Regulators of MALAT1 expression

Abstract

Embodiments of the present invention provide methods, compounds, and compositions that can be used to inhibit MALAT1 expression, which can be used to treat, prevent, or improve MALAT1-related cancers.

Description

[0001] Sequence Listing

[0002] This application is being filed together with a Sequence Listing in electronic format. The Sequence Listing is being filed as a file named BIOL00359WOSEQ_ST25.txt, created on February 20, 2020, having a size of 596 kb. The information in the electronic format of the Sequence Listing is hereby incorporated by reference in its entirety into this application. Technical Field

[0003] Embodiments of the present invention provide methods, compounds, and compositions useful for inhibiting MALAT1 expression, which can be used to treat, prevent, or improve MALAT1-related cancers. Background Art

[0004] Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) is a non-coding lncRNA expressed in many human cell types and is highly conserved among mammalian species. MALAT1 was initially identified from metastatic NSCLC patients and is upregulated in multiple types of cancers (Zhang X. et al., RNA Biol. 2017, Ping J et al., 2003).

[0005] Certain embodiments provided herein relate to effective and tolerable compounds and compositions useful for inhibiting MALAT1 expression, which can be used to treat, prevent, improve MALAT1-related cancers, or slow their progression. Detailed Description

[0006] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and do not limit the embodiments, as claimed. As used herein, the singular forms include the plural unless otherwise expressly stated. As used herein, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms (such as "includes" and "included") is not limiting.

[0007] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application (including but not limited to patents, patent applications, articles, books, papers, and GenBank and NCBI reference sequence records) are hereby expressly incorporated by reference in their entirety for the portions of the documents discussed herein and incorporated by reference in their entirety.

[0008] It should be understood that the sequences shown in each SEQ ID NO in the examples included herein are not related to any modifications of the sugar moiety, internucleoside bond or nucleobase. Thus, the compounds defined by SEQ ID NO may independently include one or more modifications of the sugar moiety, internucleoside bond or nucleobase. The compounds indicated by the ION numbers indicate combinations of nucleobase sequences, chemical modifications and motifs.

[0009] Unless otherwise indicated, the following terms have the following meanings:

[0010] "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H (H) furanosyl sugar moiety, such as that present in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil).

[0011] "2'-O-methoxyethyl" (also 2'-MOE and 2'-O(CH2)2-OCH3) refers to an O-methoxy-ethyl modification at the 2'-position of the furanosyl ring. The 2'-O-methoxyethyl-modified sugar is a modified sugar.

[0012] "2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside) refers to a nucleoside containing a 2'-MOE-modified sugar moiety.

[0013] "2'-substituted nucleoside" or "2-modified nucleoside" refers to a nucleoside containing a 2'-substituted or 2'-modified sugar moiety. As used herein, "2'-substituted" or "2-modified" with respect to the sugar moiety means that the sugar moiety contains at least one 2'-substituent other than H or OH.

[0014] "3'-target site" refers to the nucleotide in the target nucleic acid that is complementary to the 3'-most nucleotide of a specific compound.

[0015] "5'-target site" refers to the nucleotide in the target nucleic acid that is complementary to the 5'-most nucleotide of a specific compound.

[0016] "5-methylcytosine" refers to cytosine having a methyl group attached to the 5-position.

[0017] "about" means within ±10% of the value. For example, if the statement is "the compound achieves about 70% inhibition of MALAT1", it means that the MALAT1 level within the range of 60% and 80% is inhibited.

[0018] "Administration" refers to the route by which a compound or composition provided herein is introduced into an individual to perform its intended function. Examples of administration routes that can be used include, but are not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

[0019] "Co-administration" or "concomitant administration" means that two or more compounds are administered in any manner such that the pharmacological actions of both are manifested in the patient. Co-administration does not require that the two compounds be in a single pharmaceutical composition, in the same dosage form, by the same administration route, or administered simultaneously. The actions of the two compounds themselves do not need to be manifested simultaneously. The actions only need to overlap for a period of time without co-prolongation in time. Co-administration or concomitant administration encompasses parallel or sequential administration.

[0020] "Improve" means to improve or alleviate at least one indicator, sign, or symptom of a related disease, disorder, or condition. In certain embodiments, improvement includes delaying or slowing the progression or severity of one or more indicators of a condition or disease. The progression or severity of an indicator can be determined by subjective or objective measures known to those of skill in the art.

[0021] "Animal" refers to a human or non-human animal, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates including but not limited to monkeys and chimpanzees.

[0022] As used in the present disclosure, "antibody" refers to an immunoglobulin or a fragment or derivative thereof, and encompasses any polypeptide containing an antigen-binding site, whether produced in vitro or in vivo. The term includes, but is not limited to, polyclonal antibodies, monoclonal antibodies, monospecific antibodies, multispecific antibodies, non-specific antibodies, humanized antibodies, single-chain antibodies, chimeric antibodies, synthetic antibodies, recombinant antibodies, hybrid antibodies, mutant antibodies, and grafted antibodies. For the purposes of the present disclosure, unless otherwise modified by the term "complete" as in "complete antibody", the term "antibody" also includes antibody fragments, such as Fab, F(ab’)2, Fv, scFv, Fd, dAb, and other antibody fragments that retain antigen-binding function (i.e., the ability to specifically bind, for example, CTLA-4 or PD-L1). Generally, such fragments will contain an antigen-binding domain.

[0023] "Anti-CTLA-4 antibody" refers to an antibody or an antigen-binding fragment thereof that specifically binds to a CTLA-4 polypeptide. Exemplary anti-CTLA-4 antibodies are described, for example, in U.S. Patents 6,682,736, 7,109,003, 7,123,281, 7,411,057, 7,824,679, 8,143,379, 7,807,797, and 8,491,895 (where Tremelimumab is 11.2.1), which patents are incorporated herein by reference. Tremelimumab (U.S. Patent 6,682,736) is an exemplary anti-CTLA-4 antibody. The Tremelimumab VL, VH, and CDR amino acid sequences are provided as SEQ ID NOs: 1-8 herein.

[0024] "Anti-OX40 antibody" refers to an antibody or an antigen-binding fragment thereof that specifically binds to OX40. OX40 antibodies include monoclonal and polyclonal antibodies that are specific for OX40 and antigen-binding fragments thereof. In certain aspects, the anti-OX40 antibodies described herein are monoclonal antibodies (or antigen-binding fragments thereof), such as murine monoclonal antibodies, humanized monoclonal antibodies, or fully human monoclonal antibodies. In one specific embodiment, the OX40 antibody is an OX40 receptor agonist, such as the murine anti-human OX40 monoclonal antibody (9B12) described by Weinberg et al., J Immunother 29, 575-585 (2006). In another embodiment, the OX40 antibody is MEDI0562 as described in US 2016 / 0137740, which patent is incorporated herein by reference. The MEDI0562 VH and VL amino acid sequences are provided as SEQ ID NOs: 25-26 herein. In other embodiments, the antibody or antigen-binding fragment thereof that specifically binds to OX40 binds to the same OX40 epitope as mAb 9B12.

[0025] "Anti-PD-L1 antibody" refers to an antibody or an antigen-binding fragment thereof that specifically binds to a PD-L1 polypeptide. Exemplary anti-PD-L1 antibodies are described, for example, in US2013 / 0034559, U.S. Patent 8,779,108, and 9,493,565, which patents are incorporated herein by reference. Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody. The Durvalumab VL, VH, and CDR amino acid sequences are provided as SEQ ID NOs: 9-16 herein. Other anti-PD-L1 antibodies include BMS-936559 (Bristol-Myers Squibb) and MPDL3280A (atezolizumab) (Roche).

[0026] "Anti-PD-1 antibody" refers to an antibody or an antigen-binding fragment thereof that specifically binds to a PD-1 polypeptide. Exemplary anti-PD-1 antibodies are described, for example, in U.S. Pat. Nos. 7,521,051, 8,008,449, 8,354,509, 9,073,994, 9,393,301, 9,402,899, and 9,439,962, which are incorporated herein by reference. Exemplary anti-PD-1 antibodies include, but are not limited to, nivolumab, pembrolizumab, pidilizumab, and AMP-514.

[0027] "Antigen-binding domain", "antigen-binding fragment", and "binding fragment" refer to a part of an antibody molecule that contains the amino acids responsible for the specific binding between the antibody and the antigen. In the case of a large antigen, the antigen-binding domain may bind only a part of the antigen. The part of the antigen molecule responsible for the specific interaction with the antigen-binding domain is called an "epitope" or "antigenic determinant". The antigen-binding domain generally contains the variable region of the antibody light chain (VL) and the variable region of the antibody heavy chain (VH), however, it is not necessary to contain both. For example, the so-called Fd antibody fragment consists only of the VH domain but still retains some antigen-binding functions of the intact antibody. The binding fragments of an antibody are produced by recombinant DNA techniques or by enzymatic or chemical cleavage of the intact antibody. Binding fragments include Fab, Fab’, F(ab’)2, Fv, and single-chain antibodies. Antibodies other than "bispecific" or "bifunctional" antibodies are understood to have the same respective binding sites. Digestion of an antibody with papain yields two identical antigen-binding fragments also called "Fab" fragments, and an "Fc" fragment, which does not have antigen-binding activity but has the ability to crystallize. Digestion of an antibody with pepsin yields an F(ab’)2 fragment in which the two arms of the antibody molecule remain linked and contain two antigen-binding sites. The F(ab’)2 fragment has the ability to cross-link antigens. As used herein, "Fv" refers to the smallest fragment of an antibody that retains the antigen recognition and antigen-binding sites. As used herein, "Fab" refers to a fragment of an antibody that contains the constant domain of the light chain and the CH1 domain of the heavy chain.

[0028] "mAb" refers to a monoclonal antibody. The antibodies of the present disclosure include, but are not limited to, fully natural antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab’, single-chain V-region fragments (scFv), fusion polypeptides, and unconventional antibodies.

[0029] "Antisense activity" refers to any detectable and / or measurable activity attributable to the hybridization of an antisense compound with its target nucleic acid. In certain embodiments, the antisense activity is a decrease in the amount or expression of the target nucleic acid or the protein encoded by such target nucleic acid as compared to the target nucleic acid level or target protein level in the absence of the antisense compound directed against the target.

[0030] "Antisense compound" refers to a compound comprising an oligonucleotide and optionally one or more additional features such as a conjugate group or a terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds such as oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

[0031] "Antisense inhibition" refers to a decrease in the level of a target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid as compared to the level of the target nucleic acid in the absence of the antisense compound.

[0032] "Antisense mechanism" refers to all those mechanisms involving the hybridization of a compound with a target nucleic acid, where the result or effect of the hybridization is target degradation or target occupancy, accompanied by hindrance of cellular machinery involved in, for example, transcription or splicing.

[0033] "Antisense oligonucleotide" refers to an oligonucleotide having a nucleobase sequence complementary to a target nucleic acid or a region or segment thereof. In certain embodiments, the antisense oligonucleotide can specifically hybridize to the target nucleic acid or a region or segment thereof.

[0034] "Bicyclic nucleoside" or "BNA" refers to a nucleoside comprising a bicyclic sugar moiety. "Bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, where the second ring is formed by a bridge connecting two atoms in the first ring to form a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0035] "Branching group" refers to a group of atoms having at least three positions capable of forming covalent bonds with at least three groups. In certain embodiments, the branching group provides multiple reactive sites for attaching a tethered ligand to an oligonucleotide via a conjugation linker and / or a cleavable moiety.

[0036] "Cell targeting moiety" refers to a conjugate group or a part of a conjugate group capable of binding to one or more specific cell types.

[0037] "cEt" or "constrained ethyl" refers to a bicyclic furanosyl sugar moiety containing a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH3)-O-2'.

[0038] "cEt nucleoside" refers to a nucleoside containing a cEt-modified sugar moiety.

[0039] "Chemical modification" in a compound describes a substitution or change in any unit in the compound formed by a chemical reaction relative to the original state of such unit. "Modified nucleoside" refers to a nucleoside independently having a modified sugar moiety and / or a modified nucleobase. "Modified oligonucleotide" refers to an oligonucleotide containing at least one modified internucleoside bond, modified sugar, and / or modified nucleobase.

[0040] "Chemically distinct region" refers to a region of a compound that is chemically different to some extent compared to another region of the same compound. For example, a region having 2'-O-methoxyethyl nucleotides is chemically different from a region having nucleotides without 2'-O-methoxyethyl modification.

[0041] "Chimeric antisense compound" refers to an antisense compound having at least 2 chemically distinct regions, with multiple subunits at each position.

[0042] "Chirally enriched population" refers to a collection of molecules having the same molecular formula, wherein the number or percentage of molecules in the population having a specific stereochemical configuration at a specific chiral center is greater than the number or percentage of molecules in the population that would be expected to have the same specific stereochemical configuration at the same specific chiral center if the specific chiral center were atactic. A chirally enriched population of molecules having multiple chiral centers within each molecule may contain one or more atactic chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds containing modified oligonucleotides.

[0043] "Cleavable bond" refers to any chemical bond that is capable of being cleaved. In certain embodiments, the cleavable bond is selected from: amide, polyamide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, disulfide, or peptide.

[0044] "Cleavable moiety" refers to a bond or group of atoms that is cleaved under physiological conditions (e.g., in a cell, animal, or human body).

[0045] "Complementary" with respect to oligonucleotides means that when two nucleobase sequences are aligned in opposite directions, the nucleobase sequence of such oligonucleotides or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof. Unless otherwise specified, nucleobase matches or complementary nucleobases as described herein are limited to the following pairs: adenine (A) with thymine (T), adenine (A) with uracil (U), cytosine (C) with guanine (G), and 5-methylcytosine ( m C) with guanine (G). Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. In contrast, "fully complementary" or "100% complementary" with respect to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

[0046] "Conjugating group" means a group of atoms attached to an oligonucleotide. A conjugating group includes a conjugating moiety and a conjugating linker that attaches the conjugating moiety to the oligonucleotide.

[0047] "Conjugating linker" means a group of atoms that includes at least one bond that attaches a conjugating moiety to an oligonucleotide.

[0048] "Conjugating moiety" means a group of atoms attached to an oligonucleotide through a conjugating linker.

[0049] "Contiguous" in the context of an oligonucleotide means that nucleosides, nucleobases, sugar moieties, or internucleoside bonds are adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are adjacent to each other in a sequence.

[0050] "Designed" or "designed to" means the process of designing a compound that specifically hybridizes to a selected nucleic acid molecule.

[0051] "Diluent" means a component of a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, a diluent in an injectable composition can be a liquid, such as a saline solution.

[0052] "Differently modified" means chemically modified or chemical substituents that are different from each other, including the absence of modification. Thus, for example, MOE nucleosides and unmodified DNA nucleosides are "differently modified", even though the DNA nucleosides are unmodified. Similarly, DNA and RNA are "differently modified", even though both are naturally occurring unmodified nucleosides. Nucleosides that are the same and do not contain different nucleobases are not differently modified. For example, a nucleoside containing a 2'-OMe-modified sugar and an unmodified adenine nucleobase and a nucleoside containing a 2'-OMe-modified sugar and an unmodified thymine nucleobase are not differently modified.

[0053] "Dose" means a specified amount of a compound or agent provided in a single administration or over a specified period of time. In certain embodiments, a dose may be administered by bolus, tablet, or injection two or more times. For example, in certain embodiments, when subcutaneous administration is desired, the desired dose may require a volume that is not easily provided by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered by injection two or more times to minimize injection site reactions in an individual. In other embodiments, the compound or agent is administered by infusion over an extended period of time or in a continuous manner. A dose may be specified as the amount of agent per hour, per day, per week, or per month.

[0054] "Dosing regimen" is a combination of doses designed to achieve one or more desired effects.

[0055] "Double-stranded antisense compound" means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a double helix, and wherein one of the two oligomeric compounds comprises an oligonucleotide.

[0056] "Effective amount" means the amount of a compound sufficient to achieve a desired physiological result in an individual in need of the compound. The effective amount may vary in an individual depending on factors such as the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated, the formulation of the composition, the assessment of the medical condition of the individual, and other relevant factors.

[0057] "Efficacy" means the ability to produce a desired effect.

[0058] "Expression" includes all functions by which the coding information of a gene is converted into a structure that is present and operative in a cell. Such structures include, but are not limited to, the products of transcription and translation.

[0059] "Gapmer" means an oligonucleotide that comprises an internal region having a plurality of nucleosides that support ribonuclease H cleavage between outer regions having one or more nucleosides, wherein the nucleosides that make up the internal region are chemically different from the one or more nucleosides that make up the outer regions. The internal region may be referred to as the "gap" and the outer regions may be referred to as the "flanks".

[0060] "Hybridization" means the annealing of an oligonucleotide and / or nucleic acid. While not limited to a specific mechanism, the most common hybridization mechanism involves hydrogen bonding between complementary nucleobases, which may be Watson-Crick hydrogen bonding, Hoogsteen hydrogen bonding, or reverse Hoogsteen hydrogen bonding. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0061] "Adjacent" means that there are no intervening elements between adjacent elements of the same type (e.g., no intervening nucleobases between adjacent nucleobases).

[0062] "Immune checkpoint inhibitor" means an agent that inhibits the expression or activity of a protein that inhibits an immune response. In one embodiment, the immune checkpoint inhibitor is an agent that inhibits the CTLA-4 or PD-1 pathway. Specific checkpoint inhibitors include antibodies that inhibit PD-1, PD-L1, or CTLA-4.

[0063] "Immunomodulator" means an agent that enhances an immune response (e.g., an anti-tumor immune response). Exemplary immunomodulators of the present disclosure include: antibodies, such as anti-CTLA-4 antibodies, anti-PD-L1 antibodies, anti-PD-1 antibodies, and antigenic fragments of any of these antibodies; and OX40 agonists, including proteins, such as OX40 ligand fusion proteins, OX40 antibodies, or fragments thereof. In one embodiment, the immunomodulator is an immune checkpoint inhibitor.

[0064] "Individual" means a human or non-human animal selected for treatment or therapy.

[0065] "Inhibit expression or activity" means a reduction or blockage of expression or activity relative to the expression or activity in an untreated or control sample and does not necessarily indicate complete elimination of expression or activity.

[0066] "Internucleoside bond" means a group or bond that forms a covalent bond between adjacent nucleosides in an oligonucleotide. "Modified internucleoside bond" means any internucleoside bond other than the naturally occurring phosphodiester internucleoside bond. Non-phosphodiester bonds are referred to herein as modified internucleoside bonds.

[0067] "Extended oligonucleotide" refers to those oligonucleotides that have one or more additional nucleosides relative to the oligonucleotides disclosed herein (e.g., the parental oligonucleotide).

[0068] "Linked nucleosides" means adjacent nucleosides that are joined together by an internucleoside bond.

[0069] "Linker-nucleoside" means the nucleoside that links an oligonucleotide to a conjugate moiety. The linker-nucleoside is located within the conjugate linker of the compound. Linker-nucleosides are not considered part of the oligonucleotide portion of the compound, even if they are contiguous with the oligonucleotide.

[0070] "Mismatch" or "non-complementary" means that when aligning a first oligonucleotide and a second oligonucleotide, the nucleobases of the first oligonucleotide are not complementary to the corresponding nucleobases of the second oligonucleotide or the target nucleic acid. For example, nucleobases including, but not limited to, universal nucleobases, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary relative to the nucleobase with which they hybridize. As another example, when aligning a first oligonucleotide and a second oligonucleotide, nucleobases of the first oligonucleotide that are not capable of hybridizing with the corresponding nucleobases of the second oligonucleotide or the target nucleic acid are mismatched or non-complementary nucleobases.

[0071] "Modulate" means to change or adjust a characteristic in a cell, tissue, organ, or organism. For example, modulating MALAT1 RNA can refer to increasing or decreasing the level of MALAT1 RNA and / or MALAT1 protein in a cell, tissue, organ, or organism. A "modulator" affects a change in a cell, tissue, organ, or organism. For example, a MALAT1 compound can be a modulator that decreases the amount of MALAT1 RNA and / or MALAT1 protein in a cell, tissue, organ, or organism.

[0072] "MOE" means methoxyethyl.

[0073] "Monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

[0074] "Motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0075] "Native" or "naturally occurring" means existing in nature.

[0076] "Non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" means a modified sugar moiety that contains a modification (such as a substitution) that does not form a bridge between two atoms of the sugar to form a second ring.

[0077] "Nucleic acid" means a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

[0078] "Nucleobase" means a heterocyclic moiety capable of base pairing with a base of another nucleic acid. As used herein, "naturally occurring nucleobases" are adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). "Modified nucleobases" are naturally occurring nucleobases that have been chemically modified. "Universal base" or "universal nucleobase" is a nucleobase other than naturally occurring nucleobases and modified nucleobases and is capable of base pairing with any nucleobase.

[0079] "Nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide that is independent of any sugar or internucleoside linkage.

[0080] "Nucleoside" means a compound containing a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently unmodified or modified. "Modified nucleoside" means a nucleoside containing a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides lacking a nucleobase.

[0081] "Oligomeric compound" means a compound containing a single oligonucleotide and optionally one or more additional features such as a conjugate group or a terminal group.

[0082] "Oligonucleotide" means a polymer of linked nucleosides that may each independently be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8 - 80 linked nucleosides. "Modified oligonucleotide" means an oligonucleotide in which at least one sugar, nucleobase, or internucleoside linkage is modified. "Unmodified oligonucleotide" means an oligonucleotide that does not contain any modification of sugar, nucleobase, or internucleoside.

[0083] "Parent oligonucleotide" means an oligonucleotide whose sequence is used as a design basis for more oligonucleotides having similar sequences but different lengths, motifs, and / or chemical properties. The newly designed oligonucleotides may have the same or overlapping sequences as the parent oligonucleotide.

[0084] "Parenteral administration" means administration by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra - arterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intraventricular administration.

[0085] "Pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to an individual. For example, a pharmaceutically acceptable carrier may be a sterile aqueous solution such as PBS or water for injection.

[0086] "Pharmaceutically acceptable salt" means a physiologically and pharmaceutically acceptable salt of a compound such as an oligomeric compound or an oligonucleotide, i.e., a salt that retains the desired biological activity of the parent compound and does not confer undesired toxicological effects.

[0087] "Pharmaceutical agent" means a compound that provides a therapeutic benefit when administered to an individual.

[0088] "Pharmaceutical composition" means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition may contain one or more compounds or their salts and a sterile aqueous solution.

[0089] "Phosphorothioate bond" means a modified phosphate bond in which one of the non - bridging oxygen atoms is replaced by a sulfur atom. A phosphorothioate internucleoside bond is a modified internucleoside bond.

[0090] "Phosphorus moiety" refers to a group containing a phosphorus atom. In certain embodiments, the phosphorus moiety comprises a monophosphate, diphosphate or triphosphate or a phosphorothioate.

[0091] "Moiety" refers to a defined number of consecutive (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, the moiety is a defined number of consecutive nucleobases of a target nucleic acid. In certain embodiments, the moiety is a defined number of consecutive nucleobases of an oligomeric compound.

[0092] "Prevent" means to delay or pre - hinder the onset, development or progression of a disease, disorder or condition for a period ranging from several minutes to an indefinite period.

[0093] "Prodrug" refers to a compound that is in one form in vitro and metabolizes in vivo or within its cells to another form when administered to an individual. In certain embodiments, the metabolized form is the active or more active form of the compound (e.g., a drug). Generally, the conversion of a prodrug in vivo is facilitated by the action of one or more enzymes (e.g., endogenous enzymes or viral enzymes) or one or more chemical substances present in cells or tissues and / or by physiological conditions.

[0094] "Reduce" means to decrease to a lesser degree, size, amount or number.

[0095] "RefSeq No." is a unique combination of letters and numbers assigned to a sequence to indicate the specific target transcript (e.g., target gene) of the sequence. Such sequences and information regarding target genes (collectively referred to as gene records) can be found in gene sequence databases. Gene sequence databases include the NCBI Reference Sequence Database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three form the International Nucleotide Sequence Database Collaboration or INSDC).

[0096] "Region" is defined as a part of a target nucleic acid that has at least one identifiable structure, function or characteristic.

[0097] "RNAi compound" refers to an antisense compound that acts at least in part through RISC or Ago2 but not through ribonuclease H to regulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double - stranded siRNA, single - stranded RNA (ssRNA), and microRNA (including microRNA mimics).

[0098] "Segment" is defined as a smaller part or sub - part of a region within a nucleic acid.

[0099] "Side effect" refers to a physical illness and / or condition attributable to treatment other than the desired effect. In certain embodiments, side effects include injection site reactions, abnormal liver function tests, abnormal kidney function, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, myopathy, and discomfort. For example, an increase in the level of transaminases in serum may indicate hepatotoxicity or abnormal liver function. For example, an increase in bilirubin may indicate hepatotoxicity or abnormal liver function.

[0100] "Single-stranded" with respect to a compound means that the compound has only one oligonucleotide. "Self-complementary" means that the oligonucleotide hybridizes at least in part to itself. A compound consisting of one oligonucleotide is a single-stranded compound, wherein the oligonucleotide of the compound is self-complementary. A single-stranded compound may be capable of binding to a complementary compound to form a double helix.

[0101] "Site" is defined as a unique nucleobase position within a target nucleic acid.

[0102] "Specifically hybridizable" means that an oligonucleotide has a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effect on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

[0103] "Specific inhibition" with respect to a target nucleic acid means reducing or blocking the expression of the target nucleic acid, while exhibiting less, minimal, or no effect on non-target nucleic acids. Reducing does not necessarily indicate complete elimination of target nucleic acid expression.

[0104] "Standard cell assay" refers to one or more of the assays described in the Examples and reasonable variations thereof.

[0105] "Standard in vivo experiment" refers to one or more of the procedures described in one or more of the Examples and reasonable variations thereof.

[0106] In the context of a population of molecules having the same molecular formula, a "stereorandom chiral center" refers to a chiral center having a random stereochemical configuration. For example, in a population of molecules containing a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as, but not necessarily the same as, the number of molecules having the (R) configuration of the stereorandom chiral center. When the stereochemical configuration of a chiral center is the result of a synthetic method that is not designed to control the stereochemical configuration, it is considered random. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside bond.

[0107] "Sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. "Unmodified sugar moiety" or "unmodified sugar" refers to a 2'-OH(H) furanosyl moiety, as present in RNA ("unmodified RNA sugar moiety"); or a 2'-H(H) moiety, as present in DNA ("unmodified DNA sugar moiety"). The unmodified sugar moiety has a hydrogen at each of the 1', 3' and 4' positions, an oxygen at the 3' position and two hydrogens at the 5' position. "Modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or a sugar substitute. "Modified furanosyl sugar moiety" refers to a furanosyl sugar containing a non-hydrogen substituent that replaces at least one hydrogen of the unmodified sugar moiety. In certain embodiments, the modified furanosyl sugar moiety is a 2'-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

[0108] "Sugar substitute" refers to a modified sugar moiety that has a moiety (such as an internucleoside bond, a conjugating group or a terminal group in an oligonucleotide) other than a furanosyl moiety that can link a nucleobase to another group. A modified nucleoside containing a sugar substitute can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides are capable of hybridizing to a complementary compound or nucleic acid.

[0109] "Synergy" or "synergize" refers to a combined effect that is greater than the additive effect of the individual components at the same doses.

[0110] "MALAT1" refers to any nucleic acid or protein of MALAT1. "MALAT1 nucleic acid" refers to any nucleic acid encoding MALAT1. For example, in certain embodiments, the MALAT1 nucleic acid includes a DNA sequence encoding MALAT1, an RNA sequence transcribed from DNA encoding MALAT1 (including genomic DNA containing introns and exons), and an mRNA sequence encoding MALAT1. "MALAT1 mRNA" refers to the mRNA encoding the MALAT1 protein. Targets may be referred to in upper or lower case.

[0111] "MALAT1-specific inhibitor" refers to any agent that can specifically inhibit MALAT1 RNA and / or MALAT1 protein expression or activity at the molecular level. For example, MALAT1-specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules and other agents that can inhibit the expression of MALAT1 RNA and / or MALAT1 protein.

[0112] "Target gene" refers to the gene encoding the target.

[0113] "Targeting" refers to the specific hybridization of a compound to a target nucleic acid to induce a desired effect.

[0114] "Target nucleic acid", "target RNA", "target RNA transcript", and "nucleic acid target" all refer to a nucleic acid that can be targeted by a compound described herein.

[0115] "Target region" refers to the portion of a target nucleic acid that is targeted by one or more compounds.

[0116] "Target segment" refers to the nucleotide sequence of a target nucleic acid that is targeted by a compound. "5'-target site" refers to the 5'-most terminal nucleotide of the target segment. "3'-target site" refers to the 3'-most terminal nucleotide of the target segment.

[0117] "Terminal group" refers to a chemical group or moiety covalently attached to the end of an oligonucleotide.

[0118] "Therapeutically effective amount" refers to the amount of a compound, agent, or composition that provides a therapeutic benefit to an individual.

[0119] "Treatment" refers to the administration of a compound or pharmaceutical composition to an animal to effect a change or improvement in a disease, disorder, or condition in the animal.

[0120] Certain embodiments

[0121] Certain embodiments provide methods, compounds, and compositions for inhibiting MALAT1 expression.

[0122] Certain embodiments provide compounds that target MALAT1 nucleic acids. In certain embodiments, the MALAT1 nucleic acid has the sequence shown in RefSeq or GENBANK accession number XR_001309.1 (SEQ ID NO:1) (which is incorporated by reference in its entirety) or GENBANK accession number EF177381.1 (SEQ ID NO:2824) (which is incorporated by reference in its entirety). In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0123] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 8 to 80 linked nucleosides and having a nucleobase sequence of at least 8 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 10 to 30 linked nucleosides.

[0124] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 8 to 80 linked nucleosides and having a nucleobase sequence of at least 8 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 10 to 30 linked nucleosides.

[0125] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 9 to 80 linked nucleosides and having a nucleobase sequence of at least 9 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 10 to 30 linked nucleosides.

[0126] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 9 to 80 linked nucleosides and having a nucleobase sequence of at least 9 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 10 to 30 linked nucleosides.

[0127] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 10 to 80 linked nucleosides and having a nucleobase sequence of at least 10 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 10 to 30 linked nucleosides.

[0128] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 10 to 80 linked nucleosides and having a nucleobase sequence of at least 10 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 10 to 30 linked nucleosides.

[0129] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 11 to 80 linked nucleosides and having a nucleobase sequence of at least 11 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 11 to 30 linked nucleosides.

[0130] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 11 to 80 linked nucleosides and having a nucleobase sequence of at least 11 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 11 to 30 linked nucleosides.

[0131] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 12 to 80 linked nucleosides and having a nucleobase sequence of at least 12 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 12 to 30 linked nucleosides.

[0132] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 consecutive nucleobases of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 12 to 30 linked nucleosides.

[0133] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 16 to 30 linked nucleosides.

[0134] Certain embodiments provide a compound comprising a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is composed of 16 to 30 linked nucleosides.

[0135] Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence composed of a nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0136] Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence composed of a nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0137] In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase segments that are complementary to an equally sized segment within nucleotides 1535-1550, 2034-2049, 2341-2356, 4821-4836, 4840-4855, 4931-4946, 5049-5064, 5494-5509, or 5495-5510 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

[0138] In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary within nucleotides 1535-1550, 2034-2049, 2341-2356, 4821-4836, 4840-4855, 4931-4946, 5049-5064, 5494-5509, or 5495-5510 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

[0139] In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence that comprises at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase segments of the nucleobase sequence of any one of SEQ ID NO:2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

[0140] In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence that comprises at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase segments of the nucleobase sequence of any one of SEQ ID NO:2-10. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

[0141] In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide is composed of 16 to 30 linked nucleosides.

[0142] In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide is composed of 16 to 30 linked nucleosides.

[0143] In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813.

[0144] In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10.

[0145] In certain embodiments, at least one internucleoside bond of any of the foregoing modified oligonucleotides is a modified internucleoside bond, at least one sugar of any of the foregoing modified oligonucleotides is a modified sugar, and / or at least one nucleobase of any of the foregoing modified oligonucleotides is a modified nucleobase.

[0146] In certain embodiments, at least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar. In certain embodiments, the modified sugar comprises 2'-O-methoxyethyl. In certain embodiments, the modified sugar is a bicyclic sugar such as a 4'-CH(CH3)-O-2' group, a 4'-CH2-O-2' group, or a 4'-(CH2)2-O-2' group.

[0147] In certain embodiments, at least one internucleoside bond of the modified oligonucleotide is a modified internucleoside bond such as a phosphorothioate internucleoside bond.

[0148] In certain embodiments, at least one nucleobase of any of the foregoing modified oligonucleotides is a modified nucleobase such as 5-methylcytosine.

[0149] In certain embodiments, any of the foregoing modified oligonucleotides has:

[0150] a gap segment composed of linked 2'-deoxynucleosides;

[0151] A 5' flanking segment, which consists of linked nucleosides; and

[0152] A 3' flanking segment, which consists of linked nucleosides;

[0153] wherein a spacer segment is located between the 5' flanking segment and the 3' flanking segment and wherein each nucleoside of each flanking segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising any one of those shown in SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising any one of those shown in SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising any one of those shown in SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising any one of those shown in SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of any one of those shown in SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of any one of those shown in SEQ ID NOs: 2-10.

[0154] In certain embodiments, the compound comprises or consists of a modified oligonucleotide, the modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising any one of those shown in SEQ ID NOs: 2-10 or 36-2813, wherein the modified oligonucleotide has:

[0155] A spacer segment, which consists of linked 2'-deoxynucleosides;

[0156] A 5' flanking segment, which consists of linked nucleosides; and

[0157] A 3' flanking segment, which consists of linked nucleosides;

[0158] wherein the spacer segment is located between the 5' flanking segment and the 3' flanking segment and wherein each nucleoside of each flanking segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0159] In certain embodiments, the compound comprises or consists of a modified oligonucleotide, the modified oligonucleotide consisting of from 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence shown in any one of SEQ ID NOs: 2-10, wherein the modified oligonucleotide has:

[0160] a gap segment consisting of linked 2'-deoxynucleosides;

[0161] a 5' flanking segment consisting of linked nucleosides; and

[0162] a 3' flanking segment consisting of linked nucleosides;

[0163] wherein the gap segment is located between the 5' flanking segment and the 3' flanking segment and wherein each nucleoside of each flanking segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of from 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0164] In certain embodiments, the compound comprises or consists of a modified oligonucleotide, the modified oligonucleotide consisting of from 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence shown in any one of SEQ ID NOs: 36-2646 or 2664-2813, wherein the modified oligonucleotide has:

[0165] a gap segment consisting of 10 linked 2'-deoxynucleosides;

[0166] a 5' flanking segment consisting of 3 linked nucleosides; and

[0167] a 3' flanking segment consisting of 3 linked nucleosides;

[0168] wherein the gap segment is located between the 5' flanking segment and the 3' flanking segment; wherein each nucleoside of each flanking segment comprises a cEt nucleoside; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of from 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0169] In certain embodiments, the compound comprises or consists of a modified oligonucleotide, the modified oligonucleotide consisting of from 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence shown in any one of SEQ ID NOs: 2-7, wherein the modified oligonucleotide has:

[0170] a gap segment consisting of 10 linked 2'-deoxynucleosides;

[0171] A 5’ flanking segment, which consists of 3 linked nucleosides; and

[0172] A 3’ flanking segment, which consists of 3 linked nucleosides;

[0173] wherein the spacer segment is located between the 5’ flanking segment and the 3’ flanking segment; wherein each nucleoside of each flanking segment comprises a cEt nucleoside; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0174] In certain embodiments, the compound comprises or consists of a modified oligonucleotide having a nucleobase sequence comprising any one of those shown in SEQ ID NOs: 8-10; wherein the modified oligonucleotide comprises the glycosyl motif kkk-d-y-d(8)-kkk, wherein "k" indicates a cEt-modified sugar moiety, "d" indicates an unmodified 2'-deoxyribosyl sugar moiety, and "y" indicates a 2'-O-methyl-modified sugar moiety; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0175] In certain embodiments, the compound comprises or consists of ION 1304884 having the nucleobase sequence and chemical motif: GksGksAksTdsUysAdsAdsTdsGdsTdsAdsGdsTdsGksTksAk (SEQ ID NO:8), wherein "d" represents 2'-deoxyribose, "k" represents a cEt-modified sugar, "y" represents a 2'-O-methyl-modified sugar, "s" represents a phosphorothioate internucleoside bond, and "mC" refers to 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0176] In certain embodiments, the compound comprises or consists of ION 1304890 having a nucleobase sequence and chemical motif: GksGksTksTdsAysTdsAdsGdsmCdsTdsTdsGdsAdsmCksAksAk (SEQ ID NO:9), wherein "d" represents 2'-deoxyribose, "k" represents a cEt-modified sugar, "y" represents a 2'-O-methyl-modified sugar, "s" represents a phosphorothioate internucleoside linkage, and "mC" refers to 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0177] In certain embodiments, the compound comprises or consists of ION 1304906 having a nucleobase sequence and chemical motif: GksmCksAksGdsAysTdsAdsAdsTdsGdsTdsTdsmCdsTksmCksAk (SEQ ID NO:10), wherein "d" represents 2'-deoxyribose, "k" represents a cEt-modified sugar, "y" represents a 2'-O-methyl-modified sugar, "s" represents a phosphorothioate internucleoside linkage, and "mC" refers to 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0178] Certain embodiments provide a modified oligonucleotide according to the following chemical structure:

[0179]

[0180] (SEQ ID NO:6), or a salt thereof. In certain embodiments, the modified oligonucleotide is a sodium salt or a potassium salt.

[0181] Certain embodiments provide a modified oligonucleotide according to the following chemical structure:

[0182]

[0183] (SEQ ID NO:6).

[0184] Under certain conditions, certain compounds disclosed herein function as acids. Although such compounds may be depicted or described in their protonated (free acid) form or ionized and associated with a cation (salt) form, the aqueous solutions of such compounds exist in a state of equilibrium between such forms. For example, the phosphate ester bonds of oligonucleotides in aqueous solution exist in a state of equilibrium between the free acid, anion, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. In addition, certain oligonucleotides have several such bonds, each in equilibrium. Thus, an oligonucleotide in solution exists as an ensemble of forms that are in equilibrium at multiple positions. Unless otherwise indicated, the oligonucleotides described herein and the term "oligonucleotide" are intended to include all such forms. The structures depicted necessarily portray a single form. However, unless otherwise indicated, such diagrams are also intended to include the corresponding forms. In this document, a structure depicting the free acid of a compound (followed by the term "or a salt thereof") explicitly includes all such forms that may be fully or partially protonated / deprotonated / associated with a cation. In certain cases, one or more specific cations are identified.

[0185] In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding MALAT1.

[0186] In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound.

[0187] In any of the foregoing embodiments, the compound can be composed of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In certain embodiments, the compound comprises or consists of an oligonucleotide.

[0188] In certain embodiments, the compounds or compositions provided herein comprise salts of modified oligonucleotides. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

[0189] In certain embodiments, the compounds or compositions as described herein are highly tolerable, as demonstrated by at least one of the following: an increase in alanine aminotransferase (ALT) or aspartate aminotransferase (AST) values of no more than 4-fold, 3-fold, or 2-fold compared to saline-treated animals; or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control-treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable, as demonstrated by no increase in ALT or AST compared to control-treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable, as demonstrated by no increase in liver, spleen, or kidney weight compared to control animals.

[0190] Certain embodiments provide a composition comprising a compound or a salt thereof as described in any of the foregoing embodiments and at least one pharmaceutically acceptable carrier or diluent. In certain embodiments, the viscosity of the composition is less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 centipoise (cP). In certain embodiments, a composition having any of the foregoing viscosities comprises a compound provided herein at a concentration of about 100 mg / mL, about 125 mg / mL, about 150 mg / mL, about 175 mg / mL, about 200 mg / mL, about 225 mg / mL, about 250 mg / mL, about 275 mg / mL, or about 300 mg / mL. In certain embodiments, the temperature of a composition having any of the foregoing viscosities and / or compound concentrations is room temperature or about 20 °C, about 21 °C, about 22 °C, about 23 °C, about 24 °C, about 25 °C, about 26 °C, about 27 °C, about 28 °C, about 29 °C, or about 30 °C.

[0191] Non-limiting numbered embodiments include:

[0192] E1. A compound comprising a modified oligonucleotide having a length of 8 to 80 linked nucleosides and having a nucleobase sequence of at least 8 consecutive nucleobases comprising any one of SEQ ID NOs: 2-10.

[0193] E2. A compound comprising a modified oligonucleotide having a length of 9 to 80 linked nucleosides and having a nucleobase sequence of at least 9 consecutive nucleobases comprising any one of SEQ ID NOs: 2-10.

[0194] E3. A compound comprising a modified oligonucleotide having a length of from 10 to 80 linked nucleosides and having a nucleobase sequence of at least 10 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NO: 2-10.

[0195] E4. A compound comprising a modified oligonucleotide having a length of from 11 to 80 linked nucleosides and having a nucleobase sequence of at least 11 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NO: 2-10.

[0196] E5. A compound comprising a modified oligonucleotide having a length of from 12 to 80 linked nucleosides and having a nucleobase sequence of at least 12 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NO: 2-10.

[0197] E6. A compound comprising a modified oligonucleotide having a length of from 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 2-10.

[0198] E7. A compound comprising a modified oligonucleotide having a length of 16 linked nucleosides and having a nucleobase sequence consisting of any one of SEQ ID NO: 2-10.

[0199] E8. A compound comprising a modified oligonucleotide having a length of from 8 to 80 linked nucleosides and being complementary within nucleotides 1535-1550, 2034-2049, 2341-2356, 4821-4836, 4840-4855, 4931-4946, 5049-5064, 5494-5509 or 5495-5510 of SEQ ID NO: 1.

[0200] E9. The compound according to any one of embodiments E1-E8, wherein the modified oligonucleotide comprises at least one modified internucleoside bond, at least one modified sugar or at least one modified nucleobase.

[0201] E10. The compound according to embodiment E9, wherein the modified internucleoside bond is a phosphorothioate internucleoside bond.

[0202] E11. The compound according to embodiment E9 or E10, wherein the modified sugar is a bicyclic sugar.

[0203] Compound as described in embodiment E11, wherein the bicyclic sugar is selected from the group consisting of: 4'-(CH2)-O-2'(LNA); 4'-(CH2)2-O-2'(ENA); and 4'-CH(CH3)-O-2'(cEt).

[0204] E13. A compound as described in embodiment E9 or E10, wherein the modified sugar is 2'-O-methoxyethyl.

[0205] E14. A compound as described in any one of embodiments E9 - E13, wherein the modified nucleobase is 5-methylcytosine.

[0206] E15. A compound as described in any one of embodiments E1 - E14, wherein the modified oligonucleotide comprises:

[0207] A gap segment, which consists of linked 2'-deoxynucleosides;

[0208] A 5' flanking segment, which consists of linked nucleosides; and

[0209] A 3' flanking segment, which consists of linked nucleosides;

[0210] Wherein the gap segment is located between the 5' flanking segment and the 3' flanking segment and each nucleoside of each flanking segment comprises a modified sugar.

[0211] E16. A compound comprising a modified oligonucleotide having a length of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 2 - 10, wherein the modified oligonucleotide comprises:

[0212] A gap segment, which consists of linked 2'-deoxynucleosides;

[0213] A 5' flanking segment, which consists of linked nucleosides; and

[0214] A 3' flanking segment, which consists of linked nucleosides;

[0215] Wherein the gap segment is located between the 5' flanking segment and the 3' flanking segment and each nucleoside of each flanking segment comprises a modified sugar.

[0216] E17. A compound comprising a modified oligonucleotide having a length of 16 - 80 linked nucleobases and having a nucleobase sequence comprising the sequence shown in any one of SEQ ID NOs: 2 - 7, wherein the modified oligonucleotide comprises:

[0217] A gap segment, which consists of 10 linked 2'-deoxynucleosides;

[0218] A 5’ flanking segment, which consists of 3 linked nucleosides; and

[0219] A 3’ flanking segment, which consists of 3 linked nucleosides;

[0220] wherein the spacer segment is located between the 5’ flanking segment and the 3’ flanking segment, wherein each nucleoside of each flanking segment comprises a cEt nucleoside; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine.

[0221] E18. A compound according to any one of embodiments E1-E17, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to SEQ ID NO:1.

[0222] E19. A compound according to any one of embodiments E1-E18, wherein the compound is single-stranded.

[0223] E20. A compound according to any one of embodiments E1-E18, wherein the compound is double-stranded.

[0224] E21. A compound according to any one of embodiments E1-E20, wherein the compound comprises ribonucleotides.

[0225] E22. A compound according to any one of embodiments E1-E20, wherein the compound comprises deoxyribonucleotides.

[0226] E23. A compound according to any one of embodiments E1-E22, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.

[0227] E24. A compound according to any one of the foregoing embodiments, wherein the compound consists of the modified oligonucleotide.

[0228] E25. A compound consisting of a pharmaceutically acceptable salt of any one of the compounds according to embodiments E1-E24.

[0229] E26. A compound according to embodiment 25, wherein the pharmaceutically acceptable salt is a sodium salt.

[0230] E27. A compound according to embodiment 26, wherein the pharmaceutically acceptable salt is a potassium salt.

[0231] E28. A modified oligonucleotide according to the following chemical structure:

[0232]

[0233] (SEQ ID NO:6), or a salt thereof.

[0234] E29. The modified oligonucleotide according to embodiment E28, wherein the modified oligonucleotide is the sodium salt or the potassium salt.

[0235] E30. A modified oligonucleotide having the following chemical structure:

[0236]

[0237] (SEQ ID NO:6).

[0238] E31. A composition comprising a compound according to any one of embodiments E1 - E27 or a modified oligonucleotide according to any one of embodiments E28 - E30 and a pharmaceutically acceptable diluent or carrier.

[0239] E32. A composition comprising a compound according to any one of embodiments E1 - E27 or a modified oligonucleotide according to any one of embodiments E28 - E30 and water.

[0240] E33. A composition comprising a compound according to any one of embodiments E1 - E27 or a modified oligonucleotide according to any one of embodiments E28 - E30, the composition for use in therapy.

[0241] E34. A method of treating or ameliorating cancer in an individual, comprising administering to the individual a compound that targets MALAT1, thereby treating or ameliorating the cancer.

[0242] E35. The method according to embodiment E34, wherein the compound is an antisense compound that targets MALAT1.

[0243] E36. The method as described in embodiment E34 or E35, wherein the cancer is breast cancer; inflammatory breast cancer; ductal breast cancer; lobular breast cancer; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR- and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+ and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B-cell malignancy; lymphoma; B-cell lymphoma; Hodgkin lymphoma; T-cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

[0244] E37. The method as described in any one of embodiments E34-E36, wherein administering the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth or metastasis.

[0245] E38. The method as described in any one of embodiments E34-E37, wherein administering the compound increases or induces cancer cell differentiation, cancer cell adhesion or tumor differentiation.

[0246] E39. The method as described in any one of embodiments E34-E38, wherein administering the compound induces the cancer cell or tumor to have a cystic, ductal or acinar phenotype or morphology.

[0247] E40. A method as described in any one of embodiments E34 - E39, wherein administering the compound induces cancer cells or tumors to have a more differentiated phenotype or structure.

[0248] E41. The method as described in embodiment E40, wherein the more differentiated phenotype or structure includes the presence of secreted lipid droplets, an increase in desmosome structures, polarization of ductal structures, or an increase in the levels of E - cadherin or casein.

[0249] E42. A method of inhibiting the expression of MALAT1 in cancer cells, comprising contacting the cancer cells with a compound that targets MALAT1, thereby inhibiting the expression of MALAT1 in the cancer cells.

[0250] E43. The method as described in embodiment E42, wherein the cancer is breast cancer; inflammatory breast cancer; ductal carcinoma of the breast; lobular carcinoma of the breast; tubular A breast cancer; tubular B breast cancer; basal - like breast cancer; HER2 - positive (HER2+) breast cancer; HER2 - negative (HER2 -) breast cancer; estrogen receptor - negative (ER -) breast cancer; estrogen receptor - positive (ER+) breast cancer; progesterone receptor - negative (PR -) breast cancer; progesterone receptor - positive (PR+) breast cancer; ER - positive (ER+) and PR - positive (PR+) breast cancer; ER - positive (ER+) and PR - negative (PR -) breast cancer; ER - negative (ER -) and PR - positive (PR+) breast cancer; ER - positive (ER+) and HER2 - negative (HER2 -) breast cancer; ER -, PR - and HER2 - triple - negative breast cancer (ER -, PR -, HER2 -; TNBC); hormone receptor - negative breast cancer (ER - and PR -); ER+, PR+ and HER2+ triple - positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non - small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B - cell malignancy; lymphoma; B - cell lymphoma; Hodgkin lymphoma; T - cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL).

[0251] E44. A method of reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth or metastasis in an individual having cancer, which comprises administering to the individual a compound that targets MALAT1, thereby reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth or metastasis in the individual.

[0252] E45. A method of increasing or inducing cancer cell differentiation, cancer cell adhesion or tumor differentiation in an individual having cancer, which comprises administering to the individual a compound that targets MALAT1, thereby increasing or inducing cancer cell differentiation, cancer cell adhesion or tumor differentiation in the individual.

[0253] E46. A method of inducing a cancer cell or tumor to have a cystic, ductal or acinar phenotype or morphology in an individual having cancer, which comprises administering to the individual a compound that targets MALAT1, thereby inducing the cancer cell or tumor to have a cystic, ductal or acinar phenotype or morphology.

[0254] E47. A method of inducing a cancer cell or tumor to have a more differentiated phenotype or structure, which comprises administering to an individual a compound that targets MALAT1, thereby inducing the cancer cell or tumor to have a more differentiated phenotype or structure.

[0255] E48. The method according to embodiment E47, wherein the more differentiated phenotype or structure comprises the presence of lipid droplets, an increased number of desmosome structures, polarization of ductal structures, or an increased level of E-cadherin or casein.

[0256] E49. The method according to any one of embodiments E44 - E48, wherein the individual has breast cancer; inflammatory breast cancer; ductal carcinoma of the breast; lobular carcinoma of the breast; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR- and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+ and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B-cell malignancy; lymphoma; B-cell lymphoma; Hodgkin lymphoma; T-cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL).

[0257] E50. The method according to any one of embodiments E34 - E49, wherein the compound is an antisense compound targeting MALAT1.

[0258] E51. The method according to any one of embodiments E34 - E49, wherein the compound is a compound according to any one of embodiments E1 - E27, a modified oligonucleotide according to any one of embodiments E28 - E30, or a composition according to embodiment E31 or E32.

[0259] E52. The method according to any one of embodiments E34 - E51, wherein the compound is administered parenterally.

[0260] Use of a compound targeting MALAT1 for treating, preventing or ameliorating MALAT1-related cancers.

[0261] E54. The use according to embodiment E53, wherein the cancer is breast cancer; inflammatory breast cancer; ductal breast cancer; lobular breast cancer; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR- and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+ and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B-cell malignancy; lymphoma; B-cell lymphoma; Hodgkin lymphoma; T-cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL).

[0262] E55. The use according to embodiment E53 or E54, wherein the compound is an antisense compound targeting MALAT1.

[0263] E56. The use according to any one of embodiments E53-E55, wherein the compound is a compound according to any one of embodiments E1-E27, a modified oligonucleotide according to any one of embodiments E28-E30, or a composition according to embodiment E31 or E32.

[0264] Use of a compound targeting MALAT1 in the manufacture of a medicament for treating or ameliorating MALAT1-related cancers.

[0265] E58. The use according to embodiment E57, wherein the cancer is breast cancer; inflammatory breast cancer; ductal breast cancer; lobular breast cancer; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR- and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+ and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematological cancer; myeloma; multiple myeloma (MM); B-cell malignancy; lymphoma; B-cell lymphoma; Hodgkin lymphoma; T-cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL).

[0266] E59. The use according to embodiment E57 or E58, wherein the compound is an antisense compound targeting MALAT1.

[0267] E60. The use according to any one of embodiments E57-E59, wherein the compound is a compound according to any one of embodiments E1-E27, a modified oligonucleotide according to any one of embodiments E28-E30, or a composition according to embodiment E31 or E32.

[0268] Use of a compound targeting MALAT1 in the preparation of a medicament for treating or ameliorating cancers associated with MALAT1.

[0269] E62. The use according to embodiment E61, wherein the cancer is breast cancer; inflammatory breast cancer; ductal breast cancer; lobular breast cancer; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR- and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+ and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B-cell malignancy; lymphoma; B-cell lymphoma; Hodgkin lymphoma; T-cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL).

[0270] E63. The use according to embodiment E61 or E62, wherein the compound is an antisense compound targeting MALAT1.

[0271] E64. The use according to any one of embodiments E61-E63, wherein the compound is a compound according to any one of embodiments E1-E27, a modified oligonucleotide according to any one of embodiments E28-E30, or a composition according to embodiment E31 or E32.

[0272] Certain indications

[0273] Certain embodiments provided herein relate to methods of inhibiting MALAT1 expression, which can be used to treat, prevent or improve MALAT1-related cancers in an individual by administering a compound that targets MALAT1. In certain embodiments, the compound can be a MALAT1-specific inhibitor. In certain embodiments, the compound can be an antisense compound, an oligomeric compound or an oligonucleotide that targets MALAT1.

[0274] Examples of MALAT1-related cancers that can be treated, prevented and / or improved with the compounds and methods provided herein include breast cancer; inflammatory breast cancer; ductal breast cancer; lobular breast cancer; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR- and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+ and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B cell malignancy; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL).

[0275] In certain embodiments, breast cancer has one or more of the following characteristics: androgen receptor positive, growth dependent on androgens; estrogen receptor (ER) negative, growth independent of estrogen; progesterone receptor (PR) negative, growth independent of progesterone; or Her2 / neu negative. In certain embodiments, breast cancer is triple-negative (ER-, PR-, HER2-) breast cancer with respect to ER, PR, and HER2. In certain embodiments, breast cancer is triple-negative and AR positive (ER-, PR-, HER2-, AR+). In certain embodiments, breast cancer is ER negative and AR positive (ER-, AR+). In certain embodiments, breast cancer is ER positive and AR positive (ER+, AR+). In certain embodiments, breast cancer is apocrine breast cancer. Apocrine breast cancer is often "triple-negative" apocrine breast cancer, meaning that the cells do not express the ER, PR, or HER2 receptors and are usually but not necessarily AR positive. In certain embodiments, apocrine breast cancer is triple-negative (ER-, PR-, HER2-) and AR positive (ER-, PR-, HER2-, AR+) apocrine breast cancer with respect to ER, PR, and HER2. In certain embodiments, apocrine breast cancer is ER negative and AR positive (ER-, AR+) apocrine breast cancer. In certain embodiments, apocrine breast cancer originates from the sweat glands of the breast. In certain embodiments, apocrine breast cancer is ductal carcinoma or cancer cells of the breast. In certain embodiments, apocrine breast cancer can have any one or more of the following characteristics: abundant eosinophilic granular cytoplasm; distinct margins; large vesicular nuclei; a nucleus-to-cytoplasm ratio of about 1:2; and / or accumulation of secretory granules (called apical snout) in the apical cytoplasm. In certain embodiments, breast cancer is molecular apocrine breast cancer that is ER negative and AR positive (ER-, AR+). In some aspects, molecular apocrine breast cancer that is ER negative and AR positive (ER-, AR+) can further be molecular apocrine breast cancer that is PR positive, PR negative, HER2 negative, or HER2 positive. In certain embodiments, breast cancer is HER2-positive breast cancer. In certain embodiments, breast cancer is PR-positive breast cancer. In certain embodiments, breast cancer is ER-positive breast cancer. Breast cancer can be identified as positive or negative for hormone receptors (such as ER, PR, or HER2) by standard histological techniques. For example, in some embodiments, according to relevant ASCO and CAP guidelines, when fewer than 1% of the cells exhibit nuclear staining for estrogen and progesterone receptors and immunohistochemical staining for HER2 shows a 0, 1+, or 2+ positive score and the FISH ratio (the ratio of HER2 gene signals to chromosome 17 signals) is less than 1.8, a histological breast cancer sample can be classified as "triple-negative" (ER-, PR-, HER2-).(Meyer, P. et al., PLoS ONE 7(5):e38361 (2012)).

[0276] In certain embodiments, the B-cell lymphoma is non-Hodgkin B-cell lymphoma. Examples of non-Hodgkin B-cell lymphoma in certain embodiments that can be treated with the compounds provided herein include, but are not limited to, diffuse large B-cell lymphoma (DLBCL), activated B-cell lymphoma (ABC-DLBCL), germinal center B-cell lymphoma (GCB DLBCL), follicular lymphoma, mucosa-associated lymphoid tissue lymphoma (MALT), small cell lymphocytic lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma (MCL), Burkitt lymphoma, mediastinal large B-cell lymphoma, Waldenström macroglobulinemia, nodal marginal zone B-cell lymphoma (NMZL), splenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, and lymphomatoid granulomatosis.

[0277] In certain embodiments, the T-cell lymphoma that can be treated with the compounds provided herein includes, but is not limited to, peripheral T-cell lymphoma and anaplastic large cell lymphoma (ALCL).

[0278] In certain embodiments, the leukemia that can be treated with the compounds provided herein includes, but is not limited to, acute lymphocytic leukemia (ALL).

[0279] In certain embodiments, a method of treating, preventing, or ameliorating MALAT1-related cancer in an individual comprises administering to the individual a compound comprising a MALAT1-specific inhibitor, thereby treating, preventing, or ameliorating the cancer. In certain embodiments, the compound comprises an antisense compound that targets MALAT1. In certain embodiments, the compound comprises an oligonucleotide that targets MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide that consists of 8 to 80 linked nucleosides and has a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide that consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide that consists of 8 to 80 linked nucleosides and has a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide that consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide may consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis. In certain embodiments, administering the compound increases or induces cancer cell differentiation, cancer cell adhesion, or tumor differentiation. In certain embodiments, administering the compound induces breast cancer cells or breast tumors to have a cystic, ductal, or acinar phenotype or morphology. In certain embodiments, administering the compound induces breast cancer cells or breast tumors to have a more differentiated phenotype or structure.In some embodiments, more differentiated phenotypes or structures include, but are not limited to, the presence of secreted lipid droplets, increased desmosome structures, polarization of ductal structures, or increased levels of differentiation markers such as E-cadherin or milk proteins such as casein.

[0280] In certain embodiments, a method of treating or ameliorating cancer comprises administering to an individual a compound comprising a MALAT1-specific inhibitor, thereby treating or ameliorating cancer. In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; ductal carcinoma of the breast; lobular carcinoma of the breast; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR-, and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma, and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B cell malignancy; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound that targets MALAT1. In certain embodiments, the compound comprises an oligonucleotide that targets MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide that consists of 8 to 80 linked nucleosides and has a nucleobase sequence that comprises at least 8 consecutive nucleobases of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide that consists of 16 to 80 linked nucleosides and has a nucleobase sequence that comprises a nucleobase sequence of any one of SEQ ID NOs: 2-10.In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide may consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890 or 1304906. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to an individual. In certain embodiments, administration of the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth or metastasis. In certain embodiments, administration of the compound increases or induces cancer cell differentiation, cancer cell adhesion or tumor differentiation. In certain embodiments, administration of the compound induces breast cancer cells or breast tumors to have a cystic, ductal or alveolar phenotype or morphology. In certain embodiments, administration of the compound induces breast cancer cells or breast tumors to have a more differentiated phenotype or structure. In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, the presence of lipid droplets, an increase in desmosome structures, polarization of ductal structures, or an increase in the levels of differentiation markers such as E-cadherin or milk proteins such as casein.

[0281] In certain embodiments, the individual is identified as having or at risk of having MALAT1-related cancer.

[0282] In certain embodiments, a method of inhibiting MALAT1 expression in an individual having or at risk of having a MALAT1-related cancer comprises administering to the individual a compound comprising a MALAT1-specific inhibitor, thereby inhibiting MALAT1 expression in the individual. In certain embodiments, administering the compound inhibits MALAT1 expression in the breast. In certain embodiments, the individual has or is at risk of having the following cancers: breast cancer; inflammatory breast cancer; ductal carcinoma of the breast; lobular carcinoma of the breast; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR- and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+ and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B cell malignancy; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeting MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeting MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence with at least 8 consecutive nucleobases comprising any one of the nucleobase sequences of SEQ ID NO: 2-10.In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide composed of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide composed of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of nucleobase sequences SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide composed of the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide may be composed of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to an individual. In certain embodiments, administration of the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis. In certain embodiments, administration of the compound increases or induces cancer cell differentiation, cancer cell adhesion, or tumor differentiation. In certain embodiments, administration of the compound induces breast cancer cells or breast tumors to have a cystic, ductal, or alveolar phenotype or morphology. In certain embodiments, administration of the compound induces breast cancer cells or breast tumors to have a more differentiated phenotype or structure. In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, the presence of lipid droplets, an increase in desmosome structures, polarization of ductal structures, or an increase in the levels of differentiation markers such as E-cadherin or milk proteins such as casein.

[0283] In certain embodiments, the individual is identified as having or at risk of having a MALAT1-related cancer.

[0284] In certain embodiments, methods of inhibiting MALAT1 expression in a cell include contacting the cell with a compound comprising a MALAT1-specific inhibitor, thereby inhibiting MALAT1 expression in the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a breast cell. In certain embodiments, the cell is in the breast. In certain embodiments, the cell is in the breast of an individual having or at risk of having cancer, such as breast cancer; inflammatory breast cancer; ductal carcinoma of the breast; lobular carcinoma of the breast; tubular A breast cancer; tubular B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR-, and HER2-triple-negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple-positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma, and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B-cell malignancy; lymphoma; B-cell lymphoma; Hodgkin lymphoma; T-cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeting MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeting MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence with at least 8 consecutive nucleobases comprising any one of SEQ ID NOs: 2-10.In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide composed of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide composed of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of nucleobase sequences SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide composed of the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide may be composed of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890 or 1304906. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0285] In certain embodiments, a method of reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in an individual having or at risk of having a MALAT1-related cancer comprises administering to the individual a compound comprising a MALAT1-specific inhibitor, thereby reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in the individual. In certain embodiments, a method of increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in an individual having or at risk of having a MALAT1-related cancer comprises administering to the individual a compound comprising a MALAT1-specific inhibitor, thereby increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in the individual. In certain embodiments, administering the compound induces a cystic, ductal, or acinar phenotype or morphology in breast cancer cells or breast tumors. In certain embodiments, administering the compound induces a more differentiated phenotype or structure in breast cancer cells or breast tumors. In certain embodiments, a more differentiated phenotype or structure includes, but is not limited to, the presence of lipid droplets, an increase in desmosome structures, polarization of ductal structures, or an increase in the levels of differentiation markers such as E-cadherin or milk proteins such as casein.In certain embodiments, the individual has or is at risk of having the following cancers: breast cancer; inflammatory breast cancer; ductal breast cancer; lobular breast cancer; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR-, and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma, and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B-cell malignancy; lymphoma; B-cell lymphoma; Hodgkin lymphoma; T-cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeting MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeting MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10.In certain embodiments, the compound comprises a modified oligonucleotide that consists of from 8 to 80 linked nucleosides and has a nucleobase sequence that comprises at least 8 consecutive nucleobases of either nucleobase sequence SEQ ID NO: 36 - 2646 or 2664 - 2813. In certain embodiments, the compound comprises a modified oligonucleotide that consists of from 16 to 80 linked nucleosides and has a nucleobase sequence that comprises a nucleobase sequence of either SEQ ID NO: 36 - 2646 or 2664 - 2813. In certain embodiments, the compound comprises a modified oligonucleotide that consists of a nucleobase sequence of either SEQ ID NO: 36 - 2646 or 2664 - 2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of from 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890 or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to an individual. In certain embodiments, the individual is identified as having or being at risk of having a cancer associated with MALAT1.

[0286] Certain embodiments relate to a compound comprising a MALAT1-specific inhibitor for treating cancer. In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; ductal carcinoma of the breast; lobular carcinoma of the breast; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR-, and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma, and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B cell malignancy; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeting MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeting MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 2-10.In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NO: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NO: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NO: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NO: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide may consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890 or 1304906. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0287] Certain embodiments relate to a compound comprising a MALAT1 - specific inhibitor for reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in an individual with cancer. Certain embodiments relate to a compound comprising a MALAT1 - specific inhibitor for increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in an individual with cancer. In certain embodiments, administration of the compound induces breast cancer cells or breast tumors to have a cystic, ductal, or acinar phenotype or morphology. In certain embodiments, administration of the compound induces breast cancer cells or breast tumors to have a more differentiated phenotype or structure. In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, the presence of lipid - secreting droplets, an increase in desmosome structures, polarization of ductal structures, or an increase in the levels of differentiation markers such as E - cadherin or milk proteins (such as casein). In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; ductal carcinoma of the breast; lobular carcinoma of the breast; tubular type A breast cancer; tubular type B breast cancer; basal - like breast cancer; HER2 - positive (HER2+) breast cancer; HER2 - negative (HER2 -) breast cancer; estrogen receptor - negative (ER -) breast cancer; estrogen receptor - positive (ER+) breast cancer; progesterone receptor - negative (PR -) breast cancer; progesterone receptor - positive (PR+) breast cancer; ER - positive (ER+) and PR - positive (PR+) breast cancer; ER - positive (ER+) and PR - negative (PR -) breast cancer; ER - negative (ER -) and PR - positive (PR+) breast cancer; ER - positive (ER+) and HER2 - negative (HER2 -) breast cancer; ER -, PR -, and HER2 - triple - negative breast cancer (ER -, PR -, HER2 -; TNBC); hormone receptor - negative breast cancer (ER - and PR -); ER+, PR+, and HER2+ triple - positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma, and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non - small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B - cell malignancy; lymphoma; B - cell lymphoma; Hodgkin lymphoma; T - cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).In certain embodiments, the compound comprises an antisense compound targeting MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeting MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide composed of 8 to 80 linked nucleosides and having a nucleobase sequence with at least 8 consecutive nucleobases comprising any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide composed of 8 to 80 linked nucleosides and having a nucleobase sequence with at least 8 consecutive nucleobases comprising any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide may be composed of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890 or 1304906. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0288] Certain embodiments relate to the use of a compound comprising a MALAT1 - specific inhibitor for manufacturing or preparing a medicament for treating cancer. Certain embodiments relate to the use of a compound comprising a MALAT1 - specific inhibitor for preparing a medicament for treating MALAT1 - related cancer. In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; ductal breast cancer; lobular breast cancer; tubular type A breast cancer; tubular type B breast cancer; basal - like breast cancer; HER2 - positive (HER2+) breast cancer; HER2 - negative (HER2 -) breast cancer; estrogen receptor - negative (ER -) breast cancer; estrogen receptor - positive (ER+) breast cancer; progesterone receptor - negative (PR -) breast cancer; progesterone receptor - positive (PR+) breast cancer; ER - positive (ER+) and PR - positive (PR+) breast cancer; ER - positive (ER+) and PR - negative (PR -) breast cancer; ER - negative (ER -) and PR - positive (PR+) breast cancer; ER - positive (ER+) and HER2 - negative (HER2 -) breast cancer; ER - , PR - and HER2 - triple - negative breast cancer (ER - , PR - , HER2 - ; TNBC); hormone receptor - negative breast cancer (ER - and PR -); ER+ , PR+ and HER2+ triple - positive breast cancer (ER+ , PR+ , HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non - small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B - cell malignancy; lymphoma; B - cell lymphoma; Hodgkin lymphoma; T - cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeting MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeting MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence with at least 8 consecutive nucleobases of any one of SEQ ID NOs: 2 - 10.In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide composed of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide composed of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of nucleobase sequences SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide composed of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide composed of the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide may be composed of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890 or 1304906. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0289] Certain embodiments relate to the use of a compound comprising a MALAT1 - specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in an individual with cancer. Certain embodiments relate to the use of a compound comprising a MALAT1 - specific inhibitor for the manufacture or preparation of a medicament for increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in an individual with cancer. In certain embodiments, administration of the compound induces breast cancer cells or breast tumors to have a cystic, ductal, or acinar phenotype or morphology. In certain embodiments, administration of the compound induces breast cancer cells or breast tumors to have a more differentiated phenotype or structure. In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, the presence of lipid - secreting droplets, an increase in desmosome structures, polarization of ductal structures, or an increase in the levels of differentiation markers such as E - cadherin or milk proteins (such as casein).In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; ductal carcinoma of the breast; lobular carcinoma of the breast; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR-, and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma, and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial carcinoma; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B cell malignancy; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeting MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeting MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide, the modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide, the modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10.In certain embodiments, the compound comprises a modified oligonucleotide, the modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide, the modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide may consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890 or 1304906. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0290] In any of the foregoing methods or uses, the compound may target MALAT1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. For example, the modified oligonucleotide may consist of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside bond, at least one modified sugar and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond, the modified sugar is a bicyclic sugar or 2'-O-methoxyethyl, and the modified nucleobase is 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises: a gap segment consisting of linked 2'-deoxynucleosides; a 5' flanking segment consisting of linked nucleosides; and a 3' flanking segment consisting of linked nucleosides, wherein the gap segment is located immediately adjacent to and between the 5' flanking segment and the 3' flanking segment, and wherein each nucleoside of each flanking segment comprises a modified sugar.

[0291] In any of the foregoing embodiments, the modified oligonucleotide can consist of 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to SEQ ID NO:1. In certain embodiments, at least one internucleoside bond of the modified oligonucleotide is a modified internucleoside bond, at least one sugar of the modified oligonucleotide is a modified sugar, and / or at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond, the modified sugar is a bicyclic sugar or a 2'-O-methoxyethyl sugar, and the modified nucleobase is 5-methylcytosine. In certain embodiments, the modified oligonucleotide has: a gap segment consisting of linked 2'-deoxynucleosides; a 5' flanking segment consisting of linked nucleosides; and a 3' flanking segment consisting of linked nucleosides, wherein the gap segment is located immediately adjacent to and between the 5' flanking segment and the 3' flanking segment, and wherein each nucleoside of each flanking segment comprises a modified sugar.

[0292] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide having:

[0293] a gap segment consisting of linked 2'-deoxynucleosides;

[0294] a 5' flanking segment consisting of linked nucleosides; and

[0295] a 3' flanking segment consisting of linked nucleosides;

[0296] Wherein the spacer segment is located between the 5' flanking segment and the 3' flanking segment and wherein each nucleoside of each flanking segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising any one of the nucleobase sequences shown in SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising any one of the nucleobase sequences shown in SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising any one of the nucleobase sequences shown in SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising any one of the nucleobase sequences shown in SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of any one of the nucleobase sequences shown in SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of any one of the nucleobase sequences shown in SEQ ID NOs: 2-10.

[0297] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide, said modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising any one of the nucleobase sequences shown in SEQ ID NOs: 2-10 or 36-2813, wherein the modified oligonucleotide has:

[0298] a spacer segment, which consists of linked 2'-deoxynucleosides;

[0299] a 5' flanking segment, which consists of linked nucleosides; and

[0300] a 3' flanking segment, which consists of linked nucleosides;

[0301] wherein the spacer segment is located between the 5' flanking segment and the 3' flanking segment and wherein each nucleoside of each flanking segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0302] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide, the modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence shown in any of SEQ ID NOs: 2-10, wherein the modified oligonucleotide has:

[0303] a gap segment, which consists of linked 2'-deoxynucleosides;

[0304] a 5' flanking segment, which consists of linked nucleosides; and

[0305] a 3' flanking segment, which consists of linked nucleosides;

[0306] wherein the gap segment is located between the 5' flanking segment and the 3' flanking segment and wherein each nucleoside of each flanking segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0307] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide, the modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence shown in any of SEQ ID NOs: 36-2646 or 2664-2813, wherein the modified oligonucleotide has:

[0308] a gap segment, which consists of 10 linked 2'-deoxynucleosides;

[0309] a 5' flanking segment, which consists of 3 linked nucleosides; and

[0310] a 3' flanking segment, which consists of 3 linked nucleosides;

[0311] wherein the gap segment is located between the 5' flanking segment and the 3' flanking segment; wherein each nucleoside of each flanking segment comprises a cEt nucleoside; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0312] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide, the modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence shown in any of SEQ ID NOs: 2-7, wherein the modified oligonucleotide has:

[0313] a gap segment, which consists of 10 linked 2'-deoxynucleosides;

[0314] a 5' flanking segment consisting of 3 linked nucleosides; and

[0315] a 3' flanking segment consisting of 3 linked nucleosides;

[0316] wherein a spacer segment is located between the 5' flanking segment and the 3' flanking segment; wherein each nucleoside of each flanking segment comprises a cEt nucleoside; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0317] In any of the foregoing methods or uses, the compound may comprise or consist of a modified oligonucleotide having a nucleobase sequence comprising any of the nucleobase sequences shown in SEQ ID NOs: 8 - 10; wherein the modified oligonucleotide comprises the glycosyl motif kkk - d - y - d(8) - kkk, wherein "k" indicates a cEt - modified sugar moiety, "d" indicates an unmodified 2'-deoxyribosyl sugar moiety, and "y" indicates a 2'-O-methyl - modified sugar moiety; wherein each internucleoside bond is a phosphorothioate bond; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0318] In any of the foregoing methods or uses, the compound may comprise or consist of ION 1304884 having a nucleobase sequence and chemical motif: GksGksAksTdsUysAdsAdsTdsGdsTdsAdsGdsTdsGksTksAk (SEQ ID NO: 8), wherein "d" represents 2'-deoxyribose, "k" represents a cEt - modified sugar, "y" represents a 2'-O-methyl - modified sugar, "s" represents a phosphorothioate internucleoside bond, and "mC" refers to 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0319] In any of the foregoing methods or uses, the compound can comprise or consist of ION 1304890 having a nucleobase sequence and chemical motif: GksGksTksTdsAysTdsAdsGdsmCdsTdsTdsGdsAdsmCksAksAk (SEQ ID NO:9), where "d" represents 2'-deoxyribose, "k" represents a cEt-modified sugar, "y" represents a 2'-O-methyl-modified sugar, "s" represents a phosphorothioate internucleoside bond, and "mC" refers to 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0320] In any of the foregoing methods or uses, the compound can comprise or consist of ION 1304906 having a nucleobase sequence and chemical motif: GksmCksAksGdsAysTdsAdsAdsTdsGdsTdsTdsmCdsTksmCksAk (SEQ ID NO:10), where "d" represents 2'-deoxyribose, "k" represents a cEt-modified sugar, "y" represents a 2'-O-methyl-modified sugar, "s" represents a phosphorothioate internucleoside bond, and "mC" refers to 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0321] In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:

[0322]

[0323] (SEQ ID NO:6), or a salt thereof. In certain embodiments, the modified oligonucleotide is a sodium salt or a potassium salt.

[0324] In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:

[0325]

[0326] (SEQ ID NO:6).

[0327] In any of the foregoing methods or uses, the compound can be administered parenterally. For example, in certain embodiments, the compound can be administered by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intraventricular administration.

[0328] Certain combinations and combination therapies

[0329] In certain embodiments, a first agent comprising a compound described herein is co-administered with one or more second agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as that treated by the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition than that treated by the first agent described herein. In certain embodiments, the first agent is designed to treat an undesired side effect of the second agent. In certain embodiments, the second agent is co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat one or more undesired side effects of a pharmaceutical composition as described herein. In certain embodiments, the second agent is co-administered with the first agent to produce a combined effect. In certain embodiments, the second agent is co-administered with the first agent to produce a synergistic effect. In certain embodiments, co-administration of the first agent and the second agent allows for the use of lower doses compared to the doses required to achieve a therapeutic or prophylactic effect when each agent is administered as a monotherapy.

[0330] In certain embodiments, one or more of the compounds or compositions provided herein are co-administered with one or more second agents. In certain embodiments, one or more of the compounds or compositions provided herein are administered at different times from one or more second agents. In certain embodiments, one or more of the compounds or compositions provided herein are formulated together with one or more second agents in a single formulation. In certain embodiments, one or more of the compounds or compositions provided herein are formulated separately from one or more second agents.In certain embodiments, the second agent is selected from: chemotherapeutic agents including, but not limited to, capecitabine (Xeloda), carboplatin, cisplatin, cyclophosphamide, docetaxel (Taxotere), doxorubicin, epirubicin (Ellence), eribulin (Halaven), fluorouracil (5-FU, Efudex), gemcitabine (Gemzar), ixabepilone (Ixempra), methotrexate (Rheumatrex, Trexall), paclitaxel (Taxol), or vinorelbine (Navelbine); combination regimens including, but not limited to, AC (doxorubicin and cyclophosphamide), EC (epirubicin, cyclophosphamide), AC or EC (epirubicin and cyclophosphamide) followed by T (doxorubicin and cyclophosphamide, followed by paclitaxel or docetaxel), CAF (cyclophosphamide, doxorubicin, and 5-FU), CEF (cyclophosphamide, epirubicin, and 5-FU), CMF (cyclophosphamide, methotrexate, and 5-FU), TAC (docetaxel, doxorubicin, and cyclophosphamide), TC (docetaxel and cyclophosphamide), AC-TH (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab), AC-THP (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab, pertuzumab), TCHP (docetaxel, carboplatin, trastuzumab, pertuzumab), TCH (docetaxel, carboplatin, trastuzumab), or TH (paclitaxel, trastuzumab); hormonal therapies including, but not limited to, selective estrogen receptor modulators, tamoxifen, toremifene (Fareston), fulvestrant (Faslodex), goserelin (Zoladex), or leuprolide (Eligard, Lupron); aromatase inhibitors (AIs) including, but not limited to, anastrozole (Arimidex), exemestane (Aromasin), or letrozole (Femara); HER2-targeted therapies including, but not limited to, trastuzumab (Herceptin), lapatinib (TYKERB), pertuzumab (Perjeta), or neratinib (Nerlynx).

[0331] Certain embodiments relate to the use of a compound targeting MALAT1, in combination with a second agent, as described herein. In specific embodiments, such use is in a method for treating a patient suffering from cancer, including but not limited to breast cancer; inflammatory breast cancer; ductal breast cancer; lobular breast cancer; tubular type A breast cancer; tubular type B breast cancer; basal-like breast cancer; HER2-positive (HER2+) breast cancer; HER2-negative (HER2-) breast cancer; estrogen receptor-negative (ER-) breast cancer; estrogen receptor-positive (ER+) breast cancer; progesterone receptor-negative (PR-) breast cancer; progesterone receptor-positive (PR+) breast cancer; ER-positive (ER+) and PR-positive (PR+) breast cancer; ER-positive (ER+) and PR-negative (PR-) breast cancer; ER-negative (ER-) and PR-positive (PR+) breast cancer; ER-positive (ER+) and HER2-negative (HER2-) breast cancer; ER-, PR- and HER2-triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor-negative breast cancer (ER- and PR-); ER+, PR+ and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcoma (e.g., epithelioid sarcoma, rhabdoid sarcoma and synovial sarcoma); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung cancer (NSCLC); small cell lung cancer (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; colorectal cancer; small intestine cancer; gastric cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; kidney cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; Merkel cell carcinoma; blood cancer; hematopoietic system cancer; myeloma; multiple myeloma (MM); B-cell malignancy; lymphoma; B-cell lymphoma; Hodgkin lymphoma; T-cell lymphoma; leukemia; or acute lymphoblastic leukemia (ALL).In certain embodiments, the second agent is selected from: chemotherapeutic agents, including but not limited to capecitabine (Xeloda), carboplatin, cisplatin, cyclophosphamide, docetaxel (Taxotere), doxorubicin, epirubicin (Ellence), eribulin (Halaven), fluorouracil (5-FU, Efudex), gemcitabine (Gemzar), ixabepilone (Ixempra), methotrexate (Rheumatrex, Trexall), paclitaxel (Taxol) or vinorelbine (Navelbine); combination regimens, including but not limited to AC (doxorubicin and cyclophosphamide), EC (epirubicin, cyclophosphamide), AC or EC (epirubicin and cyclophosphamide) followed by T (doxorubicin and cyclophosphamide, followed by paclitaxel or docetaxel), CAF (cyclophosphamide, doxorubicin and 5-FU), CEF (cyclophosphamide, epirubicin and 5-FU), CMF (cyclophosphamide, methotrexate and 5-FU), TAC (docetaxel, doxorubicin and cyclophosphamide), TC (docetaxel and cyclophosphamide), AC-TH (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab), AC-THP (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab, pertuzumab), TCHP (docetaxel, carboplatin, trastuzumab, pertuzumab), TCH (docetaxel, carboplatin, trastuzumab) or TH (paclitaxel, trastuzumab); hormone therapies, including but not limited to selective estrogen receptor modulators, tamoxifen, toremifene (Fareston), fulvestrant (Faslodex), goserelin (Zoladex) or leuprolide (Eligard, Lupron); aromatase inhibitors (AIs), including but not limited to anastrozole (Arimidex), exemestane (Aromasin) or letrozole (Femara); HER2-targeted therapies, including but not limited to trastuzumab (Herceptin), lapatinib (TYKERB), pertuzumab (Perjeta) or neratinib (Nerlynx).

[0332] Certain embodiments relate to combinations of compounds that target MALAT1 as described herein and a second agent, where the second agent is, for example, a second agent selected from: chemotherapeutic agents including, but not limited to, capecitabine (Xeloda), carboplatin, cisplatin, cyclophosphamide, docetaxel (Taxotere), doxorubicin, epirubicin (Ellence), eribulin (Halaven), fluorouracil (5-FU, Efudex), gemcitabine (Gemzar), ixabepilone (Ixempra), methotrexate (Rheumatrex, Trexall), paclitaxel (Taxol), or vinorelbine (Navelbine); combination regimens including, but not limited to, AC (doxorubicin and cyclophosphamide), EC (epirubicin, cyclophosphamide), AC or EC (epirubicin and cyclophosphamide) followed by T (doxorubicin and cyclophosphamide, followed by paclitaxel or docetaxel), CAF (cyclophosphamide, doxorubicin, and 5-FU), CEF (cyclophosphamide, epirubicin, and 5-FU), CMF (cyclophosphamide, methotrexate, and 5-FU), TAC (docetaxel, doxorubicin, and cyclophosphamide), TC (docetaxel and cyclophosphamide), AC-TH (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab), AC-THP (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab, pertuzumab), TCHP (docetaxel, carboplatin, trastuzumab, pertuzumab), TCH (docetaxel, carboplatin, trastuzumab), or TH (paclitaxel, trastuzumab); hormonal therapies including, but not limited to, selective estrogen receptor modulators, tamoxifen, toremifene (Fareston), fulvestrant (Faslodex), goserelin (Zoladex), or leuprolide (Eligard, Lupron); aromatase inhibitors (AIs) including, but not limited to, anastrozole (Arimidex), exemestane (Aromasin), or letrozole (Femara); HER2-targeted therapies including, but not limited to, trastuzumab (Herceptin), lapatinib (TYKERB), pertuzumab (Perjeta), or neratinib (Nerlynx).

[0333] In certain embodiments, the compounds that target MALAT1 as described herein and the second agent are used in combination therapy by administering the two agents simultaneously, separately, or sequentially. In certain embodiments, the two agents are formulated as a fixed-dose combination product. In other embodiments, the two agents are provided to the patient as separate units, and then the separate units can be used simultaneously or consecutively (sequentially).

[0334] In certain embodiments, the compounds targeting MALAT1 as described herein are used in combination with an immunomodulator, such as an anti-PD-L1 antibody (or antigen-binding fragment thereof), an anti-PD-1 antibody (or antigen-binding fragment thereof), an anti-CTLA-4 antibody (or antigen-binding fragment thereof), or an OX40 agonist (e.g., an OX40 ligand fusion protein or an OX40 agonist antibody or antigen-binding fragment thereof).

[0335] In certain embodiments, the compounds targeting MALAT1 as described herein are used in combination with an immune checkpoint inhibitor, such as an anti-PD-L1 antibody (or antigen-binding fragment thereof), an anti-PD-1 antibody (or antigen-binding fragment thereof), or an anti-CTLA-4 antibody (or antigen-binding fragment thereof).

[0336] Anti-PD-L1 antibodies are known in the art. Exemplary anti-PD-L1 antibodies include: MEDI4736 (durvalumab), MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105, and MPDL3280A (atezolizumab).

[0337] Anti-PD-1 antibodies are known in the art. Exemplary anti-PD-1 antibodies include: nivolumab, pembrolizumab, pidilizumab, and AMP-514.

[0338] Anti-CTLA-4 antibodies are known in the art. Exemplary anti-CTLA-4 antibodies include: tremelimumab and ipilimumab (also known as MDX-010 (or BMS-734016)).

[0339] OX40 agonists and antibodies are known in the art. Exemplary OX40 agonists and / or antibodies include: MEDI6383, 9B12, and MEDI0562.

[0340] In one embodiment, the combination comprises the antisense oligonucleotide Ionis 1158161 or a salt thereof and at least one immunomodulator selected from the group consisting of: MEDI4736, MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105, nivolumab, pembrolizumab, pidilizumab, MPDL3280A, tremelimumab, ipilimumab, MEDI0562, and MEDI0562.

[0341] Certain anti-PD-L1 antibodies

[0342] The present disclosure includes antibodies that specifically bind to and inhibit PD-L1.

[0343] Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody that is selective for the PD-L1 polypeptide and blocks the binding of PD-L1 to the PD-1 and CD80 receptors. Durvalumab can relieve PD-L1-mediated inhibition of human T cell activation in vitro and inhibit tumor growth in xenograft models through a T cell-dependent mechanism.

[0344] Information regarding the use of durvalumab (or a fragment thereof) in the methods provided herein can be found in U.S. Patent 8,779,108, the disclosure of which is incorporated herein by reference in its entirety. The crystallizable fragment (Fc) domain of durvalumab contains triple mutations in the constant domain of the IgG1 heavy chain that reduce binding to complement component C1q and Fcγ receptors responsible for mediating antibody-dependent cell-mediated cytotoxicity (ADCC).

[0345] Durvalumab and antigen-binding fragments thereof for use in the methods provided herein comprise a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In certain embodiments, MEDI4736 or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 2.14H9OPT antibody as disclosed in U.S. Patents 8,779,108 and 9,493,565, the disclosures of which are incorporated herein by reference in their entirety.

[0346] There are a variety of anti-PD-L1 antibodies in the published literature, which may be included in the present disclosure, including compounds in development and / or in clinical trials, such as: durvalumab (MEDI4736), MPDL3280A, BMS936559, 2.7A4, AMP-714, and MDX-1105. Patent specifications disclosing anti-PD-L1 antibodies available for the present disclosure include: U.S. Patent Nos. 7,943,743, 8,383,796, 9,102,725, 9,273,135 (BMS / Medarex), US2006 / 0153841 (DanaFarber), US2011 / 0271358 (Dana Farber), U.S. Patent Nos. 8,552,154 and 9,102,727 (DanaFarber), U.S. Patent No. 8,217,149 (Genentech) (including the issued U.S. Patent No. 8,217,149), US2012 / 0039906 (INSERM), US2016 / 0031990 (Amplimmune), U.S. Patent No. 8,779,108 (MedImmune, for durvalumab / MEDI4726 and 2.7A4), US2014 / 0044738 (Amplimmune, for AMP-714), and US2010 / 0285039 (John’s Hopkins University). Each of these disclosures is incorporated herein by reference in its entirety.

[0347] Certain anti-CTLA-4 antibodies

[0348] Antibodies that specifically bind CTLA-4 and inhibit CTLA-4 activity can be used to enhance the anti-tumor immune response. Information regarding tremelimumab (or antigen-binding fragments thereof) for use in the methods provided herein can be found in US 6,682,736 (referred to as 11.2.1 in said patent), the disclosure of which is incorporated herein by reference in its entirety. Tremelimumab (also known as CP-675,206, CP-675, CP-675206, and ticilimumab) is a human IgG2 monoclonal antibody that is highly selective for CTLA-4 and blocks the binding of CTLA-4 to CD80 (B7.1) and CD86 (B7.2). It has been shown to result in immune activation in vitro, and tumor regression has been shown in some patients treated with tremelimumab.

[0349] Trametinib for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In a particular aspect, trametinib or an antigen-binding fragment thereof for use in the methods provided herein comprises a light chain variable region comprising the amino acid sequence shown above and a heavy chain variable region comprising the amino acid sequence shown above. In a particular aspect, trametinib or an antigen-binding fragment thereof for use in the methods provided herein comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the CDR1, CDR2, and CDR3 sequences defined by Kabat as shown above, and wherein the light chain variable region comprises the CDR1, CDR2, and CDR3 sequences defined by Kabat as shown above. One of ordinary skill in the art will be able to readily identify Chothia definitions, Abm definitions, or other CDR definitions known to one of ordinary skill in the art. In a particular aspect, trametinib or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 11.2.1 antibody as disclosed in U.S. Patent 6,682,736, which is incorporated herein by reference in its entirety.

[0350] Other anti-CTLA-4 antibodies are described, for example, in US 20070243184. In one embodiment, the anti-CTLA-4 antibody is ipilimumab, also known as MDX-010; BMS-734016.

[0351] Certain OX40 agonists

[0352] During or shortly after antigen sensitization, an OX40 agonist interacts with the OX40 receptor on CD4+ T cells, resulting in an increased response of CD4+ T cells to the antigen. An OX40 agonist that interacts with the OX40 receptor on antigen-specific CD4+ T cells can increase T cell proliferation compared to the response to the antigen alone. The elevated response to the antigen can be maintained for a substantially longer period of time compared to the absence of an OX40 agonist. Thus, stimulation by an OX40 agonist enhances the antigen-specific immune response by enhancing T cell recognition of the antigen (e.g., tumor cells). OX40 agonists are described, for example, in U.S. Patents 6,312,700, 7,504,101, 7,622,444, and 7,959,925, which are incorporated herein by reference in their entirety. Methods of using such agonists in cancer treatment are described, for example, in US2015 / 0098942 and US2015 / 0157710, each of which is incorporated herein by reference.

[0353] OX40 agonists include, but are not limited to, OX40-binding molecules, such as binding polypeptides, such as OX40 ligand (“OX40L”) or an OX40-binding fragment, variant or derivative thereof, such as a soluble extracellular ligand domain and an OX40L fusion protein, and an anti-OX40L antibody (e.g., a monoclonal antibody, such as a humanized monoclonal antibody) or an antigen-binding fragment, variant or derivative thereof. Examples of anti-OX40 monoclonal antibodies are described, for example, in U.S. Pat. Nos. 5,821,332 and 6,156,878, the disclosures of which are incorporated herein by reference in their entireties. In certain embodiments, the anti-OX40 monoclonal antibody is 9B12 or an antigen-binding fragment, variant or derivative thereof, as described in Weinberg, A.D. et al. J Immunother 29, 575-585 (2006), which is incorporated herein by reference in its entirety. In another embodiment, the OX40 antibody is MEDI0562, as described in US2016 / 0137740.

[0354] In certain embodiments, an antibody or an antigen-binding fragment thereof that specifically binds OX40 binds to the same OX40 epitope as mAb 9B12. Examples of humanized OX40 antibodies are described by Morris et al., Mol Immunol. May 2007;44(12):3112-3121. 9B12 is a murine IgG1 anti-OX40 mAb directed against the extracellular domain of human OX40 (CD134) (Weinberg, A.D. et al. J Immunother 29, 575-585 (2006)). It was selected from a panel of anti-OX40 monoclonal antibodies because of its ability to elicit an agonist response to OX40 signaling, stability and high level of production by the hybridoma. For clinical use, the 9B12 mAb was equilibrated with phosphate-buffered saline at pH 7.0 and its concentration was adjusted to 5.0 mg / ml by dialysis.

[0355] "OX40 ligand" ("OX40L") (also known in various ways as tumor necrosis factor ligand superfamily member 4, gp34, TAX transactivated glycoprotein-1, and CD252) is predominantly present on antigen-presenting cells (APCs) and can be induced on activated B cells, dendritic cells (DCs), Langerhans cells, plasmacytoid DCs, and macrophages (Croft, M., (2010) Ann Rev Immunol 28:57-78). Other cells, including activated T cells, NK cells, mast cells, endothelial cells, and smooth muscle cells, can express OX40L in response to inflammatory cytokines (Id.). OX40L specifically binds to the OX40 receptor. The human protein is described in U.S. Patent 6,156,878. The murine OX40L is described in U.S. Patent 5,457,035. OX40L is expressed on the cell surface and comprises an intracellular receptor-binding domain, a transmembrane receptor-binding domain, and an extracellular receptor-binding domain. A functionally active soluble form of OX40L can be generated by deleting the intracellular and transmembrane domains as described, for example, in U.S. Patents 5,457,035, 6,312,700, 6,156,878, 6,242,566, 6,528,055, 6,528,623, 7,098,184, and 7,125,670, the disclosures of which are incorporated herein by reference in their entirety for all purposes. A functionally active form of OX40L is a form that retains the ability to specifically bind OX40, i.e., a form that has the OX40 "receptor-binding domain". An example is amino acids 51 to 183 of human OX40L. Methods for determining the ability of an OX40L molecule or derivative to specifically bind OX40 are discussed below. Methods for preparing and using OX40L and its derivatives, such as derivatives that include the OX40-binding domain, are described in U.S. Patents 6,156,878, 6,242,566, 6,528,055, 6,528,623, 7,098,184, and 7,125,670, which also describe proteins that comprise a soluble form of OX40L linked to other peptides, such as the human immunoglobulin ("Ig") Fc region, which can be produced to facilitate purification of the OX40 ligand from cultured cells or to enhance the stability of the molecule after administration to a mammal in vivo (see also U.S. Patents 5,457,035 and 7,959,925, both of which are incorporated herein by reference in their entirety).

[0356] The definition of OX40L also includes OX40 ligand variants, whose amino acid sequences are different from those of naturally occurring OX40 ligand molecules but retain the ability to specifically bind to the OX40 receptor. Such variants are described in U.S. Patents 5,457,035, 6,156,878, 6,242,566, 6,528,055, 6,528,623, 7,098,184, and 7,125,670. In a related embodiment, a mutant of OX40L is used, which loses the ability to specifically bind to OX40, for example, amino acids 51 to 183, in which phenylalanine at position 180 in the receptor-binding domain of human OX40L has been replaced with alanine (F180A).

[0357] OX40 agonists include fusion proteins in which one or more domains of OX40L are covalently linked to one or more additional protein domains. Exemplary OX40L fusion proteins that can be used as OX40 agonists are described in U.S. Patent 6,312,700, the disclosure of which is incorporated herein by reference in its entirety. In one embodiment, the OX40 agonist includes an OX40L fusion polypeptide that self-assembles into a multimeric (e.g., trimeric or hexameric) OX40L fusion protein. Such fusion proteins are described, for example, in U.S. Patent 7,959,925, which is incorporated herein by reference. Due to the ability to spontaneously assemble into highly stable trimers and hexamers, multimeric OX40L fusion proteins exhibit increased efficacy in enhancing antigen-specific immune responses in a subject.

[0358] In another embodiment, an OX40 agonist capable of assembling into a multimeric form includes a fusion polypeptide that, in the N-terminal to C-terminal direction, includes: an immunoglobulin domain, where the immunoglobulin domain includes an Fc domain; a trimerization domain, where the trimerization domain includes a coiled-coil trimerization domain; and a receptor-binding domain, where the receptor-binding domain is an OX40 receptor-binding domain, such as OX40L or its OX40-binding fragment, variant, or derivative, where the fusion polypeptide can self-assemble into a trimeric fusion protein. In one aspect, an OX40 agonist capable of assembling into a multimeric form is capable of binding to the OX40 receptor and stimulating at least one OX40-mediated activity. In certain aspects, the OX40 agonist includes the extracellular domain of the OX40 ligand.

[0359] The trimerization domain of an OX40 agonist capable of assembling into a multimeric form is used to promote the self-assembly of individual OX40L fusion polypeptide molecules into a trimeric protein. Thus, an OX40L fusion polypeptide having a trimerization domain self-assembles into a trimeric OX40L fusion protein. In one aspect, the trimerization domain is a leucine zipper domain or other coiled-coil polypeptide structure. Exemplary coiled-coil trimerization domains include: TRAF2( Accession number Q12933, amino acids 299 - 348); thrombospondin 1 (accession number P07996, amino acids 291 - 314); Matrilin-4 (accession number O95460, amino acids 594 - 618); CMP(matrilin-1) (accession number NP—002370, amino acids 463 - 496); HSF1 (accession number AAX42211, amino acids 165 - 191); and Cubilin (accession number NP—001072, amino acids 104 - 138). In certain specific aspects, the trimeric domain includes a TRAF2 trimeric domain, a Matrilin-4 trimeric domain, or a combination thereof.

[0360] OX40L FP is a human OX40 ligand IgG4P fusion protein that specifically binds to the human OX40 receptor, a member of the TNFR superfamily, and triggers its signal transduction. OX40L FP is also described in US2016 / 0024176, which is incorporated herein by reference in its entirety. OX40L FP is composed of three distinct domains: (1) the extracellular receptor-binding domain (RBD) of human OX40 ligand, which forms a homotrimer and binds to the OX40 receptor; (2) a leucine zipper trimeric domain derived from TNFR-associated factor 2, which stabilizes the homotrimeric structure of the OX40 ligand RBD; and (3) the human IgG4 crystallizable fragment γ (Fcγ) domain, which promotes Fcγ receptor clustering of the fusion protein upon binding to the OX40 receptor and contains a serine-to-proline substitution at position 228 (according to EU numbering) in the hinge region (IgG4P) to promote the stability of two sets of OX40 ligand RBD homotrimers. The IgG4P Fc domain is directly fused to a leucine zipper trimeric domain of amino acid residues 310 - 349 derived from human tumor necrosis factor 2 (TRAF2). Fused to the C-terminus of the TRAF2 domain are amino acid residues 51 - 183 of the extracellular receptor-binding domain (RBD) of human OX40L (gene name TNFSF4). The TRAF2 domain stabilizes the homotrimeric structure of the OX40L RBD for OX40 binding and activation, while the IgG4P Fc domain confers serum stability, dimerization of the OX40L trimer, and promotes Fcγ receptor clustering of the hexameric fusion protein. An OX40L FP variant has a phenylalanine (F) to alanine (A) mutation at the amino acid corresponding to position 180 in OX40L. Another OX40L FP variant has an IgG4P Fc domain replaced by a human IgG1 Fc domain. In a specific embodiment, the OX40 agonist for the present disclosure is one of the OX40L FP variants.

[0361] In certain embodiments, the OX40 agonists for use in the present disclosure have been modified to increase their serum half-life. For example, the serum half-life of an OX40 agonist can be increased by conjugation to a heterologous molecule such as serum albumin, an antibody Fc region, or PEG. In certain embodiments, the OX40 agonist can be conjugated to other therapeutic agents or toxins to form immunoconjugates and / or fusion proteins. In certain embodiments, the OX40 agonist can be formulated to facilitate administration and promote the stability of the active agent.

[0362] Antibody derivatives

[0363] Antibodies for use in the present disclosure (e.g., anti-CTLA-4, anti-PD-L1, anti-PD-1, anti-OX40) can include variants of these sequences that retain the ability to specifically bind their targets. Such variants can be derived from the sequences of these antibodies by those of ordinary skill in the art using techniques well known in the art. For example, amino acid substitutions, deletions, or additions can be made in the FRs and / or CDRs. Although changes in the FRs are often designed to improve antibody stability and immunogenicity, changes in the CDRs are generally designed to increase the affinity of the antibody for its target. Variants of the FRs also include naturally occurring immunoglobulin allotypes. Such affinity-increasing changes can be determined empirically by conventional techniques involving altering the CDRs and testing the affinity of the antibody for its target. For example, conservative amino acid substitutions can be made within any of the disclosed CDRs. The various alterations can be made according to the methods described in Antibody Engineering, 2nd Edition, Oxford University Press, edited by Borrebaeck, 1995. These include, but are not limited to, nucleotide sequences that are altered by substituting different codons that encode functionally equivalent amino acid residues within the coding sequence, thus producing "silent" changes. For example, nonpolar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Positively charged (basic) amino acids include arginine, lysine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

[0364] Derivatives and analogs of the antibodies of the present disclosure can be generated by a variety of techniques well known in the art, including recombinant and synthetic methods (Maniatis (1990) Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; and Bodansky et al. (1995) The Practice of Peptide Synthesis, 2nd ed., Spring Verlag, Berlin, Germany). Similar shuffling or combinatorial techniques have also been disclosed by Stemmer (Nature (1994) 370:389-391), which describes techniques regarding the β-lactamase gene, but observes that the method can be used to generate antibodies).

[0365] Novel VH or VL regions carrying one or more sequences derived from the sequences disclosed herein can be generated using random mutagenesis of one or more selected VH and / or VL genes. One such technique, error-prone PCR, has been described by Gram et al. (Proc. Nat. Acad. Sci. U.S.A. (1992) 89:3576-3580).

[0366] Another method that can be used is to direct mutagenesis of the CDRs of the VH or VL genes. Such techniques have been disclosed by Barbas et al. (Proc. Nat. Acad. Sci. U.S.A. (1994) 91:3809-3813) and Schier et al. (J. Mol. Biol. (1996) 263:551-567).

[0367] Similarly, one or more or all three CDRs can be grafted into a library of VH or VL domains, and then antigen-binding fragments specific for CTLA-4 or PD-L1 can be screened.

[0368] A portion of the immunoglobulin variable domain will contain at least one of the CDRs substantially as described herein and optionally intervening framework regions of an scFv fragment as described herein. The portion can include at least about 50% of either or both of FR1 and FR4, where the 50% is the C-terminal 50% of FR1 and the N-terminal 50% of FR4. Additional residues at the N-terminus or C-terminus of a substantial portion of the variable domain can be those that are not typically associated with naturally occurring variable domain regions. For example, constructing an antibody by recombinant DNA techniques can result in the introduction of N-terminal or C-terminal residues encoded by linkers introduced to facilitate cloning or other manipulation steps. Other manipulation steps include introducing a linker to connect the variable domain to another protein sequence, including an immunoglobulin heavy chain constant region, other variable domains (e.g., in the generation of a diabody), or a protein tag as discussed further below.

[0369] One of ordinary skill in the art will recognize that the antibodies for use in this disclosure can include antigen-binding fragments that contain only a single CDR from either the VL or VH domain. Either of the single-chain specific binding domains can be used to screen for complementary domains that can form a two-domain specific antigen-binding fragment capable of binding, for example, CTLA-4 and PD-L1.

[0370] The antibodies for use in this disclosure as described herein can be linked to another functional molecule, such as another peptide or protein (albumin, another antibody, etc.). For example, the antibody can be linked by chemical crosslinking or by recombinant methods. The antibody can also be linked to one of a variety of non-protein polymers in the manner described in U.S. Patent Nos. 4,640,835, 4,496,689, 4,301,144, 4,670,417, 4,791,192, or 4,179,337, such as polyethylene glycol, polypropylene glycol, or polyoxyalkylene. The antibody can be chemically modified by covalently conjugating it to a polymer, for example, to increase its circulatory half-life. Exemplary polymers and methods for linking them are also shown in U.S. Patent Nos. 4,766,106, 4,179,337, 4,495,285, and 4,609,546.

[0371] Antibodies can also be altered to have a glycosylation pattern different from the native pattern. For example, one or more carbohydrate moieties can be deleted and / or one or more glycosylation sites can be added to the original antibody. Adding a glycosylation site to an antibody of the present disclosure can be achieved by altering the amino acid sequence to contain a glycosylation site consensus sequence known in the art. Another means of increasing the number of carbohydrate moieties on an antibody is by chemical or enzymatic coupling of a glycoside to an amino acid residue of the antibody. Such methods are described in WO 87 / 05330 and Aplin et al. (1981) CRC Crit. Rev. Biochem., 22:259-306. Removing any carbohydrate moieties from an antibody can be achieved chemically or enzymatically, for example, as described by Hakimuddin et al. (1987) Arch. Biochem. Biophys., 259:52 and Edge et al. (1981) Anal. Biochem., 118:131 and Thotakura et al. (1987) Meth. Enzymol., 138:350. Antibodies can also be tagged with a detectable or functional label. Detectable labels include radioactive labels such as 131I or 99Tc, which can also be linked to the antibody using conventional chemical methods. Detectable labels also include enzyme labels such as horseradish peroxidase or alkaline phosphatase. Detectable labels also include chemical moieties such as biotin, which can be detected by binding to a specific homologous detectable moiety (e.g., labeled avidin).

[0372] Antibodies in which the CDR sequences are only non-substantially different from those shown herein are encompassed within the scope of the present disclosure. Generally, an amino acid is replaced with a related amino acid having similar charge, hydrophobicity, or stereochemical characteristics. Such substitutions will be within the general skill of the person skilled in the art. Different from in the CDRs, more substantial changes can be made in the FRs without adversely affecting the binding properties of the antibody. Changes in the FRs include, but are not limited to, humanizing framework residues of non-human origin or engineering certain framework residues that are important for antigen contact or stabilizing the binding site, for example, changing the class or subclass of the constant region, changing specific amino acid residues that may alter effector functions such as Fc receptor binding, for example, as described in U.S. Patents 5,624,821 and 5,648,260 and Lund et al. (1991) J. Immun. 147:2657-2662 and Morgan et al. (1995) Immunology 86:319-324, or changing the species from which the constant region is derived.

[0373] Those skilled in the art will understand that the modifications described above are not all-exhaustive, and many other modifications will be apparent to the skilled person in light of the teachings of the present disclosure.

[0374] Certain compounds

[0375] In certain embodiments, the compounds described herein can be antisense compounds. In certain embodiments, the antisense compounds comprise or consist of oligomeric compounds. In certain embodiments, the oligomeric compounds comprise modified oligonucleotides. In certain embodiments, the modified oligonucleotides have a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid.

[0376] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the modified oligonucleotides have a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid.

[0377] In certain embodiments, the compound or antisense compound is single-stranded. This single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, this oligomeric compound comprises or consists of an oligonucleotide and an optional conjugating group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

[0378] In certain embodiments, the compound is double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide and a second modified oligonucleotide, the first modified oligonucleotide having a region complementary to the target nucleic acid, and the second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotides are RNA oligonucleotides. In such embodiments, the thymine nucleobases in the modified oligonucleotides are replaced by uracil nucleobases. In certain embodiments, the compound comprises a conjugating group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide consists of 12-30 linked nucleosides, and the second modified oligonucleotide consists of 12-30 linked nucleosides. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NO: 36-2646 or 2664-2813. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 consecutive nucleobases of any one of SEQ ID NO: 2-10.

[0379] In certain embodiments, the antisense compound is double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound and a second oligomeric compound, the first oligomeric compound having a region complementary to the target nucleic acid and the second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double-stranded antisense compounds typically comprises or consists of a modified oligonucleotide and an optional conjugating group. The oligonucleotide of the second oligomeric compound of such double-stranded antisense compounds may be modified or unmodified. Either or both of the oligomeric compounds of the double-stranded antisense compound may comprise a conjugating group. The oligomeric compounds of the double-stranded antisense compound may include non-complementary overhanging nucleosides.

[0380] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, microRNA-targeting oligonucleotides, and single-stranded RNAi compounds such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

[0381] In certain embodiments, the compounds described herein have a nucleobase sequence which, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted.

[0382] In certain embodiments, the compounds described herein comprise oligonucleotides composed of 10 to 30 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 12 to 30 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 12 to 22 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 14 to 30 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 14 to 20 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 15 to 30 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 15 to 20 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 16 to 30 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 16 to 20 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 17 to 30 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 17 to 20 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 18 to 30 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 18 to 21 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 18 to 20 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 20 to 30 linking subunits. In other words, such oligonucleotides are composed of 12 to 30 linking subunits, 14 to 30 linking subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linking subunits, respectively. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 14 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 16 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 17 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 18 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 19 linking subunits. In certain embodiments, the compounds described herein comprise oligonucleotides composed of 20 linking subunits.In other embodiments, the compounds described herein comprise oligonucleotides composed of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linking subunits. In certain such embodiments, the compounds described herein comprise oligonucleotides composed of: 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linking subunits or a range defined by any two of the above values. In some embodiments, the linking subunit is a nucleotide, nucleoside, or nucleobase.

[0383] In certain embodiments, the compound may further comprise additional features or elements attached to the oligonucleotide, such as a conjugating group. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where the conjugating group comprises a nucleoside (i.e., the nucleoside to which the conjugating group is attached to the oligonucleotide), the nucleoside of the conjugating group is not counted towards the length of the oligonucleotide.

[0384] In certain embodiments, the compound can be shortened or truncated. For example, a single subunit can be deleted from the 5' end (5' truncation) or alternatively from the 3' end (3' truncation). A shortened or truncated compound targeting MALAT1 nucleic acid can have two subunits deleted from the 5' end of the compound, or alternatively can have two subunits deleted from the 3' end of the compound. Alternatively, the deleted nucleosides can be dispersed throughout the compound.

[0385] When a single additional subunit is present in the extended compound, the additional subunit may be located at the 5' or 3' end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, such as in a compound where two subunits are added to the 5' end of the compound (5' addition) or alternatively added to the 3' end of the compound (3' addition). Alternatively, the added subunits may be dispersed throughout the compound.

[0386] The length of a compound such as an oligonucleotide can be increased or decreased, and / or mismatched bases can be introduced without abolishing activity (Woolf et al., Proc. Natl. Acad. Sci. USA 1992, 89:7305 - 7309; Gautschi et al., J. Natl. Cancer Inst. March 2001, 93:463 - 471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341 - 3358). However, seemingly small changes in the oligonucleotide sequence, chemistry, and motifs can result in large differences in one or more of the many properties required for clinical development (Seth et al., J. Med. Chem. 2009, 52, 10; Egli et al., J. Am. Chem. Soc. 2011, 133, 16642).

[0387] In certain embodiments, the compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short interfering RNAs or siRNAs) and single-stranded RNAi compounds (or ssRNAs). Such compounds act at least in part through the RISC pathway to degrade and / or sequester target nucleic acids (thus, including microRNA / microRNA-mimic compounds). As used herein, the term siRNA is intended to be equivalent to other terms used to describe nucleic acid molecules capable of mediating sequence-specific RNAi, such as short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and the like. In addition, as used herein, the term "RNAi" is intended to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, transcriptional repression, or epigenetics.

[0388] In certain embodiments, the compounds described herein can comprise any of the MALAT1-targeting oligonucleotide sequences described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand and a second strand, wherein the first strand comprises a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises a first strand and a second strand, wherein the first strand comprises the nucleobase sequence of any of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises ribonucleotides, wherein the first strand has uracil (U) instead of thymine (T) in any of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises: (i) a first strand that comprises a nucleobase sequence complementary to a site on MALAT1 targeted by any of SEQ ID NOs: 2-10 or 36-2813; and (ii) a second strand. In certain embodiments, the compound comprises a first strand and a second strand, wherein the first strand comprises a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a first strand and a second strand, wherein the first strand comprises the nucleobase sequence of any of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises ribonucleotides, wherein the first strand has uracil (U) instead of thymine (T) in any of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises: (i) a first strand that comprises a nucleobase sequence complementary to a site on MALAT1 targeted by any of SEQ ID NOs: 2-10; and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides, wherein the 2'-position of the sugar contains a halogen (such as fluoro; 2'-F) or contains an alkoxy group (such as methoxy; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern along one strand of the dsRNA compound for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases. In certain embodiments, the compound comprises one or more bonds between adjacent nucleotides in addition to the naturally occurring phosphodiester bond. Examples of such bonds include phosphoramidate, phosphorothioate, and dithiophosphate bonds.The compound can also be a chemically modified nucleic acid molecule, as taught in U.S. Patent No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed in WO 00 / 63364, filed Apr. 19, 2000.

[0389] In certain embodiments, the first strand of the compound is the siRNA guide strand and the second strand of the compound is the siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the first or second strand of the compound can comprise a conjugating group.

[0390] In certain embodiments, the compounds described herein can comprise any of the oligonucleotide sequences targeting MALAT1 described herein. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises the nucleobase sequence of any of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises ribonucleotides, wherein uracil (U) replaces thymine (T) in any of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises a nucleobase sequence that is complementary to the site on MALAT1 targeted by any of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises the nucleobase sequence of any of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises ribonucleotides, wherein uracil (U) replaces thymine (T) in any of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a nucleobase sequence that is complementary to the site on MALAT1 targeted by any of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises one or more modified nucleotides, wherein the 2'-position of the sugar contains a halogen (such as fluoro; 2'-F) or contains an alkoxy group (such as methoxy; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern along a strand of the compound for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases. In certain embodiments, the compound comprises one or more bonds between adjacent nucleotides other than the naturally occurring phosphodiester bond. Examples of such bonds include phosphoramidate, phosphorothioate, and dithiophosphate bonds. The compound can also be a chemically modified nucleic acid molecule, as taught in U.S. Patent 6,673,661.In other embodiments, the compounds contain a capping strand, as disclosed in WO 00 / 63364, filed Apr. 19, 2000. In certain embodiments, the compounds are composed of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compounds may contain a conjugating group.

[0391] In certain embodiments, the compounds described herein contain modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations, which may be defined as (R) or (S) (in terms of absolute stereochemistry), α or β (such as in terms of sugar anomers), or (D) or (L) (such as in terms of amino acids), etc. Unless otherwise specified, all such possible isomers, including their racemic and optically pure forms, are included in the modified oligonucleotides provided herein. Similarly, all cis and trans isomers and tautomeric forms are also included.

[0392] The compounds described herein include the following variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, the compounds herein containing a hydrogen atom encompass all possible deuterium substitutions of each 1 H hydrogen atom. Isotope substitutions encompassed by the compounds herein include, but are not limited to: 2 H or 3 H in place of 1 H; 13 C or 14 C in place of 12 C; 15 N in place of 14 N; 17 O or 18 O in place of 16 O; and 33 S, 34 S, 35 S or 36 S in place of 32 S. In certain embodiments, non-radioactive isotope substitutions may confer new properties on the compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions may produce compounds suitable for research or diagnostic purposes such as imaging assays.

[0393] Certain mechanisms

[0394] In certain embodiments, the compounds described herein comprise or consist of a modified oligonucleotide. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise an oligomeric compound. In certain embodiments, the compounds described herein are capable of hybridizing to a target nucleic acid to afford at least one antisense activity. In certain embodiments, the compounds described herein selectively affect one or more target nucleic acids. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to afford one or more desired antisense activities and that does not hybridize to one or more non-target nucleic acids or hybridize to one or more non-target nucleic acids in a manner that produces significant undesired antisense activity.

[0395] In certain antisense activities, hybridization of the compounds described herein to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in ribonuclease H-mediated cleavage of a target nucleic acid. Ribonuclease H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not necessarily have to be unmodified DNA. In certain embodiments, the compounds described herein are sufficiently "DNA-like" to elicit ribonuclease H activity. In addition, in certain embodiments, one or more non-DNA-like nucleosides in the gap of the spacer are tolerated.

[0396] In certain antisense activities, the compound or a portion of the compound described herein is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of a target nucleic acid by Argonaute. The compound loaded into RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).

[0397] In certain embodiments, hybridization of the compounds described herein to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in an alteration in the splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to the target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in an alteration in the translation of the target nucleic acid.

[0398] Antisense activity can be observed directly or indirectly. In certain embodiments, the observation or detection of antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0399] Target Nucleic Acids, Target Regions, and Nucleotide Sequences

[0400] In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide that comprises a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: mRNA and precursor mRNA, including intron regions, exon regions, and untranslated regions. In certain embodiments, the target RNA is mRNA. In certain embodiments, the target nucleic acid is precursor mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron.

[0401] The nucleotide sequence encoding MALAT1 includes, but is not limited to, the following: RefSEQ No. XR_001309.1 (SEQ ID NO:1), which is incorporated herein by reference in its entirety.

[0402] Hybridization

[0403] In some embodiments, hybridization occurs between the compounds disclosed herein and MALAT1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases of nucleic acid molecules (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding).

[0404] Hybridization can occur under different conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0405] Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein can specifically hybridize to MALAT1 nucleic acid.

[0406] Complementarity

[0407] An oligonucleotide is said to be complementary to another nucleic acid when, upon aligning the two nucleobase sequences in opposite directions, the nucleobase sequence of the oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof. Unless otherwise specified, nucleobase matches or complementary nucleobases as described herein are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at every nucleoside and may include one or more nucleobase mismatches. When such an oligonucleotide has nucleobase matches at every nucleoside with no nucleobase mismatches, the oligonucleotide is fully complementary or 100% complementary.

[0408] In certain embodiments, the compounds described herein comprise or consist of a modified oligonucleotide. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise an oligomeric compound. Non-complementary nucleobases between the compound and the MALAT1 nucleic acid may be tolerated provided that the compound is still capable of specifically hybridizing to the target nucleic acid. Additionally, the compound may hybridize to one or more segments of the MALAT1 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., loop structures, mismatches or hairpin structures).

[0409] In certain embodiments, the compounds provided herein or a designated portion thereof is, is at least, or is at most 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to the MALAT1 nucleic acid, its target region, target segment or designated portion. In certain embodiments, the compounds provided herein or a designated portion thereof is 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100% (or any number between these ranges) complementary to the MALAT1 nucleic acid, its target region, target segment or designated portion. The percentage of complementarity of the compound to the target nucleic acid can be determined using conventional methods.

[0410] For example, a compound in which 18 out of 20 nucleobases are complementary to the target region and thus will specifically hybridize will represent 90% complementarity. In this example, the remaining non-complementary nucleobases may be clustered or alternating with the complementary nucleobases and need not be contiguous with each other or with the complementary nucleobases. Thus, a compound consisting of 18 nucleobases (which has 4 non-complementary nucleobases that flank two regions that are completely complementary to the target nucleic acid) will have an overall complementarity of 77.8% with the target nucleic acid. The percentage of complementarity of a compound with a region of a target nucleic acid can be routinely determined using the BLAST program (basic local alignment search tool) and the PowerBLAST program known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). The percentage of homology, sequence identity or complementarity can be determined by, for example, using the Gap program (Wisconsin Sequence Analysis Package, version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using the Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489) algorithm with default settings.

[0411] In certain embodiments, the compounds described herein or specified portions thereof are completely complementary (i.e., 100% complementary) to the target nucleic acid or specified portions thereof. For example, a compound may be completely complementary to a MALAT1 nucleic acid or its target region or target segment or target sequence. As used herein, "completely complementary" means that each nucleobase of the compound is complementary to the corresponding nucleobase of the target nucleic acid. For example, a 20-nucleobase compound is completely complementary to a 400-nucleobase target sequence as long as there is a corresponding 20-nucleobase portion of the target nucleic acid that is completely complementary to the compound. Complete complementarity can also be used with respect to specified portions of the first nucleic acid and / or the second nucleic acid. For example, a 20-nucleobase portion of a 30-nucleobase compound can be "completely complementary" to a 400-nucleobase target sequence. The 20-nucleobase portion of the 30-nucleobase compound is completely complementary to the target sequence when the target sequence has a corresponding 20-nucleobase portion, where each nucleobase is complementary to the 20-nucleobase portion of the compound. At the same time, the entire 30-nucleobase compound may or may not be completely complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

[0412] In certain embodiments, the compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, the antisense activity against the target is reduced by such mismatches, but the activity against non-targets is reduced by a greater amount. Thus, in certain such embodiments, the selectivity of the compound is improved. In certain embodiments, the mismatch is specifically located within an oligonucleotide having a spacer motif. In certain such embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, or 8 at the 5' end of the gap region. In certain such embodiments, the mismatch is located at position 9, 8, 7, 6, 5, 4, 3, 2, 1 at the 3' end of the gap region. In certain such embodiments, the mismatch is located at position 1, 2, 3, or 4 at the 5' end of the flank region. In certain such embodiments, the mismatch is located at position 4, 3, 2, or 1 at the 3' end of the flank region. In certain embodiments, the mismatch is specifically located within an oligonucleotide that does not have a spacer motif. In certain such embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 at the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is located at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 at the 3' end of the oligonucleotide.

[0413] The positioning of the non-complementary nucleobase(s) can be at the 5' or 3' end of the compound. Alternatively, one or more non-complementary nucleobases can be in an internal position of the compound. When two or more non-complementary nucleobases are present, they can be contiguous (i.e., linked) or non-contiguous. In one embodiment, the non-complementary nucleobases are located in the flank segments of a spacer oligonucleotide.

[0414] In certain embodiments, the compounds described herein that are of or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (such as a MALAT1 nucleic acid) or a designated portion thereof.

[0415] In certain embodiments, the compounds described herein that are of or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (such as a MALAT1 nucleic acid) or a designated portion thereof.

[0416] In certain embodiments, the compounds described herein also include those that are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of consecutive (i.e., linked) nucleobases within a region or segment of a target nucleic acid. "Portion" can also refer to a defined number of consecutive nucleobases in a compound. In certain embodiments, the compound is complementary to a portion of at least 8 nucleobases in the target segment. In certain embodiments, the compound is complementary to a portion of at least 9 nucleobases in the target segment. In certain embodiments, the compound is complementary to a portion of at least 10 nucleobases in the target segment. In certain embodiments, the compound is complementary to a portion of at least 11 nucleobases in the target segment. In certain embodiments, the compound is complementary to a portion of at least 12 nucleobases in the target segment. In certain embodiments, the compound is complementary to a portion of at least 13 nucleobases in the target segment. In certain embodiments, the compound is complementary to a portion of at least 14 nucleobases in the target segment. In certain embodiments, the compound is complementary to a portion of at least 15 nucleobases in the target segment. In certain embodiments, the compound is complementary to a portion of at least 16 nucleobases in the target segment. Also encompassed are compounds that are complementary to a portion of at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more (or ranges defined by any two of these values) nucleobases in the target segment.

[0417] Identity

[0418] The compounds provided herein may also have a defined percentage of identity with a specific nucleotide sequence SEQ ID NO or a compound or portion thereof represented by a specific ION number. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. As used herein, a compound is consistent with a sequence disclosed herein if it has the same nucleobase pairing ability. For example, RNA containing uracil in place of thymine in a disclosed DNA sequence will be considered consistent with the DNA sequence because both uracil and thymine pair with adenine. Also encompassed are shortened and extended forms of the compounds described herein as well as compounds having non-consistent bases relative to the compounds provided herein. Non-consistent bases may be adjacent to each other or dispersed throughout the compound. The percentage of identity of a compound is calculated based on the number of bases having consistent base pairing relative to the sequence to which it is compared.

[0419] In certain embodiments, the compounds or portions thereof described herein have or have at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with one or more compounds or SEQ ID NOs or portions thereof disclosed herein. In certain embodiments, the compounds described herein have about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% (or any percentage between such values) identity with a specific nucleotide sequence, SEQ ID NO, or a compound or portion thereof represented by a specific ION number, wherein the compound comprises an oligonucleotide having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 at the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 at the 3' end of the oligonucleotide.

[0420] In certain embodiments, the compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an equal-length portion of the target nucleic acid. In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases is compared to an equal-length portion of the target nucleic acid.

[0421] In certain embodiments, the compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an equal-length portion of the target nucleic acid. In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases is compared to an equal-length portion of the target nucleic acid.

[0422] Certain modified compounds

[0423] In certain embodiments, the compounds described herein comprise or consist of oligonucleotides composed of linked nucleosides. The oligonucleotide can be an unmodified oligonucleotide (RNA or DNA) or can be a modified oligonucleotide. The modified oligonucleotide includes at least one modification relative to unmodified RNA or DNA (i.e., comprises at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside bond).

[0424] A. Modified nucleosides

[0425] Modified nucleosides contain a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0426] 1. Modified sugar moiety

[0427] In certain embodiments, the sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions corresponding to those of other types of modified sugar moieties.

[0428] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more acyclic substituents, the one or more acyclic substituents including but not limited to substituents at the 2’, 4’ and / or 5’ positions. In certain embodiments, one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2’-substituents for the non-bicyclic modified sugar moiety include but are not limited to: 2’-F, 2’-OCH3 (“OMe” or “O-methyl”), and 2’-O(CH2)2OCH3 (“MOE”). In certain embodiments, the 2’-substituent is selected from: halogen, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 alkoxy, O-C1-C 10 substituted alkoxy, O-C1-C 10 alkyl, O-C1-C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylene-O-alkyl, alkynyl, arylalkyl, aralkyl, O-arylalkyl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ), wherein each R m and R n is independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10alkyl groups, and 2'-substituents as described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from the following: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of 4'-substituents of the sugar moiety suitable for linear non-bicyclic modification include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of 5'-substituents of the sugar moiety suitable for non-bicyclic modification include, but are not limited to: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar contains more than one non-bridging sugar substituent, such as the 2'-F-5'-methyl sugar moiety and the modified sugar moieties and modified nucleosides described in Migawa et al., US2010 / 190837 and Rajeev et al., US2013 / 0203836.

[0429] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside contains a sugar moiety that contains a linear 2'-substituent selected from the following: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(R m )(R n ))), where each R m and R n is independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 alkyl.

[0430] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside contains a sugar moiety that contains a linear 2'-substituent selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”).

[0431] In certain embodiments, a 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety that comprises a linear 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0432] Nucleosides comprising a modified sugar moiety, such as a non-bicyclic modified sugar moiety, are referred to by one or more positions on the sugar moiety of the nucleoside that are substituted. For example, a nucleoside comprising a 2'-substituted or 2-modified sugar moiety is referred to as a 2'-substituted nucleoside or a 2-modified nucleoside.

[0433] Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring to give a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4'-to-2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt" when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., U.S. 7,399,845; Bhat et al., U.S. 7,569,686; Swayze et al., U.S. 7,741,457; and Swayze et al., U.S. 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., U.S. 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., U.S. 8,278,425), 4'-CH2-O-N(CH3)-2' (see, e.g., Allerson et al., U.S. 7,696,345 and Allerson et al., U.S. 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(═CH2)-2' and analogs thereof (see, e.g., Seth et al., U.S. 8,278,426), 4'-C(R a R b )-N(R)-O-2', 4'-C(R a R b)-O-N(R)-2’,4’-CH2-O-N(R)-2’ and 4’-CH2-N(R)-O-2’, where each R, R a and R b is independently H, a protecting group or a C1-C 12 alkyl group (see, for example, Imanishi et al., U.S. 7,427,672).

[0434] In certain embodiments, such 4’ to 2’ bridges independently include 1 to 4 linking groups independently selected from the following: -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-;

[0435] wherein:

[0436] x is 0, 1 or 2;

[0437] n is 1, 2, 3 or 4;

[0438] each R a and R b is independently H, a protecting group, a hydroxyl group, a C1-C 12 alkyl group, a substituted C1-C 12 alkyl group, a C2-C 12 alkenyl group, a substituted C2-C 12 alkenyl group, a C2-C 12 alkynyl group, a substituted C2-C 12 alkynyl group, a C5-C 20 aryl group, a substituted C5-C 20 aryl group, a heterocyclic radical, a substituted heterocyclic radical, a heteroaryl group, a substituted heteroaryl group, a C5-C7 cycloaliphatic radical, a substituted C5-C7 cycloaliphatic radical, a halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, an acyl group (C(=O)-H), a substituted acyl group, CN, a sulfonyl group (S(=O)2-J1) or a sulfinyl group (S(=O)-J1); and each J1 and J2 is independently H, a C1-C 12 alkyl group, a substituted C1-C 12 alkyl group, a C2-C12 alkenyl, substituted C2-C 12 alkenyl, C2-C 12 alkynyl, substituted C2-C 12 alkynyl, C5-C 20 aryl, substituted C5-C 20 aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 aminoalkyl, substituted C1-C 12 aminoalkyl or a protecting group.

[0439] Additional bicyclic sugar moieties are known in the art, see for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. 7,053,207; Imanishi et al., U.S. 6,268,490; Imanishi et al U.S. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499; Wengel et al., U.S. 6,670,461; Wengel et al., U.S. 7,034,133; Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S. 7,572,582; and Ramasamy et al., U.S. 6,525,191; Torsten et al., WO2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., U.S. 7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S.8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; Allerson et al., US2008 / 0039618; and Migawa et al., US2015 / 0191727.

[0440] In certain embodiments, the bicyclic sugar moiety and the nucleoside incorporating such a disaccharide moiety are further defined by their anomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L configuration or in the β-D configuration.

[0441]

[0442] α-L-methoxy (4’-CH2-O-2’) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, the general description of the bicyclic nucleoside includes both anomeric configurations. Unless otherwise specified, when identifying the position of a particular bicyclic nucleoside (e.g., LNA or cEt) in the exemplary embodiments herein, it is in the β-D configuration.

[0443] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5’-substituted and 4’-2’-bridged sugars).

[0444] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atoms of the sugar moiety are replaced by, for example, sulfur, carbon, or nitrogen atoms. In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2’-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and / or at the 5’-position.

[0445] In certain embodiments, the sugar surrogate comprises a ring having other than 5 atoms. For example, in certain embodiments, the sugar surrogate includes a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans can be further modified or substituted. Nucleosides incorporating such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (see, e.g., Leumann, C.J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro-HNA:

[0446]

[0447] (“F-HNA”, see, for example, Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; and Swayze et al., U.S. 9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran) and nucleosides comprising additional modified THP compounds of the formula:

[0448]

[0449] wherein, for each of the modified THP nucleosides, independently:

[0450] Bx is a nucleobase moiety;

[0451] T3 and T4 are each independently a internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is a internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxy protecting group, a linked conjugating group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of R1 and R2 is independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0452] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0453] In certain embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than one heteroatom. For example, glycosides containing a morpholino sugar moiety and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506). As used herein, the term "morpholino" refers to a sugar substitute having the following structure:

[0454]

[0455] In certain embodiments, the morpholino can be modified, for example, by adding or changing various substituents from the above morpholino structure. Such sugar substitutes are referred to herein as "modified morpholinos".

[0456] In certain embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include, but are not limited to: peptide nucleic acids ("PNA"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865) and the nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378.

[0457] Many other bicyclic and tricyclic sugar and sugar substitute ring systems that can be used in modified nucleosides are known in the art.

[0458] 2. Modified nucleobases

[0459] Nucleobase (or base) modifications or substitutions can be structurally distinct from naturally occurring or synthetic unmodified nucleobases, but can be functionally interchangeable with the naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can confer nuclease stability, binding affinity, or some other beneficial biological property to an antisense compound.

[0460] In certain embodiments, the compounds described herein comprise modified oligonucleotides. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides containing unmodified nucleobases. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides containing modified nucleobases. In certain embodiments, the modified oligonucleotides comprise one or more nucleosides that do not contain a nucleobase, referred to as abasic nucleosides.

[0461] In certain embodiments, the modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2-, N-6-, and O-6-substituted purines. In certain embodiments, the modified nucleobases are selected from: 2-aminopropyladenine; 5-hydroxymethylcytosine; 5-methylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-N-methylguanine; 6-N-methyladenine; 2-propyladenine; 2-thiouracil; 2-thiothymine; and 2-thiocytosine; 5-propynyl (C≡C-CH3) uracil; 5-propynylcytosine; 6-azauracil; 6-azacytosine; 6-azathymine; 5-ribosyluracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy, 8-aza, and other 8-substituted purines; 5-halo especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine; 7-methylguanine; 7-methyladenine; 2-F-adenine; 2-aminoadenine; 7-deazaguanine; 7-deazaadenine; 3-deazaguanine; 3-deazaadenine; 6-N-benzoyladenine; 2-N-isobutyrylguanine; 4-N-benzoyl cytosine; 4-N-benzoyl uracil; 5-methyl 4-N-benzoyl cytosine; 5-methyl 4-N-benzoyl uracil; universal bases; hydrophobic bases; promiscuous bases; size-expanded bases; and fluorinated bases. Additional modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Additional nucleobases include those disclosed in the following: Merigan et al., U.S. 3,687,808; The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I. ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B. eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke S.T. ed., CRC Press, 2008, 163-166 and 442-443.

[0462] Publications teaching the preparation of certain of the modified nucleobases described above, as well as other modified nucleobases, include, but are not limited to: Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler et al., U.S. 5,484,908; Matteucci et al., U.S. 5,502,177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594,121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., U.S. 6,166,199; and Matteucci et al., U.S. 6,005,096.

[0463] In certain embodiments, a compound that targets MALAT1 nucleic acid comprises one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine.

[0464] 3. Modified internucleoside linkages

[0465] The naturally occurring internucleoside linkages of RNA and DNA are 3'-to-5' phosphodiester linkages. In certain embodiments, compounds having one or more modified (i.e., non-naturally occurring) internucleoside linkages as described herein are generally selected over compounds having naturally occurring internucleoside linkages because they have desired properties such as enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0466] Representative internucleoside linkages having chiral centers include, but are not limited to, alkyl phosphates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having chiral centers can be prepared as a population of modified oligonucleotides containing racemic internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, wherein all of the phosphorothioate internucleoside linkages are racemic. Such modified oligonucleotides can be generated using synthetic methods capable of randomly selecting the stereochemical configuration of each phosphorothioate bond. Nevertheless, as will be understood by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides that contain one or more specific phosphorothioate internucleoside linkages in a specifically selected stereochemical configuration. In certain embodiments, a specific configuration of a specific phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, a specific configuration of a specific phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, a specific configuration of a specific phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, a specific configuration of a specific phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, a specific configuration of a specific phosphorothioate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, such as those described in: Oka et al., JACS 125, 8307 (2003); Wan et al., Nuc. Acid. Res. 42, 13456 (2014); and WO 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides containing (Rp) and / or (Sp) phosphorothioates contain one or more of the following formulas, where "B" represents a nucleobase:

[0467]

[0468] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be atactic or in a specific stereochemical configuration.

[0469] In certain embodiments, compounds that target MALAT1 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkage is a phosphorothioate linkage. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage.

[0470] In certain embodiments, the compounds described herein comprise oligonucleotides. Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

[0471] In certain embodiments, the nucleosides of the modified oligonucleotide can be joined together using any internucleoside linkage. Two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphate esters (which contain a phosphodiester bond (“P═O”) (also referred to as an unmodified or naturally occurring bond)), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”) and dithiophosphates (“HS-P═S”). Representative non-phosphorus-containing internucleoside linking groups include, but are not limited to, methylene methylimino (-CH2-N(CH3)-O-CH2-), phosphorothioate, thiocarbamate (-O-C(═O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to the naturally occurring phosphodiester bond, modified internucleoside linkages can be used to alter (usually increase) the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as individual enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0472] Neutral internucleoside linkages include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thiormacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages that include siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages that include mixed N, O, S, and CH2 components.

[0473] In certain embodiments, an oligonucleotide comprises modified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, the internucleoside linkages are arranged in a gapped motif. In such embodiments, the internucleoside linkages in each of the two flanking regions are different from the internucleoside linkages in the gapped region. In certain embodiments, the internucleoside linkages in the flanks are phosphodiesters and the internucleoside linkages in the gap are phosphorothioates. The nucleoside motifs are independently selected such that such oligonucleotides with a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif, and if they do not have a gapped nucleoside motif, the flank lengths and the gap length may be the same or different.

[0474] In certain embodiments, an oligonucleotide comprises a region having an alternating internucleoside linkage motif. In certain embodiments, an oligonucleotide comprises a region of uniformly modified internucleoside linkages. In certain such embodiments, an oligonucleotide comprises a region uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, an oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate, and at least one internucleoside linkage is a phosphorothioate.

[0475] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block having at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block having at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block having at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block having at least 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.

[0476] In certain embodiments, the oligonucleotide comprises one or more methylphosphonate linkages. In certain embodiments, an oligonucleotide having a spacer nucleoside motif comprises a linkage motif comprising all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate linkage is in the central gap of an oligonucleotide having a spacer nucleoside motif.

[0477] In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced and the number of phosphodiester internucleoside linkages can be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced and the number of phosphodiester internucleoside linkages can be increased while still maintaining nuclease resistance. In certain embodiments, it is desirable to reduce the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.

[0478] Certain motifs

[0479] In certain embodiments, the compounds described herein include oligonucleotides. The oligonucleotides can have motifs, such as patterns of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages. In certain embodiments, a modified oligonucleotide includes one or more modified nucleosides that include a modified sugar. In certain embodiments, a modified oligonucleotide includes one or more modified nucleosides that include a modified nucleobase. In certain embodiments, a modified oligonucleotide includes one or more modified internucleoside linkages. In such embodiments, the modifications, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of the modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of the sugar moiety, nucleobase, and internucleoside linkage are each independent of one another. Thus, a modified oligonucleotide can be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, the nucleobase motif describes modifications to the nucleobases independent of the nucleobase sequence).

[0480] a. Certain sugar motifs

[0481] In certain embodiments, the compounds described herein include oligonucleotides. In certain embodiments, the oligonucleotide includes one or more types of modified and / or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar motif. In some cases, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0482] In certain embodiments, a modified oligonucleotide includes or consists of a region having a spacer motif that includes two outer regions or "flanks" and a central or inner region or "gap". The three regions of the spacer motif (5'-flank region, gap region, and 3'-flank region) form a continuous nucleoside sequence, wherein at least some of the sugar moieties of the nucleosides of each flank are different from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each flank that are closest to the gap (the 3'-terminal most nucleoside of the 5'-flank and the 5'-terminal most nucleoside of the 3'-flank) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the flank and the gap (i.e., the flank / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap includes one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two flanks are the same as each other (symmetric spacer). In certain embodiments, the sugar motif of the 5'-flank is different from the sugar motif of the 3'-flank (asymmetric spacer).

[0483] In certain embodiments, the flanks of the spacer comprise 1-5 nucleosides. In certain embodiments, the flanks of the spacer comprise 2-5 nucleosides. In certain embodiments, the flanks of the spacer comprise 3-5 nucleosides. In certain embodiments, all of the nucleosides of the spacer are modified nucleosides.

[0484] In certain embodiments, the gap of the spacer comprises 7-12 nucleosides. In certain embodiments, the gap of the spacer comprises 7-10 nucleosides. In certain embodiments, the gap of the spacer comprises 8-10 nucleosides. In certain embodiments, the gap of the spacer comprises 10 nucleosides. In one embodiment, each of the nucleosides of the gap of the spacer is an unmodified 2'-deoxynucleoside.

[0485] In certain embodiments, the spacer is a deoxy spacer. In such embodiments, the nucleosides on the gap side of each flank / gap junction are unmodified 2'-deoxynucleosides, and the nucleosides on the flank side of each flank / gap junction are modified nucleosides. In certain such embodiments, each of the nucleosides of the gap is an unmodified 2'-deoxynucleoside. In certain such embodiments, each of the nucleosides of each flank is a modified nucleoside.

[0486] In certain embodiments, the modified oligonucleotide has a fully modified sugar motif, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, herein referred to as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniformly modified oligonucleotide comprises the same 2'-modification.

[0487] In certain embodiments, the modified oligonucleotide can comprise a sugar motif as described in any of: Swayze et al., US2010 / 0197762; Freier et al., US2014 / 0107330; Freier et al., US2015 / 0184153; and Seth et al., US2015 / 0267195, each of which is incorporated herein by reference in its entirety.

[0488] Certain embodiments provided herein relate to modified oligomeric compounds that can be used to inhibit the expression of a target nucleic acid, which can be used for treating, preventing, ameliorating or slowing the progression of a disease associated with the target nucleic acid. In certain embodiments, the modified oligomeric compound comprises an antisense oligonucleotide as a spacer having certain glycosyl motifs. In certain embodiments, the spacer glycosyl motifs provided herein can be combined with any nucleobase sequence and any internucleoside linkage motif to form an effective antisense oligonucleotide.

[0489] In certain embodiments, a method comprises contacting a cell with a compound or administering the compound to a subject, the compound comprising a modified oligonucleotide composed of 16 linked nucleosides and having the motif: ekk-d9-kkee, wherein 'd' represents 2'-deoxyribose, 'k' represents a cEt nucleoside, and 'e' represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

[0490] In certain embodiments, a method comprises contacting a cell with a compound or administering the compound to a subject, the compound comprising a modified oligonucleotide composed of 16 linked nucleosides and having the motif: k-d9-kekeke, wherein 'd' represents 2'-deoxyribose, 'k' represents a cEt nucleoside, and 'e' represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

[0491] In certain embodiments, a method comprises contacting a cell with a compound or administering the compound to a subject, the compound comprising a modified oligonucleotide composed of 16 linked nucleosides and having the motif: kkk-d8-kekek, wherein 'd' represents 2'-deoxyribose, 'k' represents a cEt nucleoside, and 'e' represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

[0492] In certain embodiments, a method includes contacting a cell with a compound or administering the compound to a subject, the compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d9-keke, where 'd' represents 2'-deoxyribose, 'k' represents a cEt nucleoside, and 'e' represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, the compound is administered to the subject to treat the subject's cancer.

[0493] In certain embodiments, a method includes contacting a cell with a compound or administering the compound to a subject, the compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-kdkdk, where 'd' represents 2'-deoxyribose, 'k' represents a cEt nucleoside, and 'e' represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, the compound is administered to the subject to treat the subject's cancer.

[0494] In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, where 'd' represents 2'-deoxyribose, 'k' represents a cEt nucleoside, and 'e' represents a 2'-MOE nucleoside. In certain embodiments, a method includes contacting a cell with a compound or administering the compound to a subject, the compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, where 'd' represents 2'-deoxyribose, 'k' represents a cEt nucleoside, and 'e' represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, the compound is administered to the subject to treat the subject's cancer.

[0495] In certain embodiments, a method includes contacting a cell with a compound or administering the compound to a subject, the compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-ekeke, where 'd' represents 2'-deoxyribose, 'k' represents a cEt nucleoside, and 'e' represents a 2'-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, the compound is administered to the subject to treat the subject's cancer.

[0496] b. Certain nucleobase motifs

[0497] In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, no nucleobase is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine.

[0498] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is located at the 3'-end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleotides of the 3'-end of the oligonucleotide. In certain embodiments, the block is located at the 5'-end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleotides of the 5'-end of the oligonucleotide.

[0499] In certain embodiments, an oligonucleotide having a spacer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, a nucleoside comprising a modified nucleobase is in the central gap of the oligonucleotide having a spacer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobases are selected from: 2-thiopyrimidine and 5-propynylpyrimidine.

[0500] c. Certain internucleoside linkage motifs

[0501] In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, substantially each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is independently selected from phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the sugar motif of the modified oligonucleotide is a spacer, and all of the internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the flanks are unmodified phosphodiester bonds. In certain embodiments, the terminal internucleoside linkage is modified.

[0502] 4. Certain modified oligonucleotides

[0503] In certain embodiments, the compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into the modified oligonucleotides. In certain embodiments, the modified oligonucleotides are characterized by their modifications, motifs, and overall length. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a spacer sugar motif can be modified or unmodified and can follow or not follow the spacer modification pattern of the sugar modification. For example, the internucleoside linkages within the flanking regions of the sugar spacer can be the same or different from each other and can be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such spacer oligonucleotides can comprise one or more modified nucleobases that are independent of the spacer pattern of the sugar modification. In addition, in certain cases, the oligonucleotides are described by an overall length or range and by the length or length range of two or more regions (e.g., regions of nucleosides having a specified sugar modification), and in such cases, the number of each range can be selected such that an oligonucleotide having an overall length outside the specified range is obtained. In such cases, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions A, B, and C, where region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides in which A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are within the requirements for A, B, and C), because the overall length of such oligonucleotides is 22, which exceeds the upper limit (20) of the overall length of the modified oligonucleotide. In this document, if the description of an oligonucleotide is silent with respect to one or more parameters, such parameters are not restricted. Thus, a modified oligonucleotide described only as having a spacer sugar motif without further description can have any length, internucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

[0504] Certain conjugated compounds

[0505] In certain embodiments, the compounds described herein comprise, consist of, or consist essentially of an oligonucleotide (modified or unmodified) and optionally one or more conjugating groups and / or terminal groups. A conjugating group consists of one or more conjugating moieties and a conjugation linker that links the conjugating moiety to the oligonucleotide. The conjugating group can be attached to either or both ends of the oligonucleotide and / or at any internal position. In certain embodiments, the conjugating group is attached to the 2'-position of the nucleoside of a modified oligonucleotide. In certain embodiments, the conjugating group attached to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugating group or terminal group is attached at the 3'-end and / or 5'-end of the oligonucleotide. In certain such embodiments, the conjugating group (or terminal group) is attached at the 3'-end of the oligonucleotide. In certain embodiments, the conjugating group is attached near the 3'-end of the oligonucleotide. In certain embodiments, the conjugating group (or terminal group) is attached at the 5'-end of the oligonucleotide. In certain embodiments, the conjugating group is attached near the 5'-end of the oligonucleotide.

[0506] In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, the oligonucleotide is complementary to messenger RNA (mRNA). In certain embodiments, the oligonucleotide is complementary to a sense transcript.

[0507] Examples of terminal groups include, but are not limited to, conjugating groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.

[0508] A. Certain Conjugating Groups

[0509] In certain embodiments, the oligonucleotide is covalently linked to one or more conjugating groups. In certain embodiments, the conjugating group modifies one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugating group imparts a new property to the attached oligonucleotide, such as a fluorophore or reporter group capable of detecting the oligonucleotide.

[0510] Certain conjugating groups and conjugate moieties have been previously described, for example: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); thiolcholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids such as di-hexadecyl-rac-glycerol or 1,2-di-O-hexadecyl-rac-glycerol-3-H-phosphonium triethylammonium (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973); or adamantane acetic acid, palmitoyl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); octadecylamine or hexylamino-carbonyloxy cholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937); tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038 / mtna.2014.72; and Nishina et al., Molecular Therapy, 2008, 16, 734-740); or GalNAc clusters (e.g., WO2014 / 179620).

[0511] 1. Conjugate moiety

[0512] The conjugating moiety includes, but is not limited to, an insert, a reporter molecule, a polyamine, a polyamide, a peptide, a carbohydrate (e.g., GalNAc), a vitamin moiety, polyethylene glycol, a thioether, a polyether, cholesterol, thiol cholesterol, a bile acid moiety, folic acid, a lipid, a phospholipid, biotin, a phenazine, a phenanthridine, an anthraquinone, an adamantane, an acridine, a fluorescein, a rhodamine, a coumarin, a fluorophore, and a dye.

[0513] In certain embodiments, the conjugating moiety includes an active pharmaceutical substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine indomethacin, a barbiturate, a cephalosporin, a sulfonamide, an antidiabetic agent, an antibacterial agent, or an antibiotic.

[0514] 2. Conjugating Linker

[0515] The conjugating moiety is linked to the oligonucleotide through a conjugating linker. In certain compounds, the conjugating group is a single chemical bond (i.e., the conjugating moiety is linked to the oligonucleotide through a single bond via the conjugating linker). In certain embodiments, the conjugating linker comprises a chain structure, such as a hydrocarbon chain; or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units.

[0516] In certain embodiments, the conjugating linker includes one or more groups selected from the following: alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In certain such embodiments, the conjugating linker includes groups selected from the following: alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugating linker includes groups selected from the following: alkyl and amide groups. In certain embodiments, the conjugating linker includes groups selected from the following: alkyl and ether groups. In certain embodiments, the conjugating linker contains at least one phosphorus moiety. In certain embodiments, the conjugating linker includes at least one phosphate group. In certain embodiments, the conjugating linker includes at least one neutral linking group.

[0517] In certain embodiments, the conjugation linker, including those described above, is a bifunctional linking moiety, e.g., those known in the art to be useful for attaching a conjugation group to a parent compound such as the oligonucleotides provided herein. Generally, the bifunctional linking moiety includes at least two functional groups. One of the functional groups is selected to bind to a specific site on the compound, and the other is selected to bind to the conjugation group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety includes one or more groups selected from the following: amino, hydroxy, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0518] Examples of conjugation linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), 4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid N-succinimidyl ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugation linkers include, but are not limited to, substituted or unsubstituted C1-C 10 alkyl, substituted or unsubstituted C2-C 10 alkenyl, or substituted or unsubstituted C2-C 10 alkynyl, where a non-limiting list of preferred substituents includes hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0519] In certain embodiments, the conjugation linker comprises 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, the linker-nucleosides are unmodified. In certain embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from purine, substituted purine, pyrimidine, or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from the following: uracil, thymine, cytosine, 4-N-benzoyl cytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyl adenine, guanine, and 2-N-isobutyryl guanine. It is generally desirable for the linker-nucleosides to be cleaved from the compound after the compound reaches the target tissue. Thus, the linker-nucleosides are typically linked to each other and to the remainder of the compound by a cleavable bond. In certain embodiments, such cleavable bond is a phosphodiester bond.

[0520] In this text, linker-nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or having a specified percentage of complementarity to a reference nucleic acid and the compound also comprises a conjugate group that comprises a conjugated linker containing a linker-nucleoside, those linker-nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8 - 30 nucleosides, and (2) a conjugate group comprising 1 - 10 linker-nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in this compound exceeds 30. Alternatively, a compound may comprise a modified oligonucleotide consisting of 8 - 30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in this compound does not exceed 30. Unless otherwise indicated, a conjugated linker comprises no more than 10 linker-nucleosides. In certain embodiments, a conjugated linker comprises no more than 5 linker-nucleosides. In certain embodiments, a conjugated linker comprises no more than 3 linker-nucleosides. In certain embodiments, a conjugated linker comprises no more than 2 linker-nucleosides. In certain embodiments, a conjugated linker comprises no more than 1 linker-nucleoside.

[0521] In certain embodiments, it is desirable to cleave the conjugate group from the oligonucleotide. For example, in certain cases, a compound comprising a particular conjugate moiety is better taken up by a particular cell type, but once the compound has been taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugates may comprise one or more cleavable moieties, typically within the conjugated linker. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group comprising at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or subcellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0522] In certain embodiments, the cleavable bond is selected from: an amide, an ester, an ether, one or two esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or two esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate ester or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate ester bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0523] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and / or to the remainder of the compound by a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to the 3' or 5'-terminal nucleoside of the oligonucleotide by a phosphoester internucleoside bond and is covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphoester or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0524] Compositions and methods for formulating pharmaceutical compositions

[0525] The compounds described herein can be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on many criteria, including but not limited to the route of administration, the degree of the disease, or the dose to be administered.

[0526] Certain embodiments provide pharmaceutical compositions comprising one or more compounds or salts thereof. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more compounds. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, the pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more compounds and phosphate buffered saline (PBS). In certain embodiments, the pharmaceutical composition consists of one or more compounds and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. The compositions and methods for formulating pharmaceutical compositions depend on many criteria, including but not limited to the route of administration, the degree of the disease, or the dose to be administered.

[0527] The compounds described herein that target MALAT1 nucleic acids can be used in pharmaceutical compositions by combining the compounds with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Thus, in one embodiment, a pharmaceutical composition comprising a compound that targets MALAT1 nucleic acids and a pharmaceutically acceptable diluent is employed in the methods described herein. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

[0528] Pharmaceutical compositions comprising the compounds provided herein encompass any pharmaceutically acceptable salt, ester, or salt of such ester, or any other oligonucleotide that is capable of (directly or indirectly) providing its biologically active metabolite or residue upon administration to an animal (including a human). In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of the compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts.

[0529] Prodrugs can include additional nucleosides incorporated at one or both ends of the compound, which can be cleaved by endogenous nucleases in the body to form the active compound. In certain embodiments, the compound or composition further comprises a pharmaceutically acceptable carrier or diluent.

[0530] Examples

[0531] Non-limiting disclosure and incorporation by reference

[0532] Although the sequence listing accompanying this application identifies each sequence as "RNA" or "DNA" as required, in reality, those sequences can be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that names such as "RNA" or "DNA" used to describe modified oligonucleotides are arbitrary in some cases. For example, an oligonucleotide comprising a nucleoside with a 2'-OH sugar moiety and a thymine base can be described as DNA with a modified sugar (2'-OH, versus the native 2'-H of DNA) or RNA with a modified base (thymine (methylated uracil), versus the native uracil of RNA).

[0533] Accordingly, the nucleic acid sequences provided herein (including but not limited to those in the sequence listing) are intended to cover nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having a nucleobase sequence of "ATCGATCG" covers any oligonucleotide having this nucleobase sequence (whether modified or unmodified), including but not limited to such compounds containing RNA bases, such as those having the sequence "AUCGAUCG" and those having some DNA bases and some RNA bases (such as "AUCGATCG") and compounds having other modified nucleobases, such as "AT m CGAUCG", wherein m C indicates a cytosine base containing a methyl group at the 5-position.

[0534] Although certain compounds, compositions, and methods described herein have been specifically described in accordance with certain embodiments, the following examples are only for illustrating the compounds described herein and are not intended to limit the compounds described herein. The references cited in this application are each incorporated herein by reference in their entirety.

[0535] Example 1: Design of Spacers with PS Internucleoside Linkages Complementary to Human MALAT1 RNA

[0536] Modified oligonucleotides complementary to human MALAT1 nucleic acids were designed. The modified oligonucleotides in the following table are 3-10-3 cET spacers. The length of the spacer is 16 nucleosides, wherein the central gap segment contains 10 2'-deoxynucleosides or a combination of 1 2'-O-methyl nucleoside and 9 2'-deoxynucleosides. The central gap segment is flanked on the 5'-direction and 3'-direction by respective flanking segments each containing 3 nucleosides. Each nucleoside in the 5'-flanking segment and each nucleoside in the 3'-flanking segment have a cEt sugar modification. The internucleoside linkages throughout each spacer are phosphorothioate (P=S) bonds. Each cytosine residue is 5-methylcytosine. The Sequence and Chemical Representation column specifies the sequence, including 5-methylcytosine, sugar chemistry, and internucleoside bond chemistry; wherein the subscript 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, the subscript 'k' represents the cET sugar moiety, the subscript's' represents the phosphorothioate internucleoside bond, the superscript'm' in front of the cytosine residue represents 5-methylcytosine, and the subscript 'y' represents 2'-O-methyl ribose. "Start site" indicates the 5'-most terminal nucleoside in the human nucleic acid sequence that is complementary to the spacer. "Stop site" indicates the 3'-most terminal nucleoside in the human nucleic acid sequence that is complementary to the spacer.

[0537] Each of the modified oligonucleotides listed in the following table is complementary to the human MALAT1 nucleic acid sequence SEQ ID NO:1 (GENBANK accession number: XR_001309.1).

[0538] Table 1

[0539] cET spacer with PS internucleoside linkages complementary to human MALAT1

[0540]

[0541]

[0542] Example 2: Antisense inhibition of human MALAT1 in A-431 cells by modified oligonucleotides

[0543] The modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a single table shown below. Using free uptake, cultured A-431 cells at a density of 10,000 cells per well were treated with 5 nM of the modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and the MALAT1 RNA level was measured by quantitative real-time RT-PCR. The human primer-probe set RTS2736 (forward sequence AAAGCAAGGTCTCCCCACAAG, designated herein as SEQ ID NO.: 2814; reverse sequence TGAAGGGTCTGTGCTAGATCAAAA, designated herein as SEQ ID NO.: 2815; probe sequence TGCCACATCGCCACCCCGT, designated herein as SEQ ID NO.: 2816) was used to measure the RNA level. As measured by The MALAT1 RNA level was normalized to the total RNA content. The results are presented in the following table as the percentage of the control (% UTC) of the amount of MALAT1 RNA relative to untreated control cells.

[0544] Table 2

[0545] Inhibition of MALAT1 RNA by 3-10-3 cEt spacer targeting SEQ ID NO.:1

[0546]

[0547] Example 3: Dose-dependent inhibition of human MALAT1 in A-431 cells by cEt spacer

[0548] The modified oligonucleotides described in the above studies were tested at various doses in A-431 cells. Using free uptake, cultured A-431 cells at a density of 10,000 cells per well were treated with the modified oligonucleotides diluted to the concentrations described in the table below. After approximately 48 hours, MALAT1 RNA levels were measured using the human MALAT1 primer-probe set RTS2736 as previously described. As measured by , the MALAT1 RNA levels were normalized to the total RNA content. The results are given in the table below as the control percentage (% UTC) of the amount of MALAT1 RNA relative to untreated control cells. Linear regression was used on the log / linear plots of the data in excel to calculate the IC50.

[0549] Table 3

[0550] Dose-dependent inhibition of human MALAT1 mRNA expression by modified oligonucleotides in A-431

[0551]

[0552] Example 4: Dose-dependent inhibition of human MALAT1 in MDA-MB-436 cells by cEt spacer

[0553] The modified oligonucleotides described in the above studies were tested at various doses in MDA-MB-436 cells. Using free uptake, cultured MDA-MB-436 cells at a density of 5,000 - 12,000 cells per well were treated with the modified oligonucleotides diluted to the concentrations described in the table below. After approximately 48 hours, MALAT1 RNA levels were measured using the human MALAT1 primer-probe set RTS 2736 as previously described. The MALAT1 RNA levels were normalized to β-actin measured using the human primer-probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGC GTTACA, designated herein as SEQ ID NO.:2817; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO.:2818; probe sequence CCTT TCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO.:2819). The results are given in the table below as the control percentage (% UTC) of the amount of MALAT1 RNA relative to untreated control cells. The following tables represent individual experiments. The IC50 of Table 4 was calculated using Prism6 software with the "log(inhibitor) vs. response - variable slope (4 parameters)" equation. The IC50 of Tables 5 and 6 was calculated using Prism7 software with the "log(inhibitor) vs. response - variable slope (3 parameters)" equation.

[0554] Table 4

[0555] Dose-dependent inhibition of human MALAT1 RNA expression by modified oligonucleotides in MDA-MB-436 cells

[0556]

[0557] Table 5

[0558] Dose-dependent inhibition of human MALAT1 RNA expression by modified oligonucleotides in MDA-MB-436 cells

[0559]

[0560] Table 6

[0561] Dose-dependent inhibition of human MALAT1 RNA expression by modified oligonucleotides in MDA-MB-436 cells

[0562]

[0563] Example 5: Tolerance of modified oligonucleotides targeting human MALAT1 in CD-1 mice

[0564] CD-1 mice were treated with modified oligonucleotides selected from the studies described above and changes in the levels of various plasma chemical markers were evaluated.

[0565] Treatment

[0566] Groups of 4-6 week-old male CD-1 mice (obtained from Charles River) were injected subcutaneously twice a week with 50 mg / kg of the modified oligonucleotide for 4 weeks (8 treatments in total). One group of male CD-1 mice was injected with PBS. The mice were euthanized 25 days after the start of treatment (24 hours after the last administration).

[0567] Plasma chemical markers

[0568] To evaluate the effect of the modified oligonucleotide on liver function, the plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL) and albumin (ALB) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are given in the table below.

[0569] Table 7

[0570] Plasma chemical markers in CD-1 mice

[0571]

[0572] Body weight and organ weights

[0573] At the end of the study, the body weights of CD-1 mice were measured and the mean body weights of each group are given in the table below. At the end of the study, kidney, spleen and liver weights were measured and are given in the table below.

[0574] Table 8

[0575] Body weight and organ weights

[0576] ION number Body weight (g) Liver (g) Kidney (g) Spleen (g) PBS 32 1.7 0.5 0.1 1157929 34 2.3 0.5 0.2 1158161 34 2.3 0.5 0.2

[0577] Example 6: Tolerance of Modified Oligonucleotides Targeting Human MALAT1 in CD-1 Mice

[0578] CD-1 mice were treated with modified oligonucleotides selected from the studies described above and changes in the levels of various plasma chemical markers were evaluated.

[0579] Treatment

[0580] Groups of 4 - 6-week-old male CD-1 mice (obtained from Charles River) were injected subcutaneously twice a week with 50 mg / kg of the modified oligonucleotide for 4 weeks (8 treatments in total). A group of male CD-1 mice was injected with PBS. The mice were euthanized 24 days after the start of treatment (24 hours after the last administration).

[0581] Plasma chemical markers

[0582] To evaluate the effect of the modified oligonucleotide on liver function, the plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are given in the table below.

[0583] Table 9

[0584] Plasma chemical markers in CD-1 mice

[0585]

[0586] Body weight and organ weights

[0587] At the end of the study, the body weights of CD-1 mice were measured and the mean body weights of each group are given in the table below. At the end of the study, kidney, spleen and liver weights were measured and are given in the table below.

[0588] Table 10

[0589] Body weight and organ weights

[0590]

[0591] Example 7: Tolerance of Modified Oligonucleotides Targeting Human MALAT1 in CD-1 Mice

[0592] CD-1 mice were treated with modified oligonucleotides selected from the studies described above, and changes in the levels of various plasma chemical markers were evaluated.

[0593] TreatmentMale CD-1 mice (obtained from Charles River), 4 - 6 weeks old, were treated with 50 mg / kg of the modified oligonucleotide by subcutaneous injection twice a week for 4 weeks (a total of 8 treatments). One group of male CD-1 mice was injected with PBS. The mice were euthanized 26 days after the start of treatment (24 hours after the last administration).

[0594] Plasma Chemical Markers

[0595] To evaluate the effect of the modified oligonucleotide on liver function, the plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are given in the table below.

[0596] Table 11

[0597] Plasma Chemical Markers in CD-1 Mice

[0598]

[0599] Body Weight and Organ Weights

[0600] At the end of the study, the body weights of the CD-1 mice were measured, and the average body weights of each group are given in the table below. At the end of the study, the kidney, spleen, and liver weights were measured and are given in the table below.

[0601] Table 12

[0602] Body Weight and Organ Weights

[0603]

[0604] Example 8: Tolerance of Modified Oligonucleotides Targeting Human MALAT1 in CD-1 Mice

[0605] CD-1 mice were treated with modified oligonucleotides selected from the studies described above, and changes in the levels of various plasma chemical markers were evaluated.

[0606] Treatment

[0607] Male CD-1 mice (obtained from Charles River) at 4 - 6 weeks of age were subcutaneously injected with 50 mg / kg of the modified oligonucleotide twice a week for 4 weeks (a total of 8 treatments). One group of male CD-1 mice was injected with PBS. The mice were euthanized 25 days after the start of treatment (24 hours after the last administration).

[0608] Plasma chemical markers

[0609] To evaluate the effect of the modified oligonucleotide on liver function, the plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are given in the table below.

[0610] Table 13

[0611] Plasma chemical markers in CD-1 mice

[0612]

[0613] Body weight and organ weights

[0614] The body weights of CD-1 mice were measured at the end of the study, and the average body weights of each group are given in the table below. The kidney, spleen, and liver weights were measured at the end of the study and are given in the table below.

[0615] Table 14

[0616] Body weight and organ weights

[0617] ION number Body weight (g) Liver (g) Kidney (g) Spleen (g) PBS 32 1.6 0.5 0.1 1304890 36 2.0 0.5 0.2 1304906 34 1.8 0.5 0.1

[0618] Example 9: Tolerance of modified oligonucleotides targeting human MALAT1 in CD-1 mice

[0619] CD-1 mice were treated with the modified oligonucleotide selected from the studies described above and the changes in the levels of various plasma chemical markers were evaluated.

[0620] TreatmentMale CD-1 mice (obtained from Charles River) at 4 - 6 weeks of age were subcutaneously injected with 50 mg / kg of the modified oligonucleotide twice a week for 4 weeks (a total of 8 treatments). One group of male CD-1 mice was injected with PBS. The mice were euthanized 25 days after the start of treatment (24 hours after the last administration).

[0621] Plasma chemical markers

[0622] To evaluate the effect of the modified oligonucleotides on liver function, the plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and total bilirubin (TBIL) were measured using an...

Claims

1. A modified oligonucleotide as described by the following chemical structure: or a salt thereof.

2. The modified oligonucleotide according to claim 1, wherein the modified oligonucleotide is the sodium salt or the potassium salt.

3. A modified oligonucleotide as described by the following chemical structure:

4. A composition comprising the modified oligonucleotide according to any one of claims 1-3 and a pharmaceutically acceptable diluent or carrier.

5. A composition comprising the modified oligonucleotide according to any one of claims 1-3 and water.

Images