Application of chloroplast gene psbA in plant improvement

Abstract

The invention discloses the application of chloroplast gene psbA in plant improvement. By expressing the psbA gene in the cell nucleus of the plant, the photosynthesis efficiency, biomass, product yield and survivability of the plant under heat stress are improved.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural genetic engineering and relates to the application of the chloroplast gene psbA in plant improvement. Specifically, it relates to the application of the chloroplast gene psbA in improving plant traits and increasing yield, and especially to the application of the chloroplast gene psbA in improving plant photosynthesis efficiency, biomass, product yield and survival ability under heat stress. Background Art

[0002] Temperature is one of the primary factors influencing plant growth cycles and geographic distribution. With the intensification of the greenhouse effect, high-temperature stress caused by global warming is becoming an increasingly severe challenge to modern agricultural production systems and a serious threat to global food security. Extreme heat waves can severely impact agricultural production. According to estimates by the Food and Agriculture Organization of the United Nations, for every 1°C increase in global temperature, wheat yields will decrease by 6%, rice by 3.2%, corn by 7.4%, and soybean yields by 3.1%. In recent years, with global warming, extreme heat waves have become increasingly common worldwide and in my country. These disastrous high-temperature events pose a serious threat to global agricultural production and food yields, even leading to significant reductions in grain production in some years.

[0003] Chloroplasts are the organelles in plant cells that carry out photosynthesis. Specifically, the thylakoid membranes within chloroplasts are the site of photosynthesis. During photosynthesis, the light reaction is primarily carried out by the photosystem I (PSI) and photosystem II (PSII) complexes, which are located in the thylakoid membranes. The PSII complex plays a crucial and irreplaceable role in the primary reactions of photosynthesis. Long-term studies have shown that the PSII complex is particularly sensitive to heat stress, while the PSI complex is relatively insensitive. The PSII complex is composed of many subunits, and its core subunit, the D1 protein, is the most sensitive to heat stress. The D1 protein is a core PSII protein and the most easily damaged and fastest-renewed protein within the PSII complex. Normal sunlight (high light intensity) or high temperature stress often induces excessive reduction of the electron transport chain, leading to a rapid accumulation of reactive oxygen species (ROS) within chloroplasts. Simply put, as long as plants perform photosynthesis, whether under normal conditions or heat stress, ROS accumulate in their chloroplasts, though the amount accumulated is higher under heat stress. Accumulated ROS further attack the PSII complex on the chloroplast thylakoid membrane. The core protein subunit of PSII, D1, is particularly sensitive to ROS and is highly susceptible to oxidative damage and subsequent degradation. Over eons of evolution, plants have developed a repair mechanism for the PSII complex, known as the PSII repair cycle. During this repair process, damaged D1 proteins in the PSII complex are replaced by newly synthesized D1. Therefore, the efficiency of D1 protein synthesis in chloroplasts determines the efficiency of PSII repair, and thus the efficiency of plant photosynthesis. Chloroplasts are semi-autonomous organelles with their own genomes. The chloroplast gene encoding the D1 protein is psbA, which is expressed in chloroplasts, and its mRNA is translated into D1 protein there. Accumulated ROS in chloroplasts significantly inhibit the translation of psbA mRNA, leading to a decrease in the repair efficiency of the PSII complex, a situation that is particularly serious under high temperature stress. Since photosynthesis in plants inevitably accumulates ROS in chloroplasts, how to improve the repair efficiency of PSII under strong light conditions or high temperature stress, thereby enhancing plant photosynthetic efficiency, biomass, and yield, has long been a fundamental scientific issue and a global challenge for scientists in this field. Summary of the Invention

[0004] To enable plants, especially crops, to adapt to the objective phenomenon of climate warming, the inventors changed their research design ideas and strategies, breaking through the conventional thinking and cognitive limitations in this field. They creatively integrated the plant's chloroplast gene psbA into the nuclear genome and created a new nuclear fusion gene-encoded D1 protein synthesis pathway in transgenic plants such as Arabidopsis, tobacco, and rice. They were surprised to find that expressing the chloroplast gene psbA in the nucleus significantly improved the plant's photosynthetic efficiency, yield, and high temperature resistance, which unprecedentedly overturned the field's understanding of the restrictive function of D1 protein in photosynthesis.

[0005] Specifically, the technical solution of the present invention is as follows.

[0006] The present invention provides the use of the chloroplast gene psbA in plant improvement. More specifically, the present invention provides the use of the chloroplast gene psbA in improving plant traits and increasing product yield.

[0007] The method of application is to express the psbA gene also in the cell nucleus of the plant. That is, the psbA gene is integrated into the nuclear genome (chromosome) of the plant cell so that the nuclear genome of the plant cell also expresses the psbA gene.

[0008] Preferably, the promoter pHsfA2 (also expressed as proHsfA2 or promoter (HsfA2)) of the heat shock transcription factor gene HsfA2 (HEAT SHOCK TRANSCRIPTIONFACTOR A2) is fused to the psbA gene to form the expression cassette pHsfA2::psbA of the psbA gene.

[0009] Preferably, a sequence PTP (plastid-transit peptide sequence) cloned from the RbcS gene (ribulose-1,5-bisphosphate carboxylase small subunit gene) and encoding a chloroplast localization signal peptide (Plastid transit peptide) can be further added to the N-terminus of the psbA coding region to form a fusion gene pHsfA2::RbcS PTP -psbA serves as another psbA gene expression cassette.

[0010] The above application further comprises the following steps: inserting the psbA gene, the expression cassette pHsfA2::psbA, or the expression cassette pHsfA2::RbcS PTP -psbA was cloned into a plant binary expression vector to obtain a psbA gene expression vector. The constructed psbA gene expression vector was then transferred into Agrobacterium, and the plants were transformed by Agrobacterium. Positive plants were obtained through genomic and transcriptional level identification.

[0011] In one embodiment, when the psbA gene, the pHsfA2 gene, and the RbcS gene are all derived from Arabidopsis thaliana, the above application may include the following steps:

[0012] 1) Extract the Arabidopsis genome and clone the heat-responsive promoter pHsfA2 sequence and the chloroplast localization signal peptide RbcS PTP sequence;

[0013] 2) extracting Arabidopsis thaliana total RNA and cloning the psbA gene sequence by RT-PCR or by extracting the Arabidopsis thaliana genome and cloning the psbA gene sequence;

[0014] 3) The pHsfA2 gene fragment and RbcS gene fragment obtained in step 1) PTP The gene fragment and the psbA gene fragment obtained in step 2) are sequentially connected into a plant binary expression vector to construct a psbA gene expression vector;

[0015] 4) Transforming the psbA gene expression vector constructed in step 3) into Agrobacterium;

[0016] 5) The plants were transformed by Agrobacterium, and positive plants were obtained through genomic and transcriptional level identification, that is, transgenic plants whose cell nuclei also expressed the psbA gene.

[0017] Preferably, the plant binary expression vector can be pCAMBIA1300 or pCAMBIA2300.

[0018] In one embodiment, the psbA gene may be a chloroplast psbA gene from Arabidopsis thaliana, whose NCBI accession number is ATCG00020 and whose CDS coding sequence is SEQ ID NO: 3. The psbA gene may also be a chloroplast psbA gene from other photosynthetic plants, for example, a nucleic acid sequence having a homology of 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more, or preferably 98% or more to SEQ ID NO: 3, and encoding the core protein subunit D1 protein of the PSII complex.

[0019] In one embodiment, the heat-responsive promoter pHsfA2 can be derived from the HsfA2 gene of wild-type Col-0 Arabidopsis thaliana, whose NCBI accession number is AT2G26150 and the nucleotide sequence is SEQ ID NO: 1. The pHsfA2 promoter in the present invention can also be a heat-responsive promoter pHsfA2 derived from other photosynthetic plants, such as a nucleic acid sequence having a homology of 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more, or preferably 98% or more to SEQ ID NO: 1, and having heat-responsive promoter function.

[0020] In one embodiment, the sequence PTP encoding the chloroplast localization signal peptide may be SEQ ID NO: 2. The PTP sequence in the present invention may also be a sequence PTP of a chloroplast localization signal peptide derived from other photosynthetic plants, for example, a nucleic acid sequence having a homology of 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more, or preferably 98% or more to SEQ ID NO: 2, and having the function of a chloroplast localization signal peptide.

[0021] The above-mentioned plants are preferably crops, including but not limited to rice, wheat, corn, soybean, sorghum, cotton, vegetables, and cruciferous plants (such as Arabidopsis thaliana).

[0022] To facilitate the above-mentioned applications, the present invention also provides a kit comprising: a pHsfA2 gene promoter fragment, a sequence fragment of the N-terminal chloroplast localization signal peptide of the RbcS gene, and a psbA gene fragment; PCR primers, restriction enzymes, and an intermediate vector (such as pMD19-T) required for cloning these three gene fragments into a plant binary expression vector. Alternatively, the kit comprises: the psbA gene expression vector as described in claim 6 or 7; and reagents for transforming the psbA gene expression vector into Agrobacterium. Alternatively, the kit comprises: Agrobacterium transformed with the psbA gene expression vector; and reagents for transforming plants with the Agrobacterium.

[0023] This invention, for the first time, has created a novel D1 protein synthesis pathway encoded by a nuclear fusion gene, resulting in two D1 protein biosynthesis pathways in transgenic plants: one chloroplast-derived pathway (a naturally occurring pathway in plants) and a newly engineered pathway that is expressed in the nucleus, translated in the cytoplasm, and ultimately enters the chloroplasts to function. This genetically engineered nuclear-dependent D1 synthesis pathway significantly enhances the repair efficiency of the PSII complex, thereby increasing plant photosynthesis efficiency, carbon dioxide assimilation rate, biomass, and yield. Compared to wild-type plants, the biomass increase ranged from 43.7-80.2% in transgenic Arabidopsis lines, 15.1-22.3% in transgenic tobacco lines, and 20.6-22.9% in transgenic rice lines. When applied to transgenic rice lines, yield measurements under field conditions were conducted over multiple growing seasons from 2016 to 2019 at breeding bases in Songjiang, Shanghai (N30°56′36″, E121°07′26″) and Lingshui, Sanya, Hainan (N18°30′58″, E110°0′36″), respectively, demonstrating yield increases ranging from 8.1% to 21.0%. Therefore, this original innovation, which adds a completely new D1 synthesis pathway to plant cells and significantly improves plant photosynthesis efficiency, biomass, and yield, is of great significance to global food production and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 pHsfA2::RbcS PTP -psbA construction diagram and three transgenic plants genome level identification photos. Figure a is the fusion gene pHsfA2::RbcS PTP -psbA vector construction schematic diagram, design of primers (Primer) RbcS from the RbcS sequence PTP -F and primers psbA-R from the psbA sequence, amplified products of 283bp, which were used for identification at the gene level and transcription level; Figure b is an agarose gel electrophoresis photograph of DNA detection of three plants: Arabidopsis wild type (WT) and transgenic lines (A1, A2 and A3), tobacco wild type (WT) and transgenic lines (T6, T13 and T58), rice wild type (WT) and transgenic lines (R3, R13 and R23). The primers in Figure a were used to identify the genomic levels of transgenic Arabidopsis, tobacco and rice, respectively. The position marked by the arrow is the 283bp amplified product. This band can be amplified in all three transgenic lines of plants, but not in the wild type. The amplified band was verified to be correct by sequencing.

[0025] Figure 2The figure shows the comparison of psbA gene transcription level (relative expression level) and D1 protein expression in wild-type WT and transgenic lines of three plants grown under normal temperature conditions (Control) and heat treatment high temperature conditions (Heat). PTP -psbA transcription level (relative expression level); b is qRT-PCR detection of RbcS in tobacco wild type (WT) and transgenic lines (T6, T13, T58) under normal and heat treatment conditions PTP -psbA transcription level; c is qRT-PCR detection of RbcS in rice wild type (WT) and transgenic lines (R3, R13, R23) under normal and heat treatment conditions PTP -psbA transcription level; d is the protein amount of thylakoid membrane protein D1 in detached leaves of wild type and corresponding transgenic lines under normal and heat treatment conditions detected by Western blot. PTP -F and psbA-R are the same Figure 1 The primers used in the experiment were used. Bars represent the standard error of three replicates (**P value < 0.01, ***P value < 0.001, Student's t test). The trends of the three replicates were consistent. The results indicate that nuclear expression of the psbA gene can increase the amount of D1 protein in plants.

[0026] Figure 3 This shows that the D1 protein encoded by the nucleus can enter the chloroplast and localize on the thylakoid membrane. Figure a is a homology alignment of the N-terminal amino acid sequences (1-74 amino acids) of the D1 protein in Arabidopsis (AtD1), the D1 protein in tobacco (NtD1), and the D1 protein in rice (OsD1). The red arrows above indicate the different amino acid sequences of the D1 proteins in Arabidopsis, tobacco, and rice; Figures b and c are the detection of Arabidopsis AtD1 sequences in transgenic rice by mass spectrometry under normal conditions. 8 RESESLWGR 16 (b) and OsD1 sequences of rice 8 RESTSLWGR 16 (c) The results of three biological replicates were consistent; in photos d and e, under normal and heat-treated conditions (38°C, 2h), immunogold assays using Myc or HA and gold-labeled secondary antibodies were able to detect the transformed fusion gene pHsfA2::RbcS on the chloroplast thylakoid membrane. PTPTransgenic Arabidopsis thaliana expressing D1-MYC or D1-HA proteins via the -psbA-Myc or -HA vectors. Arrows indicate gold particles on the thylakoid membrane (TG), and SGs represent starch grains. Bars in the images = 0.5 μm.

[0027] Figure 4 Three plants, wild type WT and transformed with pHsfA2::RbcS PTP Comparison of PSII photochemical efficiency (Fv / Fm) in transgenic lines expressing the -psbA vector grown under normal temperature (Control) and during the recovery phase of heat treatment (Heat). Figure (a) shows Arabidopsis (WT, A1, A2, A3), tobacco (WT, T6, T13, T58), and rice (WT, R3, R13, R23). Scale bars in the photographs are 5 cm, and the results are consistent across three biological replicates. Figures (d, f) show statistical bar graphs of PSII photochemical efficiency in detached leaves under heat treatment. Figures (d, n = 9, 41°C, 1 hour), tobacco (e, n = 6, 42°C, 3 hours), and rice (f, n = 15, 44°C, 2 hours and 4 hours). Bars indicate standard errors (**P value < 0.01, ***P value < 0.001, Student's t test).

[0028] Figure 5 For three plants, wild type WT and transformed with pHsfA2::RbcS PTP Blue native-PAGE gel electrophoresis of thylakoid membrane complex proteins and transmission electron microscopy images of chloroplasts in transgenic lines expressing the -psbA vector, grown at normal temperature (Control) and during the recovery phase of heat treatment (Heat). Figures a to c show the PSII supercomplex, PSI+PSII core dimer, PSII monomer, CP43-less PSII, and LHCII trimer in Arabidopsis (a), tobacco (b), and rice (c); Figures d to f show chloroplast structures in Arabidopsis (d), tobacco (e), and rice (f). The results were consistent across three biological replicates. Bars in the images are 0.5 μm.

[0029] Figure 6 For three plants, wild type WT and transformed with pHsfA2::RbcS PTPThe PSII quantum yield (Φ) of detached leaves of transgenic lines carrying the -psbA vector grown under normal temperature (Control) and during the recovery phase of heat treatment (Heat) was PSII ) and photon flux density (PPFD) detection statistics. (a) and (b) show normal and heat-treated Arabidopsis, (c) and (d) show normal and heat-treated tobacco, and (e) and (f) show normal and heat-treated rice.

[0030] Figure 7 For three plants, wild type WT and transformed with pHsfA2::RbcS PTP Statistical graphs showing the electron transport rate in detached leaves of transgenic lines expressing the -psbA vector, grown under normal temperature (Control) and during the recovery phase of heat treatment (Heat). (a) and (b) show normal and heat-treated controls for Arabidopsis, (c) and (d) show normal and heat-treated controls for tobacco, and (e) and (f) show normal and heat-treated controls for rice.

[0031] Figure 8 Wild-type WT and pHsfA2::RbcS transformed Arabidopsis and tobacco are shown. PTP Phenotypes of transgenic lines expressing the -psbA vector grown under normal conditions and scanning electron micrographs of epidermal cells in detached leaves. Figures a to c show Arabidopsis (WT, A1, A2, and A3), and Figures d to f show tobacco (WT, T6, T13, and T58). Scale bars in the plant photos on the left represent 5 cm, and in the SEM photos in the center represent 50 μm. The right side shows the average cell size statistics from SEM observations (**P value < 0.01, ***P value < 0.001, Student's t test).

[0032] Figure 9 Arabidopsis wild type (WT) and transformed with pHsfA2::RbcS are shown. PTP -psbA vector transgenic lines (A1, A2, A3), seedling survival phenotypes under different concentrations of lincomycin treatment, three plant wild type WT and transformed pHsfA2::RbcS PTPNet CO2 assimilation rates of transgenic lines expressing the -psbA vector under normal growth conditions (Control). (a) shows a photograph of Arabidopsis seedling survival phenotypes, and (b) and (d) show statistical plots of net CO2 assimilation rates for Arabidopsis, tobacco, and rice, respectively. Bars indicate standard errors (***P value < 0.001, Student's t test).

[0033] Figure 10 Comparative photographs of the phenotypes of mature wild-type (WT) and transgenic lines (R3, R13, and R23) rice grown in the Songjiang field in 2016, along with statistical graphs showing tiller number, biomass per plant, and grain yield per plant (n=30). Error bars indicate standard error (**P value < 0.01, ***P value < 0.001, Student's t test). (a) shows the mature rice phenotype, (b) shows the average tiller number per plant, (c) shows the average aboveground biomass per plant, and (d) shows the average grain yield per plant.

[0034] Figure 11 Figure 2. Statistical graphs of tiller number per plant (n=30), aboveground biomass (biomass per plant) (n=36), and grain yield per plant (n=36) for mature wild-type (WT) and transgenic rice lines (R3, R13, and R23) grown in fields in Lingshui County, Hainan Province in 2016. Error bars indicate standard error (**P value < 0.01, ***P value < 0.001, Student's t test). (a) is the mean tiller number per plant, (b) is the mean biomass per plant, and (c) is the mean grain yield per plant.

[0035] Figure 12Figure 2. Statistical graphs of aboveground biomass (biomass per plot) (n=3) and grain yield (grain yield per plot) (n=3) for wild-type (WT) and transgenic rice lines (R3, R13, and R23) grown in field conditions in Songjiang in 2017. Error bars indicate standard error (**P value < 0.01, ***P value < 0.001, Student's t test). (a) is the mean biomass bar for each plot, and (b) is the mean grain yield bar for each plot.

[0036] Figure 13 Figure 2 shows the statistical graphs of the aboveground biomass (biomass per plot) (n=5) and grain yield (grain yield per plot) (n=5) of the empty control transgenic lines (EV, which refers to the transgenic lines containing only an empty plant binary expression vector, such as pCAMBIA1300 or pCAMBIA2300 empty vector, without our fusion gene construction. The purpose of obtaining the empty control transgenic lines is to eliminate the influence of tissue culture effects during the production of empty vectors and transgenic plants. This is a stricter control plant than the wild type) and the R3 plots of the transgenic lines. Error bars indicate standard errors (**P value < 0.01, ***P value < 0.001, Student's t test). Where a is the average biomass statistical bar for each plot, and b is the average grain yield statistical bar for each plot. DETAILED DESCRIPTION

[0037] In order to solve the fundamental scientific problem and global problem of the decline in plant photosynthesis efficiency, biomass and product yield caused by climate warming, we have broken through the conventional thinking in this field and creatively integrated the cloned Arabidopsis chloroplast gene psbA into the nuclear genome, which greatly increased the expression of D1 protein. More importantly, the present invention fuses the promoter of the heat shock transcription factor gene HsfA2, which strongly responds to high temperature stress and expresses high levels, with the psbA gene, and adds a sequence encoding a chloroplast localization signal peptide PTP (this fragment is cloned from the RbcS gene) to the N-terminus of the psbA coding region. We constructed this newly constructed fusion gene pHsfA2::RbcS PTP -psbA cDNA was successfully integrated into the genomes of transgenic Arabidopsis, tobacco, and rice through plant binary expression vectors, and expressed at high levels in response to heat stress.

[0038] The above research design ideas and strategies effectively circumvented the obstacle of ROS accumulated in chloroplasts significantly inhibiting the translation process of psbA mRNA, and the fusion gene pHsfA2::RbcS PTP The -psbA cDNA is expressed in the nucleus, and the resulting psbA mRNA is translated on cytoplasmic ribosomes. Following translation, guided by the added N-terminal PTP chloroplast localization signal peptide, it enters the chloroplast and localizes to the thylakoid membrane. These findings were confirmed by protein profiling of the thylakoid membranes of transgenic plants and immunogold electron microscopy subcellular localization experiments.

[0039] Our findings also confirm that plants have a high demand for D1 during both normal growth and heat stress. The existing natural chloroplast D1 synthesis pathway cannot meet the demand for newly synthesized D1 protein required for rapid growth and heat stress resistance. While it is difficult to prove that D1 protein synthesized by the natural chloroplast pathway cannot meet plant needs, our new findings overturn the understanding of scientists in this field that D1 protein has a limiting function in photosynthesis.

[0040] Regarding the function of creating a nucleus-dependent D1 biosynthesis pathway in improving plant photosynthesis efficiency, carbon dioxide assimilation rate, and biomass, we used three commonly used plants to verify the effect. They include the dicotyledonous plants Arabidopsis and tobacco, and the monocotyledonous crop rice, one of the most important food crops in the world. Three independent transgenic lines were obtained for each plant, including three Arabidopsis ( A rabidopsis) transgenic lines are designated as A1, A2, and A3 in the examples. T obacco) transgenic lines are designated as T6, T13, and T58 in the examples. R ice, Latin name Oryza sativa L.) transgenic strains are marked as R3, R13 and R23 in the examples. The photosynthesis efficiency, carbon dioxide assimilation rate and biomass of the three strains of each plant have increased significantly compared with the wild type, and the effect is remarkable and surprising. Compared with the wild type, the increase in biomass is 43.7-80.2% in Arabidopsis transgenic strains, 15.1-22.3% in tobacco transgenic strains, and 20.6-22.9% in rice transgenic strains. The yield measurement experiment of rice transgenic strains under field conditions was carried out for three consecutive growing seasons (2016 to 2017) at the breeding bases in Songjiang, Shanghai (N30°56′36″, E121°07′26″) and Lingshui, Sanya, Hainan (N18°30′58″, E110°0′36″), and the yield increase was between 8.1-21.0%.

[0041] Our original and innovative discovery addresses a long-standing scientific challenge for scientists in the field: how to enhance the efficiency of chloroplast D1 synthesis under high temperature stress, thereby increasing plant photosynthetic efficiency, biomass, and yield. This represents a significant breakthrough in improving plant light energy utilization efficiency and provides a solution for addressing food security in the face of global warming caused by the greenhouse effect.

[0042] In this article, for the sake of simplicity, a protein such as chloroplast localization signal peptide PTP is sometimes referred to as its encoding gene RbcS. PTP The terms are used interchangeably. Those skilled in the art should understand that they refer to different substances in different descriptions. They can easily understand their meanings based on the context. For example, when describing the function or category of a chloroplast localization signal peptide, PTP refers to the protein; when describing a gene, it refers to the gene encoding the small peptide, RbcS. PTP , abbreviated as RbcS or rbcs.

[0043] A preferred method of producing transgenic plants according to the present invention involves transferring a vector carrying a promoter and a target gene (operably linked) into Agrobacterium, which then integrates the vector fragment containing the promoter and target gene into the plant's chromosome. Examples of transgenic recipient plants include Arabidopsis thaliana, tobacco, and rice.

[0044] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified, such as by adding genes that express enzymes or luminescent compounds that produce color changes in the plant (such as the GUS gene, GFP gene, or luciferase gene), antibiotic resistance markers (such as gentamicin markers and kanamycin markers), or chemical resistance marker genes (such as herbicide resistance genes). For the safety of transgenic plants, it is possible to omit any selectable marker genes and directly screen for transformed plants using stress.

[0045] For the present invention, the term "vector" may refer to an expression cassette or a plasmid for containing a gene sequence, which is well known to those skilled in the art.

[0046] For ease of operation, the application method of the present invention can be performed using a kit, which combines the required materials in a single kit. In a preferred embodiment, the kit, in addition to comprising: a pHsfA2 gene fragment, an RbcS gene fragment, a psbA gene fragment, a plant binary expression vector, PCR primers, restriction endonucleases, an intermediate vector (such as pMD19-T), a psbA gene expression vector, Agrobacterium, and necessary reagents, can also include at least one of the following items: a carrying tool having a space divided into a defined space that can accommodate one or more containers, 96-well plates, or strips, such as a test kit, a medicine bottle, a test tube, and the like, each container containing a single component for the method of the present invention; and instructions, which can be written on the bottle, test tube, or the like, or on a separate piece of paper, or on the outside or inside of the container, such as a paper document with a window for downloading an operation demonstration video app, such as a QR code. The instructions can also be in multimedia form, such as a CD, a USB flash drive, a network drive, and the like.

[0047] The main advantages of the present invention include:

[0048] 1. The chloroplast gene psbA of the present invention can effectively improve photosynthetic efficiency by being expressed in the cell nucleus;

[0049] 2. The chloroplast gene psbA of the present invention can be expressed in the nucleus to effectively increase plant biomass and product yield;

[0050] 3. The expression of the chloroplast gene psbA in the cell nucleus of the present invention can effectively improve the survival ability and photosynthetic efficiency of plants under heat stress, thereby increasing crop yield.

[0051] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only for illustrative purposes and are not limitations of the present invention. In addition, it should be understood that after reading the concept of the present invention, various changes or adjustments made by those skilled in the art should fall within the scope of protection of the present invention, and these equivalent forms also fall within the scope limited by the appended claims of the present application.

[0052] For example, in the embodiment, the optimal combination is to fuse the promoter pHsfA2 of the Arabidopsis thaliana HsfA2 gene with the psbA gene to drive its expression in the nuclear genome. A sequence encoding a chloroplast localization signal, PTP, is added to the N-terminus of the psbA coding region. This fragment is cloned from the Arabidopsis thaliana RbcS gene, allowing the psbA gene to be expressed in the nuclei of Arabidopsis thaliana, tobacco, and rice. However, the chloroplast gene psbA in the present invention is not limited to Arabidopsis psbA, but should include psbA genes from other photosynthetic plants; the promoter of the gene HsfA2 is not limited to the promoter of the Arabidopsis HsfA2 gene, but should include promoters of HsfA2 genes from other plants; and the term "plant" also includes other plants and crops.

[0053] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages mentioned are by mass unless otherwise specified.

[0054] Example

[0055] Materials and methods

[0056] The whole gene synthesis, primer synthesis and sequencing in this article were all completed by Invetrogene and BGI.

[0057] The molecular biology experiments in this article, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly performed with reference to Molecular Cloning Laboratory Manual (3rd edition), edited by J. Sambrook and D.W. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002).

[0058] The operation can be carried out according to the instructions of the relevant kit. If necessary, the specific experimental conditions such as PCR conditions can be determined through simple experiments.

[0059] The heat-responsive promoter proHsfA2 sequence fragment used in the examples can be cloned from the Arabidopsis genome. The NCBI accession number of the Arabidopsis HsfA2 gene is AT2G26150. The proHsfA2 sequence fragment is the promoter sequence of SEQ ID NO: 1, which is the 2000 bp before ATG:

[0060]

[0061] The chloroplast localization signal peptide sequence PTP used in the examples can be cloned from the RbcS gene of Arabidopsis thaliana and is a 240 bp rbcs sequence SEQ ID NO: 2:

[0062] atggcttcctctatgctctcttccgctactatggttgcctctccggctcaggccactatggtcgctcctttcaacggacttaagtcctccgctgccttcccagccacccgcaaggctaacaa cgacattacttccatcacacaagcaacggcggaagagttaactgcatgcaggtgtggcctccgattggaaagaagaagtttgagactctctcttaccttcctgaccttaccgattccgaa(SEQ ID NO:2).

[0063] The psbA gene coding frame (CDS) sequence used in the examples can be the Arabidopsis thaliana chloroplast psbA gene coding frame sequence, which has a full length of 1062 bp, its NCBI accession number is ATCG00020, and the sequence is SEQ ID NO: 3:

[0064]

[0065] Example 1: Gene cloning

[0066] 1.1 Extract the Arabidopsis genome and clone the heat-responsive promoter pHsfA2 sequence.

[0067] Wild-type Col-0 Arabidopsis leaves were picked and ground into powder using liquid nitrogen. The Arabidopsis genome was extracted using a plant genomic DNA extraction kit (DP305) (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0068] PCR primers (5'-3'):

[0069] Forward pHsfA2-F: ACGCGTCGACCTTTGCCAATTCCTCTGTCCTC;

[0070] Reverse pHsfA2-R: CGGGATCCTTTCGTTGTTTATCTCAAATC.

[0071] High-fidelity enzyme KOD–Plus-Neo (toyobo, product number: KOD-401)

[0072] PCR conditions: 94°C for 2 minutes; 98°C for 10 seconds, 58°C for 30 seconds, 68°C for 2 minutes, 30 cycles; 68°C for 10 minutes. The gene fragment amplified by RT-PCR was sequenced and verified to be SEQ ID NO: 1, which was correct.

[0073] 1.2 Extract the Arabidopsis genome and clone the PTP sequence of the chloroplast localization signal peptide.

[0074] According to the method in step 1.1, wild-type Col-0 Arabidopsis leaves were picked and crushed, and the Arabidopsis genome was extracted using the Plant Genomic DNA Extraction Kit (DP305) (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0075] PCR primers (5'-3'):

[0076] Forward RbcS-PTP-F: CGGGATCCATGGCTTCCTCTATGCTCTCTTC,

[0077] Reverse RbcS-PTP-R: CCCCCGGGTTCGGAATCGGTAAGGTCAG.

[0078] High-fidelity enzyme KOD–Plus-Neo (toyobo, product number: KOD-401)

[0079] PCR conditions: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, 68°C for 20 s, 30 cycles; 68°C for 10 min.

[0080] The gene fragment amplified by RT-PCR was sequenced and verified to be the PTP sequence rbcs, which was SEQ ID NO: 2, and was verified to be correct.

[0081] 1.3 Extract Arabidopsis RNA and clone the psbA gene sequence by RT-PCR.

[0082] Wild-type Col-0 Arabidopsis leaves were harvested and ground into a powder using liquid nitrogen. 100 mg of this powder was placed in a 1.5 mL RNA-free centrifuge tube and total RNA was extracted using the RNAiso Plus Plant Total RNA Extraction Kit (Takara, Cat. No. 9109). The extracted RNA was directly reverse transcribed to produce cDNA.

[0083] Take 1 μg RNA and use PrimeScript TM cDNA was produced by reverse transcription using a reverse transcription kit containing RT Master Mix (Perfect Real Time) (takara, catalog number: RR036Q).

[0084] Sequencing of the gene fragment amplified by RT-PCR confirmed that the psbA gene sequence was SEQ ID NO: 3, which was correct. (1062 bp)

[0085] PCR primers (5'-3'):

[0086] Forward psbA-cDNA-F: TCCCCCGGGATGACTGCAATTTTAGAGAGAC,

[0087] Reverse psbA-cDNA-R: GGGGTACCTCCATTTGTAGATGGAGCCTC.

[0088] High-fidelity enzyme KOD–Plus-Neo (toyobo, product number: KOD-401)

[0089] PCR conditions: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, 68°C for 1 min, 30 cycles; 68°C for 10 min.

[0090] Example 2: Construction of plant binary expression vector

[0091] 2.1 The 2000 bp fragment of the heat-responsive promoter proHsfA2 promoter sequence SEQ ID NO: 1 was amplified by PCR using the fidelity enzyme kod-plus and ligated into the intermediate vector pMD19-T. The fragment was confirmed to be correct after sequencing.

[0092] PCR primers (5'-3'):

[0093] Forward pHsfA2-F: ACGCGTCGACCTTTGCCAATTCCTCTGTCCTC,

[0094] Reverse pHsfA2-R: CGGGATCCTTTCGTTGTTTATCTCAAATC

[0095] High-fidelity enzyme KOD–Plus-Neo (toyobo, product number: KOD-401)

[0096] PCR conditions: 94°C for 2 min; 98°C for 10 s, 58°C for 30 s, 68°C for 2 min, 30 cycles; 68°C for 10 min.

[0097] 2.2 Use the Sal1 / BamH1 restriction site to connect into the plant binary expression vector pCAMBIA1300 to form the vector proHsfA2-pCAMBIA1300.

[0098] 2.3 The chloroplast signal localization peptide rbcs sequence fragment SEQ ID NO: 2 was amplified by PCR using the fidelity enzyme kod-plus and ligated into the intermediate vector pMD19-T. The sequence was confirmed to be correct.

[0099] The conditions for cloning rbcs sequences by RT-PCR are:

[0100] PCR primers (5'-3'):

[0101] Forward RbcS-PTP-F: CGGGATCCATGGCTTCCTCTATGCTCTCTTC,

[0102] Reverse RbcS-PTP-R CCCCCGGGTTCGGAATCGGTAAGGTCAG.

[0103] High-fidelity enzyme KOD–Plus-Neo (toyobo, product number: KOD-401)

[0104] PCR conditions: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, 68°C for 20 s, 30 cycles; 68°C for 10 min.

[0105] 2.4 Use the BamH1 / Smal1 restriction site to ligate into the proHsfA2-pCAMBIA1300 described in B to form the vector proHsfA2-rbcs-pCAMBIA1300.

[0106] The ligation was performed using the DNA Ligation Kit Ver. 2.1 (takara, catalog number: 6022Q) at 16°C for 1 h.

[0107] 2.5 The psbA gene coding frame sequence fragment SEQ ID NO: 3 was amplified by PCR using the fidelity enzyme kod-plus and ligated into the intermediate vector pMD19-T. The sequence was confirmed to be correct after sequencing.

[0108] The conditions for cloning rbcs sequences by RT-PCR are:

[0109] PCR primers (5'-3'):

[0110] Forward psbA-cDNA-F: TCCCCCGGGATGACTGCAATTTTAGAGAGAC,

[0111] Reverse psbA-cDNA-R: GGGGTACCTCCATTTGTAGATGGAGCCTC.

[0112] High-fidelity enzyme KOD–Plus-Neo (toyobo, product number: KOD-401)

[0113] PCR conditions: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, 68°C for 1 min, 30 cycles; 68°C for 10 min.

[0114] 2.6 Use the Smal1 / Kpn1 restriction site to ligate into the proHsfA2-rbcs-pCAMBIA1300 described in D to form the final vector proHsfA2-RbcS PTP -psbA-pCAMBIA1300.

[0115] The ligation was performed using the DNA Ligation Kit Ver. 2.1 (takara, catalog number: 6022Q) at 16°C for 1 h.

[0116] PCR primers (5'-3'):

[0117] Forward RbcSPTP-F': ATGGCTTCCTCTATGCTCTCTTC,

[0118] Reverse psbA-R': CCCATAGGCTTTCGCTTTCGC.

[0119] Figure 1 The vector pHsfA2::RbcS is shown PTP -psbA main structure and identification at the genome level of transgenic plants.

[0120] Example 3: Plasmid transfer into Agrobacterium and plant transformation

[0121] 3.1 Take 1 μg of the correctly sequenced plasmid proHsfA2-RbcS constructed in Example 2 PTP -psbA-pCAMBIA1300 and Agrobacterium GV3101 competent cells (Shanghai Weidi Biotechnology Co., Ltd., Catalog No. AC1001) were incubated on ice for 30 minutes, quickly frozen in liquid nitrogen for 5 minutes, heat-shocked at 37°C for 5 minutes, and placed on ice for 5 minutes. 1 mL of LB medium was added and the cells were shaken at 28°C for 4 hours. All the cells were plated onto kanamycin-resistant and rifamycin-resistant LB plates and cultured in a 28°C incubator for 2-4 days to obtain engineered Agrobacterium.

[0122] 3.2 Single colonies were picked from kanamycin- and rifampicin-resistant LB plates and cultured in LB (Kan + Rif) tubes for 48 hours to an OD600 ≥ 2.0. Cultures were incubated overnight (12 hours) at 28°C. After harvesting, the cells were incubated in MMA buffer (10 mM MES, 10 mM MgCl2, and 100 μM acetosyringone) for 3 hours. The cells were then injected into Arabidopsis, tobacco, and rice plants using a needleless syringe. Transgenic plants were identified as positive at the genomic and transcriptional levels.

[0123] Example 4: Plant trait investigation of WT and transgenic plants under normal and heat treatment conditions

[0124] 4.1 Plant culture

[0125] The normal growth conditions of the three plants used as controls are:

[0126] Arabidopsis and tobacco, 22℃±1℃, 16h light / 8h dark.

[0127] Rice seedlings, 28℃ 12h light / 12h dark.

[0128] Heat treatment conditions are:

[0129] Arabidopsis thaliana, 21 days, 41°C, 8.5 hours later, transfer to normal growth for 3 days to recover, and take pictures.

[0130] Tobacco, 30 days, 42℃, after 38 hours, it returned to normal growth for 5 days to recover, and then took pictures.

[0131] Rice, 14 days, 44℃, 37 hours later, returned to normal growth for 8 days and recovered, and photographed.

[0132] 4.2 Plant genome level identification

[0133] Leaves of wild-type and transgenic plants of the three species were picked and ground into powder using liquid nitrogen. Plant genomes were extracted using a plant genomic DNA extraction kit (DP305) (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0134] Using the extracted plant genome as a template, primer RbcS PTP -F and psbA-R were amplified by RT-PCR.

[0135] Enzymes: PCR SuperMix (+dye) (Golden Biotechnology, catalog number: AS112-11)

[0136] PCR conditions: 94°C for 2 min; 94°C for 30 s, 60°C for 30 s, 72°C for 20 s, 30 cycles; 72°C for 10 min.

[0137] The amplified DNA fragments were subjected to agarose gel electrophoresis. Figure 1 The arrow in the electrophoresis photograph indicates the 283bp amplification product. This band was amplified in all three transgenic plant lines, but not in the wild type. Sequencing confirmed the amplified band.

[0138] 4.3 Detection of psbA gene transcription levels in three plants under different growth conditions

[0139] The wild-type and transgenic plants of the three plants were grown under normal temperature conditions (Control) and heat treatment conditions (Heat). Leaves of the plants were picked and ground into powder using liquid nitrogen. The plant genome was extracted using a plant genomic DNA extraction kit (DP305) (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0140] Using the extracted plant genome as a template, primer RbcS PTP -F and psbA-R were amplified by qRT-PCR to detect RbcS PTP -psbA transcript levels.

[0141] PCR

[0142] Kit: TB Premix Ex Taq TM II (Tli RNaseH Plus) (takara, catalog number: RR820Q).

[0143] Two-step PCR amplification standard procedure: Stage 1: 95℃ 30s pre-denaturation,

[0144] Stage 2: PCR reaction: 95°C for 5 seconds, 60°C for 30-34 seconds, for 40 cycles.

[0145] See the results Figure 2 In ac, the expression levels of the psbA gene in the transgenic lines of the three plants were significantly higher than that in the wild type WT, regardless of whether they were grown under normal conditions (Control) or heat treatment (Heat) conditions.

[0146] 4.4 Detection of D1 protein in three plants under different growth conditions

[0147] Leaves of each plant were picked and ground into powder using liquid nitrogen. Plant protein was extracted using a plant protein extraction kit (C500053) (Shanghai Sangon Biotechnology Co., Ltd.).

[0148] Western blotting was performed using the following materials: D1 antibody (Agrisera, Sweden, catalog number: AS05 084); PVDF membrane (thermofish, catalog number: 88518); goat anti-rabbit (Sigma, catalog number: AP132); Immobilon ECL Ultra Western HRP Substrate (catalog number: WBULS0500). The extracted proteins were subjected to Western blotting. The results are shown in Figure 2 Middle d, whether grown under normal conditions (Control) or heat treatment (Heat) conditions, the amount of D1 protein in the transgenic lines of the three plants was significantly higher than that in the wild type WT.

[0149] 4.5 Detection of D1 protein in cells

[0150] The amino acid sequence (1-74 amino acids) of the D1 protein in Arabidopsis thaliana (AtD1), tobacco D1 protein (NtD1) and rice D1 protein (OsD1) were compared. Under normal conditions, the transgenic rice was detected to contain the Arabidopsis AtD1 sequence by mass spectrometry. 8 RES E SLWGR 16 (Figure b) and the OsD1 sequence of rice 8 RES T SLWGR 16 (Figure c) Under normal and heat-treated conditions (38°C, 2h), immunogold assays using Myc or HA and gold-labeled secondary antibodies were able to detect the transformed fusion gene pHsfA2::RbcS on the chloroplast thylakoid membrane. PTPTransgenic Arabidopsis thaliana D1-MYC or D1-HA proteins expressed with -psbA-Myc vector or -HA vector (photos d and e).

[0151] The results showed that the D1 protein encoded by the nucleus could enter the chloroplast and localize on the thylakoid membrane.

[0152] 4.6 Investigating the effects of the psbA gene on plant heat tolerance and PSII photochemical efficiency

[0153] Three plants: wild type WT and transformed with pHsfA2::RbcS PTP The transgenic lines of the -psbA vector were grown under normal temperature conditions (Control) and then heat treated (Heat) (41°C for 1 h for Arabidopsis; 42°C for 3 h for tobacco; and 44°C for 2 h and 4 h for rice) to recover their growth. Figure 4 In photos (center, right), under normal temperature conditions (Control), wild-type Arabidopsis thaliana WT plants were slightly smaller than transgenic lines (A1, A2, and A3). However, after heat treatment, wild-type Arabidopsis thaliana WT plants were significantly smaller than transgenic lines, indicating that nuclear expression of the psbA gene enhances plant heat tolerance. Under normal temperature conditions (Control), wild-type tobacco WT plants were slightly smaller than transgenic lines (T6, T13, and T58). However, after heat treatment, wild-type tobacco WT plants were significantly smaller than transgenic lines, indicating that nuclear expression of the psbA gene enhances plant heat tolerance. Under normal temperature conditions (Control), wild-type rice WT plants were similar to transgenic lines (R3, R13, and R23). However, after heat treatment, wild-type rice WT plants were significantly smaller than transgenic lines, indicating that nuclear expression of the psbA gene enhances plant heat tolerance.

[0154] The method of PSII photochemical efficiency is described in the following literature:

[0155] Peng,LWet al.,LOW PSII ACCUMULATION1 is involved in efficient assembly of photosystem II in Arabidopsis thaliana.Plant Cell 18,955-969(2006).

[0156] Lu Y,Hall DA,Last RL(2011),A small zinc finger thylakoid protein plays role in maintenance of photosystem II in Arabidopsis thaliana.PlantCell.23:1861–1875.

[0157] The wild type WT and the transformed pHsfA2::RbcS PTP The PSII photochemical efficiency (Fv / Fm) of the transgenic strains of the -psbA vector was determined. Figure 4 Middle bar graph df, after heat treatment, the PSII photochemical efficiency of transgenic lines of Arabidopsis, tobacco and were all higher than that of the wild type (WT), indicating that nuclear expression of the psbA gene can improve the PSII photochemical efficiency of plants.

[0158] 4.7 Investigating the Effects of the psbA Gene on the Thylakoid Membrane in Plant Cells

[0159] Three plants: wild type WT and transformed with pHsfA2::RbcS PTP The transgenic lines expressing the -psbA vector were grown under normal temperature conditions (Control) and then recovered after heat treatment (Heat) (41°C, 1 h for Arabidopsis; 42°C, 3 h for tobacco; 44°C, 2 h and 4 h for rice).

[0160] Thylakoid membranes were extracted and isolated from plant leaves according to the method described in the following literature:

[0161] Peng,LWet al.,LOW PSII ACCUMULATION1 is involved in efficient assembly of photosystem II in Arabidopsis thaliana.Plant Cell,18,955-969(2006).

[0162] The extracted thylakoid membrane protein complex was subjected to Blue native-PAGE gel electrophoresis and the cells were photographed by transmission electron microscopy. The results are shown in Figure 5Photos a to c show that when grown under normal temperature conditions (Control), there is little difference between Arabidopsis wild-type WT and transgenic lines (A1, A2, and A3). However, after heat treatment (Heat), the protein bands in Arabidopsis wild-type WT significantly weakened, while those in transgenic lines only slightly weakened, indicating that nuclear expression of the psbA gene protects the thylakoid membrane and enhances plant heat tolerance. When grown under normal temperature conditions (Control), there is little difference between tobacco wild-type WT and transgenic lines (T6, T13, and T58). However, after heat treatment, the protein bands in tobacco wild-type WT significantly weakened, while those in transgenic lines only slightly weakened, indicating that nuclear expression of the psbA gene protects the thylakoid membrane and enhances plant heat tolerance. When grown under normal temperature conditions (Control), there was little difference between the wild-type rice WT and the transgenic lines (R3, R13, and R23). However, after heat treatment, the protein bands of the wild-type rice WT became significantly weaker, while those of the transgenic lines became slightly weaker, indicating that the nuclear expression of the psbA gene has a protective effect on the thylakoid membrane and enhances the plant's heat tolerance.

[0163] Depend on Figure 5 As shown in photos df, the chloroplast structures of the wild-type and transgenic lines of the three plants are similar and show little change when grown under normal temperature (Control). However, after heat treatment (Heat), the chloroplast structures of the wild-type plants differ significantly from those under normal conditions (Control), while the transgenic lines show only slight changes. These photos indicate that nuclear expression of the psbA gene protects the thylakoid membrane under heat treatment.

[0164] 4.8 Investigate the PSII quantum yield in plants.

[0165] Three plants were taken: wild type WT and transformed with pHsfA2::RbcS PTP The PSII quantum yield (Φ) of the detached leaves of the transgenic lines carrying the -psbA vector were measured in the normal temperature condition (Control) and the heat treatment (Heat) recovery stage according to the method described in the following literature. PSII ) and photon density (PPFD):

[0166] Lu Y,Hall DA,Last RL(2011)A small zinc finger thylakoid protein playsarole in maintenance of photosystem II in Arabidopsis thaliana.Plant Cell.23:1861–1875.

[0167] like Figure 6 As shown, the results showed that nuclear expression of the psbA gene increased the PSII quantum yield under both normal and heat-treated conditions.

[0168] 4.9 Investigate the PSII quantum yield in plants.

[0169] Three plants were taken: wild type WT and transformed with pHsfA2::RbcS PTP The electron transport rate of detached leaves of transgenic lines carrying the -psbA vector, grown under normal temperature conditions (Control) and during the recovery phase of heat treatment (Heat), was measured according to the method described in the following literature:

[0170] Lu Y,Hall DA,Last RL(2011)A small zinc finger thylakoid protein plays a role in maintenance of photosystem II in Arabidopsis thaliana.PlantCell.23:1861–1875.

[0171] like Figure 7 As shown, the results showed that nuclear expression of the psbA gene increased the electron transport rate under both normal and heat treatment conditions.

[0172] 4.10 Investigating the Effects of the psbA Gene on Plant Growth and Biomass

[0173] Arabidopsis and tobacco wild type WT and transformed with pHsfA2::RbcS PTP The transgenic lines carrying the -psbA vector were grown under normal temperature conditions (Control), and the plants were photographed regularly (21 days, 23 days, and 27 days for Arabidopsis; 45 days, 56 days, and 73 days for tobacco), and the epidermal cells of detached leaves were observed under scanning electron microscopy. Figure 8At the same growth time, wild-type Arabidopsis thaliana WT plants were significantly smaller than transgenic lines, and their cell size was also smaller. At the same growth time, wild-type tobacco WT plants were significantly smaller than transgenic lines, and their cell size was also smaller. These results indicate that nuclear expression of the psbA gene can promote plant growth and increase biomass.

[0174] 4.11 Investigating the Effects of the psbA Gene on Lincomycin Resistance and CO2 Assimilation Rate in Plants

[0175] Arabidopsis wild type (WT) and transformed with pHsfA2::RbcS PTP -psbA vector transgenic lines (A1, A2, A3) were treated with different concentrations of lincomycin and then grown to observe the survival rate of seedlings. Plants not treated with lincomycin were used as controls. Figure 9 a, When not treated with lincomycin, wild type (WT) and transformed pHsfA2::RbcS PTP The seedling growth phenotypes of transgenic lines expressing the psbA vector were similar. When treated with 20-60 μM lincomycin, wild-type (WT) plants gradually became smaller and had a lower seedling survival rate than transgenic lines (A1, A2, and A3). When the lincomycin concentration reached 100 μM, both wild-type and transgenic seedlings struggled to grow normally. This result suggests that nuclear expression of psbA can enhance lincomycin resistance.

[0176] According to the method described in the following literature, three plants of wild type WT and transformed pHsfA2::RbcS were tested. PTP Net CO2 assimilation rate of transgenic lines carrying -psbA vector under normal growth conditions:

[0177] Feilke,K.Streb,P.Cornic,G.et al.,(2016).Effect of Chlamydomonasplastid terminal oxidase 1expressed in tobacco on photosynthetic electrontransfer.Plant Journal.85:219-228.

[0178] Figure 9 bd show the statistical graphs of the net CO2 assimilation rate of Arabidopsis, tobacco, and rice, respectively. The net CO2 assimilation rate of the transgenic lines was higher than that of the wild type, indicating that nuclear expression of psbA can increase the CO2 assimilation rate of the plant.

[0179] Example 5: Rice field experiment

[0180] From 2016 to 2017, the temperature in my country was relatively high. The yield measurement experiment of transgenic rice lines under field conditions was carried out for three consecutive growing seasons at the breeding bases in Songjiang, Shanghai (N30°56′36″, E121°07′26″) and Lingshui, Sanya, Hainan (N18°30′58″, E110°0′36″); and in 2019, a small plot investigation and verification of rice fields was carried out again at the Songjiang breeding base in Shanghai.

[0181] 5.1 Investigate the effects of the psbA gene on rice biomass and grain yield.

[0182] Phenotypic photos of mature wild-type (WT) and transgenic rice lines (R3, R13, and R23) grown in the field in Songjiang in 2016 are shown in Figure 10 As shown in Figure a, the transgenic lines are taller than wild-type plants, with more ears and grains. Averaged per plant, the transgenic lines also exhibited higher tiller numbers, aboveground biomass, and grain yield than the wild-type (see Figures bd). These results indicate that nuclear expression of psbA increases rice biomass and grain yield. Compared to the wild-type, the biomass increase in the transgenic lines ranged from 20.6% to 22.9%.

[0183] 5.2 Investigate the effect of psbA gene on rice biomass and grain yield.

[0184] Average tiller number per plant (a, n=30), average aboveground biomass (b, n=36), and average grain yield (c, n=36) of wild-type (WT) and transgenic rice lines (R3, R13, and R23) grown in fields in Lingshui County, Hainan Province in 2016. Figure 11 Based on the average statistics of each plant, the transgenic lines had higher tiller number, aboveground biomass, and grain yield than the wild type (see Figures ac). These results indicate that nuclear expression of psbA increased rice biomass and grain yield across different regions. Compared to the wild type, the biomass increase in the transgenic lines ranged from 20.6% to 22.9%.

[0185] 5.3 Investigate the effect of psbA gene on rice biomass and grain yield.

[0186] The aboveground biomass (biomass per plot) (n=3) and grain yield (grain yield per plot) (n=3) of wild-type rice (WT) and transgenic lines (R3, R13, and R23) grown in the field at Songjiang in 2017 are shown in Table 2. Figure 12Based on the average statistics for each plot, the aboveground biomass and grain yield of the transgenic lines were higher than those of the wild type (see Figures a and b). These results indicate that nuclear expression of psbA increased rice biomass and grain yield. Compared to the wild type, the biomass increase in the transgenic lines ranged from 20.6% to 22.9%.

[0187] 5.4 Further investigate the effect of psbA gene on rice biomass and grain yield.

[0188] The aboveground biomass (biomass per plot) (n=5) and grain yield (grain yield per plot) (n=5) of rice empty vector (EV) and transgenic line R3 grown in the field in Songjiang in 2019 are shown in Figure 2. Figure 13 According to the average statistics of each plot, the aboveground biomass and grain yield of the transgenic line R3 were higher than those of the empty carrier, as shown in Figures a and b. The results showed that the transgenic line R3 expressing psbA in the nucleus had certain comparative advantages in rice biomass and grain yield, with the yield increase ranging from 8.1% to 21.0%.

[0189] The above experiments show that expressing the chloroplast gene psbA in the nucleus significantly improves plant photosynthetic efficiency, product yield, high temperature resistance, and adaptability to harsh environments. When applied to rice, the present invention can increase rice biomass and grain yield, showing great potential for widespread application. Sequence Listing <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> Application of chloroplast gene psbA in plant improvement <130> SHPI2010093 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2000 <212> DNA <213> Arabidopsis thaliana () <400> 1 ctttgccaat tcctctgtcc tcgataagag ctccaatacc agaaatgagt aaaaaaccaa 60 ctccaatagt tcggattgta ctccatagct gttctttaaa gtgagtcctt tctgtggata 120 tcgtatggat cggtgcacta gcagttccaa ggacaccatc tttgttggt tttcctacgt 180 ttctaaatgc cccaagacct cttcctccct tgcacacca gcaataccta 240 aaagaaaaac agcaaacat ttcccatat tatatagaga atggctcag aagctgctaa 300 tacaaatatg aaagcagga cacaatccaa gtatccattc agatcaac aaacagctc 360 tccctcctta cccacctctt tgcaatgttc gaaccagctc actgatcg agcctatcaa 420 ctttaaccaa tgccttaatg tattccgata acggcagaggc attcgcatgc aaagaaggtt 480 ggctttcaa cattctgata acagcctcag gatcattctct tcgaataagt tctctcagat 540 gtgcaacctc attacktct tctctcac ggactctgcg agcaagcta ccacatac 600 tcgattgaaa cctcgttcgc ggtaaagaag ctccaccacc acccacagct atagataaaa 660 taaaaccaat ttacatcaa aacactctta aaaaacaag aaaaccat aaacggaatc 720 agatttacc tccagtact cccacttag gaaagagga gtaagctcta acagtaagc 780 ttcttaaact gctcaatcc ctttcatgac tcgaacctg tcatcggtga agagaatcaa 840 tacagatgaa gttaattact aatcccaaac tcaaaatgac actagacaac acatgaaaac 900 atttgataa aagtgaatac ttttacccat tttgaatcaa aaaaattgaa actttttata 960 ccaatttcaa aattaggtga cttgggtagt caaataaatc aaatgacaat atcacagaga 1020 caatctagaa tcctaaaaga caacatttg agggcagaga agaatttgag cttctagggt 1080 ttgaaaaata tcatctttag cttatgaatc acaaagatct tgataaaacc catcagaaat 1140 tattatctaa ttagatcaaa tccactacag tatcaaacca aagtcgaaac cttttcgta 1200 ttaaaaattg gataaagggg aaaagagaaa aatgaaacaa aaaccttggt gatgatgcgc 1260 ctccaagcca tcaatcaaat ctctccttca cgatatctta aaaattggtg ttaatgtctg 1320 ataaatcgaa gttcctcgat ctatatcgga aacaaaagac ttcttcgttg tgtttgggga 1380 agaaccgttc taatcttatt ccctaaagtc ttaaaaacac taaattacac gtgagagacc 1440 tgtttggtta tcgggtgaga gaaaaattgt gcagcaggtg gagacacgca cgagatatgtgt 1500 aggtcgcctc ttaagtacat aataccctt ggacataccc aataattcat tttagtaggc 1560 tttttctggc ggcccacatt aaaaagaagg acctagaaca taaattggca tcgttagaaa 1620 tgggcttaag taaaggccca tatgatatat atataaaaaa agagattcta gattagtaac 1680 gaagtttctg gaacattgtc ttgtcttgtc gccacgtgct cacataaatg tcaaagaagc 1�40 ttcaatacag tgaaatgatc ttgtcttgtc tctagaacct tctcttctct ccccttataa 1800 tttcatttct ctctcctcca cgcctcaatc tctcaactca aaactcaaca ttttctgaag 1860 aaagtcgcaa actttaccca aaacccagtt tctaatttta gcaacaaaat caaaaatatc 1920 tacttttgtt tctcgaaagt tacgaaattc atacaatcta gcttatctct gagcttatgg 1980 atttgagata aacaacgaaa 2000 <210> 2 <211> 240 <212> DNA <213> Arabidopsis thaliana() <400> 2 atggcttcct ctatgctctc ttccgctact atggttgcct ctccggctca ggccactatg 60 gtcgctcctt tcaacggact taagtcctcc gctgccttcc cagccacccg caaggctaac 120 aacgacatta cttccatcac aagcaacggc ggaagagtta actgcatgca ggtgtggcct 180 ccgattggaa agaagaagtt tgagactctc tcttaccttc ctgaccttac cgattccgaa 240 <210> 3 <211> 1062 <212> DNA <213> Arabidopsis thaliana() <400> 3 atgactgcaa ttttagagag acgcgaaagc gaaagcctat ggggtcgctt ctgtaactgg 60 ataactagca ctgaaaaccg tctttacatt ggatggtttg gtgttttgat gatccctacc 120 ttattgaccg caacttctgt ttttattatc gcattcattg ctgctcctcc agtagatatt 180 gatggtattc gtgaacctgt ttctggatct cttctttacg gaaacaatat tatttccggt 240 gccattattc ctacttctgc agctattgga ttgcattttt acccaatctg ggaagctgca 300 tccgttgatg aatggctata caacggcggt ccttatgaac taattgttct acacttttta 360 cttggtgtag cttgttatat gggtcgtgag tgggaactta gtttccgtct gggtatgcgt 420 ccttggattg ctgttgcata ttcagctcct gttgcagctg cgactgctgt tttcttgatc 480 tatccaattg gtcagggaag tttttctgat ggtatgcctc taggaatctc tggtactttc 540 aactttatga ttgtattcca ggctgagcac aacattctta tgcacccatt tcacatgtta 600 ggtgtagctg gtgtattcgg cggctccctt tttagtgcta tgcatggttc cttggtaact 660 tctagtttga tcagggaac cacagaaaat gaatctgcta atgaaggtta cagattcggg 780. caagaagaag aaacttacaa cattgtagct gctcacggtt attttggccg attgattttc caatatgcta gtttcaacaa ttctcgttct ttacattct tcttagcggc ttggccggta gtaggtattt ggtttactgc tttaggtatt agtacttgg ctttcaacct aaatggtttc aatttcaacc aatcagtagt tgatagtcaa ggacgtgtta ttaatacttg ggctgatatt attack ctaaccttgg attack atgcatgaac gtaatgctca caacttccct ctagacctag ctgctgttga ggctccatct acaaatggat aa

Claims

1. Chloroplast genes psbA Application in plant improvement, wherein the plant improvement refers to improving the photosynthesis efficiency, biomass, product yield and survivability under heat stress of plants, characterized in that: Also expressed in plant nuclei psbA Genes, including: psbA Heat shock transcription factor gene with nucleotide sequence fused to gene as shown in SEQ ID NO: 1 HsfA2 promoter pHsfA2 , thus constituting a thermally induced psbA Gene expression cassette pHsfA2::psbA , wherein psbA The CDS nucleotide sequence of the gene is shown in SEQ ID NO: 3, and the plant is selected from rice, wheat, corn, soybean, sorghum, cotton, vegetables, and cruciferous plants.

2. The use according to claim 1, characterized in that Will psbA The gene is integrated into the nuclear genome of the plant cell, so that the nuclear genome of the plant cell also expresses the gene. psbA Gene.

3. The use according to claim 1, characterized in that exist psbA A sequence encoding a chloroplast localization signal peptide is added to the gene, so that the psbA protein expressed in the cell nucleus is localized to the chloroplast.

4. The use according to claim 3, characterized in that exist psbA A sequence encoding a chloroplast localization signal peptide was added to the N-terminus of the coding region.

5. The use according to claim 4, characterized in that The sequence encoding the chloroplast localization signal peptide was cloned from RbC gene, and the sequence encoding the chloroplast localization signal peptide PTP, thus forming a fusion gene pHsfA2::RbcS PTP -psbA As another psbA Gene expression cassette.

6. The use according to claim 4, characterized in that The nucleotide sequence of the sequence PTP encoding the chloroplast localization signal peptide is shown in SEQ ID NO:

2.

7. The use according to claim 5, characterized in that The following steps are also included: psbA Genes, or psbA The gene expression cassette was cloned into the expression vector to obtain psbA Gene expression vector, and then construct psbA The gene expression vector is transferred into Agrobacterium, which is then used to transform the plants. Positive plants are obtained through identification at the genome level and transcription level.

8. The use according to claim 7, characterized in that described psbA Gene expression cassette selected from expression cassette pHsfA2:: psbA , or expression cassette pHsfA2::RbcS PTP -psbA .

9. The use according to claim 1, wherein The steps include: 1) Extract Arabidopsis RNA and clone by RT-PCR psbA Gene sequence; 2) Change p HsfA2 Gene and step 1) psbA The genes were sequentially linked into plant binary expression vectors to construct psbA gene expression vectors; 3) The constructed psbA The gene expression vector is transformed into Agrobacterium; 4) Transform the plants with Agrobacterium and obtain positive plants through genomic and transcriptional level identification.

Images