Methods and means for modifying the alkaloid content of plants

Abstract

The present invention provides a method for regulating (e.g. reducing) the alkaloid content of a plant (e.g. a tobacco plant), the method comprising modifying the plant by regulating (e.g. reducing) the expression of at least one armadillo repeat protein. The present invention also provides the use of an armadillo repeat protein for regulating the alkaloid content of a plant, and tobacco cells, plants, plant propagation materials, harvested leaves, processed tobacco or tobacco products obtainable according to the present invention.

Description

Technical Field

[0001] The present invention relates to methods for regulating the alkaloid content, such as nicotine content, of a plant or part thereof. The present invention also extends to methods for regulating the expression of a polypeptide encoded by a gene, the polypeptide regulating the alkaloid content in a plant. In another aspect, the present invention provides methods for regulating the expression of a gene encoding a polypeptide that regulates the alkaloid content in a plant. The present invention also extends to constructs that can be used to regulate the polypeptide, plant cells transformed with such constructs, and the transgenic plants themselves. The present invention also relates to the use of leaves harvested from such transgenic plants, the transgenic plants having been transformed with a genetic construct for regulating alkaloid content, and smoking articles (e.g., combustible smoking articles) comprising such leaves. Background Art

[0002] Alkaloids are a group of naturally occurring compounds that contain primarily basic nitrogen atoms and are produced by a wide variety of organisms including bacteria, fungi, plants and animals.

[0003] Alkaloids can be classified based on the similarity of the carbon skeleton such as indole, isoquinoline and pyridine. Pyridine derivatives are a class of monomeric alkaloids; this class includes simple pyridine derivatives, polycyclic condensed and non-condensed pyridine derivatives, and sesquiterpene pyridine derivatives. Examples are nicotine, nornicotine, anabasine, mithofamine and anatabine.

[0004] Most of the known biological functions of alkaloids are related to protection. Neuroactive molecules such as caffeine, cocaine, morphine and nicotine act as defense compounds against invading predators. The accumulation of these alkaloids is the result of a signal transduction cascade that monitors gene expression, enzyme activity and alkaloid concentration. The fine regulation of alkaloid content in plants involves negative feedback loops and degradation pathways.

[0005] Nicotine occurs naturally in several plant species, but is found at the highest levels in tobacco plants. Cultivated tobacco produces 2-4% of the alkaloid by dry weight. Nicotine is present in both wild and cultivated tobacco ( Nicotiana ) species and plays an important role in plant defense against herbivores and insects (Voelckel et al. 2001, incorporated herein by reference), accounting for ~90% of the total alkaloid content. The remaining 10% of the alkaloid pool is mainly composed of the structurally related compounds nornicotine, anatabine, anabasine, and pseudooxynicotine (PON).

[0006] The regulation of alkaloid content in tobacco is complex. Several factors including genotype, environment, fertilization, and agronomic practices (e.g., topping) influence alkaloid levels in tobacco plants. Some key regulators of nicotine biosynthesis are well characterized, such as putrescine N-methyltransferase (PMT), which plays a key role in this pathway, is activated by members of the ethylene response factor (ERF) superfamily, the largest family of transcription factors in the tobacco genome (Rushton et al., 2008, incorporated herein by reference). Other transcription factors that induce alkaloid biosynthesis belong to the MYC2-like basic helix-loop-helix (bHLH) family. MYC2-like bHLHs regulate alkaloid levels directly through Gbox-mediated binding and activation of alkaloid structural genes, and indirectly through the activation of ERFs.

[0007] Modifying the alkaloid content in plants (e.g., tobacco) can have several commercial advantages. For example, reducing the total alkaloid content in a plant can increase the value of the plant as a biomass resource. For example, modifying the alkaloid content can include reducing the alkaloid content in a tobacco plant, such as the nicotine content. In view of the "nicotine ceiling", i.e., the potential regulation of the average nicotine upper limit in tobacco products, tobacco plants and products with reduced nicotine may be desirable. On the other hand, increasing the alkaloid content in a plant such as a tobacco plant can help protect the plant from insects and herbivores. There is still a need for a plant and a method for preparing the same, wherein the plant has an alkaloid content regulated, such as a nicotine content regulated, when having improved commercially desirable traits.

[0008] During the post-harvest leaf curing process, reactions between pyridine alkaloids and nitrosating species lead to the formation of tobacco-specific nitrosamines (TSNAs). Nornicotine and PON are precursors of the TSNAs NNN and NNK, respectively. Reducing the production and accumulation of nornicotine and PON is of great significance. The CYP82E family of nicotine demethylase genes is the main regulator of the conversion of nicotine to nornicotine, and altering its activity or accumulation leads to reduced NNN levels. However, to date, the enzyme or gene responsible for the production of PON has not been identified.

[0009] As described in the examples, the inventors sought to investigate the genes responsible for alkaloid synthesis with the aim of modulating the alkaloid content in plants, for example reducing the nicotine content in tobacco plants. Summary of the invention

[0010] It has been surprisingly found that the alkaloid content and / or TSNA content or TSNA precursor content of a plant can be regulated by regulating the expression of an armadillo repeat protein or by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein as taught herein. The gene encoding the armadillo repeat protein as taught herein acts as a positive regulator of nicotine biosynthesis. Nitab4.5_0002810g0020.2 is taught herein as a positive regulator of nicotine, nornicotine and PON in cultivated tobacco. Nitab4.5_0002810g0020.2 encodes an armadillo (Arm) repeat protein. These proteins contain tandem copies of a degenerate protein sequence motif of approximately 40 amino acids, which form a conserved three-dimensional structure. The functions of these proteins are generally determined by characteristic sequences outside the Arm domain.

[0011] According to the present invention, tobacco products with regulated alkaloid content and commercially desirable traits sought by consumers of tobacco products can be produced.In some cases, consumers may desire products with low levels of alkaloid content, such as low levels of nicotine content.

[0012] The present invention may be particularly useful in the field of plant molecular agriculture, where plants (e.g., tobacco and other Nicotiana species) are used to produce proteins, peptides and metabolites, e.g., for the production of therapeutics and drugs such as antibiotics, virus-like particles, or neutraceuticals or small molecules. Tobacco has been used to develop HIV-neutralizing antibodies in an EU-funded project called PharmPlant, and Medicago Inc. in Canada has been involved in a tobacco-based platform for the production of virus-like particles for influenza vaccine manufacturing.

[0013] Therefore, the plants according to the present invention can be used in molecular agriculture to reduce or eliminate the presence of nicotine, nornicotine, PON and / or other nicotine alkaloids. The use of low nicotine plants or rootsocks is beneficial in molecular agriculture and will reduce downstream processing costs associated with purification.

[0014] In other cases, it may be desirable to produce plants with high alkaloid levels, such as high levels of nicotine content, so that nicotine can be purified from the tobacco plant to produce pure nicotine products such as for use in devices that utilize liquids containing nicotine (e.g., e-cigarettes) or tobacco heating devices. For example, the production of plants with leaves containing high levels of nicotine can reduce the cost of nicotine extraction for the production of e-liquids for use in electronic cigarettes.

[0015] The inventors have surprisingly identified a method for regulating the alkaloid content, such as the nicotine content, of a plant, such as a tobacco plant, by modulating the expression or nucleic acid sequence of a gene encoding an armadillo repeat protein, which acts as a positive regulator of nicotine in tobacco, or by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein, which acts as a positive regulator of nicotine in tobacco. The alkaloid content, such as the nicotine content, of a plant, such as a tobacco plant, can be reduced by reducing the expression of a gene encoding an armadillo repeat protein, or by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein, such as by disrupting an armadillo repeat domain, or can be increased by increasing the expression of a gene encoding an armadillo repeat protein, or by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein, such as by increasing the binding affinity of an armadillo repeat domain. Prior to the present invention, it was not known that modulation of expression of a gene encoding an armadillo repeat protein or modification of the nucleic acid sequence of at least one gene encoding an armadillo repeat protein as described herein could be used to modulate alkaloid content.

[0016] In one aspect, a method for modulating (e.g., reducing) the alkaloid content of a plant or part thereof or a cell culture is provided, the method comprising modifying the plant or cell culture by modulating the expression of at least one gene encoding an armadillo repeat protein or by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein.

[0017] In another aspect, a method for modulating (e.g., reducing) the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a tobacco plant or plant part thereof is provided, the method comprising modifying the plant or cell culture by modulating the expression of at least one gene encoding an armadillo repeat protein or by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein.

[0018] In a further aspect, there is provided the use of at least one gene encoding an armadillo repeat protein for modulating the alkaloid content of a cell or a plant or a part thereof or a cell culture.

[0019] In yet another aspect, a method for producing a plant or part thereof, a cell culture, a plant propagation material, a leaf, a cut harvested leaf, a processed leaf or a cut and processed leaf having a modulated (e.g., reduced) alkaloid content is provided, the method comprising: modifying the plant or cell culture to modulate the expression of at least one gene encoding an armadillo repeat protein; or modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein.

[0020] In one aspect, the present invention provides a method for modulating (e.g., reducing) the alkaloid content of a plant or part thereof or a cell culture, the method comprising modifying the plant or cell culture by: modulating (e.g., reducing) the expression of at least one Armadillo repeat protein, the at least one Armadillo repeat protein:

[0021] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0022] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0023] In a further aspect, the present invention provides a method for modulating (e.g., reducing) the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a tobacco plant or plant part thereof, the method comprising modifying the plant or cell culture by: modulating (e.g., reducing) the expression of at least one Armadillo repeat protein, the at least one Armadillo repeat protein:

[0024] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0025] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0026] In another aspect, the present invention provides the use of at least one gene encoding an Armadillo repeat protein for modulating the alkaloid content of a cell or a plant or a part thereof or a cell culture; wherein the Armadillo repeat protein:

[0027] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0028] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0029] The present invention also provides a method for producing a plant or part thereof, a cell culture, a plant propagation material, a leaf, a cut harvested leaf, a processed leaf or a cut and processed leaf having a modulated (e.g. reduced) alkaloid content, the method comprising modifying the plant or cell culture to: modulate (e.g. reduce) the expression of at least one Armadillo repeat protein, the at least one Armadillo repeat protein:

[0030] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0031] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0032] Suitably, the at least one gene encoding the armadillo repeat protein may encode an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or wherein the at least one gene encoding the armadillo repeat protein comprises a nucleic acid sequence as shown in SEQ ID No. 2 or 3; or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0033] Suitably, the alkaloid content may be modulated (eg reduced) compared to a plant or cell culture which has not been modified to: modulate expression of at least one armadillo repeat protein; or to modify the nucleic acid sequence of at least one gene encoding an armadillo repeat protein.

[0034] In a further aspect, the present invention provides a plant or part thereof or a cell culture which has been modified to achieve modulation (e.g., reduction) in alkaloid content compared to an unmodified plant or unmodified cell culture, wherein the modification is modulation of expression of at least one Armadillo repeat protein, the at least one Armadillo repeat protein:

[0035] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0036] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0037] In one aspect, a plant or part thereof or cell culture is provided which has been modified to achieve modulation (e.g., reduction) in alkaloid content compared to an unmodified plant or unmodified cell culture, wherein the modification is modulation of expression of at least one gene encoding an armadillo repeat protein, modification of at least one gene encoding an armadillo repeat protein, or modification of a nucleic acid sequence of at least one gene encoding an armadillo repeat protein; wherein the armadillo repeat protein comprises an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or wherein the at least one gene encoding an armadillo repeat protein comprises a nucleic acid sequence as shown in SEQ ID No. 2 or 3; or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0038] In a further aspect, there is provided plant propagation material obtainable (eg obtained) from a plant according to the invention or from a plant or cell culture produced by a method according to the invention.

[0039] In a further aspect, a method or use according to the invention, or a plant or part thereof or a cell culture according to the invention, or a plant propagation material according to the invention is provided, wherein the alkaloid content of the plant is reduced compared to a plant or a cell culture which has not been modified to modulate the expression of at least one gene encoding an armadillo repeat protein or to modify the nucleic acid sequence of at least one gene encoding an armadillo repeat protein.

[0040] Suitably, expression of the at least one gene encoding an Armadillo repeat protein may be reduced compared to a plant or part thereof or a cell or cell culture which has not been modified to modulate expression of the at least one gene encoding an Armadillo repeat protein.

[0041] Suitably, the alkaloid content of the plant or part thereof or cell or cell culture may be increased compared to a plant which has not been modified to modulate expression of at least one armadillo repeat protein or to modify the nucleic acid sequence of at least one gene encoding an armadillo repeat protein.

[0042] Suitably, the plant may be modified to increase expression of at least one gene encoding an armadillo repeat protein or to modify the nucleic acid sequence of at least one armadillo repeat protein; and the plant or cell culture exhibits increased alkaloid content compared to a plant or cell culture that has not been modified to modulate expression of at least one armadillo repeat protein.

[0043] Suitably, the total alkaloid content of the plant or cell culture may be regulated. Suitably, the content of one or more alkaloids selected from nicotine, nornicotine, PON, anabasine, mithofamine and anatabine may be regulated (e.g. reduced), preferably, the content of nicotine, nornicotine and / or PON is regulated (e.g. reduced).

[0044] In one aspect, the plant or plant cell is from the Solanaceae ( Solanaceae ).

[0045] Suitably, the plant or plant cell may be from the genus Solanum ( Solanum ).

[0046] Suitably, the plant or plant cell may be from the genus Nicotiana ( Nicotiana ).

[0047] Suitably, the nicotine content may be adjusted. Suitably, the nicotine content may be reduced.

[0048] In one aspect, a method or use according to the invention, a plant or part thereof or a cell culture according to the invention, or a plant propagation material according to the invention is provided, wherein at least one gene encoding an armadillo repeat protein comprises an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or wherein at least one gene encoding an armadillo repeat protein comprises a nucleic acid sequence as shown in SEQ ID No. 2 or 3; or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0049] In a further aspect, a method or use according to the invention, a plant or part thereof or a cell culture according to the invention, or a plant propagation material according to the invention is provided, wherein an additional gene encoding an armadillo repeat protein is regulated, wherein the additional gene comprises a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant or functional fragment or orthologue of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0050] In a further aspect, the present invention provides the use of a nucleotide sequence encoding an Armadillo repeat protein to select plants with a modulated (e.g. reduced) alkaloid content and / or a modulated (e.g. reduced) tobacco-specific nitrosamine (TSNA) or TSNA precursor content, wherein the Armadillo repeat protein:

[0051] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0052] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0053] In one aspect, there is provided use of a plant or part or cell culture thereof according to the invention, or a plant produced by a method of the invention, for growing a plant.

[0054] In another aspect, there is provided use of a plant or part thereof or a cell culture according to the invention, or a plant produced by a method of the invention, for producing a product.

[0055] In yet another aspect, there is provided the use of a plant according to the invention or a part thereof, or a plant produced by a method according to the invention, for growing crops.

[0056] In another aspect, there is provided use of a plant or part thereof according to the invention, or a plant produced according to the invention, for producing leaves.

[0057] In another aspect, there is provided harvested leaves of a plant according to the invention, or obtainable (e.g. obtained) (or obtained) from a plant propagated from propagation material according to the invention, or obtainable (e.g. obtained) (or obtained) from a plant obtained by use according to the invention, or obtainable (e.g. obtained) (or obtained) from a plant produced by a method according to the invention.

[0058] In one aspect, the harvested leaves of a plant are cut harvested leaves.

[0059] In another aspect, there is provided a processed leaf, preferably a processed tobacco leaf, preferably a non-viable processed tobacco leaf, which:

[0060] obtainable (e.g. obtained) from (or obtained from) a plant obtainable (e.g. obtained) from the use according to the invention;

[0061] obtainable (e.g. obtained) (or obtained) by processing the plant according to the invention;

[0062] obtainable (eg obtained) from (or obtained from) a plant propagated from the plant propagation material according to the invention; or

[0063] Obtainable (eg obtained) (or obtained) by processing harvested leaves of a plant according to the invention; or

[0064] Obtainable from (eg obtained from) (or obtained from) a plant produced by a method according to the invention.

[0065] In one aspect, the leaves are processed by curing, fermenting, pasteurizing, or a combination thereof.

[0066] Suitably, the machining blade may be a cutting machining blade.

[0067] In another aspect, there is provided a cured tobacco material made from a plant or part thereof or extract thereof according to the invention.

[0068] In a further aspect, there is provided a tobacco blend comprising the cured tobacco material according to the invention.

[0069] In another aspect, a tobacco industry product is provided, which is prepared by:

[0070] A tobacco plant or part thereof according to the invention, or a tobacco cell culture according to the invention;

[0071] Tobacco plants or parts thereof propagated from tobacco plant propagation material according to the invention;

[0072] Harvested leaves of a plant according to the present invention, wherein the plant is tobacco;

[0073] The processed leaves according to the invention, wherein the plant is tobacco;

[0074] or

[0075] Plants produced by the method according to the invention.

[0076] In one aspect, the tobacco product is a combustible smoking article.

[0077] In another aspect, the tobacco product is a smokeless tobacco product.

[0078] Suitably, the tobacco product may be a non-combustible gas aerosol delivery system, such as a tobacco heating device or an aerosol generating device.

[0079] In one aspect, there is provided the use of a tobacco cell according to the invention for modulating alkaloid content in a cell culture.

[0080] In one aspect, a combustible smoking article, a non-combustible gas aerosol delivery system, a smokeless tobacco product or a tobacco heating device is provided, which comprises a plant or part thereof or an extract thereof (e.g., a tobacco extract) according to the invention, or a tobacco cell culture according to the invention; or a cured tobacco material according to the invention; or a tobacco blend according to the invention.

[0081] In a further aspect, there is provided the use of a nucleotide sequence of at least one gene encoding an armadillo repeat protein to select plants having a modulated (e.g. reduced) alkaloid content and / or a modulated (e.g. reduced) tobacco-specific nitrosamine (TSNA) or TSNA precursor content, preferably, wherein the sequence of the armadillo repeat protein is selected from: SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or wherein the at least one gene encoding an armadillo repeat protein comprises a nucleic acid sequence as shown in SEQ ID No. 2 or 3; or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0082] In another aspect, the present invention provides a mutant of a plant carrying a heritable mutation in a nucleotide sequence, wherein:

[0083] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0084] b) encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3,

[0085] wherein the heritable mutation modulates (e.g., reduces) expression of an armadillo repeat protein, and wherein the mutant plant has a modulated (e.g., reduced) alkaloid content and / or a modulated tobacco-specific nitrosamine (TSNA) or TSNA precursor content relative to a comparable plant not carrying the heritable mutation.

[0086] In one aspect, a mutant of a plant carrying a heritable mutation in the nucleotide sequence of at least one gene encoding an armadillo repeat protein is provided, preferably, wherein the gene is selected from: SEQ ID No. 2 or 3; or a functional variant or functional fragment or ortholog thereof; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3; wherein the heritable mutation modulates (e.g., reduces) the expression of at least one gene encoding an armadillo repeat protein or modifies the nucleic acid sequence of at least one gene encoding an armadillo repeat protein; and wherein the mutant plant has a modulated (e.g., reduced) alkaloid content and / or a modulated tobacco-specific nitrosamine (TSNA) or TSNA precursor content relative to a comparable plant that does not carry the heritable mutation.

[0087] In a further aspect, there is provided progeny or seeds of a mutant plant carrying a heritable mutation according to the invention.

[0088] In a further aspect, the present invention provides harvested leaves, processed leaves or cured tobacco material produced from a plant comprising a modification in a nucleotide sequence, wherein:

[0089] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0090] b) encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3;

[0091] wherein the modification modulates (e.g., reduces) expression of at least one gene encoding an armadillo repeat protein, and wherein the plant has a modulated (e.g., reduced) alkaloid content and / or a modulated tobacco-specific nitrosamine (TSNA) or TSNA precursor content relative to a comparable plant that does not carry the modification in the at least one gene encoding an armadillo repeat protein.

[0092] In one aspect, a harvested leaf, processed leaf or cured tobacco material produced from a plant is provided, the plant comprising a modification in the nucleotide sequence of at least one gene encoding an armadillo repeat protein, wherein the at least one gene is selected from: SEQ ID No. 2 or 3; or a functional variant or functional fragment or ortholog thereof; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3; wherein the modification modulates (e.g., reduces) expression of the at least one gene encoding an armadillo repeat protein or modifies the nucleic acid sequence of the at least one gene encoding an armadillo repeat protein; and wherein the plant has a modulated (e.g., reduced) alkaloid content and / or a modulated tobacco-specific nitrosamine (TSNA) or TSNA precursor content relative to a comparable plant that does not carry the modification in the at least one gene encoding an armadillo repeat protein.

[0093] In a further aspect, there is provided a method, leaf, plant, plant propagation material, harvested leaf, processed tobacco, tobacco product, use or a combination thereof as described herein with reference to the description and accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0094] Embodiments of the present invention will now be described, by way of example only, with reference to the accompanying drawings, in which:

[0095] Figure 1 Nicotine, nornicotine and PON content of 5-week-old TN90 leaves expressing Nitab4.5_0002810g0020.2 (SEQ ID No. 3) are shown. Nicotine, nornicotine and PON content are expressed relative to the control and contain three biological replicates analyzed by t-test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0096] Figure 2 Nicotine, nornicotine and PON content of 5-week-old TN90 leaves expressing constructs that silence Nitab4.5_0002810g0020.2 (SEQ ID No. 3) by virus-inducible gene silencing are shown. Nicotine, nornicotine and PON content are expressed relative to the control and include three biological replicates analyzed by t-test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P values ​​≤ 0.001.

[0097] Figure 3Alkaloid content of 5-week-old TN90 leaves expressing the following constructs is shown: OE = overexpression of Nitab4.5_0002810g0020.2; DeltaArm = expression of Nitab4.5_0002810g0020.2 sequence, which has been modified to delete the armadillo repeat domain (Arm). Alkaloid content is expressed relative to control and contains three biological replicates analyzed by one-way ANOVA and Tukey's multiple-comparison post-test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0098] Figure 4 Alkaloid content of 5-week-old TN90 leaves expressing the following constructs is shown: OE = overexpression of Nitab4.5_0002810g0020.2; As = Nitab4.5_0002810g0020.2 antisense. Alkaloid content is expressed relative to control and contains three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0099] Figure 5 Alkaloid content of 5-week-old TN90 leaves expressing the following constructs is shown: OE = overexpression Nitab4.5_0002810g0020.2; amiRNA = amiRNA sequence shown in SEQ ID No. 6. Alkaloid content is expressed relative to control and contains three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance with a P value of ≤ 0.001.

[0100] Figure 6 Alkaloid content of greenhouse-grown TN90 plants overexpressing Nitab4.5_0002810g0020.2 in a stable T1 line at the 12-leaf stage is shown. Each point represents the average of 24 measurements sampled from the bottom to the top of the leaf.

[0101] Figure 7 Shown is the alkaloid content of the adult TN90 plant of greenhouse growth for Nitab4.5_0002810g0020.2 silencing.Alkaloid content is expressed relative to control, and comprises three measured values ​​of 20 plants / genotype analyzed by single factor ANOVA and Tukey's multiple comparison post hoc test.Values ​​are shown as mean ± SEM.Asterisk indicates the statistical significance of P value≤0.001.

[0102] Figure 8 It is shown that according to the present invention, Nicotiana tabacum )'s amino acid sequence of Nitab4.5_0002810g0020.2 - SEQ ID No. 1 - Armadillo repeat protein.

[0103] Fig. 9 The genomic sequence of Nitab4.5_0002810g0020.2 encoding the Armadillo Repeat protein from Nicotiana tabacum according to the present invention is shown - SEQ ID No. 2.

[0104] Fig.10 The transcript sequence of Nitab4.5_0002810g0020.2 encoding the Armadillo Repeat protein from Nicotiana tabacum according to the present invention is shown - SEQ ID No. 3.

[0105] Fig.11 Shows Figure 5 The miRNA sequences used in

[0106] Sequence Listing

[0107] A summary of sequence identifiers used throughout the subject specification and the corresponding sequence listing is provided, wherein:

[0108] SEQ ID No. 1 corresponds to the amino acid sequence of Nitab4.5_0002810g0020.2.

[0109] SEQ ID No. 2 corresponds to the genomic sequence of Nitab4.5_0002810g0020.2.

[0110] SEQ ID No. 3 corresponds to the transcript sequence of Nitab4.5_0002810g0020.2.

[0111] SEQ ID No. 4 is the sequence TRV1 used in Example 2.

[0112] SEQ ID No. 5 is the sequence TRV2 used in Example 2.

[0113] SEQ ID No. 6 is Figure 5 The amiRNA sequences used in

[0114] Some sequences disclosed herein contain "X" or "N" in the nucleotide sequence. "X" or "N" can be a deletion or insertion of any nucleotide or one or more nucleotides. For example, in some cases, a string of "X" or "N" is shown. The number of "X" or "N" is not necessarily related to the actual number of nucleotides at the position. There may be more or fewer nucleotides than shown as "X" or "N" in the sequence. DETAILED DESCRIPTION

[0115] The inventors have shown for the first time that by modulating the expression of at least one gene encoding an Armadillo repeat protein in a plant (eg a tobacco plant) or by modifying the nucleic acid sequence of at least one gene encoding an Armadillo repeat protein, the alkaloid and / or TSNA content of a plant can be modulated.

[0116] The present invention provides a method for modulating (e.g. reducing) the alkaloid content of a plant or a part thereof, the method comprising modifying the plant by modulating (e.g. increasing) the expression of at least one gene encoding an armadillo repeat protein or by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein.

[0117] Also provided is a method for modulating (e.g., reducing) the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a tobacco plant or a plant part thereof, the method comprising modifying the plant by modulating (e.g., increasing) the expression of at least one gene encoding an armadillo repeat protein or by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein.

[0118] The at least one gene encoding an armadillo repeat protein may be selected from at least one gene encoding an armadillo repeat protein comprising an amino acid sequence as shown in SEQ ID No. 1, or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or wherein the at least one gene encoding an armadillo repeat protein comprises a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3. Suitably, the armadillo repeat protein may comprise an armadillo repeat domain.

[0119] In one aspect, at least one armadillo repeat protein gene encodes a polypeptide comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or wherein at least one gene encoding an armadillo repeat protein comprises a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3. Suitably, the armadillo repeat protein may comprise an armadillo repeat domain.

[0120] "Expression" of a gene encoding an armadillo repeat protein may refer to the level of transcription, translation, or protein expression.

[0121] Measuring the level or amount of a gene product can be performed by any suitable method, including, for example, comparison of mRNA transcript levels, protein or peptide levels and / or plant phenotype between modified plants and comparable plants that have not been modified according to the invention.

[0122] The term "comparable product" as defined herein will be a product derived from a plant (e.g., a tobacco plant) that has not been modified according to the present invention, but in which all other relevant characteristics are the same (e.g., plant species, growth conditions, methods of processing plants such as tobacco, etc.). Comparable products according to the present invention may mean a plant (e.g., a tobacco plant) or a part thereof, such as a leaf (e.g., a tobacco leaf), a harvested leaf (e.g., a harvested tobacco leaf), a cut harvested leaf (e.g., a cut harvested tobacco leaf), a processed leaf (e.g., a processed tobacco leaf), or a plant propagation material (e.g., a tobacco plant propagation material), or a product comprising the plant or a part thereof, such as a tobacco product or a combination thereof, that is obtainable from (e.g., obtainable from) or obtainable from a plant that has not been modified according to the present invention, e.g., to regulate the expression of a gene encoding an armadillo repeat protein or to modify the nucleic acid sequence of at least one gene encoding an armadillo repeat protein. In one embodiment, a comparable product is a product that does not comprise a gene encoding an armadillo repeat protein whose expression has been regulated. In one embodiment, a comparable product is a product that does not comprise a modified nucleic acid sequence encoding at least one gene encoding an armadillo repeat protein.

[0123] As used herein, the term "modification" or "modified" means a plant (e.g., a tobacco plant) or a nucleic acid sequence that has been altered or changed. The present invention encompasses plant modification using techniques for genetic modification of plants or non-genetic modification of plants. Such methods are well known in the art, and examples of genetic modification techniques include transformation, transgenics, cisgenics, and gene editing methods. Examples of non-genetic modification techniques include fast neutron mutagenesis, chemical mutagenesis such as ethyl methanesulfonate (EMS) mutagenesis, and modern population analysis methods.

[0124] The term "unmodified plant" as defined herein would be a plant (e.g., a tobacco plant) that has not been modified according to the invention, e.g., to modulate the expression of an armadillo repeat protein or to modify the nucleic acid sequence of at least one gene encoding an armadillo repeat protein; and wherein all other relevant characteristics are the same (e.g., plant species, growing conditions, method of processing tobacco, etc.). In one embodiment, an unmodified plant is a plant that does not comprise a gene encoding an armadillo repeat protein, the expression of which has been modulated. In one embodiment, an unmodified plant is a plant that does not comprise a modified nucleic acid sequence encoding at least one gene encoding an armadillo repeat protein.

[0125] Armadillo repeat protein

[0126] As used herein, "armadillo repeat protein" has its ordinary meaning in the art and refers to a protein comprising an armadillo repeat sequence, which is a repetitive amino acid sequence of approximately 40 residues in length. Tandem armadillo repeat sequences typically fold together to form an armadillo (ARM) domain.

[0127] The armadillo repeat protein comprises an armadillo repeat domain. In one embodiment, the armadillo repeat domain is a sequence corresponding to amino acids 118 to 162 of SEQ ID No. 1 when aligned (eg, gapped) with SEQ ID No. 1.

[0128] Armadillo repeat proteins function through the interaction of their tandem armadillo repeat domains with a range of different binding partners. Armadillo repeat proteins have roles as cell contact and cytoskeleton-associated proteins and signal transduction functions by generating and transducing signals that affect gene expression.

[0129] The three-dimensional folding of the armadillo repeat is known from the crystal structure of β-catenin. The cylindrical structure of the protein contains a positively charged groove that is thought to interact with the acidic surface of β-catenin's interacting partners (Huber et al. Cell. 1997 Sep 5;90(5):871-82).

[0130] As used herein, "a gene encoding an armadillo repeat protein" refers to a gene encoding an armadillo repeat protein.

[0131] In one embodiment, the armadillo repeat protein comprises an amino acid sequence as shown in SEQ ID No. 1, or a sequence having at least 80% (e.g. at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) identity to SEQ ID No. 1, or a homologue thereof. Suitably, the armadillo repeat protein may comprise an armadillo repeat domain, such as a domain corresponding to amino acids 118 to 162 of SEQ ID No. 1 when aligned (e.g., gapped) with SEQ ID No. 1.

[0132] In one embodiment, the armadillo repeat protein according to the present invention comprises the amino acid sequence shown in SEQ ID No. 1 or consists of the amino acid sequence shown in SEQ ID No. 1.

[0133] Suitably, the protein may be derived from tobacco.

[0134] In one embodiment, the armadillo protein is encoded by a polynucleotide sequence, wherein the gene (before mutation) comprises a sequence as shown in SEQ ID No. 2 or 3; or a sequence having at least 80% sequence identity thereto. Suitably, the armadillo repeat protein may comprise an armadillo repeat domain, such as a domain corresponding to amino acids 118 to 162 of SEQ ID No. 1 when aligned (e.g., gapped) with SEQ ID No. 1.

[0135] Suitably, the armadillo protein for use according to the invention may be encoded by a polynucleotide sequence, wherein the gene (before mutation) comprises a sequence as shown in SEQ ID No. 2, or a sequence having at least 80% sequence identity thereto (preferably at least 85%, preferably at least 90%, preferably at least 93%, preferably at least 94%, preferably at least 95%, at least 97% or at least 99% identity thereto). Suitably, the armadillo repeat protein may comprise an armadillo repeat domain, for example a domain corresponding to amino acids 118 to 162 of SEQ ID No. 1 when aligned (e.g. gapped) with SEQ ID No. 1.

[0136] Suitably, the armadillo protein for use according to the invention may be encoded by a polynucleotide sequence, wherein the gene (before mutation) comprises a sequence as shown in SEQ ID No. 3, or a sequence having at least 80% sequence identity thereto (preferably at least 85%, preferably at least 90%, preferably at least 93%, preferably at least 94%, preferably at least 95%, at least 97% or at least 99% identity thereto). Suitably, the armadillo repeat protein may comprise an armadillo repeat domain, for example a domain corresponding to amino acids 118 to 162 of SEQ ID No. 1 when aligned (e.g. gapped) with SEQ ID No. 1.

[0137] In one embodiment, the armadillo protein is encoded by a polynucleotide sequence, wherein the gene (before mutation) is selected from: SEQ ID No. 2 or 3.

[0138] Suitably, the wild-type protein for use according to the present invention may be encoded by a polynucleotide sequence from Nicotiana tabacum.

[0139] In one aspect, the invention provides a method of reducing the alkaloid content of a plant or a part or cell thereof (eg a plant cell), the method comprising modifying the plant by reducing or inhibiting the expression of at least one Armadillo Repeat protein as defined herein.

[0140] In one aspect, the present invention provides a method for reducing the alkaloid content of a plant or a part or cell thereof (such as a plant cell), the method comprising modifying the plant by reducing or inhibiting the expression of at least one gene encoding an Armadillo Repeat protein as defined herein.

[0141] In one aspect, the present invention provides a method for reducing the alkaloid content of a plant or a part thereof or a plant cell, the method comprising modifying the plant by reducing or inhibiting the expression of at least one armadillo repeat protein, the at least one armadillo repeat protein comprising: an amino acid sequence as shown in SEQ ID No. 1, or a sequence having at least 80% identity thereto, or a functional variant, functional fragment or ortholog of SEQ ID No. 1; or encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3. Suitably, the armadillo repeat protein may comprise an armadillo repeat domain.

[0142] In one aspect, the present invention provides a method for reducing the tobacco-specific nitrosamine (TSNA) or TSNA precursor content of a plant or part thereof (eg leaves), the method comprising modifying the plant by reducing or inhibiting the expression of at least one Armadillo repeat protein as defined herein.

[0143] In one aspect, the present invention provides a method for reducing the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a plant or part thereof (e.g. leaves), the method comprising modifying the plant by reducing or inhibiting the expression of at least one gene encoding an Armadillo repeat protein as defined herein.

[0144] In one aspect, the present invention provides a method for reducing the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a plant or a part thereof (e.g., leaves), the method comprising modifying the plant by reducing or inhibiting the expression of at least one Armadillo repeat protein, the at least one Armadillo repeat protein:

[0145] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0146] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0147] As used herein, the term "inhibit" (eg, inhibiting expression of a gene encoding an Armadillo repeat protein) means that expression of a gene encoding an Armadillo repeat protein is less or reduced compared to gene expression of the gene in a comparable product.

[0148] The expression of a specific gene encoding an armadillo repeat protein can be measured by measuring the transcription and / or translation of the gene. Methods for measuring transcription are well known in the art and include, among others, Northern blotting, RNA-Seq, in situ hybridization, DNA microarrays, and RT-PCR. On the other hand, the expression of a gene can be measured indirectly by measuring the level of a gene product, such as a protein encoded by the gene.

[0149] In some embodiments, the expression of a gene encoding an armadillo repeat protein may be modulated (i.e., increased or decreased) by at least about 10%, 20%, 30% or 40%, suitably at least about 50%, 60%, 70%, more suitably at least about 80%, 90%, 95% or 100% when compared to the expression of a gene encoding an armadillo repeat protein in a plant (e.g., a tobacco plant) that has not been modified according to the invention.

[0150] Suitably, expression of the armadillo repeat protein gene may be reduced, partially inactivated, suppressed, eliminated, knocked out or lost such that protein expression or function of the armadillo repeat protein gene is undetectable.

[0151] In one aspect, at least one armadillo repeat protein gene is knocked out. In other words, the armadillo repeat protein gene has been rendered completely ineffective.

[0152] Any method known in the art for reducing or preventing the expression of a protein may be used in the methods according to the invention.

[0153] For example, the method may include:

[0154] ● providing a mutation in a nucleic acid sequence encoding a protein comprising an amino acid sequence as shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto;

[0155] ● providing a mutation in a regulatory region (e.g., a promoter or enhancer) that helps control the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto;

[0156] ● Provide antisense RNA, siRNA or miRNA that reduces the level of a nucleic acid sequence encoding a protein comprising an amino acid sequence as shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto.

[0157] The above methods each result in a reduction or prevention of the expression of: a protein comprising an amino acid sequence as shown in SEQ ID No. 1; or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto, or a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) identity thereto.

[0158] In one aspect, the regulatory sequence of the armadillo repeat protein can be modified. The regulatory sequence can be, for example, a promoter, enhancer or other regulatory signal. Suitably, the modification of the regulatory sequence can result in reduced expression of the armadillo repeat protein. For example, modification of the promoter such as mutation or deletion may reduce the expression of the armadillo repeat protein.

[0159] As used herein, the term "mutation" includes natural genetic variants or artificially engineered variants. In particular, the term "mutation" refers to a variation in a nucleotide sequence encoding an amino acid sequence or an amino acid sequence compared to a sequence as shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (preferably at least 85%, preferably at least 90%, preferably at least 93%, preferably at least 95%, preferably at least 98%, preferably at least 99%) sequence identity thereto.

[0160] In one embodiment, the mutation reduces the alkaloid content of the plant. In another embodiment, the mutation reduces the content of at least one TSNA or TSNA precursor in tobacco.

[0161] In one embodiment, the method according to the invention may comprise providing a plant or part thereof or a plant cell with a nucleic acid sequence, wherein said nucleic acid results in the reduction or elimination of the expression of at least one gene encoding an Armadillo Repeat protein.

[0162] In one embodiment, the method according to the invention may comprise providing a plant or part thereof or a plant cell with a nucleic acid sequence, wherein the nucleic acid results in a modification of the nucleic acid sequence of at least one gene encoding an Armadillo repeat protein.

[0163] Suitably, the nucleic acid sequence may be introduced into a plant or part or cell thereof. Suitably, an endogenous nucleic acid sequence in a plant or part or cell thereof may be modified to encode a polypeptide according to the invention (e.g. by gene editing). For example, an endogenous nucleotide sequence may be modified to reduce the expression of at least one gene encoding an armadillo repeat protein.

[0164] In a preferred embodiment, each copy of the nucleic acid sequence present in the plant is modified, e.g., mutated as defined herein (e.g., each genomic copy of the gene encoding the protein in the plant is mutated), the nucleic acid sequence encoding a protein comprising the sequence as shown in SEQ ID No. 1, or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto, or wherein at least one gene encoding the armadillo repeat protein comprises a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) identity to SEQ ID No. 2 or 3. For example, each copy of the gene in the allotetraploid genome of tobacco may be mutated.

[0165] In a preferred embodiment, the plant or plant cell according to the invention is homozygous. Suitably, the plant or plant cell may be homozygous for a modification such as suppression or mutation.

[0166] In one embodiment, the plant or plant cell according to the invention expresses only a modified, e.g., mutated, nucleic acid encoding an armadillo repeat protein. In other words, in some embodiments, no endogenous (or endogenous and functional protein) is present in the plant according to the invention. In other words, if any endogenous protein is present, it is preferably in an inactive form.

[0167] In one embodiment, the method may comprise providing a mutation in a nucleic acid sequence as shown in SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) identity thereto.

[0168] The mutation can alter the plant genome so that the nucleic acid sequence encoding the protein is completely or partially deleted or otherwise modified to prevent the armadillo repeat protein from forming protein: protein interactions, wherein the protein comprises the amino acid sequence shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto.

[0169] The mutation may interrupt a nucleic acid sequence encoding a protein comprising an amino acid sequence as shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto.

[0170] The interruption may result in the nucleic acid sequence not being transcribed and / or translated.

[0171] The nucleic acid sequence can be interrupted, for example, by deleting or otherwise modifying the ATG start codon of the nucleic acid sequence, such that translation of the protein is reduced or prevented.

[0172] The nucleotide sequence may comprise one or more nucleotide changes that reduce or prevent protein expression or influence protein transport. For example, the expression of the protein may be reduced or prevented by introducing one or more premature stop codons, frameshifts, splice mutants or non-tolerant amino acid substitutions in the open reading frame.

[0173] A premature stop codon refers to a mutation that introduces a stop codon into the open reading frame and prevents translation of the entire amino acid sequence. The premature stop codon can be a TAG ("amber"), TAA ("ochre"), or TGA ("cream" or "umber") codon.

[0174] A frameshift mutation (also called a framing error or frame shift) is a mutation caused by the insertion / deletion (insertion or deletion) of multiple nucleotides in a nucleic acid sequence that cannot be divided by three. Due to the triplet nature of gene expression through codons, insertions or deletions can change the reading frame, resulting in a translation that is completely different from the original. Frameshift mutations will often cause the codon after the mutation to be read to encode a different amino acid. Frameshift mutations will usually result in the introduction of premature stop codons.

[0175] Splicing mutants insert, delete or change many nucleotides at specific sites, where splicing occurs during the processing of precursor messenger RNA into mature messenger RNA. The loss of splicing sites causes one or more introns to remain in mature mRNA and may lead to the production of abnormal proteins.

[0176] Non-tolerant amino acid substitutions refer to mutations that cause non-synonymous amino acid substitutions in a protein, which result in reduced or eliminated function of the protein.

[0177] Any method known in the art for providing a mutation in a nucleotide sequence can be used in the method according to the present invention. For example, homologous recombination can be used to produce a vector in which one or more of the nucleotide sequences involved are mutated and used to transform a plant or plant cell. The recombinant plant or plant cell expressing the mutated sequence can then be selected.

[0178] In one embodiment, the mutation introduces a non-tolerant amino acid substitution in a protein comprising the amino acid sequence shown in SEQ ID No. 1, or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto.

[0179] In one embodiment, the mutation reduces, inhibits or eliminates the ability of the armadillo repeat protein to form protein-protein interactions compared to the protein shown in SEQ ID No. 1, or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto.

[0180] In one embodiment, the mutation does not alter the level or expression of the protein, but reduces, inhibits or eliminates the ability of the armadillo repeat protein to form protein-protein interactions, compared to the protein shown as SEQ ID No. 1, or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto. Suitably, the mutation may be in the armadillo repeat domain of the armadillo repeat protein. Suitably, the mutation may be in the protein-protein interaction domain of the armadillo repeat protein.

[0181] The expression of the protein can be determined by measuring the presence of the protein by Western blot using an antibody specific for the armadillo repeat protein, such as an antibody specific for the armadillo repeat sequence. The ability of a modulated or mutated armadillo repeat protein to form protein-protein interactions can be determined, for example, by performing a co-immunoprecipitation experiment using the modulated or mutated armadillo repeat protein and the corresponding unmodified or unmutated armadillo repeat protein. If the modulation or mutation in the armadillo repeat protein reduces, inhibits or eliminates the ability of the armadillo repeat protein to form protein-protein interactions, then the co-immunoprecipitation will show that the modulated or mutated armadillo repeat protein will have fewer protein:protein interactions.

[0182] In one embodiment, the armadillo repeat protein comprises an armadillo repeat domain.

[0183] As used herein, the term "armadillo repeat domain" refers to a structurally conserved protein domain of about 40-45 amino acids that is involved in protein-protein interactions.

[0184] Armadillo repeat domains can be annotated or predicted by comparison of amino acid sequences with known protein structures. For example, armadillo repeat proteins and armadillo repeat protein domains can be identified by sequence alignment against SEQ ID No. 1, wherein the presence of amino acid residues corresponding to those from about amino acid 118 to about 162 of SEQ ID No. 1 indicates an armadillo repeat domain.

[0185] In one embodiment, the armadillo repeat domain is a region of the protein corresponding to approximately amino acids 118 to 162 of SEQ ID No. 1.

[0186] In one embodiment, the armadillo repeat domain is a sequence corresponding to amino acids 118 to 162 of SEQ ID No. 1 when aligned (eg, gapped) with SEQ ID No. 1.

[0187] In one embodiment, the armadillo repeat domain may contain mutations that modulate the expression of at least one gene encoding an armadillo repeat protein. In one embodiment, the armadillo repeat domain may contain mutations that increase the expression of at least one gene encoding an armadillo repeat protein. In one embodiment, the armadillo repeat protein domain may contain mutations that decrease the expression of at least one gene encoding an armadillo repeat protein.

[0188] The mutation may be a deletion, a splice mutant, or a codon encoding a non-tolerant amino acid substitution.

[0189] In one embodiment, the armadillo repeat domain may be mutated so as to modify the ability of the armadillo repeat protein to form protein: protein interactions. In other words, the armadillo repeat domain may be mutated so as to result in modification of the binding affinity of the armadillo repeat protein. In one embodiment, the mutation may be contained in the region corresponding to about amino acids 118-162 of SEQ ID No. 1. In one embodiment, the mutation may be contained in the region corresponding to amino acids 118-162 of SEQ ID No. 1. Suitably, the amino acid numbering corresponds to an alignment with SEQ ID No. 1, such as a gap alignment.

[0190] In one embodiment, the nucleic acid sequence encoding the armadillo repeat protein can be completely or partially deleted. The deletion can be continuous or can include multiple segments of the sequence. The deletion preferably removes a sufficient amount of nucleotide sequence so that the nucleic acid sequence no longer encodes a functional armadillo repeat protein. When compared to the corresponding genome of a comparable unmodified plant, the deletion can be complete, in which case 100% of the coding portion of the nucleic acid sequence is absent. The deletion can, for example, remove at least 50, 60, 70, 80 or 90% of the coding portion of the nucleic acid sequence. Suitably, at least a portion of the protein can be deleted. The deletion can, for example, remove at least 10, 20, 30, 40, 50, 60, 70, 80 or 90% of the coding portion of the protein.

[0191] The deletion may remove at least a portion of the armadillo repeat domain.

[0192] The deletion may, for example, remove at least 10, 20, 30, 40, 50, 60, 70, 80 or 90% of the armadillo repeat protein domain.

[0193] Suitably, the deletion may remove at least 5 amino acids, at least 10 amino acids, at least 15, at least 20, at least 25, at least 30 amino acids from the armadillo repeat protein domain. Suitably, the deletion may remove at least 5 amino acids, at least 10 amino acids, at least 15, at least 20, at least 25, at least 30 amino acids from the armadillo repeat protein domain, wherein the domain corresponds to about amino acid residue 118 to about amino acid residue 162 of SEQ ID No. 1.

[0194] In one embodiment, the deletion can remove at least 100 amino acids, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550 amino acids from the C-terminus of the armadillo repeat protein.

[0195] Suitably, the mutant protein may be a truncated protein lacking at least about 100 amino acids, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 550 amino acids corresponding to the amino acids from the C-terminus of SEQ ID No. 1, or a sequence having at least 80% (preferably at least 85%, at least, at least 90%, at least 95%, at least 98%) sequence identity to a truncated protein lacking at least about 100 amino acids, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 550 amino acids corresponding to the amino acids from the C-terminus of SEQ ID No. 1.

[0196] Suitably, the mutant protein may be a truncated protein lacking at least 100 amino acids, at least 150, at least 200, at least 250, at least 300, at least 350, at least about 400, at least about 450, at least about 500, at least about 550 amino acids corresponding to the amino acids from the C-terminus of SEQ ID No. 1, or a sequence having at least 80% (preferably at least 85%, at least, at least 90%, at least 95%, at least 98%) sequence identity to a truncated protein lacking at least 100 amino acids, at least 150, at least 200, at least 250, at least 300, at least 350, at least about 400, at least about 450, at least about 500, at least about 550 amino acids corresponding to the amino acids from the C-terminus of SEQ ID No. 1.

[0197] Methods for deleting nucleotide sequences in plants are known in the art. For example, homologous recombination can be used to produce a vector in which one or more of the nucleotide sequences involved are lost and used to transform plants or plant cells. Recombinant plants or plant cells expressing the new sequence portion can then be selected.

[0198] Plant cells transformed with the vectors described herein can be grown and maintained according to well-known tissue culture methods, for example, by culturing the cells in a suitable medium supplied with necessary growth factors such as amino acids, plant hormones, vitamins and the like.

[0199] Modification of nucleic acid sequences can be performed using directed mutagenesis methods, also known as targeted nucleotide exchange (TNE) or oligo-directed mutagenesis (ODM). Directed mutagenesis methods include, but are not limited to, those using zinc finger nucleases, TALENs (see WO2011 / 072246 and WO2010 / 079430), Cas9-like, Cas9 / crRNA / tracrRNA, Cas9 / gRNA or other CRISPR systems (see WO 2014 / 071006 and WO2014 / 093622), meganucleases (see WO2007 / 047859 and WO2009 / 059195), or directed mutagenesis methods using mutagenic oligonucleotides, which may contain chemically modified nucleotides having sequence complementarity to the gene for enhanced mutagenesis that are introduced into plant protoplasts (e.g., KeyBase® or TALENs).

[0200] On the other hand, mutagenesis systems such as TILLING (Targeting Induced Local Lesions IN Genomics; McCallum et al., 2000, Nat Biotech 18:455, and McCallum et al. 2000, Plant Physiol. 123, 439-442, both of which are incorporated herein by reference) can be used to generate plant lines containing genes encoding proteins with mutations. TILLING uses traditional chemical mutagenesis (e.g., ethyl methanesulfonate (EMS) mutagenesis to produce random mutations), followed by high-throughput screening of mutations. Therefore, plants, seeds, cells and tissues containing genes with desired mutations can be obtained.

[0201] The method can include the following steps: mutagenesis of plant seeds (for example EMS mutagenesis), merging of plant individuals or DNA, pcr amplification of the region of interest, heteroduplex formation and high-flow detection, identification of mutant plants, sequencing of mutant pcr products. It should be understood that other mutagenesis and selection methods can be used equally to generate the plant of this modification. Seeds can for example be irradiated or chemically treated, and can screen plants with regard to the phenotype of modification.

[0202] Fast neutron deletion mutagenesis can be used in a reverse genetics sense (i.e., using PCR) to identify plant lines carrying deletions in endogenous genes. See, e.g., Ohshima et al. (1998) Virology 213:472-481; Okubara et al. (1994) Genetics 137:867-874; and Quesada et al. (2000) Genetics 154:421-4315, which are incorporated herein by reference.

[0203] In another approach, dominant mutants can be used to trigger RNA silencing due to gene inversion and recombination of duplicated gene loci. See, e.g., Kusaba et al. (2003) Plant Cell 15: 1455-1467 (incorporated herein by reference).

[0204] The modified plants can be distinguished from unmodified plants, i.e., wild-type plants, by molecular methods, such as one or more mutations present in the DNA, and by the phenotypic characteristics of the modification. The modified plants can be homozygous or heterozygous for the modification. Preferably, the modified plants are homozygous for the modification.

[0205] In one embodiment, the method of reducing or preventing protein expression does not include treating the plant with chemicals (e.g., agrochemicals), wherein the protein comprises the amino acid sequence shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto.

[0206] Other ways to reduce or prevent expression will be apparent to those skilled in the art and include the use of virus-induced gene silencing (VIGs), microRNA silencing, RNAi, antisense, tDNA insertion, or dominant negative constructs (or antimorphic mutations).

[0207] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by virus-induced gene silencing.

[0208] In one embodiment, the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by microRNAs.

[0209] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by RNAi.

[0210] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by antisense inhibition.

[0211] In one embodiment, expression of a protein comprising the amino acid sequence shown in SEQ ID No. 1, SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by sense suppression.

[0212] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereof can be reduced or eliminated by tDNA insertion.

[0213] In one embodiment, expression of a protein comprising the amino acid sequence shown in SEQ ID No. 1, SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by a dominant negative construct (or a reverse allele mutation).

[0214] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by a system based on site-directed mutagenesis.

[0215] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by a CRISPR-based system.

[0216] In one embodiment, the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 1, or an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) sequence identity thereto can be reduced or eliminated by zinc finger nucleases, TALENs, meganucleases, mutagenic oligonucleotides or TILLING.

[0217] In one aspect, the present invention provides a method of increasing the alkaloid content of a plant or a part thereof or a plant cell, the method comprising modifying the plant by increasing the expression of at least one gene encoding an Armadillo Repeat protein.

[0218] In one aspect, the present invention provides a method for increasing the alkaloid content of a plant or a part thereof or a plant cell, the method comprising modifying the plant by increasing the expression of at least one gene encoding an armadillo repeat protein, the armadillo repeat protein comprising an amino acid sequence as shown in SEQ ID No. 1, or having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) of the amino acid sequence, or a functional variant or functional fragment or ortholog of the amino acid sequence as shown in SEQ ID No. 1, or wherein the at least one gene encoding an armadillo repeat protein comprises a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%) identity with SEQ ID No. 2 or 3.

[0219] In one aspect, the present invention provides a method of reducing the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a plant or part thereof (eg, leaves), the method comprising modifying the plant by reducing the expression of at least one Armadillo repeat protein.

[0220] In one aspect, the present invention provides a method for reducing the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a plant or a part thereof (e.g., leaves), the method comprising modifying the plant by reducing the expression of at least one gene encoding an armadillo repeat protein, the armadillo repeat protein comprising a sequence as shown in SEQ ID No. 1, or a sequence having at least 80% identity with the amino acid sequence as shown in SEQ ID No. 1, or a functional variant or functional fragment or ortholog of SEQ ID No. 1, or wherein at least one gene encoding an armadillo repeat protein comprises a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0221] As used herein, the term "increasing" (eg, increasing expression of a gene encoding an Armadillo repeat protein) means that expression of the Armadillo repeat protein gene is higher compared to gene expression of an unmodified gene in a comparable product.

[0222] In some embodiments, the modification that increases the expression of at least one armadillo repeat protein gene, and thereby increases the alkaloid content and / or TSNA content (or its precursors) is selected from:

[0223] increasing, promoting or amplifying the transcription, translation or expression of at least one armadillo repeat protein;

[0224] increasing the synthesis of a polypeptide encoded by at least one armadillo repeat protein; or its release from intracellular stores; or

[0225] Reducing the degradation rate of a polypeptide encoded by at least one armadillo repeat protein gene.

[0226] Suitably, the method may comprise transforming cells of a plant (e.g., a tobacco plant) with a genetic construct encoding at least one armadillo repeat protein comprising an amino acid sequence as shown in SEQ ID No. 1, or a functional variant, functional fragment or ortholog thereof, or a sequence having at least 80% identity to SEQ ID No. 1; or comprising a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant, functional fragment or ortholog thereof, or a nucleic acid sequence having at least 80% identity to SEQ ID No. 2 or 3; or comprising a nucleotide sequence encoding a protein capable of promoting or augmenting at least one endogenous armadillo repeat protein gene.

[0227] It will be appreciated that each of these options will result in increased activity and expression of a polypeptide encoded by at least one armadillo repeat protein gene. The method may comprise regenerating a plant from the transformed cell. Provided is the use of a genetic construct capable of increasing expression of a polypeptide encoded by at least one armadillo repeat protein gene for increasing alkaloid content (e.g. nicotine content) and or TSNA content (or precursors thereof) in a plant or part or cell thereof transformed with said construct.

[0228] The genetic construct may encode a polypeptide comprising the amino acid SEQ ID No. 1, or a functional variant or functional fragment or straight homologue thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or it may comprise a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or straight homologue thereof, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0229] In another embodiment, the invention relates to a method for increasing the alkaloid content of a plant or a part thereof and / or the TSNA content (or a precursor thereof) in a plant or a part thereof, comprising modifying said plant by increasing the activity of at least one gene encoding an Armadillo repeat protein.

[0230] In one embodiment, the activity of at least one gene encoding an armadillo repeat protein may be increased by introducing (or providing) a mutation to at least one gene encoding an armadillo repeat protein.

[0231] Suitably, expression of at least one gene encoding an armadillo repeat protein may be increased by introducing a mutation to:

[0232] a) at least one gene encoding an armadillo repeat protein, the armadillo repeat protein comprising the amino acid sequence as shown in SEQ ID No. 1; or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0233] b) a nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0234] In one embodiment, the armadillo repeat protein for use according to the invention exhibits increased activity compared to an unmodified armadillo repeat protein. The armadillo repeat protein for use according to the invention may exhibit at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% increased binding compared to an unmodified armadillo repeat protein.

[0235] Alkaloid content

[0236] In one embodiment, the invention provides a method of modulating the alkaloid content of a plant (eg, a tobacco plant) or a part thereof, the method comprising modifying the plant by modulating the expression of at least one Armadillo Repeat protein.

[0237] In one embodiment, the present invention provides a method of modulating the alkaloid content of a plant (eg, a tobacco plant) or a part thereof, the method comprising modifying the nucleic acid sequence of at least one gene encoding an Armadillo Repeat protein.

[0238] The term "modulate" is used herein to mean to increase or decrease.

[0239] The term "increasing the alkaloid content" is used herein to mean that the concentration and / or total alkaloid content in the product of the invention (e.g., a plant, a part thereof (e.g., a leaf), a processed leaf, or a product prepared from a plant (e.g., a tobacco product)) is higher than in a comparable product which has not been modified according to the invention.

[0240] The term "reduced alkaloid content" is used herein to mean that the concentration and / or total alkaloid content in the product of the invention (e.g., a plant, a part thereof (e.g., a leaf), a processed leaf, or a product prepared from a plant (e.g., a tobacco product)) is lower than in a comparable product which has not been modified according to the invention.

[0241] In some embodiments, modulation of alkaloid content refers to an increase in alkaloid content, wherein expression of at least one armadillo repeat protein gene is decreased (or inhibited).

[0242] In some embodiments, modulation of alkaloid content refers to an increase in alkaloid content, wherein the nucleic acid sequence of at least one gene encoding an armadillo repeat protein has been modified.

[0243] In some embodiments, modulation of alkaloid content refers to a decrease in alkaloid content, wherein the expression of at least one armadillo repeat protein is reduced or inhibited or eliminated. In some embodiments, modulation of alkaloid content refers to a decrease in alkaloid content, wherein the expression of at least one gene encoding an armadillo repeat protein is reduced or inhibited or eliminated.

[0244] In some embodiments, modulation of alkaloid content refers to a decrease in alkaloid content, wherein the nucleic acid sequence of at least one gene encoding an armadillo repeat protein has been modified.

[0245] In a further aspect, the alkaloid content is measured from leaves. In one aspect, the alkaloid content is measured from green leaves. In a further aspect, the alkaloid content is measured from conditioned leaves, such as air-cured, flue-cured, fire-cured, or sun-cured leaves. In a further aspect, the alkaloid content is measured from flue-cured leaves. In a further aspect, the alkaloid content is measured from air-cured leaves.

[0246] The term "alkaloid content" is used herein to mean the concentration and / or total amount of the whole group of compounds classified as alkaloids. Alkaloids generally present in tobacco include nicotine, nornicotine, PON, anatabine, anabasine and mithosamine. In one embodiment, the content of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine and mithosamine is regulated. In one embodiment, the content of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine and mithosamine is reduced. In one embodiment, the content of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine and mithosamine is increased. Suitably, nicotine content can be regulated. In one embodiment, nicotine content is reduced. In another embodiment, nicotine content is increased.

[0247] Any method known in the art for determining the concentration and / or total content of alkaloids may be used.A preferred method for analyzing alkaloid content involves analysis by gas chromatography-flame ionization detection (GC-FID).

[0248] In one embodiment, a method is provided for producing a plant (e.g., a tobacco plant) or part thereof obtainable (e.g., obtained) or obtained by the plant of the present invention, a plant (e.g., a tobacco plant) or part thereof, a plant propagation material (e.g., a tobacco plant propagation material), a cell (e.g., a tobacco cell), a leaf (e.g., a tobacco leaf), a harvested leaf (e.g., a harvested tobacco leaf), a cut harvested leaf (e.g., a cut harvested tobacco leaf), a processed leaf (e.g., a processed tobacco leaf), a cut and processed leaf (e.g., a cut and processed tobacco leaf), a product (e.g., a tobacco product) comprising the plant or part thereof, or a combination thereof, wherein the plant of the present invention has a modulated alkaloid content, the method comprising: modifying the plant to modulate the expression of a gene encoding an armadillo repeat protein; or modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein. The modulated alkaloid content can be determined by comparing the alkaloid content in the following to a comparable product: a plant (e.g., a tobacco plant) or a part thereof, a plant propagation material (e.g., a tobacco plant propagation material), a cell (e.g., a tobacco cell), a leaf (e.g., a tobacco leaf), a harvested leaf (e.g., a harvested tobacco leaf), a cut harvested leaf (e.g., a cut harvested tobacco leaf), a processed leaf (e.g., a processed tobacco leaf), a cut and processed leaf (e.g., a cut and processed tobacco leaf), a product such as a tobacco product comprising a plant or a part thereof of the present invention, or a combination thereof.

[0249] Suitably, alkaloid content can be regulated in plant, for example tobacco plant, for example tobacco plant of modification. Suitably, alkaloid content can be regulated in blade (for example tobacco blade, for example tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in blade of results (for example tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in blade of cutting results (for example tobacco blade from the tobacco plant of cutting results). Suitably, alkaloid content can be regulated in processing blade (for example processing tobacco blade, for example processing tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in blade of cutting and processing (for example cutting and processing tobacco blade, for example cutting and processing tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in blade after modulation (for example tobacco blade after modulation from the tobacco plant of modification). Suitably, alkaloid content can be regulated in extract of green blade (for example green tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in the product (for example tobacco product, for example tobacco product produced by the tobacco plant of modification or its part) comprising plant of the present invention or its part. Suitably, alkaloid content can be regulated in any one of the above-mentioned products or its combination. Suitably, the regulation of the above-mentioned alkaloid content can be an increase in the alkaloid content. Suitably, the regulation of the above-mentioned alkaloid content can be a reduction in the alkaloid content (for example a reduction in the nicotine content).

[0250] In one embodiment, the level of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine, and miosamine is reduced.

[0251] Suitably, the above-mentioned regulation of alkaloid content may be a decrease in nicotine content. Suitably, the above-mentioned regulation of alkaloid content may be an increase in nicotine content.

[0252] In one embodiment, the nicotine content of the modified plant (e.g., tobacco plant), plant propagation material (e.g., tobacco plant propagation material), leaves (e.g., tobacco leaves), harvested leaves (e.g., harvested tobacco leaves), cut harvested leaves (e.g., cut harvested tobacco leaves), processed leaves (e.g., processed tobacco leaves), cut and processed leaves (e.g., cut and processed tobacco leaves), or tobacco products from the modified tobacco plant is reduced.

[0253] In one embodiment, when compared to the alkaloid content of a plant (e.g., tobacco plant) or a part thereof that has been grown under similar growth conditions and has not been modified to: regulate the expression of at least one gene encoding armadillo repeat proteins; or modify the nucleic acid sequence of at least one gene encoding armadillo repeat proteins, the alkaloid content of a plant (e.g., tobacco plant) or a part thereof can be adjusted to at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 times. Suitably, the alkaloid content can be adjusted to about 2 times to about 10 times, preferably about 3 times to about 10 times, and suitably about 3 times to about 5 times. Suitably, the modification can be an increase or decrease in the alkaloid content. Suitably, the adjustment can be the adjustment of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine and mithofamine. Suitably, the nicotine content is adjusted.

[0254] In one embodiment of the invention, compared with a plant (e.g., tobacco plant) or its part that has not been modified according to the present invention, the alkaloid content of a plant (e.g., tobacco plant) or its part can be adjusted by 1%, 2%, 5%, 8%, 10%, 12%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. When compared with an unmodified plant (e.g., tobacco plant) or its part, adjustment can be an increase or reduction in the alkaloid content. Suitably, adjustment can be the adjustment of total alkaloid content. Suitably, adjustment can be the adjustment of one or more alkaloids selected from nicotine, nornicotine, PON, anabasine, anabasine and mithofamine. Suitably, adjustment is the adjustment of nicotine content, such as the reduction in nicotine content. Suitably, adjustment is the adjustment of nicotine content, such as the reduction in nicotine content. Suitably, adjustment is the adjustment of PON content, such as the reduction in PON content.

[0255] Tobacco-specific nitrosamines (TSNA) content

[0256] In one embodiment, the invention provides a method of modulating (i.e. increasing or decreasing) the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a plant (e.g. a tobacco plant) or part thereof. Suitably, the method may comprise modifying the plant by modulating the expression of at least one armadillo repeat protein. Suitably, the method may comprise modifying the plant by modifying the nucleic acid sequence of at least one gene encoding an armadillo repeat protein. Suitably, the TSNA or TSNA precursor content may be reduced.

[0257] TSNA can be measured in processed tobacco, such as cured tobacco or reconstituted tobacco. In one embodiment, TSNA content is measured and / or modified (eg, reduced) in cured tobacco plants or parts thereof (eg, cured tobacco leaves).

[0258] As used herein, the term "tobacco-specific nitrosamines" or "TSNAs" has its usual meaning in the art, i.e., nitrosamines found only in tobacco products or other nicotine-containing products. Suitably, at least one tobacco-specific nitrosamine may be 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), N'-nitrosonornicotine (NNN), N'-nitrosoanatabine (NAT) or N'-nitrosoanatabine (NAB).

[0259] When used with respect to at least one tobacco-specific nitrosamine, the term "precursor thereof" refers to one or more chemicals or compounds of the tobacco plant that cause the formation of tobacco-specific nitrosamines or are associated with nitrosative reactions that cause tobacco-specific nitrosamines to be produced. Suitably, the term "precursor thereof" may refer to nitrates, nitrites or nitrogen oxides.

[0260] The term "modulate" is used herein to mean to increase or decrease.

[0261] In one embodiment, the TSNA is N'nitrosonornicotine (NNN) and / or the precursor is nornicotine.

[0262] In one embodiment, the TSNA may be one or more selected from the group consisting of N'-nitrosonornicotine (NNN), N'-nitrosonicotinoline (NAT), N'-nitrosonetab (NAB) and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK). Suitably, at least one tobacco-specific nitrosamine may be NNK or NNN. In one embodiment, the tobacco-specific nitrosamine is NNN.

[0263] In one embodiment, the precursor of TSNA is one or more selected from the group of nornicotine, anabasine, anatabine and oxidized derivatives of nicotine such as pseudo-oxidized nicotine (PON).

[0264] In a preferred embodiment, the precursor of TSNA is nornicotine.

[0265] In one embodiment, the precursor of the TSNA may be PON. Precursors of TSNAs (e.g., NNN, NNK, NAB and / or NAT) may be measured in green tobacco leaves, e.g., prior to processing, e.g., prior to curing. In one embodiment, precursors of TSNAs (e.g., NNN, NNK, NAB and / or NAT) are measured and / or modified (e.g., reduced) in green tobacco leaves, e.g., prior to processing, e.g., prior to curing.

[0266] In one embodiment, performance of the methods and or uses of the invention results in a reduction in at least one TSNA or precursor thereof in the modified tobacco plant (or part thereof) when compared to a tobacco plant (or part thereof) which has not been modified according to the invention.

[0267] The term "reduction of at least one TSNA or a precursor thereof" or "reduction of at least one TSNA or a precursor thereof" is used herein to mean that the concentration and / or total content of at least one TSNA or a precursor thereof is lower in the product, method or use of the invention relative to a comparable product, method or use. For example, a comparable tobacco industry product would be derived from a tobacco plant that has not been modified according to the invention, but in which all other relevant characteristics are the same (e.g., plant species, growing conditions, methods of processing the tobacco, etc.).

[0268] Any method known in the art for determining the concentration and / or level of at least one TSNA or its precursor may be used. In particular, such a method may be used which may include the addition of a deuterium labeled internal standard, water extraction and filtration, followed by analysis using reverse phase high performance liquid chromatography with tandem mass spectrometry (LC-MS / MS). Other examples of methods for determining the concentration and / or level of tobacco specific nitrosamine precursors include methods such as CORESTA recommended method CRM-72: Determination of Tobacco Specific Nitrosamines in Tobacco and Tobacco Products by LC-MS / MS; the CRM being developed as ISO / DIS 21766 or the method detailed in Wagner et al. Analytical Chemistry (2005), 77(4), 1001-1006, which are incorporated herein by reference in their entirety.

[0269] Suitably, the concentration and / or total content of at least one tobacco-specific nitrosamine or its precursor can be reduced by implementing the method and / or use of the present invention. Suitably, the concentration and / or level of at least one tobacco-specific nitrosamine or its precursor can be reduced in a tobacco plant of the present invention (e.g., obtainable (e.g., obtained) or obtained by the method and / or use of the present invention) when compared with the concentration and / or level of at least one tobacco-specific nitrosamine or its precursor in a tobacco plant not yet modified according to the present invention.

[0270] The concentration and / or total content of at least one tobacco-specific nitrosamine or its precursor may be reduced in tobacco leaves, harvested leaves, processed tobacco leaves, tobacco industry products, or a combination thereof obtainable from (e.g., obtained from) or obtained from a tobacco plant (or part of a tobacco plant or tobacco cell culture) of the present invention, when compared to tobacco leaves, harvested leaves, processed tobacco leaves, tobacco industry products, or a combination thereof obtainable from (e.g., obtained from) or obtained from a tobacco plant (or part of a tobacco plant or tobacco cell culture) that has not been modified according to the present invention.

[0271] Suitably, the concentration and / or total content of at least one tobacco-specific nitrosamine or a precursor thereof may be reduced in the processed tobacco leaves.

[0272] Suitably, the concentration and / or level of at least one tobacco-specific nitrosamine or a precursor thereof may be reduced in the tobacco industry product.

[0273] In one embodiment, at least one tobacco-specific nitrosamine or its precursor can be reduced by at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In some embodiments, at least one tobacco-specific nitrosamine or its precursor can be reduced by about 5% to about 95%, about 10% to about 90%, 20% to about 80%, 30% to about 70%, or about 40% to 60%.

[0274] With respect to processed (e.g., cured) tobacco leaves (e.g., cured or reconstituted), at least one tobacco-specific nitrosamine or its precursor can be reduced by about 5000 ng / g to about 50 ng / g, about 4000 ng / g to about 100 ng / g, about 3000 ng / g to 500 ng / g, or 2000 ng / g to 1000 ng / g. In some embodiments, at least one tobacco-specific nitrosamine or its precursor can be reduced by at least about 5000 ng / g, at least about 4000 ng / g, at least about 3000 ng / g, at least about 2000 ng / g, at least about 1000 ng / g, at least about 500 ng / g, at least about 100 ng / g, or at least about 50 ng / g.

[0275] Biomass production

[0276] In one aspect, the invention provides a method for producing biomass, comprising:

[0277] Cells that have been artificially engineered to modulate (eg, increase) expression of a gene encoding an Armadillo Repeat protein as defined herein are grown under conditions that produce biomass.

[0278] In another aspect, the invention provides a method for producing biomass, comprising:

[0279] Cells which have been artificially engineered to modify the nucleic acid sequence of a gene encoding an armadillo repeat protein as defined herein are grown under conditions to produce biomass.

[0280] In one embodiment, the invention provides a method of producing biomass having a modified (e.g., increased) nicotine concentration and / or total content, comprising growing cells that have been artificially engineered to:

[0281] Increase the expression of at least an armadillo repeat protein comprising the amino acid sequence as shown in SEQ ID No. 1, or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0282] Increase the expression of the following: the nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0283] In one embodiment, the invention provides a method of producing biomass having a modified (e.g., increased) nicotine concentration and / or total content, comprising growing cells that have been artificially engineered to modify:

[0284] A nucleic acid sequence encoding at least one gene of an armadillo repeat protein, the armadillo repeat protein comprising the amino acid sequence as shown in SEQ ID No. 1, or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0285] A nucleotide sequence as shown in SEQ ID No. 2 or 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 2 or 3, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0286] Suitably, the armadillo repeat protein comprises an armadillo repeat domain.

[0287] Suitably, the nucleic acid sequence may comprise a modification (eg a mutation or deletion) in the armadillo repeat domain.

[0288] The cell may be artificially modified by any method known in the art to increase the expression of at least one gene encoding an armadillo repeat protein. Suitably, the cell may be artificially modified to express an exogenous gene encoding an armadillo repeat protein. Suitably, the cell may be artificially modified to overexpress a gene encoding an armadillo repeat protein.

[0289] Suitably, the biomass may contain a higher concentration and / or total content of nicotine than biomass produced from comparable cells which have not been modified according to the invention.

[0290] Suitably, the cells for biomass production may be plant cells, such as tobacco cells.

[0291] Suitably, the cells for biomass production may be yeast cells.

[0292] In one embodiment, the cell (e.g., yeast cell) may be further modified to include one or more sequences that increase nicotine alkaloid biosynthesis. Suitably, these one or more sequences may be incorporated into a nucleic acid construct suitable for cell (e.g., yeast cell) transformation. One or more sequences may be overexpressed in a cell (e.g., yeast cell). The sequence may be selected from one or more of the following genes: MPO (or methylputrescine oxidase or MPO1 or MPO2); A622 (or isoflavone reductase-like protein or isoflavone reductase homolog (homolog) or isoflavone reductase-like protein); BBL (or berberine bridge enzyme or berberine bridge enzyme-like or BBE or NBB1); PMT (or putrescine N-methyltransferase or putrescine methyltransferase or S-adenosyl-L-methionine: putrescine N-methyltransferase or PMT or PMT1 or PMT2 or PMT3 or PMT4) and QPT (or quinolinate phosphoribosyltransferase). In one embodiment, the sequence may be selected from one or more of the following genes: BBL, A622, PMT, and MPO (MPO1 or MPO2). Genes suitable for modification in this manner may be taught, for example, in US2016032299, which is incorporated herein by reference.

[0293] Commercially desirable traits

[0294] In one embodiment, the plant of the invention has a modified (i.e., increased or decreased) total alkaloid content, and / or a modified (i.e., increased or decreased) content of one or more alkaloids selected from nicotine, nornicotine, anabasine, mithofamine and anatabine and / or decreased nicotine, while the flavor profile and / or other commercially desirable traits are at least maintained. In one embodiment, the plant of the invention produces leaves of similar grade and / or quality to plants that have not been modified according to the invention.

[0295] In one embodiment, a plant of the invention has a reduced nicotine content without a significant change in the flavor profile of the plant (eg, compared to the same plant that has not been modified according to the invention).

[0296] In one embodiment, the plants of the invention have a modified (i.e. increased or decreased) alkaloid and / or TSNA content (e.g., compared to the same plant that has not been modified according to the invention) without a significant change (e.g., decrease) in other commercially desirable traits of the plant. In particular, the yield of the modified plant is preferably not reduced compared to the same plant that has not been modified according to the invention.

[0297] Thus, in one embodiment, the methods and uses of the present invention relate to modifying (i.e. increasing or decreasing) the total alkaloid content, and / or modifying (i.e. increasing or decreasing) one or more alkaloids selected from nicotine, nornicotine, anabasine and anatabine, and / or modifying (i.e. increasing or decreasing) the nicotine content and / or TSNA content while maintaining the flavor profile and / or other commercially desirable traits (e.g. yield).

[0298] As used herein, the term "commercially desirable traits" will include traits such as yield, mature plant height, number of harvestable leaves, average node length, cutter leaf length, cutter leaf width, quality (e.g., leaf mass, appropriately modulated leaf mass), abiotic (e.g., drought) stress tolerance, herbicide tolerance, and / or biotic (e.g., insect, bacterial or fungal) stress tolerance.

[0299] For example, according to the United States Department of Agriculture (USDA) grades and standards, leaf quality can be measured based on the color, texture, and aroma of the cured leaves.

[0300] Tobacco grades are evaluated based on factors including, but not limited to, petiole position, leaf size, leaf color, leaf uniformity and integrity, maturity, texture, elasticity, gloss (related to the intensity and depth of color and brightness of the leaf), hygroscopicity (the ability of the tobacco leaf to absorb and retain moisture from the environment) and green nuance or cast.

[0301] Leaf grade can be determined using standard methods known in the art, for example, using the Official Standard Grades published by the Agricultural Marketing Service of the US Department of Agriculture (7 USC §511). See, e.g., the official standard grades for Burley Tobacco (U.S. Type 31 and Foreign Type 93), effective November 5, 1990 (55 FR 40645); the official standard grades for Flue-cured Tobacco (U.S. Types 11, 12, 13, 14 and Foreign Type 92), effective March 27, 1989 (54 FR 7925); the official standard grades for Pennsylvania Seedleaf Tobacco (U.S. Type 41), effective January 8, 1965 (29 FR 16854); the official standard grades for Ohio Cigar-Leaf Tobacco (U.S. Types 42, 43, and 44), effective December 8, 1963 (28 F.R. 11719 and 28 FR 7925). 11926); the official standard grades for Wisconsin Cigar-Binder Tobacco (U.S. 54 and 55), effective November 20, 1969 (34 FR 17061); the official standard grades for Wisconsin Cigar-Binder Tobacco (U.S. 54 and 55), effective November 20, 1969 (34 F.R. 17061); the official standard grades for Georgia and Florida ShadeGrown Cigar-Wrapper Tobacco (U.S. 62), effective April 1971. USDA grade index values ​​may be determined based on industry recognized grade indices. See, e.g., Bowman et al., Tobacco Science, 32:39-40 (1988); Legacy Tobacco Document Library (Bates Document #523267826-523267833, July 1, 1988, Memorandum on the Proposed Burley Tobacco Grade Index); and Miller et al., 1990, Tobacco Intern., 192:55-57 (all of the foregoing references are incorporated herein in their entirety).

[0302] In one aspect, the USDA grade index is a 0-100 numerical representation of the received federal grade and is a weighted average of all shank positions. A higher grade index indicates higher quality. In another aspect, the blade grade can be determined via hyper-spectral imaging. See, for example, WO 2011 / 027315 (which is incorporated herein by reference).

[0303] In one embodiment, the tobacco plants of the present invention provide commercially acceptable grades of tobacco.

[0304] Suitably, the tobacco plants of the present invention provide commercially acceptable grades of cured tobacco.

[0305] In one embodiment, when growing under similar growth conditions, tobacco plant of the present invention can produce the leaf of at least about 70% USDA grade index value with the USDA grade index value of comparable plant leaves.Suitably, when growing under similar growth conditions, tobacco plant disclosed herein may be able to produce the leaf of at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 98% USDA grade index value with the USDA grade index value of control plant. Suitably, the tobacco plants disclosed herein may be capable of producing leaves having a USDA Grade Index value of 65% to 130%, 70% to 130%, 75% to 130%, 80% to 130%, 85% to 130%, 90% to 130%, 95% to 130%, 100% to 130%, 105% to 130%, 110% to 130%, 115% to 130% or 120% to 130% of the USDA Grade Index value of a comparable plant.

[0306] In one aspect, the tobacco plants of the present invention are capable of producing leaves having a USDA Grade Index value of at least 50. Suitably, the tobacco plants disclosed herein may be capable of producing leaves having a USDA Grade Index value of 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, and 95 or more.

[0307] Unless otherwise indicated, tobacco yield as used herein refers to cured leaf yield, which is calculated based on cured tobacco leaf weight per acre under standard field conditions following standard agronomic and curing practices.

[0308] In one aspect, plants of the invention (e.g., tobacco plants) have a yield that is 50% to 150%, 55% to 145%, 60% to 140%, 65% to 135%, 70% to 130%, 75% to 125%, 80% to 120%, 85% to 115%, 90% to 110%, 95% to 105%, 50% to 100%, 55% to 100%, 60% to 100% of the yield of comparable plants when grown under similar field conditions. %, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 95% to 100%, 100% to 150%, 105% to 150%, 110% to 150%, 115% to 150%, 120% to 150%, 125% to 150%, 130% to 150%, 135% to 150%, 140% to 150% or 145% to 150%.

[0309] In another aspect, the yield of plants (e.g., tobacco plants) of the invention is about 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 times the yield of comparable plants when grown under similar field conditions.

[0310] In another aspect, the yield of tobacco plants of the present invention is comparable to the yield of comparable plants that are fire-tube cured when grown under similar field conditions.

[0311] In one aspect, the tobacco plant of the invention provides a yield selected from the group consisting of about 1200 to 3500, 1300 to 3400, 1400 to 3300, 1500 to 3200, 1600 to 3100, 1700 to 3000, 1800 to 2900, 1900 to 2800, 2000 to 2700, 2100 to 2600, 2200 to 2500, and 2300 to 2400 pounds per acre.

[0312] In another aspect, the tobacco plant of the present invention provides a yield selected from the group consisting of about 1200 to 3500, 1300 to 3500, 1400 to 3500, 1500 to 3500, 1600 to 3500, 1700 to 3500, 1800 to 3500, 1900 to 3500, 2000 to 3500, 2100 to 3500, 2200 to 3500, 2300 to 3500, 2400 to 3500, 2500 to 3500, 2600 to 3500, 2700 to 3500, 2800 to 3500, 2900 to 3500, 3000 to 3500, and 3100 to 3500 pounds per acre.

[0313] In a further aspect, the tobacco plant of the present invention provides a yield selected from the group consisting of about 1200 to 3500, 1200 to 3400, 1200 to 3300, 1200 to 3200, 1200 to 3100, 1200 to 3000, 1200 to 2900, 1200 to 2800, 1200 to 2700, 1200 to 2600, 1200 to 2500, 1200 to 2400, 1200 to 2300, 1200 to 2200, 1200 to 2100, 1200 to 2000, 1200 to 1900, 1200 to 1800, 1200 to 1700, 1200 to 1600, 1200 to 1500, and 1200 to 1400 pounds per acre.

[0314] Plant breeding

[0315] In one embodiment, the present invention provides a method for producing a plant having a modified alkaloid content and / or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content, comprising:

[0316] a. crossing a donor plant having a modified nicotine content and / or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content and wherein the expression of at least one gene encoding an armadillo repeat protein has been modulated in the donor plant according to the invention with a recipient tobacco plant that does not have a modified nicotine content or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content and has a commercially desirable trait;

[0317] b. isolating genetic material from offspring of the donor plant hybridized with the recipient plant; and

[0318] c. performing molecular marker-assisted selection using molecular markers, comprising:

[0319] i. Identifying an introgressed region comprising a mutation in a polynucleotide sequence encoding a protein defined in a.

[0320] In another embodiment, the present invention provides a method for producing a plant having a modified alkaloid content and / or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content, comprising:

[0321] ii. crossing a donor plant having a modified nicotine content and / or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content; wherein the nucleic acid sequence of at least one gene encoding an armadillo repeat protein has been modified in the donor plant according to the present invention, with a recipient tobacco plant that does not have a modified nicotine content or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content and has a commercially desirable trait;

[0322] iii. isolating genetic material from offspring of the donor plant hybridized with the recipient plant; and

[0323] iv. performing molecular marker-assisted selection using molecular markers, comprising:

[0324] v. Identifying an introgressed region comprising a mutation in a polynucleotide sequence encoding a protein defined in a.

[0325] vi.

[0326] When compared to comparable plants, expression of the Armadillo Repeat protein was modulated in donor plants:

[0327] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0328] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant or functional fragment or orthologue of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3. Suitably, the armadillo repeat protein comprises an armadillo repeat domain.

[0329] Molecular marker-assisted selection may comprise performing PCR to identify introgressed nucleic acid sequences comprising a mutation that modulates expression of a protein comprising the amino acid sequence shown in SEQ ID No. 1 or an amino acid sequence having at least 80% sequence identity thereto.

[0330] plant

[0331] Suitable plants according to the present invention include plants of the Solanaceae family, which includes, for example, Datura, Eggplant, Mandrake, Nightshade (Bellagio), Capsicum (Chili pepper, Capsicum annuum), Potato and Tobacco.

[0332] In one embodiment, a suitable genus of the Solanaceae family is Solanum, such as Lycopersicon esculentum ( Solanum lycopersicum ).

[0333] In one embodiment, a suitable genus of the Solanaceae family is Nicotiana ( Nicotiana ), such as Nicotiana tabacum or Nicotiana rustica ( Nicotiana rustica ).

[0334] A suitable species of the genus Nicotiana may be Nicotiana tabacum. Species of the genus Nicotiana may be referred to herein as tobacco plants, or simply tobacco.

[0335] Tobacco Plant

[0336] The invention provides methods, uses, and cells (eg, tobacco cells), plants (eg, tobacco plants), and plant propagation materials for plants (eg, tobacco plants).

[0337] As used herein, the term "tobacco plant" refers to plants in the genus Nicotiana used in the production of tobacco products. Non-limiting examples of suitable "tobacco" plants include Nicotiana tabacum and Nicotiana rustica (e.g., Nicotiana tabacum ( N. tabacum L. ), LAB21, LN KY171, Tl 1406, Basma, Galpao, Perique, Beinhart 1000-1 and Petico).

[0338] Tobacco material can be derived from or derived from the variant of tobacco type, commonly referred to as burley tobacco variant, flue or bright and dark variants. In some embodiments, tobacco material is derived from burley, Virginia or dark tobacco plants. Tobacco plants can be selected from burley tobacco, rare tobacco, specialty tobacco, expanded tobacco, etc.

[0339] The present invention also contemplates the use of tobacco cultivars and elite tobacco cultivars. Thus, the tobacco plants used herein can be tobacco varieties or elite tobacco cultivars. Particularly useful tobacco varieties include flue-cured Virginia type, burley type and Oriental type.

[0340] In some embodiments, the tobacco plant can be, for example, selected from one or more of the following varieties: L. cultivar TI 1068, AA 37-1, B 13P, Xanthi (Mitchell-Mor), KT D#3 Hybrid 107, Bel-W3, 79-615, Samsun Holmes NN, F4 from the cross BU21 x Hoja Parado, line 97, KTRDC#2 Hybrid 49, KTRDC#4 Hybrid 1 10, Burley 21, PM016, KTRDC#5 KY 160 SI, KTRDC#7 FCA, KTRDC#6 TN 86SI, PM021, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KY 10, KY 14, KY 160, KY 17, KY 8959, KY 9, KY 907, MD 609, McNair 373, NC 2000, PG 01, PG 04, P01, P02, P03, RG 11, RG 17, RG 8, Speight G-28, TN 86, TN 90, VA 509, AS44, Banket A1, Basma Drama B84 / 31, Basma I Zichna ZP4 / B, Basma Xanthi BX 2A, Batek, Besuki Jember, C104, Coker 319, Coker 347, Criollo Misionero, PM092, Delcrest, Djebel 81, DVH 405, Galpao Comum, HB04P, Hicks Broadleaf, Kabakulak Elassona、PM102、Kutsage E1 , KY 14 x L8, KY 171, LA BU 21, McNair 944, NC 2326, NC 71, NC 297, NC 3, PVH 03, PVH 09, PVH 19, PVH 21 10, Red Russian, Samsun, Saplak, Simmaba, Talgar 28. PM132, Wislica, Yayaldag, NC 4, TRMadole, Prilep HC-72, Prilep P23, Prilep PB 156 / 1, Prilep P12-2 / 1, Yaka JK-48, YakaJB 125 / 3, TI-1068, KDH-960, TI-1070, TW136, PM204, PM205, Basma, TKF4028, L8, TKF2002, TN 90, GR141, Basma xanthi, GR149, GR153 and Petit Havana.

[0341] Non-limiting examples of varieties or cultivars are: BD 64, CC 101, CC 200, CC 27, CC 301, CC400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CD 263, DF91 1, DT 538 LC, Galpao tobacco, GL 26H, GL 350, GL 600, GL 737, GL939, GL 973, HB 04P, HB 04P LC, HB3307PLC, Hybrid 403LC, Hybrid 404LC, Hybrid 501 LC, K 149, K326, K 346, K 358, K394, K 399, K 730, KDH 959, KT 200, KT204LC, KY10, KY14, KY 160, KY17, KY 171, KY 907, KY907LC, KTY14xL8 LC, Little Crittenden, McNair 373, McNair944, msKY 14xL8, Narrow Leaf Madole, Narrow Leaf Madole LC, NBH 98, N-126, N-777LC, N-7371 LC, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC 606, NC 71, NC 72, NC 810, NC BH 129. NC 2002, Neal Smith Madole, OXFORD 207, PD7302 LC, PD 7309 LC, PD 7312 LC 'Periq'e' Tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R610, R 630, R 7-1 1 , R 7-12, RG 17, RG 81, RG H51, RGH 4, RGH 51, RS 1410, Speight168, Speight 172, Speight 179, Speight 210, Speight 220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight G-70, Speight H-6, Speight H20, Speight NF3, Tl1406, Tl 1269, TN 86, TN86LC, TN 90, TN 97, TN97LC, TN D94, TND950, TR (Tom Rosson) Madole, VA 309, VA359, AA 37-1, B 13P, Xanthi (Mitchell-Mor), Bel-W3, 79-615, SamsunHolmes NN, KTRDC No. 2 Hybrid 49, Burley 21, KY 8959, KY 9, MD 609, PG 01, PG 04, P01, P02, P03, RG 1 1, RG 8, VA 509, AS44, Banket A1, Basma Drama B84 / 31, Basma I Zichna ZP4 / B, Basma Xanthi BX 2A, Batek, Besuki Jember, C104, Coker 347, Criollo Misionero, Delcrest, Djebel 81. DVH 405. Galpao Comum, HB04P, Hicks Broadleaf, KabakulakElassona, Kutsage E1, LA BU 21, NC 2326, NC 297, PVH 21 10, Red Russian, Samsun, Saplak, Simmaba, Talgar 28, Wislica, Yayaldag, Prilep HC-72, Prilep P23, Prilep PB156 / 1, Prilep P12-2 / 1, Yaka JK-48, Yaka JB 125 / 3, TI-1068, KDH-960, Tl-1070, TW136, Basma, TKF 4028, L8, TKF 2002, GR141, Basma xanthi, GR149, GR153, Petit Havana. Such low converter subvarieties are contemplated even though not specifically identified herein.

[0342] The tobacco plant may be Burley, Flue-cured Virginia, or Oriental.

[0343] In one embodiment, the plant propagation material may be obtainable (eg, obtained) from a plant of the invention (eg, a tobacco plant).

[0344] "Plant propagation material" as used herein refers to any plant matter taken from a plant from which further plants can be produced. Suitably, the plant propagation material may be selected from seeds, plant callus and plant pieces. Suitably, the plant propagation material may be seeds. Suitably, the plant propagation material may be plant callus. Suitably, the plant propagation material may be plant pieces.

[0345] In one embodiment, the cell (eg tobacco cell), tobacco plant and / or plant propagation material may be obtainable (eg obtained) (eg obtained) by a method according to the invention.

[0346] Suitably, a tobacco plant according to the present invention may have a modulated (e.g. reduced) nicotine content when compared to an unmodified tobacco plant, wherein the tobacco plant has been modified to modulate (e.g. increase) the expression of at least one Armadillo repeat protein, wherein the at least one Armadillo repeat protein:

[0347] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0348] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0349] Suitably, a tobacco plant according to the present invention may have a modulated (e.g. reduced) tobacco-specific nitrosamine (TSNA) or TSNA precursor content when compared to an unmodified tobacco plant, wherein the tobacco plant has been modified to modulate (e.g. increase) the expression of at least one Armadillo repeat protein, wherein the at least one Armadillo repeat protein:

[0350] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0351] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3.

[0352] In one embodiment, a tobacco plant according to the invention comprises a tobacco cell of the invention.

[0353] In another embodiment, the plant propagation material may be obtainable (eg, obtained) (eg, obtained) from a tobacco plant of the invention.

[0354] In one embodiment, there is provided use of a tobacco plant as described herein for breeding tobacco plants.

[0355] In another embodiment, the present invention also provides use of the tobacco plant of the preceding embodiment for producing tobacco industry products.

[0356] In another embodiment, there is provided use of the tobacco plants of the present invention to grow crops.

[0357] In one embodiment, there is provided use of a cell as provided in the preceding embodiments for producing a tobacco industry product.

[0358] In one embodiment, the invention provides cell cultures (eg, in vitro cultures).

[0359] Tobacco cell culture can be a cell suspension culture. These in vitro cultured cells can be incorporated into tobacco industry products, for example as a substitute for conventional tobacco particles, shredded tobacco (shreds), finely cut or long cut tobacco flakes, as an additive component, or both as a substitute and as an additive. Suitably, cell culture can produce nicotine.

[0360] In one embodiment, there is provided the use of a cell culture, such as a harvested and / or processed cell culture according to the invention, for producing a tobacco industry product.

[0361] Tobacco cells harvested from in vitro culture may be dried, such as freeze-dried, for example to produce a powder.

[0362] In one embodiment, cell culture is tobacco cell culture.Technician will know the known methods for establishing the in vitro culture of tobacco cell.Only for example, can use following method: collect the seed from interested tobacco plant, and sterilize its outside to eliminate undesirable organism, plant described seed with growth interested tobacco plant, from tobacco plant (for example, from tobacco stem) take out tissue for use as explant, establish callus culture from tobacco explant, establish cell suspension culture from callus culture, and gather in the crops culture material (for example comprising tobacco cell) to produce tobacco cell culture.

[0363] Tobacco cells can be harvested by various methods, including filtration, such as vacuum filtration. The sample can be washed in the filter by adding water, and the remaining liquid is removed by filtration, such as vacuum filtration.

[0364] The harvested tobacco cell culture may be further processed, such as dried, such as air-dried and / or freeze-dried.The harvested tobacco cell culture or the dried harvested tobacco cell culture or an extract thereof may be incorporated into a tobacco industry product according to the invention.

[0365] In one embodiment, the invention provides plants (e.g., tobacco plants) or parts thereof for use in molecular agriculture. Suitably, plants or parts thereof modified according to the invention can be used to make proteins, e.g., therapeutic agents, such as antibiotics, virus-like particles, nutritional medicines or small molecules.

[0366] In one embodiment, the present invention provides a method for producing a protein (e.g., a therapeutic protein); the method comprises modifying a plant or part thereof capable of producing the protein (e.g., a therapeutic protein) by regulating expression of an Armadillo Repeat protein, wherein:

[0367] a) comprising an amino acid sequence as shown in SEQ ID No. 1 or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 1; or

[0368] b) encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 2 or 3; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 2 or 3;

[0369] and cultivating the plant under conditions sufficient to allow production of the protein (eg, a therapeutic protein). Suitably, the armadillo repeat protein comprises an armadillo repeat domain.

[0370] product

[0371] The present invention also provides products obtainable (e.g. obtained) or obtained from a plant according to the present invention. Products obtainable (e.g. obtained) or obtained from a plant in which the expression of a gene encoding an armadillo repeat protein has been modulated are provided. Products obtainable (e.g. obtained) or obtained from a plant in which at least one nucleic acid sequence of an armadillo repeat protein has been modified are provided. Suitably, the nucleic acid sequence encoding an armadillo repeat domain has been modified.

[0372] In one embodiment, the product may comprise a construct of the invention that modulates the expression of at least one gene encoding an armadillo repeat protein as defined herein. In one embodiment, the product may comprise a construct of the invention that modifies the nucleic acid sequence of at least one gene encoding an armadillo repeat protein as defined herein.

[0373] The invention also provides products obtainable (eg obtained from) or obtained from tobacco according to the invention.

[0374] In one embodiment, there is provided use of a tobacco plant of the present invention for producing tobacco leaves.

[0375] Suitably, the tobacco leaves may be subjected to downstream applications, such as processing.

[0376] Therefore, in one embodiment, the use of the aforementioned embodiments can provide processed tobacco leaves. Suitably, the tobacco leaves can be subjected to modulation, fermentation, pasteurization or a combination thereof. In another embodiment, the tobacco leaves can be cut. In some embodiments, the tobacco leaves can be cut before or after being subjected to modulation, fermentation, pasteurization or a combination thereof.

[0377] In one embodiment, the invention provides harvested leaves of the tobacco plant of the invention.

[0378] In a further embodiment, the harvested leaves may be obtainable (eg, obtained) (eg, obtained) from a tobacco plant propagated from the propagation material of the invention.

[0379] In another embodiment, there is provided harvested leaves obtainable (eg obtained) from a method or use of the invention.

[0380] Suitably, the harvested leaves may be cut harvested leaves.

[0381] In some embodiments, the harvested leaves may contain living tobacco cells.In other embodiments, the harvested leaves may be subjected to further processing.

[0382] Processed tobacco leaves are also provided.

[0383] The processed tobacco leaf blade may be obtainable (eg obtained) from a tobacco plant of the invention. Suitably, the processed tobacco leaf blade may be obtainable (eg obtained) from a tobacco plant obtained according to any of the methods and / or uses of the invention.

[0384] In another embodiment, the processed tobacco leaf blade may be obtainable (eg, obtained) from a tobacco plant propagated from tobacco plant propagation material according to the invention.

[0385] The processed tobacco leaves of the present invention may be obtainable (eg, obtained) by processing the harvested leaves of the present invention.

[0386] As used herein, the term "processed tobacco leaf" refers to a tobacco leaf that has undergone one or more processing steps to which tobacco is subjected in the art."Processed tobacco leaf" contains no or substantially no living cells.

[0387] The term "living cell" refers to a cell that is capable of growth and / or metabolic activity. Thus, if a cell is said to be not alive, also known as "non-viable", the cell does not exhibit the characteristics of a living cell.

[0388] The term "substantially free of living cells" means that less than about 5% of all cells are alive. Preferably, less than about 3%, more preferably less than about 1%, even more preferably less than about 0.1% of all cells are alive.

[0389] In one embodiment, the processed tobacco leaves may be processed by one or more of: curing, fermenting, and / or pasteurizing.

[0390] Suitably, the processed tobacco leaves may be processed by curing.

[0391] The tobacco leaves may be cured by any method known in the art. In one embodiment, the tobacco leaves may be cured by one or more curing methods selected from the group consisting of air-curing, open flame curing, fire tube curing, and sun curing.

[0392] Suitably, the tobacco leaves may be air-cured.

[0393] Typically, air-curing is achieved by hanging the tobacco leaves in a well-ventilated curing barn and allowing them to dry. This is usually done over a period of four to eight weeks. Air-curing is particularly suitable for Burley tobacco.

[0394] Suitably, the tobacco leaves may be open fire cured. Open fire curing is generally achieved by hanging the tobacco leaves in large curing barns where a hardwood fire is kept smoldering low, either continuously or intermittently, and typically takes between three days and ten weeks, depending on the process and the tobacco.

[0395] In another embodiment, the tobacco leaves can be fire-tube cured. Fire-tube curing can include stringing the tobacco leaves onto tobacco rods and hanging them on tier-poles in a curing barn. The curing barn usually has a flame path that runs with an externally supplied firebox. Generally, this results in tobacco that has been heat-cured without being exposed to smoke. Typically, the temperature rises slowly during the curing process, and the entire process takes about 1 week.

[0396] Suitably, the tobacco leaves may be cured. This process generally involves exposing uncovered tobacco to the sun.

[0397] Suitably, the processed tobacco leaves may be processed by fermentation.

[0398] Fermentation can be carried out in any manner known in the art. Generally, during fermentation, tobacco leaves are piled into a tobacco pile (pile) covered with a modulation in a sack, for example, to retain moisture. The combination of the residual water inside the leaf and the tobacco weight generates the natural heat that makes tobacco mature. The temperature in the center of the pile is monitored every day. In some methods, the whole pile is opened every week. Then take out the leaf to shake and moisten, and the pile is rotated, so that the inner leaf is placed on the top of the pile outside and the bottom leaf. This ensures the uniform fermentation of the whole pile. The extra moisture on the leaf adds the actual rotation of the leaf itself to generate heat, thereby releasing the natural ammonia of tobacco and reducing nicotine, while also deepening the color and improving the aroma of tobacco. Generally, the fermentation process continues up to 6 months, which depends on the variety of tobacco, the handle position on the leaf, the thickness of the leaf and the intended use.

[0399] Suitably, the processed tobacco leaves may be processed by pasteurisation.Pasteurisation may be particularly preferred when the tobacco leaves are to be used in the preparation of smokeless tobacco industrial products, most preferably snus.

[0400] The pasteurization of tobacco leaves can be carried out by any method known in the art. For example, the pasteurization method can be as described in J Foulds, L Ramstrom, M Burke, K Fagerstrom. Effect of smokeless tobacco (snus) on smoking and public health in Sweden. Tobacco Control (2003) 12 : 349–359, the teachings of which are incorporated herein by reference.

[0401] During snus production, pasteurization is generally carried out by a process in which the tobacco is heat treated with steam for 24-36 hours, reaching a temperature of approximately 100° C. This results in a nearly sterile product, and without wishing to be bound by theory, one of the consequences of this is believed to be limiting further TSNA formation.

[0402] In one embodiment, the pasteurization process may be steam pasteurization.

[0403] In some embodiments, the processed tobacco leaves may be cut. The processed tobacco leaves may be cut before or after processing. Suitably, the processed tobacco leaves may be cut after processing.

[0404] In one embodiment, use of the foregoing embodiments can provide reconstituted tobacco.

[0405] In one embodiment, reconstituted tobacco is provided.

[0406] As used herein, "reconstituted" may also be referred to as reconstituted, recycled or homogenized sheet tobacco, and refers to tobacco material generated from tobacco leaf residues after processing. Reconstituted tobacco allows for the production of consistent, high quality blends, and allows for adjustment of the ratios of the various components.

[0407] Reconstituted tobacco can be nanofibre reconstituted (nanofibres can be extracted in solid or liquid form), paper reconstituted (which uses stems, scraps and midrib as raw materials), or slurry reconstituted (which uses a mixture of finely powdered material and tobacco stems that is ground into powder and mixed with water and a vegetable binder. The soluble residue is formed into sheets by extracting the water).

[0408] Any method known in the art can be used to prepare reconstituted tobacco, for example, see CORESTA Congress, Sapporo, 2012, Smoke Science / Product Technology Groups, SSPT 12 (incorporated herein by reference).

[0409] In some embodiments, the leaf of the results of tobacco plant, tobacco plant and / or processed tobacco leaf can be used to extract nicotine. The extraction of nicotine can be realized using any method known in the art. For example, the method for extracting nicotine from tobacco is taught in US 2,162,738, which is incorporated herein by reference.

[0410] In one aspect, the present invention provides a cured tobacco material made from a tobacco plant or part thereof according to the present invention.

[0411] In another aspect, the present invention provides a tobacco blend comprising a tobacco material made from a tobacco plant or part thereof according to the present invention, or a tobacco cell culture according to the present invention. In one aspect, the present invention provides a tobacco blend comprising a cured tobacco material according to the present invention.

[0412] Suitably, tobacco blends according to the present invention can include about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 10% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 20% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 30% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 40% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 50% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 60% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can comprise about 70% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can comprise about 80% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can comprise about 90% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention.

[0413] In one aspect, the tobacco blend products of the present invention comprise at least about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 95 percent by dry weight of tobacco cured from a tobacco plant or part thereof according to the present invention or a tobacco cell culture according to the present invention.

[0414] Suitably, the tobacco material after curing can be air-cured. Suitably, the tobacco material after curing can be fire-tube cured. Suitably, the tobacco material after curing can be sun-cured. Suitably, the tobacco material after curing can be open flame cured.

[0415] Tobacco industry products or smoking articles according to the invention may comprise a tobacco material according to the invention (eg, a cured tobacco material or a reconstituted tobacco material).

[0416] In another aspect, the invention provides tobacco industry products.

[0417] In one embodiment, the tobacco industry product according to the invention may be a blended tobacco industry product. Suitably, a tobacco blend may comprise a cured tobacco material according to the invention.

[0418] In one embodiment, tobacco industry products can be prepared from the tobacco plants or parts thereof of the present invention.

[0419] Suitably, tobacco plants or parts thereof may be propagated from tobacco plant propagation material according to the invention.

[0420] The term " part " used in the context of tobacco plant as this paper refers to a part of tobacco plant. Suitably, " part " can be a leaf, root or stem or flower of tobacco plant. Suitably, " part " can be a leaf, root or stem of tobacco plant.

[0421] Tobacco industry products

[0422] As used herein, the term "tobacco industry product" is intended to include combustible smoking articles, such as cigarettes, cigarillos, cigars, tobacco for pipes or hand-rolled cigarettes (whether based on tobacco, tobacco derivatives, expanded tobacco, reconstituted tobacco, tobacco substitutes or other smokeable materials), non-combustible gas aerosol delivery systems, such as heating products that release compounds from a matrix material without combustion, such as electronic cigarettes, tobacco heating products, and hybrid systems that generate aerosols from a combination of matrix materials, such as hybrid systems containing liquid or gel or solid matrices, and aerosolizable matrix materials used in these aerosol delivery systems; as well as non-aerosol delivery products, such as lozenges, chewing gum, patches, products containing inhalable powders, and smokeless tobacco industry products such as oral tobacco and snus, which may or may not deliver nicotine.

[0423] In one embodiment, a tobacco industry product can be prepared from (eg, can comprise) a tobacco plant or part thereof of the invention.

[0424] Suitably, tobacco plants or parts thereof may be propagated from tobacco plant propagation material according to the invention.

[0425] As used herein in the context of tobacco plants, the term "part thereof" refers to a part of the tobacco plant. Preferably, the "part thereof" is a leaf of the tobacco plant.

[0426] In another embodiment, tobacco industry products can be prepared from the harvested leaves of the present invention.

[0427] In further embodiments, tobacco industry products can be prepared from the processed tobacco leaves of the present invention.

[0428] Suitably, tobacco industry products may be prepared from tobacco leaves processed by one or more of: curing, fermenting and / or pasteurising.

[0429] Suitably, the tobacco industry product may comprise cut tobacco leaves, optionally processed in accordance with the preceding embodiments.

[0430] In another embodiment, tobacco industry products can be prepared from tobacco cell cultures according to the present invention.

[0431] In another embodiment, a tobacco industry product may be prepared from (eg may comprise) a cured tobacco material according to the invention.

[0432] In another embodiment, a tobacco industry product can be prepared from (eg, can include) a tobacco blend according to the invention.

[0433] In one embodiment, the tobacco industry product may be a smoking article.

[0434] As used herein, the term "smoking article" may include smokeable products such as cigarettes, cigarettes, cigars and cigarillos, whether based on tobacco, tobacco derivatives, expanded tobacco, reconstituted tobacco or tobacco substitutes.

[0435] In another embodiment, the tobacco industry product can be a smokeless tobacco industry product.

[0436] As used herein, the term "smokeless tobacco industry product" refers to a tobacco industry product that is not intended to be smoked and / or subjected to combustion.

[0437] Smokeless tobacco industry products (including heat-not-burn materials) can contain tobacco in any form (including dry particles, shredded tobacco, granules, powders, or slurries) deposited on, mixed in, surrounded by, or combined with other ingredients, the other ingredients taking any form such as sheets, films, tabs, foams, or beads.

[0438] In one embodiment, smokeless tobacco industry products can include snus, snuff, chewing tobacco, and the like.

[0439] In one embodiment, the tobacco industry product is a combustible smoking article selected from the group consisting of cigarettes, cigarillos, and cigars.

[0440] In one embodiment, the tobacco industry product comprises one or more components of a combustible smoking article, such as a filter, a filter rod, a filter rod segment, tobacco, a tobacco rod, a tobacco rod segment, a spill, an additive release component such as a capsule, a thread, a bead, a paper such as a plug wrap, a tipping paper or a cigarette paper.

[0441] In one embodiment, the tobacco industry product is a non-combustible gas aerosol delivery system.

[0442] In one embodiment, the tobacco industry product comprises one or more components of a non-combustible gas aerosol delivery system, such as a heater and an aerosolizable substrate.

[0443] In one embodiment, the aerosol supply system is an electronic cigarette, also known as a vaping device.

[0444] In one embodiment, the electronic cigarette includes a heater, a power source capable of powering the heater, an aerosolizable substrate such as a liquid or gel, a housing, and optionally a mouthpiece.

[0445] In one embodiment, the aerosolizable substrate is contained in a substrate container. In one embodiment, the substrate container is associated with or includes a heater.

[0446] In one embodiment, the tobacco industry product is a heating product that releases one or more compounds by heating rather than burning a matrix material. The matrix material is an aerosolizable material, which may be, for example, tobacco or other non-tobacco products, which may or may not contain nicotine. In one embodiment, the heating product is a tobacco heating product.

[0447] In one embodiment, the heating product is an electronic device.

[0448] In one embodiment, the tobacco heating product comprises a heater, a power source capable of powering the heater, and an aerosolizable substrate such as a solid or gel material.

[0449] In one embodiment, the heating product is a non-electronic article.

[0450] In one embodiment, the heating product includes an aerosolizable substrate, such as a solid or gel material, and a heat source capable of supplying thermal energy to the aerosolizable substrate without any electrical means, such as by burning a combustion material such as charcoal.

[0451] In one embodiment, the heated product further comprises a filter capable of filtering the aerosol generated by heating the aerosolizable substrate.

[0452] In some embodiments, the aerosolizable base material may comprise a vapor or aerosol generating agent or a humectant, such as glycerol, propylene glycol, triacetin, or diethylene glycol.

[0453] In one embodiment, the tobacco industry product is a hybrid system, generates aerosol with the combination of the non-combustion host material by heating.The host material can include, for example, solid, liquid or gel, which may or may not contain nicotine.In one embodiment, the hybrid system includes liquid or gel matrix and solid matrix.Solid matrix can be, for example, tobacco or other non-tobacco products, which may or may not contain nicotine.In one embodiment, the hybrid system includes liquid or gel matrix and tobacco.

[0454] In further embodiments, the tobacco industry product may be a tobacco heating device or a hybrid device or an electronic cigarette, and the like.

[0455] Typically in tobacco heating devices or hybrid devices, an aerosol is generated by transferring heat from a heat source to a physically separate aerosol-forming substrate or material, which may be located within, around or downstream of the heat source. During smoking, volatile compounds are released from the aerosol-forming substrate by heat transfer from the heat source and are entrained in the air drawn in through the smoking article. As the released compounds cool, they condense to form an aerosol that is inhaled by the user.

[0456] Aerosol generating articles and devices for consuming or smoking tobacco heating devices are known in the art. They may include, for example, electrically heated aerosol generating devices, wherein an aerosol is generated by transferring heat from one or more electrical heating elements of the aerosol generating device to an aerosol-forming substrate of the tobacco heating device.

[0457] Suitably, the tobacco heating device may be an aerosol generating device.

[0458] Preferably, the tobacco heating device may be a heat-not-burn device. Heat-not-burn devices are known in the art and release compounds by heating rather than burning tobacco.

[0459] Examples of suitable heat not burn devices may be those taught in WO2013 / 034459 or GB2515502, which are incorporated herein by reference.

[0460] In one embodiment, the aerosol-forming substrate of the tobacco heating device may be a tobacco industry product according to the present invention.

[0461] In one embodiment, the tobacco heating device may be a hybrid device.

[0462] Polynucleotide / polypeptide / construct

[0463] In certain embodiments of the invention, constructs regulating the expression of at least one armadillo repeat protein or nucleic acid sequence may be transformed into plant cells, suitably under the direction of a promoter.

[0464] In certain embodiments of the present invention, under the guidance of a promoter, a construct that reduces (i.e., inhibits) the expression of at least one armadillo repeat protein or modifies its nucleic acid sequence can be transformed into a plant cell. For example, the genetic construct can be a gene editing construct or can include an RNAi molecule, which can include a small interfering RNA (siRNA) molecule or a short hairpin (shRNA) molecule.

[0465] In certain embodiments of the invention, a construct that increases expression of an armadillo repeat protein, such as a construct encoding a gene encoding an armadillo repeat protein, such as an endogenous armadillo repeat protein, can be transformed into a plant cell, suitably under the direction of a promoter.

[0466] The construct can be introduced into the plant according to the present invention with the aid of a suitable vector, such as a plant transformation vector. The plant transformation vector may comprise an expression cassette comprising a promoter sequence, a construct sequence targeting a gene encoding an armadillo repeat protein, and optionally a 3' untranslated terminator sequence in the transcriptional direction 5'-3', including a termination signal for RNA polymerase and a polyadenylation signal for polyadenylase. The promoter sequence may be present in one or more copies, and such copies may be identical or variants of the promoter sequence described above. The terminator sequence may be obtained from plant, bacterial or viral genes. Suitable terminator sequences are, for example, pea E9 Terminator sequence, derived from Agrobacterium tumefaciens ( Agrobacterium tumefaciens )of Nopaline synthase Genetic nos terminator sequence, and from cauliflower mosaic virus 35S terminator Those skilled in the art will readily recognize other suitable terminator sequences.

[0467] The constructs of the present invention may also contain gene expression enhancing mechanisms to increase the strength of the promoter. Examples of such enhancer elements are derived from pea Plastocyanin The enhancer element is part of the promoter of the gene and is the subject of International Patent Application No. WO 97 / 20056, which is incorporated herein by reference. Suitable enhancer elements can be, for example, derived from Agrobacterium tumefaciens. Nopaline synthase Genetic nos Enhancer element, and from cauliflower mosaic virus 35S Enhancer elements.

[0468] These regulatory regions may be derived from the same gene as the promoter DNA sequence, or may be derived from tobacco or other organisms, such as from the Solanaceae family or from the subfamily Lycopodiellae ( Cestroideae All regulatory regions should be able to function in cells of the tissue to be transformed.

[0469] The promoter DNA sequence may be derived from the same gene as the gene of interest, e.g., the gene that the promoter is to direct, such as the gene encoding the armadillo repeat protein according to the invention, the coding sequence used in the invention, or may be derived from a different gene from tobacco or another organism, e.g., from the Solanaceae family or from the subfamily Lycopodiellae.

[0470] The expression cassette can be incorporated into a basic plant transformation vector, e.g. pBIN 19 Plus , pBI 101 , pKYLX71:35S2, pCAMBIA2300 or other suitable plant transformation vectors known in the art. In addition to the expression cassette, the plant transformation vector will contain such sequences as are necessary for the transformation process. These may include Agrobacterium ( Agrobacterium ) vir gene, one or more T-DNA border sequences, and a selectable marker or other means of identifying transgenic plant cells.

[0471] The term "expression vector or plant transformation vector" means a construct capable of expression in vivo or in vitro. Preferably, the expression vector is incorporated into the genome of the organism. In one embodiment, the vector of the invention expresses a protein, such as an armadillo repeat protein as described herein. The term "incorporated" preferably includes stable incorporation into the genome.

[0472] Techniques for transforming plants are well known in the art and include, for example, Agrobacterium-mediated transformation. The basic principle in the construction of genetically modified plants is to insert genetic information into the plant genome in order to obtain stable maintenance of the inserted genetic material. An overview of general techniques can be found in the literature by Potrykus ( Annu Rev Plant Physiol Plant Mol Biol

[1991] 42:205-225) and Christon (AgroFood-Industry Hi-Tech 1994 Mar / Apr 17-27), which references are incorporated herein by reference.

[0473] Generally, in Agrobacterium-mediated transformation, a binary vector carrying an exogenous DNA of interest, i.e., a construct according to the present invention, is transferred from an appropriate Agrobacterium strain to a target plant by co-cultivation of Agrobacterium with an explant from the target plant. The transformed plant tissue is then regenerated on a selective medium containing a selective marker and a plant growth hormone. An alternative method is the floral dip method (Clough & Bent, 1998 Plant J. 1998 December; 16 (6): 735-43, which is incorporated herein by reference), whereby the flower buds of a complete plant are contacted with a suspension of an Agrobacterium strain containing a chimeric gene, and after fruiting, the transformed individuals are germinated and identified by growth on a selective medium. Direct infection of plant tissue by Agrobacterium is a simple technique that has been widely used and described in Butcher DN et al. (1980), Tissue Culture Methods for Plant Pathologists , eds.: DS Ingrams and JP Helgeson, 203-208, which reference is incorporated herein by reference.

[0474] Further suitable transformation methods include direct gene transfer into protoplasts, for example using polyethylene glycol or electroporation techniques, particle bombardment, microinjection, and the use of silicon carbide fibers. The use of ballistic transformation, including silicon carbide whisker technology, to transform plants is taught in Frame BR, Drayton PR, Bagnaall SV, Lewnau CJ, Bullock WP, Wilson HM, Dunwell JM, Thompson JA & Wang K (1994), which references are incorporated herein by reference. Production of fertile transgenic maize plants by silicon carbide whisker-mediated transformation is described in The Plant Journal 6: 941-948, which is incorporated herein by reference), and viral transformation techniques are taught, for example, in Meyer P, Heidmmm I & Niedenhof I (1992), which is incorporated herein by reference. The use of cassava mosaic virus as a vector system for plants is described in Gene 110: 213-217, which is incorporated herein by reference. Further teachings on plant transformation can be found in EP-A-0449375, which is incorporated herein by reference.

[0475] In a further aspect, the present invention relates to a vector system which carries the construct and introduces it into the genome of an organism such as a plant, suitably a tobacco plant. The vector system may comprise one vector, but it may comprise two vectors. In the case of two vectors, the vector system is generally referred to as a binary vector system. The binary vector system is described in Gynheung Anetal, (1980), Binary Vectors, Plant Molecular Biology Manual A3, 1-19, which are incorporated herein by reference.

[0476] A widely adopted system for transforming plant cells uses the Ti plasmid from Agrobacterium tumefaciens or from Agrobacterium rhizogenes ( Agrobacterium rhizogenes ) of the Ri plasmid, which was described by An et al. (1986), Plant Physiol. 81, 301-305 and Butcher DN et al., (1980), Tissue Culture Methods for Plant Pathologists, Editors: DS Ingrams and JP Helgeson, 203-208, which are incorporated herein by reference. After each method of introduction of the desired foreign gene in the plant according to the invention, the presence and / or insertion of further DNA sequences may be necessary. The use of T-DNA for plant cell transformation has been well studied and is described in EP-A-120516; Hoekema, in: The Binary Plant Vector System Offset-drukkerij Kanters BB, Amsterdam, 1985, Chapter V; Fraley et al., Crit. Rev. Plant Sci., 4:1-46; and Anetal., EMBO J( 1985) 4:277-284, which is incorporated herein by reference.

[0477] Plant cells transformed with one or more constructs that modulate the expression of or modify the nucleic acid sequence of at least one gene encoding an armadillo repeat protein can be grown and maintained according to well-known tissue culture methods, for example, by culturing the cells in a suitable medium supplied with necessary growth factors such as amino acids, plant hormones, vitamins, etc.

[0478] The term "transgenic plant" in connection with the present invention includes any plant comprising a construct which modulates the expression of at least one gene encoding an armadillo repeat protein according to the present invention or modifies its nucleic acid sequence. Accordingly, a transgenic plant is a plant which has been transformed with a construct according to the present invention. Preferably, according to the present invention, the transgenic plant shows a modulated alkaloid content and / or a modulated TSNA content (or its precursors). The term "transgenic plant" does not include a native nucleotide coding sequence in its natural environment when under the control of its natural promoter (which is also in its natural environment).

[0479] In one aspect, the gene, construct, plant transformation vector or plant cell encoding the armadillo repeat protein according to the present invention is in an isolated form. The term "isolated" means that the sequence is at least substantially free of at least one other component with which the sequence is naturally associated in nature and as found in nature.

[0480] In one aspect, the gene, construct, plant transformation vector or plant cell encoding the armadillo repeat protein according to the present invention is in a purified form. The term "purified" means in a relatively pure state, such as at least about 90% pure, or at least about 95% pure, or at least about 98% pure.

[0481] As used herein, the term "nucleotide sequence" refers to an oligonucleotide sequence or a polynucleotide sequence, as well as variants, homologues, fragments and derivatives (e.g., portions thereof). The nucleotide sequence may be of genomic or synthetic or recombinant origin, it may be double-stranded or single-stranded, whether representing the sense strand or the antisense strand.

[0482] The term "nucleotide sequence" related to the present invention includes genomic DNA, cDNA, synthetic DNA and RNA. Preferably, it means a DNA encoding the present invention, more preferably a cDNA sequence.

[0483] In a preferred embodiment, when relevant to and when encompassed by the scope of the present invention itself, the nucleotide sequence, i.e., the gene encoding the armadillo repeat protein, comprises the native nucleotide sequence when in its natural environment and when it is linked to one or more of its naturally associated sequences that are also in its natural environment. For ease of reference, we shall refer to this preferred embodiment as the "native nucleotide sequence". In this regard, the term "native nucleotide sequence" means the entire nucleotide sequence, which is in its natural environment and when operably linked to the entire promoter with which it is naturally associated, the promoter is also in its natural environment.

[0484] The nucleotide sequence for use of the present invention can be present in a vector, wherein the nucleotide sequence is operably linked to a regulatory sequence that can ensure expression of the nucleotide sequence by a suitable host organism. The construct for use of the present invention can be transformed into a suitable host cell as described herein to ensure expression of the polypeptide of the present invention. The selection of a vector such as a plasmid, cosmid or phage vector will often depend on the host cell to be introduced therein. The vector can be used, for example, for the production of RNA in vitro, or for transfection, transformation, transduction or infection of a host cell.

[0485] In some applications, the nucleotide sequence for use in the present invention is operably linked to a regulatory sequence that is capable of ensuring expression of the nucleotide sequence, for example, by a selected host cell. For example, the present invention includes a vector comprising a nucleotide sequence of a gene encoding an armadillo repeat protein as described herein operably linked to such a regulatory sequence, i.e., the vector is an expression vector.

[0486] The term "operably linked" refers to a juxtaposition wherein the components are in a relationship permitting them to function in their intended manner. A regulatory sequence "operably linked" to a coding sequence is linked in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

[0487] The term "regulatory sequence" includes promoters and enhancers and other expression regulatory signals. The term "promoter" is used in the usual sense of the art, such as an RNA polymerase binding site. The nucleotide sequence within the construct encoding the gene encoding the armadillo repeat protein can be operably linked to at least one promoter.

[0488] The term "construct", which is synonymous with terms such as "cassette" or "vector", comprises a nucleotide sequence for use in accordance with the present invention attached directly or indirectly to a promoter.

[0489] An example of indirect attachment is between the promoter and the nucleotide sequence of the present invention, providing a suitable spacer group, such as an intron sequence, such as the Sh1-intron or the ADH intron. The same is true for the term "fused" related to the present invention, which includes direct or indirect attachment. In some cases, the term does not include the natural combination of nucleotide sequences encoding proteins that are usually combined with wild-type gene promoters and when they are all in their natural environment. The construct can even contain or express a marker that allows the selection of a genetic construct.

[0490] In some embodiments, the promoter can be operably linked to a nucleotide sequence in a construct or vector for regulating nicotine concentration and / or total content in a cell or cell culture or a tobacco plant or part thereof.

[0491] In some embodiments, the promoter can be selected from the group consisting of: a constitutive promoter, a tissue-specific promoter, a developmentally regulated promoter, and an inducible promoter.

[0492] In one embodiment, the promoter may be a constitutive promoter.

[0493] Constitutive promoters direct the expression of a gene continuously throughout various parts of the plant during plant development, although the gene may not be expressed at the same level in all cell types. Examples of known constitutive promoters include those associated with the cauliflower mosaic virus 35S transcript (Odell JT, Nagy F, Chua NH. (1985). Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature. 313 810-2), the rice actin 1 gene (Zhang W, McElroy D, Wu R. (1991). Analysis of rice Act1 5' region activity in transgenic rice plants. Plant Cell 3 1155-65) and the maize ubiquitin 1 gene (Cornejo MJ, Luth D, Blankenship KM, Anderson OD, Blechl AE. (1993). Activity of a maize ubiquitin promoter in transgenic rice. Plant Molec. Biol. 23 567-81). A constitutive promoter, for example, the carnation etched ring virus (CERV) promoter (Hull R, Sadler J, Longstaff M (1986) (CaMV / 35S), figwort mosaic virus 35S promoter. The sequence of carnation etched ring virus DNA: comparison with cauliflower mosaic virus and retroviruses. EMBO Journal, 5 (2): 3083-3090).

[0494] The constitutive promoter may be selected from: the Carnation Etch Ring Virus (CERV) promoter, the Cauliflower Mosaic Virus (CaMV35S promoter), the promoter from the rice actin 1 gene or the maize ubiquitin 1 gene.

[0495] The promoter may be a tissue-specific promoter. A tissue-specific promoter is a promoter that directs the expression of a gene in one (or several) parts of a plant, usually throughout the lifetime of those plant parts. The category of tissue-specific promoters also generally includes promoters whose specificity is not absolute, i.e., they may also direct expression at lower levels in tissues other than preferred tissues. Tissue-specific promoters include the phaseolin promoter, the legumin b4-promoter, the usp-promoter, the sbp-promoter, the ST-LS1 promoter, and the B33 (patatin class I promoter).

[0496] In another embodiment, the promoter can be a developmentally regulated promoter.

[0497] Developmentally regulated promoters direct changes in the expression of a gene in one or more parts of a plant at specific times during plant development. A gene may be expressed at different (usually lower) levels in said plant part at other times, and may also be expressed in other plant parts.

[0498] In one embodiment, the promoter may be an inducible promoter.

[0499] Inducible promoters can respond to the expression of inducer-directed genes. In the absence of inducer, the gene will not be expressed. Inducer can act directly on the promoter sequence, or can work by offsetting the effect of repressor molecules. Inducer can be a chemical reagent such as metabolites, proteins, growth regulators (such as auxin and salicylic acid that activate the OCS promoter) or toxic elements, physiological stress such as heat, light (such as soybean SSU promoter), damage (such as nos, nopaline synthase promoter), or osmotic pressure, or the indirect consequences of pathogen or pest action. The promoter of developmental regulation can be described as a specific type of inducible promoter, which responds to the endogenous inducer produced by the plant or the environmental stimulation at a specific moment in the life history of the plant. Examples of known inducible promoters include those associated with wound response as described, for example, by Warner SA, Scott R, Draper J. ((1993) Plant J. 3 191-201), temperature response as disclosed by Benfey & Chua (1989) (Benfey, PN, and Chua, NH. ((1989) Science 244 174-181), and chemical induction as described by Gatz ((1995) Methods in Cell Biol. 50 411-424).

[0500] Nucleotide sequences encoding proteins having the specific properties of a gene encoding an armadillo repeat protein as defined herein or proteins suitable for modification can be identified and / or isolated and / or purified from any cell or organism that produces the protein. Various methods for the identification and / or isolation and / or purification of nucleotide sequences are well known in the art. For example, once a suitable sequence has been identified and / or isolated and / or purified, PCR amplification techniques can be used to prepare more sequences.

[0501] In a further alternative, the nucleotide sequence encoding the armadillo repeat protein may be prepared synthetically by established standard methods, such as the phosphoramidite method described by Beucage SL et al., (1981) Tetrahedron Letters 22, pp. 1859-1869, or by the method described by Matthes et al., (1984) EMBO J. 3, pp. 801-805, which is incorporated herein by reference. In the phosphoramidite method, oligonucleotides are synthesized, for example, in an automatic DNA synthesizer, purified, annealed, ligated and cloned in an appropriate vector.

[0502] As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein". In some cases, the term "amino acid sequence" is synonymous with the term "peptide". In some cases, the term "amino acid sequence" is synonymous with the term "enzyme".

[0503] The present invention also includes the use of sequences that have a certain degree of sequence identity or sequence homology with one or more amino acid sequences of a polypeptide having the specific properties defined herein, or any nucleotide sequence, i.e., the armadillo repeat protein gene encoding such a polypeptide (hereinafter referred to as "one or more homologous sequences"). Here, the term "homolog" means an entity that has a certain homology with the subject amino acid sequence and the subject nucleotide sequence. Here, the term "homology" can be equivalent to "identity".

[0504] Homologous amino acid sequences and / or nucleotide sequences and / or fragments should provide and / or encode polypeptides that retain the functional activity of the armadillo repeat protein gene and / or enhance the activity of the armadillo repeat protein gene. Generally, homologous sequences will contain, for example, the same active sites as the subject amino acid sequence, etc., or will encode the same active sites. Although homology can also be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions), in the context of the present invention, it preferably means homology in terms of sequence identity. Homologous sequences generally retain functional domains or motifs. Suitably, homologs of the armadillo repeat protein may contain an armadillo repeat protein domain and an active site comprising a conserved lysine residue.

[0505] In one embodiment, homologous sequences are employed to include amino acid sequences or nucleotide sequences that have one, two or several additions, deletions and / or substitutions compared to the subject sequence.

[0506] Sequence identity

[0507] Sequence identity comparisons can be performed by eye, or more generally, by means of readily available sequence comparison programs. These commercially available computer programs can calculate the % homology between two or more sequences. % homology or % identity can be calculated on adjacent sequences, i.e., one sequence is compared with another sequence, and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called a "no gap" comparison. Typically, this no gap comparison is performed only on a relatively short number of residues.

[0508] Although this is a very simple and consistent method, it fails to take into account that, for example, in otherwise identical sequence pairs, an insertion or deletion will cause the amino acid residues in the back to be unable to be compared, thus potentially leading to a significant reduction in % homology when performing an overall comparison. Thus, most sequence comparison methods are designed to produce an optimal comparison that takes into account possible insertions and deletions without overly penalizing the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to attempt to maximize local homology.

[0509] However, these more sophisticated methods assign "gap penalties" to each gap that occurs in the alignment, so that for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting a higher relatedness between the two compared sequences - will receive a higher score than an alignment with many gaps. An "affine gap cost" is generally used, which imposes a relatively high cost for the presence of a gap, and a smaller penalty for each residue after the gap. This is the most commonly used gap scoring system. A high gap penalty will of course produce an optimized alignment with fewer gaps. Most alignment programs allow the gap penalty to be modified. However, when using such software for sequence comparison, it is preferably to use the default value.

[0510] Therefore, calculation of maximum % homology first requires producing an optimal alignment taking into account gap penalties. A suitable computer program for performing such an alignment is Vector NTI (Invitrogen Corp.). Examples of software that can perform sequence comparisons include, but are not limited to, for example, the BLAST package (see Ausubel et al. 1999 Short Protocols in Molecular Biology, 4th edition - Chapter 18), BLAST 2 (see FEMS Microbiol Lett 1999 174 (2): 247-50; FEMS Microbiol Lett 1999 177 (1): 187-8 and tatiana@ ncbi.nlm.nih.gov ), FASTA (Altschul et al. 1990 J. Mol. Biol. 403-410) and AlignX. At least BLAST, BLAST 2 and FASTA can be used for offline and online searching (see Ausubel et al. 1999, pp. 7-58 to 7-60).

[0511] Although final % homology can be measured according to identity, the comparison process itself is generally not based on all-or-no paired comparisons. On the contrary, a similarity score matrix with a change in ratio is usually used, which is based on chemical similarity or evolutionary distance to each paired comparison assignment score. An example of this matrix commonly used is the BLOSUM62 matrix-the default matrix of the BLAST program suite. The Vector NTI program usually uses a disclosed default value or a conventional symbol comparison table (if provided) (for further details, referring to the user manual). For some applications, the default values ​​of the Vector NTI program package are preferably used.

[0512] Alternatively, percent homology can be calculated using the multiple alignment feature in Vector NTI (Invitrogen Corp.) based on an algorithm similar to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73 (1), 237-244). Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software generally performs this as part of a sequence comparison and generates a numerical result.

[0513] If a gap penalty should be used when determining sequence identity, then preferably the following parameters are used for pairwise alignments:

[0514]

[0515]

[0516] In one embodiment, CLUSTAL can be used together with gap penalty and gap extension set as defined above.In some embodiments, the gap penalty for BLAST or CLUSTAL comparison can be different from those described in detail above.Technical staff will understand that the standard parameters for performing BLAST and CLUSTAL comparison may change regularly, and will be able to select appropriate parameters based on the standard parameters detailed for BLAST or CLUSTAL comparison algorithm at that time.

[0517] Suitably, the degree of identity with respect to a nucleotide sequence is determined over at least 50 contiguous nucleotides, preferably over at least 60 contiguous nucleotides, preferably over at least 70 contiguous nucleotides, preferably over at least 80 contiguous nucleotides, preferably over at least 90 contiguous nucleotides, preferably over at least 100 contiguous nucleotides, preferably over at least 150 contiguous nucleotides, preferably over at least 200 contiguous nucleotides, preferably over at least 250 contiguous nucleotides, preferably over at least 300 contiguous nucleotides, preferably over at least 350 contiguous nucleotides, preferably over at least 400 contiguous nucleotides, preferably over at least 450 contiguous nucleotides, preferably over at least 500 contiguous nucleotides, preferably over at least 550 contiguous nucleotides, preferably over at least 600 contiguous nucleotides, preferably over at least 650 contiguous nucleotides, or preferably over at least 700 contiguous nucleotides.

[0518] Suitably, the degree of identity with respect to nucleotide, cDNA, cds or amino acid sequences may be determined over the entire sequence.

[0519] The sequences may also have deletions, insertions or substitutions of amino acid residues which produce silent changes and result in functionally equivalent substances. Deliberate amino acid substitutions may be made based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residues, as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values ​​include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

[0520] Conservative substitutions can be made, for example, according to the following table. Amino acids in the same group in the second column, and preferably in the same row in the third column, can be substituted for each other:

[0521]

[0522] The present invention also includes homologous substitutions (substitution and replacement are both used herein to mean the exchange of an existing amino acid residue with an alternative residue), i.e. like-for-like substitutions, such as basic substitutions for basic, acidic substitutions for acidic, polar substitutions for polar, etc. Non-homologous substitutions may also occur, i.e. from one class of residues to another, or on the other hand involving the inclusion of unnatural amino acids, such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyridylalanine, thienylalanine, naphthylalanine and phenylglycine.

[0523] Substitution can also be made with unnatural amino acids, including; α* and α-disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids such as trifluorotyrosine*, p-Cl-phenylalanine*, p-Br-phenylalanine*, p-I-phenylalanine*, L-allyl-glycine*, β-alanine*, L-α-aminobutyric acid*, L-γ-aminobutyric acid*, L-α-aminoisobutyric acid*, L-ε-aminocaproic acid # , 7-aminoheptanoic acid*, L-methionine sulfone # *, L-norleucine*, L-norvaline*, p-nitro-L-phenylalanine*, L-hydroxyproline # , L-thioproline (thioproline)*, methyl derivatives of phenylalanine (Phe) such as 4-methyl-Phe*, pentamethyl-Phe*, L-Phe (4-amino) # , L-Tyr (methyl)*, L-Phe (4-isopropyl)*, L-Tic (1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid)*, L-diaminopropionic acid # and L-Phe(4-benzyl)*. The notation * has been used for the purposes discussed above (in relation to homologous or nonhomologous substitution) to indicate the hydrophobic character of the derivative, while # has been used to indicate the hydrophilic character of the derivative, with #* indicating amphiphilic character.

[0524] In addition to amino acid spacers such as glycine or β-alanine residues, the variant amino acid sequence may include suitable spacers that may be inserted between any two amino acid residues of the sequence, including alkyl groups such as methyl, ethyl or propyl. Further variations involve the presence of one or more amino acid residues in peptidomimetic form, which will be fully understood by those skilled in the art. For the avoidance of doubt, "peptidomimetic form" is used to refer to variant amino acid residues in which the α-carbon substituent is located on the nitrogen atom of the residue rather than the α-carbon. Methods for preparing peptides in peptidomimetic form are known in the art, for example Simon RJ et al., PNAS(1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol . (1995) 13(4), 132-134.

[0525] Nucleotide sequences for use in the present invention may include synthetic or modified nucleotides therein. Many different types of modifications to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and / or acridine or polylysine chain additions at the 3' and / or 5' ends of the molecule. For the present invention, it will be appreciated that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be performed to enhance the in vivo activity or lifespan of the nucleotide sequences of the present invention.

[0526] The present invention also includes sequences complementary to the nucleic acid sequences of the present invention, or sequences that can hybridize with the sequences of the present invention or with sequences complementary thereto. The term "hybridization" as used herein should include "a process by which a nucleic acid strand binds to a complementary strand via base pairing", as well as amplification processes such as those performed in polymerase chain reaction (PCR) technology.

[0527] The present invention also relates to nucleotide sequences that can hybridize with the nucleotide sequences of the present invention (including the complementary sequences of those presented herein). Preferably, hybridization is determined under stringent conditions (e.g., 50° C. and 0.2xSSC {1xSSC = 0.15 M NaCl, 0.015 M Na3 citric acid, pH 7.0}). More preferably, hybridization is determined under high stringency conditions (e.g., 65° C. and 0.1xSSC {1xSSC = 0.15 M NaCl, 0.015 M Na3 citric acid, pH 7.0}).

[0528] A review of general techniques for transforming plants can be found in the literature by Potrykus ( Annu Rev Plant Physiol Plant Mol Biol

[1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech 1994 March / April 17-27), which are incorporated herein by reference. Further teachings on plant transformation can be found in EP-A-0449375, which is incorporated herein by reference.

[0529] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994) and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide a general dictionary of many of the terms used in the present disclosure for those of skill in the art.

[0530] The present disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the embodiments of the present disclosure. Numerical ranges include the numerical values ​​of the limited ranges. Unless otherwise indicated, any nucleic acid sequence is written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino to carboxyl orientation, respectively.

[0531] The headings provided herein are not limitations of the various aspects or embodiments of the disclosure, which can be obtained by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0532] Amino acids are referred to herein using the name, three-letter abbreviation or single-letter abbreviation of the amino acid. As used herein, the term "protein" includes proteins, polypeptides and peptides. As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein". In some cases, the term "amino acid sequence" is synonymous with the term "peptide". In some cases, the term "amino acid sequence" is synonymous with the term "enzyme".

[0533] In the present disclosure and claims, conventional single-letter and three-letter codes for amino acid residues may be used. The 3-letter code for amino acids is as defined by the IUPACIUB Joint Commission on Biochemical Nomenclature (JCBN). It should also be understood that due to the degeneracy of the genetic code, a polypeptide may be encoded by more than one nucleotide sequence.

[0534] Other definitions of terms may appear throughout the specification. Before describing the exemplary embodiments in more detail, it should be understood that the present disclosure is not limited to the specific embodiments described, as these may of course vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, as the scope of the present disclosure will be limited only by the appended claims.

[0535] Where a range of values ​​is provided, it is understood that, unless the context clearly indicates otherwise, each intermediate value based on one-tenth of the unit of the lower limit between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any specified value or intermediate value in the specified range and any other specified value or intermediate value in the specified range is included in the present disclosure. Depending on any specifically excluded limits in the specified range, the upper and lower limits of these smaller ranges may be independently included in or excluded from the range, and each range in which any limit, no limit, or both limits are included in the smaller range is also included in the present disclosure. Where a specified range includes one or two limits, ranges excluding either or both of those included limits are also included in the present disclosure.

[0536] It must be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an enzyme" or "nitrate reductase" includes a plurality of such candidate agents and equivalents thereof known to those skilled in the art, and so forth.

[0537] advantage

[0538] It has surprisingly been found that the alkaloid content (e.g., nicotine and / or nornicotine and / or PON content) and / or TSNA content of a plant can be modulated (e.g., reduced) by modulating the expression of at least one armadillo repeat protein as taught herein, which acts as a positive regulator of nicotine in tobacco. Thus, tobacco products having modulated alkaloid (e.g., nicotine and / or nornicotine and / or PON content) and / or TSNA content and commercially desirable traits sought by consumers of tobacco products can be produced.

[0539] The present inventors have surprisingly identified methods for regulating (e.g. reducing) the alkaloid content (e.g. nicotine and / or nornicotine and / or PON content) and / or TSNA content of a plant (e.g. tobacco plant) by regulating (e.g. reducing) the expression of an armadillo repeat protein. The alkaloid (e.g. nicotine content) or TSNA content of a plant (e.g. tobacco plant) can be reduced by reducing or inhibiting the expression of a gene encoding an armadillo repeat protein. The alkaloid (e.g. nicotine content) or TSNA content of a plant (e.g. tobacco plant) can be increased by increasing the expression of a gene encoding an armadillo repeat protein. Prior to the present invention, it was not known that regulation of the expression of an armadillo repeat protein as described herein could be used to regulate the alkaloid (e.g. nicotine and / or nornicotine and / or PON content) and / or TSNA content of a plant (e.g. tobacco plant).

[0540] The present inventors have determined that inhibiting the expression of a gene encoding an armadillo repeat protein can reduce the alkaloid content (eg nicotine content) of the modified plants to surprisingly low levels.

[0541] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that such publication constitutes prior art for the claims appended hereto. Example

[0542] Example 1 - Transient overexpression of the armadillo repeat protein increases alkaloid content in leaves

[0543] Methods and Materials

[0544] clone

[0545] Armadillo repeat protein expression vector

[0546] The gene sequence (SEQ ID No. 3) was amplified from a Gateway™ compatible cDNA library using primers located outside of the restriction sites flanking the gene sequence. The gene sequence was then transferred to an expression vector.

[0547] The resulting plasmid was sequenced and transformed into Agrobacterium tumefaciens GV3101pMP90 by heat shock and transiently expressed in TN90 leaves.

[0548] Transient gene expression

[0549] Agrobacterium tumefaciens GV3101 strains carrying constructs of interest were grown overnight in Luria-Bertani (LB) medium supplemented with appropriate antibiotics. The culture was quickly spun down and resuspended to OD600 = 0.6 in a buffer containing 10 mM MgCl2, 10 mM MES pH 5.6 and 100 μM acetosyringone and incubated at room temperature for 1 hour. Infiltration into TN90 leaves was performed with a needleless syringe. Samples were obtained 5 days after infiltration.

[0550] The tests were performed with three biological replicates.

[0551] Alkaloid measurement

[0552] The relative contents of pyridine alkaloids were determined by reversed-phase high-performance liquid chromatography with tandem mass spectrometry (LC-MS / MS). Chromatographic separation was achieved using a Gemini-NX column (100 mm × 3.0 mm, 3 μm particle size, Phenomenex) and a gradient chromatographic separation using 6.5 mM ammonium acetate buffer (aq) (pH 10) and methanol.

[0553] The mass spectrometer was operated in electrospray (ESI) positive mode using scheduled MRM data acquisition. Two MRM transitions were monitored for each analyte and one for an isotopically labeled internal standard.

[0554]

[0555] Statistical analysis

[0556] Statistical significance based on one-way ANOVA analysis was performed using Prism 5.01 software (GraphPad Software).

[0557] result

[0558] The alkaloid content of 5-week-old TN90 leaves expressing the Nitab4.5_0002810g0020.2 construct is shown in Figure 1 Nicotine, nornicotine and PON content are expressed relative to the control and contain three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0559] Overexpression of Nitab4.5_0002810g0020.2 resulted in a significant increase in nicotine, nornicotine and PON contents in leaves.

[0560] in conclusion

[0561] Nitab4.5_0002810g0020.2 is a positive regulator of alkaloid content in leaves, particularly nicotine, nornicotine and PON content, and is a regulator of pyridine alkaloids in tobacco.

[0562] Example 2 - Virus-induced gene silencing (VIGS) of the armadillo repeat protein reduces alkaloid content in leaves quantity

[0563] Virus-induced gene silencing (VIGS)

[0564] For virus-induced gene silencing, a 300-nucleotide cDNA fragment was synthesized and cloned into pTV00 (between EcoRI and XhoI sites) using the following primers Nitab4.5_0002810g0020.2_InFusion 5'TGAGTAAGGTTACCGAATTC (SEQ ID No. 4); and Nitab4.5_0002810g0020.2_InFusion 3'CTCGAGGCCCGGGCATGTCC (SEQ ID No. 5) using the In-Fusion cloning kit to form TRV2- Nitab4.5_0002810g0020.2. The plasmid was then transformed into Agrobacterium tumefaciens GV3101.

[0565] TRV vectors containing both (TRV RNA1) and (TRV RNA2) containing the targeted nucleotide sequence were propagated separately in Agrobacterium tumefaciens. These cultures were mixed (1:1) and infiltrated into 2-week-old TN90 plants using a syringe. The silencing effect was evaluated five weeks after virus infection by evaluating the expression level of the target gene.

[0566] silence

[0567] VIGS assays were performed as previously described (Ratcliff et al., 2001) Ratcliff, F. et al., (2001), The Plant Journal, 25: 237-245 (incorporated herein by reference). Briefly, independent cultures of A. tumefaciens GV3101 carrying TRV2 and TRV1 plasmids were propagated overnight in LB medium supplemented with appropriate antibiotics. The cultures were resuspended in VIGS buffer (10 mM morpholineethanesulfonic acid pH 5.6, 10 mM MgCL2, and 100 µM acetosyringone) and the optical density was adjusted to OD 600= 1, and incubated overnight in the dark at room temperature. These cultures were mixed (1: 1) and infiltrated into 2-week-old TN90 plants with a syringe. The silencing effect of the virus infection was evaluated two weeks later by evaluating the expression level of the target gene. TRV-luciferase was used as a negative control, and TRV-PDS (reduced chlorophyll content of silent leaves) was used as a phenotypic silencing control.

[0568] result

[0569] Nicotine, nornicotine and PON contents of leaves of 5-week-old TN90 expressing a construct silencing Nitab4.5_0002810g0020.2 are shown in Figure 2 The content is expressed relative to the control and contains three biological replicates analyzed by t-test. The values ​​are shown as mean ± SEM. The asterisk indicates statistical significance of P value ≤ 0.001.

[0570] Silencing Nitab4.5_0002810g0020.2 resulted in a decrease in nicotine, nornicotine and PON content in leaves.

[0571] in conclusion

[0572] Nitab4.5_0002810g0020.2 is a positive regulator of alkaloid content in leaves, particularly nicotine, nornicotine and PON content, and is a regulator of pyridine alkaloids in tobacco.

[0573] Example 3 - Nitab4.5_0002810g0020.2-mediated regulation of alkaloid content requires the Arm domain

[0574] To determine whether the Arm domain is required for regulation of alkaloid content, a construct was prepared in which the Arm domain of Nitab4.5_0002810g0020.2 was deleted (Delta-Arm).

[0575] The method used to express the construct is as described in Example 1.

[0576] result

[0577] The alkaloid contents of leaves of 5-week-old TN90 expressing Nitab4.5_0002810g0020.2 and Nitab4.5_0002810g0020.2 Delta-Arm are shown in Figure 3 In. Alkaloid content is expressed relative to the control and contains three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0578] Leaves expressing the Nitab4.5_0002810g0020.2-DeltaArm construct contained less nicotine, nornicotine, and PON compared to leaves expressing the Nitab4.5_0002810g0020.2 construct.

[0579] in conclusion

[0580] Nitab4.5_0002810g0020.2-mediated regulation of alkaloid content requires the Arm domain.

[0581] Example 4 - Transient overexpression of Nitab4.5_0002810g0020.2 antisense results in nicotine, nornicotine and Significant reduction in PON

[0582] The alkaloid content of 5-week-old TN90 leaves expressing Nitab4.5_0002810g0020.2 and antisense to Nitab4.5_0002810g0020.2 is shown in Figure 4 In. Alkaloid content is expressed relative to the control and contains three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0583] Leaves containing the antisense of Nitab4.5_0002810g0020.2 contained less nicotine, nornicotine, and PON compared to leaves expressing the Nitab4.5_0002810g0020.2 construct.

[0584] in conclusion

[0585] Transient overexpression of Nitab4.5_0002810g0020.2 antisense resulted in significant reductions in nicotine, nornicotine, and PON.

[0586] Example 5 - Transient expression of an artificial miRNA targeting Nitab4.5_0002810g0020.2 results in nicotine, Significant reduction in nornicotine and PON

[0587] The alkaloid contents of 5-week-old TN90 leaves expressing Nitab4.5_0002810g0020.2 and artificial miRNA targeting Nitab4.5_0002810g0020.2 (SEQ ID No. 6) are shown in Figure 5 In. Alkaloid content is expressed relative to the control and contains three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0588] in conclusion

[0589] Transient expression of an artificial miRNA targeting Nitab4.5_0002810g0020.2 resulted in significant reductions in nicotine, nornicotine, and PON.

[0590] Example 6 - Stable T1 selected lines overexpressing Nitab4.5_0002810g0020.2 have increased bioavailability Alkali content

[0591] Nicotine, nornicotine and PON contents of greenhouse-grown TN90 plants overexpressing Nitab4.5_0002810g0020.2 at the 12-leaf stage are shown in Figure 6 middle.

[0592] Each point represents the mean of 24 measurements sampled from the bottom to the top of the leaf.

[0593] Figure 6 It was shown that stable T1 lines overexpressing the armadillo repeat protein had increased alkaloid content, particularly increased nicotine, nornicotine and PON content.

[0594] Example 7 - Adult plants silenced for Nitab4.5_0002810g0020.2 have reduced alkaloid content quantity

[0595] The alkaloid contents of greenhouse-grown TN90 plants silenced for Nitab4.5_0002810g0020.2 are shown in Figure 7 middle.

[0596] Alkaloid content is expressed relative to control and contains three measurements of 20 plants / genotype analyzed by one-way ANOVA and Tukey's multiple comparison post hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0597] Figure 7 It was shown that adult plants silenced for the armadillo repeat protein had reduced alkaloid content, particularly reduced nicotine, nornicotine and PON content. Sequence Listing <110> British American Tobacco (Investments) Limited <120> Methods and means for modifying the alkaloid content of plants <130> P115515PCT <150> GB1818715.3 <151> 2018-11-16 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 436 <212> PRT <213> Tobacco (Nicotiana tabacum) <400> 1 Met Pro Asn Thr Ser Thr Thr Ser Asn Trp Tyr Leu Thr Tyr Ile Lys 1 5 10 15 Leu Arg Phe Phe Thr Lys Val Arg Arg Phe Leu Gln Leu Lys Ala Ala 20 25 30 Ser Lys Lys Pro Leu Lys Pro Ser Asp Gln Pro Arg Glu Lys Ser Asp 35 40 45 Thr Leu Ile Val Ile Glu Glu Gly Glu Lys Gly Glu Lys Gly Ile Met 50 55 60 Gly Lys Glu Ser Asp Ile Lys Asp Asn Gly Trp Met Val Leu Gln Lys 65 70 75 80 Ser Val Lys Lys Leu His Phe Gly Ser Ser Glu Glu Lys Glu Val Ala 85 90 95 Ala Lys Glu Ile Lys Lys Leu Ala Lys Glu Asp Leu Lys Arg Arg Lys 100 105 110 Leu Met Ala Glu Leu Gly Val Ile Pro Pro Leu Val Ala Met Ile Gly 115 120 125 Gly Ser Glu Val Val Leu Arg Arg Gln Arg Leu Ala Val Gln Ala Leu 130 135 140 Val Glu Leu Ala Asn Gly Ser Phe Thr Asn Lys Ala Leu Met Val Glu 145 150 155 160 Ala Gly Ile Leu Ser Arg Leu Pro Gln Lys Pro Asp Asn Leu Asp Gly 165 170 175 Asn Thr Arg Gln Glu Phe Ala Glu Leu Ile Leu Ser Ile Ser Ser Leu 180 185 190 Ala Asn Thr Gln Phe Ser Met Asp Ser Ser Arg Ile Ile Pro Phe Val 195 200 205 Val Ser Ile Leu Asp Ser Ser Asn Ser Ser Val Glu Thr Lys Ser Thr 210 215 220 Cys Leu Gly Thr Leu Tyr Asn Leu Ser Ser Val Leu Glu Asn Ala Ala 225 230 235 240 Ile Leu Ala Thr Asn Gly Thr Met Thr Thr Leu Phe Arg Leu Ser Ser 245 250 255 Leu Lys Glu Val Ser Glu Lys Ala Leu Ala Thr Leu Gly Asn Leu Val 260 265 270 Val Thr Leu Met Gly Lys Lys Ala Met Glu Glu Asn Pro Met Val Pro 275 280 285 Glu Ser Leu Ile Glu Ile Met Thr Trp Glu Glu Lys Pro Lys Cys Gln 290 295 300 Glu Leu Ser Val Tyr Ile Leu Met Ile Leu Ala His Gln Ser Ser Ile 305 310 315 320 Gln Arg Glu Lys Met Ala Lys Ala Gly Ile Val Pro Val Leu Leu Glu 325 330 335 Val Ala Leu Leu Ser Ser Pro Leu Ala Gln Lys Arg Ala Leu Lys Leu 340 345 350 Leu Gln Trp Phe Lys Asp Glu Arg Gln Ser Lys Met Gly Pro His Ser 355 360 365 Gly Pro Gln Ala Gly Arg Ile Ala Ile Asp Ser Pro Pro Val Ser Pro 370 375 380 Arg Ala Val Asp Glu Ser Lys Lys Leu Met Lys Lys Ile Val Lys Gln 385 390 395 400 Ser Leu His Lys Asn Met Glu Thr Ile Thr Ser Arg Ala Asn Gly Gly 405 410 415 Ser Asp Cys Ser Arg Leu Lys Ser Leu Val Val Ser Ser Ser Ser Lys 420 425 430 Ser Leu Pro Tyr 435 <210> 2 <211> 4253 <212> DNA <213> Nicotiana tabacum <400> 2 ccgatgtaac tgacatatcg tgaatctgca tgtgctttct gctcttcttg ttttgttgcc 60 ctcaaagtct tcttctctct ttgtctgctt cttttccaac taattctttc tttcaccaaa 120 agtcagatat aaacacactt aatttaaaac cttttagaat ttcaattaaa ccacccctac 180 ccctacccct acccccacca cggcccctac aaaaccgttc ttcttcatat atgtcctctt 240 cacgagtagt atatatcgaa acatgcctaa tacttcaaca actagtaatt ggtatttgac 300 ctacataaag cttaggtttt tcacaaaagt ccgtcggttc cttcagctca aggcagcatc 360 taaaaagcca ttgaaaccgt ctgatcagcc gagagaaaaa tcagatatactt tgatcgtgat 420 tgaagaaggt gaaaagggag aaaagggtat aatgggaaaa gagagtgata ttaaagataa 480 tggatggatg gttttgcaaa aatctgtgaa gaaacttcac tttgggagtt cggaagaaaa 540 agaggtggca gccaaagaga taaaaaagtt ggctaaagaa gacttaaaga ggaggaaact 600 gatggcggag ctgggcgtaa ttccgccgct tgtggccatg attggtggtt ctgaggtggt 660 gctgcggcgg cagagattgg ctgttcaagc attagttgag cttgccaatg gctctttcac 720 gtaagttcat ttacttataa ttttataaat cataaatatt aatcactcgt ttaagtaaaa 780 tccttttta ttttatttta tcaattaatc cactttcttc ttcatgcttg gttttctcct 840 cggctaatag ttacgatcaa gtttaagtgc taagtttgac gctccactaa tatatgtgtt 900 tatcgtaaaa acgataagaa caagaatcat gaatttataa caatttgtaa ttttataata 960 atgtgagatt ttttcatcac attaagtaag aaatttgtaa aggtgaagtt caaattttat 1020 cccatattcg tgaactggag aactgatttt aaaattttaat taaatcgcat tatccatttt 1080 ggaaaagcaa atggcatgtt aattttctgt ttcgtgattt ctttcagtaa agaacatcta 1140 ttattgccaa aatagaagaa tgaatttata gtttttatta atatcctata aacgttagat 1200 gtcaaggtga ttggcttaat ggtttaaaaa ctgaagtgat aatcttgcat attaaggtta 1260 gaaactaata aaggtacta aaggtgaatt atatttggta atctagtcaa gatgcatgca 1320 aaaaactcga caattaccgt cctagaaaaa tttagctaac atgtagaata taatatgatt 1380 ttttattgag ctgagatttt gatagtgatc ttatttaat agcaatataa tacaaggggt 1440 tccgtagtac aaatttcatc ctattaagct agtgggtttt agtgcggtgg tatgacgtgg 1500 cgactgatta ttagatgtgt aactaactac ataaagggaa atgtacgaat acgtggagcc 1560 cactgaccac tttcagtggc caatatttga ctttaacaca ctgtatggca cgtgaggtct 1620 ggttagaga ataatacccc gtctcttggc tcttaaagtg cccaagaagt tcatgacttt 1680 gtacctccca tcatagatag ccataaaaat aaaatatccc tagtgatttt tatcccaata 1740 aaattcaaat atgttccaat tacatctttg ttttcgagg atgtgtatga ccaaaataaa 1800 aaatattact ctctatttca atttagatga tgtagtttga ctcgacacgg agtttaagag 1860 aaaataggac ttttaaaact tgtggtctta aaaacttaaa gagtaaaagc tttgtaggct 1920 aatgtcattt gtgtggctat aaaaacttct cattaatgat aaaagaatta aaatgaagag 1980 tttaaagtta aattatttcc aaacttaaaa atgcgtcatc tattttggaa caaactaaaa 2040 agaaaagtac ttcgtcaccc tgaattctat actatttaaa cgtccaattt tataacgga 2100 ataaaaaact gcagctatgc aaaaagaaaa actctaatat tctattgcat ctactagtttt 2160 attctttaat ttcctcgtac ttttctcttt gtactttttg gttaagcgat tggtaagaac 2220 ttttttacat agacttttgt tgtggtctgt ttttaaccat atgatatttc gaaaatagtc 2280 ttaaatctct tcttcatttg aaagccttta aataatgact aagaaagcaa gtagcaaatg 2340 gatttatca acttgacttt cttgccatag cattttcgaa gccttaaaat ggcaaatata 2400 ggttagttga gtcaacttga ccttctagcc cataacattt tatccgaaaa ggacttaggc 2460 cttttctaa gcctcgattg gtcctacaat acaagtatgt ggtatgacca cattgttttg 2520 gtaattatga agagggttga atcgactcta tgatgatagc gtacagcttt cacctgatct 2580 tttaacattt cagtttcgat aaatatctt tgaaggacaa aataattgat acgtttcacc 2640 caatctttta ttttagtcct atttttatct atgtatttgg attaatttca tgaaaaaaga 2700 cgtcattttt ctcttatgag agtaaaaaaa atataatgat atagaattta ttgttattgt 2760 agttaaaatt gttgccataa aatgcgttca ctgtctagta caaccatggt ggaataacta 2820 gcgggttgtt cattttacat gttattctta cttgtcttta ttaatattg tggccgaagt 2880 gatcaaagtg gagtggttca cgtattaatt atatgaaaac aattaagaaa tatggtaaaa 2940 tcgactttgt tgaccttcag ttcttgcact gatctggttt gcagaatctt attgacttct 3000 cactgtcaat aatgttttta atttctattg ttatttattt ggggacccct acttgattgg 3060 gcaatccccc aacttcctac ccatttttct atatcatttt ccaagttgct gaccaataaa 3120 tataactaat gaaagtcata aaattgggtc cctaatgctt ggttattcta atattcttt 3180 tggccatatc attggagtaa ttcatttgtt taacattgtt cttttttctt ggttcccatt 3240 ttcaggaaca aggctctgat ggtagaagca ggaatcttat caagattacc ccaaaaacca 3300 gacaatttag atggaaacac aaggcaagaa tttgcagaat tgatcttgtc tatatcatcc 3360 ctagccaaca cccaattcag tatggattcc tcaagaatta ttccatttgt agtcagcatt 3420 cttgattcat ccaactcaag tgttgaaaca aaaagtacat gtctaggaac attgtacaat 3480 ttatcctcag tgctggaaaa tgctgccatt ttggcaacta atggaacaat gactactctc 3540 tttagattgt cttcattgaa ggaagtatca gagaaagcat tagccacatt gggaaatcta 3600 gtagttacct taatggggaa gaaggcaatg gaagaaaatc ctatggtgcc cgagagctta 3660 atcgaaataa tgacatggga agagaagcca aaatgtcaag aattatcggt ctatattttg 3720 atgattttgg ctcaccagag ttctattcaa agggagaaaa tggctaaggc tggtattgtt 3780 ccagttctac ttgaagtggc attgttgagt agtcctttgg ctcaaaaaag agcattgaaa 3840 ttattacaat ggtttaagga tgaaaggcag agcaaaatgg gacctcactc tgggccacaa 3900 gcaggaagga tagcaattga ttcaccacca gtgagtccaa gagccgttga tgaaagcaag 3960 aaactgatga agaaaattgt gaaacaaagc cttcataaaa atatggaaac aattactagt 4020 agagccaatg gtggtagtga ttgttcaagg cttaagtccc tagttgttag ctcaagttct 4080 aagagtttgc cttactaaga atgatctttt aagcatttta ttaagtctca ccttgcacta 4140 cttgtgcaat gttctgcaag aatttttgta tcatatgaaa atatttgtcc ttcaaacaaa 4200 aaaggagtga tcttaaccaa ataacaataa tctattgatt cgttccattt gtg 4253 <210> 3 <211> 1311 <212> DNA <213> Tobacco (Nicotiana tabacum) <400> 3 atgcctaata cttcaacaac tagtaattgg tatttgacct acataaagct taggtttttc 60 acaaaagtcc gtcggttcct tcagctcaag gcagcatcta aaaagccatt gaaaccgtct 120 gatcagccga gagaaaatc agatactttg atcgtgattg aagaaggtga aaagggagaa 180 aagggtataa tgggaaaaga gagtgatatt aaagataatg gatggatggt tttgcaaaaa 240 tctgtgaaga aacttcactt tgggagttcg gaaaaaag aggtggcagc caaagagata 300 aaaaaagttgg ctaaaaga cttaaagagg aggaaactga tggcggagct gggcgtaatt 360 ccgccgcttg tggccatgat tggtggttct gaggtggtgc tgcggcggca gagattggct 420 gttcaagcat tagttgagct tgccaatggc tctttcacga aaaggctct gatggtagaa 480 gcaggaatct tatcaagatt accccaaaaa ccagacaatt tagatggaaa cacaaggcaa 540 gaatttgcag aattgatctt gtctatatca tccctagcca acacccaatt foottggat 600 tcctcaagaa ttatccatt tgtagtcagc attcttgatt catccaactc aagtgttgaa 660 aaaaaagta catgtctagg aacattgtac aatttatcct cagtgctgga aaatgctgcc 720 attttggcaa ctaatggaac aatgactact ctctttagat tgtcttcatt gaaggaagta 780 tcagagaaag cattagccac attgggaaat ctagtagtta ccttaatggg gaagaaggca 840 atggaagaaa atcctatggt gcccgagagc ttaatcgaaa taatgacatg ggaagagaag 900 ccaaaatgtc aagaattatc ggtctatatt ttgatgattt tggctcacca gagttctatt 960 caaagggaga aaatggctaa ggctggtatt gttccagttc tacttgaagt ggcattgttg 1020 agtagtcctt tggctcaaaa aagagcattg aaattattac aatggtttaa ggatgaaagg 1080 cagagcaaaa tgggacctca ctctgggcca caagcaggaa ggatagcaat tgattcacca 1140 ccagtgagtc caagagccgt tgatgaaagc aagaaactga tgaagaaaat tgtgaaacaa 1200 agccttcata aaaatatgga aacaattact agtagagcca atggtggtag tgattgttca 1260 aggcttaagt ccctagttgt tagctcaagt tctaagagtt tgccttacta a 1311 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 4 tgagtaaggt taccgaattc 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 5 ctcgaggccc gggcatgtcc 20 <210> 6 <211> 410 <212> DNA <213> Artificial sequence <220> <223> amiRNA sequences <400> 6 acaaacacac gctcggacgc atattacaca tgttcataca cttaatactc gctgttttga 60 attgatgttt taggaatata tatgtagata cgcccagctc cgccatcact tcacaggtcg 120 tgatatgatt caattagctt ccgactcatt catccaaata ccgagtcgcc aaaattcaaa 180 ctagactcgt taaatgaatg aatgatgcgg tagacaaatt ggatcattga ttctctttga 240 tgatggcggc gctgggcgta cactctctct tttgtattcc aattttcttg attaatcttt 300 cctgcacaaa aacatgcttg atccactaag tgacatatat gctgccttcg tatatatagt 360 tctggtaaaa ttaacatttt gggtttatct ttatttaagg catcgccatg 410

Claims

1. A method for regulating the nicotine, nornicotine and / or pseudo-oxidized nicotine content of a tobacco plant or part thereof, or a tobacco cell culture, the method comprising modifying the tobacco plant or tobacco cell culture by: regulating the expression of an Armadillo repeat protein, the Armadillo repeat protein: a) consisting of the amino acid sequence shown in SEQ ID No.1; or b) is encoded by the nucleotide sequence shown in SEQ ID No. 2 or 3.

2. Use of a gene encoding an armadillo repeat protein for regulating the nicotine, nornicotine and / or pseudo-oxidized nicotine content of a tobacco plant or part thereof, or a tobacco cell or cell culture; wherein the armadillo repeat protein: a) consisting of the amino acid sequence shown in SEQ ID No.1; or b) is encoded by the nucleotide sequence shown in SEQ ID No. 2 or 3.

3. A method for producing a tobacco plant or part thereof, or a tobacco cell culture, having a modulated nicotine, nornicotine and / or pseudo-oxidized nicotine content, the method comprising modifying the plant or cell culture to modulate the expression of an Armadillo repeat protein, the Armadillo repeat protein: a) consisting of the amino acid sequence shown in SEQ ID No.1; or b) is encoded by the nucleotide sequence shown in SEQ ID No. 2 or 3.

4. The method of claim 3, comprising the step of obtaining plant propagation material from said tobacco plant or part thereof, or tobacco cell culture.

5. The method of claim 3, wherein the tobacco plant part is a leaf.

6. The method of claim 3, comprising the step of harvesting leaves from said tobacco plant.

7. A method according to claim 5 or 6, comprising the step of machining the blade.

8. The method of claim 7, comprising the step of cutting the leaves.

9. The method according to any one of claims 1 or 3 to 6, wherein regulating the expression of the armadillo repeat protein comprises modifying the nucleic acid sequence of the gene encoding the armadillo repeat protein in the armadillo repeat domain.

10. The method according to any one of claims 1 or 3 to 6, wherein the nicotine, nornicotine and / or pseudo-oxidized nicotine content is modulated compared to a tobacco plant or tobacco cell culture that has not been modified to modulate the expression of an armadillo repeat protein or to modify the nucleic acid sequence of a gene encoding an armadillo repeat protein.

11. The method according to any one of claims 1 or 3 to 6, wherein the nicotine, nornicotine and / or pseudo-oxidized nicotine content of the tobacco plant is reduced compared to a tobacco plant or tobacco cell culture that has not been modified to modulate the expression of the armadillo repeat protein, or to modify the nucleic acid sequence of the gene encoding the armadillo repeat protein.

12. The method according to claim 11, wherein the expression of the armadillo repeat protein is reduced compared to a tobacco plant or tobacco cell culture that has not been modified to modulate the expression of a gene encoding the armadillo repeat protein or to modify the nucleic acid sequence of a gene encoding the armadillo repeat protein.

13. A method according to any one of claims 1 or 3 to 6, wherein the nicotine content is adjusted.

14. A method according to claim 13, wherein the nicotine content is reduced.

15. The use of tobacco plants or parts thereof, or tobacco cell cultures, for growing plants or producing products, The tobacco plant or part thereof, or tobacco cell culture has been modified to achieve modulation of nicotine, nornicotine and / or pseudo-oxidized nicotine content compared to an unmodified tobacco plant or part thereof, or unmodified tobacco cell culture, wherein the modification is modulation of expression of an Armadillo repeat protein, wherein the Armadillo repeat protein: a) consisting of the amino acid sequence shown in SEQ ID No.1; or b) is encoded by the nucleotide sequence shown in SEQ ID No. 2 or 3.

16. The use according to claim 15, wherein the use is for growing crops or producing leaves.

17. The use according to claim 15, wherein the product is a tobacco industry product.

18. Use of a tobacco plant produced by the method of any one of claims 1 or 3 for growing tobacco plants or producing products.

19. The use according to claim 18, wherein the use is the cultivation of tobacco crops or the production of tobacco leaves.

20. The use according to claim 18, wherein the product is a tobacco industry product.

21. Non-viable processed tobacco leaves, which: (a) obtained from a tobacco plant obtained from the use according to claim 2; or (b) obtained by processing a plant which has been modified to achieve modulation of the nicotine, nornicotine and / or pseudo-oxidized nicotine content compared to an unmodified tobacco plant or part thereof, wherein the modification is modulation of the expression of an Armadillo Repeat protein, said Armadillo Repeat protein: i) consists of the amino acid sequence shown in SEQ ID No.1; or ii) encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or (c) obtained from a tobacco plant propagated from plant propagation material obtained from: (i) a tobacco plant as defined in (b); or (ii) a tobacco plant or tobacco cell culture produced by the method of any one of claims 1 or 3; or (d) obtained by processing harvested leaves of: (i) a tobacco plant as defined in (b) or (c); (ii) a tobacco plant obtained by the use of claim 2; or (iii) a tobacco plant produced by the method of any one of claims 1 or 3; or (e) obtained from a tobacco plant produced by the method of any one of claims 1 or 3.

22. The non-viable processed tobacco leaf according to claim 21, wherein the tobacco leaf is processed by curing, fermenting, pasteurizing or a combination thereof.

23. The non-viable processed tobacco leaf blade according to claim 21, wherein the processed tobacco leaf blade is a cut processed tobacco leaf blade.

24. A cured tobacco material or extract thereof made from a tobacco plant or part thereof which has been modified to achieve a modulated nicotine, nornicotine and / or pseudo-oxidized nicotine content compared to an unmodified tobacco plant or part thereof, wherein the modification is the modulation of expression of an Armadillo repeat protein, wherein the Armadillo repeat protein: a) consisting of the amino acid sequence shown in SEQ ID No.1; or b) is encoded by the nucleotide sequence shown in SEQ ID No. 2 or 3.

25. A cured tobacco material or extract thereof according to claim 24, wherein the nicotine content is adjusted.

26. A cured tobacco material or extract thereof according to claim 24, wherein the nicotine content is reduced.

27. A tobacco blend comprising the cured tobacco material of any one of claims 24 to 26.

28. A tobacco industry product prepared by: (a) a tobacco plant or part thereof, or a tobacco cell culture, which has been modified to achieve modulation of nicotine, nornicotine and / or pseudo-oxidized nicotine content compared to an unmodified tobacco plant or part thereof, or an unmodified tobacco cell culture, wherein the modification is modulation of expression of an Armadillo repeat protein, wherein the Armadillo repeat protein: i) consists of the amino acid sequence shown in SEQ ID No.1; or ii) encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or (b) a tobacco plant or part thereof propagated from tobacco plant propagation material obtained from: (i) a tobacco plant as defined in (a); or (ii) a tobacco plant or tobacco cell culture produced by the method of any one of claims 1 or 3; (c) harvested leaves of: (i) a tobacco plant as defined in (a) or (b); (ii) a tobacco plant obtained by the use of claim 2; or (iii) a tobacco plant produced by the method of any one of claims 1 or 3; (d) non-viable processed tobacco leaves according to claim 21; or (e) A tobacco plant produced by the method of any one of claims 1 or 3.

29. The tobacco industry product according to claim 28, wherein the nicotine content is adjusted.

30. The tobacco industry product according to claim 28, wherein the nicotine content is reduced.

31. The tobacco industry product according to claim 28, wherein the tobacco industry product is: a) Combustible smoking products; b) smokeless tobacco products; or c) Non-flammable aerosol supply system.

32. The tobacco industry product according to claim 31, wherein the non-combustible gas aerosol supply system is a tobacco heating device or an aerosol generating device.

33. Combustible smoking articles, non-combustible gas aerosol delivery systems, or smokeless tobacco products, comprising: (a) a tobacco plant or part thereof, or a tobacco cell culture, which has been modified to achieve modulation of nicotine, nornicotine and / or pseudo-oxidized nicotine content compared to an unmodified tobacco plant or part thereof, or an unmodified tobacco cell culture, wherein the modification is modulation of expression of an Armadillo repeat protein, wherein the Armadillo repeat protein: i) consists of the amino acid sequence shown in SEQ ID No.1; or ii) encoded by: a nucleotide sequence as shown in SEQ ID No. 2 or 3; or (b) an extract from the tobacco plant or part thereof referred to in (a); or (c) a cured tobacco material according to any one of claims 24 to 26; or (d) A tobacco blend according to claim 27.

34. The non-combustible gas aerosol supply system according to claim 33, wherein the non-combustible gas aerosol supply system is a tobacco heating device.

35. Use of a nucleotide sequence encoding an Armadillo repeat protein to select tobacco plants having a modulated nicotine, nornicotine and / or pseudo-oxidized nicotine content, the Armadillo repeat protein: a) consisting of the amino acid sequence shown in SEQ ID No.1; or b) is encoded by the nucleotide sequence shown in SEQ ID No. 2 or 3.

36. Use according to claim 35, wherein the tobacco plant has a reduced nicotine, nornicotine and / or pseudo-oxidized nicotine content.

37. A method for producing a mutant of a tobacco plant carrying a heritable mutation in a nucleotide sequence, said nucleotide sequence: a) encoding an armadillo repeat protein consisting of the amino acid sequence shown in SEQ ID No. 1; or b) consists of: As shown in SEQ ID No. 2 or 3, The method comprises introducing into the nucleotide sequence a heritable mutation that eliminates expression of an armadillo repeat protein, and wherein the mutant of the tobacco plant has reduced nicotine, nornicotine and / or pseudo-oxidized nicotine content relative to a comparable tobacco plant that does not carry the heritable mutation.

38. The method according to claim 37, wherein the heritable mutation that eliminates expression of the armadillo repeat protein is a deletion of at least a portion of the armadillo repeat protein.

39. The method according to claim 37, comprising the step of obtaining progeny from said mutant of tobacco plant, wherein said progeny carries said heritable mutation according to claim 37 or 38.

40. The method according to claim 39, wherein the progeny are seeds.

41. The method according to claim 37 or 38, comprising the step of harvesting leaves from the mutant of the tobacco plant.

42. A method according to claim 41, comprising the step of machining said blades.

43. A non-viable processed tobacco leaf produced from a tobacco plant comprising a modification in a nucleotide sequence: a) encoding an armadillo repeat protein consisting of the amino acid sequence shown in SEQ ID No. 1; or b) consists of: The nucleotide sequence as shown in SEQ ID No. 2 or 3; wherein the modification eliminates expression of the nucleotide sequence, and wherein the tobacco plant has a reduced nicotine, nornicotine and / or pseudo-oxidized nicotine content relative to a comparable tobacco plant that does not carry the modification in the nucleotide sequence.

44. The non-viable processed tobacco leaf blade according to Claim 43, wherein the non-viable processed tobacco leaf blade is a cured tobacco material.

Images