Nanofibers of plant tissue origin

Abstract

The present disclosure provides nanofibers comprising self-assembling cellular components derived from homogenized plant tissue. Also described are methods for preparing such nanofibers and their use in treating or preventing a disease or disorder in a subject and / or as a delivery vehicle.

Description

[0001] Field of the Invention

[0002] The present invention generally relates to nanofibers and their uses. More specifically, the present invention relates to nanofibers derived from plant tissues and their uses. Background Art

[0003] Fruits are a rich source of dietary components, ranging from simple molecules that provide energy, such as sugars, to complex macromolecules that serve as dietary fiber, vitamins, minerals, and nutraceuticals with various disease prevention and health regulatory functions, such as cellulose and pectin (Paliyath et al., 2011). Polyphenols, especially flavonoids and their derivatives, have recently received increasing attention due to their numerous biological effects, such as scavenging free radicals, regulating enzyme activity, inhibiting cell proliferation, and their potential use as antibiotics, anti-allergic agents, and anti-inflammatory agents (Clifford and Brown, 2006). Polyphenols have been shown to have a potential role in preventing cardiovascular diseases, cancer, and other degenerative diseases (Scalbert et al., 2005; Paliyath et al., 2010). Since they are widely distributed in plant-derived foods and beverages, including fruit juices, tea, coffee, and wine, polyphenols may be considered common micronutrients in the human diet. Consumption of polyphenol-rich foods has been promoted as a means of preventing the development of chronic diseases and reducing chronic disease mortality.

[0004] The bioactivity of polyphenols in vivo depends on their absorption and metabolism, as well as their distribution in the body after ingestion (Clifford and Brown, 2006). In the case of the gastrointestinal tract (GIT), epithelial cells are in contact with these components or their metabolites. The content of polyphenols in foods can range from 100 - 5000 mg / kg (Manach et al., 2004); however, the extent of absorption of dietary polyphenols in the intestine is relatively small (Spencer and Rice Evans, 2003). Plasma and tissue levels of free phenolic components are generally in the low micromolar range. Similarly, it has been proposed that not all consumed phenolic components are bioavailable due to food matrix interactions (Saura-Calixto and Diaz-Rubio, 2007; Saura-Calixto et al., 2007; DelRio et al., 2010). Understanding the nature and role of diet-derived structures is important because their study influences the understanding of the impact of food-derived nanomaterials on human health.

[0005] As the use of engineered nanomaterials increases worldwide, the impact of nanomaterials on human health has received increasing attention (Maynard, 2006). Engineered nanomaterials can escape into the environment as airborne nanostructured aggregates (such as silver nanoparticles, TiO2) or SWNTs (single-walled carbon nanotubes) and enter the body through inhalation, ingestion, and skin penetration, and then move to other organs. Nanoparticles of titanium and zinc are increasingly used in the cosmetic industry. Engineered nanomaterials from biological components are also being explored in drug delivery, cosmetics, food ingredients, coatings, food packaging, etc. (Azeredo et al., 2009; Ramasamy et al., 2009; Zhao et al., 2011; Sessa et al., 2011; Zhang et al., 2012). Nanomaterials can also enter the body through the food chain, especially by consuming plant-derived foods that have accumulated these materials from soil, water, and air (Rico et al., 2011). The potential of macromolecules present in food to self-assemble into nanostructures will be particularly important (IOM, 2009). For example, the potential formation of amorphous carbon nanoparticles has been observed in caramelized foods (Palashuddin et al., 2012).

[0006] Alternative, additional, and / or improved nanomaterials and / or methods for their production are desired. SUMMARY OF THE INVENTION

[0007] The object of the present disclosure is to provide nanofibers that can be derived from natural sources (i.e., plant tissues) and are used as food supplements, for treating and / or preventing certain diseases or disorders, and / or for delivering bioactive agents to subjects in need. A method for producing the same is also provided.

[0008] In one embodiment, provided herein is a nanofiber comprising self-assembled cellular components derived from homogenized plant tissue, the cellular components comprising one or more structural carbohydrates or their cleavage products, wherein lipids and polyphenols are not structural components of the nanofiber.

[0009] In another embodiment of the above nanofibers, the nanofibers can be substantially free of lipids, can be substantially free of polyphenols, or both.

[0010] In yet another embodiment of any of the above one or more nanofibers, the nanofibers can include:

[0011] Elongated fibers that comprise one or more strands containing or made of at least one structural carbohydrate.

[0012] In yet another embodiment of any of the above-described nanofibers, the nanofibers may include pectin, hemicellulose, peptides and / or proteins, organic acids, their cleavage products, or any combination thereof.

[0013] In yet another embodiment of any of the above-described nanofibers, the organic acid may include malic acid, ascorbic acid, or both.

[0014] In yet another embodiment of any of the above-described nanofibers, the cellular components may include those released from plant tissues during the ripening or homogenization of ripe fruits, which are capable of self-assembling into nanofibers.

[0015] In yet another embodiment of any of the above-described nanofibers, the one or more structural carbohydrates may include pectin, pectic acid, pectin methyl ester, pectin derivatives, polygalacturonic acid, rhamnogalacturonan, xyloglucan, hemicellulose, xyloglucan having a β-(1→4)-linked glucose, mannose, or xylose backbone, and / or arabinogalactan, and / or one or more of their cleavage products.

[0016] In another embodiment of any of the above-described nanofibers, the nanofibers may have a fibrous shape with a diameter of about 5 - 10 nm.

[0017] In yet another embodiment of any of the above-described nanofibers, the nanofibers may be stabilized by hydrogen bond interactions and formed between macromolecules derived from the catabolism of plant tissue cellular components and having hydroxyl and / or amino and / or organic acid groups.

[0018] In yet another embodiment of any of the above-described nanofibers, the nanofibers may be amorphous.

[0019] In yet another embodiment of any of the above-described nanofibers, the nanofibers may further contain bioactive agents.

[0020] In yet another embodiment of any of the above-described nanofibers, the bioactive agent may be a pharmaceutically active drug, protein, enzyme, nutritional preparation, or nutrient.

[0021] In yet another embodiment of any of the above-described nanofibers, the nanofibers may be in an aqueous solution.

[0022] In yet another embodiment of any of the above-described nanofibers, the nanofibers may be in powder form.

[0023] In yet another embodiment of any of the above-described one or more nanofibers, the nanofibers can be in dehydrated, lyophilized, freeze-dried, spray-dried, or nano-spray-dried form.

[0024] In yet another embodiment of any of the above-described one or more nanofibers, the plant tissue can comprise fruit or vegetable plant tissue, and / or the polyphenols can have been removed from the plant tissue prior to homogenization.

[0025] In yet another embodiment of any of the above-described one or more nanofibers, the plant tissue can comprise senescent fruits, ripe vegetables, or any combination thereof; preferably, wherein the plant tissue comprises cherries, blueberries, grapes, peaches, nectarines, plums, apricots, papayas, tomatoes, or any combination thereof.

[0026] In yet another embodiment of any of the above-described one or more nanofibers, the plant tissue can comprise tart cherry fruit tissue.

[0027] In yet another embodiment, provided herein is a method for preparing nanofibers from homogenized plant tissue, the method comprising:

[0028] Preparing homogenized plant tissue in a solution having a low polyphenol content, the solution comprising cellular components released from the plant tissue;

[0029] Removing debris from the homogenized plant tissue if present; and

[0030] Optionally, dialyzing the homogenized plant tissue to remove uncomplexed compounds, or removing uncomplexed compounds by size exclusion,

[0031] Thereby providing a solution comprising nanofibers formed by self-assembly of the cellular components.

[0032] In another embodiment of the above method, the method can further comprise the step of dehydrating, lyophilizing, freeze-drying, spray-drying, or nano-spray-drying the solution comprising the nanofibers.

[0033] In yet another embodiment of any of the above-described one or more methods, the nanofibers can be formed by self-assembly in a substantially aqueous medium.

[0034] In yet another embodiment of any of the above-described one or more methods, the step of preparing homogenized plant tissue in a solution can comprise homogenizing the plant tissue in an aqueous, organic, or mixed aqueous-organic medium.

[0035] In yet another embodiment of any of the above-described one or more methods, the step of preparing homogenized plant tissue in solution may include subjecting the plant tissue to high-shear homogenization and / or sonication in an aqueous, organic, or mixed aqueous-organic medium comprising any one or more of water, ethanol, methanol, or acetone.

[0036] In yet another embodiment of any of the above-described one or more methods, the step of preparing homogenized plant tissue in solution may include the step of bleaching the plant tissue to remove polyphenols therefrom prior to homogenizing the plant tissue.

[0037] In another embodiment of any of the above-described one or more methods, the bleaching may include extracting polyphenols from the plant tissue with an extraction solvent.

[0038] In yet another embodiment of any of the above-described one or more methods, the extraction solvent may include ethanol.

[0039] In yet another embodiment of any of the above-described one or more methods, the step of removing debris may include dialysis, filtering the homogenized plant tissue, centrifuging the homogenized plant tissue, or subjecting the homogenized plant tissue to tangential flow filtration or continuous flow filtration, or any combination thereof.

[0040] In yet another embodiment of any of the above-described one or more methods, the method may be used to prepare any of the above-described one or more nanofibers.

[0041] In another embodiment, provided herein is a method for preparing nanofibers from homogenized plant tissue, the method comprising:

[0042] Preparing homogenized plant tissue in a solution having a low polyphenol content, the solution comprising cellular components released from the plant tissue;

[0043] Removing debris from the homogenized plant tissue if present;

[0044] Allowing nanofibers to form by self-assembly of the cellular components; and

[0045] Lyophilizing, spray drying, or nano spray drying to form a powder comprising nanofibers.

[0046] In another embodiment of the above method, the self-assembly may occur in a substantially aqueous medium.

[0047] In yet another embodiment of any of the above-described one or more methods, the step of preparing homogenized plant tissue in solution may include homogenizing the plant tissue in an aqueous, organic, or mixed aqueous-organic medium.

[0048] In yet another embodiment of any of the above-described one or more methods, the step of preparing homogenized plant tissue in solution may include subjecting the plant tissue to high-shear homogenization and / or sonication in an aqueous, organic, or mixed aqueous-organic medium comprising any one or more of water, ethanol, methanol, or acetone.

[0049] In yet another embodiment of any of the above-described one or more methods, the step of preparing homogenized plant tissue in solution may include the step of bleaching the plant tissue prior to homogenizing the plant tissue to remove polyphenols therefrom.

[0050] In yet another embodiment of any of the above-described one or more methods, bleaching may include extracting polyphenols from the plant tissue with an extraction solvent.

[0051] In yet another embodiment of any of the above-described one or more methods, the extraction solvent may include ethanol.

[0052] In another embodiment of any of the above-described one or more methods, the step of removing debris may include dialysis, filtering the homogenized plant tissue, centrifuging the homogenized plant tissue, or performing tangential flow filtration or continuous flow filtration on the homogenized plant tissue, or any combination thereof.

[0053] In yet another embodiment of any of the above-described one or more methods, the plant tissue may include plant tissue extracted with an extraction solvent to remove polyphenols therefrom.

[0054] In another embodiment of any of the above-described one or more methods, the extraction solvent may include ethanol.

[0055] In yet another embodiment of any of the above-described one or more methods, the method may be used to prepare any of the above-described one or more nanofibers.

[0056] In another embodiment, provided herein is a nanofiber prepared by any of the above-described one or more methods.

[0057] In another embodiment, provided herein is a food powder prepared from any of the above-described one or more nanofibers, optionally wherein the food powder is provided in the form of a micron-sized fine powder.

[0058] In another embodiment, provided herein is a method of delivering a bioactive agent to a subject or cell in need thereof, the method comprising:

[0059] administering to the subject any of the above-described one or more nanofibers complexed or conjugated with a bioactive agent.

[0060] In another embodiment of the above method, the bioactive agent may be an element such as selenium, zinc, iron, or magnesium.

[0061] In yet another embodiment of any of the above-described one or more methods, the bioactive agent can be an anti-cancer drug, and the subject can be a subject suffering from cancer.

[0062] In yet another embodiment of any of the above-described one or more methods, the anti-cancer drug can be paclitaxel, vincristine, or any natural or synthetic compound for treating cancer.

[0063] In yet another embodiment of any of the above-described one or more methods, the bioactive agent can be introduced into the nanofibers during nanofiber formation, or the bioactive agent can be complexed or conjugated with the pre-formed nanofibers in an aqueous medium optionally containing alcohol or other organic components.

[0064] In another embodiment of any of the above-described one or more methods, the aqueous medium can contain DMSO, or a buffer, or both.

[0065] In yet another embodiment, provided herein is a method for treating or preventing cancer in a subject in need thereof, the method comprising:

[0066] administering to the subject any of the above-described one or more nanofibers.

[0067] In another embodiment of the above method, the nanofibers can be co-administered simultaneously or sequentially with the anti-cancer drug.

[0068] In yet another embodiment of any of the above-described one or more methods, the nanofibers can be complexed or conjugated with the anti-cancer drug.

[0069] In yet another embodiment of any of the above-described one or more methods, the anti-cancer drug can be paclitaxel or vincristine.

[0070] In another embodiment, provided herein is a method for providing soluble dietary fiber to a subject, the method comprising:

[0071] administering to the subject any of the above-described one or more nanofibers.

[0072] In yet another embodiment, provided herein is a thickening food additive comprising any of the above-described one or more nanofibers.

[0073] In another embodiment, provided herein is a method for reducing postprandial blood glucose levels in a subject in need thereof, the method comprising:

[0074] administering to the subject any of the above-described one or more nanofibers.

[0075] In yet another embodiment, provided herein is a cosmetic comprising any of the above-described one or more nanofibers.

[0076] In yet another embodiment, provided herein is a composition for topical administration to a subject in need, the composition comprising any one or more of the above-described nanofibers and optionally a bioactive agent.

[0077] In yet another embodiment, provided herein is a method for preventing sunburn in a subject in need, the method comprising:

[0078] administering any one or more of the above-described nanofibers to the skin of the subject.

[0079] In yet another embodiment of the above method, the nanofibers may comprise anthocyanins or another UV protectant, or may be administered with anthocyanins or another UV protectant.

[0080] In yet another embodiment, provided herein is a method for reducing cell proliferation, the method comprising:

[0081] treating a cell or tissue or organ with any one or more of the above-described nanofibers.

[0082] In yet another embodiment of the above method, the nanofibers may be used simultaneously or sequentially with an anticancer drug.

[0083] In yet another embodiment of any one or more of the above methods, the nanofibers may be complexed or conjugated with an anticancer drug.

[0084] In yet another embodiment of any one or more of the above methods, the anticancer drug may be paclitaxel or vincristine.

[0085] In another embodiment, provided herein is a method for reducing triglyceride accumulation in the liver of a subject in need, the method comprising:

[0086] administering any of the above-described nanofibers to the subject.

[0087] In yet another embodiment, provided herein is the use of any one or more of the above-described nanofibers for delivering a bioactive agent to a subject or cell in need.

[0088] In another embodiment of the above use, the bioactive agent may be an element such as selenium, zinc, magnesium or iron.

[0089] In yet another embodiment of any one or more of the above uses, the bioactive agent may be an anticancer drug, and the subject may be a subject suffering from cancer.

[0090] In yet another embodiment of any one or more of the above uses, the anticancer drug may be paclitaxel or vincristine.

[0091] In yet another embodiment of any of the above - mentioned one or more uses, the bioactive agent can be introduced into the nanofibers during nanofiber formation, or the bioactive agent can be complexed or conjugated with the already - formed nanofibers in an aqueous medium.

[0092] In another embodiment of any of the above - mentioned one or more uses, the aqueous medium can contain DMSO, or a buffer, or both.

[0093] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more nanofibers for treating or preventing cancer in a subject in need thereof.

[0094] In yet another embodiment of any of the above - mentioned one or more uses, the nanofibers can be co - administered or sequentially co - administered with an anti - cancer drug.

[0095] In yet another embodiment of any of the above - mentioned one or more uses, the nanofibers can be complexed or conjugated with an anti - cancer drug.

[0096] In another embodiment of any of the above - mentioned one or more uses, the anti - cancer drug can be paclitaxel or vincristine.

[0097] In another embodiment, provided herein is the use of any of the above - mentioned one or more nanofibers for providing soluble dietary fiber to a subject.

[0098] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more nanofibers as a thickening food additive or fiber substitute.

[0099] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more nanofibers for reducing the post - prandial blood glucose level in a subject in need thereof.

[0100] In another embodiment, provided herein is the use of any of the above - mentioned one or more nanofibers in cosmetics.

[0101] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more nanofibers for topical administration to a subject in need thereof, wherein the nanofibers are optionally complexed or conjugated with a bioactive agent.

[0102] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more nanofibers as a drug delivery carrier for topical administration.

[0103] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more nanofibers for preventing sunburn in a subject in need thereof, wherein the nanofibers are applied to the skin of the subject.

[0104] In another embodiment of the above uses, the nanofibers can comprise anthocyanins or another UV protectant, or can be applied with anthocyanins or another UV protectant.

[0105] In yet another embodiment, provided herein is the use of any one or more of the above nanofibers for reducing cell proliferation.

[0106] In another embodiment of the above uses, the nanofibers can be used simultaneously or sequentially with an anticancer drug.

[0107] In yet another embodiment of the above one or more uses, the nanofibers can be complexed or conjugated with an anticancer drug.

[0108] In yet another embodiment of the above one or more uses, the anticancer drug can be paclitaxel or vincristine.

[0109] In another embodiment, provided herein is the use of any one or more of the above nanofibers for reducing triglyceride accumulation in the liver of a subject in need thereof.

[0110] In another embodiment, provided herein is a targeted nanofiber comprising any one or more of the above nanofibers conjugated with a targeting antibody specific for a cancer marker.

[0111] In another embodiment of the above targeted nanofibers, the targeting antibody can comprise a PD-L1 antibody or an antigen-binding fragment thereof for targeting the targeted nanofiber to cancer cells.

[0112] In yet another embodiment of the above targeted nanofibers, the targeted nanofiber can be complexed or conjugated with at least one cytotoxic drug or anticancer drug.

[0113] In yet another embodiment of any of the above targeted nanofibers, the targeted nanofiber can be complexed or conjugated with paclitaxel, doxorubicin, or both.

[0114] In another embodiment, provided herein is an antibacterial nanofiber comprising any one or more of the above nanofibers complexed or conjugated with an antibacterial agent.

[0115] In another embodiment of the above antibacterial nanofibers, the antibacterial agent can include lysozyme, tetracycline, or nisin, or any combination thereof.

[0116] In yet another embodiment of any of the above one or more antibacterial nanofibers, the antibacterial nanofiber can be used to treat or prevent MDR bacterial infections.

[0117] In another embodiment, provided herein is a nanoparticle comprising self-assembled cellular components derived from homogenized plant tissue, the cellular components comprising one or more structural carbohydrates or their cleavage products, wherein lipids are not a structural component of the nanoparticle.

[0118] In another embodiment of the above-described nanoparticle, the nanoparticle can be substantially lipid-free.

[0119] In yet another embodiment of any of the above one or more nanoparticles, the nanoparticle can comprise pectin, hemicellulose, peptides, and / or proteins, organic acids, at least one polyphenol, their cleavage products, or any combination thereof.

[0120] In yet another embodiment of any of the above one or more nanoparticles, the nanoparticle can comprise:

[0121] a pectin-based core;

[0122] an intermediate layer surrounding the core, the intermediate layer comprising macromolecules of pectin and hemicellulose and / or their cleavage products, polyphenols, and organic acids; and

[0123] a fibrillated outer layer comprising macromolecular carbohydrates and proteins, optionally formed by catabolism during the maturation of the plant tissue and / or during homogenization.

[0124] In another embodiment of any of the above one or more nanoparticles, the organic acid can include malic acid, ascorbic acid, or both.

[0125] In yet another embodiment of any of the above one or more nanoparticles, the polyphenol can include anthocyanin.

[0126] In yet another embodiment of any of the above one or more nanoparticles, the cellular components can include those cellular components released from the plant tissue during the maturation of the ripe fruit and / or during homogenization, which are capable of self-assembling into nanoparticles.

[0127] In yet another embodiment of any of the above one or more nanoparticles, the one or more structural carbohydrates can include one or more of pectin, pectic acid, pectin methyl ester, pectin derivatives, polygalacturonic acid, rhamnogalacturonan, xyloglucan, hemicellulose, xyloglucan having a β-(1→4)-linked glucose, mannose, or xylose backbone, and / or arabinogalactan and / or their cleavage products.

[0128] In yet another embodiment of any of the above one or more nanoparticles, the nanoparticle can have a substantially spherical structure with a diameter of about 50 - 250 nm.

[0129] In another embodiment of any one or more of the above-described nanoparticles, the nanoparticles may comprise:

[0130] a pectin-based core;

[0131] a middle layer surrounding the core, the middle layer comprising one or more helical fibril structures comprising pectin or its derivatives, and one or more hemicellulose-derived molecules or their derivatives; and

[0132] a fibrillated outer layer comprising hemicellulose or its cleavage products, and one or more peptides derived from cellular proteins.

[0133] In yet another embodiment of any one or more of the above-described nanoparticles, the nanoparticles may be stabilized by hydrogen bond interactions present in the pH range of about 3 - 7 and are formed between macromolecules derived from the catabolism of plant tissue cell components and having hydroxyl and / or amino and / or organic acid groups.

[0134] In yet another embodiment of any one or more of the above-described nanoparticles, the nanoparticles may be amorphous.

[0135] In yet another embodiment of any one or more of the above-described nanoparticles, the nanoparticles may further comprise a bioactive agent.

[0136] In another embodiment of any one or more of the above-described nanoparticles, the bioactive agent may be a pharmaceutically active drug, a protein, an enzyme, a nutritional preparation, or a nutrient.

[0137] In another embodiment of any one or more of the above-described nanoparticles, the nanoparticles may be in an aqueous solution.

[0138] In yet another embodiment of any one or more of the above-described nanoparticles, the nanoparticles may be in powder form.

[0139] In yet another embodiment of any one or more of the above-described nanoparticles, the nanoparticles may be in a dehydrated, lyophilized, freeze-dried, spray-dried, or nano-spray-dried form.

[0140] In yet another embodiment of any one or more of the above-described nanoparticles, the plant tissue may comprise fruit or vegetable plant tissue.

[0141] In another embodiment of any one or more of the above-described nanoparticles, the plant tissue may comprise senescent fruit, ripe vegetables, or any combination thereof; preferably, wherein the plant tissue comprises cherries, blueberries, grapes, peaches, nectarines, plums, apricots, papayas, tomatoes, or any combination thereof.

[0142] In yet another embodiment of any of the above-described one or more nanoparticles, the plant tissue can comprise tart cherry fruit tissue.

[0143] In another embodiment, provided herein is a method for preparing nanoparticles from homogenized plant tissue, the method comprising:

[0144] Preparing homogenized plant tissue in a solution that contains cell components released from the plant tissue;

[0145] Removing debris, if present, from the homogenized plant tissue; and

[0146] Optionally, dialyzing the homogenized plant tissue to remove uncomplexed compounds, or removing uncomplexed compounds by size exclusion,

[0147] Thereby providing a solution comprising nanoparticles formed by self-assembly of cell components.

[0148] In another embodiment of the above method, the method can further comprise the step of dehydrating, lyophilizing, freeze-drying, spray-drying, or nano spray-drying the solution comprising the nanoparticles.

[0149] In yet another embodiment of any of the above-described one or more methods, the nanoparticles can be formed by self-assembly in a substantially aqueous medium.

[0150] In yet another embodiment of any of the above-described one or more methods, the step of preparing homogenized plant tissue in a solution can comprise homogenizing the plant tissue in an aqueous, organic, or mixed aqueous-organic medium.

[0151] In yet another embodiment of any of the above-described one or more methods, the step of preparing homogenized plant tissue in a solution can comprise subjecting the plant tissue to high-shear homogenization and / or sonication in an aqueous, organic, or mixed aqueous-organic medium comprising any one or more of water, ethanol, methanol, or acetone.

[0152] In yet another embodiment of any of the above-described one or more methods, the step of removing debris can comprise dialyzing, filtering the homogenized plant tissue, centrifuging the homogenized plant tissue, or performing tangential flow filtration or continuous flow filtration on the homogenized plant tissue, or any combination thereof.

[0153] In yet another embodiment of any of the above-described one or more methods, the method can be used to prepare the nanoparticles as described herein.

[0154] In another embodiment, provided herein is a method for preparing nanoparticles from homogenized plant tissue, the method comprising:

[0155] Prepare a homogenized plant tissue in a solution that contains cell components released from the plant tissue;

[0156] Allow the formation of nanoparticles by self-assembly of the cell components;

[0157] If debris is present, remove the debris from the homogenized plant tissue; and

[0158] Freeze-dry, spray-dry, or nano-spray-dry to form a powder containing the nanoparticles.

[0159] In another embodiment of the above method, the self-assembly can occur in a substantially aqueous medium.

[0160] In yet another embodiment of any of the above one or more methods, the step of preparing the homogenized plant tissue in a solution can include high-shear homogenization of the plant tissue in an aqueous, organic, or mixed aqueous-organic medium.

[0161] In another embodiment of any of the above one or more methods, the step of removing debris can include filtering the homogenized plant tissue, or centrifuging the homogenized plant tissue, or both.

[0162] In yet another embodiment of any of the above one or more methods, the method can be used to prepare the nanoparticles as described herein.

[0163] In another embodiment, provided herein is a nanoparticle prepared by any of the above one or more methods.

[0164] In another embodiment, provided herein is a food powder prepared from any of the above one or more nanoparticles, optionally wherein the food powder is provided in the form of micron-sized fine powder.

[0165] In another embodiment, provided herein is a method for delivering a bioactive agent to a subject, cell, or organism in need thereof, the method comprising:

[0166] Administering any of the above one or more nanoparticles complexed or conjugated with a bioactive agent to the subject, cell, or organism using a chemical or physical method.

[0167] In another embodiment of the above method, the bioactive agent can be an element such as selenium, zinc, iron, or magnesium.

[0168] In another embodiment of any of the above one or more methods, the bioactive agent can be an anti-cancer drug, and the subject can be a subject suffering from cancer.

[0169] In another embodiment of any of the above-described one or more methods, the anti-cancer drug can be paclitaxel, vincristine, or any natural or synthetic compound for treating cancer.

[0170] In another embodiment of any of the above-described one or more methods, the bioactive agent can be introduced into the nanoparticles during nanoparticle formation, or the bioactive agent can be complexed or conjugated with the pre-formed nanoparticles in an aqueous medium optionally containing alcohol or other organic components.

[0171] In another embodiment of any of the above-described one or more methods, the aqueous medium can contain DMSO, or a buffer, or both.

[0172] In another embodiment, provided herein is a method for treating a disease or disorder associated with an elevated level of reactive oxygen species that cause inflammation in a subject in need thereof, the method comprising:

[0173] administering to the subject any of the above-described one or more nanoparticles.

[0174] In another embodiment, provided herein is a method for treating or alleviating inflammation in a subject in need thereof, the method comprising:

[0175] administering to the subject any of the above-described one or more nanoparticles.

[0176] In another embodiment of the above method, the nanoparticles can contain an anti-inflammatory agent or be administered in combination with an anti-inflammatory agent.

[0177] In yet another embodiment of the above-described one or more methods, the anti-inflammatory agent can contain curcumin.

[0178] In another embodiment, provided herein is a method for treating or alleviating obesity in a subject in need thereof, the method comprising:

[0179] administering to the subject any of the above-described one or more nanoparticles.

[0180] In another embodiment of the above method, the nanoparticles can contain components at least partially derived from nut, legume, herb, spice, vegetable, or fungal plant tissues that are traditionally used for food or medical purposes.

[0181] In another embodiment, provided herein is a method for treating or preventing cancer in a subject in need thereof, the method comprising:

[0182] administering to the subject any of the above-described one or more nanoparticles.

[0183] In another embodiment of the above method, the nanoparticles can be administered simultaneously or sequentially in combination with an anti-cancer drug.

[0184] In another embodiment of one or more of the above methods, the nanoparticles can be complexed or conjugated with an anti-cancer drug.

[0185] In another embodiment of one or more of the above methods, the anti-cancer drug can be paclitaxel or vincristine.

[0186] In another embodiment, provided herein is a method for delivering soluble dietary fiber to a subject, the method comprising:

[0187] administering to the subject any one or more of the above nanoparticles.

[0188] In another embodiment, provided herein is a thickening food additive comprising any one or more of the above nanoparticles.

[0189] In another embodiment, provided herein is a method for reducing postprandial blood glucose levels in a subject in need thereof, the method comprising:

[0190] administering to the subject any one or more of the above nanoparticles.

[0191] In another embodiment, provided herein is a cosmetic comprising any one or more of the above nanoparticles.

[0192] In yet another embodiment, provided herein is a composition for topical administration to a subject in need thereof, the composition comprising any one or more of the above nanoparticles and optionally a bioactive agent.

[0193] In yet another embodiment, provided herein is a method for preventing sunburn in a subject in need thereof, the method comprising:

[0194] applying any one or more of the above nanoparticles to the skin of the subject.

[0195] In another embodiment of the above method, the nanoparticles can include additional anthocyanins or another UV protectant, or can be applied with additional anthocyanins or another UV protectant.

[0196] In another embodiment, provided herein is a method for reducing cell proliferation, the method comprising:

[0197] treating cells or tissues or organs with any one or more of the above nanoparticles.

[0198] In another embodiment of the above method, the nanoparticles can be used simultaneously or sequentially with an anti-cancer drug.

[0199] In yet another embodiment of any of the above - described one or more methods, the nanoparticles can be complexed or conjugated with an anti - cancer drug.

[0200] In yet another embodiment of any of the above - described one or more methods, the anti - cancer drug can be paclitaxel or vincristine.

[0201] In another embodiment, provided herein is a method for reducing triglyceride accumulation in the liver of a subject in need thereof, the method comprising:

[0202] administering to the subject any one or more of the above - described nanoparticles.

[0203] In another embodiment, provided herein is the use of any one or more of the above - described nanoparticles for delivering a bioactive agent to a subject or cell in need thereof.

[0204] In another embodiment of the above - described use, the bioactive agent can be an element such as selenium, zinc, magnesium, or iron.

[0205] In another embodiment of any of the above - described one or more uses, the bioactive agent can be an anti - cancer drug, and the subject can be a subject suffering from cancer.

[0206] In yet another embodiment of any of the above - described one or more uses, the anti - cancer drug can be paclitaxel or vincristine.

[0207] In yet another embodiment of any of the above - described one or more uses, the bioactive agent can be introduced into the nanoparticles during nanoparticle formation, or the bioactive agent can be complexed or conjugated with the pre - formed nanoparticles in an aqueous medium.

[0208] In another embodiment of any of the above - described one or more uses, the aqueous medium can contain DMSO, or a buffer, or both.

[0209] In another embodiment, provided herein is the use of any one or more of the above - described nanoparticles for treating a disease or disorder associated with reactive oxygen species in a subject in need thereof.

[0210] In another embodiment, provided herein is the use of any one or more of the above - described nanoparticles for treating or alleviating inflammation in a subject in need thereof.

[0211] In yet another embodiment of any of the above - described one or more uses, the nanoparticles can contain an anti - inflammatory agent or can be administered together with an anti - inflammatory agent.

[0212] In yet another embodiment of any of the above - described one or more uses, the anti - inflammatory agent can contain curcumin.

[0213] In another embodiment, provided herein is the use of any one or more of the above-described nanoparticles for treating or alleviating obesity in a subject in need thereof.

[0214] In yet another embodiment of any of the above uses, the nanoparticles can be derived from nut, leguminous, herbaceous, spice, vegetable, or fungal plant tissues.

[0215] In another embodiment, provided herein is the use of any one or more of the above-described nanoparticles for treating or preventing cancer in a subject in need thereof.

[0216] In yet another embodiment of any of the above uses, the nanoparticles can be administered concomitantly or sequentially in combination with an anti-cancer drug.

[0217] In yet another embodiment of any of the above uses, the nanoparticles can be complexed or conjugated with an anti-cancer drug.

[0218] In yet another embodiment of any of the above uses, the anti-cancer drug can be paclitaxel or vincristine.

[0219] In another embodiment, provided herein is the use of any one or more of the above-described nanoparticles for providing soluble dietary fiber to a subject.

[0220] In yet another embodiment, provided herein is the use of any one or more of the above-described nanoparticles as a thickening food additive or fiber substitute.

[0221] In yet another embodiment, provided herein is the use of any one or more of the above-described nanoparticles for reducing the postprandial blood glucose level in a subject in need thereof.

[0222] In another embodiment, provided herein is the use of any one or more of the above-described nanoparticles in cosmetics.

[0223] In yet another embodiment, provided herein is the use of any one or more of the above-described nanoparticles for topical administration to a subject in need thereof.

[0224] In another embodiment, provided herein is the use of any one or more of the above-described nanoparticles as a drug delivery carrier for topical administration.

[0225] In another embodiment, provided herein is the use of any one or more of the above-described nanoparticles for preventing sunburn in a subject in need thereof, wherein the nanoparticles are applied to the skin of the subject.

[0226] In yet another embodiment of the above uses, the nanoparticles can comprise additional anthocyanins or additional UV protectants, or can be applied in combination with additional anthocyanins or additional UV protectants.

[0227] In another embodiment, provided herein is the use of any one or more of the above-described nanoparticles for reducing cell proliferation.

[0228] In another embodiment of the above use, the nanoparticles can be used simultaneously or sequentially with an anticancer drug.

[0229] In yet another embodiment of the above one or more uses, the nanoparticles can be complexed or conjugated with an anticancer drug.

[0230] In yet another embodiment of the above one or more uses, the anticancer drug can be paclitaxel or vincristine.

[0231] In another embodiment, provided herein is the use of any one or more of the above-described nanoparticles for reducing the accumulation of triglycerides in the liver of a subject in need thereof.

[0232] In another embodiment, provided herein is a targeted nanoparticle comprising any one or more of the above-described nanoparticles, the targeted nanoparticle conjugated with a targeting antibody specific for a cancer marker.

[0233] In another embodiment of the above targeted nanoparticle, the targeting antibody can comprise a PD-L1 antibody or an antigen-binding fragment thereof for targeting the targeted nanoparticle to cancer cells.

[0234] In yet another embodiment of the above one or more targeted nanoparticles, the targeted nanoparticle can be complexed or conjugated with at least one cytotoxic drug or anticancer drug.

[0235] In yet another embodiment of the above one or more targeted nanoparticles, the targeted nanoparticle can be complexed or conjugated with paclitaxel, doxorubicin, or both.

[0236] In another embodiment, provided herein is an antibacterial nanoparticle comprising any one or more of the above-described nanoparticles, the antibacterial nanoparticle complexed or conjugated with an antibacterial agent.

[0237] In another embodiment of the above antibacterial nanoparticle, the antibacterial agent can comprise lysozyme, tetracycline, or nisin, or any combination thereof.

[0238] In yet another embodiment of the above one or more antibacterial nanoparticles, the antibacterial nanoparticle can be used for treating or preventing MDR bacterial infections.

[0239] In another embodiment, provided herein is a food powder that comprises self-assembling cellular components derived from homogenized plant tissue, the cellular components comprising one or more structural carbohydrates or their cleavage products and further comprising at least one nutrient, wherein lipids are not a structural component of the food powder.

[0240] In another embodiment of the above food powder, the food powder may comprise:

[0241] A fibrous structure that wraps or coils around itself to form a nanosphere-like structure.

[0242] In yet another embodiment of any of the above one or more food powders, the food powder may further comprise a hydrophobic component.

[0243] In yet another embodiment of any of the above one or more food powders, the hydrophobic component may include almond milk, coconut milk, and / or milk derived from an edible nut or may be provided in almond milk, coconut milk, and / or milk derived from an edible nut.

[0244] In yet another embodiment of any of the above one or more food powders, the nutrient may comprise a naturally occurring active ingredient having health benefits.

[0245] In yet another embodiment of any of the above one or more food powders, the nutrient may include one or more carotenoids, annonacin, Boswellia, Ashwagandha, members of the Zingiberaceae family, fructooligosaccharides, galactooligosaccharides, inulin, Jerusalem artichoke, members of the Piperaceae family, pepper, or wild relatives containing piperine and / or its derivatives, or any of its active ingredients having health benefits, or any extract, derivative, or product isolated therefrom, or any combination thereof.

[0246] In yet another embodiment of any of the above one or more food powders, the food powder may comprise:

[0247] Sour cherry or its aqueous extract;

[0248] Almond milk, or another homogenate of almonds;

[0249] Soy milk, or another homogenate of soybeans;

[0250] Broccoli, or its aqueous extract; and

[0251] Turmeric or its powder.

[0252] In yet another embodiment of any of the above one or more food powders, the food powder may comprise:

[0253] About 25 - 30 v / v% tart cherry extract (at least about 0.1 mg / ml polyphenol equivalents);

[0254] About 25 - 30 v / v% almond milk or another homogenate of almonds;

[0255] About 10 - 18 v / v% soy milk or another homogenate of soybeans;

[0256] About 25 - 30 v / v% broccoli extract; and

[0257] About 0.5 - 2.5 w / v% turmeric or its powder.

[0258] In another embodiment of any of the above - mentioned food powders, the tart cherry extract can be about 1 - 2 mg / ml polyphenol equivalents.

[0259] In another embodiment, provided herein is a method for preparing a food powder from homogenized plant tissue, the method comprising:

[0260] Preparing homogenized plant tissue in a solution that contains cell components released from the plant tissue, the cell components comprising one or more structural carbohydrates or their cleavage products, and the homogenized plant tissue in the solution further comprises at least one nutrient;

[0261] Optionally, if present, removing debris from the homogenized plant tissue in the solution; and

[0262] Lyophilizing, freeze - drying, spray - drying or nano - spray - drying the homogenized plant tissue in the solution to form a food powder.

[0263] In another embodiment of the above - mentioned method, the plant tissue can include fruits, vegetables or other plant tissues.

[0264] In yet another embodiment of any of the above - mentioned methods, the plant tissue can include senescent fruits, ripe vegetables or any combination thereof; preferably, wherein the plant tissue includes cherries, blueberries, grapes, peaches, nectarines, plums, apricots, papayas, tomatoes, wild - sourced fruits and / or berries, or any combination thereof.

[0265] In yet another embodiment of any of the above - mentioned methods, the homogenized plant tissue in the solution can further comprise a hydrophobic component.

[0266] In another embodiment of any of the above - mentioned methods, the hydrophobic component can include almond milk, coconut water and / or milk derived from edible nuts, or can be provided in almond milk, coconut water and / or milk derived from edible nuts.

[0267] In yet another embodiment of any of the above - mentioned one or more methods, the nutritional agent may comprise naturally occurring active ingredients having health benefits.

[0268] In yet another embodiment of any of the above - mentioned one or more methods, the nutritional agent may include one or more carotenoids, annonaceous acetogenins, boswellia, withania somnifera, members of the Zingiberaceae family, fructooligosaccharides, galactooligosaccharides, inulin, Jerusalem artichoke, members of the Piperaceae family, pepper or wild relatives containing piperine and / or its derivatives, or any of its active ingredients having health benefits, or any extract, derivative or product isolated therefrom, or any combination thereof.

[0269] In yet another embodiment of any of the above - mentioned one or more methods, the homogenized plant tissue in the solution may comprise:

[0270] Sour cherry or its aqueous extract;

[0271] Almond milk or another homogenate of almonds;

[0272] Soy milk or another homogenate of soybeans;

[0273] Broccoli or its aqueous extract; and

[0274] Turmeric or its powder.

[0275] In another embodiment of any of the above - mentioned one or more methods, the homogenized plant tissue in the solution may comprise:

[0276] Approximately 25 - 30 v / v% of sour cherry extract (at least approximately 0.1 mg / ml of polyphenol equivalent);

[0277] Approximately 25 - 30 v / v% of almond milk or other homogenates of almonds;

[0278] Approximately 10 - 18 v / v% of soy milk or other homogenates of soybeans;

[0279] Approximately 25 - 30 v / v% of broccoli extract; and

[0280] Approximately 0.5 - 2.5 w / v% of turmeric or its powder.

[0281] In yet another embodiment of any of the above - mentioned one or more methods, the sour cherry extract may be approximately 1 - 2 mg / ml of polyphenol equivalent.

[0282] In yet another embodiment of any of the above - mentioned one or more methods, the step of preparing the homogenized plant tissue may include homogenizing the plant tissue in an aqueous medium, an organic medium, or a mixed aqueous - organic medium.

[0283] In yet another embodiment of any of the above-described one or more methods, the plant tissue can include one or more nutrient-containing materials, which can be fresh, pre-treated, or concentrated materials, or any combination thereof.

[0284] In yet another embodiment of any of the above-described one or more methods, the step of preparing the homogenized plant tissue can include homogenizing the plant tissue with a blender, Sonolator, or another high-performance mixing device preferably operating at high rpm and generating high shear forces.

[0285] In yet another embodiment of any of the above-described one or more methods, the step of removing debris can include removing debris with a centrifuge device, with a filtration device, by membrane filtration, by tangential flow filtration, or any combination thereof.

[0286] In yet another embodiment of any of the above-described one or more methods, the plant tissue can include plant tissue obtained from or containing tart cherries, almonds or almond milk, soybeans or soy milk, broccoli, turmeric, or any combination thereof.

[0287] In yet another embodiment of any of the above-described one or more methods, the homogenized plant tissue can include tart cherry extract, almond milk, soy milk, broccoli extract, and turmeric powder.

[0288] In another embodiment, provided herein is a food powder produced by any of the above-described one or more methods.

[0289] In yet another embodiment, provided herein is a method for delivering a bioactive agent to a subject, cell, or organism in need thereof, the method comprising:

[0290] administering to the subject or cell or organism any of the above-described one or more food powders that are complexed or conjugated with the bioactive agent using chemical or physical methods.

[0291] In another embodiment of the above method, the bioactive agent can be an element such as selenium, zinc, iron, or magnesium.

[0292] In yet another embodiment of the above-described one or more methods, the bioactive agent can be an anti-cancer drug, and the subject can be a subject suffering from cancer.

[0293] In yet another embodiment of any of the above-described one or more methods, the anti-cancer drug can be paclitaxel, vincristine, or any natural or synthetic compound for treating cancer.

[0294] In another embodiment of any of the above-described one or more methods, the bioactive agent can be introduced into the food powder during food powder formation, or the bioactive agent can be complexed or conjugated with the formed food powder in an aqueous medium optionally containing alcohol or other organic components.

[0295] In another embodiment of any of the above-described one or more methods, the aqueous medium can include DMSO, or a buffer, or both.

[0296] In yet another embodiment, provided herein is a method for treating a disease or disorder associated with an elevated level of reactive oxygen species that cause inflammation in a subject in need thereof, the method comprising:

[0297] administering to the subject any of the above-described one or more food powders.

[0298] In yet another embodiment, provided herein is a method for treating or reducing inflammation in a subject in need thereof, the method comprising:

[0299] administering to the subject any of the above-described one or more food powders.

[0300] In another embodiment of the above method, the food powder can contain an anti-inflammatory agent or be administered in combination with an anti-inflammatory agent.

[0301] In yet another embodiment of any of the above-described one or more methods, the anti-inflammatory agent can include curcumin.

[0302] In yet another embodiment, provided herein is a method for treating or reducing obesity in a subject in need thereof, the method comprising:

[0303] administering to the subject any of the above-described one or more food powders.

[0304] In another embodiment of the above method, the food powder can contain or comprise components that are at least partially derived from nut, legume, herb, spice, vegetable, or fungal plant tissues that have been traditionally used for food or medicinal purposes.

[0305] In yet another embodiment, provided herein is a method for treating or preventing cancer in a subject in need thereof, the method comprising:

[0306] administering to the subject any of the above-described one or more food powders.

[0307] In another embodiment of the above method, the food powder can be administered concomitantly or sequentially in combination with an anti-cancer drug.

[0308] In yet another embodiment of any of the above-described one or more methods, the food powder can be complexed or conjugated with an anti-cancer drug.

[0309] In yet another embodiment of any of the above-described one or more methods, the anti-cancer drug can be paclitaxel or vincristine.

[0310] In another embodiment, provided herein is a method for providing soluble dietary fiber to a subject, the method comprising:

[0311] administering to the subject any of the above-described one or more food powders.

[0312] In yet another embodiment, provided herein is a thickening food additive comprising any of the above-described one or more food powders.

[0313] In yet another embodiment, provided herein is a method for reducing postprandial blood glucose levels in the blood of a subject in need thereof, the method comprising:

[0314] administering to the subject any of the above-described one or more food powders.

[0315] In yet another embodiment, provided herein is a method for reducing cell proliferation, the method comprising:

[0316] treating a cell or tissue or organ with any of the above-described one or more food powders.

[0317] In another embodiment of the above method, the food powder can be used simultaneously or sequentially with the anti-cancer drug.

[0318] In yet another embodiment of the above method, the food powder can be complexed or conjugated with the anti-cancer drug.

[0319] In yet another embodiment of any of the above-described one or more methods, the anti-cancer drug can be paclitaxel or vincristine.

[0320] In another embodiment, provided herein is a method for reducing the accumulation of triglycerides in the liver of a subject in need thereof, the method comprising:

[0321] administering to the subject any of the above-described one or more food powders.

[0322] In yet another embodiment, provided herein is the use of any of the above-described one or more food powders for delivering a bioactive agent to a subject or cell in need thereof.

[0323] In another embodiment of the above use, the bioactive agent can be an element such as selenium, zinc, magnesium or iron.

[0324] In yet another embodiment of any of the above-described one or more uses, the bioactive agent can be an anti-cancer drug, and the subject is a subject suffering from cancer.

[0325] In yet another embodiment of any of the above - mentioned one or more uses, the anti - cancer drug can be paclitaxel or vincristine.

[0326] In yet another embodiment of any of the above - mentioned one or more uses, the bioactive agent can be introduced into the food powder during food powder formation, or the bioactive agent can be complexed or conjugated with the formed food powder in an aqueous medium optionally containing alcohol or other organic components.

[0327] In another embodiment of any of the above - mentioned one or more uses, the aqueous medium can include DMSO, or a buffer, or both.

[0328] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more food powders for treating a disease or disorder associated with reactive oxygen species in a subject in need thereof.

[0329] In another embodiment, provided herein is the use of any of the above - mentioned one or more food powders for treating or alleviating inflammation in a subject in need thereof.

[0330] In another embodiment of the above - mentioned use, the food powder can contain an anti - inflammatory agent or can be co - administered with an anti - inflammatory agent.

[0331] In yet another embodiment of any of the above - mentioned one or more uses, the anti - inflammatory agent can contain curcumin.

[0332] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more food powders for treating or alleviating obesity in a subject in need thereof.

[0333] In yet another embodiment of any of the above - mentioned one or more uses, the food powder can be at least partially derived from nut, legume, herb, spice, vegetable or fungal plant tissue.

[0334] In another embodiment, provided herein is the use of any of the above - mentioned one or more food powders for treating or preventing cancer in a subject in need thereof.

[0335] In yet another embodiment of any of the above - mentioned one or more uses, the food powder can be co - administered simultaneously or sequentially in combination with an anti - cancer drug.

[0336] In yet another embodiment of any of the above - mentioned one or more uses, the food powder can be complexed or conjugated with an anti - cancer drug.

[0337] In yet another embodiment of any of the above - mentioned one or more uses, the anti - cancer drug can be paclitaxel or vincristine.

[0338] In yet another embodiment, provided herein is the use of any of the above - mentioned one or more food powders for providing soluble dietary fiber to a subject.

[0339] In yet another embodiment, provided herein is the use of any one or more of the above food powders as a thickening food additive or a fiber substitute.

[0340] In yet another embodiment, provided herein is the use of any one or more of the above food powders for reducing the postprandial blood glucose level in a subject in need thereof.

[0341] In yet another embodiment, provided herein is the use of any one or more of the above food powders for reducing cell proliferation.

[0342] In another embodiment of the above uses, the food powder can be used simultaneously or sequentially with an anticancer drug.

[0343] In yet another embodiment of the above one or more uses, the food powder can be complexed or conjugated with an anticancer drug.

[0344] In yet another embodiment of any one or more of the above uses, the anticancer drug can be paclitaxel or vincristine.

[0345] In yet another embodiment, provided herein is the use of any one or more of the above food powders for reducing the accumulation of triglycerides in the liver of a subject in need thereof.

[0346] In yet another embodiment, provided herein is an antibacterial food powder comprising any one or more of the above food powders complexed or conjugated with an antibacterial agent.

[0347] In another embodiment of the above antibacterial food powder, the antibacterial agent can include lysozyme, tetracycline, or nisin, or any combination thereof.

[0348] In yet another embodiment of any one or more of the above antibacterial food powders, the antibacterial food powder can be used for treating or preventing MDR bacterial infections.

[0349] In yet another embodiment, provided herein is a method for loading a bioactive agent or cargo into any one or more of the above nanoparticles, the method comprising:

[0350] providing a dehydrated, lyophilized, or freeze-dried nanoparticle sample;

[0351] mixing the bioactive agent or cargo with the nanoparticle sample to provide a mixture; and

[0352] adding water or an aqueous solution to the mixture to cause the nanoparticles to shrink and trap the bioactive agent or cargo therein.

[0353] In certain embodiments, provided herein is a composition comprising any one or more of the above-described nanoparticles, any one or more of the above-described food powders, any one or more of the above-described nanofibers, or any combination thereof. In certain embodiments, the composition may further comprise a pharmaceutically acceptable excipient, carrier, or diluent. In certain embodiments, it is contemplated that mixtures of any two or any three of the nanoparticles, nanofibers, and / or food powders described herein may be used for the uses and / or methods described herein. In certain embodiments, for example, a mixture of nanoparticles and nanofibers may be used; a mixture of nanoparticles and food powders may be used; a mixture of nanofibers and food powders may be used; or a mixture of nanoparticles, nanofibers, and food powders may be used. BRIEF DESCRIPTION OF THE DRAWINGS

[0354] Figure 1 Shows a transmission electron micrograph of nanoparticles prepared from tart cherries (A). The nanoparticles were adsorbed onto a carbon-coated nickel grid for 1 min by floating the grid on a 50 μl droplet of the extract. The grid was removed, blotted at the edges, and floated on a 1% uranyl acetate droplet. After 30 s, the grid was removed, blotted at the edges, and examined directly using a Leo electron microscope. In the liquid medium, the nanoparticles vary in size between 50-100 nm in diameter. Panel B shows a magnified view of the nanoparticles. Arrows indicate fibrillar structures emanating from the nanoparticles;

[0355] Figure 2 Shows a magnified view of the nanoparticles observed under EM. Panel A - Two nanoparticles that have shed their outer structure (arrow 2) expose a smoother inner shell (arrow 1). Panels B, C - Show the detailed morphology of the outer shell containing fibrils. Arrow 1 shows the region of the fibril with a helical filamentous structure. The helical filamentous structure is wrapped with fibrils (arrow 2). Panel C shows a region with a simple fibril structure peeled off from the helical filament. Panel D shows a fibril mat (arrow) formed during the potential natural dissociation of the complex when stored as a solution;

[0356] Figure 3Shows the effect of pectinase (polygalacturonase) treatment on the stability of nanoparticles. 1 ml of a dialysis extract containing nanoparticles (0.8 - 1 mg polyphenol equivalent / ml) was treated with pectinase (1 unit / ml extract) for 15 min. The nanoparticles were adsorbed onto carbon-coated nickel grids and observed after staining with uranyl acetate as described previously. Panel A - After polygalacturonase treatment of the extract, spherical complexes can be seen to dissolve into smaller vesicles and filamentous structures (boxed area), indicating the presence of macromolecular structures containing α-1,4-glycosidic bonds of polygalacturonic acid. Panel B shows an enlarged version of the boxed area. Panels C and D show the effect of treating the nanoparticles with cellulase (β-1,4-glucanase), which strips the filamentous outer shell of the complexes, leaving the core, indicating the presence of β-1,4-glucan-type components in the filaments;

[0357] Figure 4 Shows the effect of trypsin treatment on the structure of nanoparticles prepared from sour cherries. 1 ml of a dialysis extract was treated with 1 unit of trypsin for 15 min and the nanoparticles were detected as described above. Trypsin treatment resulted in the dissolution of the outer filamentous structure (Panel, stained with ruthenium red), manifested as a darkly stained area around the spherical internal pectin shell of the nanoparticles. A tendency for the shell-like structures to fuse together was also observed after cellulase treatment (see Figure 3 ). Dissolution of the outer shell by trypsin indicates that the outer filamentous shell is also composed of proteins (i.e., extended types of glycoproteins found in cell walls) and peptides that may be derived from their degradation during maturation and senescence. The panel shows an enlarged view of the shell-like structure. Panel C shows partially digested nanoparticles, which show the filamentous outer shell dispersed into fibril / fibril-like structures. Panel D shows nanoparticles that have been stripped of the fibril-like structures. Arrows show the spherical shell left after dissolution of the fibril-like structures. Panel E shows an enlarged view of the fibril / fibril-like structures, showing the intertwined components that may form the fibril / fibril-like structures. The fibril / fibril-like structures are not filamentous and appear to lack left-right symmetry, and are manifested as helically arranged molecules that will wind around their own axes to form fibril-like structures with formed primary, secondary, and tertiary rope-like forms;

[0358] Figure 5Shows a scanning electron micrograph of a freeze-dried dialyzed tart cherry extract, which shows nanoparticles. Removal of water seems to increase the size of the nanoparticles, possibly causing the outer fibril portion to collapse. Without wishing to be bound by theory, in an aqueous environment, the outer portion of the nanoparticles seems to be free and extended, and the structure can be held together at least in part by hydrogen bonding. When water is removed, the fibrillar structure may tend to fuse with the pectin core of the nanoparticles and also swell, as there are no water molecules to facilitate hydrogen bonding. While in solution, the nanoparticles typically show a size distribution in the range of 25 - 50 nm in diameter, and after freeze-drying, they are 200 - 800 nm in size, with some diameters reaching above the micron level;

[0359] Figure 6 Shows a scanning electron micrograph of a dialyzed extract from tart cherries, showing the formation of multiple structures, which include flakes (arrow 1), tubular regions (arrow 2), and fibrils (arrow 3). The budding of nanoparticles (arrow 4) can be seen in some regions. These structures represent intermediate stages in the formation of nanoparticles;

[0360] Figure 7 Shows a scanning electron micrograph (plate A) and a transmission electron micrograph of nanofibers isolated from ethanol-bleached tart cherries. The tart cherry fruit was incubated in 50% ethanol to remove polyphenols (anthocyanins), washed, and homogenized in water. After removing debris, the homogenate was dialyzed against water, and the dialyzed extract was freeze-dried for SEM and used directly for TEM. Plate A shows the nanofibers and the nanofilm structure of the nanofibers (arrow 1, arrow 2). After staining with uranyl acetate, the nanofibers appear as long (microns or more) structures (arrow 1) with a diameter of 5 - 10 nm (plate B). These fibers still retain the ability to form helical structures (arrow 2) in solution. As shown, comparatively, nanofibers and nanoparticles have different structures;

[0361] Figure 8Shows the effect of detergents on the stability of nanoparticles. The dialyzed extract of tart cherries was incubated in a 6 - 8 kDa cut-off dialysis bag in the presence of increasing concentrations of lipid-unstable detergents such as Triton-X 100 and sodium deoxycholate, and dialyzed against water with the pH adjusted to 4 for 12 h. The absorbance of polyphenols inside the dialysis bag was measured at 520 nm (benzopyran) and 260 nm (phenolic ring). The detergent treatment did not disrupt the complex as no loss of polyphenol content was observed after extensive dialysis. If the nanoparticles contain lipids as structural entities / components, the detergent treatment would result in the leakage of polyphenols from the dialysis bag into the dialysate, correspondingly reducing the absorbance of the extract inside the dialysis bag. When the concentration of Triton-X 100 in the solution increased, the increase in the absorbance of Triton-X 100 at 260 nm might be due to the absorption of the phenyl moiety of Triton-X 100 at 260 nm;

[0362] Figure 9 Shows the organic composition of the nanoparticles obtained by filtering the homogenate through a size exclusion column (PD 10). The nanoparticles and nanofibers were separated and freeze-dried into powder. The powder (400 μg) was dissolved in 100 μl of pyridine, and 100 μl of BSTFA:TMCS mixture (99:1) was added. The solution was incubated at 80 °C for 1 h. 1 μl was injected directly for GC-MS analysis. The non-hydrolytic trimethylsilylation (TMS) of organic acid standards (A), nanoparticles (B), and nanofibers (C) and their separation using GC-MS are shown, indicating the presence of malic acid. As shown, relatively, nanofibers and nanoparticles are different types of structures with different compositions, while malic acid is a common component. The lower panel shows the mass spectrum of the reference trimethylsilyl derivative of malic acid;

[0363] Figure 10 Shows the trimethylsilyl derivatives of sugars in nanoparticles (referred to as nanocomplexes in the figure) and nanofibers (referred to as nanofilaments in the figure) (upper panel) and sugar standards (lower panel). Before derivatization with BSTFA, the nanoparticles and nanofibers were digested with trifluoroacetic acid (TFA). The major sugars in the nanoparticles are mannose, galactose / galacturonic acid, and glucose. The nanofibers are rich in arabinose and a small amount of glucose, as well as galactose / galacturonic acid. The amounts are relative as the TFA digestion is harsh and may degrade some components. Galactose and galacturonic acid provide similar peak distributions, so this peak may represent both compounds. The results mainly show that hexoses are dominant in the nanoparticles and pentoses are dominant in the nanofibers;

[0364] Figure 11Shows SDS-PAGE analysis of proteins isolated from the sour cherry fraction and stained with Coomassie blue. Proteins were isolated from whole fruits using Trizol extraction. Under conditions that inhibit protease activity (such as in the presence of phenol, guanidinium isothiocyanate), after adding water and phase separation, protein degradation is minimal and the proteins are present in the organic phase (phenol:chloroform). Lane 1 - molecular weight standard reference; Lane 2 - proteins isolated from whole fruits; Lane 3 - proteins from aqueous fruit homogenate; Lane 4 - proteins from cell debris juice obtained after centrifugation at 1500×g; Lane 5 - proteins in the clarified juice obtained after centrifugation at 15000×g; Lane 6 - freeze-dried powder of the dialyzed extract dissolved and loaded into sample buffer; Lane 7 - proteins extracted from the freeze-dried powder using the organic phase of Trizol reagent. After extracting the fruits with water, the juice mainly contains low molecular weight peptides (25 kD) that remain in the organic phase. When observed after SDS-PAGE and Coomassie blue staining, the freeze-dried powder of the dialyzed extract (Lane 6) does not show discrete protein bands but shows a smear of peptides (Lane 6). Trizol extraction and phase separation of the extract with water should theoretically result in the migration of proteins to the organic-rich phase (phenol:chloroform phase). No staining was observed with Coomassie Brilliant Blue (Lane 7), indicating that the peptides may have migrated to the aqueous phase due to increased hydrophilicity (association with carbohydrates, polyphenols). Equal amounts of sample (15 μg protein) were loaded in each lane based on fresh weight;

[0365] Figure 12Shows the SDS-PAGE analysis of peptides in nanoparticles. Extraction and dialysis were carried out in water and buffer (potassium citrate, 300 mM, pH 6, final pH after homogenization was pH 5) to improve the stability of polyphenols (anthocyanins). Panel A shows that when the gel was incubated in 10% acetic acid (v / v) in water, the gel before staining showed pink due to polyphenols (anthocyanins). Panel B shows the same gel stained with Coomassie Brilliant Blue to show the peptides. Lane 1 - molecular weight standard reference; Lane 2 shows the association of polyphenols (anthocyanins) and polypeptides in the nanoparticles of the freeze-dried powder of the dialyzed water extract loaded in the sample buffer. After Trizol extraction, the supernatant (aqueous phase, Lane 3) showed the presence of peptides and their association with polyphenols (anthocyanins). Lane 4 - buffered dialyzed extract powder loaded in the sample buffer. Lanes 5, 6, and 7 correspond to the supernatant, interphase, and organic phase of the dialyzed extract powder obtained after Trizol extraction. Note that most of the peptides and polyphenols (anthocyanins) are in the water (hydrophilic) phase of the Trizol extract (Lane 5). Lane 7 corresponding to the organic phase did not show anthocyanin or peptide staining. Lanes 8, 9, and 10 correspond to the supernatant, interphase, and organic phase of the dialyzed extract powder of ethanol-bleached cherries obtained after Trizol extraction, in which most of the polyphenols (anthocyanins) have been removed. Lane 8 in Panel B shows Coomassie Blue staining. The interphase and organic phase of the bleached cherry dialyzed extract showed the least peptide staining (Lanes 9, 10; Panel B). After SDS-PAGE of the dialyzed extract powder, the similarity of staining with propidium iodide and Coomassie Brilliant Blue revealed the association of pectin and polypeptides in the nanoparticles (Panels C and D). Panel C shows the staining pattern using propidium iodide (10 μg in water, 0.2% in water). Lane 1 corresponds to a standard sample of commercially available pectin. Lane 2 represents the dialyzed powder of the dialyzed extract; Lane 3 corresponds to the dialysate, and this fraction showed relatively stronger polypeptide staining. Lane 4 corresponds to a polygalacturonic acid standard, which showed staining with propidium iodide rather than polypeptide staining. The gelatinous-like precipitate of the acid cherry homogenate also showed the presence of pectin and polypeptides (Lane 5);

[0366] Figure 13Shows the dialyzed extracts of ethanol-bleached and unbleached cherries containing nanofibers and nanoparticles respectively, which were subjected to SDS-PAGE and immunolocalization with a structure-specific monoclonal antibody (rat IgM, www.Plant Probes.net). Bound antibodies were detected with alkaline phosphatase-conjugated goat anti-rat IgG. Panel A shows the polypeptides in nanofibers (lane 2) and nanoparticles (lane 3) by Coomassie Brilliant Blue staining. The nanofibers from bleached cherries are highly hygroscopic and become gelatinous, making it difficult to enter the gel. Panel B shows the reactivity of the antibody against homogalacturonan (oligomeric 1,4-linked methyl galacturonate; LM 20). The dialyzed extract of bleached cherries showed reactivity with this antibody, indicating the exposure of homogalacturonan units in the nanofibers. However, the reactivity of the dialyzed extract of unbleached cherries (containing spherical nanoparticles) was much lower (Panel B, lane 3). This is again reflected in the dot blot intensity shown below Panel B. In the spherical nanoparticles, the pectin moiety forms a shell and may be masked by peptides, hemicelluloses, and polyphenols (anthocyanins). These may hinder the entry of anti-homogalacturonan antibodies into the interior. In the nanofibers, the pectin moiety may be exposed, allowing strong interaction with anti-homogalacturonan antibodies. Both nanofibers and nanoparticles showed only slight reactivity against extensin (which recognizes the LMI epitope carried by a series of HRGPs [hydroxyproline-rich glycoproteins]), indicating that extensin (which is the major cell wall protein in fruits) (Panel C) may be incomplete but may contain peptides derived from extensin. Very strong reactivity was observed against arabinogalactan-protein (glycoprotein; LM14 epitope) (hemicellulose protein) in the complexes and fibers, indicating that this may be a major component of the basic structure of nanoparticles or nanofibers (Panel D). The lower panel below Panel A shows the cross-reactivity of nanoparticles and nanofibers against xyloglucan (LM 15; recognizes the XXXG motif of xyloglucan). During blotting, there was no reaction between the antibody and the molecules transferred from the gel. Dot blot showed strong reactivity of nanofibers against xyloglucan but no reactivity against nanoparticles;

[0367] Figure 14Reduced SDS-PAGE of nanoparticles (lane 2) and nanofibers (lane 3) is shown. 100 µg each was dissolved in a 10% gel. (A) Gel A was incubated in 10% acetic acid and then stained with Coomassie Brilliant Blue (gel B). Gel bands highlighted by numbers were identified by LC / MS / MS as follows: Band 1: PR protein fragment; endo-1,3-β-glucosidase from cherry (accession number #P50694); Band 2: PR protein fragment; major cherry allergen Pru a1 (accession number #O24248); Band 3: most likely a fragment of Band 1. Panels B and C show the amino acid sequences of β-glucosidase (accession number P50694) and Pru a1 (accession number O24248), respectively;

[0368] Figure 15 FT-IR spectra showing comparison of lyophilized powders of dialyzed extracts of ethanol bleached and unbleached cherries (upper panel) with several components of structural similarity (lower panel) are shown. Due to the complex nature of the components in the extracts, it is difficult to obtain precise assignment of structures and functional groups. Comparison with the spectra of standards showed the presence of OH stretching (carbohydrates, polyphenols, 3000 - 3500 cm-1) and several peaks due to CH-, COO-, CN-, etc. stretching from 500 - 2000 cm-1. Similarities to true pectin, protein, peptide backbone (C-N-C-N) are evident. BSA and PGA are included in the figure as standards for comparison;

[0369] Figure 16 Wide-angle X-ray diffraction of lyophilized powders of dialyzed extracts (nanoparticles) and dialyzates (pectin) obtained after water extraction of sour cherries is shown. The spikes are caused by deflection of the sample holder. Both the dialyzed extract and dialyzate powders show very diffuse bands from 2θ 10° to 30°, indicating the absence of a crystal structure in the dialyzed extract (DE) and dialyzate (DZ). Cellulose (β-1,4-glucan) is the only carbohydrate present in the cell wall in a crystal structure. This result indicates the absence of cellulose product (β-1,4-glucan moiety) as a major component in the nanoparticles. Pectin has an amorphous structure, enabling them to form sheets, vesicles, and filaments and not showing a clear sharp diffraction pattern;

[0370] Figure 17Shows the results indicating the structural model of the proposed nanoparticles. An enlarged view of the nanoparticles observed by TEM in the sour cherry homogenate is provided in Panel A, and the enlarged area is shown as in Panel B. The aqueous homogenate of the sour cherry was centrifuged (15000 x g) at 4 °C for 15 min to precipitate debris and gel-like pectinaceous materials. The homogenate was passed through a PD 10 size exclusion column packed with Sephadex G 25 (exclusion limit 5 kD, 7.5 ml bed volume, Amersham Biosciences), and the void volume fraction was collected. The fraction containing the nanoparticles was examined by transmission electron microscopy. The figure shows a collapsed region around the core, presenting a ring-like structure (Panel A, arrow 1), surrounded by a region of lower electron density composed of helical filamentous structures that may contain pectin and protein (Panel A, arrow 2), sometimes located in the helical organization as previously seen (arrow 2). Around this layer, there is a fibrous region of slightly higher electron density forming the outside of the nanoparticles (Panel A, arrow 3), which may contain filaments of arabinogalactan-protein and may contain polyphenols (i.e., anthocyanins). An enlarged view of the nanoparticles is shown as in Panel B. The helical elements are indicated by arrows;

[0371] Figure 18 Shows the effect of feeding a nanoparticle (NP) solution to mice on the body weight changes of wild-type and ETKO mice. Mice (6 - 7 months old) were divided into 4 groups of 5 - 6 mice each (wild-type untreated (WT U), wild-type treated (WT T), knockout untreated (KO U), and knockout treated (KO T)). The nanoparticle-treated mice received a dose of 133 μg equivalent of NP solution / 40 g body weight / day (100 mg extract / kg body weight) by gavage, 5 times a week. The untreated mice received water. The experiment lasted for 4 weeks. In the test groups, the first week of NP treatment had no effect on the body weight of the mice. However, after weeks 2, 3, and 4, continued NP treatment prevented the body weight gain of the ETKO mice. Although there was no significant change in the weight loss between the untreated WT and the WT treated under these specific doses / conditions, the decrease in body weight gain between the untreated KO and the treated KO was statistically significant (P < 0.05).

[0372] Figure 19Shows the effect of nanoparticle (NP) treatment on the change in triglyceride levels in the liver. The tissue was derived from the experiment described in Example 2. The triglyceride levels in the liver tissue were evaluated by the method described in the Wako L-type TG M assay kit (Wako Life Sciences, CA, USA). There was a significant decrease in triglyceride levels in ETKO mice receiving NP treatment. The upper panel shows the data obtained from male and female mice. The lower panel shows the data obtained from male mice. The reduction of liver triglycerides by NP treatment supports the use of NP for the prevention of lipid deposition and related pathological symptoms in the liver, which are defined by, for example, the activities of marker enzymes (such as alanine transaminase and aspartate transaminase) and the structural reversal closer to the liver structure of wild-type mice. Similar abnormalities are also observed in humans with non-alcoholic fatty liver disease and / or NASH, indicating that the nanoparticles and / or food powders described herein can provide options for treating and / or reversing such conditions;

[0373] Figure 20 Shows the histopathology of liver sections from mice treated as described in Example 2. Frozen sections were stained with Oil Red-O stain (Sigma-Aldrich) to make lipid droplets containing triglycerides visible as red droplets. The top two panels / lines show images of stained liver sections from wild-type (untreated - top; nanoparticle-treated - bottom) mice. Quantification of the red-stained areas showed little change in control and treated mice. Each panel / line shows sections from 3 independent mice. The bottom two panels / lines show the appearance of liver sections from ETKO untreated (top) and NP-treated (bottom) mice. Generally, liver sections from ETKO mice showed several blank areas. These areas were reduced in treated ETKO mice. In addition, the structure of the liver tended to be similar to that of WT (relatively more purple areas compared to the control). The area of the Oil Red-stained region was significantly reduced after treatment (lower panel of the figure). Abbreviations: wild-type untreated (WT-U), wild-type treated (WT-T), knockout untreated (KO-U), and knockout treated (KO-T). "SC" appearing in the figure legend indicates "sour cherry";

[0374] Figure 21 Shows the serum parameters of nanoparticle (NP)-treated and untreated mice. There were no significant changes in albumin, globulin, and their ratio. The total protein level in the serum seemed to decrease slightly. The values are the mean ± SEM of 3 independent treatments. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0375] Figure 22Shows the changes in the levels of serum physiological function markers (ALT, AST, cholesterol, and CK) in control and NP-treated mice. These analyses were performed by standard methods using test kits in the Pathology Laboratory of the University of Guelph Laboratory Services. Alanine aminotransferase and aspartate aminotransferase are enzymes that indicate the functional status of the liver. If liver function is low or if the liver is inflamed, more of these enzymes are secreted into the blood. In obese mice, the levels of ALT and AST showed significant and substantial decreases in response to NP treatment. Even in wild-type mice with low levels of these enzymes, NP treatment caused a decrease. NP treatment appears to normalize liver function in obese mice. In both wild-type and obese mice, the cholesterol level in the serum also decreased in response to NP treatment. High creatine kinase levels are an indicator of muscle injury, which also showed a substantial decrease in NP-treated obese mice. These results support the anti-inflammatory function of NP. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0376] Figure 23 Shows the levels of glucose and phosphorus in the blood of untreated and nanoparticle-treated mice. There were no significant changes in the phosphorus levels in the sera of untreated and treated wild-type and ETKO mice. The glucose levels were similar in wild-type and showed a decreasing trend in obese mice after treatment with the NP solution;

[0377] Figure 24 Shows the evaluation of STAT4 gene expression changes in response to treatment with the nanoparticle solution as described in Example 2. The PCR products were quantified by agarose gel electrophoresis and stained with ethidium bromide. There were no significant changes in the STAT4 levels between untreated and treated wild-type mice. There was a decreasing trend in STAT4 expression in ETKO mice fed the NP solution. In this test, the values were not significantly different from the levels in untreated ETKO mice, but a decreasing trend was observed. The values are the mean ± SEM of 4 - 5 mice per group. STAT4 (signal transducer and activator of transcription 4) is a transcription factor of the STAT family of proteins. STAT4 is phosphorylated by Janus kinases, which enables it to dimerize and translocate to the nucleus during cytokine signal transduction and increase gene expression. An increase in Stat 4-related gene expression is an indication of activation of the inflammatory pathway;

[0378] Figure 25Shows the evaluation of NF-kB gene expression changes in response to treatment with the nanoparticle solution described in Example 2. The NF-kB band intensity was quantified by Western blot and chemiluminescent detection. The expression of NF-kB was upregulated in obese mice, indicating an increase in the function of the inflammatory pathway. Treatment with the nanoparticle solution did not result in significant changes in NF-kB levels in wild-type or obese mice. Values are the mean ± SEM of 4-5 mice per group. Nuclear factor-kB (NF-kB) is a key protein involved in initiating inflammatory signaling through cytokines such as interleukin and tumor necrosis factor-α. This pathway is complex and may have pro-inflammatory and anti-inflammatory effects depending on the condition. Reduced NF-kB signaling is considered an indication of a reduced degree of inflammation;

[0379] Figure 26 Shows the evaluation of TNFα gene expression changes in mice in response to treatment with the nanoparticle solution described in Example 2. Quantification was performed by RT-PCR, and the products were separated by agarose gel electrophoresis and ethidium bromide staining. There were no significant changes in TNFα gene expression levels between untreated and treated wild-type mice. There was a significant decrease in TNFα expression in ETKO mice fed the NP solution. Values are the mean ± SEM of 4-5 mice per group. TNFα is a key protein involved in signal transduction pathways associated with inflammation caused by infection and autoimmune activation. For example, it is usually necessary to downregulate TNFα to control chronic autoimmune diseases. Reducing TNFα helps reduce obesity, which is also associated with an inflammatory state in the body;

[0380] Figure 27 Shows the evaluation of IL6 gene expression changes in mice in response to treatment with the nanoparticle solution described in Example 2. There were no significant changes in IL6 levels between untreated and treated wild-type mice. There was a significant decrease in IL6 expression in ETKO mice fed the NP solution. Values are the mean ± SEM of 4-5 mice per group. IL6 is a cytokine that mediates pro-inflammatory and anti-inflammatory pathways. Activation of IL6 is known to lead to the development of a chronic inflammatory state, resulting in various diseases. Downregulating IL6 can help reduce inflammation and chronic conditions such as obesity;

[0381] Figure 28Shows the evaluation of changes in FASN gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating PCR products on an agarose gel, and ethidium bromide staining was used to visualize the bands. FAS levels were significantly decreased in NP-treated wild-type mice. There was a trend of decreased FAS expression in ETKO mice fed the NP solution. In this test, the values were not significantly different from the levels in untreated ETKO mice. The values are the mean ± SEM of 4-5 mice per group. FAS (fatty acid synthase) is an enzyme involved in fatty acid biosynthesis. Fatty acids are converted to triglycerides, and increased fatty acid levels can lead to fat deposition, resulting in obesity. Therefore, a decrease in the level of this enzyme may be beneficial for reducing triglyceride biosynthesis and deposition;

[0382] Figure 29 Shows the evaluation of changes in ATGL gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating PCR products on an agarose gel, and ethidium bromide staining was used to visualize the bands. There was no significant difference in ATGL levels between control and NP-treated wild-type mice. Similarly, the ATGL expression levels were the same in untreated and NP-treated ETKO mice. The values are the mean ± SEM of 4-5 mice per group; ATGL (adipose triglyceride lipase) is an enzyme involved in the initiation of the catabolism of triglycerides to fatty acids. ATGL function may be involved in the development of metabolic syndrome;

[0383] Figure 30 Shows the evaluation of changes in HSL gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating PCR products on an agarose gel, and ethidium bromide staining was used to visualize the bands. The HSL transcript level was significantly increased between control and NP-treated wild-type mice. The HSL expression levels were the same in untreated and NP-treated ETKO mice. The values are the mean ± SEM of 4-5 mice per group. HSL (hormone-sensitive lipase) is a key enzyme involved in the hydrolysis of triglycerides in adipose tissue and is a key enzyme involved in energy production. HSL acts in conjunction with ATGL to release free fatty acids from triglycerides. When energy is required, such as during fasting, this enzyme is typically activated in response to catecholamines and thus plays a role in mobilizing stored lipids. In steroid biosynthesis, it also releases fatty acids from cholesterol esters;

[0384] Figure 31Shows the evaluation of changes in LPL gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating the PCR products on an agarose gel, and ethidium bromide staining was used to visualize the bands. In wild-type mice, the level of LPL transcripts did not change in response to NP treatment. In contrast, the LPL expression level was significantly decreased in NP-treated ETKO mice. The values are the mean ± SEM of 4-5 mice per group. LPL (lipoprotein lipase) is an enzyme that hydrolyzes triglycerides bound to lipoproteins, thereby releasing free fatty acids and monoacylglycerol. LPL is similar to other lipases such as pancreatic lipase and hepatic lipase. LPL is present in several tissues, such as the heart, muscle, and adipose tissue, and they are present in the cell layer close to the capillary lumen. LPL may affect lipoprotein metabolism within capillaries. LPL activity is differentially regulated by hormones such as insulin and adrenaline. It is known that LPL levels increase after a high-fat diet or a high-carbohydrate diet and may have a function in the development of obesity;

[0385] Figure 32 Shows the evaluation of changes in PGC1-α gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating the PCR products on an agarose gel, and ethidium bromide staining was used to visualize the bands. In wild-type mice, the level of PGC1-α transcripts did not change in response to NP treatment. In contrast, in NP-treated ETKO mice, the PGC1-α expression level was significantly decreased. The values are the mean ± SEM of 4-5 mice per group. PGC1-α (peroxisome proliferator-activated receptor-γ coactivator) belongs to the family of transcriptional coactivators and is involved in regulating energy metabolism related to carbohydrates and lipids. PGC1-A is activated under stress conditions. It is also known that this protein activates NF-kB, which is involved in enhancing the inflammatory pathway. A decrease in the level of PGC1-A can thus downregulate inflammation;

[0386] Figure 33 Shows the evaluation of changes in PPAR-α gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating the PCR products on an agarose gel, and ethidium bromide staining was used to visualize the bands. In wild-type mice and ETKO obese mice, the level of PPAR-α transcripts did not change in response to NP treatment. The values are the mean ± SEM of 4-5 mice per group. PPAR-α (peroxisome proliferator-activated receptor-α) belongs to a group of transcription factors located in the nucleus. PPAR-α has a key regulatory function in lipid metabolism in the liver, including stimulating genes involved in fatty acid uptake, transport, and catabolism;

[0387] Figure 34Shows the evaluation of the change in PPAR-γ gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating the PCR products on an agarose gel and visualization of the bands was achieved by ethidium bromide staining. In wild-type mice treated with NPs, the PPAR-γ transcript was significantly reduced. There was no significant change in the PPARγ level in obese mice after NP treatment. The values are the mean ± SEM of 4-5 mice per group. PPAR-γ (peroxisome proliferator-activated receptor-γ) is another transcription factor located in the nucleus. This protein is involved in adipocyte proliferation and promotes the development of obesity. PPARγ is expressed in adipose tissue and at a lower level in muscle. It is known that PPARγ affects the development of obesity and type II diabetes;

[0388] Figure 35 Shows the evaluation of the change in CTL1 gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating the PCR products on an agarose gel and visualization of the bands was achieved by ethidium bromide staining. In wild-type mice, the level of the CTL-1 transcript did not change in response to NP treatment. In contrast, the CTL1 expression level was significantly reduced in ETKO mice treated with NPs. The values are the mean ± SEM of 4-5 mice per group. CTL-1 (choline transporter-like protein 1) is a membrane-bound enzyme and is found in the plasma membrane and mitochondria of brain cells. It is involved in the transport of choline in mitochondria for the biosynthesis of phosphatidylcholine and membrane biogenesis. Enhanced production of macrophages through inflammation leads to overexpression of CTL-1 and seems to be associated with increased inflammation. Reducing high levels of membrane biogenesis may help reduce cell enlargement and obesity-related changes;

[0389] Figure 36 Shows the evaluation of the change in PSS 2 gene expression in response to treatment with the nanoparticle solution as described in Example 2. Quantification was performed by separating the PCR products on an agarose gel and visualization of the bands was achieved by ethidium bromide staining. In wild-type mice, the level of the PSS 2 transcript did not change in response to NP treatment; however, a lower but significant reduction was shown in ETKO mice. The values are the mean ± SEM of 4-5 mice per group. PSS 2 (CDP-diacylglycerol-serine O-phosphatidyltransferase 2; phosphatidylserine synthase 2) is an enzyme involved in the biosynthesis of phosphatidylserine. This protein is localized in the mitochondria. PSS 2 knockout mice showed a normal lifespan. The results suggest that the effect of nanoparticle solution treatment may be targeted at specific genes rather than all genes involved in the lipid biosynthesis pathway;

[0390] Figure 37Shows transmission electron micrographs (TEM) of nanofibers from 2 independent nanofiber preparations. The left panel shows nanofibers isolated from ethanol-bleached tart cherries using freeze-drying (lyophilization). The right panel shows nanofibers isolated by nano spray drying;

[0391] Figure 38 Shows the complex of nanofibers with iron. The nanofiber preparation (2 mg) was dissolved in 2 ml of water and mixed with 1 mM ferrous chloride. The solution was incubated for 2 h and dialyzed overnight against water (2X) to remove unbound iron. The dialyzed solution was examined under the electron microscope without heavy metal staining (i.e., not stained with uranyl acetate which is commonly used to increase contrast). The nanofiber complex was stained with iron (instead of uranyl acetate), showing the potential of nanofibers as iron carriers;

[0392] Figure 39 Shows the uptake of calcein-loaded nanofibers in mammalian cells (calcein-nanofiber adduct). Calcein (Ex 494 nm / Em 517 nm) is not permeable through the membrane by itself and can be taken up at low levels by endocytosis (A, C). Ethanol-bleached cherries were homogenized in water and also contained 1 mg / g fresh weight equivalent of calcein, and the supernatant was dialyzed against water. Calcein complexed with nanofibers remained inside the dialysis bag and was used for uptake measurements by confocal microscopy. The uptake of calcein alone in HT 29 cells (upper left panel) and normal intestinal cells (lower left panel) was relatively very low (panels A and C). Calcein-loaded nanofibers were taken up into discrete compartments in the colorectal cancer cell line HT29 (upper right, B) and normal human intestinal CRL 1790 (lower right, D) cells. (Scale bar - 10 μm). Panels B and D show the enhanced uptake of the nanofiber-calcein complex in both types of cells;

[0393] Figure 40Shows nanoparticles isolated from unbleached tart cherries (A, C, E) and nanofibers isolated from ethanol-bleached tart cherries (B, D, F) being taken up into human cells (HT-29, CRL 2158, CRL1790). The nanoparticles and nanofibers were chemically conjugated with Dylight 650 and extensively dialyzed (3x) in water to remove unbound dye. The Dylight was conjugated to the nanoparticles and nanofibers using a method similar to that commonly used to label the amino groups of antibodies and is described in detail in the provided SOP sheet (Thermofisher). In summary, Dylight was activated with N-hydroxysuccinimide ester, which reacts with primary amines to form stable covalent amide bonds. The Dylight-conjugated nanoparticles and nanofibers were removed using a size exclusion column. The conjugated products were stored at -20 °C in the dark. Cells were seeded and allowed to grow for 48 h. The conjugated nanoparticles and nanofibers (~5 μM Dylight equivalent in 3 ml of medium) were added to the medium and the cells were incubated for an additional 24 h. The cells were maintained on Petri dishes (3.5 cm in diameter) and observed under a confocal microscope (Leica) with an excitation wavelength of 633 nm and an emission wavelength of 680 nm. Panels A and B show the uptake of Dylight-conjugated nanoparticles and nanofibers by HT 29 cells (colorectal cancer cell line), respectively; Panels C and D show the uptake of Dylight-conjugated nanoparticles and nanofibers by CRL 2158 cells (MDR colorectal cancer cell line), respectively; and Panels E and F show the uptake of conjugated nanoparticles by CRL 1790 cells (normal human intestinal cells), respectively. The insets in the panels are magnified composite images of the cells. (Scale bar - 10 μm);

[0394] Figure 41Shows the cytotoxicity of nanofiber-paclitaxel against human colorectal cancer cells (HT 29). Shows the live-dead cell analysis of HT 29 colorectal cancer cells observed under a confocal microscope. The assay kit (Invitrogen) contains two fluorescent dyes, calcein AM ester (Ex 494 nm, Em 517 nm), which specifically enters live cells, de-esterifies and stains the live cells green. Dying cells and dead cells are membrane-damaged (leaky plasma membrane) and allow ethidium homodimer (Ex 517 nm / Em 617) to enter, staining the nucleus red. Cells are observed at 517 nm (green channel) for differentiating live cells and at 617 nm for visualizing dead cells. The composite image of the two wavelengths shows the cells are transitioning towards loss of cell viability (A, D, G; yellow). Panels B and C represent the control cells observed at 617 nm (red, dead cells) and 517 nm (green, live cells), respectively. Panel A is the composite image of untreated cells. Panels E and F represent the images of cells treated with paclitaxel (32 nM) recorded at the two wavelengths 617 and 517 nm, respectively. Panel D is the composite image. Panels H and I show the cells treated with paclitaxel + nanofiber (32 nM + 4 μg / ml nanofiber). Panel G is the composite of the red and green images;

[0395] Figure 42 Shows the cytotoxicity of nanofiber-paclitaxel against human colorectal MDR cancer cells (CRL 2158). Shows the live-dead cell analysis of CRL 2158 multidrug-resistant colorectal cancer cells observed under a confocal microscope. The assay kit (Invitrogen) contains two fluorescent dyes, calcein AM ester (Ex 494 nm, Em 517 nm), which specifically enters live cells, de-esterifies and stains the live cells green. Dying cells and dead cells are membrane-damaged (leaky plasma membrane) and allow ethidium homodimer (Ex 517 nm / Em 617) to enter, staining the nucleus red. Cells are observed at 517nm (green channel) for differentiating live cells and at 617 nm for visualizing dead cells. The composite image of the two wavelengths shows the cells are transitioning towards loss of cell viability (A, D, G; yellow). Panels B and C represent the control cells observed at 617 nm (red, dead cells) and 517 nm (green, live cells), respectively. Panel A is the composite image of untreated cells. Panels E and F represent the images of cells treated with paclitaxel (32 nM) recorded at the two wavelengths 617 and 517 nm, respectively. Panel D is the composite image. Panels H and I show the cells treated with paclitaxel + nanofiber (32 nM + 4 μg / ml nanofiber). Panel G is the composite of the red and green images;

[0396] Figure 43 The cytotoxicity of nanofiber-paclitaxel against normal human intestinal cells (CRL 1790™) was shown. Live-dead cell analysis of CRL 1790 human colon normal epithelial cells observed under a confocal microscope was shown. The assay kit (Invitrogen) contains two fluorescent dyes, namely calcein AM ester (Ex 494 nm, Em 517 nm), which specifically enters live cells, de-esterifies and stains live cells green. Dying and dead cells are membrane-damaged (leaky plasma membrane) and allow ethidium homodimer (Ex 517 nm / Em 617) to enter, staining the nucleus red. Cells were observed at 517 nm (green channel) for differentiating live cells and at 617 nm for visualizing dead cells. The composite image of the two wavelengths shows that the cells are transitioning towards loss of cell viability (A, D, G; yellow). Panels B and C show control cells observed at 617 nm (red, dead cells) and 517 nm (green, live cells), respectively. Panel A is the composite image of untreated cells. Panels E and F show images of cells treated with paclitaxel (32 nM) recorded at the two wavelengths 617 and 517 nm, respectively. Panel D is the composite image. Panels H and I show cells treated with paclitaxel + nanofiber (32 nM + 4 μg / ml nanofiber). Panel G is the composite of the red and green images;

[0397] Figure 44 Scanning electron micrographs of food powders prepared from tart cherry, broccoli, and other food ingredients were shown. As described in Example 4, the food powders were prepared by blending a mixture of homogenized solutions of the components and subjecting the blended mixture to nano spray drying;

[0398] Figure 45 Transmission electron micrographs of an aqueous solution of the food powder were shown, which showed the ultrastructural features. The food powder had a flattened, elongated to spherical, tightly wound fibrous structure (see arrow labeled A). This structure was similar to the unstructured nanoparticles observed in tart cherry nanoparticles (see Figure 17 ). However, spherical structures similar to spherical cores (arrow labeled B) were observed, from which the fibrous structures emanated. The helical organizational structure (arrow C) was similar to the helical fibers observed in nanoparticles. An aliquot of 50 μl of the food powder suspension was placed on a glass slide, and a carbon-coated grid was floated on the solution with the coated side facing down for 30 s. The grid was blotted dry at the edges and stained with 0.1% uranyl acetate solution. The picture shows large aggregates of food powder particles that underwent dissolution into much smaller nanoparticles (arrow labeled A). Arrow B shows the nucleus of a nanoparticle with unwound fibers. The helical nature of the wound fibers is shown as arrow C;

[0399] Figure 46 Shows the evaluation of the antioxidant capacity of a food powder. The powder was dissolved in water, and the antioxidant capacity of the solution was determined by evaluating the DPPH radical scavenging capacity of the solution as polyphenol equivalents in micrograms (evaluated by the Folin-Ciocalteau reagent). A 0.1 mM Folin-Ciocateau reagent was prepared in methanol and added to the food powder solution in a specified amount. The antioxidant was reacted with 1 ml of DPPH reagent, and the absorbance (purple, absorption at 517 nm) was monitored. A decrease in absorbance at 517 nm was noted and expressed as the percentage of quenching compared to a control without polyphenols. Trolox was used as a positive control at the same concentration as the polyphenols and showed a TEAC value of 1. Each concentration point represents a single sample of the prepared food powder;

[0400] Figure 47 Shows the evaluation of the body weight changes of wild-type (WT) and ethanolamine knockout mice (KO) treated with a food powder and water. Experiments were conducted using 24-week-old Pcyt2 knockout mice (KO) and littermate control mice. Untreated (U) KO and wild-type mouse groups (n = 4 - 6 per group) were gavaged with 100 μL of water at the time of treatment. The treated (T) groups of KO and wild-type (WT) mice (n = 4 - 6 per group) were administered 100 μg of the food powder (in 100 μL of water) 5 times per week. Oral gavage for all groups continued for 8 weeks. At the end of the treatment period, the mice were sacrificed and blood and tissue samples were collected for analysis. Asterisks indicate significantly different values (* - P < 0.05; ** - P < 0.01);

[0401] Figure 48 Shows the effect of food powder treatment on the change in triglyceride levels in the liver. The tissue was derived from the experiment described in Example 4. The triglyceride levels in the liver tissue were evaluated by the method described in the Wako L-type TG M detection kit (Wako Life Sciences, Inc., California, USA). There was no significant decrease in triglyceride levels in wild-type and ETKO mice treated with the food powder. The values are the mean ± SEM of three individual samples. There seems to be a trend of triglyceride reduction in obese mice treated with the food powder. Reducing liver triglycerides by food powder treatment may be beneficial for individuals showing metabolic syndrome. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0402] Figure 49Shows the serum parameters of food powder-treated and untreated wild-type and ETKO mice. There were no significant changes in albumin, globulin, and their ratio. There was no significant difference in total protein between the control group and the treated group. Values are the mean ± SEM of 3 independent treatments. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0403] Figure 50 Shows the serum parameters of food powder-treated and untreated wild-type and ETKO mice. There were no significant changes in glucose, phosphorus, and urea levels. In obese mice treated with food powder, the triglyceride level seemed to have a slight decrease. Values are the mean ± SEM of 3 independent samples. Abbreviations: wild-type untreated (WT-U), wild-type treated (WT-T), knockout untreated (KO-T), and knockout treated (KO-T);

[0404] Figure 51 Shows the changes in the transcriptional levels of chemokines (chemotactic cytokines) in wild-type and ETKO mice treated with food powder. CCL-type chemokines are small glycoproteins secreted by activated T cells, which attract monocytes to the site of inflammation. CCL1 (C-C motif chemokine ligand 1) and its family members (CCL2, CCL3, CCL5...) are involved in the inflammatory process. A significant decrease in CCL2 and CCL5 was observed in wild-type mice in response to food powder treatment. There was a tendency for these chemokines to decrease after food powder treatment in ETKO mice, but there was no significant difference in this test. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. CCL1 exerts its function by binding to CCR8. CCL2 (monocyte chemoattractant protein 1; MCP1) is also involved in attracting monocytes to the site of inflammation and binds to the receptors CCR2 and CCR4. CCL3 (macrophage inflammatory protein-α; MIP1α) is involved in acute inflammation and is a leukocyte attractant. It binds to the receptors CCR1, CCR4, and CCR5). CCL5 binds to the CCR5 surface receptor and is involved in inflammation and cancer progression. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0405] Figure 52Shows the changes in the transcriptional levels of chemokines (chemotactic cytokines) in wild-type and ETKO mice treated with food powder. CCL-type chemokines are small glycoproteins secreted by activated T cells that attract monocytes to the site of inflammation. The figure shows the changes in the transcriptional levels of CCL6, CCL7, CCL17, and CCL19. CCL6 is unique to rodents and can bind to CCR1 during its action. CCL6 is expressed in macrophages during myeloid cell differentiation. A significant decrease in CCL6, CCL7, and CCL17 was observed in wild-type mice in response to food powder treatment. A significant decrease in CCL7 was observed in ETKO mice. No change in the CCL19 transcript was shown in either wild-type or ETKO mice. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. CCL6 exerts its function by binding to CCR1. CCL7 is also involved in attracting monocytes to the site of inflammation and binds to the CCR2 receptor. Aberrant expression of CCL7 is associated with tumorigenesis, activation of MMP-2, and metastasis. Therefore, downregulation of CCL7 may be highly beneficial for cancer prevention. CCL17 is involved in the chemoattraction of lymphocytes and in the induction of inflammatory diseases such as atherosclerosis and inflammatory bowel disease. CCL19 is involved in lymphocyte recirculation. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0406] Figure 53 Shows the changes in the transcriptional levels of the CCL22 chemokine (chemotactic cytokine) in wild-type and ETKO mice treated with food powder. CCL22 is produced by tumors and tumor-infiltrating T cells, causing immunosuppression and immune cell evasion from tumors, thus contributing to tumor progression. Overexpression of CCL22 in immune cells is caused by interleukin-α. The levels of CCL22 in wild-type and ETKO mice did not change in response to food powder treatment. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0407] Figure 54Evaluation of the change in transcript levels of CCR-type receptors in wild-type and ETKO mice treated with food powder is shown. Chemokine receptors of the CCR family are expressed in blood cells such as eosinophils, basophils, lymphocytes, macrophages, and dendritic cells, and the enhancement of their expression / activity is associated with increased inflammation. When CCR binds to the ligand chemokine (CCL family), many signal transduction pathways are activated. Food powder treatment did not alter the expression levels of CCR1 and CCR6 in wild-type and ETKO mice. CCR2 and CCR8 in wild-type mice showed significant downregulation in response to food powder treatment, indicating that food powder can downregulate the inflammatory levels causing CCR. In addition, there was significant downregulation of CCR8 in ETKO mice fed with food powder. Thus, the decrease in chemokine and their receptor levels seems to be a response to food powder treatment. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0408] Figure 55 Evaluation of the change in transcript levels of CSF (colony-stimulating factor) in wild-type and ETKO mice treated with food powder is shown. CSF is a cytokine produced by granulocyte / macrophage (GM-CSF), macrophage (M-CSF), and granulocyte (G-CSF). The enhancement of its expression / activity is associated with increased inflammation, and downregulation helps to reduce inflammation and autoimmune diseases. CSF levels were similar in wild-type mice and mice treated with food powder. CSF3 was upregulated in ETKO mice, which is a potential link to the development of obesity. Treatment with food powder brought CSF levels close to those observed in wild-type mice. The decrease in chemokine and their receptor levels seems to be a response to food powder treatment. CD40LG is a ligand for the CD40 protein located on the surface of immune cells, and the increase in the expression of this protein is associated with increased inflammation and the development of several cancers. In vascular endothelium, the increase in platelet secretion of CD40 ligand seems to enhance the production of ROS, leading to the formation of plaque cells and the obstruction of arteries. In mice treated with food powder, the expression of CD40 ligand was significantly reduced, bringing its level close to that of wild-type mice. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0409] Figure 56Shows the evaluation of the changes in CXC-motif chemokines in wild-type and ETKO mice in response to food powder treatment. CXC1-type chemokines: CXCL chemokines bind to CXCR-type receptors on immunogenic cells and induce their effects. CXCL1 (CXC-motif ligand 1), which acts through its receptor CXCR-2, plays a key role in inflammation. CXCL1 was significantly downregulated in wild-type mice, while ETKO mice did not show significant changes in response to food powder treatment. CXCL 10 and its receptor CXCR3 are involved in the pathology that occurs during the development of autoimmune diseases, including organ-specific diseases (type I diabetes) and systemic autoimmune diseases such as rheumatoid arthritis. CXCL 10 and its receptor CXCR3 are associated with the pathology that occurs during the development of autoimmune diseases, including organ-specific diseases (type 1 diabetes) and systemic autoimmune diseases (such as rheumatoid arthritis). Interferon and TNF activate the production of CXCL10, leading to the activation of TH1 lymphocytes. CXCL 10 was significantly downregulated in wild-type mice, while ETKO mice did not show any changes in response to food treatment. CXCL-12 (CXC-motif ligand-12; stromal cell-derived factor 1 or SDF 1) is a chemokine that binds to its receptor CXC-R 4. CXCL-12 is expressed in a variety of tissues and is important in development. Overexpression of CXCL-12 leads to inflammation and is highly chemotactic for leukocytes (neuroinflammation). CXCL 12 is a clinical marker for pancreatic cancer, multiple sclerosis, Alzheimer's disease, etc. CXCL-12 was downregulated in wild-type mice in response to food powder treatment. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0410] Figure 57 Shows the evaluation of the effect of food treatment on the transcript levels of CXC-ligands. CXCL 5 is produced during inflammation stimulated by interleukin and TNFα. It binds to the CXC receptor 2. It is thought to play a role in cell proliferation, enhanced motility, and angiogenesis. There were no changes in CXCL 5 between untreated and food powder-treated wild-type and ETKO mice. CXCL 15 is a chemokine expressed in lung epithelial cells, intestinal cells, etc., and is associated with inflammation. There were no changes in the transcript levels of CXL15 between untreated and food powder-treated wild-type and ETKO mice. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0411] Figure 58 Shows CXCR (CXC-motif chemokine receptor, which binds to CXC ligands of the chemokine family and interleukin by attracting immunocompetent blood cells and inducing inflammation). Food powder treatment significantly reduced the CXCR-2 level in wild-type mice. No change was observed in ETKO mice. There were no differences in CXCR-5 and 3 and CXCR5 between wild-type and ETKO mice. The results suggest that in addition to ligands (C-C; C-X-C-motif), receptors can also be regulated by treatment with food powder, which can provide better downregulation of inflammation. Receptors of the tumor necrosis factor family are another group of receptors involved in inflammation, and several natural products are known to downregulate the TNFα-linked signal transduction pathway. FAS ligand (FASL) belongs to the TNF superfamily, and binding to its receptor can trigger apoptosis. After food powder treatment, there were no significant differences in the FASL levels between wild-type and ETKO mice. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0412] Figure 59 Shows the assessment of interleukin changes in wild-type and ETKO mice in response to food powder treatment. Interleukins are cytokines involved in immune function, some are proinflammatory (IL17), and some are antiinflammatory (IL10). They mediate immune function under normal conditions and when challenged by pathogenic organisms. A significant decrease in the expression levels of IL-1A, IL-1B, and IL-7 was observed in wild-type mice treated with food powder. The levels of these interleukins remained similar in response to food powder treatment. The expression levels of IL4 remained similar in untreated and food powder-treated wild-type and ETKO mice. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0413] Figure 60Shows the evaluation of interleukin changes in wild-type and ETKO mice in response to food powder treatment. Interleukins mediate immune functions under normal conditions as well as when challenged with pathogenic organisms. After treatment with food powder, there were no changes in the expression levels of IL11, IL13, IL2rb, and IL17f in wild-type and ETKO mice. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T);

[0414] Figure 61 Shows the evaluation of interleukin changes in wild-type and ETKO mice in response to food powder treatment. After treatment with food powder, there were no changes in the IL-21 expression levels in wild-type and ETKO mice. Interferon γ (IFNG) is another cytokine involved in the response to antiviral agents. In wild-type and ETKO mice, IFNG levels did not change in response to food powder treatment. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T); and

[0415] Figure 62 Shows the evaluation of changes in transcript levels related to the response of tumor necrosis factor superfamily members during treatment with food powder in wild-type and ETKO mice. LTB (lymphotoxin B: lymphotoxin β (TNF superfamily, member 3)) is a membrane protein and inducer of inflammatory responses. The level of the LTB transcript in wild-type mice was downregulated in response to food powder treatment. In ETKO mice treated with food powder, the LTB transcript level did not change. After treatment with food powder, the transcript levels of other members of the TNF superfamily such as TNFSF11, TNFSF11b, and TNFS113b did not change in wild-type and ETKO mice. Data are the mean ± SEM of transcript levels in samples from 3 independent mice. Abbreviations: wild-type untreated (WT / U), wild-type treated (WT / T), knockout untreated (KO / U), and knockout treated (KO / T).

[0416] Figure 63Shows the histopathological results of liver sections of mice treated with and without food powder. (A) group shows liver sections of untreated wild-type (WT) mice stained with hematoxylin and eosin; very few lipid bodies are visible. (B) group shows liver sections of wild-type (WT) mice treated with food powder and stained with hematoxylin and eosin; very few lipid bodies are visible. (C) group shows liver sections of untreated obese (KO) mice stained with hematoxylin and eosin; clear round areas are lipid bodies widely distributed in the liver. (D) group shows liver sections of (KO) mice treated with food powder and stained with hematoxylin and eosin; clear round areas are lipid bodies. Potential areas of tissue regeneration are indicated by arrows. Detailed Description

[0417] Described herein are nanofibers derived from plant tissues, methods for their production, and their uses. For comparison, nanoparticles and food powders and methods for their production are also described. It should be understood that the provided embodiments and examples are for illustrative purposes as desired by those skilled in the art and are not meant to be limiting in any way.

[0418] As described in detail below, nanoparticles, food powders, and nanofibers have been developed that can be characterized by several interesting properties. Although both nanoparticles and nanofibers can be prepared from plant tissues, the two nanostructures have been prepared using significantly different methods herein, and the two nanostructures have been found to adopt significantly different structures to characterize significant differences in composition and to characterize interesting differences (and similarities) in function and / or biological effects.

[0419] For example, described herein are nanoparticles comprising self-assembled cellular components derived from homogenized plant tissues, the cellular components comprising one or more cell walls and / or other cellular components. In contrast, nanofibers comprising self-assembled cellular components are also described, the self-assembled cellular components being derived from homogenized plant tissues from which polyphenols have been extracted, the cellular components comprising one or more cell walls and / or other cellular components. Methods and protocols for preparing such nanoparticles and nanofibers (indicating the differences between them) are also described, as well as the uses of such nanoparticles and nanofibers in, for example, treating or preventing diseases or disorders in a subject and / or as a delivery vehicle. Food powders related to (but different from) the currently described nanoparticles and nanofibers, particularly the nanoparticles of the present invention, are also described in detail herein.

[0420] Nanoparticles and Methods for Their Preparation

[0421] Nanoparticles:

[0422] In one embodiment, provided herein is a nanoparticle comprising self-assembling cellular components derived from homogenized plant tissue, the cellular components comprising one or more cell walls and / or other cellular components. In certain embodiments, the cellular components can include components released from plant tissue by homogenization, which self-assemble, for example, into nanoparticles. In certain embodiments, one or more cell wall components can include pectin and / or its derivatives.

[0423] In certain embodiments, provided herein is a nanoparticle comprising self-assembling cellular components derived from homogenized plant tissue, the cellular components comprising one or more structural carbohydrates or their cleavage products, wherein lipids are not a structural component of the nanoparticle.

[0424] In certain embodiments, the nanoparticle can be substantially or completely lipid-free, or can contain only minimal, residual, or trace amounts of lipids. In certain embodiments, lipids such as phospholipids, diacylglycerols, triacylglycerols, free fatty acids, or aldehydes and alkanes are not a structural component of the nanoparticle (i.e., lipids, and the nanoparticle as a whole does not form monolayer vesicles or multilamellar vesicles with membrane properties). In certain embodiments, if a certain amount of lipid is present, the amount of lipid is below the critical micelle concentration (CMC) level and does not form micelles or vesicles. In certain embodiments, the lipid makes substantially no contribution to the tertiary or quaternary structure of the nanoparticle, and / or makes no contribution to the self-assembly of the nanoparticle. In certain embodiments, the plant tissue can be selected to provide little or no lipid, and / or the lipid can be removed prior to self-assembly of the nanoparticle.

[0425] In certain embodiments, the cellular components can include those cellular components released from plant tissue during the ripening of a mature fruit or during homogenization, which are capable of self-assembling into nanoparticles.

[0426] In certain embodiments, the plant tissue can comprise plant tissue or plant material such as, for example, fruits, vegetables, leaves, flowers, seeds (at any developmental stage generally), or any combination thereof. In certain embodiments, a mixture of two or more tissues can be used. In certain embodiments, multiple tissues can be used, each tissue enriching one or more components of the nanoparticles such that homogenization of the mixture provides the components for self-assembly to form nanoparticles. In certain embodiments, the plant tissue or plant material can include, for example, tart cherries, blueberries, parts thereof, or mixtures thereof. In certain embodiments, the plant material or plant tissue can include ripe fruits. In certain embodiments, developing fruits (prior to ripening) may not contain sufficient nanoparticle components but can still be compensated for by being used in combination with other plant materials or tissues and / or specific nanoparticle components, and / or wherein unripe fruits are treated with enzymes to produce sufficient nanoparticle components, thereby allowing nanoparticle assembly after homogenization. In certain embodiments, homogenization of the plant tissue can be carried out by increasing ripening by exposing the cellular components to ripening enzymes under conditions where the ripening enzymes will be activated. In certain embodiments, the plant tissue can provide pectin, one or more hemicelluloses, proteins / peptides, one or more carbohydrates, malic acid (or another organic acid capable of forming hydrogen bonds), at least one anthocyanin, and / or ascorbic acid, or any combination thereof. In certain embodiments, the plant tissue can provide at least pectin, one or more hemicelluloses, proteins / peptides, one or more carbohydrates, malic acid (or another organic acid capable of forming hydrogen bonds), at least one anthocyanin, and ascorbic acid. In certain embodiments, the nanoparticles can comprise pectin, hemicellulose, peptides and / or proteins, organic acids, at least one polyphenol, their cleavage products, or any combination thereof. In certain embodiments, the organic acids can include malic acid, ascorbic acid, or both. In certain embodiments, the polyphenols can include anthocyanins. In certain embodiments, the cellular components include those released from the plant tissue during and / or during homogenization of the ripe fruit, which are capable of self-assembling into nanoparticles. In certain embodiments, homogenization can increase the exposure of the cellular components to the ripening enzymes, forming cleavage products that may contribute to the nanoparticles.

[0427] In certain embodiments, the nanoparticles described herein can be free or substantially free of starch (e.g., α- and β-amylose). Starch tends to form dendromer-type structures, and thus the presence of relatively high levels of starch in the plant tissue used to produce the nanoparticles can interfere with nanoparticle production. In certain embodiments, if plant tissues containing starch are used, they can be used in small amounts to maintain a low starch content. For example, if bananas are used as part of the plant tissue, the proportion of the plant tissue represented by the bananas can be relatively low relative to the other components of the plant tissue used. In certain embodiments, similar considerations can also apply to the food powders and / or nanofibers also described in detail herein.

[0428] In certain embodiments, the plant tissue can be in a partially degraded state (e.g., mature) with a partially degraded cell wall, or can be produced from the plant tissue by adding carbohydrate- and / or proteolytic enzymes to the tissue during a homogenization process that catabolizes the cell wall components. In certain embodiments, the starting plant tissue can be partially processed, e.g., by fixing in a preservative such as alcohol or acetic acid (vinegar), and rehydrating before homogenization. In certain embodiments, for example, the plant tissue can be blended with ascorbic acid and malic acid to promote the structural integrity and / or yield of the nanoparticles.

[0429] In certain embodiments, the plant tissue can include fruit or vegetable plant tissue. In certain embodiments, the plant tissue can include senescent fruit, mature vegetables, or any combination thereof. In certain preferred embodiments, the plant tissue can include cherries (e.g., tart cherries), blueberries, grapes, peaches, nectarines, plums, apricots, papayas, tomatoes, or any combination thereof. For example, in certain preferred embodiments, the plant tissue can include tart cherry fruit tissue. In certain embodiments, the plant tissue can include the peel and / or the outer tissue of the fruit, such as in cocoa.

[0430] In certain embodiments, the nanoparticles can include pectin, hemicellulose, peptides and / or proteins, organic acids, at least one polyphenol, their cleavage products, or any combination thereof. In certain embodiments, the organic acids can include malic acid, ascorbic acid, or both. In certain embodiments, the polyphenols can include anthocyanins.

[0431] In certain embodiments, one or more structural carbohydrates of the nanoparticles can include pectin, pectic acid, pectin methyl ester, pectin derivatives, polygalacturonic acid, rhamnogalacturonic acid, hemicelluloses such as xyloglucan (which in certain embodiments can be neither cellulose nor pectin) and having a β-(1→4)-linked glucose, mannose, or xylose backbone, and / or arabinogalactan and / or one or more of their cleavage products.

[0432] In certain embodiments, the nanoparticles can have a substantially spherical structure, for example, with a diameter of about 50 - 250 nm. In certain embodiments, the nanoparticles can be amorphous. In certain embodiments, the nanoparticles can be provided in an aqueous solution, dry powder form, or dehydrated, lyophilized, freeze-dried, spray-dried, or nano-spray-dried form.

[0433] In certain embodiments, the nanoparticles can include: a pectin-based core; an intermediate layer surrounding the core, the intermediate layer containing macromolecules of pectin and hemicellulose and / or their cleavage products, polyphenols, and organic acids; and a fibrillated outer layer containing macromolecular carbohydrates and proteins (peptides), optionally formed from catabolites formed during the maturation and / or homogenization of plant tissue. This is described in more detail below Figure 17 Examples of such structural organizations are depicted. In certain embodiments, the pectin-based core can be a generally hollow or solid, spherical structure, and treating the nanoparticles with pectin-degrading enzymes such as polygalacturonase / pectinase can cause the core to break down into smaller spheroids (indicating that the core can be pectin-based). In certain embodiments, the intermediate layer can include, for example, a layer formed from macromolecules derived from pectin and hemicellulose, hydrogen bonded through anthocyanins, ascorbic acid, and malic acid, and peptides derived from various cellular proteins. In certain embodiments, the fibrillated outer layer can include, for example, macromolecular structural carbohydrates and / or proteins derived from catabolism occurring during the maturation of plant tissue.

[0434] In certain embodiments, the nanoparticles can include one or more peptides derived from the degradation of proteins produced in plant tissue during maturation and / or homogenization. In certain embodiments, the nanoparticles can include one or more catabolites of structural carbohydrates produced in plant tissue during maturation and / or homogenization.

[0435] In certain embodiments, the nanoparticles can comprise: a pectin-based core; an intermediate layer surrounding the core, the intermediate layer comprising one or more helical fibrillar structures comprising pectin or a derivative thereof, and one or more hemicellulose-derived molecules or derivatives thereof; and a fibrillated outer layer comprising hemicellulose or a cleavage product thereof, and one or more peptides derived from cellular proteins.

[0436] In certain embodiments, the nanoparticles can be stabilized by hydrogen bond interactions present in the pH range of about 3 - 7 and are formed between macromolecules derived from the catabolism of plant tissue cell components and having hydroxyl groups (such as those found in sugars) and / or amino groups (such as those found in peptides) and / or organic acid groups (such as those found in ascorbic acid and / or malic acid). In certain embodiments, the hydrogen bond interactions can also involve the hydroxyl groups of small molecules, such as polyphenols (such as anthocyanins, such as cyanidin-3-glucoside and / or cyanidin-3-rutinoside). In certain embodiments, the nanoparticles can form / self-assemble under slightly neutral-acidic conditions (such as at a pH of about 3 - 7) and in a solution of a non-buffer or another solution with a high ionic strength that may interfere with hydrogen bonds. In certain embodiments, calcium ions can act as a bridge between polygalacturonic acid chains, thereby enabling the stabilization of the nanoparticles. It should be understood that salts such as potassium, sodium, and / or calcium can be present in the solution, such as derived from plant tissue.

[0437] It should be understood that the conditions under which the cellular components released from plant tissue can self-assemble into nanoparticles by homogenization can vary depending on the specific application and the materials used. In certain embodiments, the above conditions can be within a temperature range of about 15°C - 40°C, preferably about 15°C - 35°C. In certain embodiments, the above conditions can be in water, or in a mixture of water and water-miscible organic solvents such as (but not limited to) methanol or ethanol. In certain embodiments, the conditions under which the cellular components released from plant tissue can self-assemble into nanoparticles by homogenization can be in a solution of about 15% - 100% v / v water, more preferably about 30% - 100% v / v water, and most preferably about 100% v / v water. When self-assembly occurs in an aqueous or substantially aqueous solution, it is contemplated that in certain embodiments, enzymes commonly present in a maturation environment (such as polygalacturonase) can be added to the mixture, especially when using immature fruits as the plant tissue or as part of the plant tissue to assist in self-assembly. In certain embodiments, the conditions under which self-assembly can occur can be, for example, in a substantially aqueous medium. In certain embodiments, the production of nanoparticles can be achieved using a suitable medium by the methods described herein. Generally, the medium can be water or an aqueous medium, but in certain embodiments, it can be or include water and miscible organic solvents such as, but not limited to, one or more alcohols (which can include ethanol and / or methanol), one or more ketones (such as acetone), one or more solvents (which can include dimethyl sulfoxide), or alone or in any suitable combination thereof. In certain embodiments, the self-assembly of nanoparticles can occur in one of the above media. The conditions for self-assembly can include any thermodynamically feasible conditions. In certain embodiments, for example, the conditions for self-assembly can include a temperature of about 4°C - 30°C, ion concentrations typically consistent with those found physiologically (i.e., in the micromolar to millimolar range), a sugar concentration in the range of about 5 - 10% w / v, and natural organic acids present in the millimolar range.

[0438] In certain embodiments, a preferred method can include a method in which at about 4°C, fruit tissue is homogenized in an aqueous or alcoholic medium (or a combination of both) using a blender, polytron, or any other device that may disrupt the cellular tissue. After making the starting material into a smooth homogenate, the homogenate can be filtered to remove debris and centrifuged at about 10,000 xg to precipitate fine debris. The resulting homogenate can be dialyzed in a dialysis bag with a 100 kD cut-off at about 4°C for about 15 h. The solution from the dialysis bag can be collected and subjected to dehydration and / or freeze-drying / spray-drying, nano spray-drying, etc. to provide nanoparticles. For example, these can be dried and stored in the dark at about -20°C for long-term storage.

[0439] In certain embodiments, homogenization can include any suitable method of impregnating plant tissue, such as grinding, mixing, high-shear homogenization, or using a device such as a Polytron to homogenize the plant tissue.

[0440] In certain embodiments, the plant tissue can include one or more fruits and / or vegetables, which may or may not be combined with other plant tissues. In instances where a nutritional preparation is desired, a carrier (such as a fruit) and a plant containing the nutritional preparation (such as a turmeric rhizome) can be used as the plant tissue. In certain embodiments, plant tissue (such as a fruit) and a purified or partially purified product (such as turmeric powder or curcumin) can be used.

[0441] Some examples of nutritional preparation compounds and plant families can include:

[0442] 1. Carotenoids (β-carotene, lycopene, lutein, and / or other xanthophylls, astaxanthin, etc.);

[0443] 2. Annonaceous acetogenins (polyketides from Annona fruits with anticancer properties;

[0444] 3. Boswellia (which can provide additional anti-inflammatory functions in combination with, for example, curcumin);

[0445] 4. Withania somnifera (an herbal component containing withanolides, having anti-stress and cancer-preventive effects), mainly having a steroid structure;

[0446] 5. Members of the Zingiberaceae family, including edible ginger (Zingiber officinalis), mango ginger (Curcuma amada), and other members of the Zingiberaceae family containing several bioactive components (including gingerol and shogaol);

[0447] 6. Turmeric (containing curcumin);

[0448] 7. Fructooligosaccharides, galactooligosaccharides, and inulin from Jerusalem artichoke to increase the prebiotic content;

[0449] 8. Members of the Piperaceae family, such as black pepper (Piper nigrum) and its wild relatives containing piperine and several derivatives; and / or

[0450] 9. Any other suitable components from plants not listed above.

[0451] In a further embodiment, the nanoparticles can comprise at least one polyphenol. In certain embodiments, the polyphenol can be or comprise anthocyanin or several anthocyanins. In a still further embodiment, the nanoparticles can also comprise organic acids, such as malic acid, ascorbic acid, or both. In certain embodiments, the nanoparticles can comprise more than one polyphenol. As will be appreciated, the polyphenol composition of the nanoparticles can reflect the polyphenol composition of the plant tissue (e.g., fruit) used and provide any additional polyphenols (if external polyphenols are added). When using tart cherries, for example, the polyphenols can include cyanidin 3-rutinoside or glucoside. When using blueberries, the polyphenols can include the various phenols and anthocyanins found in blueberries. Examples of polyphenols (anthocyanins and phenols) are shown in the table below:

[0452] Anthocyanin componentPhenolic component

[0453] Delphinidin 3-galactosideCaffeic acid

[0454] Delphinidin 3-glucosideFerulic acid

[0455] Delphinidin 3-arabinosideGallic acid

[0456] Cyanidin 3-glucosideCinnamic acid

[0457] Petunidin 3-galactosidePhenylacetic acid

[0458] Peonidin 3-galactosideCatechin / Epicatechin

[0459] Petunidin 3-arabinosideIsorhamnetin

[0460] Malvidin 3-galactosideMyricetin

[0461] Peonidin 3-arabinosideChlorogenic acid

[0462] Malvidin 3-glucoside4-O-feruloylquinic acid

[0463] Malvidin 3-arabinosideQuercetin 3-arabinoside

[0464] Delphinidin 6-acetyl-3-glucosideSyringetin 3-O-galactoside

[0465] Malvidin 6-acetyl-3-glucoside

[0466] In certain embodiments, the nanoparticles can have a substantially spherical structure with a diameter of about 50 - 250 nm. In certain embodiments, the nanoparticles can comprise a pectin-based core surrounded by one or more helical fibrillar structures comprising pectin components (e.g., rhamnogalacturonan), one or more hemicellulose-derived molecules (e.g., xyloglucan), and one or more peptides derived from cell wall proteins such as hydroxyproline-rich glycoproteins (HRGPs).

[0467] In certain embodiments, the nanoparticles can further comprise one or more bioactive agents. In certain embodiments, the bioactive agent can be complexed, conjugated, or mixed with the nanoparticles. For example, the bioactive agent can be a pharmaceutically active drug, a nutritional preparation, or a nutrient. Given the teachings herein, those skilled in the art will be aware of the various suitable drugs, nutritional preparations, and / or nutrients that can be used according to the specific application. In certain embodiments, the pharmaceutically active drug can include any suitable drug developed for the control of chronic diseases, such as those used for cancer treatment (e.g., vincristine, vinblastine, paclitaxel, doxorubicin, polyketides, etc.). In certain embodiments, the nutritional preparation can comprise carotenoids (e.g., lycopene, zeaxanthin, astaxanthin, which may have potential for use in eye drops), anti-inflammatory agents (e.g., turmeric / curcumin, boswellia, ashwagandha, and / or other bioactive herbs), nutrients (e.g., Fe2+, Zn, Se, cobalamin (VitB12)), and / or antioxidant enzymes (e.g., superoxide dismutase, catalase targeting regions of ischemia / reperfusion, etc.).

[0468] In certain embodiments, the nanoparticles can be provided, for example, in the form of an aqueous solution, a dry powder, or a dehydrated, lyophilized, freeze-dried, spray-dried, or nano-spray-dried form. In certain embodiments, the nanoparticles can be formulated for oral administration. In certain embodiments, the nanoparticles can be provided in a form suitable for ingestion with food. In certain embodiments, the nanoparticles can be provided in the form of capsules, injectable forms, spray forms for mucosal regions, and / or topical application forms (e.g., ointments) for skin applications.

[0469] In certain embodiments, a composition comprising the nanoparticles as described herein is provided. In certain embodiments, the nanoparticles or the composition can further comprise a pharmaceutically acceptable carrier, excipient, or diluent added during or after the preparation of the nanoparticles. In certain embodiments, the composition can further include a bioactive agent, such as a drug, a biomolecule, a protein, an enzyme, an antibody, or any other agent.

[0470] In a further embodiment, the plant tissue for preparing the nanoparticles may include fruit or vegetable plant tissue. In certain embodiments, the plant tissue may independently or combinatorially include fruits, such as cherries, blueberries, grapes, and in certain embodiments may additionally include other products of nutritional importance, such as broccoli, almonds, soybeans, or turmeric, either as tissue or as processed products or any combination thereof. For example, the plant tissue may include tart cherry fruit. In certain embodiments, the plant tissue may further include nutrients of plant origin or carriers of nutritional preparations. In certain embodiments, the plant tissue may further include, for example, a combination of tart cherry fruit with plant tissue (e.g., broccoli, mushrooms, nuts or nut products (i.e., almonds, hazelnuts), roots (i.e., Withania somnifera, Panax ginseng, Cyperus rotundus, etc.)).

[0471] Extensive studies have been conducted, showing that the organizational structure of the nanoparticles described herein is complex. Based on the experimental evidence obtained (see the Examples section listed below), and not wishing to be bound by theory in any way, the following structural model for certain embodiments of the nanoparticles described herein is proposed:

[0472] According to the EM data, the nanoparticles may include different inner cores surrounded by different intermediate layers, and a more fibrillated outer layer with prominent fibrous structures may be provided on the intermediate layers. These three different regions (inner core, intermediate layer, and outer layer) are distinguishable based on their ability to bind heavy metals (e.g., uranyl acetate). Uranium ions can bind to negatively charged moieties such as sugar acids (glucuronic acid, galacturonic acid) of polymer chains, making the region electron-dense. Thus, the difference between the three layers may reflect the difference in polymer composition in these layers.

[0473] Enzyme treatment of the nanoparticles results in structural breakage, revealing an intermediate structure. Treatment with pectinase (polygalacturonase) causes the entire nanoparticle to break into vesicle structures, indicating that polygalacturonic acid moieties may be dispersed throughout the nanoparticle.

[0474] Treatment with β-1,4-glucanase results in the dissolution of the outer structure of the nanoparticles, leaving the inner core. Since there are no detectable levels of long-chain cellulose molecules (x-ray diffraction pattern) in the structure, it seems that this activity may be directed against hemicellulose moieties with a β-1,4-glucan structure. Thus, it is expected that hemicellulose may form the major part of the components arranged in the middle / intermediate layers and the outer layer of the nanoparticles.

[0475] The nuclear structure is observed after trypsin treatment. Trypsin treatment also results in the dissolution of the outer and intermediate layers, leaving a spherical pectin-based inner core. Thus, the outer and intermediate layers may also contain proteins / peptides.

[0476] During SDS-PAGE, the antibody generated against homogalacturonan showed a strong reaction to the nanofibers. SDS-PAGE showed the presence of anthocyanins, peptides, and pectin in the nanoparticles, while anthocyanins were absent in the nanofibers. It is speculated that the antibody may not be able to reach the interior of the nanoparticles, thus resulting in a weaker reaction. This also indicates that homogalacturonan may be exposed on the nanofibers and cause strong cross-reactivity with the antibody (dot blot, Figure 12 ).

[0477] The cross-reactivity with the antibody generated against extensin was very low in both the nanoparticles and the nanofibers (dot blot, Figure 12 ), indicating that there were no significant levels of extensin-derived peptides in either the nanoparticles or the nanofibers.

[0478] In contrast, strong reactivity of the antibody generated against hemicellulose-protein (arabinogalactan-protein) was observed, suggesting that this may be a major component of the outer layer of the nanoparticles and a component of the nanofibers.

[0479] In certain embodiments, the nanoparticles as described herein may further comprise one or more bioactive agents, such as drugs, nutrients, biomolecules (i.e., proteins, enzymes, nucleic acids, nutritional formulations, or other agents). In certain embodiments, the bioactive agent may be complexed or chemically conjugated to the nanoparticles. In certain embodiments, the bioactive agent may be introduced into the nanoparticles (and complexed or conjugated to the nanoparticles) during or after nanoparticle formation.

[0480] In another embodiment, provided herein is a targeted nanoparticle comprising the nanoparticles as described herein conjugated with a targeting antibody that specifically targets a cancer marker. In certain embodiments, the targeting antibody may include a PD-L1 antibody for targeting the targeted nanoparticles to cancer cells. In certain embodiments, the targeted nanoparticles may be complexed or conjugated with at least one cytotoxic or anticancer drug. In certain embodiments, the targeted nanoparticles may be complexed or conjugated with paclitaxel, doxorubicin, or both.

[0481] In another embodiment, provided herein is an antibacterial nanoparticle comprising the nanoparticles as described herein complexed or conjugated with an antibacterial agent. In certain embodiments, the antibacterial agent may comprise lysozyme, tetracycline, or nisin, or any combination thereof. In certain embodiments, the antibacterial nanoparticles can be used to treat or prevent MDR bacterial infections.

[0482] Methods for preparing nanoparticles:

[0483] In one embodiment, provided herein is a method for preparing nanoparticles (such as those described herein) from homogenized plant tissue, the method comprising:

[0484] providing the homogenized plant tissue in a solution that contains cell components released from the plant tissue;

[0485] removing debris (if present) from the homogenized plant tissue; and

[0486] optionally, dialyzing the homogenized plant tissue to remove uncomplexed compounds, or removing uncomplexed compounds by size exclusion,

[0487] thereby providing a solution comprising nanoparticles formed by self-assembly of the cell components.

[0488] In certain embodiments, the solution can comprise any suitable medium. Generally, the medium can comprise water or an aqueous medium, but in certain embodiments can be or comprise water and a miscible organic solvent, such as but not limited to one or more alcohols (which can include ethanol and / or methanol), one or more ketones (such as acetone), one or more solvents (which can include dimethyl sulfoxide), or alone or in any suitable combination thereof.

[0489] In certain embodiments, debris can be removed by dialysis, filtering the homogenized plant tissue, centrifuging the homogenized plant tissue, or performing tangential flow filtration or continuous flow filtration on the homogenized plant tissue, or any combination thereof. In certain embodiments, the step of removing debris can include filtering the homogenized plant tissue, or centrifuging the homogenized plant tissue, or both. In certain embodiments, the debris can be removed by one or a combination of the following techniques, which can include centrifugation (e.g., simple or continuous flow centrifugation) and / or membrane filtration (e.g., dialysis, centrifugation using a suitable cut-off membrane such as 1 - 100 μm), tangential flow filtration, size exclusion column separation, etc., these techniques alone or in combination with these techniques. In certain embodiments, centrifugation at ~9000 - 12000 g can precipitate most of the debris, or filtration through a 100 micron filter can provide suitable debris removal.

[0490] In certain embodiments, the dialysis step (if performed) can be carried out using simple dialysis against water (or another aqueous solution, although water is preferred), although this may be more easily used on a laboratory scale rather than for commercial large-scale products. Thus, in certain embodiments, dialysis / separation can be carried out using continuous centrifugation, tangential flow filtration, or the dialysis separation can be omitted by making the particles fine enough (e.g., using equipment such as a high shear homogenizer (such as an acoustic spectrometer) or a microfluidizer).

[0491] In certain embodiments, the debris-free clarified homogenate can be further purified using membrane filtration techniques, where smaller molecules not incorporated into the nanoparticles can be removed. This can include, for example, simple dialysis against water using a dialysis bag with a 100,000 MW cut-off, or tangential flow filtration (cross-flow filtration) of the homogenate by transmembrane filtration through a suitable membrane of a similar cut-off size or using a stirred cell (such as an Amicon or similar device) that can concentrate the nanoparticles. Alternatively, a size exclusion column with a similar exclusion limit (100,000 MW) can be used, where the nanoparticles are eluted in the void volume using a solvent (water or a low molarity buffer (e.g., 1 mM) at a pH of about 4-5). Such operations are preferably carried out at about 4 °C.

[0492] In certain embodiments, the method can further include the step of dehydrating, lyophilizing, freeze-drying, spray-drying, or nano-spray-drying the solution containing the nanoparticles.

[0493] In certain embodiments, the method can include forming nanoparticles by self-assembly under suitable conditions. In certain embodiments, for example, the above conditions can be within a temperature range of about 4°C to 40°C, preferably about 15°C to 35°C. In certain embodiments, the above conditions can be in water or in a mixture of water and a water-miscible organic solvent such as (but not limited to) methanol or ethanol. In certain embodiments, the conditions for the cell components released from plant tissue to self-assemble into nanoparticles by homogenization can be in a solution of about 15% - 100% v / v water, more preferably about 30% - 100% v / v water, and most preferably about 100% v / v water. When self-assembly occurs in an aqueous or substantially aqueous solution, it is expected that in certain embodiments, enzymes commonly present in a mature environment (such as pectinase) can be added to the mixture, especially when using immature fruits as plant tissue or as part of plant tissue, to assist in self-assembly. In certain embodiments, the conditions under which self-assembly can occur can be, for example, in a substantially aqueous medium. In certain embodiments, the production of nanoparticles can be achieved using a suitable medium by the methods described herein. Generally, the medium can be water or an aqueous medium, but in certain embodiments, it can be or include water and a miscible organic solvent, such as but not limited to one or more alcohols (which can include ethanol and / or methanol), one or more ketones (such as acetone), one or more solvents (which can include dimethyl sulfoxide), or individually or in any suitable combination thereof. In certain embodiments, the self-assembly of nanoparticles can occur in one of the above media. The conditions for self-assembly can include any thermodynamically feasible conditions. In certain embodiments, for example, the conditions for self-assembly can include a temperature of about 4°C to 30°C, ionic concentrations typically consistent with those found physiologically (i.e., in the micromolar to millimolar range), and a sugar concentration in the range of about 5 - 10% (w / v) and natural organic acids present in the millimolar range.

[0494] In some embodiments, the method can include forming nanoparticles by self-assembly in a substantially aqueous medium. Typically, in the above method, dialysis can be carried out overnight at about 4 °C to facilitate nanoparticle assembly. If dialysis is carried out at room temperature, the risk of contamination from atmospheric pollutants may increase. In some embodiments, nanoparticles can be prepared under GMP conditions to provide pure nanoparticles, especially in pharmaceutical applications, such as applications where a drug is added to the nanoparticles. In some embodiments, homogenized plant tissue (i.e., homogenate) is prepared at a ratio of about 1 g of tissue to 1 or 2 ml of water. The tissue is typically already 80 - 90% water. These conditions can vary based on the nature of the starting material. In some embodiments, nanoparticles can form or begin to form during homogenization and can also form subsequently, for example, during dialysis (if carried out). In some embodiments, a nanoparticle solution containing about 80% or more nanoparticles can be obtained. In some embodiments, the temperature can generally be kept low, such as at about 4 °C to prevent unwanted degradation.

[0495] In another embodiment of the above method, the step of providing homogenized plant tissue in a solution can include homogenizing the plant tissue in an aqueous medium or an organic medium (such as, but not limited to, an aqueous medium or an organic medium (or a mixture thereof), including water, ethanol, methanol, or acetone or a mixture thereof). In some embodiments, homogenized plant tissue can be prepared by polytron or by sonication using, for example, a sonicator. In another embodiment, the step of providing homogenized plant tissue in a solution can include subjecting the plant tissue to high-shear homogenization and / or sonication in an aqueous medium or an organic medium containing any one or more of, for example, water, ethanol, methanol, or acetone. In some embodiments, high-shear homogenization can include, for example, homogenizing at about 3000 - 5000 rpm, where the blade diameter is about 20 cm and the pressure is about 80 kN (those skilled in the art will know the appropriate high-shear homogenization conditions suitable for a particular application in view of the teachings herein). For example, if sonication and / or cavitation can be used, the shear force can be selected such that the nanoparticles are not pulled apart by the conditions used. In some embodiments, the size range of the homogenized plant tissue in the solution can be, for example, about 50 - 250 nm. In some embodiments, a Polytron set at a rate of about 6 - 7 can be used, with a 30 s pulse for about 3 cycles.

[0496] For example, in certain illustrative embodiments, homogenized plant tissue can include plant tissue such as cherry fruit that has been homogenized in a blender at approximately 4500 rpm for about 5 min and then further finely homogenized with a polytron for about 5 min. The resulting slurry can then be filtered through approximately 4 layers of cheesecloth and centrifuged at approximately 10,000 x g to remove debris, and the supernatant can be collected. The supernatant can be dialyzed against water in a dialysis bag with a 10,000 D cut-off to remove low molecular weight components. After dialysis, the solution can be lyophilized or spray dried to obtain nanoparticles in powder form.

[0497] In certain embodiments, a sonicator can be used that utilizes accelerated fluid flow, ultrasonic cavitation, and turbulence to prepare dispersions. In the case of nanoparticles, it is expected that a relatively low-pressure system may be preferred, and pump selection can be made accordingly. The sonicator is a product of Sonic Corporation, Stratford, Connecticut (www.sonicmixing.com).

[0498] In yet another embodiment, provided herein is a method for preparing nanoparticles as described herein from homogenized plant tissue, the method comprising:

[0499] Preparing homogenized plant tissue in a solution that contains cellular components released from the plant tissue;

[0500] Allowing nanoparticles to form by self-assembly of the cellular components;

[0501] Removing debris (if present) from the homogenized plant tissue; and

[0502] Lyophilizing, spray drying, or nano spray drying to form a powder comprising nanoparticles.

[0503] For example, in certain embodiments, the spray drying step can employ, for example, a Fujisaki 4-nozzle spray drying system, which can evaporate different volumes of water (DAIICHI JITSUGYO (AMERICA), Inc. (DJA) 939 A.E.C. Drive, Wood Dale, IL 60191, USA). One such pilot-scale model (MDL 150) can evaporate ~10 kg of water per hour, is designed to spray dry ~200 liters of homogenate per day, and recover ~40 kg of NP or food powder per day.

[0504] In certain embodiments, when the plant tissue includes, for example, tart cherries, the above method can be used. Tart cherries have been found to be particularly effective for the above method and do not require a dialysis step before forming a powder comprising nanoparticles.

[0505] In certain embodiments of the above methods, self-assembly can occur in a substantially aqueous medium. In certain embodiments, the step of preparing the homogenized plant tissue in solution can include subjecting the plant tissue to high shear homogenization in an aqueous medium or an organic medium. In certain embodiments, the step of removing debris can include filtering the homogenized plant tissue, or centrifuging the homogenized plant tissue, or both.

[0506] In certain embodiments, it is contemplated that the nanoparticles described herein can be used to deliver cargo, such as bioactive agents or another reagent of interest. It has been observed that, for example, the nanoparticles described herein expand in size upon freezing or spray drying and then contract in size when placed in an aqueous solution or water. Thus, in certain embodiments, it is contemplated that a dry or substantially dry powder or other formulation of nanoparticles can be mixed with a particular cargo and then water or an aqueous solution can be added to contract the nanoparticles, thereby capturing the cargo within the nanoparticles for delivery. In experimental studies, nanoparticle solutions produced structures with diameters of 50 - 250 nm, which, when observed under SEM (vacuum drying effect), were observed to have a shell-like structure that was ~4 - 5 times larger in diameter based on TEM and SEM data, providing an example of this size expansion upon drying.

[0507] In certain embodiments, in cases where it is desired to complex or conjugate the nanoparticles with another moiety, such as a bioactive agent, any of the methods described herein can further include the additional step of introducing the moiety (i.e., the bioactive agent) into the homogenized plant tissue in solution or into the already formed nanoparticles under conditions suitable for complexing or chemically coupling or conjugating the moiety with the nanoparticles.

[0508] In certain embodiments, for example, chemical conjugation can be achieved using methods suitable for the functional groups present in the nanoparticles (i.e., -NH2, -COOH, -OH) and the conjugation reagent. For example, when using Dylight in Example 3 below, N-hydroxysuccinimide (NHS) esters are used to activate the dye, which are reactive groups for labeling the -NH2 moiety of proteins. The NHS ester of the compound reacts with the primary amine of the acceptor (i.e., the nanoparticle or nanofiber containing the peptide) to form a stable covalent amide bond and release the NHS group. As will be appreciated, other coupling agents or crosslinkers that bind at the same or different functional groups are also available (e.g., from Thermofisher Scientific).

[0509] In a preferred embodiment, the nanoparticles and / or nanofibers can be dissolved in phosphate buffered saline and mixed with the recommended 0.67 M borate buffer (Thermofisher scientific) to provide a concentration level of 2 mg / ml. After thorough mixing with the activated labeling reagent (NHS ester), the mixture can be incubated at 25 °C for 1 h. The mixture containing the conjugated product (NP / NF) can be separated using a size exclusion column or spin column provided by the manufacturer. The conjugated NP / NF can be eluted in the void volume. The conjugated product can be lyophilized and stored as a dry powder, for example, at -20 °C (see, for example, Nour Karra and Simon Benita* (2012), The Ligand Nanoparticle Conjugation Approach for Targeted Cancer Therapy; Current Drug Metabolism, 2012, 13, 22 - 41, which is incorporated herein by reference).

[0510] Nanofibers and methods for their production

[0511] Nanofibers

[0512] Nanofibers have also been developed and are described herein. Although both nanoparticles and nanofibers can be prepared from plant tissues, the two nanostructures have been prepared using significantly different methods herein, and the two nanostructures have been found to adopt significantly different structures to characterize significant differences in composition and to characterize interesting differences (and similarities) in function and / or biological effects.

[0513] Accordingly, a nanofiber comprising self - assembling cellular components derived from homogenized plant tissue is also described herein. Compared to the nanoparticles described above, nanofibers differ in many respects, particularly in that the nanofibers are derived from homogenized plant tissue from which polyphenols have been extracted or in which the natural polyphenol content is low. In certain instances, the cellular components can include components released from the plant tissue by homogenization that self - assemble into nanofibers. In certain instances, one or more of the cellular components can include pectin. In certain instances, the nanofibers can include one or more hemicellulose - derived molecules, one or more peptides derived from cell wall proteins, or both.

[0514] In one embodiment, provided herein is a nanofiber comprising self-assembling cellular components derived from homogenized plant tissue, the cellular components comprising one or more structural carbohydrates or their cleavage products, wherein lipids and polyphenols are not structural components of the nanofiber.

[0515] As described herein, the presently described nanofibers can generally be prepared from any suitable plant tissue, such as those that can be used to prepare the nanoparticles described in detail herein (e.g., see above), provided that the polyphenols have been first extracted or are present at low or reduced levels in the plant tissue. In certain embodiments, the self-assembly, cellular components, structural carbohydrates or their cleavage products, and lipid content of the nanofibers can be substantially similar to those of the nanoparticles described in detail herein, except that the polyphenols do not play a structural role in the nanofibers, resulting in nanofibers adopting a structure and organization significantly different from that of the nanoparticles.

[0516] In certain embodiments, the nanofibers can be substantially lipid-free, substantially polyphenol-free, or both.

[0517] In certain embodiments, the nanofibers can include elongated fibers that include one or more strands comprising at least one structural carbohydrate or made of at least one structural carbohydrate. In certain embodiments, the basic nanofibers can include elongated fibers that are micron-scale in length and about 5-10 nm in diameter (see Figure 37 , left panel and right panel). These fibers appear to be homologous to the fibers released from the nanoparticles after trypsin treatment (see Figure 4 , plates D, E). Such fibrous structures were also observed when the dried nanofibers were examined with a scanning electron microscope (see Figure 7 , plate A). In certain embodiments, the nanofibers can be considered to be the product of ethanol-bleached nanoparticles. The nanofibers were also observed as helically wound structures (see Figure 2 , plate C), suggesting that they may originate from macromolecules surrounding the pectin core of the nanoparticles.

[0518] In certain embodiments, the nanofibers can comprise pectin, hemicellulose, peptides and / or proteins, organic acids, their cleavage products, or any combination thereof. In certain embodiments, the organic acids can include malic acid, ascorbic acid, or both.

[0519] In certain embodiments, the cellular components can include those released from the plant tissue during the ripening of the mature fruit or during homogenization, which are capable of self-assembling into nanofibers.

[0520] In certain embodiments, one or more structural carbohydrates include one or more of pectin, pectic acid, pectin methyl ester, pectin derivatives, polygalacturonic acid, rhamnogalacturonan, xyloglucan, hemicellulose, xyloglucans having a β-(1→4)-linked glucose, mannose, or xylose backbone, and / or arabinogalactan and / or their cleavage products.

[0521] In certain embodiments, the nanofibers can have a fibrous shape with a diameter of, for example, about 5 - 10 nm. In certain embodiments, the nanofibers can be amorphous.

[0522] In certain embodiments, the nanofibers can be stabilized by hydrogen - bond interactions and are formed between macromolecules derived from the catabolism of plant tissue cell components and having hydroxyl and / or amino and / or organic acid groups.

[0523] In certain embodiments, the nanofibers can further include bioactive agents. For example, in certain embodiments, the nanofibers as described herein can further contain one or more bioactive agents, such as drugs, nutrients, biomolecules (i.e., proteins, enzymes, nucleic acids, nutritional formulations, or other agents). In certain embodiments, the bioactive agent can be complexed or chemically conjugated with the nanofibers. In certain embodiments, the bioactive agent can be introduced (and complexed or conjugated) to the nanofibers during or after nanofiber formation. In certain embodiments, the bioactive agent can be or include a pharmaceutically active drug, protein, enzyme, nutritional formulation, or nutrient.

[0524] In certain embodiments, the nanofibers can generally be provided in any suitable form, such as those described above for nanoparticles. In certain embodiments, the nanofibers can be provided, for example, in an aqueous solution, in the form of a dry powder, or in a dehydrated, lyophilized, freeze - dried, spray - dried, or nano - spray - dried form.

[0525] In certain embodiments, the plant tissue used for preparing the nanofibers can include fruit or vegetable plant tissue with a low polyphenol content, or from which polyphenols have been extracted or removed. In certain embodiments, the plant tissue can include senescent fruits, ripe vegetables, or any combination thereof; preferably, wherein the plant tissue includes cherries (e.g., tart cherries), blueberries, grapes, peaches, nectarines, plums, apricots, papayas, tomatoes, or any combination thereof with a low polyphenol content and / or from which polyphenols have been removed or reduced. In certain embodiments, the plant tissue can include the peel and / or the external tissue of the fruit, such as in cocoa, for example, with a low polyphenol content and / or from which polyphenols have been removed or reduced.

[0526] In some instances, the nanofibers can have a filamentous or fibrous structure with a diameter of about 5-10 nm and a length in the micrometer range. In some instances, the nanofibers can also contain one or more bioactive agents. In some instances, the bioactive agents can be complexed, conjugated, or mixed with the nanofibers. By way of example, the bioactive agents can be pharmaceutically active drugs, nutritional preparations, or nutrients. In some embodiments, the bioactive agents can include one or more cancer drugs such as paclitaxel, docetaxel, doxorubicin, vincristine, and / or vinblastine; one or more metals such as iron, magnesium, selenium, and / or zinc; one or more nutritional preparations such as boswellia, withanolide, annonacin, tetracyclines such as vancomycin, and other antibacterial agents such as ricin, lysozyme, and other molecules with similar properties for controlling diseases and food bacterial contamination.

[0527] In some instances, the nanofibers can be provided, for example, in the form of an aqueous solution, a dry powder, or a dehydrated, lyophilized, freeze-dried, spray-dried, or nano-spray-dried form.

[0528] In some embodiments, the nanofibers can be provided as a capsule to be ingested with food or as a nanofiber-nutritional preparation complex (such as boswellia, curcumin, withania somnifera, etc., see other examples provided herein related to nanoparticles and / or food powders).

[0529] For example, in some illustrative embodiments, the homogenized plant tissue can include plant tissues such as cherry fruits that have been substantially depleted or exhausted of low molecular weight components (including polyphenols) by soaking in about 95% ethanol (1:1 w / v) for about 24-4 h, after which the solution can be decanted and the fruits can be further incubated in ethanol for an additional 48 h to remove most or substantially all of the color components (i.e., anthocyanins). The fruit tissue is then thoroughly washed with water for about 24 h (2x-3x in an equal volume of water). The fruit tissue is then homogenized with a blender at about 4500 rpm for about 5 min and then further homogenized with a polytron for about 5 min. The resulting slurry can then be filtered through about 4 layers of cheesecloth and centrifuged at about 10,000 x g to remove debris, and the supernatant can be collected. The supernatant can be dialyzed against water in a dialysis bag with a 10,000 D cut-off to remove low molecular weight components. After dialysis, the solution can be lyophilized or spray-dried to obtain the nanofibers in powder form.

[0530] Alternatively, in some embodiments, the fruit tissue can be cold pressed to separate the juice. The pomace thus obtained can be decolorized and then incubated in ethanol to remove the coloring components (e.g., anthocyanins and other polyphenols that can hydrogen bond with the carbohydrates and peptides of the nanoparticles). After hydration, the tissue can be homogenized and processed as described above.

[0531] In a further example, the plant tissue for preparing the nanofibers can include fruit or vegetable plant tissue. In some examples, the plant tissue can include cherries, blueberries, grapes, or any combination of their fruits. By a preferred example, the plant tissue can include tart cherry fruit tissue.

[0532] Method for producing nanofibers

[0533] In another embodiment, a method for preparing nanofibers (such as those described herein) from homogenized plant tissue can include:

[0534] Preparing the homogenized plant tissue in a solution with low polyphenol content, the solution containing cell components released from the plant tissue;

[0535] Removing debris (if any) from the homogenized plant tissue; and

[0536] Optionally, dialyzing the homogenized plant tissue to remove uncomplexed compounds, or removing uncomplexed compounds by size exclusion,

[0537] Thereby providing a solution containing nanofibers formed by self-assembly of cell components.

[0538] In some embodiments, the bleached plant tissue can generally be considered a tissue from which simple, free, soluble molecules are removed by extracting them from the tissue using an organic solvent highly miscible with water. This may include solvents such as ethanol, methanol, acetone, etc. These solvents may disrupt the cell compartments and enable most of the free molecules (such as anthocyanins, sugars, organic acids, etc.) to leach into the dehydrating medium. In contrast, osmotic dehydration using a sucrose solution mainly extracts water and leaves the components in the fruit. The bleaching described herein refers to the loss of tissue color rather than an oxidation process.

[0539] In another embodiment, provided herein is a method for preparing nanofibers from homogenized plant tissue, the method comprising:

[0540] Preparing the homogenized plant tissue in a solution with low polyphenol content, the solution containing cell components released from the plant tissue;

[0541] Removing debris (if any) from the homogenized plant tissue;

[0542] Permit the formation of nanofibers through the self-assembly of cellular components; and

[0543] Freeze-dry, spray-dry, or nano spray-dry to form a powder containing nanofibers.

[0544] In certain embodiments, the methods and steps for preparing nanofibers described herein can be substantially similar to those described herein for producing nanoparticles, except that the plant tissue can be of low polyphenol content, or the plant tissue can be the plant tissue from which polyphenols are extracted to facilitate nanofiber formation.

[0545] In certain instances of the above methods, nanofibers can be formed by self-assembly in a substantially aqueous medium. In certain embodiments, a low temperature (i.e., about 40 °C) can be used during the homogenization process, and a wide range of water-miscible solvents can be considered for separating the nanofibers.

[0546] In certain instances of the above methods, the method can include the step of dehydrating, lyophilizing, freeze-drying, spray-drying, or nano spray-drying a solution containing nanofibers.

[0547] In certain embodiments, the step of preparing homogenized plant tissue in solution can include homogenizing the plant tissue in an aqueous or organic medium or a mixed aqueous / organic medium. In certain embodiments, the step of preparing homogenized plant tissue in solution can include subjecting the plant tissue to high-shear homogenization and / or sonication in an aqueous or organic medium containing any one or more of water, ethanol, methanol, or acetone.

[0548] In a further instance, the step of preparing homogenized plant tissue in solution can include the step of bleaching the plant tissue prior to homogenizing the plant tissue to remove polyphenols therefrom. In another embodiment, the bleaching of the plant tissue can include extracting polyphenols from the plant tissue with an extraction solution. In certain embodiments, the extraction solution can contain ethanol.

[0549] In another instance, the step of providing homogenized bleached plant tissue in solution can include subjecting the plant tissue to high-shear homogenization in an aqueous or organic medium. In another instance, the step of providing homogenized bleached plant tissue in solution can include homogenizing the bleached plant tissue in an aqueous or organic medium.

[0550] In certain embodiments, the step of removing debris can include dialysis, filtering the homogenized plant tissue, centrifuging the homogenized plant tissue, or performing tangential flow filtration or continuous flow filtration on the homogenized plant tissue, or any combination thereof.

[0551] Food powder and additive and method for producing the same

[0552] Food powder and additive

[0553] In another embodiment, provided herein is a food powder or a food additive comprising the nanoparticles and / or nanofibers described herein, or a part or component thereof, or a structure associated therewith. In certain embodiments, the food powder may comprise, for example, the basic structural components of nanoparticles and / or nanofibers in the form of micron-sized fine powder.

[0554] In another embodiment, provided herein is a food powder comprising self-assembled cellular components derived from homogenized plant tissue, the cellular components comprising one or more structural carbohydrates or their cleavage products and further comprising at least one nutrient.

[0555] In certain embodiments, the food powder may comprise a fibrous structure that wraps around itself to form a nanospherical structure.

[0556] In certain embodiments, the food powder described herein may include a substantially spherical or elliptical structure having a size range of about 1 - 10 µm under the preparation conditions. In certain embodiments, when dissolved in water, such large structures may dissipate into smaller spherical structures in the range of about 50 - 100 nm. In certain embodiments, the food powder structure may comprise one or more randomly wound and assembled fibers homologous to those observed in nanoparticles and nanofibers. In certain embodiments, the overall structure of the food powder may be similar to or homologous to the structure of nanospheres, where there is no precise organization of the fibers, and the described fibers may be capable of adsorbing several components present in, for example, the homogenate of tissue extracts.

[0557] In certain embodiments, one or more nutrients of the food powder may be complexed with the above-described fibrous nanosphere structure of the food powder and may contribute to the formation of the food powder and / or its resulting structure.

[0558] In certain embodiments, the food powder may further comprise a hydrophobic component. In certain embodiments, the hydrophobic component may include almond milk, coconut milk, and / or milk derived from edible nuts or may be provided in almond milk, coconut milk, and / or milk derived from edible nuts.

[0559] In certain embodiments, the nutritional agent can include naturally occurring active ingredients having health benefits. In certain embodiments, the nutritional agent can include one or more components such as carotenoids, annonaceous acetogenins, boswellia, withania somnifera, members of the Zingiberaceae family, fructooligosaccharides, galactooligosaccharides, inulin, Jerusalem artichoke, members of the Piperaceae family, pepper, or wild relatives containing piperine and / or its derivatives, or any of its active ingredients having health benefits, or any extract, derivative, or product isolated therefrom, or any combination thereof.

[0560] In a preferred embodiment, the food powder can include:

[0561] Sour cherry or its aqueous extract;

[0562] Almond milk or another homogenate of almonds;

[0563] Soy milk, or another homogenate of soybeans;

[0564] Broccoli or its aqueous extract; and

[0565] Turmeric or its powder.

[0566] In certain further preferred embodiments, the food powder can include:

[0567] About 25 - 30 v / v% sour cherry extract (polyphenol equivalent of at least about 0.1 mg / ml);

[0568] About 25 - 30 v / v% almond milk or another homogenate of almonds;

[0569] About 10 - 18 v / v% soy milk or another homogenate of soybeans;

[0570] About 25 - 30 v / v% broccoli extract; and

[0571] About 0.5 - 2.5 w / v% turmeric or its powder.

[0572] The above food powder examples are intended to provide an aesthetically pleasing product without the smell of broccoli or soybeans. It should be understood that various other components, combinations of components, and relative percentages of components are also covered herein.

[0573] In certain further embodiments, the sour cherry extract can be about 1 - 2 mg / ml polyphenol equivalent.

[0574] In certain embodiments, the tart cherry extract may be combined with or replaced by one or more fruit powders, pomaces, or powders produced by spray drying fruit juices from dried whole fruits, or other commercially available fruit powders of interest. In certain embodiments, fruits that are dried and ground to micron size (as opposed to, for example, fresh fruits) may be used for rehydration and homogenization.

[0575] As described herein, the food powders of the present invention can generally be prepared from any suitable plant tissue that can be used to prepare the nanoparticles and / or nanofibers described in detail herein. In certain embodiments, the food powders can be prepared from fruits, vegetables, or other plant tissues or products capable of forming carbohydrate-based nanoparticles or nanofibers as described herein, but as will be understood, the food powders can have different textures, such as more nanospherical structures. The food powders can be prepared in any suitable medium including aqueous, organic, or combinations thereof. In certain embodiments, these food powders can also include nutraceuticals or nutriment-containing materials (or nutriments) that are desired to be included in the food powder product, which will typically be customized for the intended application of the food powder, and can include fresh, processed, or concentrated powders, individually or in any desired combination by weight or volume.

[0576] In certain embodiments, the food powders described herein can be prepared by combining a plant tissue suitable for preparing the nanoparticles and / or nanofibers already described in detail herein with a nutraceutical or nutriment-containing material. As will be understood, the nutraceutical or nutriment-containing material will typically be customized for the intended application of the food powder and can include fresh, processed, or concentrated powders, individually or in any desired combination by weight or volume. In certain embodiments, the food powders can be developed with nutraceutical or nutriment-containing components or components targeted for specific physiological conditions (such as chronic diseases), and such nutraceutical or nutriment-containing materials can have, for example, prophylactic and / or therapeutic properties. As will be understood, the term nutraceutical or nutriment as used herein can include any suitable active agent or compound (or material containing an active agent or compound) suitable for a particular indication and is not limited to those entities generally considered to be nutriments, such as those found in foods. For example, in certain embodiments, the nutriment can include any suitable natural (or non-natural) ingredient having health benefits. In certain embodiments, the plant tissue can include the peel and / or the outer tissue of the fruit, such as in cocoa.

[0577] In certain embodiments, the food powder can include:

[0578] 1. Sour cherry (or sour cherry extract), or another fruit or vegetable (or its extract), which is capable of forming carbohydrate-based nanoparticles or nanofibers as described herein;

[0579] 2. A hydrophobic component (such as, but not limited to, almond milk), which can bind hydrophobic molecules from added substances (other examples are, for example, coconut milk or milk derived from edible nuts); and

[0580] 3. A nutrient-containing material (such as a functional food extract) containing one or more bioactive ingredients, which contains one or more bioactive ingredients customized for the required application, such as a food powder.

[0581] Some non-limiting examples of the nutrient-containing material may include one or more of the following active compounds and / or plant families:

[0582] Carotenoids (i.e., β-carotene, lycopene, lutein and other xanthophylls, astaxanthin, etc.);

[0583] Annatto (a polyketide derived from annatto fruit with anti-cancer properties);

[0584] Boswellia (which can provide additional anti-inflammatory functions together with curcumin);

[0585] Withania somnifera (an herbal component containing withanolides, having anti-stress and cancer-preventive effects), mainly having a steroid structure;

[0586] Members of the Zingiberaceae family, which may include edible ginger, mango ginger or other members of the Zingiberaceae family containing any of several bioactive ingredients (including gingerol and shogaol); turmeric (i.e., Curcuma longa, containing curcumin);

[0587] Fructooligosaccharides, galactooligosaccharides and inulin from Jerusalem artichoke to increase the prebiotic content;

[0588] Members of the Piperaceae family, such as Piper nigrum and its wild relatives containing piperine and several derivatives; and / or

[0589] Any other suitable ingredients not listed above (such as, but not limited to, those derived from plants);

[0590] And / or any extract, derivative, product isolated therefrom, or material or plant tissue containing such components.

[0591] Method for producing food powder and additives

[0592] In another embodiment, provided herein is a method for preparing a food powder from homogenized plant tissue, the method comprising:

[0593] preparing homogenized plant tissue in a solution that contains cell components released from the plant tissue, the cell components comprising one or more structural carbohydrates or their cleavage products, and the homogenized plant tissue in the solution further comprising at least one nutrient;

[0594] optionally, removing debris (if present) from the homogenized plant tissue in the solution; and

[0595] lyophilizing, freeze-drying, spray-drying or nano-spray-drying the homogenized plant tissue in the solution to form a food powder.

[0596] Examples of suitable plant tissues and nutrients have been described in detail above.

[0597] In yet another embodiment of the above method, the step of preparing the homogenized plant tissue can include homogenizing the plant tissue in an aqueous medium, an organic medium or a mixed aqueous-organic medium. In certain embodiments, the food powder can be prepared by homogenizing a food powder starting material in a solution. For example, homogenization can be achieved using a blender, preferably operating at high rpm and capable of generating high shear forces, or any other suitable machine capable of efficient mixing (such as a sonicator).

[0598] In certain embodiments, the homogenized plant tissue in the solution can be filtered to remove debris, or the debris can alternatively be removed from the homogenized mixture. For example, a centrifugation device or a filtration device (such as a membrane filtration device or a tangential flow filtration device) capable of filtering debris (i.e., particulate matter that did not enter the homogenate and settled by gravity) can be used to remove the debris.

[0599] In certain embodiments, the food powder can then be dehydrated, freeze-dried, spray-dried, nano-spray-dried, or otherwise dehydrated or dried. For example, a device capable of removing water (or another solvent used) can be used, which can include a nano-spray dryer, or a freeze dryer for aqueous samples, or more preferably, an efficient spray dryer capable of spray-drying large volumes. In certain embodiments, the dryer can operate under reduced pressure.

[0600] In another embodiment, the plant tissue can include fruits, vegetables, or plant tissues. In another embodiment, the plant tissue can comprise senescent fruits, mature vegetables, or any combination thereof; preferably, wherein the plant tissue includes cherries, blueberries, grapes, peaches, nectarines, plums, apricots, papayas, tomatoes, or any combination thereof. In certain embodiments, the plant tissue can include plant tissues obtained from or containing tart cherries, almonds or almond milk, soybeans or soy milk, broccoli, turmeric, or any combination thereof. In certain embodiments, the homogenized plant tissue can include tart cherry extract, almond milk, soy milk, broccoli extract, and turmeric powder. Suitable plant tissues have been described in detail above.

[0601] In certain embodiments, the homogenized plant tissue in the solution can further comprise a hydrophobic component as described above.

[0602] In yet another embodiment, the plant tissue can include one or more nutrient-containing materials, which can be fresh, pre-treated, or concentrated materials, or any combination thereof.

[0603] In certain embodiments of the above method, the step of preparing the homogenized plant tissue can include homogenizing the plant tissue with a blender, sonicator, or another high-performance mixing device preferably operating at high rpm and generating high shear forces.

[0604] In certain embodiments of the above method, the step of removing debris can include removing debris with a centrifuge device, with a filtration device, by membrane filtration, by tangential flow filtration, or any combination thereof.

[0605] In certain embodiments, the plant tissue can include plant tissues obtained from or containing tart cherries, almonds or almond milk, soybeans or soy milk, broccoli, turmeric, or any combination thereof.

[0606] In a preferred embodiment, the starting materials for the method can include:

[0607] Tart cherries or their aqueous extracts;

[0608] Almond milk or another homogenate of almonds;

[0609] Soy milk or another homogenate of soybeans;

[0610] Broccoli or its aqueous extract; and

[0611] Turmeric or its powder.

[0612] In certain further preferred embodiments, the starting materials for the method can include:

[0613] About 25 - 30 v / v% tart cherry extract (polyphenol equivalent of at least about 0.1 mg / ml);

[0614] About 25 - 30 v / v% almond milk or another homogenate of almonds;

[0615] About 10 - 18 v / v% soy milk or another homogenate of soybeans;

[0616] About 25 - 30 v / v% broccoli extract; and

[0617] About 0.5 - 2.5 w / v% turmeric or its powder.

[0618] In certain embodiments, the tart cherry extract can be, for example, about 1 - 2 mg / ml polyphenol equivalent.

[0619] The above food powder examples are intended to provide an aesthetically pleasing product without the odor of broccoli or soybeans. It should be understood that various other components, combinations of components, and relative percentages of components are also covered herein.

[0620] In certain embodiments, the methods and steps for preparing food powders as described herein can be substantially similar to those described herein for generating nanoparticles and / or nanofibers, except that the presence of at least one nutrient agent favors the generation of food powder nanosphere structures rather than nanoparticle and / or nanofiber structures.

[0621] Uses of Nanoparticles, Nanofibers, and Food Powders

[0622] Examples of the intended uses of the nanoparticles, nanofibers, and food powders described herein are listed below. These examples are not intended to be limiting, but rather provide illustrative examples intended for use by those skilled in the art. The experimental studies set forth in the following Examples section provide further details regarding exemplary methods and uses.

[0623] In certain embodiments, the subjects or cells referred to herein can include animal subjects or animal cells. In certain embodiments, the animal can be a mammal. In certain embodiments, the animal can be a human.

[0624] Nanoparticles:

[0625] In one embodiment, provided herein is a method of delivering a bioactive agent to a subject in need thereof, the method comprising:

[0626] Administering to the subject nanoparticles as described herein that are complexed or conjugated with a bioactive agent.

[0627] For example, in certain embodiments, the bioactive agent can be selenium, zinc, magnesium, and / or iron. In certain embodiments, the bioactive agent can include an anti-cancer drug, and the subject can be a subject suffering from cancer. In certain embodiments, the anti-cancer drug can be paclitaxel or vincristine or another natural or synthetic compound for treating cancer. In certain embodiments, the bioactive agent can be introduced into the nanoparticles during nanoparticle formation, or the bioactive agent can be complexed with the formed nanoparticles in an aqueous medium optionally containing an alcohol or other organic compound. In certain embodiments, the aqueous medium can include DMSO, or a buffer, or both.

[0628] In another embodiment, provided herein is a method for treating a disease or disorder associated with reactive oxygen species in a subject in need thereof, the method comprising:

[0629] administering to the subject nanoparticles as described herein.

[0630] In certain embodiments, the nanoparticles can act as an antioxidant.

[0631] In yet another embodiment, provided herein is a method for treating or reducing inflammation in a subject in need thereof, the method comprising:

[0632] administering to the subject nanoparticles as described herein.

[0633] In certain embodiments, the nanoparticles can comprise an anti-inflammatory agent, or be administered sequentially, simultaneously, or in combination with an anti-inflammatory agent. In certain embodiments, the anti-inflammatory agent can comprise curcumin.

[0634] In yet another embodiment, provided herein is a method for treating or reducing obesity in a subject in need thereof, the method comprising:

[0635] administering to the subject nanoparticles as described herein.

[0636] In certain embodiments, the nanoparticles can comprise components at least partially derived from nut, legume, herb, spice, vegetable, or fungal plant tissues traditionally used for food or medical purposes.

[0637] In yet another embodiment, provided herein is a method for treating or preventing cancer in a subject in need thereof, the method comprising:

[0638] administering to the subject nanoparticles as described herein.

[0639] In certain embodiments, the nanoparticles can be administered simultaneously, sequentially, or in combination with an anti-cancer drug. In certain embodiments, the nanoparticles can be complexed or conjugated with an anti-cancer drug. In further embodiments, the anti-cancer drug can be paclitaxel or vincristine.

[0640] In yet another embodiment, provided herein is a method of providing a soluble dietary fiber to a subject, the method comprising:

[0641] administering to the subject the nanoparticles as described herein.

[0642] In yet another embodiment, provided herein is a viscosity enhancing food additive comprising the nanoparticles as described herein.

[0643] In yet another embodiment, provided herein is a method for reducing postprandial blood glucose levels in a subject in need thereof, the method comprising:

[0644] administering to the subject the nanoparticles as described herein.

[0645] In yet another embodiment, provided herein is a cosmetic comprising the nanoparticles as described herein.

[0646] In yet another embodiment, provided herein is a composition for topical administration to a subject in need thereof, the composition comprising the nanoparticles as described herein and an optional bioactive agent.

[0647] In yet another embodiment, provided herein is a method for preventing sunburn in a subject in need thereof, the method comprising:

[0648] applying the nanoparticles as described herein to the skin of the subject.

[0649] In certain embodiments, the nanoparticles can include additional anthocyanins or another UV protectant, or be applied with additional anthocyanins or another UV protectant.

[0650] In another embodiment, provided herein is a method for reducing cell proliferation, the method comprising:

[0651] contacting a cell or tissue or organ with the nanoparticles as described herein.

[0652] In certain embodiments, the nanoparticles can be used simultaneously or sequentially with an anti-cancer drug. In yet another embodiment, the nanoparticles can be complexed or conjugated with an anti-cancer drug. In yet another embodiment, the anti-cancer drug can be paclitaxel or vincristine.

[0653] In yet another embodiment, provided herein is a method for reducing triglyceride accumulation in the liver of a subject in need thereof, the method comprising:

[0654] administering to the subject the nanoparticles as described herein.

[0655] In yet another embodiment, provided herein is a method for reducing cholesterol levels in a subject in need thereof, the method comprising:

[0656] administering the nanoparticles as described herein.

[0657] In yet another embodiment, provided herein is a method for improving lipid metabolism in a subject in need thereof, the method comprising:

[0658] administering the nanoparticles as described herein.

[0659] In another embodiment, provided herein is a targeted nanoparticle comprising the nanoparticles as described herein conjugated to a targeting antibody specific for a cancer marker. In certain embodiments, the targeting antibody can comprise a PD-L1 antibody for targeting the nanoparticles to cancer cells. In certain embodiments, the targeted nanoparticle can be complexed or conjugated with at least one cytotoxic or anticancer drug. In certain embodiments, the targeted nanoparticle can be complexed or conjugated with paclitaxel, doxorubicin, or both and / or another anticancer agent such as one or more pathway-directed antibodies (i.e., PI3K (phosphatidylinositol-3-kinase)).

[0660] In another embodiment, provided herein is an antibacterial nanoparticle comprising the nanoparticles as described herein complexed or conjugated with an antibacterial agent. In certain embodiments, the antibacterial agent can comprise lysozyme, tetracycline, or nisin, or any combination thereof. In certain embodiments, for example, the antibacterial nanoparticle can be used for treating or preventing MDR bacterial infections, and / or for surface sterilization in industries such as the food industry and / or hospitals.

[0661] Nanofibers:

[0662] In one embodiment, provided herein is a method for delivering a bioactive agent to a subject in need thereof, the method comprising:

[0663] administering to the subject the nanofibers as described herein complexed or conjugated with a bioactive agent.

[0664] In certain embodiments, the bioactive agent can include zinc or iron or selenium or magnesium, or any combination thereof. In certain embodiments, the bioactive agent can include an anticancer drug, and the subject can be a subject suffering from cancer. In certain embodiments, the anticancer drug can be paclitaxel or vincristine.

[0665] In certain embodiments, the bioactive agent can be introduced into the nanofibers during the nanofiber formation process, or the bioactive agent can be complexed with the already formed nanofibers in an aqueous medium optionally containing an alcohol or other organic compound. In certain embodiments, the aqueous medium can include DMSO, or a buffer, or both.

[0666] In another embodiment, provided herein is a method for treating or preventing cancer in a subject in need thereof, the method comprising:

[0667] administering to the subject the nanofibers described herein.

[0668] In certain embodiments, the nanofibers can be administered simultaneously or sequentially or in combination with an anti-cancer drug. In certain embodiments, the nanofibers can be complexed or conjugated with an anti-cancer drug. In certain embodiments, the anti-cancer drug can be paclitaxel or vincristine.

[0669] In another embodiment, provided herein is a method for providing soluble dietary fiber to a subject, the method comprising:

[0670] administering to the subject the nanofibers described herein.

[0671] In certain embodiments, provided herein is a thickening food additive comprising the nanofibers described herein.

[0672] In another embodiment, provided herein is a method for reducing postprandial blood glucose levels in a subject in need thereof, the method comprising:

[0673] administering to the subject the nanofibers described herein.

[0674] In another embodiment, provided herein is a cosmetic comprising the nanofibers described herein.

[0675] In another embodiment, provided herein is a composition for topical administration to a subject in need thereof, the composition comprising the nanofibers described herein and an optional bioactive agent.

[0676] In another embodiment, provided herein is a method for preventing sunburn in a subject in need thereof, the method comprising:

[0677] applying the nanofibers described herein to the skin of the subject.

[0678] In certain embodiments, the nanofibers can include anthocyanins or another UV protectant, or be applied together with anthocyanins or another UV protectant.

[0679] In yet another embodiment, provided herein is a method for reducing cell proliferation, the method comprising:

[0680] introducing nanofibers, optionally complexed or conjugated with a cytotoxic agent, into a cell or tissue or organ.

[0681] In certain embodiments, the nanofibers can be complexed or conjugated with a targeting antibody specific for the cell or tissue or organ.

[0682] In certain embodiments, the nanofibers can be administered or used simultaneously or sequentially or in combination with an anti-cancer drug. In certain embodiments, the nanofibers can be complexed or conjugated with an anti-cancer drug. In certain embodiments, the anti-cancer drug can be paclitaxel or vincristine.

[0683] In another embodiment, provided herein is a method for reducing triglyceride accumulation in the liver of a subject in need thereof, the method comprising:

[0684] administering to the subject the nanofibers described herein.

[0685] In another embodiment, provided herein is a targeted nanofiber comprising the nanofibers described herein conjugated with a targeting antibody specific for a cancer marker. In certain embodiments, the targeting antibody can comprise a PD-L1 antibody for targeting the targeted nanofiber to cancer cells. In certain embodiments, the targeted nanofiber can be complexed or conjugated with at least one cytotoxic drug or anti-cancer drug. In certain embodiments, the targeted nanofiber can be complexed or conjugated with paclitaxel, doxorubicin, or both.

[0686] In another embodiment, provided herein is an antibacterial nanofiber comprising the nanofibers described herein complexed or conjugated with an antibacterial agent. In certain embodiments, the antibacterial agent can comprise lysozyme, tetracycline, or nisin, or any combination thereof. In certain embodiments, the antibacterial nanofiber can be used to treat or prevent MDR bacterial infections.

[0687] Food powder:

[0688] In one embodiment, provided herein is a method for delivering a bioactive agent to a subject or organism in need thereof, the method comprising:

[0689] administering to the subject the food powder described herein, which is complexed or conjugated with the bioactive agent using chemical or physical methods.

[0690] In another embodiment, the bioactive agent can be an element such as selenium, zinc, iron, or magnesium. In another embodiment, the bioactive agent can be an anti-cancer drug, and the subject can be a subject suffering from cancer. In certain embodiments, the anti-cancer drug can be paclitaxel, vincristine, or any natural or synthetic compound for treating cancer.

[0691] In another embodiment, the bioactive agent can be introduced into the food powder during the food powder formation process, or the bioactive agent can be complexed with the already formed food powder in an aqueous medium optionally containing an alcohol or other organic compound. In certain embodiments, the aqueous medium can include DMSO, or a buffer, or both.

[0692] In yet another embodiment, provided herein is a method for treating a disease or disorder associated with an elevated level of reactive oxygen species that cause inflammation in a subject in need thereof, comprising:

[0693] administering to the subject a food powder as described herein.

[0694] In another embodiment, provided herein is a method for treating or alleviating inflammation in a subject in need thereof, the method comprising:

[0695] administering to the subject a food powder as described herein.

[0696] In certain embodiments, the food powder can include an anti-inflammatory agent or be administered in combination with an anti-inflammatory agent. In certain embodiments, the anti-inflammatory agent can include curcumin.

[0697] In another embodiment, provided herein is a method for treating or alleviating obesity in a subject in need thereof, the method comprising:

[0698] administering to the subject a food powder as described herein.

[0699] In yet another embodiment, the food powder can include components at least partially derived from nut, legume, herb, spice, vegetable, or fungal plant tissues that have traditionally been used for food or medicinal purposes.

[0700] In another embodiment, provided herein is a method for treating or preventing cancer in a subject in need thereof, the method comprising:

[0701] administering to the subject a food powder as described herein.

[0702] In another embodiment, the food powder can be administered simultaneously or sequentially in combination with an anti-cancer drug. In yet another embodiment, the food powder can be complexed or conjugated with an anti-cancer drug. In yet another embodiment, the anti-cancer drug can be paclitaxel or vincristine.

[0703] In another embodiment, provided herein is a method for providing a soluble dietary fiber to a subject, the method comprising:

[0704] administering to the subject a food powder as described herein.

[0705] In another embodiment, provided herein is a thickening food additive comprising a food powder as described herein.

[0706] In another embodiment, provided herein is a method for reducing postprandial blood glucose levels in a subject in need thereof, the method comprising:

[0707] administering to the subject a food powder as described herein.

[0708] In another embodiment, provided herein is a method for reducing cell proliferation, the method comprising:

[0709] treating a cell or tissue or organ with a food powder as described herein.

[0710] In another embodiment, the food powder can be used simultaneously or sequentially with an anti-cancer drug. In yet another embodiment, the food powder can be complexed or conjugated with an anti-cancer drug. In yet another embodiment, the anti-cancer drug can be paclitaxel or vincristine.

[0711] In another embodiment, provided herein is a method for reducing triglyceride accumulation in the liver of a subject in need thereof, the method comprising:

[0712] administering to the subject a food powder as described herein.

[0713] In another embodiment, provided herein is an antibacterial food powder comprising a food powder as described herein complexed or conjugated with an antibacterial agent. In certain embodiments, the antibacterial agent can comprise lysozyme, tetracycline, or nisin, or any combination thereof. In certain embodiments, the antibacterial food powder can be used to treat or prevent MDR bacterial infections.

[0714] In another embodiment, provided herein is an antibacterial food powder comprising a food powder as described herein complexed or conjugated with an antibacterial agent. In another embodiment, the antibacterial agent can comprise lysozyme, tetracycline or nisin, or any combination thereof. In certain embodiments, the antibacterial food powder can be used to treat or prevent MDR bacterial infections.

[0715] Example 1 - Preparation and Characterization of Nanoparticles and Nanofibers

[0716] Spontaneous Assembly of Macromolecules in Sour Cherry (Prunus cerasus L.) Fruit into Nanoparticles and Nanofibers under Cell Disruption Conditions, and Their Comparison

[0717] The present inventors hypothesized that nanostructures could be generated by specific fruit processing methods that cause cell disruption, providing an environment where molecular interactions could occur and potentially leading to the formation of well-defined nanostructures. This example describes the preparation, isolation, physicochemical properties, and structural characteristics of nanoparticles and nanofibers derived from a biological source (sour cherry fruit in this example) using different methods, which could have beneficial effects in, for example, food function, chronic disease prevention, and / or improving drug and / or bioactive delivery to cells.

[0718] In this example, the homogenization of sour cherry fruit in an aqueous medium (or an alcoholic medium containing both alcohol and water), and the spontaneous assembly of cellular components (e.g., pectin, dextran, oligosaccharides linked to proteins, and / or their degradation products), polyphenols, and organic acids (e.g., malic acid) to form nanoparticles (and nanofibers, where the polyphenols have been extracted from the homogenized fruit) were studied. The nanoparticles formed in these studies were detergent-stable, uniform spherical structures with a size range of approximately 25 - 50 nm in solution, and much larger when dehydrated after lyophilization into a powder. Also, different morphological types of nanostructures, herein called nanofibers, were prepared, which were distinct from the spherical structures and were in the form of nanofibers with a width of approximately 5 - 10 nm and lengths of several micrometers, and were generated from ethanol-bleached polyphenol-free cherries as the homogenized plant tissue. Treatment with pectinase completely disrupted the complex, indicating the pectin nature of the constituent structure. Moreover, treatment with cellulase and trypsin removed the outer fibrillar structure of the nanoparticles, exposing the core. SDS-PAGE of the nanoparticles showed polypeptides of different masses, co-migrating with pectin and polyphenols as smear bands, while the nanofibers mainly showed polypeptides. Both the nanoparticles and nanofibers showed a strong affinity for antibodies raised against arabinogalactan-protein complexes, while the affinity for extensin was much lower. The nanoparticles did not react with anti-homogalacturonan and anti-xyloglucan, while the nanofibers showed a strong reaction. The nanoparticles were rich in hexoses such as glucose, galactose / galacturonic acid, and mannose, while the nanofibers were rich in pentoses such as arabinose. The FT-IR spectra of the nanoparticles and nanofibers were similar to those of proteins and pectin. The 38 kD polypeptide visible as an apparent band after SDS-PAGE showed sequence similarity to endo-1,3-β-glucosidase of dextran, while the 20 kD polypeptide showed similarity to thaumatin-like protein. This example describes the structural characteristics of self-assembled nanoparticles from sour cherry fruit compared to nanofibers also derived from sour cherry fruit in different ways.

[0719] Materials and Methods:

[0720] Sour cherries: The sour cherry fruits used in this example were from the Vineland Research Station in Vineland, Ontario, where these fruits were preserved as germplasm. All varieties were high-polyphenol varieties, with polyphenol contents ranging from 300 - 500 mg / 100 g fresh weight. The main variety in this study was V 70151, and other varieties such as V71261, Hymann Conserva, and Hymann Rubisn also showed high levels of nanoparticle formation. The sour cherries used in this example were Prunus cerasus L.

[0721] Chemicals were obtained from Sigma Chemical Company in St. Louis, USA; Fisher Chemical Company; In Vitrogen; Molecular Probes; and other companies, etc.

[0722] Preparation and separation of nanoparticles and preparation and separation of nanofibers:

[0723] For nanoparticles, the extraction method included homogenizing the sour cherry fruits in a medium (preferably water as used in this example, but alternatively pure or diluted methanol or ethanol) at a 1:1 w / w ratio (1 g tissue to 1 ml water or alcohol) using a polytron homogenizer with a PTA 10 probe at the medium (4 - 5) setting until the fruit tissue was completely homogenized. The homogenate was filtered through four layers of cheesecloth to remove debris. The resulting homogenate was centrifuged (18,000 x g) for 20 min in a Sorvall RC 6 Plus centrifuge. The supernatant was decanted. 5 ml of the supernatant was dialyzed (Spectra-Por, 6 - 8 kD cut-off) against water (1 L) at 4°C for 12 h. The dialyzed extract inside the dialysis bag was frozen and stored at -20°C like the supernatant (referred to as the crude extract). Since the extract may contain enzymes that can degrade nanoparticles in aqueous solution, the dialyzed extract was kept at low temperature. In embodiments using an alcohol or substantially alcohol-containing medium, such enzymes would likely be denatured and / or have reduced activity, although low temperature is generally still preferred. As described herein, nanoparticles are stable once freeze-dried or spray-dried (for example).

[0724] The polyphenols leached into water were highly diluted, and thus, for experimental purposes, they were passed through a sep-pak C18 column and eluted with methanol to be concentrated by hydrophobic interaction chromatography.

[0725] For the lyophilization method, the dialyzed homogenate was placed in a flask with a volume of 1 liter (~250 ml) and a shell was made by cooling in liquid N2. The flask was connected to a lyophilizer (operating at -60 °C, using a 3-4 Toricelli vacuum for this purpose). Before lyophilization, the alcohol solution was dialyzed against water to remove the alcohol. In the case of nanoparticles, complete removal of water could not be achieved by this method, probably because water was bound to the nanoparticles, but this could provide a concentrated solution. This method could be used to dialyze the nanofiber solution into a fine powder.

[0726] For nanofibers, the pitted sour cherry fruits were soaked in 50% ethanol for 48 h, with the solvent being changed 3 times, which led to the removal of polyphenols and the sour cherry fruits turning grayish white (referred to as bleaching in this article). Pitting the sour cherry fruits created a contact surface with the solvent, and in some embodiments it was expected that the fruits could even be cut into smaller pieces to further enhance the removal of polyphenols. The bleached fruits / slices were immersed in water and thoroughly washed 3 times in water to remove the ethanol (for a total of 3 h). These fruits were homogenized in water or methanol (1:1 w / w) using a polytron as used for the unbleached cherry extract described above. After centrifugation (18000 x g) for 15 min to remove debris, the homogenate was dialyzed against water. The dialyzed extract containing nanofibers was substantially free of polyphenols and could be lyophilized into a fluffy white powder.

[0727] For nano spray drying, the nanoparticle / nanofiber solution was diluted with water to a certain concentration such that a fine spray was formed (concentrated solutions tended to clog the nozzles of the sprayers used). Nano spray drying was carried out using a Buchi mini spray dryer (B290) (with a pump speed of 35 - 50%, providing a flow rate of 10 - 15 ml, an inlet temperature of 180 °C, an outlet temperature of 100 °C, and an air flow maintained at 40 L / h). The resulting powder was stored in a sealed tube at -20 °C

[0728] Electron microscopy: Approximately 500 - 1000 µg of the treated nanoscale cherry powder nanoparticles or nanofiber powder was evenly sprinkled on one side of a double-sided sticky carbon conductive tape. The tape was then mounted on a 12 mm diameter aluminum stub. The surface of the sample was observed at different magnifications and images were recorded using a scanning electron microscope (model QUANTA 250, FEI, Netherlands).

[0729] Transmission electron microscopy of nanoparticles was carried out using the previously described dialysis extracts or powders dissolved in water (~100 - 200 µg / ml) (Jacob and Paliyath, 2008). A carbon-coated nickel grid was floated on a 50 μl drop of the solution and the nanoparticles were allowed to adsorb onto the grid for 30 s. The grid was blotted dry and floated on a 1% uranyl acetate drop for 30 s. The grid was blotted dry and examined under a Leo 912 B transmission electron microscope.

[0730] Protein analysis: To assess protein degradation during processing, proteins were extracted from each step using TRIzol®, as recommended by the manufacturer (Invitrogen). Briefly, a sample of 100 μg protein equivalent (as determined by Bradford reagent) was homogenized or thoroughly mixed in TRIzol reagent (1 ml) and incubated at room temperature for 5 min. The homogenate was centrifuged at 4 °C for 15 min. For phase separation, 200 μl of chloroform was added and vortexed to mix well and centrifuged at 4 °C for 15 min. The aqueous and organic phases were separated. The aqueous phase was dried by lyophilization. The dried residue was redissolved by heating in the loading buffer (90 °C) for SDS-PAGE. To precipitate proteins from the organic fraction, 1.5 ml of isopropanol was added and incubated at room temperature for 10 min, followed by centrifugation at 12,000 x g at 4 °C for 10 min. The precipitate obtained after centrifugation was washed three times with a 95% ethanol solution of 0.3 M guanidine hydrochloride and then finally washed with 2 ml of 100% ethanol. The precipitate was redissolved by heating in the loading buffer. Protein samples were separated on a 10% polyacrylamide gel under denaturing and reducing conditions. The gel was fixed in 10% acetic acid and stained with Coomassie Brilliant Blue.

[0731] Association of Polyphenols and Polypeptides in Nanoparticles: The formation of nanoparticles during the homogenization of sour cherries in water is a spontaneous process. The resulting homogenate is strongly acidic, with a pH typically around 3.0. To test whether homogenization at a near-neutral pH has an impact on nanoparticle formation and on the association of proteins and polyphenols, sour cherries were also homogenized in 300 mM sodium citrate buffer at pH 6.0. In the TRIzol™ protein extraction method, free proteins transfer to the organic phase, while proteins tightly bound to hydrophilic molecules such as carbohydrates can partition into the aqueous phase. To evaluate the association of polyphenols and proteins in nanoparticles, proteins from the aqueous and organic phases obtained after TRIzol™ extraction were analyzed using SDS-PAGE. The diluted aqueous phase was concentrated by lyophilization, while proteins from the organic phase were precipitated using isopropanol as described previously. The precipitated intermediate phase was directly dissolved in the protein sample loading buffer. Proteins were separated on a 10% polyacrylamide gel under denaturing and reducing conditions. After electrophoresis, the gel was incubated in 10% acetic acid for 5 min and photographed to highlight the distribution of colored polyphenols. Then proteins were detected by Coomassie Brilliant Blue staining.

[0732] In these tests, nanoparticle formation was favored at low pH values between 3 and 6. The association of polyphenols and peptides could be understood by the co-migration of peptides and anthocyanins observed in the unstained gel ( Figure 12 A) and the same gel stained with Coomassie Brilliant Blue ( Figure 12 B).

[0733] Association of Pectic Acid in Nanoparticles: Apple pectin and polygalacturonic acid were dissolved in 0.1 N NaOH and used as standards. Nanoparticles and free polyphenols, as well as these pectin samples, were separated on a 10% polyacrylamide gel under denaturing / reducing conditions. After electrophoresis, the gel was stained with an aqueous solution of 10 μg / ml propidium iodide for 1 h and photographed. The same gel was stained again with Coomassie Brilliant Blue.

[0734] Western and dot blot analysis of structural components in nanoparticles: To identify the nature of the major carbohydrate structural components of nanoparticles, dot blot and Western blot were performed using three monoclonal antibodies (www.Plantprobes.net) raised against homogalacturonan (LM20), expansin (LMl), and arabinogalactan-protein (LMl4). The lyophilized powders of nanoparticles and nanofibers from unbleached and bleached sour cherries were separately heated in loading buffer at boiling water for 5 min and separated by 10% SDS-PAGE under reducing conditions. The polypeptides separated from the gel were electrotransferred onto a nitrocellulose membrane overnight. For dot blot analysis, 2 μl of the boiled sample was directly applied onto the nitrocellulose membrane. These nitrocellulose membranes were blocked with 5% non-fat milk solution in PBS (phosphate buffered saline) buffer at room temperature for 1 h. After washing three times with PBS-T (PBS containing 0.1% Tween-20) and finally with PBS, the membranes were incubated with the primary antibody solution (20x dilution) in PBS at room temperature for 2 h. After incubation, the membranes were washed 3 times with PBS-T and finally with PBS, and then incubated with anti-rat-AP conjugated secondary antibody at room temperature for 1 h. After incubation with the secondary antibody, the membranes were washed 3 times with PBS-T and finally with PBS. Color development was achieved using the Bio-Rad alkaline phosphatase conjugate substrate kit as recommended by the manufacturer.

[0735] Analysis was performed on a Varian Saturn 2000 system equipped with an ion trap. The GC was programmed at a constant flow rate of 1 ml / min on a Sil-CB8 (0.25 mm × 30 m) column. In split mode, the injector temperature was maintained constant at 250 °C (20:1). During injection, the oven temperature was held constant at 100 °C for 4 min, then increased at a rate of 8 °C / min to 250 °C and held at 250 °C for an additional 3 min. The ion trap was programmed to analyze masses between 40 - 650 m / z with an initial delay segment of 3 min.

[0736] Derivatization of sugars: Trimethylsilyl (TMS) derivatives of various pentoses and hexoses were prepared to determine their respective retention times under the given GC-MS parameters. Various sugar standards (2 mg) were dissolved in 100 μl of anhydrous pyridine, and 100 μl of BSTFA:TMCS (N,O-bis(trimethylsilyl)trifluoroacetamide:trimethylchlorosilane; 99:1) was added to the solution in a glass vial. Derivatization was carried out using the method described by the supplier (Sigma). The reaction mixture was incubated at 80 °C for 2 h. 1 µl of the derivatized sugar was injected into the GC-MS for analysis.

[0737] Derivatization of nanoparticles: As generally described above, nanoparticles were freshly prepared by homogenizing 10 g of tart cherry fruit in 10 ml of distilled water. The homogenate was centrifuged at 15000 g for 20 min. After the supernatant was clarified, it was passed through a 10 ml PD-10 desalting column and dialyzed against distilled water using a 6 - 8 kDa cut-off membrane. 100 µl of the purified nanoparticles was mixed with 200 µl of concentrated TFA to a final concentration of 8.6 M and incubated at 90 °C for 2 h. The hydrolyzed sample was dried under a nitrogen stream. The dried sample was resuspended in 100 µl of pyridine and 100 µl of BSTFA:TMCS (99:1) was added to the solution. Derivatization was carried out by incubating at 80 °C for 1 h. 1 µl of the sample was injected for GC-MS analysis.

[0738] Derivatization of nanofibers: A nanofiber solution was prepared by dissolving 4 mg of freeze-dried nanofibers in 1 ml of water. 100 µl of the nanofibers was hydrolyzed in 8.6 M TFA at 90 °C for 2 h. The hydrolyzed sample was filtered through a glass fiber filter and dried under a nitrogen stream. The dried sample was resuspended in 100 µl of pyridine and 100 µl of BSTFA:TMCS (99:1) was added to the solution. Derivatization was carried out by incubating at 80 °C for 1 h. 1 µl of the sample was injected for GC-MS analysis.

[0739] FT-IR analysis of nanoparticles: FT-IR analysis of nanoparticles and nanofibers was performed using a Bruker Tensor 27 infrared spectrometer. An equal amount of powder (1%) was mixed with KBr and made into a transparent disk, and the disk was scanned to obtain the spectrum.

[0740] Small-angle X-ray diffraction of nanoparticles: Small-angle X-ray diffraction of nanoparticles was performed using a Bruker Nanostar SAXS diffractometer. Diffraction analysis was carried out using the freeze-dried powder of the dialyzed extract of unbleached cherries and the nanoparticles in the dialysis solution.

[0741] Statistical analysis: Statistical analysis was performed using GraphPad Prism version 4. The Student t-test was used to compare the results with two means. One-way analysis of variance, followed by the "Tukey test", was used to compare the results with multiple means to evaluate the significance level. Different superscripts indicate significantly different means (p < 0.05).

[0742] Results and discussion:

[0743] Characterization of nanoparticles: In these studies, homogenization of fruits in an aqueous medium disrupted the natural organization of cellular macromolecules and simple molecules, leading to their random but structured assembly, thus generating structures with different physicochemical and structural characteristics. These structures were separated by dialysis using a low molecular weight cut-off membrane capable of size exclusion separation or a PD-10 column, taking advantage of the size differences between polyphenols and nanostructures complexed with polyphenols. The polyphenol contents of the crude tart cherry extract, the dialysis extract containing nanoparticles, and the dialysate (containing molecules with a molecular weight of ~6 kD or lower excluded by the membrane) are shown in Table 1. Approximately 80% of the polyphenols in the extract were retained within the dialysis membrane, indicating that the polyphenols exist in a complexed state. The formation of complexes in tart cherries is much higher compared to other fruits such as grapes and blueberries (although nanoparticles are also formed in grapes and blueberries). HPLC-MS separation of the polyphenol fraction showed the presence of cyanidin-3-rutinoside as the main anthocyanin, while the content of peonidin 3-rutinoside was lower. The contents of phenolic acids such as chlorogenic acid and p-coumaroylquinic acid were much smaller (see Table 2). Table 3 gives the antioxidant activities of the crude extract, the dialysis extract (nanoparticles; NP), and the dialysate from water and methanol extracts. All extracts showed high levels of superoxide, hydroxyl, and DPPH radical scavenging activities. Under both extraction conditions, the crude extract showed the highest antioxidant capacity. The antioxidant activity of the dialysate was the lowest. A large part of the antioxidant capacity was associated with the nanoparticles (i.e., the dialysis extract).

[0744] Extraction in methanol (final ~50% v / v) also led to the formation of nanoparticles.

[0745] The dialysis extract can be lyophilized into a fluffy powder containing protein (10 - 12%), polyphenols (12 - 14%), pectin (10% - 15%), and other carbohydrates (e.g., hemicellulose components such as xyloglucan, pectin components such as arabinogalactan). Once formed, the polyphenols in the nanoparticles could not be extracted with ethanol (in a proportion of 50 - 100%). The complexes are generally acid-stable (pH < 3). The addition of 10% trichloroacetic acid caused the complexes to precipitate as a red residue. However, alkaline conditions (pH > 7) led to ring cleavage of the polyphenols, which might destabilize the macromolecular organization. In contrast, the nanofibers of ethanol-bleached cherries do not contain detectable amounts of polyphenols but contain protein (~15%), pectin (15 - 20%), and other carbohydrates (hemicellulose such as xyloglucan, pectin components such as arabinoxylan and complex pectin (60 - 70%). Since complex formation is a random event, it is difficult to achieve a strict proportional relationship between the types of components, thus providing a general proportional relationship of the components.

[0746] Table 1: Total polyphenol content in tart cherry extract

[0747] Total polyphenol content (mg gallic acid / g fresh weight equivalent)

[0748] SampleWater extractMethanol extract

[0749] Crude extract0.88 ± 0.1b,c - 0.94 ± 0.1b,c1.04 ± 0.1b,c - 1.13 ± 0.1b,c

[0750] Dialyzed extract

[0751] (Nanoparticles)0.65 ± 0.1a,c - 0.63 ± 0.1a,c0.70 ± 0.1a,c - 0.80 ± 0.1a,c

[0752] Dialysate0.03 ± 0.1a,b - 0.06 ± 0.1a,b0.03 ± 0.1a,b - 0.05 ± 0.1a,b

[0753] Superscript “a” indicates statistical significance from CE (water and methanol) at p < 0.05; “b” indicates statistical significance from DE (water and methanol) at p < 0.05; and “c” indicates statistical significance from DZ (water and methanol) at p < 0.05, respectively. Values for each group are the mean ± standard error from three independent estimates.

[0754] Table 2: Polyphenol composition of tart cherry dialyzed extracts (mg gallic acid equivalent / g fresh weight)

[0755] PolyphenolDialyzed water extractDialyzed methanol extract

[0756] Cyanidin-3-sophoroside0.07 ± 0.10.07 ± 0.0

[0757] Cyanidin-3-rutinoside0.71 ± 0.1b0.55 ± 0.1a

[0758] Peonidin-3-rutinoside0.17 ± 0.10.16 ± 0.0

[0759] Pelargonidin-3-rutinoside0.06 ± 0.1b0.1 ± 0.1a

[0760] p-Coumaroylquinic acid0.02 ± 0.00.01 ± 0.0

[0761] Chlorogenic acid0.04 ± 0.10.04 ± 0.1

[0762] The superscripts “a” and “b” represent the statistical significance at p < 0.05 between components in the dialyzed water extract and the dialyzed methanol extract of each phenolic component, respectively. ND: Not detected. Quantification was performed by HPLC-MS analysis and peak area comparison.

[0763] Table 3: Antioxidant capacities of the crude extract, dialyzed extracts, and dialyzates of tart cherries

[0764] Antioxidant activity (% quenching / µg polyphenol)

[0765] Water extract Methanol extract

[0766] Antioxidant assay Crude extract Dialyzed extract

[0767] (Nanoparticles) Dialyzate Crude extract Dialyzed extract Dialyzate

[0768] Superoxide scavenging 2.6 ± 0.2b,c 1.8 ± 0.1a 1.4 ± 0.1a 3.6 ± 0.1b,c 2.5 ± 0.1a,c 1.6 ± 0.2a,b

[0769] Hydroxyl radical scavenging 4.9 ± 0.2b,c 2.1 ± 0.2a,c 1.5 ± 0.1a,b 6.5 ± 0.3b,c 3.9 ± 0.3a,c 1.8 ± 0.1a,b

[0770] DPPH radical scavenging 8.2 ± 0.3b,c 4.4 ± 0.5a 4.7 ± 0.1a 8.8 ± 0.2b,c 6.2 ± 0.2a,c 3.3 ± 0.4a,b

[0771] DPPH, hydroxyl, and superoxide radical scavenging capacities (RSC) of tart cherry extracts. The superscript “a” represents the statistical significance from the crude extract (CE) (water and methanol) at p < 0.05; “b” represents the statistical significance from the dialyzed extract (DE) (water and methanol) at p < 0.05; and “c” represents the statistical significance from the dialyzate (DL) (water and methanol) at p < 0.05, respectively.

[0772] Morphology of nanoparticles: Transmission electron microscopy (TEM) of the dialyzed extract showed nanoparticles in the range of approximately 25 - 50 nm in diameter ( Figure 1 A, arrow). The size varied greatly, indicating that the complex might undergo transformation through the loss of structural components. The nanoparticles had linear filamentous components wound around a central structure. In the magnified view of the complex, these structures could be seen stretching between two nanoparticles ( Figure 1B, arrow). The change in nanoparticle size may be caused by multiple fibers winding around the central core multiple times. The fibers seem to unfurl in several nanoparticles ( Figure 1 B, arrow), indicating that these nanoparticles can be bound together by non-covalent bonds and that changes in the external environment can dissociate the nanoparticles into their building blocks. The TEM of the structural components of the nanoparticles is as Figure 2 shown. Figure 2 A shows the nuclear structure of the nanoparticles as spherical structures, which are peeled off from the wound filaments (arrow). Fibrous structures can be observed in the background emanating from the central spherical structure. In Figure 2 B and C, the sub-structures of the filaments showing helical protofibril-like structures can be seen (arrows 1, 2). Figure 2 D shows the extended fiber structure composed of protofibrils (arrow). Therefore, the nanoparticles seem to have multiple organizational levels to form sub-structures with different characteristics, a central core, fibers surrounding the core, and fiber structures assembled into helices (which can extend into protofibrils that can be bound together by non-covalent bonds).

[0773] Structural components of the nanoparticles: In this example, ripe sour cherries were used as plant tissues to prepare nanoparticles and nanofibers. The macromolecules present in ripe fruits are mainly carbohydrates, such as cellulose, hemicellulose, pectin, and cell wall-related glycoproteins (Negi and Handa, 2008). There are very few soluble proteins in ripe fruits. In fruits such as cherries, organic acids are the main storage molecules and are converted into sugars during ripening. Starch is the main storage component, which exists in high molecular weight structures and is absent in ripe fruits. The biosynthesis of polyphenols increases during ripening, and the accumulation of polyphenols in vacuoles makes the fruits red.

[0774] Therefore, the nanoparticles from sour cherries can be composed of cell wall carbohydrates (structural carbohydrates) and proteins as the main structural components. If so, it is hypothesized that the nanoparticles can be enzymatically digested using pectin-degrading enzymes, cellulose-degrading enzymes, and proteases, and the stability can be evaluated by structural examination to learn more about the structural organization. The effect of pectinase (polygalacturonase, α1-4-glycosidase) treatment on nanoparticle stability is as Figure 3 shown in A, and the magnified area is as Figure 3as shown in Panel B. After digestion with pectinase (1 unit / ml), the nanoparticles were completely broken down into small tubular / vesicular structures, which were dispersed within an electron-dense matrix that might have been formed by binding of uranium ions to the negatively charged molecules of galacturonic acid in pectin (Negi and Handa, 2008). Notably, these digested structures resembled the nanovesicles observed in commercially available Concord grape juice (Jacob and Paliyath, 2008). Fruit homogenates are usually treated with pectinase to obtain higher juice yields during industrial processing. This observation suggests that the nanoparticles contain high levels of pectin-derived carbohydrate oligomers. The nanoparticles were treated with cellulase (β-1,4-glucanase, 1 unit / ml), and the resulting structural modifications were studied. Compared to pectinase digestion, treatment with cellulase led to the formation of much larger vesicles and vesicle aggregates ( Figure 3 Panels C and 3D, arrows). Since cellulase cannot digest pectin, the structures remaining after digestion might be composed of pectin and could be the core of the nanoparticles. Thus, the cellulose moiety could form part of the filamentous structures surrounding the pectin core of the nanoparticles. The nanoparticles were also incubated in the presence of trypsin (1 unit / ml), which again digested the outer filamentous structures of the nanoparticles, leaving a core made of pectin ( Figure 4 Panel A). These structures also resembled the empty shell structures observed after cellulase treatment, indicating that the outer filamentous structures of the nanoparticles contain a cellulose moiety and polypeptides (i.e., proteinaceous material). An enlarged view of the shell structure after stripping of the outer fibrous structure by trypsin treatment is shown in Figure 4 Panel B. Intermediate structures formed during trypsin digestion are shown in Figure 4 Panel C, Figure 4 Panel D, and Figure 4 Panel E. Figure 4 Panel C shows nanoparticles surrounded by concentric rings of fibrous structures (i.e., fibrous tissue around the pectin core), which were released due to trypsin treatment. Figure 4 Panel D shows the shell of the nanoparticles and the fibers stripped from the complex. Figure 4 Panel E shows the substructure of the fibrous material composed of long fibrillar structures that intertwined and braided into a rope-like structure, demonstrating the potential of the fibers to form large woven entities. These fibrous structures were long, reaching the micron scale in length, but had a diameter of approximately 2 - 3 nm. The resilience of the nanoparticles to chemical treatment might arise from this structural complexity that stabilizes the structure through interactions of different types of macromolecules.

[0775]

[551] Scanning electron microscopy (SEM) of the dried nanoparticle powder: The nanoparticles were lyophilized, and after removal of water, an amorphous powder was obtained. Examination of this powder by SEM revealed structural aspects that may indicate transitional stages leading to nanoparticle formation. The size distribution of the nanoparticles is as shown in Figure 5 . In the dry form, the diameters of these complexes range from <200 nm to diameters exceeding micrometers. This is almost ten times higher than that observed in the hydrated nanoparticles in suspension ( Figure 1 A), where the size variation is about 25 - 50 nm). This indicates that during slow dehydration, the water bound to the nanoparticles is removed, causing the complexes to swell. Rehydrating the powder by suspending it in water causes them to reverse into small nanoparticles (data not shown). In addition to the spherical structure, tubular structures ( Figure 5 , arrows) were also observed in the lyophilized powder. Structural changes in the lyophilized powder can also be seen in Figure 6 , Figure 6 showing the heterogeneity of the transitional structures in the form of flakes (arrow 1), filaments (arrow 2), tubes (arrow 3), and vesicles, all of which can be seen in a mixed state. The area where vesicles bud from the tubular structure is shown as arrow 4. Thus, in terms of their origin, these flakes seem to tend to form tubular structures, which can sprout from vesicle structures and are encapsulated by pectin / cellulose oligomer - polypeptide and other small molecules such as polyphenols and malic acid during nanoparticle formation.

[0776]

[552] Nanofibers from bleached cherries: Since polyphenols are tightly bound to the nanoparticles and difficult to remove by solvent extraction (alcohol, DMSO, acid, etc.), an attempt was made to remove polyphenols from the fruit by ethanol before nanoparticle production. The fruit was soaked in 50% ethanol for 48 h, with the solvent changed 3 times, and this resulted in the removal of polyphenols, and the cherry fruit turned grayish white. The same method for preparing nanoparticles was generally then carried out. The removal of polyphenols led to overall structural changes compared to those observed for the nanoparticles. Examination of the lyophilized powder showed extended strands or filamentous structures (nanofibers) interspersed with membranes with diameters on the order of nanometers (2 - 3 nm), which extended to the micrometer scale in length ( Figure 7 A). In the aqueous state, the nanofibers maintained their morphology, with lengths of several micrometers and diameters of about 5 - 10 nm ( Figure 7 B, arrow 1). These filaments also showed regions with a helical structure ( Figure 7 B, arrow 2), indicating that these regions may originate from the helical fibrous structures that encapsulate the nanoparticles and appear as stretched fibers after treatment with trypsin ( Figure 4 E). Thus, it seems that polyphenols play a major role in determining the structural organization of the nanoparticles, and these interactions may also involve association with polypeptides.

[0777] The interaction of polyphenols with proteins is known (Dangles and Dufour, 2006). Functionally, apple pectin is known to interact with polyphenols and enhance the beneficial effects of colonic fermentation and lipid removal from the body (Aprikian et al., 2003). Structurally, polyphenols are known to interact with both pectin and cellulose via ionic and hydrogen bonds (Padayachee et al., 2012). The interaction of polyphenols with the cellulose and pectin components occurs in a biphasic process, with up to 18% binding. The cellulose-pectin complex shows the highest binding. Thus, the combination of polypeptides, pectin / cellulose oligomers can thus provide a highly favorable environment for polyphenol binding, which retains the polypeptide-pectin-cellulose backbone even after polyphenol removal and assembles into nanofibers.

[0778] Stability of nanoparticles to detergents: The stability of the nanoparticles was further examined by treating the dialyzed extract with detergents such as TriionX-100 and sodium deoxycholate, which can disrupt macromolecular structures. When the dialyzed extract containing the nanoparticles was incubated with increasing concentrations of these detergents, the level of polyphenols associated with the nanoparticles remained almost constant when measured at 520 nm, which is the maximum absorption characteristic of the benzopyran moiety of anthocyanins ( Figure 8 ). Similar results were also obtained with sodium deoxycholate. An increase in the measurement at 260 nm may indicate that the micelle formation is above the critical micelle concentration at which Triton X-100 entraps polyphenols. These results also indicate the absence of lipids in the structural components of the nanoparticles.

[0779] Chemical composition of nanoparticles and comparison with nanofibers:

[0780] Acidity of nanoparticles: The nanoparticles are highly stable both in aqueous solution and in dry powder. During size exclusion chromatography of the nanoparticles, the polyphenols bound to the nanoparticles elute in the void volume, showing the maximum absorption characteristic of polyphenols at 520 nm, and the pH is 3. The elution of free polyphenols present in the solution is delayed, the eluate is blue-gray, the pH is close to 7, and the benzopyran ring of anthocyanins breaks, accompanied by the loss of red color. After the acid cherry extract, which had been dialyzed to remove free organic acids in the juice molecules, the dialyzed extract still showed a pH close to 3, indicating that in addition to the oligogalacturonic acid portion of homogalacturonan (pH 3), there may be acidic components (organic acids) bound to the nanoparticles as structural components. To identify these components, the dry nanoparticles and nanofibers were dried and trimethylsilyl derivatives were prepared, and the derivatives were analyzed by GC-MS. The results are as Figure 9As shown. The elution pattern of a standard organic acid is shown at (A) in the upper panel. (b) and (C) show the elution curves of the compounds from the nanoparticles and nanofibers, respectively. Both the nanoparticles and nanofibers show the clear presence of malic acid (mass spectrometry, trimethylsilyl derivative) eluting at 13.7 min. Malic acid is the main organic acid present in sour cherry fruit. As a hydroxy acid, malic acid can form hydrogen bonds to stabilize the molecular associations between the components of the nanoparticles and nanofibers. The peak eluting between 20-25 min is from the derivatized sugar or oligosaccharide. Figure 9 The lower panel shows the mass spectrum of a reference malic acid trimethylsilyl derivative.

[0781] SDS-PAGE analysis of sour cherry peptides: The amount of proteins in fruits is usually relatively low and protein degradation occurs during ripening through the activation of proteases. The presence of proteins in the nanoparticles was confirmed by their sensitivity to trypsin. Proteins in fruits and homogenates were separated using TRIzol™, a universal reagent that is well suited for the extraction of nucleic acids and proteins in fruits (Tiwari and Paliyath, 2011). Under these conditions where protease activity is inhibited (such as in the presence of phenol, guanidine isothiocyanate), protein degradation is minimal and proteins are present in the organic phase after the addition of water, which leads to phase separation of TRIzol extracts. Proteins in the original fruit, homogenate and pellet of the centrifuged homogenate were subjected to Trizol extraction and the organic phase (chloroform:phenol), which usually contains proteins, was analyzed by SDS-PAGE. The results are shown in Figure 2. Figure 11 As shown. Clear separation of protein bands can be seen in the gel (see Figure 11 , lanes 2, 3, 4), which represent proteins in the fruit (lane 2), proteins in the total aqueous homogenate (lane 3), and the pellet obtained after centrifugation of the homogenate (lane 4). However, after Trizol extraction of the supernatant of the fruit homogenate obtained after centrifugation, the organic phase contained almost no proteins and mainly contained low molecular weight peptides (25 kD) (lane 5). When directly analyzed without TRIzol extraction, the lyophilized powder of the dialyzed extract did not show discrete bands as proteins in the fruit or its homogenate, but showed smears of polypeptides when visualized after SDS-PAGE and Coomassie blue staining (lane 6). However, after TRIzol extraction of the dialyzed extract powder, the organic phase showed no staining with Coomassie brilliant blue, indicating that the proteins / peptides may have migrated to the aqueous phase due to the increased hydrophilicity associated with carbohydrates and polyphenols (lane 7).

[0782] SDS-PAGE analysis of peptides in nanoparticles: Since nanoparticles are composed of peptides of various molecular weights ( Figure 11, lane 6), further analysis was carried out to describe their binding properties with other components such as carbohydrate and polyphenol components. If these structural components are tightly associated in the nanoparticles, it is assumed that they should co-migrate during SDS-PAGE. Sour cherries were extracted in water or buffer (potassium citrate, 300 mM, pH 6, final pH of pH 5 after homogenization) and dialyzed against water or buffer. The dialyzed extract was freeze-dried and the powder was resuspended in loading buffer. Equal amounts (15 µg) of protein (resuspended in 15% aqueous glycerol solution) were loaded onto the gel and SDS-PAGE was performed. After electrophoresis, the gel was removed and incubated in 10% (v / v) aqueous acetic acid. Panel A ( Figure 12 ) shows the gel after peptide separation and before Coomassie Brilliant Blue staining to show the pink trailing color in the lane due to the presence of polyphenols. Panel B shows the same gel stained with Coomassie Brilliant Blue to show the polypeptides. Lane 2 shows the staining pattern of the dialyzed extract powder. Comparison of lane 2 in Panels A and B reveals the similarity between peptide migration (lane 2, Panel B) and polyphenol migration (lane 2, Panel A), indicating tight binding of polyphenols to polypeptides in the nanoparticles. Compared to peptides, polyphenols are small and uncharged molecules and would elute from the gel if they were not complexed. Trizol extraction and phase separation were performed on the dialyzed extract powder containing nanoparticles (obtained from water extract), and lane 3 (Panels A, B) corresponding to the aqueous supernatant fraction showed the presence of polypeptides and polyphenols, indicating their tight binding. This property also reveals the hydrophilicity of the peptide-carbohydrate-polyphenol complex, because in the absence of complex formation, the polypeptides themselves would partition into the organic phase of the TRIzol extract (phenol:chloroform). However, as previously described ( Figure 11 , lane 7), the organic phase of the Trizol extract from the nanoparticles did not have any polypeptides. The association of peptides and polyphenols was also evident in the dialyzed buffer extract powder ( Figure 12, Lane 4). Lanes 5, 6, and 7 correspond to the supernatant, interphase, and organic phase of the powder of the dialysis buffer extract obtained after TRIzol extraction. Polypeptides that are usually retained in the chloroform:phenol phase migrate to the aqueous phase (Lane 5), and a large number of polypeptides and polyphenols can be observed in the aqueous phase. The interphase shows the presence of polypeptides but few polyphenols (Lane 6, Panels B, A). Lane 7, corresponding to the organic phase, shows neither the presence of anthocyanins nor the presence of peptides. Lanes 8, 9, and 10 correspond to the supernatant, interphase, and organic phase of the powder of the dialysis extract of ethanol-bleached cherries obtained after TRIzol extraction, in which most of the polyphenols have been removed. Although the removal of polyphenols results in a structural transformation of the nanoparticles from spherical-structured nanofibers to filamentous-structured nanofibers, polypeptides remain a component of the nanofibers (Lane 8, Panel B). The interphase and organic phase of the dialysis extract of bleached cherries show the least staining for peptides (Lanes 9, 10; Panel B).

[0783] Carbohydrate composition of nanoparticles and nanofibers: The pectic nature of the carbohydrates in the nanoparticles and their association with polypeptides were revealed by the similarity of propidium iodide staining and Coomassie Brilliant Blue staining after SDS-PAGE. Propidium iodide has been reported as a stain for pectic acid (Rounds et al., 2011). Panel C ( Figure 12 ) shows the staining pattern of the nanoparticles with propidium iodide (10 μmol aqueous solution). The lower panel (D) shows the corresponding gel stained with Coomassie Brilliant Blue. Lane 1 corresponds to a standard sample of commercially available pectin, which shows minimal staining with propidium iodide. Staining of pectin with propidium iodide is due to the presence of negatively charged free carboxylic acid groups. If the carboxylic acid groups are blocked by naturally occurring methylation in some pectin samples, the staining will be reduced. Lane 2 shows the migration pattern of the components in the freeze-dried powder of the dialysis extract dissolved in 15% glycerol, showing the distribution of pectin in the nanoparticles (Panel A) and polypeptides (Panel B). Lane 3 corresponds to the pectin / polyphenol / peptide fraction obtained after freeze-drying the dialysis fraction, which shows relatively stronger staining for polypeptides. Lane 4 corresponds to the polygalacturonic acid standard, which shows staining with propidium iodide rather than for polypeptides. The gelatinous-like precipitate of the acid cherry homogenate also shows the presence of pectin and polypeptides (Lane 5);

[0784] Further analysis of the chemical properties of the nanoparticles was carried out by Western blot analysis ( Figure 13). Before and after bleaching (removing polyphenols) in ethanol, the tart cherry fruits were extracted in water and the nanoparticles and nanofibers were separated by dialysis of the water. The dialyzed extracts were lyophilized, the complexes were dissolved in glycerol:water, then SDS-PAGE was performed and immunolocalization was carried out using structure-specific monoclonal antibodies (rat IgM) raised against homogalacturonan (a twentymer of α-1,4-galacturonic acid with methylated units interspersed to form the main backbone structure of pectin), extensin (the main cell wall glycoprotein), and arabinogalactan-protein (the main pectin-linking protein). Bound antibodies were detected with alkaline phosphatase-labeled goat anti-rat IgG. Panel A shows Coomassie blue staining of nanofibers / nanoparticles from bleached cherries (lane 2; nanofibers) and unbleached cherries (lane 3; nanoparticles), respectively. After extraction of polyphenols with ethanol, Coomassie blue staining decreased significantly, indicating that polypeptides may have decreased together with polyphenols (lane 2). This may also be due to reduced penetration of the nanofibers from bleached cherries into the gel. Panel B shows the reactivity of antibodies raised against homogalacturonan with nanofibers / nanoparticles from bleached cherries (Panel B, lane 2) and unbleached cherries (lane 3). Interestingly, the nanofibers from bleached cherries showed stronger reactivity with homogalacturonan compared to the nanoparticles from unbleached cherries (Panel B, lane 3). This was again reflected in the intensity of the dot blots shown below Panel B. This may potentially reflect differences in the accessibility of the antibodies in the nanoparticles / nanofibers to the homogalacturonan moiety. The key difference between the nanoparticles from unbleached cherries and the nanofibers from bleached cherries is the presence of polyphenols. By removing polyphenols by bleaching, the homogalacturonan moiety can be more exposed, which can lead to increased reactivity with antibodies. Moreover, these results suggest that polyphenols are a component of the nanoparticles from unbleached cherries and that removal of polyphenols can lead to a structural transformation. Incubating the filamentous nanofibers with cherry polyphenols did not reverse the transformation from filamentous to spherical (data not shown), however, both forms were structurally stable. Both the nanoparticles and nanofibers showed a moderate reactivity against anti-extensin, an antibody raised against the main cell wall protein in fruits (Panel C). The dot blot of anti-extensin also showed minimal reactivity. However, a very strong reactivity against anti-arabinogalactan-protein (pectin-protein) was observed for both types of nanoparticles / nanofibers, indicating that this may be a major component of the basic structure of the nanoparticles / nanofibers (Panel D, lanes 2, 3; dot blot). The protein blot against xyloglucan did not show any cross-reactivity in the gel but showed a strong reactivity against the nanofibers (bottom panel, Panel A, forming filamentous aggregates).It seems that the polypeptides are stripped from the nanoparticles and nanofibers during SDS solubilization, but the carbohydrates may remain as aggregates and cannot effectively enter the gel due to their large size and lack of charge.

[0785] After digestion with trifluoroacetic acid (8.6 M) and trimethylsilylation of the released sugars using BSTFA:TMCS (Sigma, 99:1), qualitative analysis of the carbohydrate composition of the nanoparticles and nanofibers was carried out. The qualitative characteristics of the sugars separated and identified by GC-MS, as well as those of common sugars used as standards (lower panel), are shown as Figure 10 (upper panel). The sugar components of the nanoparticles (blue; labeled as nanocomplexes) and nanofibers (red; labeled as nanofilaments) have both similarities and differences. Glucose, galactose / galacturonic acid, and mannose are the main components in the nanoparticles, and the content of arabinose is relatively low. The sugars in the nanofibers are rich in arabinose, and the contents of galactose / galacturonic acid and glucose are low. There may be other unidentified sugars in the nanoparticles and nanofibers, and some peaks may also originate from sugars modified during TFA digestion. The results indicate that during nanofiber formation, several oligomers rich in glucose, galactose / galacturonic acid, and mannose can be stripped off, leaving nanofibers that are mainly arabinose-rich oligomers of arabinogalactan still derived from pectin.

[0786] Identification of peptides from pathogenesis-related proteins in nanofibers: In SDS-PAGE analysis, the appearance of peptides with various molecular weights could be detected in both the nanoparticles and nanofibers, which was caused by the action of natural protease activity during the homogenization of cherries ( Figure 14 , panel A; lanes 2, 3; gels A, B). Among them, in the nanofibers with relative molecular weights of 40 kD and 20 kD (labeled as 1, 3, Figure 14 ; panel A), at least two bands were different (lane 3; B). A polypeptide band with a slightly stronger intensity and a molecular weight of approximately 40 kD (labeled as 2, gel B) was also observed. These three polypeptides were found to bind to polyphenols (purple) in the unstained gel (gel A, lane 2). These bands were cut and subjected to peptide fingerprint analysis after trypsin digestion and LC-MS / MS. The sequences of the main peptides identified are shown as Figure 14(Panels B and C). Band 1 with a molecular weight of ~40 kD in lane 3 (nanofibers) showed sequence similarity to the PR protein endo-1,3-β-glucosidase (accession number #P50694) from cherry (Panel B). The sequence identified by LC-MS-MS (shown as the highlighted fragment and the deduced sequence from GenBank) corresponded to a 246 amino acid long peptide of the protein. The second band at ~20 kD in lane 3 (nanofibers) showed sequence similarity to another PR protein, the major cherry allergen Pru a1 (accession number #O24248), with a total of 161 amino acids in the polypeptide (Panel B). The 40 kD band in the nanoparticles corresponding to band 1 in the nanofibers did not produce hydrolysis products, probably due to the interference of bound polyphenols. These identified peptide fragments represent a small fraction of all the polypeptides separated on the gel. This may imply a high activity of proteases that produce peptides which can form the overall components of the nanoparticles and nanofibers.

[0787] FT-IR analysis of nanoparticles: The FT-IR spectra of nanoparticle / nanofiber powders from unbleached and bleached cherry fruits showed complex spectra, highly similar to each other and similar to macromolecular structures such as proteins and cell wall polysaccharides ( Figure 15; Nanocomposites = nanoparticles, nanofibers = nanofibres. The figure also shows the spectra of polygalacturonic acid (PGA) (homo-galacturonan, pectin) and albumin (BSA). The main absorption bands of the nanoparticles were observed as broad bands between 3000 - 3600 nm, 2600 - 3000 nm, and several peaks between 1750 - 800 nm in the fingerprint region. Due to the macromolecular nature of the nanoparticles, the absorption peaks characteristic of individual functional groups or structural features are merged. By comparing with the spectral characteristics of polypeptides, pectins, and polyphenols, several structural features of the nanoparticles can be elucidated. The proportions of components such as protein (>10%), carbohydrates (~70%), and polyphenols (~10 - 15%) present in the nanoparticles may also affect the peaks and peak shapes, revealing the overall predominance of peak characteristics over carbohydrates. FT-IR analysis of the cell wall carbohydrate components showed the characteristics of cellulose, hemicellulose, and pectin (Kacurakova et al., 2000; Urias-Orona, 2010). In mature fruits, the increased activities of cellulolytic and pectinolytic enzymes lead to the catabolism of cell wall components, producing low molecular weight oligomers with characteristic linkages. Among them, pectin is a complex molecule with α-1,4-linked galacturonic acid and has an intermittent hairy region (i.e., brush-like) composed of rhamnogalacturonan, galactan, arabinan, and arabinogalactan (Negi and Handa, 2008). Xyloglucan, xylan, glucomannan, and galactomannan are the hemicellulose components of the cell wall. Therefore, during the homogenization of fruits, any of these components can be incorporated into the nanoparticles. Western blot studies showed the presence of homo-galacturonan and arabinogalactan in the nanoparticles, indicating that pectin is mainly involved in their formation. The FT-IR spectra of two types of nanoparticles / nanofibres from cherries showed strong absorption in the carbohydrate region spanning 900 cm-1 and 1200 cm-1. The nanofibres from bleached cherries showed a sharp peak at ~1017 cm-1, which is characteristic of pectin with a high proportion of homo-galacturonan (Kacurakova et al., 2000). The shoulder peak between 1045 cm-1 and 1074 cm-1 may originate from β-linked arabinogalactan. Absorption from rhamnogalacturonan and hemicellulose occurs in this broad region.

[0788] Although the absorption in the carbohydrate region mainly stems from glycosidic bonds (C-O-C), the anomeric region provides information about the type of linkage between sugar moieties. α-linkages are characterized by an absorption band at 834 cm-1, and β-linkages are characterized by an absorption band at 898 cm-1. Both types of nanoparticles show a broad absorption maximum at ~834 nm, indicating that the carbohydrates in the complex mainly have α-type linkages, as commonly found in pectin, again suggesting that the carbohydrates in the nanoparticles mainly originate from pectin ( Figure 15 ).

[0789] As observed in other plant tissues, the broad band observed between ~1550 cm-1 and ~1800 cm-1 is characteristic of pectin (McCann et al., 1994). Generally, the FT-IR spectra (including the fingerprint region) of pectin isolated from tobacco cells between 900 cm-1 and 1800 cm-1 are almost the same as those observed for the nanoparticles. The two main structural elements of pectin are the ester bond (1740 cm-1) and the carboxylic acid group (1600 and 1414 cm-1). The broad peak at 1740 cm-1 is evident in both types of nanoparticles, indicating the presence of esterified pectin, with slightly lower intensity in the nanoparticles from bleached cherries ( Figure 15 ).

[0790] The absorption bands of proteins in the nanoparticles may be largely masked by the absorption bands produced by pectin (Gorinstein et al., 2009). However, certain features of the secondary structure can be observed in these spectra. The FT-IR spectra of proteins are characterized by specific amide absorptions, called amide A band, amide B band, and amides I to VII. The amide A band (~3500 cm-1) and amide B band (~3100 cm-1) produced by -NH stretching may overlap with the -OH stretching (3400 cm-1) of carbohydrate hydroxyl groups, forming a broad peak between 3600 cm-1 and 3000 cm-1 in the nanoparticle spectra. The amide I and II absorptions originate from the stretching vibrations of the -C=O and -C-N groups (1600 - 1700 cm-1) and NH stretching (1510 - 1580 cm-1) that overlap with the ester absorptions from pectin, respectively. The amide I absorption is characteristic of the backbone structure, mainly the β-sheet absorbed at ~1629 cm-1. Cell wall glycoproteins such as extensin have a large β-sheet component. However, Western analysis using an extensin antibody did not show the widespread presence of extensin in the nanoparticles ( Figure 13). However, a highly positive reactivity of antibodies produced against arabinogalactan - protein was observed in both types of nanoparticles and nanofibers. This may indicate that arabinogalactan - linked proteins, which are amphiphilic in nature (Seifert and Roberts, 2007), can provide carbohydrate - polypeptide components to the nanoparticles ( Figure 15 ).

[0791] Polyphenols are components of the nanoparticles. The relative content of polyphenols in the nanoparticles is 12 - 15%. The FT - IR spectra of the nanoparticles containing polyphenols and the nanofibers isolated from bleached cherries without polyphenols did not show major differences. Polyphenols in pure form show characteristic spectra with main absorptions in the carbohydrate region, -C=H stretching (~2850 - 3000 cm-1), and hydroxyl stretching (free 3200 - 3600 cm-1) consisting of polyphenol hydroxyls and sugar hydroxyls (David et al., 2009). Due to the low relative content of polyphenols, the absorption of polyphenol functional groups is difficult to resolve from carbohydrates and proteins ( Figure 15 ).

[0792] X - ray diffraction of the nanoparticles: As shown in this example, the widespread presence of pectin in fruits may generate nanoparticles through structural transformation. Since the nanoparticles are very sensitive to pectinase treatment and undergo complete tissue dissolution, pectin seems to be the main component of the nanoparticles. Pectin can form gels depending on the degree of methoxylation and the presence of sugars and low pH as well as divalent ions such as calcium (Fu and Rao, 2001; Strom et al., 2007). β - 1,4 - glucans such as cellulose exist as crystalline entities but can also be in an amorphous state. The sensitivity of the nanoparticles to cellulose treatment indicates that the components with β - 1,4 - glycosidic bonds are also part of the nanoparticle structure, and these can include amorphous cellulose and / or hemicellulose components (xyloglucan) that link cellulose microfibrils. Previous studies on tamarind seeds have shown that xyloglucan may be masked by pectin, and the dissolution of pectin exposes xyloglucan (Marcus et al., 2008). Therefore, the co - existence of pectin and cellulose in the nanoparticles is a possible scenario. The X - ray diffraction of crystalline cellulose shows a sharp peak centered at a diffraction angle (2θ) of 22.5º, while the X - ray diffraction of amorphous cellulose shows a characteristic broad peak at 20.7º (Park et al., 2010). The X - ray diffraction of the nanoparticle powder ( Figure 16)showed a peak centered at approximately 20º, indicating the presence of amorphous cellulose in the nanoparticles. The diffraction pattern of the dialysate powder showed a broader peak centered at 20º as it may contain various types of carbohydrate components. The X-ray diffraction patterns of the nanoparticles and the dialysate were also similar to those of the gelatin-pectin complex (Sharma et al., 2011). As the fruit ripens, the activities of cellulase and pectinase increase, leading to the dissolution of cell wall components, and several cell wall polymers that can be incorporated into the nanoparticles may be released. Therefore, the nanoparticles seem to be derived from pectin components such as polygalacturonic acid, arabinogalactan, xyloglucan, amorphous cellulose, etc., which contain free and esterified carboxyl groups. Further assembly with peptides and polyphenols during the extraction process may result in the self-assembly of these components into nanoparticles.

[0793] Proposed model for the structural organization of spherical nanoparticles: The organization of macromolecules and polyphenols that form the nanoparticles can be elucidated from several results. Electron micrographs of individual nanoparticles from the dialysis fraction of unbleached cherries are shown in Figure 17 Panel A. While most nanoparticles have diameters in the size range of approximately 25 - 50 nm and are very stable spherical structures, larger complexes with diameters exceeding 100 nm are occasionally formed. Compared to the smaller nanoparticles, the larger size may make such complexes structurally less stable. Large nanoparticles that are spherical under normal conditions occasionally collapse, revealing structural details. In the micrograph, the collapsed regions are shown as the center (arrow 1; panel A, Figure 17 ), and this observation is consistent with the results obtained after treatment with enzymes (trypsin, cellulase), where the nanoparticles are stripped of their outer structure, revealing a spherical, flexible pectin core. This core may be formed by a homogalacturonan moiety and unexposed nanoparticles as the nanoparticles did not show cross-reactivity with antibodies raised against homogalacturonan. The collapsed structure suggests that the interior of the core can be hollow. The core is surrounded by filaments assembled in a helical organization ( Figure 17 , panel A, arrow 2), and it is inferred from their sensitivity to pectinase and trypsin that the filaments are composed of homogalacturonan and protein. Polyphenols may play an important role in stabilizing the helical organization of the filaments as the removal of polyphenols with ethanol results in a completely different organization, unwinding the helical structure into filaments. When the polyphenols are removed, these filaments show strong reactivity with homogalacturonan antibodies, indicating that polyphenols can mask the helical structure. Outside the helical filaments covering the pectin core, there seems to be another distinct fibril layer, which seems to be different from the inner fibril layer ( Figure 17, Plate A, arrow 3). It is very likely that the composition of this layer is different from that of the inner layer (arrow 2), as it may consist mainly of arabinogalactan conjugated with polypeptides, since nanoparticles from unbleached cherries show strong reactivity to arabinogalactan - protein antibodies, indicating their external location and enhanced accessibility to antibodies. Arabinogalactan - protein is also part of the filamentous structures isolated from bleached cherries. Thus, nanoparticles isolated from unbleached cherries and nanofibers isolated from bleached cherries may have similar components, but are organized into physically different structures. An enlarged view of the nanoparticles ( Figure 17 , Plate B) shows a helical structure (arrow) on the inner layer of the nanoparticles.

[0794] Due to the potential cytotoxic effects of using engineered nanomaterials such as iron oxide nanoparticles, dendrimers, gold and silver nanoparticles, carbon nanotubes, etc., which have not been fully evaluated, the development of natural - product - based nanomaterials has been continuously explored (Maynard, 2006). The problem with engineered nanomaterials is that the human body may not have a mechanism to eliminate these substances from the system. In cell - culture studies, it has been observed that the toxicity from fullerene - type nanomaterials decreases with increasing hydroxylation of the structure (Lewinski et al., 2008). The main applications of engineered nanomaterials are in diagnosis and biomedicine (Kunzmann et al., 2011). Silica nanoparticles of 70 nm can penetrate the placental barrier and enter the fetus, while those of 300 nm and 900 nm sizes do not accumulate in fetal tissues (Yamashita et al., 2011). Similarly, drug - loaded polymeric micelles with a diameter of 30 nm are more effective in penetrating low - permeability tumors than 50 nm, 70 nm, or 100 nm micelles (Cabral et al., 2011). Understanding the absorption, distribution, and elimination mechanisms of engineered nanomaterials also helps in understanding these mechanisms for nanomaterials of biological origin.

[0795] Biological nanomaterials of different shapes and sizes have been proposed to provide the benefits of drug delivery and retention. Nano-liposomes, nano-gels, micelles, filaments, etc. are potential morphological variants of biological nanostructures and have potential applications in biomedicine (Nishiyama, 2007). Among them, filamentous polymeric micelles called fibrils with diameters of 22 - 60 nm and lengths of 2 - 8 μm have been observed to stay in the blood longer than spherical nano-micelles (Discher and Eisenberg, 2002). Proteins such as fibrinogen surround gold nanoparticles coated with polyacrylic acid, which seems to be a structural change and is part of its inflammation induction (Deng et al., 2011). By improving bioavailability and increasing circulation time, solid lipid nanoparticles loaded with daidzein are more effective in cardiovascular protection in animal models than daidzein alone (Gao et al., 2008).

[0796] Nanoparticles may be absorbed by endocytic mechanisms and may therefore undergo several types of modifications during binding to the cell surface, internalization, trafficking, and release in cells. During endocytosis, nanoparticles can bind to the cell surface and subsequently be internalized by vesiculation of the cytoplasmic membrane of endosomes, phagosomes, and macropinosomes. Different types of mechanisms may be involved in these processes. Vesicular structures originating from the cytoplasmic membrane can become multivesicular bodies and fuse with lysosomes. The pH of lysosomes is acidic, providing ideal conditions for the degradation of nanoparticles by releasing the contents through proteases and hydrolases. The uptake of nanoparticles by cells depends on the surface properties of the cells (Iverson et al., 2011). Nanoparticles with diameters of 20 - 50 nm seem to be taken up more than larger or smaller nanoparticles. Uptake can also depend on the surface charge of the recipient cells. Generally, positively charged nanoparticles are taken up more effectively. Nanostructures from tart cherries may exhibit both of these properties: when in the form of spherical nanoparticles, they are positively charged due to the potential exposure of surrounding peptide amino groups and the carboxylic acids of hidden polygalacturonic acid; while when nanofibers with a larger amount of polygalacturonic acid (acidic groups) are exposed to the near-neutral aqueous medium in which they are suspended, they are negatively charged. Nanoparticles with hidden polygalacturonic acid moieties react poorly with anti-homogalacturonan antibodies. In contrast, nanofibers with highly exposed polygalacturonic acid moieties react very strongly with anti-homogalacturonan antibodies, as Figure 13 shown.

[0797] Pectin, as a biopolymer widely present in plants, especially in fruits and vegetables, has been well studied for its physicochemical properties, and its potential uses in drug encapsulation, targeted delivery, and the development of hydrogels for use as skin protectants (either alone or in combination with proteins or synthetic molecules such as polyvinylpyrrolidone, polylactic acid, etc.) are being increasingly explored (Mishra et al., 2012). One advantage of pectin-based materials is that it has been consumed by humans throughout the course of evolution, and its biological property of transporting encapsulated materials to the colon as a food matrix has been demonstrated, where the polysaccharide is digested by probiotics in the colon, releasing the inclusions. Pectin can also bind to and help remove cholesterol from the gastrointestinal system. Pectin-based delivery systems have been explored for drug delivery through multiple routes (Yadav, 2009; Sriamornsak, 2011). The three-dimensional structure of the pectin matrix may be influenced by free carboxylic acid groups (homo-galacturonan and rhamnogalacturonan), as pectin chains can exist as anionic chains depending on the pH of the embedding solution, and the anionic chains can be stabilized by divalent ions in various forms such as calcium. Additionally, the ratio of methylated carboxyl groups to free carboxyl groups also affects the ability of pectin to form a 3D structure. Therefore, pectin formulations such as membranes, hydrogels, nanostructures, etc. have been developed for various medical applications. However, pectin-based matrices alone may have some drawbacks, such as low mechanical strength, low shear stability, low drug loading efficacy, and premature drug release. Therefore, chemical and physical alterations of pectin by blending or copolymerizing with biodegradable polymers such as chitosan, polylactic acid, starch, gelatin, soy protein, β-lactoglobulin, human serum albumin, etc. can provide higher charge densities (positive primary amines and negative carboxyl groups). The production of ZnO-pectin nanoparticles in the range of 70 - 200 nm in diameter has been achieved to explore the possibility of enhancing zinc absorption in zinc-deficient populations (Shi and Gunasekaran, 2008). It has been observed that such molecules penetrate deeper into tissues and are able to provide better drug delivery. Thiolated pectin nanoparticles have been prepared for better ocular drug delivery. SPION (superparamagnetic iron-based nanoparticles) and oxaliplatin were encapsulated in Pectin-Ca2+ to form pectin-based spherical nanostructures with magnetic functionality and a diameter of 100 - 200 nm. The anticancer drug paclitaxel was bound to pectin nanostructures, and the process was influenced by the hydrophilicity of pectin (-OH and -COOH groups) and the positively charged amide groups of asparagine (Verma et al., 2011). Delivery of several classes of drugs, such as poorly soluble thiazole drugs, anticancer drugs, neuro- and mood-active drugs, and insulin, has also been attempted through pectin-based nanostructures (Sharma et al., 2012).

[0798] In contrast to synthetic methods for producing pectin-based nanoparticles, this example demonstrates the potential of using an in vivo fruit-based system to produce nanoparticles and nanofibers with unique properties. The fruit serves as an independent factory for forming nanoparticles and nanofibers. As the fruit matures, catabolic processes are activated, leading to fruit softening and the production of cell wall components with lower molecular weights, including cellulose, pectin, polypeptides derived from cell wall glycoproteins with positive, negative, and amphiphilic characteristics, as well as calcium ions and low pH released during homogenization. Once the tissue is homogenized and the various components are released, self-assembly of the various components will be observed. It should be noted that in the absence of external influence, the nanoparticles formed in this example are substantially uniform in size, shape, and physicochemical properties. Fruits with different characteristics, such as sour cherries, blueberries, and grapes, all show the potential for this self-assembly of basic cell components to form essentially the same type of nanoparticles.

[0799] An interesting feature that has become apparent from this example is the role of anthocyanins and possibly malic acid in determining the self-assembly of components to form nanoparticles. In the presence of anthocyanins, the nanoparticles are spherical, with a central pectin core woven together with galacturonan-xyloglucan-arabinogalactan-polypeptide filaments. These filaments are helical in nature and contain fibrillar structures in the presence of anthocyanins. Anthocyanins are amphiphilic molecules and can serve as a bridging structure between various components. However, once the anthocyanins are removed, the nanoparticles form thin film-type (planar structures of pectin, Figure 7 ), and fibrous structures (bundle type), called nanofibers. Regardless of their shape, the spherical nanoparticles and nanofibers are highly stable and capable of binding to a variety of drugs (paclitaxel, vincristine) and / or minerals with high efficiency and absorption capacity. In terms of function, the spherical nanoparticles can also be used as carriers for anthocyanins to target the delivery of anthocyanins to the colon. For example, compared to free anthocyanins, anthocyanins can be more protected within the spherical composite structure, thus protecting them from pH changes during the transition between the stomach and the intestine.

[0800] In this example, nanoparticles and nanofibers were prepared from fruits, and their physicochemical properties and functions were studied and described. In the presence or absence of polyphenols, these nanoparticles and nanofibers are unique in that they have a large surface area resulting from the formation of a tertiary structure by pectin, cellulose, and protein. These bio-derived nanoparticles and nanofibers can provide alternatives to engineered nanomaterials in several applications. Since the building components have been consumed through food (juices, smoothies), and no adverse effects have been observed, this may indicate that the structural components may undergo bioelimination, just like any food macromolecule. The nanoparticles and nanofibers are internalized by mammalian cells, indicating that they can be used as delivery systems for, for example, small molecules, nutrients, drugs, minerals, or other such reagents / cargo. Although the nanoparticles and nanofibers are derived from similar materials, as described in detail herein, the nanoparticles and nanofibers have significant differences.

[0801] Example 2 - Functions and Applications of Nanoparticles

[0802] Effect of Nanoparticle Treatment on the Body Weights of Wild-Type and ETKO Mice

[0803] Materials and Methods:

[0804] In Vivo Analysis - Animals and Genotyping - The generation and genotyping of Pcyt2+ / − mice (also referred to as ETKO mice in this article) were as previously described (Fullerton MD et al., 2007). Pcyt2 is a gene responsible for regulating the production of the phospholipid - phosphatidylethanolamine (PE), which is an important component of cell membranes and organelles. Complete knockout of the Pcyt2 gene (null animals) results in early embryonic lethality (death of pups before birth), while heterozygous animals (having only one copy of the gene) are normal at birth and after birth. However, heterozygous mice experience long-term weight gain due to altered phospholipid metabolism. The components that make up the phospholipids are redirected, and the cellular machinery changes from making PE to triglycerides (fat). This means that the mice gain weight, have more fat in the liver and plasma, and ultimately have reduced sensitivity to insulin (insulin resistance).

[0805] Pcyt2+ / − mice were crossed according to methods approved by the University Animal Care Committee and a heterozygous colony was maintained at the University of Guelph. Mice were housed on a 12 h light / 12 h dark cycle, had free access to water, and were fed a standardized diet (catalog number S-2335; Harlan Teklad). Mice were divided into four experimental groups (n = 3 - 6 / group): (i) wild-type (C57BL / 6) untreated (WT-U); (ii) wild-type (C57BL / 6) treated (WT-T); (iii) Pcyt2 knockout - untreated (KO-U) and (iv) Pcyt2 knockout - treated (KO-T). Samples (serum and tissue (liver)) for biochemical analysis were snap-frozen in liquid nitrogen and stored at -80 °C for later use.

[0806] Blood analysis. Terminal blood was collected from the heart after clinical death. Serum was immediately separated and sent to the Animal Health Laboratory (University of Guelph; accredited analytical equipment) for biochemical analysis, such as analysis of albumin, globulin, A:G, total protein, ALT, AST, cholesterol, CK, glucose, phosphorus, triglycerides, and urea.

[0807] Chemicals and reagents. The L-type triglyceride M kit was purchased from Wako Diagnostics (Osaka, Japan and Neuss, Germany). Antibodies against p65 NF-kB and B-tubulin were from Santa Cruz Biotechnology and Cell Signaling Technology, respectively. The RNeasy Plus kit for RNA isolation was purchased from Qiagen (Valencia, CA, USA). The high-capacity cDNA reverse transcription kit for cDNA preparation was from Applied Biosystems (Foster City, CA, USA). The primers used are shown below.

[0808] Table 4: Primer sequences for PCT used to evaluate the expression levels of specific genes after treatment with nanoparticles. F = forward, R = reverse.

[0809] Primer sequenceSEQ ID NO:TM (°C)Amplicon size (bp)

[0810] STAT4F - 5' AGGTTAAGCTGGCTGTCCTG 3'

[0811] R - 5'AGATCTCTTGTCTTCTGGTTTGTTG3'1 262 150

[0814] TNF-α F - 5' CCGATGGGTTGTACCTTGTC 3'

[0815] R - 5' GGGCTGGGTAGAGAATGGAT 3'3 460 300

[0818] IL-6 F - 5' CAAGGGTGTTACACTGG 3'

[0819] R - 5' CTGGTCTCATCCGAACCCTG 3'5 662 200

[0822] FAS F - 5’ CTTCGAGATGTGCTCCCAGCTGC 3’

[0823] R - 5’ CTTAGTGATAAGGTCCACGGAGGC 3’11 1259 268

[0826] ATGL F - 5’ CAACGCCACTCACATCTACGG 3’

[0827] R - 5’ GGACACCTCAATAATGTTGGCAC 3’13 1457 106

[0830] HSL F - 5’ ACGCTACACAAAGGCTGCTT 3’

[0831] R - 5’ TCGTTGCGTTTGTAGTGCTC 3’15 1659 125

[0834] LPL F - 5’ GCTCGCACGAGCGCTCCATT 3’

[0835] R - 5’ CCTCGGGCAGGGTGAAGGGAA 3’17 1859 350

[0838] PGC1-α F - 5' TTGACTGGCGTCATTCGGG 3'

[0839] R - 5' GAAGGACTGGCCTCGTTGTC 3'19 5 396

[0842] PPAR-α Forward - 5’ CGCATGTGAAGGCTGTAAGGGC 3’

[0843] Reverse - 5’ GTCATCCAGTTCTAAGGCATTG 3’ 21 2257 289

[0846] PPAR-γ Forward - 5’ CAGAAGTGCCTTGCTGTGGGG 3’

[0847] Reverse - 5’ CTTGGCTTTGGTCAGCGGG 3’ 23 2457 157

[0850] CTL1 Forward - 5’ GAACGCTCTGCGAGTGGCTGC 3’

[0851] Reverse - 5’ TTCTTATGTTCTTGACTGCC 3’ 25 2649 376

[0854] PCYT1 Forward - 5’ ATGCACAGAGAGTTCAGCTAAAG 3’

[0855] Reverse - 5’ GGGCTTACTAAAGTCAACTTCAA 3’ 27 2850 170

[0858] PSS2 Forward - 5’ GAGTGGCTGTCCCTGAAGAC 3’

[0859] Reverse - 5’ TCGTAGATCTCACGCATGGC 3’ 31 3259 305

[0862] Nanoparticle treatment. Experiments were performed using Pcyt2 knockout mice and littermate controls at 24 - 30 weeks of age. The KO untreated group and control mice (wild type; n = 3 - 6 per group) were provided with 100 μL of water (by gavage) three times a week. The KO treated group and control mice (n = 3 - 6 per group; average body weight ~ 40 g) were administered a nanoparticle solution equivalent to 100 mg / kg / 4 weeks of polyphenols in 100 μL of water three times a week (133 μg polyphenol equivalent per dose). Oral gavage for all groups continued for 4 weeks. The experiment was repeated twice, and at the end of the experiment, the mice were sacrificed and used for blood and tissue analysis.

[0863] Immunoblotting. NF-kB was determined by immunoblotting, protein blotting, and chemiluminescent detection bands using 10% SDS-PAGE. The membranes were blocked with 5% milk in 1X PBST and incubated overnight at 4 °C with anti-NF-kB (Santa Cruz Biotechnology, Santa Cruz, CA, USA) antibody. The membranes were then incubated with anti-rabbit IgG and visualized by chemiluminescence (Sigma-Aldrich). The membranes were re-hybridized with β-tubulin to check loading accuracy. The density of specific bands was quantified using an imaging densitometer (ImageJ).

[0864] Liver triglyceride determination. The TG content of the liver was measured using the L-type TG M reagent according to the kit (Wako) method.

[0865] Total RNA isolation and gene expression. Total RNA was isolated using the RNeasy Plus kit (Qiagen, Valencia, CA, USA), and cDNA was prepared using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). At the exponential phase of PCR amplification, the optimal amount of cDNA and number of reaction cycles were used to analyze the genes of interest. Each gene level was expressed relative to the internal GAPDH control. The genes tested included pro-inflammatory genes (STAT4, TNF-α, and IL-6) and lipolytic genes (FAS, ATGL, HSL, LPL, PGC1-α, PPAR-α, PPAR-γ, CTL1, PCYT1, and PSS2). Experiments were performed using liver samples collected from Pcyt2+ / - and Pcyt2+ / + male and female mice. The reaction products were electrophoresed and stained with ethidium bromide to observe the bands. ImageJ 1.46 software was used to quantify the band density, and the gene levels were expressed as fold change relative to the control. The primers used are listed in the table above.

[0866] NF-κB was determined by SDS-PAGE immunoblotting, Western blotting, and chemiluminescent detection of bands. Membranes were blocked with 5% milk in 1X PBST and incubated overnight at 4 °C with anti-NF-κB (Santa Cruz Biotechnology, Santa Cruz, CA, USA) antibody. The membrane was then incubated with anti-rabbit IgG and visualized by chemiluminescence (Sigma-Aldrich). Membranes were reprobed with β-tubulin to check loading accuracy. The density of specific bands was quantified using an imaging densitometer (ImageJ).

[0867] Statistical analysis. Statistical analysis was completed using Prism GraphPad. Data are expressed as mean ± S.E. Statistical significance was calculated using Student's t-test (P value < 0.05 was considered significant) or one-way ANOVA. When significant effects were found, post hoc comparisons were performed using Tukey's honest significant difference test. A P < 0.05 was considered significant.

[0868] Results and discussion: Experiments were conducted to study the effect of nanoparticle treatment on the body weight of wild-type and ETKO mice. Figure 18 The effect of feeding nanoparticle (NP) solution to mice on body weight changes in wild-type and ETKO mice is shown. Mice (6 - 7 months old) were divided into 4 groups of 5 - 6 mice each (wild-type untreated (WT U), wild-type treated (WT T), knockout untreated (KO U), and knockout treated (KO T)). Nanoparticle-treated mice received a dose of 133 μg equivalent of NP solution / 40 g body weight / day (100 mg extract / kg body weight) by gavage, 5 times a week. Untreated mice received water. The experiment lasted for 4 weeks. In the test group, NP treatment had no effect on the body weight of mice in the first week. However, after weeks 2, 3, and 4, continued NP treatment prevented weight gain in ETKO mice. Although there was no significant change in weight loss between untreated WT and WT treated under these specific doses / conditions, the decrease in weight gain between untreated KO and treated KO was statistically significant (P < 0.05). These results support the use of nanoparticles in the treatment and / or management of obesity and / or weight loss.

[0869] Effect of nanoparticle treatment on liver triglyceride levels, liver histopathology, serum biochemical parameters, and gene expression

[0870] Materials and methods:

[0871] Histological analysisTo examine liver histology, tissues were fixed in 10% neutral buffered formalin + phosphate buffered saline and embedded in paraffin. 10-μm liver sections were stained with hematoxylin and eosin (H&E) and observed by light microscopy. Tissue lipids were analyzed using an imaging densitometer (ImageJ) as previously described (Fullerton et al., 2007).

[0872] Liver triglyceride determination. The TG content of the liver was measured using the L-type TG M reagent according to the kit (Wako) method.

[0873] Blood analysis. Terminal blood was collected from the heart after the clinical death of the mice. Serum was immediately separated and sent for biochemical analysis, such as analysis of albumin, globulin, A:G, total protein, ALT, AST, cholesterol, CK, glucose, phosphorus, triglyceride, and urea.

[0874] Results and discussion:

[0875] Studies were conducted to investigate the effect of nanoparticle treatment on triglyceride levels in the livers of wild-type and ETKO mice. Under normal physiological conditions, liver triglyceride levels are relatively low because the liver is not involved in fat storage. The triglycerides in non-alcoholic fatty liver depend on the rate of fatty acid uptake from plasma into cells and hepatocyte capacity (Bradbury MW. 2006, Kawano Y 2013). Due to the accumulation of triglycerides in the liver tissue of obese mice, the levels of triglycerides were studied in WT and ETKO mice with or without nanoparticle (NP) treatment. Figure 19 The effect of nanoparticle (NP) treatment on changes in triglyceride levels in the mouse liver is shown. The triglyceride levels in liver tissues...

Claims

1. A nanofiber comprising self-assembling cellular components derived from homogenized plant tissue having a low polyphenol content, said homogenized plant tissue being derived from cherries, said cellular components comprising one or more structural carbohydrates or carbohydrate cleavage products, wherein, lipids and polyphenols are not structural components of the nanofiber, wherein the nanofiber is non-crystalline, lipid-free, and polyphenol-free, wherein the nanofiber comprises elongated fibers, the elongated fibers comprising one or more strands, the one or more strands containing at least one structural carbohydrate or made of at least one structural carbohydrate, and wherein, polyphenols are removed from the plant tissue prior to homogenization.

2. The nanofiber according to claim 1, wherein, the nanofiber comprises pectin, hemicellulose, peptides and / or proteins, organic acids, their cleavage products, or any combination thereof.

3. The nanofiber according to claim 2, wherein, the organic acids include malic acid, ascorbic acid, or both.

4. The nanofiber according to any one of claims 1 to 3, wherein, the cellular components include those cellular components released from the plant tissue during the ripening of the ripe fruit or during homogenization, which are capable of self-assembling into the nanofiber.

5. The nanofiber according to claim 1, wherein, the one or more structural carbohydrates include one or more of pectin, pectin derivatives, polygalacturonic acid, rhamnogalacturonan, xyloglucan, hemicellulose, and / or arabinogalactan, and / or their cleavage products.

6. The nanofiber according to claim 5, wherein, the xyloglucan includes xyloglucan having a β-(1→4) linked glucose, mannose, or xylose backbone.

7. The nanofiber according to any one of claims 1 to 3, the nanofiber having a fibrous shape with a diameter of 5 - 10 nm.

8. The nanofiber according to any one of claims 1 to 3, wherein, the nanofiber can be stabilized by hydrogen bond interactions and is formed between macromolecules in which the cellular components derived from the plant tissue are catabolized and have hydroxyl and / or amino and / or organic acid groups.

9. The nanofiber according to any one of claims 1 to 3, the nanofiber may further comprise a bioactive agent.

10. The nanofiber according to claim 9, wherein, the bioactive agent is a pharmaceutically active drug, protein, enzyme, nutritional preparation, or nutrient.

11. The nanofiber according to any one of claims 1 to 3, the nanofiber being in an aqueous solution.

12. The nanofiber according to any one of claims 1 to 3, the nanofiber being in powder form.

13. The nanofiber according to any one of claims 1 to 3, the nanofiber being in dehydrated form.

14. The nanofiber according to any one of claims 1 to 3, the nanofiber being in freeze-dried or spray-dried form.

15. The nanofibers according to any one of claims 1 to 3, wherein the nanofibers are in the form of nano spray-dried.

16. The nanofibers according to any one of claims 1 to 3, wherein, the cherry is a sour cherry.

17. A method for preparing nanofibers from homogenized plant tissue, the method comprising: preparing homogenized plant tissue in a solution having a low polyphenol content, the homogenized plant tissue being derived from cherries, the solution comprising cellular components released from the plant tissue; removing debris from the homogenized plant tissue if present, thereby providing a solution containing the nanofibers, the nanofibers being formed by self-assembly of the cellular components; wherein lipids and polyphenols are not structural components of the nanofibers, wherein the nanofibers are amorphous, lipid-free, and polyphenol-free, wherein the nanofibers comprise elongated fibers, the elongated fibers comprising one or more strands, the one or more strands containing at least one structural carbohydrate or made of at least one structural carbohydrate, and wherein polyphenols are removed from the plant tissue prior to homogenization.

18. The method according to claim 17, further comprising dialyzing the homogenized plant tissue to remove uncomplexed compounds, or removing the uncomplexed compounds by size exclusion.

19. The method according to claim 17, further comprising the step of dehydrating the solution containing the nanofibers.

20. The method according to claim 17, further comprising the step of freeze-drying or spray-drying the solution containing the nanofibers.

21. The method according to claim 17, further comprising the step of nano spray-drying the solution containing the nanofibers.

22. The method according to any one of claims 17 to 21, wherein, the nanofibers are formed by self-assembly in an aqueous medium.

23. The method according to any one of claims 17 to 21, wherein, the step of preparing the homogenized plant tissue in solution comprises homogenizing the plant tissue in an aqueous, organic or mixed aqueous-organic medium.

24. The method according to any one of claims 17 to 21, wherein, the step of preparing the homogenized plant tissue in solution comprises high-shear homogenization and / or sonication of the plant tissue in an aqueous, organic, or mixed aqueous-organic medium comprising any one or more of water, ethanol, methanol, or acetone.

25. The method according to any one of claims 17 to 21, wherein, the step of preparing the homogenized plant tissue in solution comprises bleaching the plant tissue to remove polyphenols therefrom.

26. The method according to claim 25, wherein, the bleaching comprises extracting polyphenols from the plant tissue with an extraction solvent.

27. The method according to claim 26, wherein, the extraction solvent comprises ethanol.

28. The method according to claim 22, wherein, The step of removing debris includes dialysis, filtering the homogenized plant tissue, centrifuging the homogenized plant tissue, or performing tangential flow filtration or continuous flow filtration on the homogenized plant tissue, or any combination thereof.

29. The method according to any one of claims 17 to 21, wherein, the cherry is a sour cherry.

30. The method according to any one of claims 17 to 21, wherein, the method is used for preparing nanofibers as defined in any one of claims 1 to 16.

31. A method for preparing nanofibers from homogenized plant tissue, the method comprises: preparing homogenized plant tissue in a solution having a low polyphenol content, the homogenized plant tissue being derived from a cherry, the solution comprising cell components released from the plant tissue; removing debris from the homogenized plant tissue if present; allowing the nanofibers to form by self-assembly of the cell components; and lyophilizing or spray drying to form a powder comprising the nanofibers, wherein lipids and polyphenols are not structural components of the nanofibers, wherein the nanofibers are amorphous, lipid-free, and polyphenol-free, wherein the nanofibers comprise elongated fibers, the elongated fibers comprising one or more strands, the one or more strands containing or being made of at least one structural carbohydrate, and wherein polyphenols are removed from the plant tissue prior to homogenization.

32. The method according to claim 31, wherein, the self-assembly occurs in an aqueous medium.

33. The method according to claim 31 or 32, wherein, the spray drying is nano spray drying.

34. The method according to claim 31 or 32, wherein, the step of preparing the homogenized plant tissue in a solution comprises homogenizing the plant tissue in an aqueous, organic, or mixed aqueous-organic medium.

35. The method according to claim 31 or 32, wherein, the step of preparing the homogenized plant tissue in a solution comprises subjecting the plant tissue to high-shear homogenization and / or sonication in an aqueous, organic, or mixed aqueous-organic medium comprising any one or more of water, ethanol, methanol, or acetone.

36. The method according to claim 31 or 32, wherein, the step of preparing the homogenized plant tissue in a solution comprises bleaching the plant tissue to remove polyphenols therefrom.

37. The method according to claim 36, wherein, the bleaching comprises extracting polyphenols from the plant tissue with an extraction solvent.

38. The method according to claim 37, wherein, the extraction solvent comprises ethanol.

39. The method according to claim 31 or 32, wherein, the step of removing debris includes dialysis, filtering the homogenized plant tissue, centrifuging the homogenized plant tissue, or performing tangential flow filtration or continuous flow filtration on the homogenized plant tissue, or any combination thereof.

40. The method according to claim 31 or 32, wherein, The plant tissue includes plant tissue that is extracted with an extraction solvent to remove polyphenols therefrom.

41. The method according to claim 40, wherein, the extraction solvent includes ethanol.

42. The method according to claim 31 or 32, wherein, the cherry is a sour cherry.

43. The method according to claim 31 or 32, wherein, the method is used for preparing nanofibers as defined in any one of claims 1 to 16.

44. A nanofiber prepared by the method as defined in any one of claims 17 to 43.

45. A food powder prepared by the nanofiber as defined in any one of claims 1 to 16 or 44.

46. The food powder according to claim 45, wherein, the food powder is provided in the form of a micron-sized fine powder.

47. A targeted nanofiber comprising the nanofiber as defined in any one of claims 1 to 16 or 44, the targeted nanofiber being conjugated with a targeting antibody specific for a cancer marker.

48. The targeted nanofiber according to claim 47, wherein, the targeting antibody includes a PD-L1 antibody or an antigen-binding fragment thereof for targeting the targeted nanofiber to cancer cells.

49. The targeted nanofiber according to claim 47 or 48, wherein, the targeted nanofiber is complexed or conjugated with at least one cytotoxic drug or anticancer drug.

50. The targeted nanofiber according to claim 49, wherein, the targeted nanofiber is complexed or conjugated with paclitaxel, doxorubicin, or both.

51. An antibacterial nanofiber comprising the nanofiber as defined in any one of claims 1 to 16 or 44, the nanofiber being complexed or conjugated with an antibacterial agent.

52. The antibacterial nanofiber according to claim 51, wherein, the antibacterial agent includes lysozyme, tetracycline, or nisin, or any combination thereof.

53. The antibacterial nanofiber according to claim 51 or 52, the antibacterial nanofiber being used for treating or preventing MDR bacterial infections.

Images