.50(dd,J=14.5,9.6Hz,1H),5.05(d,J=4.7Hz,1H) ,4.97-4.91(m,1H),4.86-4.78(m,1H),4.66-4.53(m,2H),3.99-3.90(m,1H),3.87(dd,J=9.3,4.6Hz,1H),3.75- 3.67(m,1H),3.67-3.59(m,1H),3.49-3.40(m,1H),3.31(s,3H),3.22(d,J=9.2Hz,1H),3.20-3.14(m,1H),3.12( s,3H),2.89-2.78(m,3H),2.73-2.63(m,1H),2.28-2.17(m,1H),2.17-2.09(m,1H),2.09-2.01(m,2H),1.96-1.8 6(m,3H),1.81(s,3H),1.78-1.69(m,3H),1.69-1.60(m,2H),1.60-1.53(m,2H),1.53-1.49(m,3H),1.48(s,3H), 1.45-1.35(m,3H),1.35-1.25(m,2H),1.23-1.09(m,6H),1.07-1.01(m,2H),0.98(d,J=3.3Hz,3H),0.97(d,J=3. 4Hz,3H),0.89-0.84(m,7H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.65(m,1H),0.64-0.54(m,1H).

[0489] The second eluted diastereomer was purified by reversed-phase rapid chromatography (C18; MeCN / water 10:90 to 100:0) to give compound 6 as a white solid (3 mg, 2.2% yield).

[0490] Compound 6: ESIMS[M+NH4] + 1008.8, [M+FA-H] - 1035.8

[0491] 1H NMR(400MHz,DMSO-d6)δ:7.53-7.06(m,1H),6.51-6.30(m,2H),6.19-6.09(m,2H),6.06(d, J=11.4Hz,1H),5.53(dd,J=14.3,8.7Hz,1H),5.15-4.95(m,3H),4.66(td,J=7.5,6.0,2.4Hz ,1H),4.62-4.52(m,1H),4.05-3.95(m,1H),3.95-3.84(m,1H),3.77(d,J=5.1Hz,1H),3.75- 3.68(m,1H),3.68-3.58(m,1H),3.31(s,3H),3.24-3.09(m,5H),3.03-2.95(m,1H),2.95-2. 87(m,1H),2.84-2.78(m,1H),2.57-2.43(m,1H),2.35-2.21(m,1H),2.20-2.11(m,1H),2.1 1-1.96(m,2H),1.96-1.85(m,1H),1.82-1.70(m,5H),1.70-1.56(m,8H),1.56-1.48(m,6H), 1.48-1.32(m,4H),1.32-1.09(m,6H),1.08-1.00(m,1H),1.00-0.92(m,6H),0.92-0.86(m,3 H), 0.86-0.80 (m, 6H), 0.78 (d, J = 6.7Hz, 3H), 0.75 (d, J = 6.6Hz, 3H), 0.53 (q, J = 11.8Hz, 1H).

[0492] Example 4. Synthesis of Compounds 7 and 8

[0493]

[0494] Zinc(II) chloride (0.67 mL, 0.67 mmol) was added to a solution of intermediate 1 (120 mg, 0.133 mmol) and propane-2-sulfonamide (164 mg, 1.33 mmol) in DCM (6 mL). The reaction mixture was stirred at room temperature for 18 hours. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 40:60).

[0495] The first eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 7 as a white solid (9.1 mg, 6.7% yield).

[0496] Compound 7: ESIMS[M+NH4] + 1008.8, [M+FA-H] + 1035.9

[0497] 1 H NMR (400MHz, DMSO-d6) δ: 7.47 (d, J = 9.3 Hz, 1H), 6.59 (s, 1H), 6.42 (dd, J = 14.0, 11.0 Hz, 1H), 6.29-6. 19(m,1H),6.16(dd,J=13.7,10.1Hz,1H),5.97-5.89(m,1H),5.49(dd,J=14.2,9.6Hz,1H),5.04(d,J= 4.7Hz,1H),4.98-4.88(m,1H),4.87-4.77(m,1H),4.66-4.55(m,2H),4.03-3.90(m,1H),3.87(dd,J= 9.2,4.6Hz,1H),3.75-3.68(m,1H),3.68-3.58(m,1H),3.50-3.39(m,1H),3.32(s,3H),3.25-3.15(m, 2H),3.12(s,3H),2.94-2.76(m,3H),2.29-2.17(m,1H),2.17-2.00(m,3H),2.00-1.87(m,3H),1.82( s,3H),1.81-1.70(m,2H),1.70-1.59(m,3H),1.59-1.45(m,6H),1.45-1.34(m,3H),1.34-1.22(m,2H) ,1.22-1.14(m,7H),1.15-1.12(m,2H),1.10(d,J=6.7Hz,3H),1.07-0.99(m,2H),1.00-0.93(m,6H),0 .89-0.82(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.72-0.64(m,1H),0.64-0.52(m,1H).

[0498] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 8 as a white solid (19.8 mg, 14.5% yield).

[0499] Compound 8: ESIMS[M+NH4] +1008.7, [MH] - 989.7

[0500] 1 H NMR(400MHz, DMSO-d6)δ:7.26(d,J=8.1Hz,1H),6.43-6.37(m,1H),6.36(s,1H),6.18-6.0 4(m,3H),5.54(dd,J=14.0,8.9Hz,1H),5.08-4.98(m,3H),4.71-4.62(m,1H),4.59(d,J=4 .4Hz,1H),4.08-3.97(m,1H),3.96-3.89(m,1H),3.77(d,J=5.0Hz,1H),3.74-3.67(m,1H) ,3.66-3.58(m,1H),3.31(s,3H),3.21-3.09(m,6H),2.86-2.77(m,1H),2.54-2.45(m,1H), 2.28-2.20(m,1H),2.19-2.13(m,1H),2.12-2.06(m,1H),2.06-1.99(m,1H),1.95-1.86(m ,1H),1.81-1.68(m,5H),1.68-1.56(m,4H),1.56-1.49(m,6H),1.49-1.32(m,6H),1.32-1. 25(m,1H),1.25-1.10(m,11H),1.09-1.01(m,1H),0.98(d,J=6.6Hz,3H),0.94-0.88(m,2H ),0.88-0.81(m,7H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.7Hz,3H),0.53(q,J=11.8Hz,1H).

[0501] Example 5. Synthesis of Compound 9 and Compound 10

[0502]

[0503] Zinc(II) chloride (0.67 mL, 0.67 mmol) was added to a solution of intermediate 1 (120 mg, 0.133 mmol) and 2-methylpropane-1-sulfonamide (274 mg, 2.00 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 1 hour. The mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 50:50).

[0504] The first eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 9 as a white solid (13.9 mg, 10.2% yield).

[0505] Compound 9: ESIMS[M+NH4] + 1022.8, [MH] - 1003.8

[0506] 1 H NMR(400MHz, DMSO-d6)δ:7.54(d,J=9.3Hz,1H),6.58(s,1H),6.43(dd,J=14.2,11.0Hz,1H),6.25(dd,J=1 4.3,10.6Hz,1H),6.18(dd,J=14.4,10.5Hz,1H),6.01-5.91(m,1H),5.50(dd,J=14.4,9.6Hz,1H),5.05(d ,J=4.5Hz,1H),4.97-4.90(m,1H),4.86-4.78(m,1H),4.67-4.54(m,2H),3.98-3.89(m,1H),3.89-3.79(m ,1H),3.76-3.68(m,1H),3.67-3.58(m,1H),3.50-3.41(m,1H),3.31(s,3H),3.25-3.15(m,2H),3.12(s,3H ),2.89-2.77(m,2H),2.74-2.61(m,2H),2.28-2.17(m,1H),2.17-2.09(m,1H),2.09-2.00(m,2H),2.00-1 .95(m,1H),1.95-1.86(m,3H),1.81(s,3H),1.78-1.59(m,5H),1.58-1.50(m,3H),1.48(s,3H),1.45-1.3 5(m,3H),1.35-1.24(m,2H),1.23-1.08(m,6H),1.05-1.00(m,2H),1.00-0.96(m,9H),0.91-0.87(m,4H), 0.85(d,J=6.4Hz,3H),0.79(d,J=6.7Hz,3H),0.76(d,J=6.7Hz,3H),0.70-0.63(m,1H),0.63-0.54(m,1H).

[0507] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 10 as a white solid (24.6 mg, 18.0% yield).

[0508] Compound 10: ESIMS [M+NH4] + 1022.9, [M-H] - 1004.0

[0509] 1 H NMR (400 MHz, DMSO-d6) δ: 7.32 (d, J = 8.2 Hz, 1H), 6.47 - 6.33 (m, 2H), 6.20 - 6.10 (m, 2H), 6.09 - 6.03 (m, 1H), 5.53 (dd, J = 14.2, 8.8 Hz, 1H), 5.10 - 4.97 (m, 3H), 4.73 - 4.62 (m, 1H), 4.59 (d, J = 4.5 Hz, 1H), 4.04 - 3.96 (m, 1H), 3.95 - 3.87 (m, 1H), 3.78 (d, J = 4.8 Hz, 1H), 3.76 - 3.69 (m, 1H), 3.68 - 3.58 (m, 1H), 3.31 (s, 3H), 3.22 - 3.09 (m, 5H), 2.94 - 2.84 (m, 2H), 2.83 - 2.76 (m, 1H), 2.56 - 2.42 (m, 1H), 2.29 - 2.20 (m, 1H), 2.20 - 2.13 (m, 1H), 2.11 - 2.00 (m, 3H), 1.95 - 1.87 (m, 1H), 1.81 - 1.70 (m, 5H), 1.68 - 1.56 (m, 5H), 1.56 - 1.50 (m, 5H), 1.50 - 1.43 (m, 3H), 1.43 - 1.33 (m, 3H), 1.31 - 1.11 (m, 6H), 1.09 - 0.95 (m, 10H), 0.95 - 0.87 (m, 2H), 0.87 - 0.81 (m, 7H), 0.79 (d, J = 6.7 Hz, 3H), 0.75 (d, J = 6.6 Hz, 3H), 0.53 (q, J = 11.8 Hz, 1H).

[0510] Example 6. Synthesis of Compound 11 and Compound 12

[0511]

[0512] Zinc(II) chloride (0.67 mL, 0.67 mmol) was added to a solution of intermediate 1 (120 mg, 0.133 mmol) and cyclopropanesulfonamide (323 mg, 2.67 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 10 min. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 100:0).

[0513] The first eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 11 as a white solid (4.4 mg, 3.2% yield).

[0514] Compound 11: ESIMS[M+NH4] + 1006.7, [M+FA-H] -- 1033.7

[0515] 1H NMR(400MHz, DMSO-d6)δ:7.51(d,J=8.5Hz,1H),6.59(s,1H),6.43(dd,J=14.1,11.0Hz,1H),6.22(dd,J=1 4.2,10.5Hz,1H),6.17(dd,J=14.4,10.8Hz,1H),6.00-5.91(m,1H),5.50(dd,J=14.3,9.6Hz,1H),5.05(d, J=4.5Hz,1H),4.99-4.90(m,1H),4.87-4.79(m,1H),4.69-4.54(m,2H),4.00-3.90(m,1H),3.90-3.80(m,1 H),3.78-3.68(m,1H),3.68-3.56(m,1H),3.50-3.40(m,1H),3.31(s,3H),3.23(d,J=9.2Hz,1H),3.19-3.1 5(m,1H),3.12(s,3H),2.91-2.78(m,2H),2.29-2.17(m,2H),2.17-2.09(m,1H),2.06-1.98(m,2H),1.98- 1.86(m,3H),1.83(s,3H),1.79-1.74(m,1H),1.73-1.67(m,2H),1.67-1.58(m,2H),1.58-1.49(m,3H),1.4 8(s,3H),1.46-1.27(m,5H),1.24-1.09(m,6H),1.09-1.00(m,2H),1.00-0.94(m,6H),0.89-0.85(m,4H),0 .85-0.81(m,4H),0.79(d,J=6.8Hz,3H),0.74(d,J=6.7Hz,3H),0.73-0.66(m,1H),0.60(q,J=11.8Hz,1H).

[0516] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 12 as a white solid (16.7 mg, 12.4% yield).

[0517] Compound 12: ESIMS[M+NH4] + 1006.4, [MH] - 987.5

[0518] 1H NMR(400MHz, DMSO-d6)δ:7.28(d,J=7.6Hz,1H),6.47-6.37(m,1H),6.36(s,1H),6.20-6.09( m,2H),6.05(d,J=11.1Hz,1H),5.54(dd,J=14.3,8.7Hz,1H),5.10-4.96(m,3H),4.70-4.63(m ,1H),4.59(d,J=4.4Hz,1H),4.05-3.94(m,2H),3.84-3.76(m,1H),3.71(d,J=5.4Hz,1H),3. 66-3.57(m,1H),3.31(s,3H),3.23-3.17(m,1H),3.17-3.10(m,4H),2.82(ddd,J=11.0,8.7,4 .3Hz,1H),2.63-2.53(m,2H),2.31-2.19(m,1H),2.19-2.09(m,2H),2.06-1.99(m,1H),1.96 -1.87(m,1H),1.80-1.72(m,5H),1.69-1.57(m,5H),1.57-1.50(m,7H),1.50-1.44(m,2H),1. 44-1.33(m,2H),1.32-1.12(m,6H),1.12-1.01(m,1H),0.98(d,J=6.4Hz,3H),0.94-0.88(m, 6H), 0.88-0.82 (m, 7H), 0.79 (d, J = 6.7Hz, 3H), 0.75 (d, J = 6.7Hz, 3H), 0.54 (q, J = 11.8Hz, 1H).

[0519] Example 7. Synthesis of Compounds 13 and 14

[0520]

[0521] Zinc(II) chloride (0.67 mL, 0.67 mmol) was added to a solution of intermediate 1 (120 mg, 0.133 mmol) and cyclobutanesulfonamide (270 mg, 2.00 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 11 min. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 80:20).

[0522] The first eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 13 as a white solid (12.3 mg, 9.19% yield).

[0523] Compound 13: ESIMS[M+NH4] + 1020.8, [M+FA-H] - 1047.9

[0524] 1 H NMR(400MHz, DMSO-d6)δ:7.46(d,J=9.3Hz,1H),6.59(s,1H),6.43(dd,J=13.9,11.0Hz,1H),6.29-6.21( m,1H),6.21-6.13(m,1H),5.92(dd,J=11.0,1.5Hz,1H),5.50(dd,J=14.2,9.6Hz,1H),5.05(d,J=4.7Hz,1 H),4.97-4.90(m,1H),4.86-4.78(m,1H),4.65-4.56(m,2H),3.97-3.90(m,1H),3.89-3.84(m,1H),3.71 -3.65(m,1H),3.65-3.58(m,1H),3.55-3.49(m,1H),3.47-3.40(m,1H),3.31(s,3H),3.22(d,J=9.2Hz,1H ),3.20-3.14(m,1H),3.12(s,3H),2.91-2.79(m,2H),2.26-2.17(m,3H),2.17-2.09(m,2H),2.09-1.99( m,3H),1.96-1.87(m,3H),1.86-1.80(m,2H),1.80-1.71(m,5H),1.69-1.59(m,3H),1.57-1.50(m,3H),1. 48(s,3H),1.45-1.35(m,3H),1.35-1.25(m,2H),1.22-1.08(m,6H),1.07-1.00(m,1H),1.00-0.93(m,7H ),0.89-0.82(m,4H),0.78(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.71-0.63(m,1H),0.63-0.54(m,1H).

[0525] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 14 as a white solid (26.6 mg, 19.5% yield).

[0526] Compound 14: ESIMS [M+NH4] + 1020.9, [M-H] - 1002.0

[0527] 1 H NMR (400 MHz, DMSO-d6) δ: 7.27 (d, J = 8.2 Hz, 1H), 6.47 (s, 1H), 6.44 - 6.34 (m, 1H), 6.17 - 6.09 (m, 2H), 6.04 (dd, J = 11.1, 1.6 Hz, 1H), 5.58 - 5.47 (m, 1H), 5.07 - 4.98 (m, 3H), 4.70 - 4.62 (m, 1H), 4.59 (s, 1H), 4.03 - 3.96 (m, 1H), 3.93 - 3.86 (m, 1H), 3.85 - 3.81 (m, 1H), 3.77 (d, J = 4.9 Hz, 1H), 3.68 - 3.63 (m, 2H), 3.31 (s, 3H), 3.20 - 3.09 (m, 5H), 2.81 (ddd, J = 11.2, 8.6, 4.3 Hz, 1H), 2.54 - 2.45 (m, 1H), 2.27 - 2.14 (m, 6H), 2.10 - 2.00 (m, 2H), 1.95 - 1.82 (m, 3H), 1.77 - 1.70 (m, 5H), 1.64 - 1.58 (m, 5H), 1.58 - 1.53 (m, 3H), 1.53 (s, 3H), 1.49 - 1.43 (m, 2H), 1.43 - 1.33 (m, 3H), 1.33 - 1.23 (m, 1H), 1.23 - 1.11 (m, 5H), 1.09 - 1.01 (m, 1H), 0.98 (d, J = 6.5 Hz, 3H), 0.94 - 0.88 (m, 2H), 0.87 - 0.81 (m, 7H), 0.80 - 0.74 (m, 6H), 0.53 (q, J = 11.8 Hz, 1H).

[0528] Example 8. Synthesis of Compounds 15 and 16

[0529]

[0530] Zinc(II) chloride (0.67 mL, 0.67 mmol) was added to a solution of intermediate 1 (120 mg, 0.133 mmol) and cyclopentanesulfonamide (298 mg, 2.00 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 11 min. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 50:50).

[0531] The first eluted diastereomer was purified by SFC chromatography (Method 1) followed by preparative HPLC (Method 2) to give compound 15 as a white solid (4.8 mg, 3.4% yield).

[0532] Compound 15: ESIMS[M+NH4] + 1034.9, [MH] - 1015.9

[0533] 1H NMR(400MHz, DMSO-d6)δ:7.48(d,J=9.2Hz,1H),6.54(s,1H),6.43(dd,J=14.1,11.0Hz,1H),6.23( dd,J=14.3,10.7Hz,1H),6.20-6.11(m,1H),5.95(dd,J=10.9,1.6Hz,1H),5.49(dd,J=14.2,9.6Hz ,1H),5.05(s,1H),4.97-4.89(m,1H),4.86-4.77(m,1H),4.71-4.51(m,2H),4.00-3.90(m,1H),3. 90-3.83(m,1H),3.78-3.68(m,1H),3.68-3.59(m,1H),3.50-3.40(m,1H),3.32(s,3H),3.24-3.20 (m,1H),3.20-3.14(m,2H),3.12(s,3H),2.92-2.80(m,2H),2.28-2.17(m,1H),2.16-2.08(m,1H), 2.08-1.99(m,2H),1.96-1.87(m,3H),1.85-1.78(m,7H),1.76-1.72(m,1H),1.69-1.59(m,6H),1. 53-1.46(m,8H),1.44-1.36(m,3H),1.34-1.26(m,2H),1.22-1.09(m,6H),1.02-0.93(m,8H),0.88 -0.83(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.63(m,1H),0.63-0.53(m,1H).

[0534] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 16 as a white solid (22.8 mg, 16.3% yield).

[0535] Compound 16: ESIMS[M+NH4] + 1034.5, [MH] - 1015.5

[0536] 1H NMR(400MHz,DMSO-d6)δ:7.53-7.11(m,1H),6.47-6.30(m,2H),6.19-6.09(m,2H),6.09-6.02(m ,1H),5.53(dd,J=14.1,8.9Hz,1H),5.18-4.90(m,3H),4.66(ddd,J=9.5,6.2,2.5Hz,1H),4.63- 4.52(m,1H),4.04-3.96(m,1H),3.96-3.87(m,1H),3.79(d,J=4.8Hz,1H),3.72-3.65(m,1H),3. 65-3.60(m,1H),3.60-3.51(m,1H),3.31(s,3H),3.20-3.10(m,5H),2.87-2.76(m,1H),2.57-2. 45(m,1H),2.28-2.20(m,1H),2.20-2.14(m,1H),2.11-2.00(m,2H),1.92-1.80(m,5H),1.79-1. 69(m,5H),1.69-1.61(m,5H),1.60-1.53(m,7H),1.51(s,3H),1.50-1.43(m,2H),1.43-1.33(m, 3H),1.31-1.27(m,1H),1.24-1.13(m,5H),1.09-1.01(m,1H),0.98(d,J=6.5Hz,3H),0.94-0.87 (m,3H),0.86-0.80(m,6H),0.78(d,J=6.7Hz,3H),0.75(d,J=6.6Hz,3H),0.53(q,J=11.9Hz,1H).

[0537] Example 9. Synthesis of Compounds 17 and 18

[0538]

[0539] Zinc(II) chloride (0.56 mL, 0.56 mmol) was added to a solution of intermediate 1 (100 mg, 0.111 mmol) and 3-chloropropane-1-sulfonamide (263 mg, 1.67 mmol) in DCM (3 mL). The reaction mixture was stirred at room temperature for 10 min. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 40:60).

[0540] The first eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 17 as a white solid (8.0 mg, 6.8% yield).

[0541] Compound 17: ESIMS[M+NH4] + 1042.4, [MH] - 1023.3

[0542] 1 H NMR (400MHz, DMSO-d6) δ: 7.69 (d, J = 9.0 Hz, 1H), 6.60 (s, 1H), 6.41 (dd, J = 14.1, 11.0 Hz, 1H), 6. 23(dd,J=14.1,10.5Hz,1H),6.17(dd,J=14.4,10.5Hz,1H),6.03-5.91(m,1H),5.49(dd,J=14.4 ,9.6Hz,1H),5.05(d,J=4.6Hz,1H),4.98-4.90(m,1H),4.86-4.77(m,1H),4.68-4.55(m,2H),3. 99-3.90(m,1H),3.88(dd,J=9.2,3.8Hz,1H),3.77-3.56(m,4H),3.51-3.40(m,1H),3.31(s,3H) ,3.25-3.16(m,2H),3.12(s,3H),3.05-2.94(m,1H),2.92-2.80(m,3H),2.29-2.17(m,1H),2.17 -2.08(m,1H),2.08-1.98(m,4H),1.96-1.87(m,3H),1.82(s,3H),1.78-1.60(m,5H),1.55-1.45 (m,6H),1.44-1.34(m,4H),1.32-1.25(m,1H),1.23-1.08(m,6H),1.04-0.94(m,8H),0.88-0.82 (m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.65(d,J=9.5Hz,1H),0.63-0.51(m,1H).

[0543] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 18 as a white solid (15.0 mg, 12.9% yield).

[0544] Compound 18: ESIMS[M+NH4] + 1042.4, [MH] - 1023.4

[0545] 1 H NMR(400MHz,DMSO-d6)δ:7.48(d,J=7.9Hz,1H),6.45(s,1H),6.43-6.35(m,1H),6 .20-6.10(m,2H),6.09-6.03(m,1H),5.53(dd,J=14.2,8.9Hz,1H),5.09-4.97(m, 3H),4.71-4.62(m,1H),4.59(d,J=4.4Hz,1H),4.03-3.96(m,1H),3.93-3.83(m,1 H),3.80-3.69(m,4H),3.68-3.58(m,1H),3.31(s,3H),3.20-3.11(m,6H),3.08-3. 02(m,1H),2.81(ddd,J=11.1,8.6,4.3Hz,1H),2.55-2.50(m,1H),2.29-2.19(m,1 H),2.16-2.02(m,5H),1.96-1.85(m,1H),1.80-1.70(m,5H),1.69-1.34(m,16H),1 .33-1.10(m,6H),1.09-1.02(m,1H),1.00-0.97(m,3H),0.94-0.89(m,2H),0.88- 0.81 (m, 7H), 0.79 (d, J = 6.6 Hz, 3H), 0.75 (d, J = 6.6 Hz, 3H), 0.54 (q, J = 11.9 Hz, 1H).

[0546] Example 10. Synthesis of Compounds 19 and 20

[0547]

[0548] Zinc(II) chloride (0.55 mL, 0.55 mmol) was added to a solution of intermediate 1 (100 mg, 0.111 mmol) and 2-hydroxyethanesulfonamide (139 mg, 1.11 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 30 min. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by rapid chromatography (silica; MeCN / DCM 0:100 to 70:30).

[0549] The first eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 19 as a white solid (2.2 mg, 1.8% yield).

[0550] Compound 19: ESIMS[MH] - 991.9

[0551] 1 H NMR (400MHz, DMSO-d6) δ: 6.44 (dd, J=14.0, 10.9Hz, 1H), 6.29-6.13 (m, 2H), 5.96 (d, J=10.6Hz, 1H), 5.50 (dd, J=14.2, 9.6Hz, 1H), 4.96-4. 90(m,1H),4.82(d,J=9.9Hz,1H),4.68-4.56(m,1H),3.97-3.84(m,2H),3.78-3.68(m,1H),3.68-3.58(m,3H),3.48-3.40(m,1H),3.39-3. 26(m,3H),3.24-3.13(m,2H),3.12(s,3H),3.05-2.79(m,4H),2.28-2.18(m,1H),2.18-1.99(m,3H),1.99-1.83(m,3H),1.81(s,3H),1.79 -1.58(m,5H),1.57-1.08(m,17H),1.06-0.89(m,8H),0.89-0.82(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.53(m,2H).

[0552] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 20 as a white solid (9.0 mg, 7.8% yield).

[0553] Compound 20: ESIMS[MH] - 991.9

[0554] 1H NMR(400MHz, DMSO-d6)δ:7.32(d,J=7.8Hz,1H),6.50-6.32(m,2H),6.21-6.08(m,2H),6.08-6.03(m,1H),5.56(dd,J=14.1,8.7Hz,1H),5.06 -4.99(m,3H),4.85(s,1H),4.71-4.62(m,1H),4.61-4.54(m,1H),4.02 -3.88(m,2H),3.81-3.67(m,4H),3.65-3.58(m,1H),3.37-3.25(m,3H) ,3.20-3.09(m,7H),2.85-2.77(m,1H),2.60-2.53(m,1H),2.28-2.19( m,1H),2.19-1.96(m,3H),1.95-1.87(m,1H),1.82-1.70(m,5H),1.69- 1.35(m,16H),1.33-1.11(m,6H),1.11-0.96(m,4H),0.95-0.81(m,9H),0.79(d,J=6.6Hz,3H),0.75(d,J=6.6Hz,3H),0.54(q,J=11.8Hz,1H).

[0555] Example 11. Synthesis of Compounds 21 and 22

[0556]

[0557] Zinc(II) chloride (0.53 mL, 0.53 mmol) was added to a solution of intermediate 2 (100 mg, 0.105 mmol) and methanesulfonamide (100 mg, 1.05 mmol) in DCM (25 mL). The reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by reversed-phase preparative HPLC (Method 1).

[0558] The first eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 21 as a white solid (4.5 mg, 4.0% yield).

[0559] Compound 21: ESIMS[MH] - 1014.0

[0560] 1H NMR (400MHz, DMSO-d6) δ: 9.28 (s, 1H), 7.27 (s, 1H), 6.58-6.34 (m, 2H), 6.26-6.08 (m, 2H), 6.09-6.00 (m, 1H), 5.53 (dd, J = 14. 1,8.8Hz,1H),5.24-5.12(m,1H),5.09-4.97(m,3H),4.76-4.64(m,1H),3.99-3.96(m,1H),3.95-3.85(m,1H),3.84-3.75(m,1 H),3.67(d,J=5.7Hz,1H),3.64-3.56(m,2H),3.45-3.17(m,4H),3.14(s,3H),2.88(s,3H),2.62-2.54(m,1H),2.30-2.08(m, 4H), 2.08-1.99 (m, 1H), 1.98-1.87 (m, 1H), 1.83-1.34 (m, 22H), 1.33-1.14 (m, 5H), 1.12-0.79 (m, 16H), 0.69 (d, J = 6.7Hz, 3H).

[0561] The second eluted diastereomer was purified by SFC chromatography (Method 1) to give compound 22 as a white solid (5.5 mg, 4.8% yield).

[0562] Compound 22: ESIMS[MH] - 1014.1

[0563] 1H NMR(400MHz, DMSO-d6)δ:9.32(s,1H),7.48(s,1H),6.72-6.38(m,2H),6.33-6.12(m,2H),5.98(d,J=10.9Hz,1H),5.50(dd,J=14.2,9.6Hz ,1H),5.26-5.15(m,1H),5.05(s,1H),4.99-4.92(m,1H),4.83(d,J=9.8Hz,1H),4.64-4.54(m,1H),3.97-3.80(m,2H),3.79-3.70(m,1H), 3.68-3.57(m,2H),3.48-3.41(m,1H),3.26(s,3H),3.21(d,J=9.2Hz,1H),3.09(s,3H),2.91-2.78(m,1H),2.71(s,3H),2.30-1.85(m,7H) ,1.80(s,3H),1.77-1.61(m,5H),1.61-1.35(m,13H),1.33-0.89(m,14H),0.86(d,J=6.5Hz,3H),0.81(d,J=6.7Hz,3H),0.77-0.55(m,4H).

[0564] Example 12. Synthesis of compounds 23 and 24

[0565]

[0566] Zinc(II) chloride (0.51 mL, 0.51 mmol) was added to a solution of intermediate 3 (100 mg, 0.102 mmol) and methanesulfonamide (97 mg, 1.0 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 30 minutes. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure to give a mixture of two diastereomers. The diastereomer mixture was separated by reversed-phase preparative HPLC (Method 1).

[0567] The first eluted diastereomer was separated to give compound 23 (5.6 mg, 4.6% yield) as a white solid.

[0568] Compound 23: ESIMS[MH] - 1037.4

[0569] 1H NMR(400MHz, DMSO-d6)δ:7.30(d,J=7.7Hz,1H),6.48(s,1H),6.46-6.33(m,1H),6.23-6.08(m,2H),6.05(d,J=11.0Hz,1H),5.54( dd,J=14.2,8.8Hz,1H),5.11-4.97(m,3H),4.73-4.62(m,1H),4.06-3.84(m,3H),3.81-3.70(m,2H),3.68-3.59(m,1H),3.37-3.26 (m,3H),3.21-3.11(m,4H),3.11-2.99(m,1H),2.89(s,3H),2.59-2.51(m,1H),2.30-1.86(m,6H),1.80-1.68(m,4H),1.66-1.46(m ,14H),1.46-1.11(m,14H),1.10-0.87(m,7H),0.88-0.82(m,6H),0.79(d,J=6.6Hz,3H),0.75(d,J=6.6Hz,3H),0.69-0.52(m,1H).

[0570] The second eluted diastereomer was purified by SFC chromatography (Method 1) followed by reversed-phase preparative HPLC chromatography (Method 3) to give compound 24 as a white solid (5.3 mg, 4.7% yield).

[0571] Compound 24: ESIMS[MH] - 1037.9

[0572] 1H NMR(400MHz, DMSO-d6)δ:7.49(d,J=9.3Hz,1H),6.60(s,1H),6.45(dd,J=14.1,11.1Hz,1H),6.31-6.11(m,2H),5.98(d,J=10.9Hz,1H),5.50(dd,J=14 .3,9.6Hz,1H),5.06(d,J=4.6Hz,1H),5.01-4.91(m,1H),4.82(d,J=9.8Hz, 1H),4.62-4.52(m,1H),4.06-3.80(m,3H),3.78-3.68(m,1H),3.68-3.56(m ,1H),3.50-3.40(m,1H),3.29(s,3H),3.23(d,J=9.1Hz,1H),3.12(s,3H),3 .08-2.98(m,1H),2.91-2.77(m,1H),2.71(s,3H),2.30-1.84(m,8H),1.81( s,3H),1.78-1.59(m,4H),1.58-1.27(m,19H),1.26-1.09(m,4H),1.08-0.9 0(m,10H),0.86(d,J=6.4Hz,3H),0.80(d,J=6.7Hz,3H),0.76-0.60(m,4H).

[0573] Example 13. Synthesis of intermediate 4-A, intermediate 4-B and compound 25

[0574]

[0575] Zinc(II) chloride (0.47 mL, 0.47 mmol) was added to a solution of intermediate 4 (100 mg, 0.094 mmol) and methanesulfonamide (180 mg, 1.88 mmol) in DCM (10 mL). The reaction mixture was stirred at room temperature for 30 minutes. The reaction mixture was diluted with H2O and extracted with dichloromethane. The organic extract was evaporated under reduced pressure. The crude product was separated by rapid chromatography (silica; cyclohexane / EtOAc 100:0 to 0:100).

[0576] The first elution peak containing the diastereomer mixture was separated using SFC chromatography (Method 1) to give intermediate 4-A (6.0 mg, 5.4% yield) as a white solid.

[0577] Intermediate 4-A: ESIMS[MH] - 1119.9

[0578] 1H NMR(400MHz, DMSO-d6)δ:7.49(d,J=9.4Hz,1H),6.59(s,1H),6.43(dd,J=14.4,11.1H z,1H),6.30-6.11(m,2H),5.98(d,J=11.2,1.5Hz,1H),5.51(dd,J=14.6,9.5Hz,1H), 5.05(d,J=4.7Hz,1H),4.97-4.90(m,1H),4.86-4.77(m,1H),4.65-4.56(m,1H),3.99 -3.80(m,2H),3.78-3.69(m,1H),3.68-3.58(m,3H),3.57-3.50(m,2H),3.48-3.40(m ,1H),3.31(s,3H),3.22(d,J=9.2Hz,1H),3.16-3.05(m,4H),3.04-2.93(m,1H),2.90 -2.76(m,1H),2.70(s,3H),2.27-2.18(m,1H),2.17-1.84(m,7H),1.81(s,3H),1.77- 1.59(m,3H),1.59-1.45(m,6H),1.44-1.08(m,12H),1.07-0.91(m,8H),0.90-0.81(m ,14H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.57(m,1H),0.03(s,6H).

[0579] The SFC fraction containing the second diastereomer was purified by reversed-phase preparative HPLC (method 4) to obtain intermediate 4-B (5.0 mg, 4.2% yield) as a white solid.

[0580] Intermediate 4-B: ESIMS[MH] - 1119.6

[0581] 1H NMR(400MHz,DMSO-d6)δ:7.29(d,J=7.6Hz,1H),6.46(s,1H),6.44-6.33(m, 1H),6.23-6.08(m,2H),6.05(d,J=11.1Hz,1H),5.54(dd,J=14.2,9.0Hz,1H ),5.07-4.96(m,3H),4.74-4.62(m,1H),4.01-3.96(m,1H),3.95-3.87(m,1 H),3.81-3.69(m,2H),3.68-3.58(m,3H),3.56-3.50(m,2H),3.38-3.25(m, 3H),3.23-3.11(m,4H),3.10-3.00(m,1H),3.00-2.91(m,1H),2.89(s,3H), 2.60-2.52(m,1H),2.28-2.18(m,1H),2.18-2.01(m,3H),2.00-1.84(m,2H) ,1.80-1.70(m,4H),1.70-1.46(m,17H),1.46-1.00(m,6H),1.00-0.91(m,4 H),0.91-0.81(m,16H),0.80-0.69(m,7H),0.65-0.51(m,1H),0.03(s,6H).

[0582] The second elution peak was purified by SFC chromatography (Method 1) to give compound 25 (5.5 mg, 5.5% yield) as a white solid.

[0583] Compound 25: ESIMS[MH] - 1005.4

[0584] 1H NMR (400MHz, DMSO-d6) δ: 7.30 (d, J = 7.8 Hz, 1H), 6.47 (s, 1H), 6.40 (dd, J = 13.7, 11.2 Hz, 1H), 6.20-6.08 (m, 2H), 6.05 (d, J = 11.0 Hz, 1H), 5.54 (dd, J = 14. 3,8.8Hz,1H),5.08-4.97(m,3H),4.70-4.62(m,1H),4.49-4.38(m,1H),4.0 2-3.96(m,1H),3.95-3.87(m,1H),3.80-3.70(m,2H),3.67-3.58(m,1H),3.5 5-3.41(m,4H),3.37-3.24(m,3H),3.22-3.10(m,4H),3.04-2.92(m,2H),2. 89(s,3H),2.60-2.49(m,1H),2.27-2.19(m,1H),2.18-1.99(m,3H),1.98-1 .87(m,2H),1.83-1.71(m,4H),1.70-1.34(m,15H),1.32-1.00(m,7H),1.00 -0.88(m,5H),0.88-0.81(m,8H),0.81-0.69(m,6H),0.59(q,J=11.7Hz,1H).

[0585] Example 14. Synthesis of Compound 26

[0586]

[0587] Acetic acid (0.1 mL) was added to a mixture of intermediate 4-B (30 mg, 0.027 mmol) in hexane (1 mL), EtOAc (1 mL), and H2O (1 mL). The reaction mixture was stirred at room temperature for 4 hours. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure. The crude product was purified by SFC chromatography (Method 1) to give compound 26 (4.5 mg, 16% yield) as a white solid.

[0588] Compound 26: ESIMS[MH] - 1005.9

[0589] 1H NMR (400MHz, DMSO-d6) δ: 7.49 (d, J = 9.3 Hz, 1H), 6.59 (s, 1H), 6.44 (dd, J = 14. 3,11.0Hz,1H),6.30-6.11(m,2H),6.02-5.94(m,1H),5.50(dd,J=14.5,9.5H z,1H),5.05(d,J=4.6Hz,1H),4.98-4.89(m,1H),4.82(d,J=9.8Hz,1H),4.64 -4.54(m,1H),4.46(s,1H),3.99-3.78(m,2H),3.77-3.68(m,1H),3.68-3.58( m,1H),3.57-3.41(m,5H),3.40-3.26(m,3H),3.22(d,J=9.2Hz,1H),3.12(s, 3H),3.10-2.93(m,2H),2.91-2.77(m,1H),2.70(s,3H),2.28-1.83(m,8H),1. 81(s,3H),1.77-1.46(m,10H),1.45-1.07(m,12H),1.07-0.89(m,8H),0.89- 0.82(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.71-0.55(m,1H).

[0590] Example 15. Synthesis of Compound 27

[0591]

[0592] Zinc(II) chloride (0.51 mL, 0.51 mmol) was added to a solution of intermediate 3 (100 mg, 0.102 mmol) and N-methylmethanesulfonamide (112 mg, 1.02 mmol) in DCM (7 mL). The reaction mixture was stirred at room temperature for 30 minutes. The reaction mixture was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure. The crude product was purified by SFC chromatography (Method 1) to give compound 27 (25 mg, 22% yield) as a white solid.

[0593] Compound 27: ESIMS[MH] - 1051.4

[0594] 1H NMR(400MHz, DMSO-d6)δ:6.49(dd,J=14.1,10.9Hz,1H),6.35(s,1H),6.30-6.12(m,2H),5.99(d,J=10.9Hz,1H),5.46(dd ,J=14.4,9.7Hz,1H),5.07(d,J=4.9Hz,1H),4.98-4.87(m,2H),4.75-4.63(m,1H),4.60-4.48(m,1H),4.02-3.90(m,2H), 3.80-3.69(m,1H),3.68-3.55(m,1H),3.53-3.26(m,5H),3.22-2.97(m,7H),2.84-2.72(m,1H),2.51(s,3H),2.29-2.13( m,2H),2.13-1.89(m,4H),1.80(s,3H),1.76-1.06(m,30H),1.04-0.90(m,8H),0.88(d,J=6.3Hz,3H),0.83-0.59(m,8H).

[0595] Example 16. Synthesis of Compounds 28 and 29

[0596]

[0597] diastereomer 1 Intermediate 7 (68 mg, 0.069 mmol) was stirred in HCl (1.35 mL, 5.52 mmol) at room temperature for 1 hour. The reaction mixture was directly freeze-dried to give the crude product. The diastereomer crude product was purified by preparative HPLC (Method 1) to give compound 28 (4.4 mg, 6.7% yield) as a white solid.

[0598] Compound 28: ESIMS[M+H] + 885.6, [M+FA-H] - 929.6

[0599] 1H NMR(400MHz,DMSO-d6)δ:6.47-6.40(m,1H),6.21-6.12(m,2H),5.96-5.87(m,1H),5. 46(dd,J=14.0,9.2Hz,1H),4.98-4.93(m,1H),4.89-4.81(m,1H),4.66-4.59(m,1H), 4.02-3.94(m,1H),3.91-3.86(m,1H),3.64-3.55(m,1H),3.48-3.40(m,1H),3.31(s, 3H),3.29-3.24(m,2H),3.21-3.16(m,1H),3.12(s,3H),2.88-2.80(m,2H),2.24-2.17 (m,1H),2.17-2.10(m,1H),2.09-2.01(m,1H),1.97-1.90(m,2H),1.88-1.82(m,1H), 1.81-1.74(m,5H),1.74-1.70(m,2H),1.68-1.61(m,2H),1.54-1.47(m,6H),1.44-1.3 7(m,3H),1.34-1.27(m,2H),1.25-1.09(m,6H),1.07-1.00(m,2H),0.98-0.95(m,6H) ,0.88-0.83(m,4H),0.79(d,J=6.7Hz,3H),0.75-0.69(m,4H),0.59(q,J=11.9Hz,1H).

[0600] diastereomer 2 Intermediate 8 (75 mg, 0.076 mmol) was stirred in HCl (4 M solution in dioxane, 0.95 mL, 3.8 mmol) at room temperature for 1 hour. The reaction mixture was directly freeze-dried to give the crude product. The diastereomer crude product was purified by preparative HPLC (Method 1) to give compound 29 (10.9 mg, 15.8% yield) as a white solid.

[0601] Compound 29: ESIMS[M+H] + 885.9, [M+FA-H] - 930.2

[0602] 1H NMR(400MHz,DMSO-d6)δ:6.50-6.40(m,1H),6.24-6.11(m,3H),5.60(dd,J=14.1,8 .7Hz,1H),5.06-5.01(m,1H),4.95(d,J=9.7Hz,1H),4.70-4.63(m,1H),4.04-3.98( m,1H),3.98-3.92(m,1H),3.69-3.61(m,2H),3.57(d,J=6.8Hz,1H),3.31(s,3H),3. 27-3.21(m,1H),3.20-3.16(m,1H),3.15(s,3H),2.82(ddd,J=11.2,8.7,4.4Hz,1H) ,2.76-2.67(m,1H),2.29-2.20(m,1H),2.19-2.13(m,1H),2.12-2.01(m,2H),1.95- 1.89(m,1H),1.85-1.80(m,3H),1.78-1.71(m,3H),1.68-1.55(m,5H),1.55-1.49(m ,6H),1.49-1.46(m,2H),1.45-1.38(m,2H),1.33-1.10(m,7H),1.02-0.97(m,4H),0 .92-0.85(m,5H),0.84-0.79(m,6H),0.74(d,J=6.7Hz,3H),0.57(q,J=11.8Hz,1H).

[0603] The absolute configuration of the C16 substituent in compound 29 was determined by X-ray co-crystallization with FKBP12. Based on the X-ray co-crystallization structure, the C16 substituent in compound 29 has an (R)- configuration. The crystal structure is depicted on... Figure 2 middle.

[0604] Example 17. Synthesis of Compounds 30 and 31

[0605]

[0606] Add 4-methylbenzenesulfonic acid hydrate (74 mg, 0.389 mmol) to a mixture of intermediate 1 (350 mg, 0.389 mmol) and tert-butyl methylcarbamate (765 mg, 5.83 mmol) in DCM (3 mL). Stir the reaction mixture at room temperature for 23 hours. Separate the entire reaction mixture containing the product mixture of the two diastereomers by reversed-phase rapid chromatography (C18; MeCN / H2O 40:60 to 90:10).

[0607] The first eluted diastereomer was purified by SFC chromatography (Method 3) followed by preparative HPLC (Method 2) to give compound 30 (22 mg, 5.4% yield) as a white solid.

[0608] Compound 30: ESIMS[M+NH4] + 1017.2, [M+FA-H] - 1044.2

[0609] 1 H NMR(400MHz,DMSO-d6)δ:6.61-6.51(m,1H),6.50-6.45(m,1H),6.24-6.15(m,2H),5.99(d ,J=11.0Hz,1H),5.66(dd,J=14.2,8.4Hz,1H),5.07(d,J=4.7Hz,1H),5.04-5.00(m,1H),4. 89(d,J=9.6Hz,1H),4.72-4.65(m,1H),4.59(d,J=4.4Hz,1H),4.48-4.29(m,1H),3.91(dd, J=8.6,4.6Hz,1H),3.73-3.61(m,1H),3.54-3.42(m,2H),3.34(d,J=8.1Hz,1H),3.30(s,3H ),3.20-3.16(m,1H),3.14(s,3H),2.96-2.88(m,1H),2.86-2.79(m,1H),2.59(s,3H),2.28 -2.19(m,2H),2.17-2.10(m,1H),2.08-2.00(m,2H),1.96-1.90(m,1H),1.86-1.80(m,1H), 1.77-1.62(m,8H),1.56-1.46(m,6H),1.43-1.26(m,17H),1.23-1.09(m,4H),1.07-1.02(m ,1H),1.01-0.94(m,6H),0.89-0.81(m,8H),0.73(d,J=6.7Hz,3H),0.58(q,J=11.9Hz,1H).

[0610] The second eluted diastereomer was purified by SFC chromatography (Method 3) followed by preparative HPLC (Method 2) to give compound 31 as a white solid (45 mg, 11.2% yield).

[0611] Compound 31: ESIMS[M+NH4] + 1017.2, [M+FA-H] - 1044.3

[0612] 1 H NMR(400MHz,DMSO-d6)δ:6.49-6.40(m,1H),6.27-6.11(m,2H),5.98-5.84(m,1H ),5.53-5.36(m,1H),5.10-5.05(m,1H),5.02-4.91(m,2H),4.64-4.54(m,2H),4. 44-4.19(m,1H),4.06-3.92(m,1H),3.77-3.64(m,1H),3.65-3.50(m,2H),3.51- 3.39(m,1H),3.33(s,3H),3.21-3.16(m,1H),3.13(s,3H),2.90-2.79(m,1H),2.6 9-2.61(m,1H),2.51(s,3H),2.26-2.13(m,2H),2.09-2.00(m,2H),1.94-1.88(m ,1H),1.78-1.67(m,5H),1.67-1.65(m,1H),1.63-1.48(m,10H),1.47-1.44(m,1H ),1.42-1.30(m,12H),1.29-1.22(m,3H),1.22-1.12(m,4H),1.12-1.01(m,1H), 1.01-0.95(m,4H),0.92-0.81(m,8H),0.80-0.73(m,6H),0.60(q,J=11.9Hz,1H).

[0613] Example 18. Synthesis of Compounds 32 and 33

[0614]

[0615] diastereomer 1 The solution of compound 31 (44 mg, 0.044 mmol) in HCl (4 M solution in dioxane, 550 μL, 2.20 mmol) was stirred at room temperature for 6 minutes. The reaction mixture was directly freeze-dried to give the crude product. The diastereomer crude product was purified by preparative HPLC (Method 2) to give compound 32 (11.5 mg, 27.4% yield) as a white solid.

[0616] Compound 32: ESIMS[M+H] + 899.9, [M+FA-H] - 945.2

[0617] 1H NMR(400MHz,DMSO-d6)δ:9.08-8.59(m,2H),6.86(s,1H),6.51-6.41(m,1H),6.34-6.1 7(m,3H),5.71-5.60(m,1H),5.12-5.07(m,2H),4.96(d,J=9.5Hz,1H),4.70-4.63(m,1H ),4.60(d,J=4.4Hz,1H),4.14-4.03(m,1H),4.02-3.90(m,2H),3.76-3.65(m,1H),3.5 4(d,J=7.3Hz,1H),3.31(s,3H),3.25-3.17(m,1H),3.17-3.15(m,1H),3.14(s,3H),2.8 5-2.75(m,2H),2.43-2.37(m,3H),2.34-2.24(m,1H),2.21-2.12(m,2H),2.11-1.97(m ,2H),1.93-1.87(m,1H),1.81(s,3H),1.78-1.68(m,4H),1.65-1.44(m,11H),1.41-1.3 6(m,1H),1.35-1.24(m,5H),1.18-1.09(m,3H),1.01-0.97(m,4H),0.96-0.92(m,1H),0 .90(d,J=6.4Hz,3H),0.87-0.79(m,7H),0.73(d,J=6.7Hz,3H),0.56(q,J=11.8Hz,1H).

[0618] diastereomer 2 Compound 30 (60 mg, 0.060 mmol) was stirred in HCl (1.25 M solution in methanol, 2.9 mL, 3.60 mmol) at room temperature for 8 hours. The reaction was evaporated under reduced pressure to give the crude product. The diastereomer crude product was purified by preparative HPLC (Method 2) to give compound 33 (3.6 mg, 6.3% yield) as a white solid.

[0619] Compound 33: ESIMS[M+H] + 900.0, [M+FA-H] - 944.0

[0620] 1H NMR(400MHz, DMSO-d6)δ:9.19(d,J=150.7Hz,2H),6.72(s,1H),6.48(dd,J=14.3,11.1Hz,1H) ,6.31-6.16(m,3H),5.56(dd,J=14.6,9.5Hz,1H),5.04(d,J=5.0Hz,1H),4.94(dd,J=6.4,1.9 Hz,1H),4.81(d,J=9.8Hz,1H),4.67-4.59(m,2H),4.17-4.05(m,1H),3.87(dd,J=9.2,4.9Hz, 1H),3.65-3.52(m,2H),3.50-3.43(m,1H),3.32(s,3H),3.23(d,J=9.2Hz,1H),3.20-3.16(m, 1H),3.12(s,3H),2.91-2.82(m,2H),2.29(s,3H),2.23-2.10(m,3H),2.09-2.03(m,1H),2.00 -1.90(m,3H),1.86(s,3H),1.80-1.63(m,5H),1.56-1.50(m,3H),1.47(s,3H),1.44-1.35(m, 4H),1.33-1.25(m,1H),1.24-1.09(m,6H),1.04-0.94(m,8H),0.90-0.87(m,1H),0.84(d,J=6 .5Hz,3H),0.80(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.72-0.66(m,1H),0.65-0.54(m,1H).

[0621] Example 19. Synthesis of compounds 34 and 35

[0622]

[0623] 4-Methylbenzenesulfonic acid hydrate (9.51 mg, 0.0501 mmol) was added to a mixture of intermediate 1 (150 mg, 0.167 mmol) and tert-butyl hydroxycarbamate (333 mg, 2.50 mmol) in DCM (5 mL). The reaction mixture was stirred at room temperature for three hours. The entire reaction mixture was purified directly by rapid chromatography (silica; MeCN / DCM 0:100 to 100:0). The second elution peak yielded a mixture of two diastereomers.

[0624] The diastereomer mixture was separated by SFC chromatography (Method 1).

[0625] The first elution of the diastereomer yielded compound 34 (32.4 mg, 19.0% yield) as a white solid.

[0626] Compound 34: ESIMS[M+NH4] + 1019.1, [M+FA-H] - 1046.1

[0627] 1 H NMR(400MHz,DMSO-d6)δ:8.78(s,1H),6.47-6.37(m,1H),6.22-6.10(m,2H),5.97 (s,1H),5.97-5.90(m,1H),5.50-5.39(m,1H),5.06(d,J=4.7Hz,1H),5.02-4.94( m,2H),4.65-4.53(m,3H),4.05-3.94(m,1H),3.87-3.76(m,1H),3.60(d,J=6.5Hz ,1H),3.58-3.51(m,1H),3.39-3.34(m,1H),3.32(s,3H),3.23-3.16(m,1H),3.14 (s,3H),2.84(ddd,J=11.2,8.6,4.3Hz,1H),2.71-2.59(m,1H),2.24-2.11(m,2H) ,2.08-2.01(m,2H),1.95-1.88(m,1H),1.78-1.71(m,5H),1.64-1.46(m,10H),1. 44-1.35(m,13H),1.30-1.13(m,8H),1.11-1.03(m,1H),1.00-0.95(m,4H),0.92- 0.82(m,8H),0.79(d,J=6.8Hz,3H),0.76(d,J=6.7Hz,3H),0.58(q,J=11.9Hz,1H).

[0628] The second elution of the diastereomer yielded compound 35 (17 mg, 10.3% yield) as a white solid.

[0629] Compound 35: ESIMS[M+NH4] + 1019.1, [M+FA-H] - 1046.1

[0630] 1H NMR(400MHz,DMSO-d6)δ:9.02(s,1H),6.55(s,1H),6.51-6.41(m,1H),6.24-6.13(m,2H), 5.96-5.90(m,1H),5.59-5.46(m,1H),5.02(d,J=4.7Hz,1H),4.99-4.93(m,1H),4.87-4.8 0(m,1H),4.69-4.61(m,1H),4.60(d,J=4.5Hz,1H),4.45-4.36(m,1H),3.87(dd,J=9.1,4. 4Hz,1H),3.85-3.76(m,1H),3.71-3.60(m,1H),3.54-3.44(m,1H),3.31(s,3H),3.23(d,J =9.2Hz,1H),3.21-3.15(m,1H),3.12(s,3H),2.91-2.79(m,2H),2.46-2.35(m,1H),2.29- 2.18(m,1H),2.17-2.10(m,1H),2.09-2.01(m,1H),1.98-1.89(m,2H),1.86(s,3H),1.79- 1.62(m,6H),1.55-1.46(m,6H),1.44-1.27(m,14H),1.25-1.09(m,6H),1.06-0.95(m,8H) ,0.89-0.83(m,4H),0.80(d,J=6.8Hz,3H),0.72(d,J=6.7Hz,4H),0.59(q,J=11.8Hz,1H).

[0631] Example 20. Synthesis of compounds 36 and 37

[0632]

[0633] diastereomer 1 A solution of compound 34 (29.7 mg, 0.030 mmol) in HCl (4 M solution in dioxane, 445 μL, 1.78 mmol) was stirred at room temperature for 13 min. The reaction mixture was directly freeze-dried to give the crude product. The diastereomer crude product was purified by preparative HPLC (Method 2) to give compound 36 (10.5 mg, 38.1% yield) as a white solid.

[0634] Compound 36: ESIMS[M+H] + 902.0, [M+FA-H] - 946.0

[0635] 1H NMR(400MHz,DMSO-d6)δ:6.81-6.74(m,1H),6.54(s,1H),6.48-6.39(m,1H),6.17-6.08(m,2H),5.96( d,J=10.7Hz,1H),5.49(dd,J=14.1,8.9Hz,1H),5.05(d,J=4.6Hz,1H),5.03-4.98(m,2H),4.71-4.63(m ,1H),4.60(d,J=4.4Hz,1H),4.02-3.93(m,2H),3.66(d,J=6.0Hz,1H),3.63-3.53(m,1H),3.40-3.35(m ,1H),3.31(s,3H),3.25-3.19(m,1H),3.16-3.12(m,4H),2.86-2.80(m,1H),2.66-2.56(m,1H),2.27-2 .15(m,2H),2.12-2.07(m,1H),2.06-1.98(m,1H),1.95-1.88(m,1H),1.84-1.78(m,4H),1.74-1.69(m ,2H),1.64-1.60(m,2H),1.59-1.56(m,2H),1.55-1.51(m,5H),1.48-1.45(m,2H),1.41-1.37(m,1H),1 .37-1.27(m,4H),1.25-1.22(m,1H),1.21-1.14(m,4H),1.07-1.02(m,1H),1.00-0.96(m,4H),0.89-0. 85(m,5H),0.83(d,J=6.4Hz,3H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.8Hz,3H),0.56(q,J=11.8Hz,1H).

[0636] diastereomer 2 A solution of compound 35 (15.7 mg, 0.0157 mmol) in HCl (392 μL, 1.57 mmol) was stirred at room temperature for 13 min. The reaction mixture was directly freeze-dried to give the crude product. The diastereomer crude product was purified by preparative HPLC (Method 2) to give compound 37 (4.0 mg, 27.5% yield) as a white solid.

[0637] Compound 37: ESIMS[M+H] + 901.6, [M+FA-H] - 945.6

[0638] 1H NMR(400MHz,DMSO-d6)δ:7.05-6.89(m,1H),6.48(s,1H),6.46-6.39(m,1H),6.18-6 .10(m,2H),5.89(dd,J=11.1,1.6Hz,1H),5.45(dd,J=14.0,9.4Hz,1H),5.04(d,J=4 .7Hz,1H),4.97-4.90(m,1H),4.90-4.83(m,1H),4.66-4.58(m,2H),4.00-3.93(m,1 H),3.91(dd,J=8.9,3.8Hz,1H),3.63-3.54(m,1H),3.48-3.39(m,1H),3.36-3.26(m, 5H),3.20-3.16(m,1H),3.12(s,3H),2.88-2.80(m,2H),2.26-2.19(m,1H),2.17-2. 10(m,1H),2.07-2.00(m,1H),1.97-1.85(m,3H),1.80-1.72(m,5H),1.70-1.61(m,4 H),1.54-1.47(m,6H),1.43-1.27(m,5H),1.23-1.11(m,6H),1.03-0.94(m,8H),0.8 8-0.83(m,4H),0.79(d,J=6.7Hz,4H),0.72(d,J=6.8Hz,3H),0.60(q,J=11.9Hz,1H).

[0639] Example 21. Synthesis of compounds 38 and 39

[0640]

[0641] diastereomer 1 4-Methylbenzenesulfonic acid hydrate (3.0 mg, 0.016 mmol) was added to a solution of intermediate 5 (15.4 mg, 0.0160 mmol) in DCM (1 mL). The reaction mixture was stirred at room temperature for 1 hour. The entire reaction mixture was directly purified by preparative HPLC (Method 2) to give compound 38 (11.3 mg, 70.6% yield) as a white solid.

[0642] Compound 38: ESIMS[M+H] + 994.0, [MH] - 992.1

[0643] 1H NMR (400MHz, DMSO-d6) δ: 8.88-8.30 (m, 2H), 6.71 (s, 1H), 6.49 (dd, J = 14.6, 11.0Hz, 1H), 6. 35-6.24(m,2H),6.20(dd,J=14.8,10.7Hz,1H),5.57(dd,J=14.8,9.6Hz,1H),5.04(d,J=4. 8Hz,1H),4.96-4.91(m,1H),4.81(d,J=9.8Hz,1H),4.66-4.61(m,1H),4.60(d,J=4.7Hz,1H ),4.08-3.98(m,1H),3.91-3.85(m,1H),3.85-3.75(m,1H),3.68-3.57(m,1H),3.50-3.42( m,1H),3.32(s,3H),3.23(d,J=9.2Hz,1H),3.21-3.15(m,1H),3.12(s,3H),3.06-2.91(m,2 H),2.89-2.74(m,4H),2.25-2.08(m,3H),2.08-1.98(m,2H),1.98-1.89(m,2H),1.84(s,3H ),1.78-1.62(m,5H),1.55-1.45(m,6H),1.44-1.28(m,5H),1.24-1.08(m,6H),1.04-0.93( m,8H),0.89-0.82(m,4H),0.80(d,J=6.8Hz,3H),0.75(d,J=6.7Hz,3H),0.69-0.54(m,2H).

[0644] diastereomer 2 4-Methylbenzenesulfonic acid hydrate (2.67 mg, 0.0141 mmol) was added to a solution of intermediate 6 (13.7 mg, 0.0141 mmol) in DCM (1 mL). The reaction mixture was stirred at room temperature for 1 hour. The entire reaction mixture was directly purified by preparative HPLC (Method 2) to give compound 39 (9.1 mg, 63.9% yield) as a white solid.

[0645] Compound 39: ESIMS[M+H] + 993.9, [MH] - 991.9

[0646] 1H NMR(400MHz,DMSO-d6)δ:8.85-8.07(m,2H),6.53-6.45(m,1H),6.36(d,J=10.9Hz,1H),6.30-6 .20(m,2H),6.17(s,1H),5.74(dd,J=14.3,8.1Hz,1H),5.12-5.08(m,1H),5.08-5.05(m,1H),4 .93(d,J=9.5Hz,1H),4.76-4.67(m,1H),4.59(d,J=4.4Hz,1H),4.10-3.98(m,2H),3.94(dd,J= 7.7,5.0Hz,1H),3.71-3.61(m,1H),3.50(d,J=7.7Hz,1H),3.31(s,3H),3.25-3.18(m,1H),3.17 -3.09(m,5H),3.08-3.02(m,1H),2.89-2.78(m,4H),2.35-2.26(m,1H),2.24-2.18(m,1H),2.1 8-2.10(m,2H),2.10-1.99(m,1H),1.95-1.88(m,1H),1.81(s,3H),1.77-1.68(m,4H),1.65-1.5 9(m,2H),1.59-1.46(m,8H),1.46-1.38(m,1H),1.37-1.22(m,6H),1.21-1.12(m,3H),1.04-0. 97(m,4H),0.94-0.88(m,4H),0.87-0.78(m,7H),0.74(d,J=6.7Hz,3H),0.56(q,J=11.9Hz,1H).

[0647] Example 22. Synthesis of Compounds 40 and 41

[0648]

[0649] diastereomer 1 Add 4-methylbenzenesulfonic acid hydrate (5.0 mg, 0.026 mmol) to a solution of intermediate 9 (20 mg, 0.018 mmol) in DCM (1 mL). Stir the reaction mixture at room temperature for 1 hour. Purify the entire reaction mixture directly by preparative HPLC (Method 2) to give compound 40 (9.6 mg, 50.9% yield) as a white solid.

[0650] Compound 40: ESIMS[M+H] + 1038.1, [MH] - 1036.1

[0651] 1 H NMR(400MHz,DMSO-d6)δ:8.85-8.39(m,2H),6.71(s,1H),6.53-6.43(m,1H),6.37-6.24(m,2 H),6.23-6.14(m,1H),5.57(dd,J=15.0,9.6Hz,1H),5.03(d,J=4.9Hz,1H),4.97-4.90(m,1H ),4.81(d,J=9.8Hz,1H),4.67-4.54(m,1H),4.45(t,J=5.4Hz,1H),4.10-3.97(m,1H),3.92- 3.78(m,2H),3.68-3.57(m,1H),3.54-3.42(m,5H),3.32(s,3H),3.23(d,J=9.1Hz,1H),3.12( s,3H),3.10-3.01(m,2H),3.01-2.93(m,2H),2.90-2.83(m,1H),2.83-2.71(m,2H),2.25-2. 07(m,3H),2.06-2.01(m,1H),1.99-1.90(m,3H),1.83(s,3H),1.74-1.62(m,4H),1.58-1.50 (m,3H),1.47(s,3H),1.45-1.26(m,6H),1.26-1.06(m,6H),1.07-0.95(m,8H),0.94-0.90(m ,1H),0.84(d,J=6.5Hz,3H),0.80(d,J=6.7Hz,3H),0.75(d,J=6.7Hz,3H),0.70-0.56(m,2H).

[0652] diastereomer 2 Add 4-methylbenzenesulfonic acid hydrate (2.3 mg, 0.012 mmol) to a solution of intermediate 10 (9 mg, 0.008 mmol) in DCM (0.5 mL). Stir the reaction mixture at room temperature for 1 hour. Purify the entire reaction mixture directly by preparative HPLC (Method 2) to give compound 41 (3.0 mg, 35.3% yield) as a white solid.

[0653] Compound 41: ESIMS[M+H] + 1037.9, [MH] - 1036.1

[0654] 1H NMR(400MHz,DMSO-d6)δ:8.90-8.13(m,2H),6.52-6.44(m,1H),6.34(d,J=11.0Hz,1H),6 .28-6.20(m,2H),6.19(s,1H),5.74(dd,J=14.2,7.9Hz,1H),5.11-5.06(m,2H),4.96-4. 90(m,1H),4.76-4.68(m,1H),4.44(t,J=5.4Hz,1H),4.11-3.97(m,2H),3.94(dd,J=7.6, 4.9Hz,1H),3.70-3.62(m,1H),3.52-3.45(m,5H),3.32(s,3H),3.28-3.19(m,1H),3.14( s,3H),3.08-2.92(m,4H),2.89-2.78(m,3H),2.35-2.26(m,1H),2.24-2.17(m,1H),2.16 -2.08(m,2H),1.96-1.89(m,2H),1.80(s,3H),1.75-1.59(m,6H),1.56-1.50(m,7H),1.4 6-1.40(m,1H),1.38-1.23(m,7H),1.21-1.14(m,2H),1.09-1.05(m,1H),1.03-0.98(m,4 H), 0.93-0.89 (m, 4H), 0.86-0.81 (m, 7H), 0.74 (d, J = 6.7Hz, 3H), 0.62 (q, J = 11.7Hz, 1H).

[0655] Example 23: Synthesis of Compound 42

[0656]

[0657] *Absolute stereochemistry of C16 is undetermined

[0658] In a reaction vial, intermediate 1 (0.185 g, 0.206 mmol) and N-methylmethanesulfonamide (0.188 mL, 2.06 mmol) were combined in anhydrous dichloromethane (1.0 mL). The vial was capped, and the mixture was purged twice under nitrogen vacuum. Trifluoroacetic acid (0.047 mL, 0.62 mmol) was added dropwise over a 20-second interval. The reaction was stirred at room temperature for 30 minutes.

[0659] The reaction was quenched with a saturated aqueous solution of NaHCO3. The quenched mixture was extracted three times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated.

[0660] The crude product was purified by silica gel rapid column chromatography (0-50% acetone-heptane) to give compound 42 as a pale yellow solid (0.063 g, 0.061 mmol, 29.8% yield).

[0661] Compound 42: ESIMS[M+NH4] + 995.8, [MH] - 976.0

[0662] HRMS calculated value for C52H84N2O13SNa (sodium adduct) was 999.5592. Measured value was 999.5591.

[0663] 1 H NMR (600MHz, chloroform-d) δ6.43(dd,J=14.7,10.9Hz,1H),6.23(dd,J=14.7,10.6Hz,1H),6.12(d d,J=14.9,10.7Hz,1H),5.97(d,J=10.9Hz,1H),5.35(dd,J=14.9,9.8Hz,1H),5.19(d,J=5. 9Hz,1H),5.14(d,J=9.9Hz,1H),4.83(d,J=12.2Hz,1H),4.70-4.65(m,1H),4.18(d,J=5.7 Hz,1H),3.91(t,J=11.2Hz,1H),3.85(t,J=8.1Hz,1H),3.63(d,J=13.9Hz,1H),3.47-3.32( m,8H),3.30(s,3H),3.00(s,3H),2.95-2.89(m,2H),2.69-2.62(m,1H),2.55(s,3H),2.25 (m,4H),2.18-2.04(m,4H),1.99(dd,J=12.9,4.3Hz,2H),1.88-1.83(m,4H),1.80-1.68(m, 3H),1.68-1.60(m,4H),1.60-1.48(m,2H),1.44-1.40(m,2H),1.40-1.17(m,4H),1.09-1.0 3(m,4H),1.02-0.96(m,4H),0.96-0.88(m,4H),0.87-0.84(m,6H),0.65(q,J=12.0Hz,1H).

[0664] Determination of absolute configuration

[0665] The absolute configuration of the compound at position C16 was specified using the chemical shifts of hydrogen atoms H25 and H27, and the relative shift Δf2 of hydrogen atom H6 from the corresponding HSQC NMR spectra. Spectra were recorded on a Bruker Spectrospin (400 MHz). DMSO-d6 was typically used as the solvent. The relative chemical shifts of H25 and H27 are characteristic of the stereoisomers (R)-C16 and (S)-C16.

[0666] Table 2

[0667] Chemical shift at H16 in the (R)-C16 epimer: 2.5-2.9ppm Chemical shift at H16 in the (S)-C16 epimer: 2.8-2.9ppm Chemical shift of the (R)-C16 epimer at H27: 3.5-3.8ppm Chemical shift of the (S)-C16 epimer at H27: 3.2-3.4ppm

[0668] The relative chemical shifts (Δf2) of the two C6 hydrogens represent the absolute configuration of the C16 epimer.

[0669] Table 3

[0670] The relative chemical shift Δf2 of H6 in the (R)-C16 epimer: 150.6-202.3Hz The relative chemical shift Δf2 of H6 in the (S)-C16 epimer: 54.5-80.9Hz

[0671] The X-ray structures of compound 2 (absolute configuration (S)-C16) and compound 29 (absolute configuration (R)-C16) are used as references for stereochemical partitioning.

[0672]

[0673] Table 4

[0674]

[0675]

[0676]

[0677] Example 24: Biological assays and data

[0678] The activity of the compounds according to this disclosure was evaluated using the following in vitro and in vivo methods.

[0679] Pharmacological characterization

[0680] Materials and Methods

[0681] Cell-based assays for determining the potency of rapamycin analogs. The potency of rapamycin analogs was determined using a MEF TSC1- / - cell-based assay. MEF TSC1- / - cells are mouse embryonic fibroblasts deficient in tuberous sclerosing protein-TSC1, which negatively regulates mTORC1 signaling and thus exhibits constitutive mTORC1 activation, leading to phosphorylation (activation) of downstream molecules. This cell-based assay was used to measure the inhibitory effect (dephosphorylation) of rapamycin analogs or other mTOR inhibitors on S6 and 4EBP1.

[0682] MEF TSC1- / - cells were plated on poly-D-lysine-coated 384-well Griener clear plates and incubated overnight at 37°C and 5% CO2. The next day, cells were washed eight times with "Hard Starve" solution (1 L DPBS + 1 g D-(+) glucose + 10 ml 7.5% sodium bicarbonate + 20 ml 1 M HEPES) and incubated for another 2 hours in the same solution. Cells were then treated with a reduced concentration of the compound (8 spots at a 3.16-fold dilution) and incubated for 2 hours at 37°C and 5% CO2. Cells were fixed with 4% paraformaldehyde for 30 min, washed five times with TBS-EDTA, and then immunostained with antibodies labeled with fluorescent markers targeting pS6 (Ser240 / 244) (Cell Signaling #9468) and p4EBP1 (Thr 37 / 46) (Cell Signaling #5123). Cell nuclei were visualized by Hoechst (Thermo Fisher Scientific #H3570) staining. Cells were imaged using their respective fluorescence channels (InCell 600) and analyzed via pS6 IC50. 50 (nM) defines the potency of mTOR inhibitors.

[0683] Animal maintenance, compound handling, and tissue collection. All procedures involving animals were approved by the Institutional Animal Care and Use Committee of the Novartis Institutes for Biomedical Research, Cambridge, MA, USA. Adult male Sprague Dawley (SD) rats were purchased from Envigo, Inc. (Indianapolis, USA). Upon introduction, the rats were maintained in a specific pathogen-free facility with controlled temperature and light (22°C, 12-h light / 12-h dark cycle: lights on at 0600h / lights off at 1800h) and free access to food and water. Rats were acclimatized for at least 3 days prior to the start of the experiment.

[0684] Compound 2 and RAD001 were formulated for oral (oral, per os, po) administration. A blank formulation (without compound 2 or RAD001) was used as a mediator control. Rats were orally administered a single dose of compound 2, RAD001, or the corresponding mediator. At a predetermined time after treatment, rats were anesthetized with 3.5% isoflurane and euthanized. Various organs were collected and frozen in liquid nitrogen. Blood was collected via tail vein or distal cardiac puncture and frozen for further pharmacokinetic analysis. All tissues were stored at -80°C until analysis.

[0685] The concentrations of compounds 2 and RAD001 in the blood were determined using HPLC / mass spectrometry.

[0686] Protein extraction and immunoblotting. For protein extraction, frozen tissue was lysed in MSD lysis buffer (MSD, Rockville, MD) supplemented with complete EDTA free protease inhibitor and PhosSTOP phosphatase inhibitor tablets (Roche, Manheim, Germany) and centrifuged at 13,000 g for 20 min at 4 °C. The resulting supernatant was used for immunoblotting. Protein quantification was performed using the BCA protein assay (Thermo Scientific, MA). Samples were incubated with 4%–20% Criterion... TM TGX TM Proteins were isolated on pre-prepared Midi protein gels (Bio-Rad, CA) and transferred to nitrocellulose membranes (Bio-Rad, CA) using the Trans Turbo blotting system (Bio-Rad, CA). Immunoblotting was performed using antibodies against p-S6 and t-S6 (1:1000 each in 5% BSA TBS-T solution) from Cell Signaling Technologies, Inc. The prefixes “p” and “t” indicate “phosphorylated” and “total” forms, respectively. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), detected with anti-GAPDH antibody (#5174, Cell Signaling Technologies, MA), served as a protein loading control. HRP-conjugated secondary antibody against rabbits (#7074) was from Cell Signaling Technologies, MA. Chemiluminescent signaling was performed using SuperSignal. TM West Femto enhanced chemiluminescent substrate (#34095, Thermo Technologies, Massachusetts) or Western The images were generated using Plus-ECL enhanced chemiluminescent substrate (NEL103001EA, PerkinElmer, MA) and captured using a ChemiDoc MP imaging system (Bio-Rayet). The resulting digital images were converted to TIFF format and quantized using ImageJ software.

[0687] Generation of FKBP knockout cells. (Used) 4D-Nucleofector TM The X reagent kit (Lonza, V4XC-2032) uses a CRISPR / Cas9 system to package samples containing targets FKBP12 (GCCACTACTCACCGTCTCCT (SEQ ID NO:1), position 1392950), FKBP12.6 (TGCCCCAAGCTCATCTAGCA (SEQ ID NO:2), position 24063057), FKBP13 (GCAGATCGGGGTCAAGAAGC (SEQ ID NO:3), position 64242479), FKBP25 (GGTTATAGGCTGTAACCAAG (SEQ ID NO:4), position 45130715), FKBP52 (AAGACTCGGTCCCCAATCAT (SEQ ID NO:5), position 2797173), and FKBP51 (TCATCAAGGCATGGGACATT (SEQ ID NO:4), position 24063057), FKBP52 (AAGACTCGGTCCCCAATCAT (SEQ ID NO:5), position 2797173), and FKBP51 (TCATCAAGGCATGGGACATT (SEQ ID NO:4), position 24063057), FKBP52 (G ...4), FKBP52 (GGCTACATCAAGGCATGGGACATT (SEQ ID NO:4), FKBP52 (GGCTACATCAAGGCATGGGACATT (SEQ ID NO:4), FKBP52 (GGCTACATCAAGGCATGGGACATT (SEQ ID NO:4), FKBP52 (GGCTACATCAAGGCATGGGACATT (SEQ ID NO:4), F A ribonucleoprotein complex containing the guide RNA (gRNA) sequence NO:6, position 35620248, was delivered to 293T cells. Cell clones were screened by immunoblotting using anti-FKBP specific antibodies: FKBP12 (Novus, NB300-508), FKBP12.6 (Abnova, H00002281-M01), FKBP13 (R&D Systems, MAB4356), FKBP25 (R&D Systems, MAB3955), FKBP52 (Cell Signaling Technologies, #11826), and FKBP51 (Cell Signaling Technologies, #12210). Single-cell clones deficient in each FKBP were selected. By sequentially knocking out five FKBP genes, five-fold FKBP12 / 12.6 / 13 / 52 / 51 knockout cells and FKBP12 / 12.6 / 25 / 52 / 51 knockout cells were generated.

[0688] Wild-type (WT) and FKBP knockout 293T cells were treated with RAD001 and compound 2. WT, FKBP12 knockout, FKBP12 / 12.6 / 13 / 52 / 51 knockout, or FKBP12 / 12.6 / 25 / 52 / 51 knockout 293T cells were seeded at a density of 30,000 cells per well in DuPont modified Eagle's medium (Thermo Fisher Scientific, #11995-065) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, #16140-071) in poly-D-lysine-coated 96-well plates (Corning, #354461). Cells were incubated at 37°C and 5% CO2 for 48 hours until they reached approximately 80% confluence. Three copies were prepared and cells were treated with RAD001 or compound 2 at 12 or 10 points in a dose range of 1000 nM to 0.0033 nM at 37°C for 2 hours. Medium supplemented with blank dimethyl sulfoxide (DMSO) was used as a control for both compounds. The amount of phosphorylated S6K1 (Thr389) was detected using a sandwich ELISA kit (Cell Signaling, Inc., #7063C) according to the manufacturer's protocol.

[0689] SPR assay for determining the binding affinity to FK506-binding protein (FKBP).

[0690] Using standard procedures, the N-terminal avi-his6-tagged FKBP fusion protein (“his6” disclosed as SEQ ID NO:7) was expressed in *E. coli* and purified by nickel chromatography. Biotinylated his-avi-FKBP was immobilized on a streptavidin chip using a Biacore 8K (GE Healthcare). To determine the kinetic affinity of rapamycin analogs for FKBP, the rapamycin analogs were diluted to a working concentration of 50-fold with DMSO. Next, 3.1 μL of each rapamycin analog solution was added to 150 μL of buffer (50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT) in a 384-well plate (Greiner Bio-One / 78127) and mixed using Biomek FX. Then, a gradient of rapamycin analogue solutions (6 concentrations / 2-fold dilutions, 3.1–100 nM, 31–1000 nM, or 310–10000 nM) was injected at 45 μL / min for 120 seconds: the contact and dissociation times in the run buffer (50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT / 2% DMSO) were 1800 seconds. The single-cycle kinetic data were fitted to a 1:1 binding model to measure the association rate ka (1 / Ms), dissociation rate kd (1 / s), and affinity K. D (M). To determine the epikinetic-affinity of the ternary complex formed with FKBP containing mTOR and a rapamycin analog, the rapamycin analog was diluted in DMSO to a final concentration of 500 μM. 6-mTOR (amino acid 2019-2112) was diluted in buffer (50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT) to prepare a concentration gradient (6 concentrations / 2-fold dilutions, 15.6–500 nM). 3.1 μL of a 500 μM rapamycin analog solution was added to 150 μL of mTOR sample in a 384-well deep plate (Greiner Bio-One / 78127) and mixed using Biomek FX. The mTOR gradient solution was then injected at 45 μL / min for 120 seconds: the contact and dissociation times in the running buffer (50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT / 2% DMSO) were 1800 seconds. Single-cycle kinetic data were fitted to a 1:1 binding model to measure the association rate ka (1 / Ms), dissociation rate kd (1 / s), and apparent affinity K of the ternary complex. D (M). See Tables 6 and 7 below.

[0691] Different pharmacology of rapamycin analogues can be achieved in different cell or tissue types, depending on 1) the relative abundance of FKBP homologs in these cells / tissues, and 2) the specificity of binding to these different FKBP homologs (Mol. Cell Biol. [Molecular and Cell Biology] (2013) 33: 1357-1367).

[0692] result

[0693] The in vitro potency of mTOR inhibitors was determined by pS6 IC50 in MEF TSC1- / - cells. 50 (nM) definition.

[0694] Table 5

[0695]

[0696]

[0697]

[0698] The IC50 value is calculated as the average of multiple measurements.

[0699] The equilibrium dissociation constants (K) of FKBP12, FKBP51 and FKBP52 D As shown in Table 6 below.

[0700] Table 6

[0701]

[0702]

[0703] The apparent affinity K for the formation of ternary complexes D (M) is shown in Table 7 below.

[0704] Table 7

[0705]

[0706] Pharmacokinetic curves of compound 2 in rats. To compare the bioavailability of compound 2 and RAD001 in rats, the compounds were formulated into solutions: compound 2 was prepared in MilliQ water in 15% PEG300, 7.5% Solutol, and 7.5% Cremophore EL, and RAD001 was prepared in PBS in 10% PEG300, 10% Solutol HS15, and 10% Cremophore EL. Rats aged 7-9 weeks (N=3 per group) were orally administered 3 mg / kg of the compound and intravenously (iv) administered 1 mg / kg of the compound. Figure 3A and 3B For compounds 2 and RAD001, the bioavailability was 16% and 19%, respectively; the terminal half-life via in vitro was 19 h and 9.5 h, respectively; and the clearance rates were 13 mL / min / kg and 32 mL / min / kg, respectively.

[0707] Compound 2 inhibits the mTORC1 pathway in rat liver. The ability of compound 2 to inhibit the mTORC1 pathway in vivo was determined in 4-6 month old rats. Figure 4A and 4B Single doses of compound 2 at 1, 3, and 10 mg / kg (formulated as custom microemulsion preconcentrates, see, for example, Shawlakadze et al. J Gerontol A Biol Sci Med Sci. [Journal of Geriatrics, Series A: Biological Sciences and Medicine] 73(7):845-852, 2018) resulted in significant dephosphorylation (inactivation) of S6 in rat liver (compared to the mediator control). Figure 4A and 4B ).

[0708] Compared to RAD001, compound 2 showed less dependence on FKBP12 for its inhibitory effect. Initially, the phosphorylation level of S6K1 (Thr389) was measured in WT and FKBP12 knockout 293T cells treated with either compound 2 or RAD001. Figure 5A and 5BS6K1 is a downstream target of mTORC1, and phosphorylation at its rapamycin analogue-sensitive Thr389 site has been used as a functional readout for mTORC1 activity (Lee, CH, Inoki, K. and Guan, KL (2007). mTOR pathway as a target in tissue hypertrophy. [mTOR pathway as a target in tissue hypertrophy] Annu. Rev. Pharmacol. Toxicol. [Annual Review of Pharmacology and Toxicology] 47, 443-467). In WT 293T cells, both RAD001 and compound 2 inhibited S6K1 (Thr389) phosphorylation by approximately 80% ( Figure 5A Without FKBP12, compound 2 still achieved approximately 70% S6K1(Thr389) dephosphorylation, while RAD001 only achieved approximately 40% S6K1(Thr389) dephosphorylation. Figure 5B These results suggest that, in the absence of FKBP12, one or more other FKBP homologs may be associated with the efficacy of compound 2.

[0709] Next, the inhibitory efficacy (potency) of compound 2 and RAD001 in 293T cells lacking the five FKBPs: FKBP12 / 12.6 / 13 / 52 / 51 was evaluated by measuring the phosphorylation level of S6K1(Thr389). Figure 5C In these cells, RAD001 lost almost all its potency, while compound 2 effectively inhibited S6K1(Thr389). Figure 5C At the highest tested concentration, compound 2 inhibited S6K1 (Thr389) by approximately 90%. Figure 5C This result suggests that, in the absence of FKBP12 / 12.6 / 13 / 52 / 51, the pharmacological effects of compound 2 may be mediated by another FKBP homolog.

[0710] To identify FKBP homologs associated with the inhibitory effect of compound 2 in the absence of FKBP12 / 12.6 / 13 / 51 / 52, the potency of compound 2 and RAD001 was evaluated in 293T cells lacking FKBP12 / 12.6 / 25 / 52 / 51 by measuring S6K1(Thr389) phosphorylation. Figure 5D In these cells, neither RAD001 nor compound 2 effectively inhibited S6K1 (Thr389). Figure 5D This result indicates that, in the absence of other FKBP (FKBP12 / 12.6 / 13 / 51 / 52) homologs, FKBP25 is sufficient to mediate the inhibitory effect of compound 2.

[0711] Without being bound by theory, other FKBPs may enhance the inhibitory effect of compound 2 in the absence of FKBP12. Therefore, compared to RAD001, compound 2 can target a wider range of cell types, including those with low levels of FKBP12 expression and sufficient levels of other FKBPs.

[0712] Having described several aspects of various embodiments, it should be understood that various changes, modifications, and improvements will readily occur to those skilled in the art. These changes, modifications, and improvements are intended to be part of this disclosure and are intended to fall within the spirit and scope of this disclosure. Therefore, the foregoing description and drawings are merely illustrative.

Claims

1. A compound having formula (I) or a pharmaceutically acceptable salt thereof, wherein: R 1 Choose freely - OR a The group consisting of 5- to 6-membered heteroaryl groups; R 2 It is H; R 3 It is -C 0-6 Alkylene-SO2R 4 ; R 4 It is C 1-6 alkyl; R a Choose from the following groups: H, -P(O)(R b )2、-C(O)R c -C(O)OR c C 1-6 Alkyl and C 1-6 Hydroxyalkyl; Each R b Independently choose H and C 1-6 The group consisting of alkyl groups; and Each R c Independently select H and C 1-6 Alkyl and C 1-6 The group consisting of hydroxyalkyl groups.

2. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R 1 Yes - OR a .

3. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R 1 It is a 5- to 6-membered heteroaryl group.

4. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R 1 Select free hydroxyl groups, The group consisting of 5-membered heteroaryl groups.

5. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein: R 1 Choose from the following groups: hydroxyl, 6. The compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, wherein the compound has the structural formula (I)-A or (I)-B:

7. The compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, wherein the compound has the structural formula (I)-C or (I)-D:

8. The compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, wherein the compound has the structural formula (I)-E or (I)-F:

9. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is selected from:

10. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is 11. A pharmaceutical composition comprising a therapeutically effective amount of the compound according to any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.

12. A pharmaceutical combination comprising a therapeutically effective amount of a compound according to any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, and one or more therapeutically active agents.

13. Use of the compound of any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 11, or the pharmaceutical composition of claim 12, for the preparation of a medicament for treating a disorder or disease mediated by the mTOR pathway.

14. Use of the compound of any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 11, or the pharmaceutical combination of claim 12, in the preparation of a medicament for treating a disease or disorder, wherein the target tissue, organ, or cell associated with the pathology of said disease or disorder has an insufficient level of FKBP12 to inhibit mTORC1.

15. The use according to claim 14, wherein the compound having formula (I) or a pharmaceutically acceptable salt thereof has a higher affinity for binding to FKBP12, FKBP25, FKBP51 and / or FKBP52 compared to rapamycin or RAD001.

16. The use according to claim 14, wherein the compound having formula (I) or a pharmaceutically acceptable salt thereof has a high affinity for FKBP12, FKBP25, FKBP51 and / or FKBP52 sufficient to inhibit mTORC1 binding.

17. The use according to any one of claims 14 to 16, wherein the therapeutic efficacy is determined empirically compared to rapamycin or RAD001.

18. Use of the compound of any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 11, or the pharmaceutical composition of claim 12, in the preparation of a medicament for treating a disease or disorder in a subject, wherein the subject has or is determined to have an FKBP12 level insufficient to inhibit mTORC1.

19. The use according to claim 18, wherein the compound having formula (I) or a pharmaceutically acceptable salt thereof has a higher affinity for binding to FKBP12, FKBP25, FKBP51 and / or FKBP52 compared to rapamycin or RAD001.

20. The use according to claim 18 or 19, wherein the subject has or is determined to have an FKBP12 level in the target tissue, organ or cell that is insufficient to inhibit mTORC1.

21. The use according to any one of claims 18 to 20, wherein the therapeutic efficacy is determined empirically compared to rapamycin or RAD001.

22. The use according to claim 13, wherein the disease or disorder is selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, cerebrovascular disease, chronic kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, infections caused by decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes.

23. The use according to claim 13, wherein the disease or disorder is selected from emphysema, stroke, diabetes-related kidney disease, cardiac hypertrophy, systolic and / or diastolic dysfunction, hypertension, cardiac dysfunction leading to decreased ejection fraction, carcinogenic immunosenescence due to reduced immune surveillance, complications of diabetes, and liver fibrosis.

24. The use according to claim 13, wherein the disease or disorder is selected from renal failure, blindness, and neuropathy.

Citation Information

Patent Citations

  • Plasmids, bacteria and gene products of plasmid DNA, processes for preparing them

    EP0003062A2

  • Spirobenzofuranone compounds, processes for their preparation and their use as medicines

    EP0003084A1

  • Indicator apparatus for determining a distance of a supersonic projectile in relation to a target

    EP0003095A1

  • Process for the preparation of substituted furans

    EP0003106A2

  • Boiler stay-bolt.

    US1137433A