Purification of mRNA by tangential flow filtration

Abstract

The present disclosure provides methods of purifying mRNA molecules, the methods comprising: (la) purifying precipitated mRNA molecules from a suspension comprising the precipitated mRNA molecules; (lb) washing and solubilizing the purified precipitated mRNA molecules; (lla) purifying the mRNA molecules using a solution comprising a chelating agent; followed by (lib) washing the purified mRNA molecules, wherein steps (la) through (lib) are performed using tangential flow filtration.

Description

[0001] This invention relates to a method for purifying mRNA molecules, the method comprising: (Ia) purifying precipitated mRNA molecules from a suspension containing precipitated mRNA molecules; (Ib) washing and dissolving the purified precipitated mRNA molecules; (IIa) purifying the mRNA molecules using a solution containing a chelating agent; and subsequently (IIb) washing the purified mRNA molecules, wherein steps (Ia) to (IIb) are performed using tangential flow filtration.

[0002] Genetic information is stored in cells as deoxyribonucleic acid (DNA) and can be transcribed into ribonucleic acid (RNA) when needed. Both DNA and RNA molecules are composed of nucleotides, which consist of a nitrogenous base, a pentose sugar, and at least one phosphate group. Different types of RNA molecules exist, including mRNA molecules that carry genetic information for protein synthesis. In eukaryotic cells, these mRNA molecules are transcribed from DNA as early-maturing mRNA molecules and subsequently modified by adding, for example, a 5' cap and a 3' poly(A) tail. The mature mRNA molecules are then transferred from the nucleus to the cytoplasm, where they are translated into proteins. Therefore, the DNA sequence, as well as the amount, stability, and translation efficiency of mature mRNA molecules, primarily determine protein synthesis in the cell.

[0003] To optimize the synthesis of desired proteins in cells, such as in a therapeutic context, mRNA-based methods represent promising tools. The advantage of using mRNA molecules is that the molecules must be introduced only into the cytoplasm of the cell for protein translation (Tavernier et al., 2011, J Control Release, 150(3):238-247; Yamamoto et al., 2009, Eur J Pharm Biopharm, 71(3):484-489). Furthermore, using mRNA molecules is less difficult, more efficient, and avoids the considerable risk of altering chromosomal DNA when the plasmid or a portion thereof is incorporated into the genome compared to the use of the corresponding DNA sequence contained in a suitable vector (such as a plasmid). mRNA molecules are primarily produced through in vitro transcription, for example, in therapeutic applications. Such methods are based on DNA templates, which are generated either by linearization of the plasmid DNA itself or by polymerase chain reaction (PCR) of the plasmid DNA. Both methods are well-established and can be easily scaled up. However, in both cases, the mRNA molecules must be purified before they can be used in downstream applications.

[0004] Purification of synthesized mRNA molecules is crucial because contaminants can negatively impact most downstream applications, especially in a therapeutic context. Various byproducts can contaminate the desired mRNA molecule, such as components used and / or generated in upstream processes like mRNA synthesis. In both in vivo and in vitro methods, short mRNA fragments can occur, for example, through hydrolysis and abortive transcription. Hydrolysis of mRNA molecules can occur in the presence of catalysts or enzymes, but can also occur spontaneously, leading to the degradation of the corresponding mRNA molecule and the formation of mRNA fragments of variable length. In the case of abortive transcription (see, for example, Revyakin et al., 2006, Science, 314(5802):1139-1143), RNA polymerase binds to the corresponding promoter element in the DNA molecule to initiate transcription, unwinding the DNA double helix around the transcription start site and initiating the synthesis of the mRNA molecule. However, in some cases, RNA polymerase does not detach from the promoter region of the DNA but remains quiescent while transcribing a portion of the DNA molecule. When unwound DNA accumulates within the enzyme, RNA polymerase expels the portion of the DNA that stores transcribed genetic information and releases synthesized RNA molecules ranging from 1 to 15 nucleotides in length (see, for example, Goldman et al., 2009, Science, 324(5929):927-928). To avoid undesirable immune responses, for example, when administering pharmaceutical compositions containing such short mRNA fragments, it is highly desirable to obtain purified, unfragmented mRNA molecules for further downstream applications, particularly in a therapeutic context.

[0005] Different methods exist for purifying mRNA molecules, including precipitation and filtration, as well as combinations thereof. RNA precipitation-based methods represent, for example, a simple and cost-effective way to obtain purified RNA molecules as a precipitate that can be resuspended in a chosen buffer for the removal of unwanted salts, nucleotides, and proteins. Precipitation can be performed using various solutions containing, for example, guanidine thiocyanate (GSCN), ammonium acetate (NH4OAc), ethanol, lithium chloride, and sodium acetate (e.g., reviewed by Walker and Lorsch, 2013, Methods Enzymol, 530:337-343). Filtration methods, on the other hand, are based on a mechanical concept for purifying target molecules such as mRNA molecules. In the case of filtration, the feed, i.e., a solution or suspension containing the target molecule (e.g., mRNA molecules), is passed through or across a filter membrane, the latter being called tangential flow filtration (TFF).

[0006] WO 2014 / 152966 A1 and WO 2015 / 164773 A1 disclose methods for purifying mRNA molecules, for example, using TFF with different solution and / or suspension volumes. The mRNA molecules are purified by precipitating them using, for example, urea, GSCN, and / or potassium chloride, and the precipitate is washed multiple times. However, in both cases, considering short mRNA fragments (such as ineffective mRNA molecules and / or hydrolysis products), it is not shown that the methods can purify target mRNA molecules.

[0007] WO 2016 / 193206 A1 discloses a method for generating and purifying RNA, wherein RNA purification includes at least one TFF step and preferably excludes phenol / chloroform extraction and / or DNA and / or RNA precipitation steps. Furthermore, RNA molecules are preferably purified by applying additional purification steps, such as cation and / or anion exchange chromatography and / or reversed-phase chromatography. As mentioned above, the purification of target RNA molecules is not disclosed in this document, taking into account ineffective mRNA molecules and / or mRNA molecule hydrolysis products.

[0008] WO 2018 / 157133 A1 discloses a method for large-scale purification of mRNA molecules. This invention particularly relates to the preparation of clean and homogeneous mRNA molecule compositions using a stirred tank or agitated Nutsche filtration apparatus. As an example, mRNA molecules are precipitated using GSCN, and the precipitate is washed with a solution containing GSCN and ethanol. Interestingly, the mRNA molecule compositions obtained by the claimed method are compared with compositions containing mRNA molecules purified using TFF, and it is shown that purification based solely on TFF produces a solution containing residual enzymes other than the target mRNA molecules.

[0009] Therefore, especially considering ineffective mRNA molecules and mRNA molecule hydrolysis products, ensuring that salts (such as GSCN) that may cause problems for downstream applications are at low levels and using systems that can be easily automated, there is still a need for alternative solutions that can effectively purify mRNA molecules on a large scale.

[0010] This application addresses the need to obtain purified mRNA molecules with high throughput by providing embodiments as described in the claims.

[0011] Specifically, the present invention relates to a method for purifying mRNA molecules, the method comprising: (Ia) purifying precipitated mRNA molecules from a suspension containing precipitated mRNA molecules using a first solution; (Ib) washing and dissolving the purified precipitated mRNA molecules obtained from step (Ia) using a second solution; (IIa) purifying the mRNA molecules from the dissolved mRNA molecules obtained from step (Ib) using a third solution containing a chelating agent; followed by (IIb) washing the purified mRNA molecules obtained from step (IIa) using a fourth solution, wherein steps (Ia) to (IIb) are performed using tangential flow filtration.

[0012] Surprisingly, it has been found that the method according to the invention highly purifies mRNA molecules, and thus produces a solution containing purified mRNA molecules with little or no mRNA hydrolysis products and ineffective mRNA molecules. Specifically, it has been found that by applying the method, mRNA hydrolysis products, ineffective mRNA molecules, proteins, and salts that could cause problems for downstream applications can be effectively removed. Therefore, by applying the method according to the invention, a solution containing purified mRNA molecules can be obtained, which is suitable for downstream applications, such as pharmaceutical applications.

[0013] In the context of this invention, the term "purification method" refers to a method for obtaining a target molecule from a mixture (e.g., a solution or suspension) containing the target molecule to be purified and components other than the target molecule, wherein the concentration of the target molecule in the solution obtained after performing the method is enhanced or increased compared to the concentration of the target molecule in the mixture before performing the method. Purification of the target molecule can also be referred to as enriching the target molecule by removing or at least substantially removing components other than the target molecule.

[0014] In the context of this invention, the target molecule is an mRNA molecule. Hereinafter, the terms “mRNA” and “mRNA molecule” are used interchangeably to refer to, for example, a single-stranded RNA molecule composed of A, C, G, and / or U nucleotides (i.e., nucleotides containing adenine, guanine, cytosine, and uracil as corresponding nitrogenous bases). Furthermore, the mRNA molecule contains one or more coding sequences that can serve as templates during the synthesis of amino acid sequences in translation. Therefore, the mRNA molecule to be purified preferably contains a coding sequence, i.e., a sequence that can be translated into an amino acid sequence (such as a protein) and contains a start codon and a stop codon. The coding sequence can be a naturally occurring sequence, a partially or fully codon-optimized sequence derived from the natural sequence to be used, or an artificial sequence. Codon optimization refers to the techniques applied to maximize protein expression by improving the translation efficiency of the corresponding mRNA molecule, because in some cases, certain species have codons that preferentially use for a given amino acid. Furthermore, the mRNA molecule may contain a 5' and / or 3' untranslated region (UTR), one or more internal ribosome entry sites (IRES), one or more additional sequences for promoting translation, and / or one or more modifications to regulate and / or prolong the duration of action. Further features of the mRNA molecule are described in further detail below.

[0015] Therefore, the term "mRNA" should be understood to mean any RNA molecule suitable for expressing an amino acid sequence or that can be translated into an amino acid sequence (such as a protein). Thus, "mRNA molecule" is intended to be understood as an mRNA molecule that exhibits its characteristic properties and / or activities and is therefore translatable into an amino acid sequence (such as a protein having the amino acid sequence that demonstrates its characteristic activities and / or properties).

[0016] In this document, the term "amino acid sequence" encompasses any kind of amino acid sequence (i.e., a chain of two or more amino acids linked by peptide bonds), and refers to any amino acid sequence of interest. Preferably, the encoded amino acid sequence is at least 5 amino acids in length, more preferably at least 10 amino acids, and even more preferably at least 50, 100, 200, or 500 amino acids. Therefore, the term "amino acid sequence" encompasses short peptides, oligopeptides, polypeptides, fusion proteins, proteins, and fragments thereof, such as known protein portions, preferably functional portions. These can be, for example, the biologically active portions of proteins or antigenic portions, such as epitopes that can effectively generate antibodies. There are no limitations regarding the function of the amino acid sequence, and possible amino acid sequences are further described in detail below.

[0017] In contrast, the components removed during the purification of the mRNA molecules, and thus the components other than the target molecules removed, include mRNA molecules that are partially or completely degraded, for example, by hydrolysis. Degradation by hydrolysis is a stochastic process, and the resulting degradation product (referred to herein as a “hydrolysis product” or also as a “mRNA molecule hydrolysis product”) is at least one nucleotide shorter than the hydrolyzed mRNA molecule. Therefore, depending on the length of the hydrolyzed mRNA molecule, the length of the resulting hydrolysis product can be, for example, less than 10,000 nucleotides, preferably less than 5,000 nucleotides, more preferably less than 500 nucleotides, even more preferably less than 250 nucleotides, even more preferably less than 170 nucleotides, and most preferably less than 120 nucleotides. Another example of a component to be removed is a non-functional mRNA molecule, which can be, for example, less than 50 nucleotides in length, preferably less than 25 nucleotides, and more preferably less than 15 nucleotides.

[0018] Furthermore, components removed during mRNA molecule purification include, for example, components used during the in vitro synthesis of the target molecule (such as in vitro transcription of mRNA molecules) and / or components contained in the cells used to amplify templates for synthesizing the target molecule and / or for transcribing mRNA molecules. In the case of in vitro transcription of mRNA molecules, such components include, for example, proteins, such as enzymes used for in vitro transcription; salts; ions, such as magnesium ions; nucleoside triphosphates; monophosphates, diphosphates, and / or triphosphates containing 5' caps and / or 5' cap analogs; ineffective transcripts; hydrolysis products; buffers, such as 3-(N-morpholino)propanesulfonic acid (MOPS); and / or chelating agents, such as ethylenediaminetetraacetic acid (EDTA).

[0019] The method according to the invention is performed by tangential flow filtration (TFF). TFF is characterized by a suspension or solution containing the mRNA molecules to be purified flowing tangentially across the surface of a filter membrane, wherein the mRNA molecules are preferably retained in the retentate. Therefore, by performing TFF for purifying mRNA molecules, the presence of filter cake that could clog the filter membrane over time is avoided, and thus the usable time of the filter membrane is increased.

[0020] Therefore, the system for purifying target molecules according to the present invention is a TFF system. A TFF system typically includes: a filtration device, such as a capsule, cassette, and holder, or a hollow fiber module; a pump; tubing; valves or clamps; and a fluid reservoir; and optionally a pressure gauge (see [link to documentation]). Figure 1This type of TFF system can be used continuously even at high mRNA molecule concentrations without clogging the filter pores. The use of TFF systems is advantageous because it allows for high-throughput purification of the mRNA molecules to be purified.

[0021] It is worth noting that the term "solution" generally refers to a homogeneous mixture of two or more substances, and is particularly applicable to liquid substances, but solutions of gases and solids are also possible. In this document, the term "solution," especially in the cases of the "first solution," "second solution," "third solution," and "fourth solution" according to the invention, encompasses liquids (such as water), preferably homogeneous liquid mixtures, and, for example, mixtures of liquids, and preferably dissolved salts.

[0022] According to the present invention, a method for purifying mRNA molecules is provided, wherein the method comprises step (Ia): purifying the precipitated mRNA molecules from a suspension containing the precipitated mRNA molecules. The purification is achieved using a first solution. The suspension containing the precipitated mRNA molecules can be obtained, for example, by cell lysis or in vitro transcription. Therefore, the precipitated mRNA molecules must be purified from components of the cells or components of the in vitro transcription mixture (e.g., amino acid sequences of proteins and enzymes, nucleoside triphosphates, buffer components, and optionally 5' caps and 5' cap analogs). 5' caps and 5' cap analogs can be included in the suspension used to perform step (Ia), for example, in cases where the mRNA molecules have already been transcribed in vitro and have been co-transcribed 5'-capped. Therefore, step (Ia) is advantageous for removing cellular components or components from the in vitro transcription mixture from the precipitated mRNA molecules.

[0023] In some embodiments of the present invention, the first solution contains ammonium acetate (NH4OAc). Therefore, the precipitated mRNA molecules are purified from the suspension using the first solution containing NH4OAc. Furthermore, the pH of the first solution is preferably in the range of 1 to 12, more preferably in the range of 1 to 10, even more preferably in the range of 3 to 9, and most preferably in the range of 6 to 8. Therefore, the precipitated mRNA molecules are purified from the suspension containing the precipitated mRNA molecules using the first solution, which contains NH4OAc and has a pH in the range of 1 to 12, preferably in the range of 1 to 10, more preferably in the range of 3 to 9, and even more preferably in the range of 6 to 8.

[0024] The method for purifying mRNA molecules according to the invention further includes step (Ib): washing and dissolving the purified precipitate of mRNA molecules obtained from step (Ia) above using a second solution. The second solution can be any solution in which the mRNA molecules can be resuspended and remain stable (i.e., not hydrolyzed), such as water. Performing step (Ib) is advantageous for removing components, particularly those from the first solution, and obtaining dissolved mRNA molecules.

[0025] In some embodiments of the present invention, the second solution is water.

[0026] The method for purifying mRNA molecules according to the invention further includes step (IIa): purifying the mRNA molecules from the dissolved mRNA molecules obtained from step (Ib) using a third solution containing a chelating agent. This is particularly advantageous for removing ineffective mRNA molecules and hydrolysis products from the solution containing the dissolved mRNA molecules.

[0027] The term "chelating agent" refers to a molecule that chelates cations, and more specifically, a molecule having donor groups that bind to the central atom in a coordination complex. This depends on several factors, such as pH and / or temperature, the concentration of the chelating agent, and / or the type of cation to be chelated. Chelating agents can be characterized, for example, by the number of teeth, i.e., the number of donor groups per molecule and / or the number of coordination positions occupied by the cation to be chelated. For example, the chelating agent EDTA has six teeth and chelates divalent cations in a 1:1 chelating agent divalent cation complex.

[0028] Preferably, in the context of this invention, the term "chelating agent" refers to a chelating agent capable of complexing divalent and / or trivalent cations (e.g., divalent magnesium and calcium ions and / or trivalent iron ions). Generally, chelating agents having fewer than four coordination sites at the cation have lower chelating activity, especially considering the effective complexation of divalent and / or trivalent cations, compared to chelating agents having four or more coordination sites at the cation.

[0029] The chelating agent according to the invention is a chelating agent having at least four coordination sites at the cation to be chelated, more preferably having more than four coordination sites at the cation to be chelated, even more preferably having at least four teeth per molecule (also referred to herein as a "powerful chelating agent"), more preferably having more than four coordination sites at the cation to be chelated (which is used in pharmaceutical compositions and / or formulations), and even more preferably EDTA. A chelating agent having more than four coordination sites at the cation to be chelated, used in pharmaceutical compositions, is for example, an antidote comprising a Na₂EDTA solution (e.g., 2 g / 10 ml; see, for example, GPUPharma GmbH) and / or calcium disodium EDTA (e.g., 50 mg / ml, Amp. 10 ml; see, for example, Laboratoires SERB), or for example, used as an excipient (see, for example, Phenhydan, Desitin Arzneimittel GmbH; or Solut N, Baxter; or Fluimucil, Zambon GmbH).

[0030] Therefore, in some embodiments of the present invention, the chelating agent is EDTA.

[0031] Examples of preferred chelating agents are listed in Table 1, among which EDTA is the most preferred chelating agent.

[0032] Table 1

[0033]

[0034]

[0035] Strong chelating agents (such as EDTA) can effectively remove, especially, divalent cations, such as magnesium cations. Magnesium cations are required, for example, by enzymes involved in the transcription of mRNA molecules, and are therefore present in high levels in cellular and in vitro transcription mixtures. The inventors have discovered that the effective removal of hydrolysis products and ineffective mRNA molecules can be achieved in step (IIa) using a strong chelating agent (such as EDTA), thereby allowing for highly purified mRNA molecules. Without being bound by theory, it is assumed that the aforementioned cations may support the formation of secondary and tertiary structures of mRNA molecules, and that the removal, especially of divalent cations (such as magnesium cations), may be particularly relevant to the purification of mRNA molecules as ineffective mRNA molecules, and that hydrolysis products may tend to bind to the mRNA molecules to be purified in the presence of said cations. Therefore, it is believed that by removing divalent cations in step (IIa) using a strong chelating agent (such as EDTA), the melting point is lowered and the secondary and / or tertiary structures of the mRNA molecules are affected. Thus, ineffective mRNA molecules and hydrolysis products can be removed as permeate. Therefore, step (IIa) is particularly advantageous for removing invalid mRNA molecules and hydrolysis products.

[0036] According to the invention, the third solution contains a chelating agent, preferably a strong chelating agent as defined above, and most preferably EDTA. As mentioned above, the complexing ability of a chelating agent can be affected by pH, since the complexation constant of a given chelating agent is affected by pH. For example, EDTA is particularly strong at higher pH values, such as between pH 8 and 10, considering the chelation of magnesium ions. However, considering the optimal trade-off between the complexing ability of a given chelating agent and the stability of the mRNA molecules to be purified, it is desirable to adjust the pH. In this case, it has been observed that strong chelating agents (such as EDTA) can effectively remove, especially divalent cations, at pH values ​​between 1 and 10, preferably between 6 and 8. Therefore, without being bound by theory, it is assumed that in this way, in particular the melting points of ineffective mRNA molecules and hydrolysis products bound to mRNA molecules can be lowered by strong chelating agents (such as EDTA), and thus ineffective mRNA molecules and hydrolysis products can be removed while adjusting the pH to a value that maintains the stability of the mRNA molecules to be purified.

[0037] Therefore, in a preferred embodiment, the pH value of the third solution containing the chelating agent is adjusted to a pH value at which the corresponding chelating agent has the best chelating ability.

[0038] Therefore, the use of a strong chelating agent (such as EDTA) with a pH between 1 and 10, preferably between 6 and 8, is advantageous for the effective removal of divalent cations and thus, consequently, for the effective removal of ineffective mRNA molecules and hydrolysis products. When using one of the aforementioned optional chelating agents, it may be necessary to adjust the pH to a level at which the option effectively removes ions, preferably divalent magnesium cations. The table above indicates the corresponding pH ranges for preferred chelating agents.

[0039] In some embodiments, the pH of the third solution is in the range of 1 to 10, preferably in the range of 3 to 9, and more preferably in the range of 6 to 8.

[0040] The pH of the third solution can be obtained using a buffer. Preferred buffers (with their respective pH ranges given in parentheses) include 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol (Bis-Tris; pH range 5.8-7.2), N-(2-acetamido)iminodiacetic acid (ADA; pH range 6.0-7.2), N-(2-acetamido)-2-aminoethanesulfonic acid (ACES; pH range 6.1-7.5), 1,4-piperazine diethanesulfonic acid (PIPES; pH range 6.1-7.5), 2-hydroxy-3-morpholino-4-ylpropane-1-sulfonic acid (MOPSO; pH range 6.2-7.6), 1,3-bis(tris(hydroxymethyl)methylamino)propane (Bis-Tris propane; pH range 6.3-9.5), N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid, and N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid. Sulfonic acid (BES; pH range 6.4-7.8), 3-(N-morpholino)propanesulfonic acid (MOPS; pH range 6.5-7.9), 2-[[1,3-dihydroxy-2-(hydroxymethyl)prop-2-yl]amino]ethanesulfonic acid (TES; pH range 6.8-8.2), 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid (HEPES; pH range 6.8-8.2), 3-(N,N-bis[2-hydroxyethyl]amino)-2-hydroxypropanesulfonic acid (DIPSO; pH range 7.0-8.2), 4-(N-morpholino)butyric acid (MOBS; pH range 6.9-8.3), and 3-[[1,3-dihydroxy-2-(hydroxymethyl)prop-2-yl]amino]-2-hydroxypropane-1-sulfonic acid (TAPSO; pH range 7.0-8.2). A particularly preferred buffer is MOPS, with a preferred pH between 6 and 8, more preferably between 6.5 and 7.5.

[0041] In some embodiments, the pH of the third solution is in the range of 1 to 10, preferably in the range between 3 and 9, and more preferably in the range between 6 and 8, and contains a buffer, preferably MOPS.

[0042] In some embodiments of the invention, the third solution contains a MOPS buffer and is preferably obtained by adjusting the pH of the MOPS buffer before adding a chelating agent, preferably EDTA.

[0043] Therefore, in some embodiments of the invention, the third solution, preferably containing EDTA as a chelating agent for removing, in particular, divalent cations (such as magnesium cations), further contains a MOPS buffer and has a pH between 6 and 8. In some embodiments of the invention, the third solution can be obtained by preparing a MOPS buffer, adjusting the pH of the MOPS buffer to between 1 and 10, preferably between 6 and 8, and then adding EDTA as a preferred chelating agent.

[0044] In some embodiments of the invention, the third solution contains 40 mM MOPS and 10 mM EDTA, and the pH is between 6 and 8, preferably between 6.5 and 7.5.

[0045] The method for purifying mRNA molecules according to the invention further includes step (IIb): washing the purified mRNA molecules obtained from step (IIa) with a fourth solution. The fourth solution can be any solution in which the mRNA molecules remain stable (i.e., do not hydrolyze). Step (IIb) is advantageous for removing components of the third solution using the fourth solution, which contains, for example, sodium chloride or citrate or water.

[0046] As described above, the second and fourth solutions can be any solutions in which the mRNA molecules remain stable (i.e., do not hydrolyze). Such fluids can be, for example, water, preferably nuclease-free water or RNase-free water, such as water for injection (WFI water). In the case of the fourth solution, such fluids can further be, for example, HEPES-buffered glucose, sodium chloride, and / or citrate.

[0047] Therefore, in some embodiments of the present invention, the fourth solution is water.

[0048] In some embodiments of the present invention, the second and fourth solutions are water.

[0049] In some embodiments of the present invention, the fourth solution comprises sodium chloride and / or citrate.

[0050] In some embodiments of the invention, the second solution is water and / or the fourth solution is water or contains sodium chloride and / or citrate. This is advantageous after step (IIb) to obtain a solution containing purified mRNA molecules without introducing components that would have to be removed in additional steps prior to further downstream processing or application.

[0051] In a preferred embodiment of the invention, the second solution is water, and the fourth solution contains sodium chloride and / or citrate, preferably with a pH between 4 and 5. This is particularly advantageous for therapeutic purposes because sodium chloride and / or citrate are preferably included in the pharmaceutical composition containing the purified mRNA molecules. Therefore, this is advantageous considering the subsequent formulation of the obtained mRNA molecules into a pharmaceutical composition, as sodium chloride and / or citrate are common components of pharmaceutical compositions. Thus, using a fourth solution containing sodium chloride or citrate as a preferred component of the pharmaceutical composition allows for the efficient integration of the steps required to purify the mRNA molecules and formulate them into a pharmaceutical composition, both in terms of time and cost.

[0052] When the fourth solution contains sodium chloride and / or citrate, the pH of the fourth solution is preferably between 3 and 6, more preferably between 3.5 and 5.5, and even more preferably between 4 and 5.

[0053] In a preferred embodiment of the method according to the invention, ethanol is not contained in any of the first solution, second solution, third solution, and / or fourth solution used in the method.

[0054] As described above, it has been surprisingly found that highly purified mRNA molecules can be obtained by applying the method of the present invention. Preferably, the solution obtained by performing the method contains purified mRNA molecules, but with no or only very low levels of hydrolysis products and invalid mRNA molecules. More preferably, after step (IIb), the percentage of mRNA molecules in the obtained solution is at least 80%, even more preferably at least 90%, and even more preferably at least 95% of all RNA molecules (mRNA molecules, hydrolysis products, and invalid mRNA molecules). This can be measured by methods known to those skilled in the art (e.g., gel electrophoresis, high-performance liquid chromatography (HPLC) analysis) or by studying electrophoretic patterns obtained by capillary gel electrophoresis or capillary electrophoresis (e.g., fragment analyzer analysis). The latter method is described in more detail in the following examples.

[0055] In some embodiments of the invention, at least step (IIa), preferably steps (Ia) to (IIb), is performed at a temperature between 0°C and 25°C, preferably between 2°C and 8°C. Therefore, the method according to the invention, at least in step (IIa), i.e., in the case of purifying mRNA molecules from the dissolved mRNA molecules obtained from step (Ib) using a third solution containing a strong chelating agent, preferably EDTA, is preferably performed between 0°C and 25°C. Thus, by performing step (IIa) at a temperature between 0°C and 25°C, preferably between 2°C and 8°C, ineffective mRNA molecules and hydrolysis products are removed. Lower temperatures, such as between 2°C and 8°C, are particularly advantageous because the amount of mRNA molecules degraded by hydrolysis is reduced compared to the amount of degradation observed when performing, especially step (IIa), at higher temperatures (such as above 25°C). Therefore, in order to obtain a large quantity of purified mRNA molecules, it is advantageous to perform at least step (IIa) of the method according to the invention at a temperature between 0°C and 25°C, preferably between 2°C and 8°C, preferably at least steps (Ia) to (IIb).

[0056] In some embodiments of the invention, the precipitated mRNA molecules contained in the suspension are obtained by in vitro transcription, preferably using a DNA template. Therefore, the mRNA molecules to be purified according to the invention can be produced by any method known in the art. Preferably, the mRNA molecules are transcribed in vitro using a DNA template.

[0057] In vitro transcription requires a purified linear or linearized DNA template containing a promoter, ribonucleoside triphosphates, a buffer system, and a suitable RNA polymerase, such as T7 RNA polymerase. For example, such a purified linear DNA template can be chemically synthesized in vitro and optionally subsequently amplified using, for example, PCR-based methods. Alternatively, the DNA template for transcription can be obtained from a DNA plasmid, typically obtained through cell lysis, purified, and linearized, for example, using site-specific restriction enzymes. In both cases, the resulting linear DNA template sequence can be used to transcribe mRNA molecules in vitro using standard laboratory protocols in the presence of A, C, G, and U nucleotides.

[0058] In some embodiments of the invention, the mRNA molecule to be purified is produced by in vitro transcription in the presence of unmodified and / or modified nucleotides. Therefore, the mRNA molecule to be purified can be synthesized by in vitro transcription based on a linear or linearized DNA template using unmodified and / or modified nucleotides. The term "unmodified nucleotide" as used herein refers to the A, C, G, T, and U nucleotides as described above. Specifically, in the case of in vitro transcription of the mRNA molecule, the term refers to the A, C, G, and U nucleotides. The term "modified nucleotide" as used herein refers to any naturally occurring or chemically synthesized isomer of the A, C, G, T, and U nucleotides, and refers to any naturally occurring or chemically synthesized analogues, alternatives, or modified nucleotides or isomers thereof having, for example, chemically modified or substituted residues. Modified nucleotides may have base modifications and / or sugar modifications. Modified nucleotides may also have, for example, phosphate group modifications with respect to the 5' cap of the mRNA molecule. Modified nucleotides also include nucleotides synthesized post-transcriptionally through covalent modification of nucleotides. Furthermore, any suitable mixture of unmodified and modified nucleotides is possible. Numerous non-limiting examples of modified nucleotides can be found in the literature (e.g., Cantara et al., Nucleic Acids Res, 2011, 39(Supplement_1):D195-D201; Helm and Alfonzo, Chem Biol, 2014, 21(2):174-185; Carell et al., Angew Chem Int Ed Engl, 2012, 51(29):7110-31), and some preferred modified nucleotides are mentioned exemplarily below based on their corresponding nucleoside residues:

[0059] 1-Methyladenosine, 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine, 2-methyladenosine, 2'-O-ribosylphosphate adenosine, N6-methyl-N6-threonylcarbamoyladenosine, N6-acetyladenosine, N6-glycinylcarbamoyladenosine, N6-isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyiso) N6-hydroxyvaline carbamoyl adenosine, 1,2'-O-dimethyl adenosine, N6,2'-O-dimethyl adenosine, 2'-O-methyl adenosine, N6,N6,2'-O-trimethyl adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-methyl adenosine, 2-methylthio-N6-isopentenyl adenosine, 2-methylthio-N6-threonyl carbamoyl adenosine, N6-2-methylthio-N6-threonyl carbamoyl adenosine, 2-methylthio- N6-(cis-hydroxyisopentenyl)adenosine, 7-methyladenosine, 2-methylthio-adenosine, 2-methoxy-adenosine, 2'-amino-2'-deoxyadenosine, 2'-azido-2'-deoxyadenosine, 2'-fluoro-2'-deoxyadenosine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenosine, 7-deaza-8-aza-adenosine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2 6-Diaminopurine, 7-Denitro-8-aza-2,6-Diaminopurine; 2-Thiocytidine, 3-Methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-hydroxycytidine, lysidine, N4-acetyl-2'-O-methylcytidine, 5-formyl-2'-O-methylcytidine, 5,2'-O-dimethylcytidine, 2-O-methylcytidine, N4,2'-O-dimethylcytidine, N4,N42'-O-trimethylcytidine, isocytidine, pseudocytidine, pseudoisocytidine, 2-thio-cytidine, 2'-methyl-2'-deoxycytidine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-bromocytidine, 2'-azido-2'-deoxycytidine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 5-aza-cytidine, 3-methylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-5-methylcytidine, 4 -Thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-l-methyl-1-denitro-pseudoisocytidine, 1-methyl-l-denitro-pseudoisocytidine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l-methyl-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methylzebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine; 1-methylguanosine, N2,7-dimethylguanosine, N2-methylguanosine, 2'-O-ribosylphosphate guanosine guanosine), 7-methylguanosine, hydroxywybutosine, 7-aminomethyl-7-deazoguanosine, 7-cyano-7-deazoguanosine, N2,N2-dimethylguanosine, N2,7,2'-O-trimethylguanosine, N2,2'-O-dimethylguanosine, 1,2'-O-dimethylguanosine, 2'-O-methylguanosine, N2,N2,2'-O-trimethylguanosine, N2,N2J-Trimethylguanosine, Isoguanosine, 4-demethylwyosine, epoxyqueuosine, undermodified hydroxywybutosine, methylated undermodified hydroxywybutosine, isowyosine, peroxywybutosine, galactosyl-queuosine, mannosyl-queuosine, queuosine, archaeosine, queuosine, methylwyosine, wyosine, 7-aminocarboxypropyldemethylwyosine, 7-aminocarboxypropylwyosine, 7-aminocarboxypropylwyosine methyl ester, 7-deazo-guanosine, 7-deazo-8-aza-guanosine, 6-thio-guanosine Glycosides, 6-thio-7-deazo-guanosine, 6-thio-7-deazo-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, N1-methylguanosine, 2'-amino-3'-deoxyguanosine, 2'-azido-2'-deoxyguanosine, 2'-fluoro-2'-deoxyguanosine Glycosides, 2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine, 3-methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5-methylaminomethyluridine, 5-carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5-hydroxyuridine, 5-methyluridine, 5-taurinomethyluridine, 5-carbamoylmethyluridine, 5-(carboxyhydroxymethyl)uridine methyl ester, dihydrouridine, 5-methyldihydrouridine, 5-methylaminomethyl-2-thiouridine, 5-(carboxy) 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, 3,2'-O-dimethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carbamoylmethyl-2-thiouridine, 5-methoxycarbonylmethyl-2'-O-methyluridine, 5-(isopentenylaminomethyl)-2'-O-methyluridine, 5,2'-O-dimethyluridine, 2'-O-methyluridine, 2'-O-methyl-2-thiorudine, 2-thio-2'-O-methyluridine, uridine 5-oxyacetic acid, 5-methoxycarbonylmethyluridine, uridine 5-oxyacetic acid methyl ester, 5-methoxyuridine, 5-aminomethyl-2-thiorudine, 5-carboxymethylaminomethyl-2-thiorudine, 5-methylaminomethyl-2-selenouridine, 5-methoxycarbonylmethyl-2-thiorudine, 5-taurinomethyl-2-thiouridine, pseudouridine, 1-methyl -3-(3-amino-3-carboxypropyl)pseudouridine, 1-methylpseudouridine, 3-methylpseudouridine, 2'-O-methylpseudouridine, 5-formyluridine, 5-aminomethyl-2-geranyluridine, 5-tauric acid methyluridine, 5-iodouridine, 5-bromouridine, 2'-methyl-2'-deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 2'-fluoro-2'-deoxyuridine, inosine, 1-methylinosine, 1,2'-O-dimethylinosine, 2' -O-methylinosine, 5-aza-uridine, 2-thio-5-aza-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 1-taurate methyl-pseudouridine, 5-taurate methyl-2-thio-uridine, 1-taurate methyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio- 1-Methyl-pseudouridine, 2-Thio-1-methyl-pseudouridine, 1-Methyl-1-denitro-pseudouridine, 2-Thio-1-methyl-1-denitro-pseudouridine, dihydropseudouridine, 2-Thio-dihydrouridine, 2-Thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 1,2'-O-dimethyladenosine, 1,2'-O-dimethylguanosine, 1,2'-O-dimethylinosine, 2,8-Dimethyladenosine, 2-Methylthio-N6-isopentenyl-adenosine, 2-Germanylthiouridine, 2-Lysicillin, 2-Methylthiocyclic N6-threonylcarbamoyladenosine, 2-Methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-Methylthio-N6-hydroxyn-valinecarbamoyladenosine, 2-Methylthio-N6-threonylcarbamoyladenosine, 2-Selenouridine, 2-Thio-2'-O-methyluridine, 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, 2'-O-methylpseudouridine, 2'-O-methyluridine, 2'-O-methyluridine 5-O-hydroxyacetic acid methyl ester, 2'-O-ribosyladenosine phosphate, 2'-O-ribosylguanosine phosphate, 3,2'-O-dimethyluridine, 3-(3-amino-3-carboxypropyl)-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 5,2'-O-dimethylcytidine, 5,2'-O-dimethyluridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 55-(isopentenylaminomethyl)-2'-O-methyluridine, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-Carboxyhydroxymethyluridine, 5-Carboxymethyl-2-thiouridine, 5-Carboxymethylaminomethyl-2-geranylthiouridine, 5-Carboxymethylaminomethyl-2-selenouridine, 5-Carboxymethylaminomethyl-2'-O-methyluridine, 5-Cyanomethyluridine, 5-Formyl-2'-O-methylcytidine, 5-Methoxycarbonylmethyl-2'-O-methyluridine, 5-Methylaminomethyl-2-geranylthiouridine, 7-Aminocarboxypropyl-demethylwyoside, 7-Methylguanosine, 8-Methyladenosine, N2,2'-O-dimethylguanosine, N2,7,2'-O-trimethylguanosine, N2,7-dimethylguanosine, N2,N2,2'-O - Trimethylguanosine, N2,N2,7-Trimethylguanosine, N2,N2,7-Trimethylguanosine, N4,2'-O-dimethylcytidine, N4,N4,2'-O-trimethylcytidine, N4,N4-dimethylcytidine, N4-acetyl-2'-O-methylcytidine, N6,2'-O-dimethyladenosine, N6,N6,2'-O-trimethyladenosine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, 2-methylthiocyclic N6-threonylcarbamoyladenosine, glutamyl-pigmentoside, guanosine added to any nucleotide, guanylylated 5' end 5'-end), hydroxy-N6-threonylcarbamoyladenosine; most preferably pseudouridine, N1-methyl-pseudouridine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-methylcytidine, 2-thiouridine, 5-iodouridine and / or 5-methyluridine.

[0060] Furthermore, the term "modified nucleotide" includes nucleotides containing isotopes (such as deuterium). The term "isotope" refers to elements with the same number of protons but different numbers of neutrons, thus producing different mass numbers. Therefore, isotopes of hydrogen are not limited to deuterium, but also include tritium. In addition, mRNA molecules may also contain isotopes of other elements, including, for example, carbon, oxygen, nitrogen, and phosphorus. Modified nucleotides may also be deuterated or contain other isotopes of hydrogen or other isotopes of oxygen, carbon, nitrogen, or phosphorus.

[0061] Therefore, in the presence of four nucleotide types (i.e., A, C, G, and U nucleotides) to produce the purified mRNA molecule via in vitro transcription, the total number of modified nucleotide types can be 0, 1, 2, 3, or 4. Thus, in some embodiments, at least one nucleotide of one nucleotide type (e.g., at least one U nucleotide) can be a modified nucleotide. In some embodiments, at least one nucleotide of a total of two nucleotide types (e.g., at least one U nucleotide and at least one C nucleotide) can be a modified nucleotide. In some embodiments, at least one nucleotide of a total of three nucleotide types (e.g., at least one G nucleotide, at least one U nucleotide, and at least one C nucleotide) can be a modified nucleotide. In some embodiments, at least one nucleotide of all four nucleotide types can be a modified nucleotide. In all these embodiments, one or more nucleotides of each nucleotide type may be modified, wherein the percentage of modified nucleotides of each nucleotide type is 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%.

[0062] In some embodiments, the total percentage of modified nucleotides contained in the mRNA molecule to be purified is 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%.

[0063] The mRNA molecule to be purified may be characterized, for example, by having 0.5% to 50%, preferably 5% to 50%, of U nucleotides and 5% to 50% of C nucleotides modified. The modified U nucleotide is preferably 5-iodouridine, and the modified C nucleotide is preferably 5-iodocytidine.

[0064] In some embodiments, the mRNA molecule to be purified may be characterized in that 15% to 25% of the U nucleotide and 5% to 15% of the C nucleotide are modified, wherein the modified U nucleotide is preferably 5-methyluridine and the modified C nucleotide is preferably 5-iodocytidine.

[0065] In some embodiments, the mRNA molecule to be purified may be characterized in that 30% to 50% of the U nucleotide and 10% to 20% of the C nucleotide are modified, wherein the modified U nucleotide is preferably 5-iodouridine and the modified C nucleotide is preferably 5-iodocytidine.

[0066] In some embodiments, the mRNA molecule to be purified may be characterized in that 30% to 50% of the U nucleotide and 5% to 15% of the C nucleotide are modified, wherein the modified U nucleotide is preferably 5-iodouridine and the modified C nucleotide is preferably 5-iodocytidine.

[0067] In some embodiments, the mRNA molecule to be purified may be characterized by 0.5% to 5% of U nucleotides and 25% to 35% of C nucleotides being modified, wherein the modified U nucleotide is preferably 2-thiouridine and the modified C nucleotide is preferably 5-methylcytidine.

[0068] The purified mRNA molecule may also be characterized, for example, by the fact that 50% to 100%, preferably 100%, of the U nucleotides are modified. The modified U nucleotide is preferably N1-methylpseuuridine.

[0069] In some embodiments of the invention, the method includes obtaining a suspension containing precipitated mRNA molecules using ammonium acetate prior to step (Ia). Precipitating mRNA molecules is advantageous for removing salts, nucleotides, and proteins, particularly because mRNA precipitation is both simple and cost-effective. Various solutions for precipitation are known to those skilled in the art, including, for example, GSCN, NH4OAc, ethanol, lithium chloride, sodium acetate, and sodium chloride. However, avoiding salts like GSCN and LDS is highly advantageous, especially for therapeutic applications. Therefore, in some embodiments of the invention, NH4OAc is used to precipitate mRNA molecules. Thus, it is preferable to use NH4OAc for precipitating mRNA molecules to obtain the suspension used in step (Ia).

[0070] As described above, in some embodiments of the invention, the first solution contains ammonium acetate. Preferably, the total amount of NH4OAc in the suspension and the first solution is between 0.1 mol / L and 5 mol / L, preferably between 1 mol / L and 4 mol / L, more preferably between 2 mol / L and 3 mol / L, and therefore less than 5 mol / L, preferably less than 4 mol / L, more preferably less than 3 mol / L. Low amounts of ammonium acetate are highly advantageous considering the time and cost-effectiveness of downstream processing. The pH of the first solution can further have a pH range of 1 to 12, preferably between 6.5 and 7.5.

[0071] In some embodiments of the present invention, the first solution contains ammonium acetate, wherein the total amount of NH4OAc in the suspension and the first solution is between 1 mol / L and 4 mol / L, preferably between 2 mol / L and 3 mol / L.

[0072] In some embodiments of the present invention, the pH of the first solution is in the range of 1 to 12, preferably between 6.5 and 7.5, and contains ammonium acetate, wherein the total amount of NH4OAc in the suspension and the first solution is between 1 mol / L and 4 mol / L, preferably between 2 mol / L and 3 mol / L.

[0073] In some embodiments of the invention, the method for purifying mRNA molecules further includes adding a fifth solution to the dissolved mRNA molecules obtained from step (Ib), followed by purification of the mRNA molecules using a third solution containing a chelating agent according to step (IIa). The fifth solution preferably contains the same chelating agent as the third solution. Therefore, the fifth solution preferably contains EDTA as a chelating agent for removing, in particular, divalent cations (such as magnesium cations), and optionally a MOPS buffer. However, the concentration of the chelating agent contained in the fourth solution is preferably higher than the concentration of the chelating agent contained in the third solution. By adding the fifth solution to the dissolved mRNA molecules obtained from step (Ib) prior to performing step (IIa), the composition of the solution in which the mRNA molecules obtained from step (Ib) are suspended can be adjusted to the composition of the third solution used in step (IIa). This has the advantage of reducing potential dilution effects and thus improving the throughput and / or reproducibility of mRNA molecule purification according to the methods disclosed herein.

[0074] In some embodiments of the invention, the method for purifying mRNA molecules further includes dephosphorylating and / or polyadenylated and / or post-capping the mRNA molecules. Therefore, not only can the methods of the present invention be used to purify mRNA molecules, but they can also be further modified to ensure that they can be translated into functional amino acid sequences such as proteins. Such modifications include: dephosphorylating the mRNA molecules to remove, for example, 5' monophosphate, diphosphate, and / or triphosphate added during in vitro synthesis or transcription of the mRNA molecules and / or during 5' capping of co-transcription; in most cases, polyadenylation of the mRNA molecules to a poly(A) tail is a major determinant of mRNA molecule lifetime; and post-capping the mRNA molecules without 5' capping of co-transcription. Since the 5' cap and 3' poly(A) tail are particularly considered major determinants of mRNA efficiency, it is advantageous to incorporate such features into the mRNA molecule purification method, considering maximizing the time and cost efficiency of mRNA molecule processing and maximizing the duration of action of the purified mRNA molecules.

[0075] The presence of the 5' cap is beneficial for enhancing the stability of mRNA molecules and thus prolonging the duration of their action.

[0076] Therefore, if the precipitated mRNA molecule to be purified does not contain a 5' cap or a 5' cap analogue, the mRNA molecule is preferably capped at the 5' end post-transcriptionally, for example by enzymatic addition of a C1-m7G cap or an m7GpppG cap.

[0077] However, more preferably, the mRNA molecule is co-transcribed and capped at 5', for example using an ARCA cap analog or by applying Trilink technology (CleanCap technology; see US 2018 / 273576 A1). In this case, using the TFF method according to the invention is advantageous for the complete removal of the cap analog.

[0078] Furthermore, if the precipitated mRNA molecule to be purified does not contain a 3' poly(A) tail, the mRNA molecule is preferably enzymatically polyadenylated with a poly(A) tail, the poly(A) tail consisting of at least 100 A nucleotides, preferably at least 120 A nucleotides, and more preferably at least 240 A nucleotides. Optionally, the poly(A) tail to be added contains non-A nucleotides, preferably G nucleotides within the poly(A) tail sequence and / or at one end of the poly(A) tail, wherein the end is not added to the 3' end of the mRNA molecule to be purified. It has been found that adding a poly(A) tail to the mRNA molecule is beneficial for prolonging the duration of action of the mRNA molecule and therefore beneficial for obtaining the desired level of translation.

[0079] Therefore, in some embodiments of the present invention, the method for purifying mRNA molecules according to the present invention further includes dephosphorylating the mRNA molecules.

[0080] In other embodiments of the invention, the method further includes polyadenylation of mRNA molecules.

[0081] In yet another embodiment of the invention, the method further includes post-capping the mRNA molecule.

[0082] In some embodiments, the method for purifying mRNA molecules according to the present invention includes at least dephosphorylating and polyadenylated the mRNA molecules.

[0083] In some embodiments, the method for purifying mRNA molecules according to the present invention includes at least dephosphorylating and capping the mRNA molecules, wherein dephosphorylating the mRNA molecules is performed after capping the mRNA molecules.

[0084] In some embodiments of the invention, the method for purifying mRNA molecules includes: dephosphorylating the mRNA molecules obtained from step (Ib), subsequently performing steps (Ia) to (IIb), followed by polyadenylation of the obtained mRNA molecules, followed by repeating steps (Ia) to (IIb), wherein the latter step (Ia) is preferably performed at a temperature between 20°C and 30°C, preferably between 23°C and 27°C, more preferably at 25°C, followed optionally by filtering the obtained retentate containing mRNA molecules. Therefore, to maximize the cost and time efficiency of mRNA molecule processing, the method for purifying mRNA molecules further includes the steps of dephosphorylation and polyadenylation of the mRNA molecules. Specifically, it has been found advantageous to combine the latter two steps with additional steps for purifying mRNA molecules to remove components also introduced during dephosphorylation and polyadenylation.

[0085] Therefore, especially when the mRNA molecule to be purified contains a co-transcribed 5' cap or a 5' cap analogue, the method for purifying the mRNA molecule may include the following steps. First, in step (Ia), the precipitated mRNA molecule is purified from a suspension containing the precipitated mRNA molecule using a first solution, preferably containing ammonium acetate. Then, in step (Ib), the purified precipitated mRNA molecule is washed and dissolved using a second solution (preferably water) to remove, for example, proteins, salts, and nucleoside triphosphates. The dissolved mRNA molecule is then dephosphorylated using methods known to those skilled in the art to remove 5' monophosphate, diphosphate, and triphosphate from potentially uncapped RNA molecules. In a further step (Ia), the dephosphorylated mRNA molecule is purified using a first solution preferably containing ammonium acetate, and subsequently, in a further step (Ib), washed with a second solution preferably water. In step (IIa), the obtained mRNA molecules are further purified using a third solution containing a chelating agent, preferably EDTA, and preferably MOPS, with a pH between 0 and 8, more preferably between 6.5 and 7.5, to remove ineffective mRNA molecules and hydrolysis products. The third solution is then removed in step (IIb) by performing a washing step using a fourth solution. If the polyadenylation step is not required, for example because a DNA template containing a sequence encoding a poly(A) tail is used for in vitro transcription, then the purified mRNA molecules obtained in step (IIb) are washed with a fourth solution, preferably containing citrate and / or sodium chloride, and step (IIb) is optionally followed by an additional filtration step using, for example, a filter membrane with a pore size less than 0.3 μm. Where the polyadenylation step is advantageous, for example because a DNA template not containing a sequence encoding a poly(A) tail is used for in vitro transcription, the obtained purified mRNA molecules are washed in step (IIb) with a fourth solution (preferably water), and then the 3' poly(A) tail can be added enzymatically (e.g., by adding poly(A) polymerase) using standard laboratory protocols to ensure the elongation of the mRNA molecules. The mRNA molecules are then subjected to steps (Ia) through (IIb) as previously described, except that step (Ia) is preferably performed at a temperature between 20°C and 30°C, preferably between 23°C and 27°C, more preferably at 25°C, for example to remove the added poly(A) polymerase, and except that the fourth solution used in step (IIb) preferably contains citrate and / or sodium chloride to obtain purified mRNA molecules containing a 5' cap or a 5' cap analogue and a 3' poly(A) tail. Optionally, the obtained purified mRNA molecules can be subjected to an additional filtration step using, for example, a filter membrane with a pore size less than 0.3 μm.

[0086] When the mRNA molecule to be purified does not contain a co-transcribed 5' cap or a 5' cap analogue, the method for purifying mRNA molecules according to the present invention may include an additional step of adding a 5' cap or a 5' cap analogue, preferably enzymatically transcribed and then transcribed. Therefore, the method for purifying mRNA molecules may include the following steps. First, in step (Ia), the precipitated mRNA molecules are purified from a suspension containing the precipitated mRNA molecules using a first solution, preferably containing ammonium acetate. Then, in step (Ib), the purified precipitated mRNA molecules are washed and dissolved using a second solution (preferably water) to remove, for example, proteins, salts, and nucleoside triphosphates. The method then further includes capping the mRNA molecules obtained from step (Ib), followed by performing steps (Ia) and (Ib) to dephosphorylate the obtained mRNA molecules, followed by performing steps (Ia) to (IIb). If the polyadenylation step is not required, for example because a DNA template containing a sequence encoding a poly(A) tail is used for in vitro transcription, then in step (IIb) the obtained purified mRNA molecules are washed with a fourth solution, preferably containing citrate and / or sodium chloride, and step (IIb) is optionally followed by an additional filtration step using, for example, a filter membrane with a pore size less than 0.3 μm. Where the polyadenylation step is advantageous, for example because a DNA template not containing a sequence encoding a poly(A) tail is used for in vitro transcription, in step (IIb) the obtained purified mRNA molecules are washed with a fourth solution (preferably water), and then the 3' poly(A) tail can be enzymatically added (e.g., by adding poly(A) polymerase) using standard laboratory protocols to ensure the elongation of the mRNA molecules. The mRNA molecules are then subjected to steps (Ia) through (IIb), wherein step (Ia) is preferably performed at a temperature between 20°C and 30°C, preferably between 23°C and 27°C, more preferably at 25°C, for example to remove the added poly(A) polymerase, and wherein step (IIb) is performed using a fourth solution preferably containing citrate and / or sodium chloride, optionally followed by filtration of the resulting retentate containing the mRNA molecules.

[0087] Therefore, steps (Ia) to (IIb) are preferably performed before any elongation of the mRNA molecule (such as 3' polyadenylation and optionally 5' capping). Specifically, steps (Ia) to (IIb) are preferably performed before 3' polyadenylation of the mRNA molecule, and preferably before 5' capping. This applies to all four embodiments described above, namely those used for purifying co-transcribed and post-transcribed 5'-capped mRNA molecules, respectively.

[0088] Furthermore, in all four embodiments described above, the step of dephosphorylating the mRNA molecule, followed by performing steps (Ia) and (Ib), can be optional. Therefore, apart from the step of dephosphorylating the mRNA molecule followed by performing steps (Ia) and (Ib), some embodiments correspond to the four embodiments described above.

[0089] TFF can be performed using capsule bodies, boxes and box holders, or hollow fiber modules as filtration devices. In particular, hollow fiber modules allow for fully pre-assembled, pre-sterilized, single-use flow paths that enable aseptic processing and provide a cost-effective method for packaging filter membranes.

[0090] Filter membranes used for mRNA molecule purification can be any type of material suitable for mRNA molecule purification and therefore do not interact with the mRNA molecules to be purified. Examples of filter membrane materials include unmodified polyethersulfone (PES), modified polyethersulfone (mPES), mPES hollow fiber membranes, polyvinylidene fluoride (PVDF), cellulose acetate, nitrocellulose, mixed cellulose esters (ME), ultra-high MW polyethylene (UPE), polyfluorotetraethylene (PTFE), nylon, polysulfone (PS), polyacrylonitrile, polypropylene, polyvinyl chloride, polyvinylidene fluoride (PVDF), and combinations thereof.

[0091] The filter membrane is characterized by its molecular weight cutoff (MWCO) value, which refers to the lowest molecular weight of particles in Daltons, where 90% of the particles are retained by the membrane. Preferably, the pore size of the filter membrane is suitable for retaining mRNA molecules while allowing components smaller than the MWCO and therefore smaller than the pore size to pass through the filter membrane as permeate. Since different components of different sizes must be removed, it is advantageous to adjust the pore size of the filter membrane to the size of the components to be removed in the corresponding steps of the method according to the invention.

[0092] In some embodiments of the invention, in step (Ia), a filter membrane with a molecular weight cutoff between 300 kDa and 0.65 μm, preferably 500 kDa, is used for TFF; and / or in steps (Ib) and (IIb), a filter membrane with a molecular weight cutoff between 1 kDa and 0.65 μm, preferably between 1 kDa and 300 kDa, more preferably between 1 kDa and 50 kDa, even more preferably 50 kDa, 70 kDa, and / or 100 kDa is used; and / or in step (IIa), a filter membrane with a molecular weight cutoff of at least 50 kDa, preferably at least 70 kDa, more preferably 70 kDa or 100 kDa is used. The filter membrane used in TFF is crucial because the pore size of the filter membrane determines the size of particles, such as mRNA molecules, and components that can pass through the filter membrane and are thus contained in the permeate.

[0093] Therefore, in step (Ia), the MWCO of the filter membrane is preferably at least 300 kDa or 0.065 μm. Preferably, the MWCO is selected from 300 kDa, 500 kDa, 750 kDa, 0.05 μm, 0.1 μm, 0.2 μm, 0.45 μm, 0.5 μm, and 0.65 μm, with a MWCO of 500 kDa being particularly preferred. This is advantageous for retaining the precipitated mRNA molecules while removing, for example, enzymes and proteins contained in lysed cells to obtain the mRNA molecules to be purified, or, in the case of mRNA molecules transcribed in vitro, enzymes, modified and unmodified nucleoside triphosphates, 5' caps, 5' cap analogs, and buffer components contained in the in vitro transcription reaction mixture. Therefore, an appropriate MWCO value can be selected by taking into account, for example, the size of the enzymes used in the pretreatment step (such as in vitro transcription of the mRNA molecules to be purified) and removed by the TFF in step (Ia). T7 RNA polymerase is an enzyme well known in the art, which will not be effectively removed when using a filter membrane with a MWCO of less than 100 kDa. When a MWCO ranging from 1 kDa to 750 kDa is applied in step (Ia), TFF can be referred to as ultrafiltration, while when a MWCO ranging from 0.05 μm to 0.65 μm is applied, TFF can be referred to as microfiltration.

[0094] In steps (Ib) and (IIb), the MWCO is preferably at least 1 kDa, preferably between 1 kDa and 50 kDa, more preferably at least 50 kDa, and even more preferably at least 70 kDa. Preferably, the MWCO is selected from 1 kDa, 3 kDa, 5 kDa, 10 kDa, 30 kDa, 50 kDa, 70 kDa, 100 kDa, 300 kDa, 0.05 μm, 0.1 μm, 0.2 μm, 0.45 μm, 0.5 μm, and 0.65 μm, with MWCO of 50 kDa, 70 kDa, or 100 kDa being particularly preferred. This facilitates the purification of mRNA molecules while effectively removing salts and other components contained in the corresponding solution, such as ammonium acetate, chelating agents (e.g., EDTA), buffers (e.g., MOPS), ineffective mRNA molecules, and / or hydrolysis products. In the case of relatively large mRNA molecules, MWCO exceeding 300 kDa may also be considered.

[0095] In step (IIa), the MWCO is preferably at least 50 kDa, more preferably at least 70 kDa, and even more preferably 70 kDa or 100 kDa. When using, for example, a MOPS-EDTA buffer as described above, a MWCO of 100 kDa is particularly preferred. In the case of other strong chelating agents or other strong chelating agent-buffer combinations, even a MWCO of more than 100 kDa can be considered for purifying relatively large mRNA molecules.

[0096] Furthermore, considering different variables, the process using TFF can be characterized, among which the two most important variables are transmembrane pressure and flow rate.

[0097] "Transmembrane pressure" (TMP) refers to the driving force that drives the component to pass through the filtration membrane. In some embodiments, the transmembrane pressure is between 100 mbar and 500 mbar in steps (Ia) and (Ib), for example, on a laboratory scale of 500 mg mRNA in typical cases, and preferably between 200 mbar and 400 mbar in steps (IIa) and (IIb), and between 2 mbar and 20 mbar, preferably between 5 mbar and 15 mbar.

[0098] The term "flow" refers to the volume of solution flowing through the TFF system, and particularly in the membrane region, while "flow rate" refers to the volume of solution flowing through the system during a given period of time. Therefore, flow rate, or crossflow velocity, refers to the rate at which the solution flows across the filtration membrane. In some embodiments, the flow rate in steps (Ia) and (Ib), for example, at a typical laboratory scale of 500 mg mRNA, is between 1.5 L / min and 2.5 L / min, preferably between 1.6 L / min and 1.9 L / min, and in steps (IIa) and (IIb), it is between 0.2 L / min and 0.6 L / min, preferably between 0.35 L / min and 0.45 L / min.

[0099] In a particularly preferred embodiment of the invention, the method for purifying mRNA molecules is performed using sequential TFF. Sequential TFF refers to a TFF system in which the retentate is used as feed for another round of TFF. Herein, the term "feed" refers to a solution or suspension containing the mRNA molecules to be purified. Thus, the initial feed contains mRNA molecules and undergoes a first round of filtration using TFF, and the resulting retentate containing mRNA molecules is again used as feed to perform another round of TFF by at least cycling the mRNA molecules. This automated repetition of purification steps is advantageous for enhancing the level of purification while reducing the risk of mRNA molecule loss due to transfer between systems.

[0100] Therefore, in some embodiments of the present invention, mRNA molecules are contained in the retentate after tangential flow filtration, preferably at least in the retentates obtained by steps (Ia) to (IIa). In the case of step (IIb), mRNA molecules may be contained in either the retentate or the permeate.

[0101] In some implementations, the mRNA molecule is contained in the cut-off obtained through steps (Ia) to (IIb).

[0102] In some embodiments of the invention, the retentate obtained in step (Ia) is used as the feed solution for tangential flow filtration in step (Ib), the retentate obtained in step (Ib) is used as the feed solution in step (IIa), and the retentate obtained in step (IIa) is used as the feed solution in step (IIb). Therefore, the invention preferably uses continuous TFF to perform at least steps (Ia) to (IIb). More specifically, the mRNA molecules are preferably circulated in the continuous TFF system according to the invention for purification. Therefore, in one embodiment of the invention, at least steps (Ia) to (IIa), preferably steps (Ia) to (IIb), are performed using continuous TFF.

[0103] Another advantage of the TFF system is its ease of use for percolation, particularly for continuous percolation. Through percolation, one portion of a solution or suspension can be exchanged with another. For example, in discontinuous percolation, the solution is first diluted and then concentrated back to the initial volume. However, this can negatively impact the functionality of the mRNA molecules to be purified.

[0104] Therefore, in a preferred embodiment of the invention, constant-volume perfiltration is used according to the method described above, causing the mRNA molecules to be purified to be circulated in a continuous TFF system for at least steps (Ia) to (IIb) for purification. Constant-volume perfiltration or continuous perfiltration refers to a filtration process in which a constant volume is maintained in the filtration system. Therefore, an amount of solution or suspension equal to the volume of the solution or suspension that permeates through the filter membrane is added. Thus, the volume of the retained product is the same as the initial feed volume into the TFF system (i.e., the feed volume), and the washing volume (i.e., the perfiltration volume) is the same as the permeate volume. The combination of continuous TFF and continuous perfiltration facilitates the removal of contaminants as permeate while maintaining the purified mRNA molecules in the circulating portion of the TFF system at a constant volume to preserve their function.

[0105] Therefore, in some embodiments of the present invention, percolation is used, preferably continuous percolation, to perform at least steps (Ia) to (IIa), preferably steps (Ia) to (IIb).

[0106] In some embodiments of the invention, the percolation volume of any one of the first, second, third, and / or fourth solutions is at least one times the suspension volume of step (Ia), for example, one, two, three, four, or five times, preferably at least ten times. Determining this percolation volume is of particular importance considering the optimal trade-off between time and cost efficiency and the desired level of purification. It has been found that the percolation volume of any one of the first, second, third, and / or fourth solutions is at least one times the suspension volume of step (Ia), preferably at least ten times. This facilitates ensuring substantial removal of components while allowing for high-throughput processing and thus large-scale purification of mRNA molecules.

[0107] In some implementations, the percolation volume is the suspension volume of step (Ia) and therefore 1 times the suspension volume containing the precipitated mRNA molecules initially fed into the TFF system in step (Ia).

[0108] In some implementations, the percolation volume is twice the volume of the suspension.

[0109] In some implementations, the percolation volume is three times the suspension volume.

[0110] In some implementations, the percolation volume is four times the suspension volume.

[0111] In some implementations, the percolation volume is 5 times the suspension volume.

[0112] In some other embodiments, the percolation volume is at least 5 times the suspension volume of step (Ia).

[0113] In some embodiments, the percolation volume is at least 10 times the suspension volume of step (Ia) and therefore at least 10 times the suspension volume containing the precipitated mRNA molecules initially fed into the TFF system in step (Ia). It has been found that using a percolation volume at least 10 times the volume initially fed into the TFF system is advantageous for substantially removing the components targeted as described above in the respective steps.

[0114] Therefore, preferably, the percolation volume of any one of the first, second, third, and / or fourth solutions is at least 10 times the suspension volume of step (Ia). Even more preferably, the percolation volume of the third and fourth solutions is at least 10 times the suspension volume of step (Ia).

[0115] In some embodiments, the percolation volume of the first, second, third, and fourth solutions is at least 10 times the suspension volume of step (Ia).

[0116] Figure 2 The image exemplarily illustrates a fully automated closed system for obtaining purified mRNA molecules according to the method of the present invention. The system includes... Figure 1 The illustrated continuous TFF system is preferably fluidly connected to the mRNA production system via a first valve. It is noteworthy that the term "valve" as used herein encompasses (e.g., two-way and / or three-way) stopcocks, clamps, and MPC connectors; preferably, valves and / or MPC connectors. Furthermore, it is preferred that the MPC connector is used in combination with the clamp. Thus, the two elements (e.g., two tubes) can be connected in such a way that allows for single-use, and / or ensures compatibility with various systems, stability against high pressure and / or pressure variations (e.g., in one of the tubes), and / or low cost.

[0117] The mRNA production system may include a reaction vessel and at least one further vessel. The reaction vessel and the at least one further vessel are preferably fluidly connected to each other and connected to a TFF system via connecting tubing. A first valve is positioned between the connecting tubing of the mRNA production system and the tubing of the TFF system, preferably feeding the tubing that circulates the feed from the reservoir to the filtration device. Optionally, the mRNA production system may be fluidly connected to the tubing that circulates the filtrate from the filtration device to the reservoir. It is noteworthy that the term "tubing" as used herein may refer to a tube, pipe, or a combination thereof. Furthermore, the connecting tubing of the mRNA production system may include an auxiliary pump. The auxiliary pump facilitates automatic regulation of the rate of fluid transfer through the connecting tubing.

[0118] The mRNA molecules to be purified according to the method of the invention can be obtained, for example, by culturing cells for cellular mRNA molecule amplification or preferably by in vitro transcription (IVT). In the case of obtaining mRNA molecules from cells, the cells, such as *E. coli* cells, can be cultured in a fermenter under cell-specific culture conditions suitable for mRNA molecule production. Preferably, the parameters of the culture conditions are automatically controlled, for example, by providing appropriate amounts of culture medium, gas, and / or buffer. Therefore, the mRNA production system may include a reaction vessel and at least one additional vessel, wherein the reaction vessel is a fermenter, and the at least one additional vessel contains, for example, a suitable culture medium, gas, and / or buffer solution. Optionally, if the mRNA molecules to be purified are obtained by IVT, an IVT template (e.g., a corresponding DNA template for IVT of the target mRNA molecule to be purified), and an IVT reagent (such as an IVT enzyme, e.g., T7 RNA polymerase) and an NTP mixture are required. Therefore, the mRNA production system may include a reaction vessel and at least one additional vessel, wherein the at least one additional vessel contains at least one of the IVT reagents.

[0119] Therefore, the reaction vessel is preferably fluidly connected to at least one other vessel, preferably at least a first other vessel and a second other vessel.

[0120] The first additional container may contain at least one of the IVT reagents and is preferably fluidly connected to the reaction vessel via connecting tubing and second and third valves. The second valve is preferably located between the reaction vessel and the connecting tubing, and the third valve is located between the connecting tubing and the first additional container. By closing the first valve and opening the second and third valves, mRNA molecules can be generated, for example, via IVT, preferably within the reaction vessel. By closing the third valve and opening the first and second valves, the generated mRNA molecules can be transferred from the mRNA production system to the TFF system.

[0121] The second additional container may contain a solution for precipitating mRNA molecules, wherein the solution preferably contains ammonium acetate (NH4OAc), for example, 5M NH4OAc. Preferably, the second additional container is fluidly connected to connecting tubing via a fourth valve. By opening the second and fourth valves and closing the first and third valves, the target molecules can preferably be precipitated in the reaction vessel or, if the reaction vessel is a fermenter, in the second additional container. Then, after opening the first valve, according to the method of the invention, the precipitated mRNA molecules in the suspension can be transferred from the mRNA production system to the TFF system for mRNA molecule purification.

[0122] therefore, Figure 2 The system shown includes a TFF system with a reservoir, preferably a continuous percolation system. Preferably, the reservoir is fluidly connected to at least three additional containers, namely at least a third, fourth, and fifth additional container, via at least a fifth valve, a sixth valve, and a seventh valve, respectively. According to the invention, the third additional container may contain a first solution, the fourth additional container contains a second solution, and the fifth additional container contains a third solution. If the second and fourth solutions are different from each other, the reservoir is preferably fluidly connected, for example, via an eighth valve, to a sixth additional container containing the fourth solution. Thus, preferably, the third additional container contains the first solution, wherein the first solution contains NH4OAc for purifying precipitated mRNA molecules, such as 2.5M NH4OAc; the fourth additional container contains water, such as water for injection (WFI) as the second solution; and the fifth additional container contains the third solution, wherein the third solution contains EDTA as a chelating agent and optionally MOPS. If the fourth solution is not water, the sixth additional container preferably contains sodium chloride and / or citrate. Furthermore, an auxiliary pump may be present to automatically regulate the rate of fluid transfer from any of the at least three additional containers to the reservoir.

[0123] Therefore, the reservoir preferably contains precipitated mRNA molecules in a suspension, which have been transferred from the mRNA production system through the first valve by opening it for a predetermined amount of time. A first solution can be added to the precipitated mRNA molecules in the suspension by opening the fifth valve for a predetermined amount of time, and then at least one round of continuous TFF can be performed to transfer the mixture to a filtration device, wherein the molecular weight cutoff of the filter membrane is preferably between 300 kDa and 0.65 μm. Thus, the suspension containing the precipitated mRNA molecules can be purified, for example, from components such as IVT mixtures of proteins, salts, and / or NTPs, according to step (Ia) of the method disclosed herein. The suspension containing the purified precipitated mRNA molecules is preferably transferred back to the reservoir as a retentate. To perform step (Ib) and thus wash and dissolve the purified precipitated mRNA molecules obtained from step (Ia), the sixth valve is opened for a predetermined amount of time. Thus, a second solution can be added to the suspension containing the precipitated mRNA molecules in the reservoir. By performing at least one round of continuous TFF using a filtration device, preferably a filter membrane with a molecular weight cutoff between 1 kDa and 0.65 μm, NH4OAc contained in the first solution can be removed. A third solution can then be added to the washed and dissolved mRNA molecules in the reservoir by opening the seventh valve for a predetermined amount of time. According to step (IIa) of the method disclosed herein, performing at least one round of continuous TFF using a filtration device, wherein the molecular weight cutoff of the filter membrane is preferably 50 kDa, more preferably 100 kDa, can effectively remove ineffective mRNA molecules and mRNA molecule hydrolysis products. To wash the purified mRNA molecules obtained from step (IIa), for example by removing components of the third solution, step (IIb) can then be performed. Therefore, by opening the sixth or eighth valve for a predetermined amount of time to add water or a fourth solution containing sodium chloride and / or citrate to the purified mRNA molecules, at least one round of continuous TFF is performed using a filtration device containing a filter membrane preferably with a molecular weight cutoff of 50 kDa.

[0124] Optionally, an additional step is performed between steps (Ib) and (IIa). Thus, the TFF system may further include a seventh additional container, preferably fluidly connected to, for example, a reservoir via a ninth valve. This seventh additional container may contain a fifth solution, wherein the fifth solution preferably contains at least a chelating agent of the third solution, preferably EDTA, at a concentration as high as that of the third solution. The fifth solution can be added to the mRNA molecules dissolved in the second solution by opening the ninth valve for a predetermined amount of time after performing step (Ib). This has the advantage of increasing the throughput and reproducibility of the method of the invention by reducing the time required to adjust the concentration of at least the chelating agent in the TFF system to the corresponding concentration as specified herein for the third solution. Furthermore, an auxiliary pump may be present to automatically regulate the rate of fluid transfer from the seventh additional container to the reservoir (not shown).

[0125] Optionally, the mRNA molecule generation system may further include a temporary container, preferably fluidly connected to the mRNA molecule generation system via a temporary valve. The temporary container may be a preferably sterile bag. By opening the first valve and the temporary valve for a predetermined amount of time, at least a portion of the suspension or solution containing mRNA molecules can be transferred from the TFF system to the mRNA molecule generation system and / or from the mRNA molecule generation system to the TFF system. This is advantageous for storing at least a portion of the suspension or solution preferably for a predetermined amount of time. Thus, at least said portion of the suspension or solution can undergo another round of purification, such as steps (Ia) and (Ib), steps (IIa) and (IIb), and / or combinations thereof. Furthermore, during the storage of at least a portion of the suspension or solution in the temporary container, the TFF system and / or the mRNA molecule generation system can be cleaned, washed, and / or sterilized with water and / or a buffer. Optionally or alternatively, the temporary container can be used to obtain a solution or suspension contained within the temporary container, preferably a solution or suspension containing at least a portion of purified mRNA molecules. Optionally, the system may further include a filter (not depicted) for an additional filtration step. The filter may include a filter membrane for the final filtration step with a pore size of less than 0.3 μm (e.g., 0.22 μm), and can therefore be used for the final filtration of suspensions containing purified mRNA molecules, such as those obtained from a temporary container.

[0126] Modifying the mRNA molecule to be purified may be advantageous, for example, by dephosphorylation, adding a 5' cap and / or a 3' poly(A) tail. Specifically, steps (Ia) to (IIb) are preferably performed at least once before the 3' polyadenylation of the mRNA molecule, and steps (Ia) to (Ib) are preferably performed at least once before the 5' capping. Optionally, the obtained mRNA molecule may be dephosphorylated after at least the first step (Ia) and at least the first step (Ib), followed by at least the second step (Ia) and at least the second step (Ib). Therefore, the system may further include one or more of the following (not depicted): a second ' additional container, preferably containing the reagents required for capping, and preferably fluidly connected to the connecting tubing of the mRNA production system via a fourth ' valve; a second " additional container, preferably containing the reagents required for dephosphorylation, and preferably fluidly connected to the connecting tubing of the mRNA production system via a fourth " valve; and a second "' additional container, preferably containing the reagents required for enzymatic addition of a poly(A) tail (e.g., at least a poly(A) polymerase), and preferably fluidly connected to the connecting tubing of the mRNA production system via a fourth "' valve. By opening the first valve and the temporary valve for a predetermined amount of time, at least a portion of the corresponding suspension containing the mRNA molecules to be purified can be transferred from the TFF system to the temporary container of the mRNA production system. By closing the first valve and opening the fourth ', fourth ", and / or fourth "' valves, capping, dephosphorylation, and / or polyadenylation of the mRNA molecules can preferably be performed in the temporary container. Optionally or additionally, if the reaction vessel is not a fermenter, a reaction vessel can be used instead of the temporary container, and thus the second valve is opened instead of the temporary valve. By closing the fourth', fourth", and / or fourth"' valves and opening the first valve, a suspension containing modified mRNA molecules can be transferred from the mRNA molecule production system to the TFF system.

[0127] It is worth noting that the filtration device may include more than one automatically replaceable filter membrane. Preferably, the filtration device includes more than one filtration device unit, for example, each filtration device unit includes a filter column, and mRNA molecules are transferred to at least one of the units having a filter membrane having the molecular weight cutoff specified above for the respective method steps.

[0128] In addition, such as Figure 2The system described may include an output device, such as an output container fluidly connected to a reservoir, for example, via a tenth valve. Preferably, the output container is a sterile, preferably disposable bag or fluidly connected to the bag for storing at least a portion of a solution or suspension containing purified mRNA molecules. The purified mRNA molecules can be obtained by opening the tenth valve. Optionally, in the (final) step (IIb), the purified mRNA molecules may be contained in the permeate rather than the retentate. Optionally, the system may further include a filter (not depicted) for an additional filtration step. The filter may include a filter membrane for the final filtration step with a pore size less than 0.3 μm (e.g., 0.22 μm), and can therefore be used for the final filtration of the suspension containing purified mRNA molecules (e.g., permeate) or obtained from the output container. Furthermore, an auxiliary pump (not shown) may be present to automatically regulate the rate of fluid transfer from the reservoir to the output device.

[0129] The system may further include preferably automatically controlled cooling and / or heating elements (not shown). These cooling and / or heating elements may be at least partially positioned around one or more of tubing, containers (e.g., reaction vessels, temporary containers, additional containers, and / or reservoirs) and / or filtration devices. Preferably, the cooling element is at least partially positioned around the reservoir and / or filtration device. Therefore, the method according to the invention can be performed by controlling the corresponding cooling and / or heating elements at a temperature between 0°C and 25°C, preferably between 2°C and 8°C for most steps. Thus, a large quantity of purified mRNA molecules can be obtained.

[0130] Preferably, the system may further include a pH control element (not shown), which is preferably automatically regulated. The element may include a device (e.g., a pH meter) for measuring the pH of the solution and / or suspension, and optionally a pH control container, wherein the latter is preferably fluidly connected to at least one of the containers (e.g., a reaction vessel, a temporary container, another container, and / or a reservoir). Thus, the pH of the solution or suspension in the respective container can be measured and / or controlled. Additionally or optionally, the pH of the permeate can be measured, preferably continuously. Therefore, the mRNA purification process can be monitored and quality checked.

[0131] Furthermore, the permeate can preferably be used to measure nucleic acid concentration and / or purity. This can be done spectrophotometrically, for example, by measuring the absorbance of molecules containing mRNA molecules in the UV range of about 260 and 280 nm. For example, the quotient of a value obtained at about 260 nm and a value obtained at about 280 nm can indicate the purity of the corresponding nucleic acid in the solution or suspension. For example, a ratio of about 1.8 to about 2.0 can indicate high purity DNA or RNA molecules, while a ratio of, for example, less than 1.8 can indicate impurities, such as proteins. Thus, information about, for example, the composition of the permeate, including the concentration of mRNA molecules, can be obtained. Optionally or alternatively, the concentration of mRNA molecules can be determined based on preferably continuous conductivity measurements. Therefore, the system may further include preferably automatically controlled elements (not shown) for nucleic acid quantification, such as a spectrometer and / or spectrophotometer, such as a nanodrop, and / or a device for performing conductivity measurements.

[0132] Any or all of the containers (e.g., reaction containers, temporary containers, additional containers, and / or storage containers) can be positioned on their respective balances. Therefore, the weight of each container can be measured, as can the weight of the solution or suspension containing the mRNA molecules to be purified or purified in each container, and the appropriate amounts of each added solution or component, such as the first solution, second solution, third solution, fourth solution, and / or fifth solution and / or IVT reagent, can be determined. Thus, the mRNA production and / or purification process can be optimized and automated.

[0133] To ensure automated regulation of the mRNA production and / or purification process, the system preferably includes control devices suitable for controlling the aforementioned apparatus, such as valves, (auxiliary) pumps, heating and / or cooling elements, elements for pH regulation, elements for nucleic acid quantification, devices for performing conductivity measurements, and / or balances. In this document, the term "system" is understood to mean "apparatus" and can be used interchangeably with it.

[0134] Regarding the connecting tubing for the mRNA molecule production system, the connecting tubing can be as follows: Figure 2 The depicted pipework, for example, fluidly connects a reaction vessel to another vessel in series. Alternatively, the pipework may refer to two or more pipes connecting the respective vessels. Thus, the pipework may, for example, refer at least to a first pipe fluidly connecting the reaction vessel to a first additional vessel and a second pipe fluidly connecting the reaction vessel to a second additional vessel. Preferably, one or more of the two or more pipes include a valve located between the respective vessel and optionally an auxiliary pump.

[0135] Any component of the above-described system can be a single-use component. Preferably, one or more of the containers (e.g., temporary containers, reaction containers, and / or other containers) and / or one or more of the (temporary) valves can be respective single-use containers and valves. Preferably, the temporary containers and / or reaction containers are respective single-use containers. Optionally, the entire system can be a single-use system, for example, for generating and purifying specific mRNA molecules. This has the advantage that the corresponding mRNA molecules can be generated and purified under aseptic conditions, while avoiding the time-consuming and costly washing, cleaning, and / or sterilization steps that would otherwise be required to reduce the risk of contamination. Therefore, preferably, one or more components of the above-described system are respective single-use components.

[0136] like Figure 2 The system illustrated exemplarily has several advantages. In such closed systems, the risk of contamination is minimized, for example by using RNase, while flux can be increased because continuous TFF can be used to avoid membrane clogging. Furthermore, such systems are easy to operate, for example by pump-controlled fluid transfer, and can even be fully automated, for example by automatically controlling (auxiliary) pumps and / or valves. Moreover, they are easily scalable and well-adjustable according to specific customer requirements. Therefore, according to the disclosed method, using... Figure 2 The system shown can perform high-throughput purification of mRNA molecules in an efficient and automated manner.

[0137] The present invention further relates to a method for producing a pharmaceutical composition, the method comprising: (a) purifying mRNA molecules according to the method described above for purifying mRNA molecules; and (b) formulating the mRNA molecules thus obtained into a pharmaceutical composition. This is of particular importance for the application of purified mRNA molecules in a pharmaceutical setting, such as administering mRNA molecules to allow the synthesis of proteins whose deficiency or defect is associated with disease and / or whose presence in cells is necessary or beneficial.

[0138] Preferably, the amino acid sequence that can be translated from the mRNA molecule purified according to the invention has an essential or beneficial function in or near the cell, for example, an amino acid sequence in or near the cell whose absence or defective form induces illness or disease, which can be alleviated or prevented; or an amino acid sequence in or near the cell that can promote processes beneficial to the body. The encoded amino acid sequence can be the complete amino acid sequence or a functional variant thereof. Further, the encoded amino acid sequence can act as a factor, inducer, regulator, stimulant, or enzyme, or a functional fragment thereof, wherein this amino acid sequence is an amino acid sequence whose function is required to remedy a disorder, specifically a metabolic disorder, or to initiate processes in the body, such as the formation of new blood vessels, tissues, etc. Here, a functional variant is understood to mean a fragment in the cell that can perform the function of an amino acid sequence, in which the function of the amino acid sequence is essential, or whose absence or defective form is pathogenic.

[0139] Preferably, such amino acid sequences are beneficial for applications in supplemental or medical purposes to produce or regenerate physiological functions resulting from the biosynthesis of suboptimal amino acid sequences, and thus advantageously influence the course of disease directly or indirectly. Disorders with a known genetic basis include, for example, cystic fibrosis, hemophilia, hypertension, elevated cholesterol levels, cancer, neurodegenerative disorders, and psychosis. An online catalog is available on the ONIM (Online Mendelian Inheritance in Man) website (http: / / onim.org), which currently contains 22,993 entries for human genes and genetic disorders, along with descriptions of their corresponding genes and phenotypes; each sequence is available from the Uniprot database (http: / / www.uniprot.org). As a non-limiting example, Table 2 below lists some congenital diseases and their corresponding genes (one or more). Due to the high degree of interaction in cell signaling pathways, mutations in a gene can cause a variety of pathogenic symptoms; only characteristic symptoms of such pathogenic symptoms are listed in Table 2.

[0140] Proteins may also have the potential to induce immunogenic responses, acting as antigens, for example. Such proteins are suitable for supplemental or medical purposes, including vaccination.

[0141] Table 2

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150] The same applies to the steps for purifying mRNA molecules, as described above in conjunction with the method for purifying mRNA molecules according to the present invention, wherein the method comprises the following steps: (Ia) purifying the precipitated mRNA molecules from a suspension containing the precipitated mRNA molecules using a first solution; (Ib) washing and dissolving the purified precipitated mRNA molecules obtained from step (Ia) using a second solution; (IIa) purifying the mRNA molecules from the dissolved mRNA molecules obtained from step (Ib) using a third solution containing a chelating agent (such as EDTA); followed by (IIb) washing the purified mRNA molecules obtained from step (IIa) using a fourth solution, wherein steps (Ia) to (IIb) are performed using tangential flow filtration.

[0151] Regarding the steps of formulating the thus obtained purified mRNA molecules into a pharmaceutical composition, these steps may include the addition of sodium chloride or citrate in step (IIb) and in the final step (IIb) (in the case of more than one step (IIb)) when the mRNA molecules are purified using water as a fourth solution. This is advantageous when the purified mRNA molecules are not obtained in a solution already containing sodium chloride or citrate, or when the purified mRNA molecules are obtained in a solution already containing sodium chloride or citrate but at a concentration different from that desired for administration. In the latter case, the method may further include the step of determining the corresponding concentration and adjusting it if necessary. Preferably, the purified mRNA molecules are contained in a solution further containing a favorable concentration of sodium chloride or citrate for administration—by using a fourth solution containing the corresponding concentration of said sodium chloride or citrate in the (final) step (IIb) of the method for purifying mRNA molecules, with a pH between 3 and 6, preferably between 4 and 5.

[0152] Formulating the obtained purified mRNA molecules into a pharmaceutical composition may include the step of adding a pharmaceutically acceptable carrier. The purified mRNA molecules are preferably contained in an effective amount, i.e., an amount sufficient to induce a detectable therapeutic response in a subject to whom the pharmaceutical composition is to be administered. The purified mRNA molecules and / or the pharmaceutical composition may be in sterile aqueous or non-aqueous solutions, suspensions, emulsions, creams, and suppositories, but may also be in the form of powders, tablets, or aerosols.

[0153] As used herein, the term "pharmaceutically acceptable carrier" refers to a compound, material, ingredient, and / or composition that, to the extent of sound medical judgment, is suitable for use in contact with human and animal tissues without causing excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio. Therefore, a pharmaceutically acceptable carrier is, in consideration of dosage, adsorption, solubility, or pharmacokinetics, an inactive substance formulated with a pharmaceutically active substance to facilitate its processing.

[0154] Examples of suitable pharmaceutically acceptable carriers are those known in the art and include phosphate-buffered saline solutions, buffers, water, emulsions (such as oil / water emulsions), various types of wetting agents, and sterile solutions. Specifically, aqueous carriers include water, alcoholic solutions / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and organic esters (such as ethyl oleate). Further examples of pharmaceutically acceptable carriers include, but are not limited to: saline, Ringer's solution, etc. Dextran solution, citrate, phosphate, and other organic acids; anti-charge ions that form salts, such as sodium and potassium; low molecular weight (>10 amino acid residues) polypeptides; proteins, such as serum albumin, or gelatin; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as histidine, glutamine, lysine, asparagine, arginine, or glycine; carbohydrates, including glucose, mannose, or dextrin; monosaccharides; disaccharides; other sugars, such as sucrose, mannitol, trehalose, or sorbitol; chelating agents, such as EDTA. TA; nonionic surfactants, such as polyoxyethylene sorbitan monolaurate, propylene glycol, Pluronics, or polyethylene glycol, commercially available under the trade name Tween; antioxidants, including methionine, ascorbic acid, and tocopherol; and / or preservatives, such as octadecyl dimethyl benzyl ammonium chloride; hexamethyl chloride; benzalkonium chloride; benzyl chloride; phenol, butanol, or benzyl alcohol; alkyl esters of p-hydroxybenzoate, such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol). Suitable pharmaceutically acceptable carriers and their formulations are described in more detail in Remington's Pharmaceutical Sciences, 17th edition, 1985, Mack Publishing Co. In addition, preservatives, stabilizers, and other additives may be present, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, nanosystems, or liposomes.

[0155] The present invention further relates to pharmaceutical compositions comprising mRNA molecules purified and manufactured according to any of the corresponding methods disclosed herein. The pharmaceutical compositions are advantageous for regulating and / or enhancing the translation of amino acid sequences (such as proteins) in the cells of a subject to which the pharmaceutical compositions are administered, wherein the presence of said amino acid sequences (such as proteins) is beneficial and / or necessary for the subject in the context of, for example, a disease.

[0156] The same applies to pharmaceutical compositions, mRNA molecules, their purification, and the formulation of pharmaceutical compositions, as set forth in the features and advantages described above within the context of the corresponding embodiments described above.

[0157] The pharmaceutical compositions of the present invention can be administered in a variety of forms and routes of administration known to those skilled in the art, such as injection, inhalation, nebulizer, cream, foam, gel, lotion, and ointment. The dosage and duration of action depend on the function that the purified mRNA molecule is intended to achieve and must be intentionally modulated in each case. The duration of action will be as long as possible, for example, if the purified mRNA molecule is used as a chronic treatment for a disease caused by a defective gene and accompanied by other indications, it can be modulated to a specific time window. Furthermore, the purified mRNA molecule, formulated into a suitable pharmaceutical composition, can be administered systemically.

[0158] Figure 1 Overview of a continuous tangential flow filtration (TFF) system employing circulating mRNA molecules according to the disclosed method. The mRNA molecules are suspended in step (Ia), dissolved in step (Ib), and in solution in steps (IIa) and (IIb), respectively.

[0159] Figure 2 : An overview of an exemplary system for purifying mRNA molecules according to the disclosed method (with the locations of valves, (auxiliary) pumps and / or (additional) containers depicted exemplary).

[0160] Figure 3 After purifying the corresponding in vitro transcription (IVT) mixtures under RT according to steps (Ia) and (Ib), the TFF cutoff containing unmodified mRNA molecules encoding tdTomato was subjected to SDS-PAGE, followed by colloidal Coomassie staining. Lane 1: Enzyme mixture in ammonium acetate (NH4OAc) as a control; Lane 2: Enzyme mixture after priming the TFF system; Lane 3: Enzyme mixture after TFF in nuclease-free water; Lane 4: IVT mixture; Lane 5: IVT mixture after priming the TFF system; Lane 6: IVT mixture after TFF in nuclease-free water; Lane 7: Enzyme mixture in nuclease-free water as a control. The enzyme mixture consisted of an RNase inhibitor, T7 RNA polymerase, inorganic pyrophosphatase, and DNase I.

[0161] Figure 4After purifying the corresponding in vitro transcription (IVT) mixtures under RT according to steps (Ia) and (b), the TFF cutoff containing unmodified mRNA molecules encoding tdTomato was subjected to SDS-PAGE, followed by colloidal Coomassie staining. Lane 1: Enzyme mixture in nuclease-free water as a control; Lane 2: IVT mixture before TFF; Lane 3: IVT mixture after perfusion of the TFF system; Lane 4: IVT mixture after TFF in nuclease-free water; Lane 5: IVT mixture after TFF in nuclease-free water (the respective mixtures were concentrated 2.5-fold after percolation with 2.5M ammonium acetate and nuclease-free water to effectively detect protein removal). The enzyme mixtures consisted of an RNase inhibitor, T7 RNA polymerase, inorganic pyrophosphatase, and DNase I.

[0162] Figure 5 After purifying the corresponding in vitro transcription (IVT) mixtures according to steps (Ia) and (b) at 4°C, the TFF cutoff containing unmodified mRNA molecules encoding tdTomato was subjected to SDS-PAGE, followed by colloidal Coomassie staining. Lane 1: Enzyme mixture in nuclease-free water as a control; Lane 2: IVT mixture before TFF; Lane 3: IVT mixture after one wash volume (equal to the initial feed volume); Lane 4: IVT mixture after TFF in nuclease-free water; Lane 5: IVT mixture after TFF in nuclease-free water (the respective mixtures were concentrated 2.5-fold after percolation with 2.5M ammonium acetate and nuclease-free water to effectively detect protein removal). The enzyme mixtures consisted of an RNase inhibitor, T7 RNA polymerase, inorganic pyrophosphatase, and DNase I.

[0163] Figure 6 A) Western blot of the translated hCFTR protein in HEK293 cells after transfection with hCFTR mRNA purified by TFF using Lipofectamine Messenger Max and hCFTR mRNA purified by ammonium acetate precipitation followed by 70% ethanol washing. The Hsp90 band is shown as a housekeeper. Untransfected cells were used as a negative control. B) The expressed hCFTR was quantified by densitometry using Image Lab software and normalized relative to HSP90 protein. Untransfected cells (UT) were used as a negative control.

[0164] Figure 7: The residual amount of non-hCFTR-incorporated mRNA molecules (internal reference mRNA molecules) compared to the amount of hCFTR target mRNA molecules after varying wash volumes, expressed as a percentage. Tangential flow filtration was performed at RT.

[0165] Figure 8 The percentage of non-hCFTR-incorporated mRNA molecules remaining after varying wash volumes, compared to the amount of hCFTR target mRNA molecules. Tangential flow filtration was performed at 4°C.

[0166] Figure 9: Capillary gel electrophoresis of tdTomato mRNA incorporating different DNA oligonucleotides (15 nt, 25 nt, and 120 nt) before (A) and after (B) TFF purification at 4°C using a fragment analyzer. The DNA oligonucleotides included were 25 nt antisense DNA oligonucleotides. A lower biomarker was provided in the fragment analyzer kit as an internal standard (15 nt long RNA oligonucleotide) to normalize the retention time of the peak during each capillary run.

[0167] Figure 10 Representatively, permeate flux was measured at different transmembrane pressure setpoints.

[0168] Figure 11: Capillary gel electrophoresis of hCFTR mRNA incorporating 25 nt and 120 nt long DNA oligonucleotides and a 256 nt long GLP-1 mRNA molecule using a fragment analyzer before purification according to Method 1(A), after steps (Ib)(B), (IIa)(C), and (IIb)(D) at RT. A lower biomarker is the internal standard (15 nt long RNA oligonucleotide) provided in the fragment analyzer kit for normalizing the peak retention time during each capillary run.

[0169] Figure 12: Capillary gel electrophoresis of hCFTR mRNA incorporating 25 nt and 120 nt long DNA oligonucleotides and a 256 nt long GLP-1 mRNA molecule using a fragment analyzer before (A) and after (B) purification according to Method 2 at RT. The lower biomarker is an internal standard (15 nt long RNA oligonucleotide) provided in the fragment analyzer kit for normalizing the retention time of the peak during each capillary run.

[0170] Other aspects and advantages of the invention will be described in the following examples, which are given for illustrative purposes and not for limitation. Every publication, patent, patent application, or other document referenced in this application is hereby incorporated by full reference. Example

[0171] The methods and materials used in this disclosure are described herein; other suitable methods and materials known in the art may also be used. These materials, methods, and examples are illustrative only and are not intended to be limiting.

[0172] The abbreviations used in this article and their corresponding descriptions are listed in Table 3.

[0173] Table 3

[0174]

[0175]

[0176] Materials and Methods

[0177] Materials, apparatus, software and testing systems used

[0178] The materials are listed in Table 4.

[0179] Table 4

[0180]

[0181]

[0182] The devices are listed in Table 5.

[0183] Table 5

[0184] Device supplier KR2i TFF System Spectrum Laboratories, Inc. Fragment Analyzer Advanced Analytical Chemidoc XRS BioRad Laboratories Novex Bolt Mini Gel Tank Life technologies

[0185] The software is listed in Table 6.

[0186] Table 6

[0187] software Provider ProSize 3.0 Advanced Analytical Excel Plug In Spectrum Laboratories, Inc. MS Excel Microsoft Image Lab BioRad Laboratories Open Lab Chem Station Agilent

[0188] The testing system is listed in Table 7.

[0189] Table 7

[0190] Test System Species variety HEK 293 people NA

[0191] Purification of IVT mixtures via TFF steps (Ia) and (Ib)

[0192] In the following text, an in vitro transcription (IVT) mixture was used, which contained an unmodified, in vitro transcribed unmodified tdTomato target mRNA molecule of 1644 nucleotides (nt) in length. Additionally, an enzyme mixture containing T7 RNA polymerase, inorganic pyrophosphatase, an RNase inhibitor, and DNase I was used.

[0193] RNA precipitation

[0194] Precipitate both the IVT mixture and the enzyme mixture separately with an equal volume of ice-cold 5M NH4OAc (pH 7) to achieve a final NH4OAc concentration of 2.5M, and incubate on ice for at least 30 minutes. Prior to TFF, dilute the respective mixtures 1:1 with 2.5M NH4OAc (pH 7) to achieve a final mRNA concentration of approximately 0.5 mg / ml. Connect the IVT or enzyme mixture to the TFF system and initially perfuse the TFF system for 10 minutes by circulating the IVT mixture at 50 ml / min with the osmotic clamp closed.

[0195] Step (Ia): Removal of proteins, nucleotides, and salts

[0196] The mixture was percolated using a 500 kDa MWCO mPES filter column at a constant TMP of approximately 200-300 mbar at 50 ml / min. The mixture was then percolated with 10 wash volumes of 2.5 M NH4OAc at pH 7. This step effectively removes enzymes, nucleotides, and buffer components from in vitro transcription. Step (Ia) can be used to remove any other proteins and / or enzymes from any other intermediate generation steps (e.g., dephosphorylation, post-capping, polyadenylation, etc.). For some enzymes (e.g., poly(A) polymerase, which binds to the mRNA molecule of interest with high affinity), a washing agent (e.g., SDS, LDS, etc.) can be added to an ammonium acetate buffer at pH 7. In the case of poly(A) polymerase used for polyadenylation, the subsequent step (Ia) is preferably performed at a temperature between 20°C and 30°C, preferably between 23°C and 27°C, and more preferably at 25°C. Such temperatures are beneficial for the efficient removal of poly(A) polymerase.

[0197] Step (Ib): Remove NH4OAc from step (Ia)

[0198] To remove NH4OAc and dissolve mRNA molecules, a 100 kDa MWCO mPES filter column was used, followed by percolation with 10 wash volumes of nuclease-free water at a flow rate of 50 ml / min and approximately 200–300 mbar TMP. Alternatively, a 50 kDa MWCO mPES filter column may be used, depending on the size of the mRNA molecules.

[0199] To investigate the purification efficiency of steps (Ia) and (Ib), the TFF trap containing mRNA molecules can be sampled before and after TFF (i.e., step (Ib)) and analyzed, for example, using UV measurement, fragment analyzer, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by colloidal Coomassie staining.

[0200] like Figures 3 to 5 As shown, by applying steps (Ia) and (Ib) as described above, enzymes can be effectively removed from mRNA molecules. Thus, mRNA molecules are retained by the TFF column, while enzymes and / or proteins are effectively removed. Smear peak analysis showed a smear pre-peak of 4.7% before TFF purification, with a deviation of +1.3% for TFF purification at 4°C and +1.8% after TFF purification at RT. Therefore, no mRNA degradation was observed.

[0201] Purification of precipitated and dissolved mRNA was performed using TFF steps (IIa) and (IIb).

[0202] In the following text, the precipitated and dissolved mRNA was used for further purification.

[0203] Testing the effects of different filter membranes and EDTA on mRNA delivery

[0204] The transfer of mRNA molecules through different filter membranes with varying pore sizes was tested using either nuclease-free water or water with nuclease-free water plus 10 mM EDTA. Four mPES columns with molecular weight cutoffs (MWCO) of 500 kDa, 300 kDa, 100 kDa, and 50 kDa were tested. Transmembrane pressure (TMP) was adjusted using the retentate clamp on the TFF system, with TMP maintained at 40 mbar for columns with MWCOs of 500 kDa and 50 kDa, and at 100 mbar for columns with MWCOs of 100 kDa and 300 kDa. The main pump flow rate was set to 15 ml / min, and TFF was performed at room temperature. The initial mRNA concentration in the feed was 0.1 mg / ml, and the mRNA concentrations in the retentate and permeate were measured using UV measurements. Each column was tested with 10 times the wash volume of the original sample volume.

[0205] In the absence of EDTA, mRNA molecules were retained by a test column with an MWCO of 500 kDa. It was assumed that smaller pore sizes (i.e., 300 kDa, 100 kDa, and 50 kDa) would not allow mRNA molecules to pass through, and therefore no further testing was performed in the absence of EDTA.

[0206] In the presence of EDTA, mRNA molecules unexpectedly migrated through the pores of a 500 kDa MWCO filter, and a 300 kDa MWCO filter also partially lost mRNA molecules. However, in the presence of 10 mM EDTA, mRNA molecules were successfully retained using both 100 and 50 kDa MWCO filters. Therefore, in the experiments shown below, a 100 kDa MWCO column was chosen to filter mRNA molecules.

[0207] It should be noted that sporadic precipitation of mRNA molecules was observed in some cases after filtration with 10 mM EDTA. However, this precipitation can be effectively prevented by using a buffer containing 40 mM MOPS and 10 mM EDTA.

[0208] Preparation of 40 mM MOPS and 10 mM EDTA percolation buffer

[0209] Prepare a 1M 3-(N-morpholino)propanesulfonic acid (MOPS) buffer, wherein the MOPS are dissolved in nuclease-free water. Then adjust the pH of the 1M MOPS buffer to pH 7 using 32% NaOH. Mix the resulting pH 7 1M MOPS buffer with 0.5M EDTA and nuclease-free water to finally obtain a percolation buffer containing 40 mM MOPS and 10 mM EDTA.

[0210] Determine the volume of wash buffer to remove nucleic acid oligonucleotides.

[0211] The efficiency of the TFF process, i.e., the minimum number of wash cycles required to completely remove impurities (such as nucleic acid oligonucleotides representing invalid transcripts and / or hydrolysis products), strongly depends on the repulsion of molecules by the membrane filter and its pore size. Therefore, the corresponding role of wash buffer volume was investigated to determine the number of wash cycles required to remove incorporated nucleic acid oligonucleotides from precipitated and dissolved mRNA containing the mRNA molecule of interest.

[0212] For this experiment, the TFF flow rate was set to 15 ml / min, and the TMP was kept constant at approximately 40 mbar using a 100 kDa MWCO mPES filter column. In a total feed volume of 5 ml, 500 μL of mRNA molecules were incorporated with 2.5% (m / m) of a 10 nt DNA oligonucleotide, 2.5% (m / m) of a 50 nt DNA oligonucleotide, and 5% (m / m) of a 120 nt DNA oligonucleotide. After washing with 5x, 10x, 15x, and 20x wash volumes of the original feed volume containing 40 mM MOPS and 10 mM EDTA, samples were aspirated for reversed-phase HPLC analysis. Before sample aspiration, the permeate clamp was closed and the retentate valve was opened to allow the retentate to circulate at 50 ml / min for 5 min. For each wash cycle, 100 μL of sample was aspirated using a sterile syringe and kept on ice until analysis. TFF was performed at room temperature. The samples were analyzed using reversed-phase HPLC, where the area detected at 260 nm represents the relative amount of DNA oligonucleotides in the sample. The corresponding area before TFF (control) was set to 100% oligonucleotides.

[0213] In all cases, nucleic acid oligonucleotides were not detected after washing with 5x, 10x, 15x, and 20x wash volumes, respectively. Therefore, the results indicate that nucleic acid oligonucleotides were no longer detectable in the retentate after a 5x wash volume of wash buffer. The minimum wash volume of 10x wash buffer needed to be determined to be sufficient for removing nucleic acid oligonucleotides from mRNA molecules.

[0214] Determine the washing volume of nuclease-free water used to remove EDTA.

[0215] Since DNA oligonucleotides are removed via TFF using a wash buffer (i.e., a percolation buffer containing 40 mM MOPS and 10 mM EDTA), the subsequent filtration step facilitates the exchange of the wash buffer with nuclease-free water. Therefore, experiments were conducted to determine the amount of wash cycles required to remove the wash buffer from the mRNA molecules. Following previous experiments, a 100 kDa MWCO mPES filter column was used to percolate a feed solution containing mRNA molecules and a total volume of approximately 5 ml, which had previously been filtered with 20x wash volumes of percolation buffer, using nuclease-free water at a flow rate of 15 ml / min and a constant TMP of 40 mbar. Samples were taken after washing with 5x, 10x, 15x, and 20x wash volumes of the original feed volume using nuclease-free water for reversed-phase HPLC analysis. To quantify the amount of residual EDTA after each washing cycle with nuclease-free water, a percolation buffer containing 40 mM MOPS and 10 mM EDTA was titrated and a calibration curve was recorded (see Table 6; MOPS-EDTA calibration curve: log(y) = 0.6467log(x) + 1.9128; r = 0.99462; r 2 =0.99877; Curve model: log / log). Since MOPS buffer alone does not show an absorption signal at 260 nm, the concentrations described in Tables 8 and 9 correspond to the concentrations of EDTA. Experiments were conducted at 22 °C RT. Table 9 shows the data after EDTA removal following each wash cycle.

[0216] As shown in Table 9, the amount of EDTA showed a gradual decrease in peak area detected by reversed-phase HPLC at 260 nm after increasing the wash volume, indicating that a minimum wash volume of 10x with nuclease-free water was necessary for partial removal of residual EDTA.

[0217] Table 8

[0218]

[0219] Table 9

[0220]

[0221] The parameters measured in the test

[0222] In previous experiments conducted at RT, the minimum number of wash cycles required to remove DNA oligonucleotides using percolation buffer in step (IIa) and the minimum number of wash cycles required to remove residual EDTA using nuclease-free water in step (IIb) were determined. To test the parameters to be determined, 500 μg of mRNA was incorporated into a total feed volume of 5 ml with 10 nt long nucleic acid oligonucleotides comprising 2.5% of the target mRNA molecule volume, 50 nt long DNA oligonucleotides comprising 2.5% of the target mRNA molecule volume, and 120 nt long DNA oligonucleotides comprising 5% of the target mRNA molecule volume (referred to as “before TFF” in Tables 8 and 9).

[0223] Unless otherwise specified, the following setup was used for the experiments described below: a feed solution containing 0.1 mg / ml mRNA molecules was percolated using a 100 kDa MWCOmPES filter column at a flow rate of 15 ml / min and a TMP of approximately 40 mbar. The wash volume applied was 10x in both cases: 10x using percolation buffer containing 40 mM MOPS and 10 mM EDTA, followed by 10x using nuclease-free water (referred to as “after TFF” in Tables 8 and 9). Because mRNA molecules are readily degraded by hydrolysis, especially at elevated temperatures, experiments were performed at 4°C, i.e., using ice water, to minimize mRNA molecule hydrolysis.

[0224] This setup resulted in the effective removal of all three lengths of DNA oligonucleotides tested (Table 10) and residual percolation buffer as determined using reverse-phase HPLC (Table 11). Furthermore, diffusion peak analysis was performed after capillary gel electrophoresis using a fragment analyzer before and after purification (Table 12). The diffusion peak analysis indicated that mRNA integrity was not altered by TFF purification and was therefore unaffected by the method described.

[0225] Table 10

[0226]

[0227] Table 11

[0228] Peak area MOPS-EDTA Residual MOPS-EDTA [mM] Before TFF 193.0 Above the upper limit of quantification After TFF 27.4 0.17

[0229] Table 12

[0230] Pre-diffusion peak [%] Reference (without MOPS-EDTA) 20.0 Before performing TFF with MOPS-EDTA at pH 7; repeat 1 18.2 Before performing TFF with MOPS-EDTA at pH 7; repeat 2 times. 15.4 10x wash buffer + 10x nuclease-free water; repeat 1 time. 17.4 10x wash buffer + 10x nuclease-free water; repeat 2 times 16.5

[0231] Determining the translation efficiency of purified mRNA molecules

[0232] Furthermore, determining the translation efficiency of the obtained purified mRNA molecules is crucial. Therefore, 1.4 x 10⁻⁶ mRNA molecules were used. 6 HEK293 cells were seeded in 6-well plates and transfected with 3.75 μg of mRNA molecules purified as described above and according to standard procedures. Transfection was performed using MessengerMax (1:15). After 24 hours, the cells were lysed and studied using SDS-page and Western blotting, respectively, with 50 μg of cell lysate each time.

[0233] As from Figure 6 As can be seen from the data, a considerable amount of mRNA molecules were detected and quantified using Western blotting (A) (B).

[0234] Determining the thresholds for removing mRNA of different lengths.

[0235] A total of 300 μg of mRNA, targeting hCFTR mRNA, was incorporated into different mRNA molecules of varying lengths, using a total volume of 5 ml. Specifically, six different types of mRNA molecules were used for incorporation, each type comprising 16.7% of the target mRNA molecule volume. Three types of mRNA molecules exhibited a cap and a poly(A) tail, with total lengths of 3,632 nt, 1,864 nt, and 1,111 nt, respectively. Two types exhibited neither a cap nor a poly(A) tail, with total lengths of 494 nt and 256 nt, respectively. The last type was a 120 nt DNA-long oligonucleotide serving as a positive control.

[0236] As described above, respectively in RT( Figure 7 ) and 4℃ Figure 8 The solution containing the incorporated mRNA molecules was filtered through a filtration buffer. Samples were aspirated before TFF (directly after sample preparation), after washing with 5x, 10x, 15x, and 20x wash volumes of the original sample volume using the aforementioned filtration buffer, and after a second wash with 10x wash volume of nuclease-free water. For each wash cycle, 100 μl of sample was aspirated using a sterile syringe and held on ice until analysis. Molecular transfer through the filter pores was assessed by capillary gel electrophoresis using a fragment analyzer.

[0237] like Figure 7 and Figure 8 As shown, a 100 kDa mPES column can be used to observe the cutoff value for mRNA molecules with a length of at least 951 nt. For mRNA molecules shorter than 951 nt, columns with a lower MWCO may be advantageous, such as, for example, 50 kDa or 70 kDa mPES columns.

[0238] The mRNA concentration was increased from 0.1 mg / ml to 1 mg / ml.

[0239] In the last set of experiments below (Figure 9), the filtration procedure described below was applied to a solution containing unmodified 1644nt long unmodified tdTomato mRNA as the target mRNA molecule. Specifically, a total of 5 ml of feed solution was analyzed, which contained 1 mg / ml of mRNA molecules, corresponding to a total of 5 mg of mRNA molecules, and 15 nt of DNA oligonucleotide and 25 nt of antisense oligonucleotide—which binds complementary to the target mRNA molecule of interest—representing 2.5% (m / m) of the target mRNA molecules, and 120 nt of oligonucleotide representing 5% (m / m) of the target mRNA molecules. This incorporated feed solution was percolated using a 100 kDa MWCO mPES filter column at a flow rate of 15 ml / min and a TMP of approximately 40 mbar at 4 °C. The washing volumes used were: i) 10x washing volume of nuclease-free water, followed by ii) 10x washing volume of percolation buffer containing 40 mM MOPS and 10 mM EDTA, followed by iii) 10x washing volume of nuclease-free water.

[0240] The diffusion value was studied as an indicator of mRNA integrity. Specifically, the following diffusion values ​​were obtained: 6.4% before TFF and 5.9% after TFF. The area of ​​the diffusion pre-peak reflects the proportion of mRNA-related hydrolysis products. Therefore, hydrolysis products could not be measured by fragment analyzer, which shows that TFF purification does not affect mRNA integrity.

[0241] An exemplary overview of determining optimal TFF parameters using conventional methods.

[0242] The following is a brief description of how technicians can optimize the above TFF method by applying conventional measures.

[0243] Step (Ia)

[0244] The TFF flow rate can be adjusted to obtain a sufficient shear rate so that the precipitated mRNA molecules can be recycled through the TFF system and swept away from the filter surface. Sufficient permeate flux can be obtained by opening the permeate clamp. Enzyme removal can be determined, for example, by SDS-Page analysis, and the required wash volume can be adjusted by conventional methods (preferably 1-20 wash volumes; more preferably 5-15; most preferably 9-11). One wash volume is defined as an equal volume of permeate medium, such as ammonium acetate buffer at pH 7, equal to the initial feed volume.

[0245] Step (Ib)

[0246] The same parameters as described in step (Ia) can be applied. Specifically, the buffer can be exchanged, for example, with nuclease-free water to dissolve the mRNA molecules and remove the buffer (e.g., ammonium acetate). Buffer removal can be determined, for example, by conductivity, UV measurement, and the required wash volume can be adjusted by conventional measures (preferably 1-20 wash volumes; more preferably 5-15; most preferably 9-11). A wash volume is defined as an equal volume of percolate medium, such as nuclease-free water, equal to the initial feed volume.

[0247] Step (IIa)

[0248] The TFF flow rate can be adjusted to obtain a sufficient shear rate so that mRNA molecules can be recycled through the TFF system and swept away from the filter surface. Sufficient permeate flux can be obtained by opening the permeate clamp. Loss of the mRNA of interest can be monitored, for example, by UV measurement in the permeate (e.g., online / offline measurement). If loss of the mRNA of interest is observed, the flow rate and / or TMP can be adjusted by conventional measures until no further loss of the mRNA of interest is observed. The desired wash volume can be adjusted by conventional measures depending on the amount of impurities (e.g., invalid transcripts and / or hydrolysis products); (preferably 1-20 wash volumes; more preferably 5-15; most preferably 9-11). One wash volume is defined as an equal volume of permeate medium, such as MOPS-EDTA at pH 7, to the initial feed volume.

[0249] Step (IIb)

[0250] The same parameters as described in step (IIa) can be applied. Specifically, the buffer can be removed, for example, by exchanging with nuclease-free water, such as MOPS-EDTA. Buffer removal can be determined by, for example, conductivity, UV measurement, and the required wash volume can be adjusted by conventional measures (preferably 1-20 wash volumes; more preferably 5-15; most preferably 9-11). A wash volume is defined as an equal volume of percolate medium, such as nuclease-free water, equal to the initial feed volume.

[0251] TMP shift assays can help determine the optimal conditions for mRNA molecule purification. For example, a total of 5 ml of feed solution containing a target mRNA molecule concentration of 1.0 mg / ml in the percolation buffer used in step (IIa) as described above was percolated using a 100 kDa MWCO mPES filter column and a flow rate of 15 ml / min. Percolate flux was measured in ml / min at six different TMP values ​​ranging from approximately 50 mbar to approximately 150 mbar. Figure 10As can be seen, for tdTomatomRNA, the optimal TMP was determined to be approximately 50 mbar at a flow rate of 15 ml / min, but this may depend on the experimental setup.

[0252] Comparative Examples

[0253] In the following text, examples are described, which are performed to compare the results obtained by the method disclosed herein (method 1) and the method disclosed in WO 2015 / 164773 A1 (method 2).

[0254] Method 1

[0255] Unmodified hCFTR mRNA transcribed in vitro (see US 9713626 B2; 5 mg pellet) was incorporated with a 25 nucleotide (nt) DNA oligonucleotide and a 120 nt DNA oligonucleotide, as well as a 256 nt glucagon-like peptide-1 molecule (GLP-1 mRNA molecule (SEQ ID NO: 1)). The 25 nt DNA oligonucleotide was incorporated into the mRNA at a rate of 2.5% of the total mRNA amount in μg. The 120 nt DNA oligonucleotide was incorporated into the mRNA at a rate of 5.0% of the total mRNA amount in μg. The 256 nt GLP-1 mRNA molecule was incorporated into the mRNA at a rate of 16% of the total mRNA amount in μg.

[0256] The incorporated mRNA molecules were precipitated using 2.5M NH4OAc (pH 7).

[0257] To remove proteins, salts, and invalid transcripts, step (Ia) (mRNA concentration: 0.5 mg / mL) was performed using 500 kDa MWCO mPES with 10x washing volume of 2.5 M NH4OAc at a flow rate of 50 mL / min and approximately 200–300 mbar TMP.

[0258] To remove NH4OAc and to dissolve mRNA molecules, step (Ib) was performed using 50 kDa MWCO mPES with 10x washing volume of nuclease-free water at a flow rate of 50 mL / min and approximately 200–300 mbar TMP (mRNA concentration: 0.5 mg / mL).

[0259] To remove divalent cations, ineffective transcripts, and / or hydrolysis products, step (IIa) was performed using 100 kDa MWCO mPES, 10x washing volume of 40 mM MOPS and 10 mM EDTA at a flow rate of 15 mL / min and approximately 20 mbar TMP (mRNA concentration: 1.0 mg / mL).

[0260] To remove the MOPS-EDTA percolation buffer, step (IIb) was performed using 100 kDa MWCO mPES, with 10x washing volume of nuclease-free water at a flow rate of 15 mL / min and approximately 20 mbar TMP (mRNA concentration: 1.0 mg / mL).

[0261] The following methods were used to study the obtained mRNA molecules: fragment analyzer / reverse-phase HPLC—to account for the removal of incorporated oligonucleotides, and Nanodrop—to determine the recovery rate of the mRNA molecules.

[0262] Method 2 (as described in WO 2015 / 164773 A1)

[0263] Unmodified hCFTR mRNA transcribed in vitro (see US 9713626 B2; 10.26 mg pellet) was incorporated with a 25 nucleotide (nt) DNA oligonucleotide, a 120 nt DNA oligonucleotide, and a 256 nt GLP-1 mRNA molecule (SEQ ID NO: 1). The 25 nt DNA oligonucleotide was incorporated into the mRNA at a rate of 2.5% of the total mRNA mass (in μg). The 120 nt DNA oligonucleotide was incorporated into the mRNA at a rate of 5.0% of the total mRNA mass (in μg). The 256 nt GLP-1 mRNA molecule was incorporated into the mRNA at a rate of 16% of the total mRNA mass (in μg).

[0264] The incorporated mRNA molecules were precipitated using the following: i) guanidine thiocyanate; sodium lauryl sarcosyl, and sodium citrate, to a final concentration of guanidine thiocyanate of 2.09 M; 0.26% sodium lauryl sarcosyl, and 13.0 mM sodium citrate; and ii) anhydrous ethanol, to a final concentration of approximately 38% EtOH, and incubated at RT for 5 minutes.

[0265] The mRNA was loaded using 500 kDa MWCO mPES at a flow rate of approximately 6 mL / min with approximately 22 mL of precipitated mRNA (mRNA concentration: 0.52 mg / mL).

[0266] Washing was performed by repeating the following two steps >5 times using 500 kDa MWCO mPES at a flow rate of approximately 6 mL / min (mRNA concentration: 0.52 mg / mL): Step a) washing with 5 mL of 2.09 M guanidine thiocyanate; 0.26% sodium dodecyl sarcosinate; 13.0 mM sodium citrate; approximately 38% EtOH, and step b) washing with 5 mL of 80% ethanol.

[0267] Elution was performed by treating the obtained solid mRNA with 5 mL of nuclease-free water and circulating again for 5–10 minutes (osmotic pressure off) to ensure dissolution (step C). This procedure was repeated until no more mRNA molecules were recovered using approximately 6 mL / min flow rate and 500 kDa MWCOmPES (mRNA concentration: 0.52 mg / mL).

[0268] Dialysis was performed using approximately 5 wash volumes of 1 mM sodium citrate (pH 6.4), at a flow rate of approximately 6 mL / min and 100 kDa MWCOmPES (step D) (mRNA concentration: 0.52 mg / mL).

[0269] The following methods were used to study the obtained mRNA molecules: fragment analyzer / reverse-phase HPLC—to account for the removal of incorporated oligonucleotides, and Nanodrop—to determine the recovery rate of the mRNA molecules.

[0270] It is worth noting that, compared to the method described in WO 2015 / 164773 A1, the following changes were made in the case of method 2 above: After linear downscaling to maintain a constant shear rate on the filter column, the initially planned flow rate was 6 mL / min. However, this flow rate resulted in very low TMP, i.e., an effective permeate flow rate of 0 mL / min, making permeation impossible. Therefore, the flow rate was gradually increased until sufficient TMP was observed to produce a considerable permeate flux. Thus, the final flow rate range for steps a) to d) was 20–24 mL / min (permeate flow rate between 1.1 mL / min and 1.25 mL / min).

[0271] The results shown in Table 13 were obtained by fragment analysis of unpurified and purified hCFTR mRNA samples. Figures 11 and 12 show the respective electrophoresis patterns for Method 1 and Method 2, respectively.

[0272] Table 13

[0273]

[0274] In Method 1, the removal of the incorporated DNA oligonucleotides (25 nt and 120 nt) was primarily achieved through steps (Ia) / (Ib). Step (IIa) is required to remove the 256 nt mRNA representing the longer hydrolysis product. Step (IIb) did not further remove the 256 nt mRNA, indicating that step (IIa) using a strong chelating agent (such as EDTA) is crucial for removing hydrolysis products and invalid sequences.

[0275] In Method 2, steps A to C only partially remove the incorporated DNA oligonucleotides (25 nt and 120 nt). Step D does not completely remove the 120 nt DNA oligonucleotide. After TFF purification, the 256 nt mRNA, representing the longer hydrolysis product, is almost entirely retained in the sample. Therefore, dialysis with 1 mM sodium citrate (step D) has no strong effect on further eliminating the 120 nt long DNA oligonucleotide representing the invalid mRNA molecule, and especially the 256 nt long mRNA representing the longer hydrolysis product.

[0276] The 256 nt long mRNA sequence used in this paper is described in further detail below.

[0277] SEQ ID No:1

[0278] Codon-optimized GLP-1 sequences

[0279] GGGAGA CUGCCAAG AUG AAGAUCAUCCUGUGGCUGUGCGUGUUCGGCCUGUUCCUGGCCACCCUGUUCCCCAUCAGCUGGCAGAUGCCUGUGGAAAGCGGCCUGAGCAGCGAGGAUAGCGCCAGCAGCGAGAGCUUCGCCAAGCGGAUCAAGAGACACGGCGAGGGCACCUUCACCAGCGACGUGUCCAGCUACCUGGAAGGCCAGCCCGCCAAAGAGUUUAUCGCCUGGCUCGUGAAGGGCAGAGGC UGA GAAUU

[0280] T7启动子的一部分 C: Ethris minimum 5'UTR, followed by additional U nucleotides, TISU 5'UTR, start codon Codon-optimized GLP-1 mRNA sequence stop codon , EcoRI限制位点的一部分

[0281] Non-polyadenylated mRNA was used for incorporation experiments.

Claims

1. A method for purifying mRNA molecules, the method comprising: (Ia) Purify the precipitated mRNA molecules from the suspension containing the precipitated mRNA molecules using the first solution; (Ib) Wash and dissolve the purified precipitate of mRNA molecules obtained from step (Ia) using the second solution; (IIa) Purify the mRNA molecule obtained from the dissolved mRNA molecule in step (Ib) using a third solution containing a chelating agent, wherein the chelating agent is a chelating agent having at least four coordination sites at the cation to be chelated; subsequently... (IIb) Wash the purified mRNA molecules obtained from step (IIa) with the fourth solution. Steps (Ia) to (IIb) are performed using tangential flow filtering.

2. The method according to claim 1, wherein the chelating agent in (IIa) is selected from the following table: 。 3. The method according to claim 1, wherein the chelating agent is EDTA.

4. The method according to claim 1 or 2, wherein the pH of the third solution is between 1 and 10.

5. The method according to any one of claims 1 to 3, wherein the third solution comprises MOPS buffer.

6. The method according to any one of claims 1 to 3, wherein steps (Ia) to (IIb) are performed at a temperature between 0°C and 25°C.

7. The method according to any one of claims 1 to 3, wherein prior to step (Ia), the suspension is obtained using ammonium acetate for precipitating the mRNA molecules, and wherein the first solution contains ammonium acetate.

8. The method according to any one of claims 1 to 3, wherein the second solution is water and / or wherein the fourth solution is water or contains sodium chloride and / or citrate.

9. The method according to any one of claims 1 to 3, wherein the mRNA molecule is contained in the retentate after tangential flow filtration.

10. The method of claim 9, wherein the retentate obtained in step (Ia) is used as the feed solution for tangential flow filtration in step (Ib), the retentate obtained in step (Ib) is used as the feed solution in step (IIa), and the retentate obtained in step (IIa) is used as the feed solution in step (IIb).

11. The method according to any one of claims 1 to 3, wherein the mRNA molecule contained in the suspension is obtained by in vitro transcription.

12. The method according to any one of claims 1 to 3, wherein the method further comprises dephosphorylating and / or polyadenylated and / or capping the mRNA molecule.

13. The method of claim 12, wherein the method comprises dephosphorylating the mRNA molecule obtained from step (Ib), followed by performing steps (Ia) to (IIb), followed by polyadenylation of the obtained mRNA molecule, followed by performing steps (Ia) to (IIb).

14. The method according to any one of claims 1 to 3, wherein in step (Ia), tangential flow filtration is performed using a filter membrane with a molecular weight cutoff between 300 kDa and 0.65 µm, and / or in steps (Ib) and (IIb), a filter membrane with a molecular weight cutoff between 1 kDa and 0.65 µm is used, and / or in step (IIa), a filter membrane with a molecular weight cutoff of at least 50 kDa is used.

15. The method according to any one of claims 1 to 3, wherein the percolation volume of any one of the first solution, the second solution, the third solution, and / or the fourth solution is at least 1 times the volume of the suspension in step (Ia).

16. A method for producing a pharmaceutical composition, the method comprising: (a) Purifying mRNA molecules according to any one of claims 1 to 15; and (b) Formulate the mRNA molecules thus obtained into a pharmaceutical composition.

Images