Modified microRNAs and their use in treating cancer

Abstract

The present disclosure provides a modified microRNA nucleic acid composition, which has one or more cytosine and / or uracil bases replaced by gemcitabine or 5-halogenated uracil respectively. More specifically, the present disclosure discloses that replacing the cytosine nucleotides in the microRNA nucleotide sequence with gemcitabine molecules will increase the ability of microRNA to inhibit cancer progression and tumorigenesis. In addition, the present disclosure discloses that replacing the cytosine nucleotides in the microRNA nucleotide sequence with gemcitabine molecules and replacing the uracil bases with 5-halogenated uracil will increase the ability of microRNA to inhibit cancer development. Therefore, the present disclosure provides various modified nucleic acid (e.g., microRNA) compositions with gemcitabine molecules incorporated in its nucleotide sequence and methods of use thereof. The present disclosure further provides a pharmaceutical composition comprising a modified nucleic acid composition, and methods of using it to treat cancer.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Application No. 62 / 818,190, filed on March 14, 2019, the entire contents of which are incorporated herein by reference.

[0003] Government support

[0004] This invention was made with government support under Grant No. CA 197098 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0005] INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0006] The Sequence Listing is an ASCII text file entitled 050_9017_PCT_SequenceListing.txt, 3 KB in size, and filed with the United States Patent and Trademark Office via EFS-Web, which is incorporated herein by reference. Technical Field

[0007] The present disclosure generally relates to nucleic acid compositions comprising 2'2'-difluoro-2'deoxycytidine (gemcitabine). More specifically, the present disclosure provides modified microRNA compositions containing one or more gemcitabine molecules and methods of using the same. In addition, the present application provides pharmaceutical compositions comprising the nucleic acid compositions of the present invention and methods of using the same to treat cancer. Background Art

[0008] MicroRNA (miRNA, miR) is a highly conserved class of small non-coding RNA molecules that mediate translation in cells or organisms by negatively regulating the expression of their target genes and thereby causing translation arrest, messenger RNA (mRNA) cleavage, or a combination thereof. See Bartel DP. Cell . (2009) 136(2):215-33. By targeting multiple transcripts, miRNAs regulate a wide range of biological processes, including apoptosis, differentiation, and cell proliferation; thus, aberrant microRNA function can lead to cancer (see Ambros V. Nature . (2004) 431 pp. 350-355), and thus, miRNAs have recently been identified as biomarkers, oncogenes or tumor suppressors. See, For example, Croce, CM. Nat Rev Genet .(2009) 10 pp. 704-714.

[0009] According to the World Health Organization, cancer is the leading cause of death worldwide, accounting for 8.8 million deaths in 2015. Lung cancer is the leading cause of cancer death in both men and women in the United States, with only 18.6% of patients diagnosed with lung cancer surviving more than 5 years. Surveillance, Epidemiology, and End Results Program. SEER Cancer StatFacts: Lung and Bronchus Cancer. National Cancer Institute. Bethesda, MD (2018). There are two main types of lung cancer: non-small cell lung cancer and small cell lung cancer. Non-small cell lung cancer is further described by the type of cancer cells present in the tissue. Therefore, non-small cell lung cancer is divided into the following lung cancer subtypes: squamous cell carcinoma (also called epidermoid carcinoma), large cell carcinoma, adenocarcinoma (cancer that originates in the cells lining the alveoli), pleomorphic carcinoma, carcinoid tumor, and salivary gland carcinoma. Meanwhile, small cell lung cancer has two main types: small cell carcinoma and combined small cell carcinoma. SEER Cancer Stat Facts: Lung and Bronchus Cancer. National Cancer Institute . Bethesda, MD (2018). The most common treatments for non-small cell lung cancer are gemcitabine (2', 2'-difluoro-2'deoxycytidine), taxol (e.g., paclitaxel), cisplatin (a DNA cross-linking agent), and combinations thereof. However, many types of antibody-based therapeutics are also used to treat non-small cell lung cancer (e.g., gefitinib, pembrolizumab, alectinib). Small cell lung cancer is usually treated with chemotherapeutic agents based on methotrexate, doxorubicin hydrochloride, and topotecan.

[0010] Breast cancer is the second most common cancer in women, and the most common type of breast cancer is ductal carcinoma. Ductal carcinoma begins in ductal cells. In contrast, lobular carcinoma, which is often found in both breasts, originates from lobule or lobule. Many chemotherapeutic agents are used to treat breast cancer, including but not limited to, cytotoxic drugs such as Taxol (e.g., paclitaxel, docetaxel), doxorubicin hydrochloride, 5-FU, gemcitabine hydrochloride, methotrexate and tamoxifen citrate. In addition, many antibody-based therapeutic agents are used to treat different types of breast cancer, such as trastuzumab, olaparib and pertuzumab.

[0011] Pancreatic cancer is a deadly cancer that is very difficult to treat. See Siegel, RL et al. Cancer J. Clin. (2015) 65 pp. 5-29. Unique aspects of pancreatic cancer include a very low 5-year survival rate of less than 7%, late presentation, early metastasis, and poor response to chemotherapy and radiation. See Maitra A and Hruban RH, Annu Rev. Pathol . (2008) 3 pp. 157-188. To date, gemcitabine-based chemotherapy (2', 2'-difluoro-2'-deoxycytidine) is the gold standard for the treatment of pancreatic cancer, but the efficacy of therapeutic interventions is limited due to drug resistance. Oettle, H et al. JAMA (2013) 310 pp. 1473-1481.

[0012] Bladder cancer is a very common form of cancer in both men and women. In 2015, an estimated 708,444 people in the United States were diagnosed with bladder cancer, with approximately 2.3% of men and women being diagnosed with bladder cancer at some point in their lives. Noone AM, et al. (eds). SEER Cancer Statistics Review, 1975-2015, National Cancer Institute . Bethesda, MD (2018). The main types of bladder cancer are: transitional cell carcinoma; squamous cell carcinoma; and adenocarcinoma. Drugs approved to treat bladder cancer include, for example, doxorubicin hydrochloride, cisplatin, gemcitabine hydrochloride, and valrubicin. Certain antibodies are also approved for the treatment of bladder cancer, including atezolizumab, avelumab, durvalumab, pembrolizumab, and nivolumab.

[0013] Approximately 225,000 women in the United States are diagnosed with ovarian cancer, with approximately 12 new cases of ovarian cancer diagnosed each year. Noone AM, et al. (eds). SEER Cancer Statistics Review, 1975-2015, National Cancer Institute . Bethesda, MD (2018). There are three main forms of ovarian cancer. That is, epithelial ovarian cancer, fallopian tube cancer, and primary peritoneal cancer, which form in the tissue covering the ovary, lining the fallopian tube, or peritoneum, respectively. Many chemotherapeutic agents are used to treat ovarian cancer, including, but not limited to, cytotoxic drugs such as Taxol (e.g., paclitaxel), doxorubicin hydrochloride, topotecan hydrochloride, gemcitabine hydrochloride, carboplatin, and cisplatin. In addition, many antibody-based therapeutic agents are administered to treat ovarian cancer, such as bevacizumab, olaparib, and rucaparib camphorsulfonate.

[0014] Gemcitabine (i.e., 2'2'-difluoro-2'deoxycytidine, dFdC, dFdCyd, difluorodeoxycytidine hydrochloride, or more specifically, gemcitabine hydrochloride) is a well-known pyrimidine nucleoside. Gemcitabine is the hydrochloride salt of an analog of the antimetabolite nucleoside deoxycytidine, which has antitumor activity. Gemcitabine is converted into active metabolites difluorodeoxycytidine diphosphate and difluorodeoxycytidine triphosphate (dFdCDP, dFdCTP) within cells. dFdCDP inhibits ribonucleotide reductase, thereby reducing the pool of deoxynucleotides available for DNA synthesis; dFdCTP is incorporated into DNA, thereby causing DNA chain termination and cell apoptosis. Gemcitabine has the chemical structure 1-(2-oxo-4-amino-1,2-dihydropyrimidin-1-yl)-2-deoxy-2,2-difluororibose hydrochloride.

[0015] 5-Fluorouracil (i.e., 5-FU, or more specifically, 5-fluoro-1H-pyrimidine-2,4-dione) is a well-known pyrimidine antagonist that is used in many adjuvant chemotherapy drugs, such as Carac® cream, Efudex®, Fluoroplex®, and Adrucil®. It is well known that 5-FU targets a key enzyme, thymidylate synthase (TYMS or TS), which catalyzes the methylation of deoxyuridine monophosphate (dUMP) to deoxythymidine monophosphate (dTMP), an important step in DNA biosynthesis. Danenberg P. V., Biochim . Biophys. Acta . (1977) 473(2):73-92.

[0016] Nevertheless, existing cancer therapies are still in their infancy and there are still many obstacles to be improved or overcome. For example, it is well known that, although quite effective in treating a variety of cancers, 5-FU and gemcitabine have significant toxicity and may cause many adverse side effects. In addition, tumor cells are known to bypass apoptotic pathways by developing resistance to common therapeutic agents such as 5-FU and gemcitabine. See Gottesman MM et al., Nature Reviews Cancer , (2002) 2(1):48-58. Therefore, more effective, more stable and less toxic drugs would be of great benefit for the treatment of cancer. Summary of the invention

[0017] Without being bound by any particular theory, the premise of the present disclosure is the following discovery: when compared with some known individual chemotherapeutic agents and / or natural microRNA molecules, replacing the cytosine bases in the nucleotide sequence of microRNA with gemcitabine will increase the effectiveness of microRNA as an anticancer therapeutic agent. The present disclosure confirms that the nucleic acid composition of the present disclosure (i.e., microRNA, which replaces at least one cytosine base with a gemcitabine molecule) has a special effect as an anticancer agent. In addition, the data herein show that contacting cells with the modified microRNA composition of the present disclosure will reduce tumorigenesis by, for example, reducing cancer cell growth and viability. In addition, it is shown that the modified microRNA of the present disclosure retains target specificity, can be delivered without using harmful and ineffective delivery vehicles (e.g., nanoparticles), and shows enhanced efficacy and stability without eliminating the natural functions of natural microRNA. Therefore, the present disclosure provides novel modified microRNA compositions with enhanced stability, efficacy and target specificity for treating cancer.

[0018] Therefore, in one aspect of the present disclosure, a nucleic acid composition comprising a modified microRNA nucleotide sequence is described, wherein the sequence has at least one cytosine base (C, C-base) replaced by a gemcitabine molecule. In certain embodiments, the modified microRNA has more than one or just one cytosine replaced by gemcitabine. In certain embodiments, the modified microRNA nucleotide sequence replaces 2,3,4,5 or more cytosine bases with a gemcitabine molecule. In a specific embodiment, all cytosine bases of natural microRNA have been replaced by gemcitabine molecules respectively.

[0019] In a specific embodiment, the nucleic acid composition comprises a modified natural miR-194 nucleotide sequence, which has been modified by replacing at least one cytosine base with a gemcitabine molecule. More specifically, the nucleic acid composition contains at least the following natural miR-194 nucleotide sequence: UGUAACAGCAACUCCAUGUGGA [SEQ ID NO. 1], wherein at least 1, 2, 3, 4 or all cytosine bases are replaced by gemcitabine molecules. In one case, an accurate cytosine base in the modified miR-194 nucleotide sequence is replaced by a gemcitabine molecule. In other cases, accurate two or at least two cytosine bases in the modified miR-194 nucleotide sequence are each replaced by a gemcitabine molecule. In yet other cases, accurate three or at least three cytosine bases in the modified miR-194 nucleotide sequence are each replaced by a gemcitabine molecule. In another case, exactly 4 or at least 4 cytosine bases in the modified miR-194 nucleotide sequence are each replaced by a gemcitabine molecule. In a specific embodiment, all cytosine bases in the modified miR-194 sequence are each replaced by a gemcitabine molecule. The modification of miR-194 can be performed in the guide strand or the passenger strand of the natural microRNA. In a preferred embodiment, the modification of the miR-194 molecule is performed on the guide strand.

[0020] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-194 nucleotide sequence UGUAANAGNAANUNNAUGUGGA [SEQ ID NO. 2], wherein N is a gemcitabine molecule.

[0021] The present disclosure also shows that a microRNA having at least one uracil base (U, U-base) replaced by a 5-halouracil such as 5-fluorouracil (5-FU) and at least one cytosine base replaced by a gemcitabine molecule exhibits improved therapeutic effects on cancer cells when compared to a natural microRNA alone or a microRNA modified by replacing at least one uracil base with 5-FU.

[0022] Therefore, in another aspect of the present disclosure, a nucleic acid composition comprising a modified microRNA nucleotide sequence is described, wherein the sequence has at least one uracil base replaced by 5-halogenated uracil and at least one cytosine base replaced by a gemcitabine molecule. In certain embodiments, the modified microRNA has more than one or just one uracil replaced by 5-halogenated uracil and more than one or just one cytosine replaced by gemcitabine. In certain embodiments, the modified microRNA nucleotide sequence replaces 2,3,4 or 5 uracil bases with 5-halogenated uracil and replaces 2,3,4 or 5 cytosine bases with gemcitabine molecule. In a specific embodiment, all uracil bases of natural microRNA have been replaced by 5-halogenated uracil, and all cytosine bases of natural microRNA have been replaced by gemcitabine molecule.

[0023] In certain embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil.

[0024] In certain embodiments, the modified microRNA nucleotide sequence includes more than one 5-halogenated uracil, wherein each 5-halogenated uracil is identical. In other embodiments, the modified microRNA nucleotide sequence includes more than one 5-halogenated uracil, wherein each 5-halogenated uracil is different. In other embodiments, the modified microRNA nucleotide sequence includes more than two 5-halogenated uracils, wherein the modified microRNA nucleotide sequence includes a combination of different 5-halogenated uracils.

[0025] In an exemplary embodiment of the present disclosure, a nucleic acid composition is provided containing a miR-194 nucleotide sequence that has been modified by replacing at least one uracil nucleotide base with a 5-halouracil and replacing at least one cytosine nucleotide base with a gemcitabine molecule.

[0026] In one case, an accurate cytosine base in a natural miR-194 nucleotide sequence is replaced by a gemcitabine molecule and an accurate uracil base is replaced by a 5-halogenated uracil. In other cases, accurate two or at least two cytosine bases in a miR-194 nucleotide sequence are each replaced by a gemcitabine molecule and accurate two or at least two uracil bases are each replaced by a 5-halogenated uracil. In other cases again, accurate three or at least three cytosine bases in a miR-194 nucleotide sequence are each replaced by a gemcitabine molecule and accurate three or at least three uracil bases are each replaced by a 5-halogenated uracil. In another case, accurate 4 or at least 4 cytosine bases in a miR-194 nucleotide sequence are each replaced by a gemcitabine molecule and accurate 4 or at least 4 uracil bases are each replaced by a 5-halogenated uracil. In specific embodiments, all cytosine bases in the miR-194 sequence are each replaced with a gemcitabine molecule and all uracil bases are each replaced with a 5-halouracil, such as 5-FU.

[0027] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-194 nucleotide sequence U F GU F AANAGNAANU F NNAU F GU F GGA [SEQ ID NO. 3], wherein N is a gemcitabine molecule and U F It is a halogenated uracil, especially 5-fluorouracil.

[0028] The disclosure also relates to the preparation of the modified microRNA compositions described herein or the preparation comprising its combination (that is, at least two different modified microRNAs). In certain embodiments, the preparation can include a pharmaceutical preparation comprising the above-mentioned nucleic acid compositions and other known pharmacological agents, such as one or more pharmaceutically acceptable carriers.

[0029] The present disclosure discloses that each of the modified microRNAs exhibits potent efficacy as an anti-cancer therapeutic agent. Notably, each of the modified microRNA nucleic acid compositions tested reduced cancer cell viability, tumor growth, and development.

[0030] Therefore, another aspect of the present disclosure relates to a method for treating cancer, comprising administering to a subject an effective amount of one or more nucleic acid compositions described herein. In certain embodiments of the methods of the present invention, the nucleic acid composition comprises a modified miR-194, wherein at least 1, 2, 3, 4 or more cytosine bases are replaced by gemcitabine molecules.

[0031] In a specific embodiment, the method comprises administering a nucleic acid composition of the present disclosure to a subject having cancer or a predisposition to cancer, wherein the nucleic acid composition is a modified miR-194 molecule having a nucleic acid sequence of UGUAANAGNAANUNNAUGUGGA [SEQ ID NO. 2], wherein N is a gemcitabine molecule.

[0032] In another embodiment, the method of the present invention comprises administering a modified miR-194 having at least 1, 2, 3, 4 or more cytosine bases replaced by a gemcitabine molecule and at least 1, 2, 3, 4 or more uracil bases replaced by a halogenated uracil such as 5-fluorouracil. In a specific embodiment, the method of the present invention comprises administering a modified mir-194 having each cytosine base replaced by a gemcitabine molecule and each uracil nucleotide base replaced by a 5-halogenated uracil.

[0033] In a specific embodiment, the method of the present invention comprises administering a nucleic acid composition of the present disclosure to a subject having cancer or a predisposition to cancer, wherein the nucleic acid composition is a nucleic acid having a nucleic acid sequence U F GU F AANAGNAANU F NNAU F GU F GGA [SEQ ID NO. 3], wherein N is a gemcitabine molecule and U F It is a halogenated uracil, especially 5-fluorouracil.

[0034] In some cases, the subject treated by the methods of the present invention is a mammal. In certain embodiments, the subject treated is a human, dog, horse, pig, mouse or rat. In a specific embodiment, the subject is a person who has been diagnosed with cancer, or has been identified as having a tendency to develop cancer. In certain embodiments, the cancer treated can be, for example, pancreatic cancer, lung cancer, ovarian cancer, breast cancer or bladder cancer. In a specific embodiment, the cancer treated is pancreatic cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figures 1A-1D . Chemical representations of exemplary modified microRNA nucleotide sequences of the present disclosure. (A) Chemical representation of a native miR-194 nucleotide sequence in which no C bases or U bases are replaced with gemcitabine or halogenated uracils, respectively (SEQ ID NO: 1). (B) Chemical representation of a native miR-194 nucleotide sequence in which all U bases are replaced with halogenated uracils (i.e., U F ) is replaced, such as in SEQ ID NO: 4 (U F GUF AACAGCAACU F CCAU F GU F GGA). (C) Chemical representation of miR-194, wherein all cytosine bases are replaced by gemcitabine molecules (X), as shown in SEQ ID NO: 2. (D) Chemical representation of the miR-194 nucleotide sequence, wherein all cytosine bases are replaced by gemcitabine molecules and each uracil base is replaced by a 5-FU molecule, as shown in SEQ ID NO: 3. The orientation of each exemplary modified microRNA described is provided as a 5' to 3' or 3' to 5' indication.

[0036] Figure 2A-D. Exemplary modified microRNA nucleic acids enter cancer cells and effectively reduce target protein expression. (A) Western blots show that miR-194 targets SET8, and compared with a control modified miR-194 (5-FU-miR-194, as shown in SEQ ID NO: 4) and unmodified miR-194 nucleic acids, an exemplary modified miR-194 composition (5-FU-Gem-miR-194, as shown in SEQ ID NO: 3) with all U bases replaced by 5-FU and all C bases replaced by gemcitabine in the presence of a transfection agent and an exemplary modified miR-194 composition (Gem-mir-194, as shown in SEQ ID NO: 2) with all C bases replaced by gemcitabine enter cells and inhibit the ability of target (SET8) expression. (B) Western blot shows that cells transfected with exemplary modified microRNAs of the present disclosure in the absence of a transfection agent enter cells and inhibit SET8 expression, while control nucleic acids cannot inhibit target expression. (C) Western blot shows that another exemplary miR-194 targets (BMI1), and compared with a control modified miR-194 (5-FU-miR-194, as shown in SEQ ID NO: 4) and unmodified miR-194 nucleic acids, an exemplary modified miR-194 composition (5-FU-Gem-miR-194, as shown in SEQ ID NO: 3) with all U bases replaced by 5-FU and all C bases replaced by gemcitabine in the presence of a transfection agent and an exemplary modified miR-194 composition (Gem-mir-194, as shown in SEQ ID NO: 2) with all C bases replaced by gemcitabine enter cells and inhibit the ability of target (BMI1) expression. (D) Western blot shows that cells transfected with an exemplary modified microRNA of the present disclosure in the absence of a transfection agent enter cells and inhibit BMI1 expression, whereas an unmodified miR-194 control nucleic acid fails to inhibit target expression.

[0037] Figures 3A-3C. Figure shows that exemplary modified miR-194 molecules inhibit pancreatic cancer cell viability in a dose-dependent manner in 3 different pancreatic cancer cell lines (A) ASPC1, (B) PANC1 and (C) HS766T. When compared to exogenously expressed native miR-194 control and modified miR-194 (5-FU-miR-194, as shown in SEQ ID NO: 4), an exemplary modified miR-194 composition with all U bases replaced by 5-FU and all C bases replaced by gemcitabine (5-FU-Gem-miR-194, as shown in SEQ ID NO: 3) and an exemplary modified miR-194 composition with all C bases replaced by gemcitabine (Gem-mir-194, as shown in SEQ ID NO: 2) inhibit pancreatic cancer cell viability.

[0038] Figure 4 . In vivo systemic treatment using an exemplary modified microRNA nucleic acid composition inhibits pancreatic cancer metastasis and tumor growth. A pancreatic cancer metastasis mouse model was established by tail vein injection of metastatic human pancreatic cancer cells. Four days after the establishment of metastasis, 80 μg of a modified miR-194 nucleic acid composition was delivered by intravenous injection at a treatment frequency of injection every other day for two weeks, as shown in SEQ ID NO: 2. Compared with the control, the exemplary modified miR-194 nucleic acid was able to inhibit metastatic pancreatic cancer growth. Mice treated with the modified miR-194 nucleic acid did not show any toxicity.

[0039] Table 1. IC50 of each exemplary modified microRNA in pancreatic cancer cell lines. In ASPC1 pancreatic cancer cells, the IC50 of modified miR-194 with all U bases replaced by 5-FU (5-FU-mIR-194, SEQ ID NO: 4) was 6.06 nM; the IC50 of modified miR-194 with all C bases replaced by gemcitabine (Gem-miR-194, as shown in SEQ ID NO: 2) was 4.29 nM, and the IC50 of modified miR-194 with all U bases replaced by 5-FU and all C bases replaced by gemcitabine (5-FU-Gem-miR-194, as shown in SEQ ID NO: 3) was 2.88 nM. In PANC1 pancreatic cancer cells, the IC50 of a modified miR-194 having all U bases replaced by 5-FU (5-FU-mIR-194, SEQ ID NO: 4) was 16 nM; the IC50 of a modified miR-194 having all C bases replaced by gemcitabine (Gem-miR-194, as shown in SEQ ID NO: 2) was 1.92 nM, and the IC50 of a modified miR-194 having all U bases replaced by 5-FU and all C bases replaced by gemcitabine (5-FU-Gem-miR-194, as shown in SEQ ID NO: 3) was 0.93 nM. In HS766T pancreatic cancer cells, the IC50 of a modified miR-194 having all U bases replaced by 5-FU (5-FU-mIR-194, SEQ ID NO: 4) was 26.45 nM; the IC50 of a modified miR-194 having all C bases replaced by gemcitabine (Gem-miR-194, as shown in SEQ ID NO: 2) was 3.57 nM, and the IC50 of a modified miR-194 having all U bases replaced by 5-FU and all C bases replaced by gemcitabine (5-FU-Gem-miR-194, as shown in SEQ ID NO: 3) was 2.46 nM. DETAILED DESCRIPTION

[0040] The present disclosure provides the nucleic acid composition incorporating one or more gemcitabine molecules.Not bound by any particular theory, surprisingly, the present disclosure discloses that replacing the cytosine nucleotides in the microRNA oligonucleotide sequence with gemcitabine molecules will increase the ability of microRNA to suppress cancer development, progression and tumorigenesis.In addition, the data herein show that when compared with a single natural microRNA or a microRNA modified by replacing uracil bases with 5-FU, contacting cancer cells with the modified microRNA composition of the present disclosure will reduce the viability of cancer cells in a dose-dependent manner.In addition, it is shown that the modified microRNA of the present disclosure retains target specificity, can be delivered without using harmful and ineffective delivery vehicles (e.g., nanoparticles), and shows enhanced efficacy and stability without eliminating the natural function of natural microRNA.Therefore, the present disclosure provides various nucleic acid (e.g., microRNA) compositions incorporating one or more gemcitabine molecules in its nucleotide sequence and methods for treating cancer using it. The present disclosure further provides formulations, such as pharmaceutical compositions, comprising the modified nucleic acid compositions, and methods for treating cancer comprising administering the same to a subject in need thereof.

[0041] Nucleic acid composition.

[0042] The terms "microRNA" or "miRNA" or "miR" are used interchangeably to refer to small non-coding ribonucleic acid (RNA) molecules that can regulate gene expression by interacting with messenger RNA molecules (mRNA), DNA or proteins. Typically, microRNAs consist of a nucleic acid sequence of about 19-25 nucleotides (bases) and are present in mammalian cells. Mature microRNA molecules are single-stranded RNA molecules processed from double-stranded precursor transcripts that form local hairpin structures. The hairpin structure is usually cleaved by the Dicer enzyme to form a double-stranded microRNA duplex. See, e.g., Bartel, Cell , (2004) 116 pp. 281-297. The term microRNA as used herein includes duplexes in the 5' to 3' direction (i.e., double-stranded miR) and single-stranded miR (i.e., mature miR) and complementary strands in the 3' to 5' direction. In a specific embodiment, the modified miR of the present disclosure consists of a single-stranded mature MiR.

[0043] Typically, one of the two strands of a microRNA duplex is packaged in a microRNA ribonucleoprotein complex (microRNP). For example, microRNPs in humans also include protein eIF2C2 / Argonaute (Ago2), helicases Gemin3 and Gemin 4. Other members of the Argonaute protein family, such as Ago1, 3, and 4, also bind to microRNAs and form microRNPs.

[0044] The terms "modified microRNA", "modified miRNA", "modified miR" or "mimics" are used interchangeably herein to refer to microRNAs that are different from natural or endogenous microRNA (unmodified microRNA) polynucleotides. More specifically, in the present disclosure, the difference between a modified microRNA and an unchanged or unmodified microRNA nucleic acid sequence is one or more bases. In certain embodiments of the present disclosure, the modified microRNA of the present disclosure includes at least one cytosine (C) nucleotide base replaced by a gemcitabine molecule. In other embodiments, the modified microRNA of the present disclosure includes at least one uracil (U) nucleotide base replaced by a 5-halouracil and at least one cytosine (C) nucleotide base replaced by a gemcitabine molecule.

[0045] The term "gemcitabine" as used herein is synonymous with 2'-deoxy-2',2'-difluorocytidine, 2',2'-difluorodeoxycytidine, 4-amino-1-((2R,4R,5R)-3,3-difluoro-4-hydroxy-5-(hydroxymethyl)-tetrahydrofuran-2-yl)pyrimidin-2(1H)-one, gemcitabine hydrochloride, dFdC, dFdCyd, and difluorodeoxycytidine hydrochloride. Gemcitabine is a nucleoside (pyrimidine) analog used as chemotherapy. Gemcitabine is sold as Gemzar®. Gemcitabine has the following structure:

[0046] .

[0047] Gemcitabine is known to stop tumor growth by incorporating into DNA during the replication process. Gemcitabine is approved for the treatment of different types of cancer, including non-small cell lung cancer, pancreatic cancer, bladder cancer, breast cancer and ovarian cancer.

[0048] In one aspect of the present disclosure, a nucleic acid composition comprising a modified microRNA nucleotide sequence is described, wherein the sequence has at least one cytosine base (C) that has been replaced by a gemcitabine molecule. As further discussed herein, the nucleic acid composition of the present disclosure can be used at least to treat cancer. Specifically, the exemplary modified microRNA of the present disclosure has been shown herein to be effective in treating pancreatic cancer.

[0049] In certain embodiments, the modified microRNA has more than one or just one cytosine replaced by gemcitabine. In certain embodiments, the modified microRNA nucleotide sequence replaces 2,3,4 or 5 cytosine bases with gemcitabine molecules. In a specific embodiment, all cytosine bases of natural microRNA have been replaced by gemcitabine molecules separately.

[0050] In a specific embodiment, the nucleic acid composition comprises a modified native miR-194 nucleotide sequence that has been modified by replacing at least one cytosine base with a gemcitabine molecule.

[0051] The term "miR-194" as used herein is intended to be synonymous with the term "microRNA-194" or "miRNA-194", and refers to an oligonucleotide having the following nucleotide sequence: UGUAACAGCAACUCCAUGUGGA [SEQ ID NO. 1]. The foregoing nucleotide sequence is referred to herein as the miR-194 unmodified (i.e., "native") sequence, unless otherwise indicated. In certain embodiments, miR-194 may be referred to in the art as: hsa-miR-194 with accession number MI0000488 or MI0000732, for stem-loop containing double-stranded microRNA; hsa-miR-194-5p, for mature miR 5' to 3' strands as shown in accession number MIMAT0000460; and hsa-miR-194-3p, for 3' to 5' complementary strands of the duplex molecule as shown in accession number MIMAT0004671. MiR-194 is well known and has been studied in detail. See, e.g., Lagos-Quintana M, et al., RNA 9: pp. 175-179 (2003). As in the above case, modified microRNAs, methods of producing miR-194 mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-194 nucleic acid forms are herein deemed to be within the scope of the term "miR-194 mimics" as used herein.

[0052] Typically, the modified miR-194 (i.e., miR-194 mimic) contains no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native sequence of miR-194, wherein the additional bases are independently selected from C, U, G, and A, or the additional bases may be exclusively one of C, U, G, or A. Typically, miR-194 mimics are used in single-stranded form, but double-stranded forms are also contemplated herein.

[0053] More specifically, the modified microRNA composition contains at least a natural miR-194 nucleotide sequence, wherein at least 1, 2, 3, 4 or all cytosine bases are replaced by gemcitabine molecules. In one case, an accurate cytosine base in a natural miR-194 nucleotide sequence is replaced by a gemcitabine molecule. In other cases, accurate two or at least two cytosine bases in a natural miR-194 nucleotide sequence are each replaced by a gemcitabine molecule. In other cases, accurate three or at least three cytosine bases in a natural miR-194 nucleotide sequence are each replaced by a gemcitabine molecule. In another case, accurate 4 or at least 4 cytosine bases in a miR-194 nucleotide sequence are each replaced by a gemcitabine molecule. In a specific embodiment, all cytosine bases in the guide chain of a natural miR-194 sequence are each replaced by a gemcitabine molecule.

[0054] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-194 nucleotide sequence UGUAANAGNAANUNNAUGUGGA [SEQ ID NO. 2], wherein N is a gemcitabine molecule.

[0055] The present disclosure also demonstrates that a microRNA having at least one uracil base replaced by a 5-halouracil such as 5-fluorouracil (5-FU) and at least one cytosine base replaced by a gemcitabine molecule exhibits improved therapeutic effects on cancer cells when compared to natural microRNA alone or a microRNA modified by replacing at least one uracil base with 5-FU.

[0056] Therefore, the nucleic acid composition comprising modified microRNA is also provided in the present disclosure, and the modified microRNA has at least one uracil base replaced by 5-halogenated uracil and at least one cytosine base replaced by gemcitabine molecule.In certain embodiments, the modified microRNA has more than one or just one uracil replaced by 5-halogenated uracil and more than one or just one cytosine replaced by gemcitabine.In certain embodiments, the modified microRNA nucleotide sequence replaces 2,3,4 or 5 uracil bases with 5-halogenated uracil and replaces 2,3,4 or 5 cytosine bases with gemcitabine molecule.In a specific embodiment, all uracil bases of natural microRNA have been replaced by 5-halogenated uracil and all cytosine bases of natural microRNA have been replaced by gemcitabine molecule.

[0057] In certain embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil.

[0058] In certain embodiments, the modified microRNA nucleotide sequence includes more than one 5-halogenated uracil, wherein each 5-halogenated uracil is identical. In other embodiments, the modified microRNA nucleotide sequence includes more than one 5-halogenated uracil, wherein each 5-halogenated uracil is different. In other embodiments, the modified microRNA nucleotide sequence includes more than two 5-halogenated uracils, wherein the modified microRNA nucleotide sequence includes a combination of different 5-halogenated uracils.

[0059] In certain embodiments, nucleic acid composition contains the nucleotide sequence modified as follows: with providing the group of the effect similar to halogen atom at least one uracil nucleobase in 5-position derivatization.In certain embodiments, the group providing similar effect has the weight similar to halogen atom or spatial dimension size, for example, at most or less than the molecular weight of 20,30,40,50,60,70,80,90 or 80 g / mol.In certain embodiments, the group providing the effect similar to halogen atom can be for example methyl, trihalomethyl (for example, trifluoromethyl) group, pseudohalide (for example, triflate, cyano group or cyanate) or deuterium (D) atom.In the case of not having 5-halogenated uracil base in microRNA nucleotide sequence or outside existence, there can be the group providing the effect similar to halogen atom.

[0060] In an exemplary embodiment of the present disclosure, a nucleic acid composition containing a miR-194 nucleotide sequence is provided, which has been modified by replacing at least one uracil nucleotide base with a 5-halogenated uracil and replacing at least one cytosine nucleotide base with a gemcitabine molecule. In one case, an accurate cytosine base of a natural miR-194 nucleotide sequence is replaced by a gemcitabine molecule and an accurate uracil base is replaced by a 5-halogenated uracil. In other cases, accurate two or at least two cytosine bases in a natural miR-194 nucleotide sequence are each replaced by a gemcitabine molecule and accurate two or at least two uracil bases are each replaced by a 5-halogenated uracil. In other cases, accurate three or at least three cytosine bases in a natural miR-194 nucleotide sequence are each replaced by a gemcitabine molecule and accurate three or at least three uracil bases are each replaced by a 5-halogenated uracil. In another case, exactly 4 or at least 4 cytosine bases in the native miR-194 nucleotide sequence are each replaced by a gemcitabine molecule and exactly 4 or at least 4 uracil bases are each replaced by a 5-halouracil. In a specific embodiment, all cytosine bases in the guide strand of the native miR-194 sequence are each replaced by a gemcitabine molecule and all uracil bases are each replaced by a 5-halouracil such as 5-FU.

[0061] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-194 nucleotide sequence U F GU F AANAGNAANU F NNAU F GU F GGA [SEQ ID NO. 3], wherein N is a gemcitabine molecule and U F It is a halogenated uracil, especially 5-fluorouracil.

[0062] Any one of the method for synthesizing nucleic acid well-known, can synthesize modified microRNA nucleic acid composition described herein.In a specific embodiment, by automated oligonucleotide synthesis, such as any one of the method for using aminophosphite chemistry well-known, produce nucleic acid composition.In order to introduce one or more gemcitabine molecules or 5-halogenated uracil bases in modified miR sequence (for example, miR-194 sequence), gemcitabine or 5-halogenated uracil nucleoside aminophosphite can be included as precursor base, and the aminophosphite derivatives of the nucleoside containing natural base (for example, A, U, G and C) to be included in the nucleotide sequence.

[0063] In certain embodiments, the nucleic acid compositions of the present disclosure can be produced biosynthetically, such as by using in vitro RNA transcription from plasmids, PCR fragments, or synthetic DNA templates, or by using recombinant ( in vivo ) RNA expression method. See, for example, CM Dunham et al., Nature Methods , (2007) 4(7), pp. 547-548. The modified microRNA sequences of the present disclosure (e.g., miR-194 sequences) can be further chemically modified, such as functionalized with polyethylene glycol (PEG) or hydrocarbons or targeting agents, particularly cancer cell targeting agents such as folates, by techniques well known in the art. In order to include such groups, reactive groups (e.g., amino, aldehyde, thiol, or carboxylate groups) that can be used to attach desired functional groups can first be included in the oligonucleotide sequence. Although such reactive groups or functional groups can be incorporated into the generated nucleic acid sequence, reactive groups or functional groups can be more easily included by using automated oligonucleotide synthesis, including non-nucleoside phosphoamidates containing reactive groups or reactive precursor groups.

[0064] Modified nucleic acid preparations

[0065] The present disclosure discloses that each of the modified microRNAs exhibits potent efficacy as anticancer therapeutic agents. Notably, each of the modified microRNA nucleic acid compositions tested reduced cancer cell viability, tumor growth, and development in a dose-dependent manner.

[0066] Therefore, the present disclosure also relates to the preparation of the modified microRNA nucleic acid composition described herein. For example, the nucleic acid composition of the present invention can be formulated for pharmaceutical use. In certain embodiments, the preparation is a pharmaceutical composition containing the nucleic acid composition described herein and a pharmaceutically acceptable carrier.

[0067] In certain embodiments, the formulations of the present disclosure comprise: a modified miR-194 nucleic acid having at least one cytosine base replaced by a gemcitabine molecule, a modified miR-194 nucleic acid having at least one cytosine base replaced by a gemcitabine molecule and at least one uracil base replaced by a halogenated uracil, or a combination thereof, and a pharmaceutically acceptable carrier.

[0068] More specifically, one or more of the modified microRNA nucleic acids shown in the following nucleotide sequences can be formulated for pharmaceutical applications and uses; UGUAAXAGXAAXUXXAUGUGGA [SEQ ID NO. 2] or U F GU F AAXAGXAAXU F XXAU F GU F GGA [SEQ ID NO. 3].

[0069] The term "pharmaceutically acceptable carrier" is used herein as a synonym for a pharmaceutically acceptable diluent, vehicle or excipient. Depending on the type of pharmaceutical composition and the intended mode of administration, the nucleic acid composition can be dissolved or suspended (e.g., as an emulsion) in a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier can be any of those liquid or solid compounds, materials, compositions and / or dosage forms suitable for contact with the tissue of a subject within the scope of reasonable medical judgment. A carrier should be "acceptable" in the sense that it is harmless to the subject to which it is provided and is compatible with the other ingredients of the formulation, i.e., does not change their biological or chemical functions.

[0070] Some non-limiting examples of materials that can serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethyl cellulose, and cellulose acetate; gelatin; talc; waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as ethylene glycol and propylene glycol; polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffers; water; isotonic saline; pH buffer solutions; and other nontoxic compatible substances used in pharmaceutical preparations. Pharmaceutically acceptable carriers may also include production aids (e.g., lubricants, talc, magnesium stearate, calcium stearate, or zinc stearate or stearic acid), solvents, or encapsulating materials. If desired, certain sweeteners and / or flavoring agents and / or coloring agents may be added. Other suitable excipients can be found in standard pharmaceutical textbooks, such as "Remington's Pharmaceutical Sciences", The Science and Practice of Pharmacy, 19th Edition, Mack Publishing Company, Easton, Pa., (1995).

[0071] In certain embodiments, a pharmaceutically acceptable carrier may include a diluent that increases the bulk of a solid pharmaceutical composition and makes the pharmaceutical dosage form easier for patients and caregivers to handle. Diluents for solid compositions include, for example, microcrystalline cellulose (e.g., Avicel ® ), microcellulose, lactose, starch, pregelatinized starch, calcium carbonate, calcium sulfate, sugar, dextran, dextrin, dextrose, dicalcium phosphate dihydrate, tricalcium phosphate, kaolin, magnesium carbonate, magnesium oxide, maltodextrin, mannitol, polymethacrylates (e.g. Eudragit ® ), potassium chloride, powdered cellulose, sodium chloride, sorbitol, and talc.

[0072] The nucleic acid compositions of the present disclosure can be formulated into compositions and dosage forms according to methods known in the art. In certain embodiments, the formulated compositions can be specifically formulated for administration in solid or liquid form, including those suitable for the following: (1) oral administration, e.g., tablets, capsules, powders, granules, pastes for lingual administration, aqueous or non-aqueous solutions or suspensions, drenches, or syrups; (2) parenteral administration, e.g., by subcutaneous, intramuscular, or intravenous injection, e.g., as a sterile solution or suspension; (3) topical administration, e.g., as a cream, ointment, or spray applied to the skin, lungs, or mucous membranes; or (4) intravaginally or intrarectally, e.g., as a pessary, cream, or foam; (5) sublingually or buccally; (6) ocularly; (7) transdermally; or (8) nasally.

[0073] In certain embodiments, the formulations of the present disclosure include solid pharmaceutical agents compressed into dosage forms (such as tablets), and may include excipients, whose functions include helping to bind the active ingredient and other excipients together after compression. Binders for solid pharmaceutical compositions include gum arabic, alginic acid, carbomer (e.g., carboxyvinyl poly), sodium carboxymethylcellulose, dextrin, ethyl cellulose, gelatin, guar gum, hydrogenated vegetable oils, hydroxyethyl cellulose, hydroxypropyl cellulose (e.g., Klucel ® ), hydroxypropyl methylcellulose (such as Methocel ® ), liquid glucose, magnesium aluminum silicate, maltodextrin, methylcellulose, polymethacrylate, povidone (e.g. Kollidon ® 、Plasdone ® ), pregelatinized starch, sodium alginate and starch.

[0074] The dissolution rate of a compacted solid pharmaceutical composition in the stomach of a subject can be increased by adding a disintegrant to the composition. Disintegrants include alginic acid, carboxymethylcellulose calcium, carboxymethylcellulose sodium (e.g., Ac-Di-Sol ® 、Primellose ® ), colloidal silicon dioxide, croscarmellose sodium, crospovidone (e.g. Kollidon ® 、Polyplasdone ® ), guar gum, magnesium aluminum silicate, methylcellulose, microcrystalline cellulose, polacrilin potassium, powdered cellulose, pregelatinized starch, sodium alginate, sodium starch glycolate (e.g., Explotab ® ) and starch.

[0075] Therefore, in certain embodiments, glidants can be added to the formulation to improve the flowability of uncompacted solid doses and improve the accuracy of dosage. Excipients that can function as glidants include colloidal silicon dioxide, magnesium trisilicate, powdered cellulose, starch, talc, and tricalcium phosphate.

[0076] When preparing dosage forms such as tablets by compressing powdered compositions, the composition is subjected to pressure from punch and die. Some excipients and active ingredients have a tendency to adhere to the surface of punch and die, which can cause pitting and other surface irregularities in the product. Lubricants can be added to the composition to reduce adhesion and promote the release of the product from the die. Lubricants include magnesium stearate, calcium stearate, glyceryl monostearate, stearyl palmitin, hydrogenated castor oil, hydrogenated vegetable oil, mineral oil, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, sodium stearyl fumarate, stearic acid, talc and zinc stearate.

[0077] Formulated pharmaceutical compositions for tableting or capsule filling can be prepared by wet granulation. In wet granulation, some or all of the active ingredients and excipients in powder form are blended, and then further mixed in the presence of a liquid, typically water, which causes the powder to agglomerate into particles. The particles are sieved and / or ground, dried, and then sieved and / or ground to the desired particle size. The particles can then be tableted, or other excipients, such as glidants and / or lubricants, can be added before tableting. Compressed tablet compositions can be prepared routinely by dry mixing. For example, the blended composition of active agent and excipient can be pressed into a block or sheet, and then crushed into compacted particles. The compacted particles can be pressed into tablets subsequently.

[0078] In other embodiments, as an alternative to dry granulation, the blended composition can be directly compressed into a compacted dosage form using direct compression technology. Direct compression produces a more uniform particle-free tablet. Excipients particularly suitable for direct compression include microcrystalline cellulose, spray-dried lactose, dicalcium phosphate dihydrate, and colloidal silicon dioxide. The appropriate use of these and other excipients in direct compression is known to those skilled in the art with experience and skill, especially in the formulation challenges of direct compression. Capsule filling can include any of the above blends and granules described with reference to compression; however, they do not go through the final compression step.

[0079] In the liquid pharmaceutical composition of the present disclosure, medicament and any other solid excipient are dissolved or suspended in a liquid carrier such as water, water for injection, vegetable oil, alcohol, polyethylene glycol, propylene glycol or glycerol. The liquid pharmaceutical composition can contain an emulsifier to evenly disperse the active ingredient or other excipients that are insoluble in the liquid carrier throughout the composition. The liquid preparation can be used as an injectable, enteric or emollient type preparation. Emulsifiers that can be used in the liquid composition of the present invention include, for example, gelatin, egg yolk, casein, cholesterol, gum arabic, tragacanth, carrageenan, pectin, methylcellulose, carbomer, cetearyl alcohol and cetyl alcohol.

[0080] In certain embodiments, the liquid pharmaceutical composition of the present disclosure can also contain a viscosity enhancer to improve the mouthfeel of the product and / or cover the lining of the gastrointestinal tract. Such reagents include gum arabic, alginic acid, soap clay, carbomer, carboxymethylcellulose calcium or sodium, cetearyl alcohol, methylcellulose, ethylcellulose, gelatin, guar gum, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, maltodextrin, polyvinyl alcohol, polyvidone, propylene carbonate, propylene glycol, alginate, sodium alginate, sodium starch glycolate, starch tragacanth and xanthan gum. In other embodiments, the liquid composition of the present disclosure can also contain a buffer, such as gluconic acid, lactic acid, citric acid or acetic acid, sodium gluconate, sodium lactate, sodium citrate or sodium acetate.

[0081] Sweeteners, such as sorbitol, saccharin, sodium saccharin, sucrose, aspartame, fructose, mannitol and invert sugar, can be added to some preparations of the present disclosure to improve taste. Flavoring agents and flavor enhancers can make dosage forms more suitable for patients. Common flavoring agents and flavor enhancers for pharmaceutical products that can be included in the compositions of the present disclosure include maltol, vanillin, ethyl vanillin, menthol, citric acid, fumaric acid, ethyl maltol and tartaric acid.

[0082] Preservatives and chelating agents, such as alcohol, sodium benzoate, butylated hydroxytoluene, butylated hydroxyanisole and ethylenediaminetetraacetic acid, may be added at safe levels for ingestion to improve storage stability. Solid and liquid compositions may also be dyed using any pharmaceutically acceptable colorant to improve their appearance and / or facilitate patient identification of the product and unit dosage level.

[0083] The dosage formulation of the present disclosure can be a capsule containing the composition (e.g., a powdered or granular solid composition of the present disclosure) in a hard or soft shell. The shell can be made of gelatin and optionally contain a plasticizer such as glycerol and sorbitol, and an opacifier or colorant.

[0084] Methods for treating cancer

[0085] As described above, when compared with the anti-cancer activity shown by exogenous expression of corresponding unmodified natural microRNA and / or other known cancer therapies, the modified microRNA nucleic acid compositions of the present disclosure and their preparations thereof show unexpected and abnormal anti-cancer activity. Therefore, another aspect of the present disclosure provides a method for treating mammalian cancer by administering an effective amount of one or more modified microRNA nucleic acid compositions of the present disclosure or their preparations to a mammal.

[0086] like Figures 2A to 2D As shown, the exemplary modified microRNA nucleic acid of the present disclosure, i.e., modified miR-194, inhibits SET8 protein expression in cancer cells ( Figure 2A and 2B )、BMI1 protein expression ( Figure 2C and 2D ) and activity. More specifically, Figures 2A-2D Show, have all C bases replaced by gemcitabine through modified microRNA (Gem-miR-194, as shown in SEQ ID NO: 2) enter cancer cells and inhibit SET8 and BMI1 with or without transfection agent.In addition, have all C bases replaced by gemcitabine and all U bases replaced by 5-FU through modified microRNA (5-FU-Gem-miR-194, as shown in SEQ ID NO: 3) can enter cancer cells to inhibit SET8 or BMI1 with or without transfection agent.

[0087] In addition and Figures 3A-3C As shown in SEQ ID NO: 2, all exemplary modified microRNAs described herein reduce pancreatic cancer cell viability. More specifically, modified microRNA (Gem-miR-194, as shown in SEQ ID NO: 2) with all C bases replaced by gemcitabine reduced the pancreatic cancer cell viability in 3 different pancreatic cancer cell lines (i.e., PANC1, ASPC1 and HS766T) in a dose-dependent manner. Similarly, modified microRNA (5-FU-Gem-miR-194, as shown in SEQ ID NO: 3) with all C bases replaced by gemcitabine and all U bases replaced by 5-FU suppressed the pancreatic cancer cell viability in all pancreatic cancer models tested in a dose-dependent manner.

[0088] In addition, the modified miR compositions of the present invention were tested and found to be therapeutically effective in vivo. For example, Figure 4It was shown that intravenous treatment with two exemplary modified microRNAs of the present disclosure (e.g., modified miR-194 as shown in SEQ ID NO: 2) is effective in treating cancer (e.g., pancreatic cancer) by inhibiting tumor growth in vivo.

[0089] Therefore, the disclosed method for treating cancer includes administering one or more modified nucleic acid compositions (e.g., modified microRNAs, such as modified miR-194 nucleic acids) of the present disclosure to a subject. In certain embodiments, the nucleic acid composition can be administered as a formulation comprising the nucleic acid composition and one or more pharmaceutical carriers.

[0090] In specific embodiments, the nucleic acid compositions of the present disclosure can be administered in the absence of a delivery vehicle or pharmaceutical carrier (ie, naked). See, e.g., Figure 2B and 2D .

[0091] The term "subject" as used herein refers to any mammal. The mammal can be any mammal, although the methods herein are more typically directed to humans. The phrase "subject in need thereof" as used herein is included within the term subject and refers to any mammalian subject in need of treatment (particularly cancer) or with a medically determined elevated risk of cancerous or precancerous conditions. In a specific embodiment, the subject includes a human cancer patient.

[0092] The term "treatment" is synonymous with the term "administering an effective amount". These terms shall refer to the medical management of a subject with the purpose of curing, improving, stabilizing, alleviating one or more symptoms of a disease, pathological condition or disorder (such as cancer) or preventing a disease, pathological condition or disorder (such as cancer). These terms are used interchangeably and include active treatment, i.e., treatment specifically directed to the improvement of a disease, pathological condition or disorder, and also include etiological treatment, i.e., treatment directed to the elimination of the cause of the disease, pathological condition or disorder. In addition, treatment includes palliative treatment, i.e., treatment aimed at relieving symptoms rather than curing a disease, pathological condition or disorder; preventive treatment, i.e., treatment aimed at minimizing or partially or completely inhibiting the development of the disease, pathological condition or disorder; and supportive treatment, i.e., treatment used to supplement another specific therapy aimed at improving the disease, pathological condition or disorder. It should be understood that treatment, while intended to cure, improve, stabilize or prevent a disease, pathological condition or disorder, does not need to actually lead to cure, improvement, stabilization or prevention. The therapeutic effect can be measured or evaluated as described herein and known in the art, and the suitability of the disease, pathological condition or disorder involved is also measured or evaluated. Such measurement and evaluation can be carried out in a qualitative and / or quantitative manner. Therefore, for example, the characteristics or features of the disease, pathological condition or disorder and / or the symptoms of the disease, pathological condition or disorder can be reduced to any effect or any amount. In a specific embodiment, the treatment of a disease such as cancer includes inhibiting the proliferation of cancer cells. In certain embodiments, the treatment of cancer can be determined by detecting the reduction of the amount of proliferative cancer cells in the subject, the reduction of tumor growth or the size of the tumor.

[0093] In certain embodiments, the nucleic acid compositions of the present disclosure are used to treat cancer.

[0094] The term "cancer" as used herein includes any disease caused by the uncontrolled division and growth of abnormal cells (including, for example, the malignant and metastatic growth of tumors). The term "cancer" also includes precancerous conditions or conditions characterized by an increased risk of cancer or precancerous conditions. Cancer or precancerous lesions (neoplastic conditions) can be located anywhere in the body, including internal organs and skin. It is well known that cancer spreads in subjects by invading normal non-cancerous tissues around the tumor through lymph nodes and blood vessels and through the blood (after the tumor invades the veins, capillaries and arteries of the subject). When cancer cells break away from the primary tumor ("metastasis"), secondary tumors appear throughout the affected subject, forming metastatic lesions.

[0095] Some non-limiting examples of cancer cells suitable for treatment using the methods of the present invention include lung, breast, pancreas, bladder, and ovary. Cancer or neoplasm may also include the presence of one or more carcinomas, sarcomas, lymphomas, blastomas, or teratomas (germ cell tumors).

[0096] In certain embodiments, the subject has pancreatic cancer, or has a medically determined increased risk of developing pancreatic cancer, such as a diagnosis of chronic pancreatitis.

[0097] In certain embodiments, the subject of the present disclosure has breast cancer, or has a medically determined increased risk of developing breast cancer. In specific embodiments, the breast cancer is triple negative breast cancer, ductal carcinoma, or lobular carcinoma.

[0098] In other embodiments, the subject has ovarian cancer, or has a medically determined increased risk of developing ovarian cancer.

[0099] In still other embodiments, the subject has bladder cancer, or has a medically determined increased risk of developing bladder cancer.

[0100] In a specific embodiment, the modified microRNA of the present disclosure is used to treat pancreatic cancer. Figure 3A-C and 4, each modified miR-194 microRNA can be used to treat pancreatic cancer. Pancreatic cancer originates from a precursor lesion called pancreatic intraepithelial neoplasia or PanIN. These lesions are usually located in the small ducts of the exocrine pancreas and can be divided into low-grade dysplasia, moderate dysplasia or high-grade dysplasia lesions according to the degree of cellular atypia. Such lesions usually indicate the presence of activating mutations in the KRAS gene, as well as certain inactivating mutations in CDKN2A, TP53 and SMAD4. Together, these gene mutations lead to the formation of invasive cancer. Pancreatic cancer staging is based on: the size of the primary tumor and whether it has grown into surrounding organs outside the pancreas; whether the tumor has spread to nearby lymph nodes, and whether it has metastasized to other organs of the body (e.g., liver, lungs, abdomen). This information is then combined and used to provide specific stages, i.e., 0, 1A, 1B, 2A, 2B, 3 and 4. For stage zero (0), pancreatic tumors are confined to the top layer of pancreatic duct cells and do not invade deeper tissues. The primary tumor has not spread outside the pancreas, such as in pancreatic carcinoma in situ or pancreatic intraepithelial neoplasia III. 1A stage pancreatic tumors are usually confined to the pancreas and are 2 cm or less in diameter. In addition, 1A stage pancreatic tumors have not spread to nearby lymph nodes or distal sites. 1B stage pancreatic tumors are confined to the pancreas and are greater than 2 cm in diameter. 1B stage pancreatic tumors have not spread to nearby lymph nodes or distal sites. 2A stage pancreatic tumors show tumor growth outside the pancreas but not into major blood vessels or nerves, but cancer has not spread to nearby lymph nodes or distal sites. The tumor presented by the subject showing 2B stage pancreatic cancer is either confined to the pancreas, or grows outside the pancreas but does not enter major blood vessels or nerves, but has spread to nearby lymph nodes. The tumor presented by the subject showing 3 stage pancreatic cancer grows outside the pancreas into major blood vessels or nerves, but has spread to distal sites. 4 stage pancreatic cancer has metastasized to distant sites, lymph nodes and organs.

[0101] According to the present disclosure, methods for treating cancer include administering one or more nucleic acid compositions of the present invention by any route known in the art. This includes, for example, (1) oral administration; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection; (3) topical administration; or (4) vaginal or rectal administration; (5) sublingual or buccal administration; (6) ocular administration; (7) transdermal administration; (8) nasal administration; and (9) direct administration to an organ or cell in need thereof.

[0102] In a specific embodiment, the modified microRNA composition of the present disclosure is administered to a subject by injection. In one embodiment, a therapeutically effective amount of the modified microRNA composition is injected intravenously. In another embodiment, a therapeutically effective amount of the modified microRNA composition is injected intraperitoneally.

[0103] The amount (dosage) of a nucleic acid composition of the disclosure administered depends on several factors, including the type and stage of the cancer, the presence or absence of auxiliary or adjuvant drugs, and the subject's weight, age, health, and tolerance to pharmaceutical agents. Depending on these various factors, the dosage can be, for example, about 2 mg / kg body weight, about 5 mg / kg body weight, about 10 mg / kg body weight, about 15 mg / kg body weight, about 20 mg / kg body weight, about 25 mg / kg body weight, about 30 mg / kg body weight, about 40 mg / kg body weight, about 50 mg / kg body weight, about 60 mg / kg body weight, about 70 mg / kg body weight, about 80 mg / kg body weight, about 90 mg / kg body weight, about 100 mg / kg body weight, about 125 mg / kg body weight, about 150 mg / kg body weight, about 175 mg / kg body weight, about 200 mg / kg body weight, about 250 mg / kg body weight, about 300 mg / kg body weight, about 350 mg / kg body weight, about 400 mg / kg body weight, about 500 mg / kg body weight, about 600 mg / kg body weight, about 700 mg / kg body weight, about 800 mg / kg body weight, about 900 mg / kg body weight, or about 1000 mg / kg body weight. mg / kg body weight, wherein the term "about" is generally understood to be within ± 10%, 5%, 2% or 1% of the indicated value. Dosage can also be within the range defined by any two of the above values. Routine experiments can be used as follows to determine appropriate dosage regimens for each patient: monitoring the impact of compounds on cancerous or precancerous conditions, or the impact of microRNA expression levels or activity (e.g., miR-194), or the impact of its target (such as SET8 and / or BMI1 levels or activity), or disease pathology, which can all be frequently and easily monitored according to methods known in the art. According to the various factors discussed above, any of the above exemplary doses of nucleic acid can be administered once, twice or multiple times a day.

[0104] The ability of the nucleic acid compositions described herein, and optionally any additional chemotherapeutic agents for use with the current methods, can be determined using pharmacological models well known in the art, such as cytotoxicity assays, apoptosis staining assays, xenograft assays, and binding assays.

[0105] The nucleic acid compositions described herein may also be co-administered with or without one or more chemotherapeutic agents, which may be auxiliary or adjuvant drugs other than the nucleic acid compositions described herein.

[0106] As used herein, "chemotherapy" or the phrase "chemotherapeutic agent" is an agent that can be used to treat cancer. Chemotherapeutic agents that can be used in conjunction with the methods described herein include, for example, any agent that directly or indirectly modulates BMI1. Examples of chemotherapeutic agents include: antimetabolites such as methotrexate and fluoropyrimidine-based pyrimidine antagonists, 5-fluorouracil (5-FU) (Carac® cream, Efudex®, Fluoroplex®, Adrucil®) and S-1; antifolates, including polyglutamatable antifolate compounds; raltitrexed (Tomudex®), GW1843 and pemetrexed (Alimta®) and non-polyglutamatable antifolate compounds; nolatrexed (Thymitaq®), plevitrexed, BGC945; folic acid analogs such as methotrexate, methotrexate, pteropterin, trimetrexate; and purine analogs such as fludarabine, 6-mercaptopurine, thiopurine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine. In a specific embodiment of the present disclosure, the chemotherapeutic agent is a compound capable of inhibiting the expression or activity of a gene or gene product involved in a signaling pathway involved in abnormal cell proliferation or apoptosis, for example, YAP1, BMI1, SET8, DCLK1, BCL2, thymidylate synthase or E2F3; and pharmaceutically acceptable salts, acids or derivatives of any of the foregoing.

[0107] In other embodiments, chemotherapy can be any of the following cancer drugs, such as methotrexate, doxorubicin, cyclophosphamide, cisplatin, oxaliplatin, bleomycin, vinblastine, gemcitabine, vincristine, epirubicin, folinic acid, paclitaxel and one or more of docetaxel. Chemotherapeutic agents can be administered before, during or after starting treatment with the nucleic acid composition.

[0108] In certain embodiments, the chemotherapeutic agent is an anticancer drug or a tissue sensitizer or other promoter of an anticancer drug.In certain embodiments, the adjuvant drug may be another nucleic acid or another miRNA, such as a microRNA mimic of the present disclosure, gemcitabine, or free 5-FU.

[0109] In a specific embodiment, the additional nucleic acid is a short hairpin RNA (shRNA), siRNA, or a nucleic acid complementary to a portion of the BCL2 3'UTR.

[0110] In certain embodiments, the chemotherapeutic agent is an adjuvant drug.

[0111] Set domain-containing protein 8, SET8 or SETD8 (GenBank AF287261) is a lysine methyltransferase that primarily monomethylates lysine-20 of histone H5. SET8 regulates transcriptional control, heterochromatin formation, genome stability, cell cycle progression, and development. See Yang, F., et al. EMBO J . (2012) 31: pp. 110-123. Therefore, any drug that inhibits the expression of SET8 can be considered as an adjuvant drug in this article.

[0112] Polycomb protein complex protein BMI-1, BMI1 (RefSeq, NM_005180.8, NP_005171.4) encodes ring finger protein, which is the main component of polycomb protein group complex 1 (PRC1). The complex works as follows: through chromatin remodeling as an important epigenetic repressor of multiple regulatory genes involved in self-renewal in embryonic development and adult stem cells. BMI1 protein plays a central role in DNA damage repair. The BMI1 gene is an oncogene, and abnormal expression is associated with a variety of cancers, and is associated with resistance to certain chemotherapy. Therefore, any drug that inhibits SET8 expression can be considered as an adjuvant drug in this article.

[0113] E2F transcription factor 3, E2F3 (RefSeq NG_029591.1, NM_001243076.2, NP_001230005.1) is a transcription factor that binds DNA and interacts with effector proteins (including but not limited to, retinoblastoma protein) to regulate the expression of genes involved in cell cycle regulation. Therefore, any drug that inhibits E2F3 expression can be considered an adjuvant drug herein.

[0114] B-cell lymphoma 2 (BCL2) (RefSeq NG_009361.1, NM_000633, NP_000624) (including its isoforms α (NM_000633.2, NP_000624.2) and β NM_000657.2, NP_000648.2) is encoded by the Bcl-2 gene and is a member of the BCL2 regulator protein family that regulates mitochondrial-mediated cell death (via the intrinsic apoptotic pathway). BCL2 is an integral mitochondrial outer membrane protein that blocks apoptotic cell death by binding to BAD and BAK proteins. Non-limiting examples of BCL2 inhibitors include antisense oligonucleotides, such as obimex (Genasense; Genta Inc.,), BH3 mimetic small molecule inhibitors, including ABT-737 (Abbott Laboratories, Inc.), ABT-199 (Abbott Laboratories, Inc.) and obakla (Cephalon Inc.). Any drug that inhibits BCL2 expression can be considered an adjuvant drug herein.

[0115] Thymidylate synthase (RefSeq: NG_028255.1, NM_001071.2, NP_001062.1) is a ubiquitous enzyme that catalyzes the necessary methylation of dUMP to generate dTMP, which is one of the four bases that make up DNA. The reaction requires CH4-folate as a cofactor, both as a methyl donor and uniquely as a reducing agent. The constant demand for CH4-folate means that thymidylate synthase activity is closely related to the activity of two enzymes responsible for replenishing the cell folate pool: dihydrofolate reductase and serine transhydroxymethylase. Thymidylate synthase is a homodimer of 30-35kDa subunits. The active site simultaneously binds folate cofactor and dUMP substrate, and dUMP is covalently bonded to the enzyme through a nucleophilic cysteine ​​residue (see, Carreras et al., Annu. Rev. Biochem., (1995) 64: 721-762). Thymidylate synthase reaction is a key part of the pyrimidine biosynthetic pathway, which produces dCTP and dTTP for incorporation into DNA. This reaction is necessary for DNA replication and cell growth. Therefore, all rapidly dividing cells (such as cancer cells) require thymidylate synthase activity. Because it is related to DNA synthesis, and therefore related to cell replication, thymidylate synthase has been the target of anticancer drugs for many years. Non-limiting examples of thymidylate synthase inhibitors include folic acid and dUMP analogs, such as 5-fluorouracil (5-FU). Any drug that inhibits the expression of thymidylate synthase can be considered as an adjuvant drug in this article.

[0116] If desired, the administration of nucleic acid compositions described herein can be combined with one or more non-drug therapies (e.g., radiotherapy and / or surgery). As well known in the art, administration of radiotherapy and / or chemotherapeutic agents (in this case, nucleic acid compositions described herein, and optionally, any additional chemotherapeutic agents) can be provided before surgery, for example, to reduce tumors or prevent the spread of cancer before surgery. Also as well known in the art, administration of radiotherapy and / or chemotherapeutic agents can be provided after surgery to destroy any residual cancer.

[0117] For the purpose of illustrating and describing certain specific embodiments of the present invention, examples have been set forth below. However, the scope of the present invention is not in any way limited to the examples described herein. Example

[0118] Example 1. Materials and methods.

[0119] Modified microRNA . All modified microRNAs are synthesized by automated oligonucleotide synthesis methods and purified by HPLC. The two chains are annealed to prepare mature modified 5-FU-miR and / or modified miR-194 of the present disclosure, which have cytosine bases replaced by gemcitabine molecules. For modified microRNA-194 containing 5-halouracil, a method called "2'-ACE RNA synthesis" was used. 2'-ACE RNA synthesis is based on a protecting group scheme, in which silyl ethers are used to protect the 5'-hydroxyl group and are combined with an acid-labile orthoester protecting group (2'-ACE) on the 2'-hydroxyl group. This combination of protecting groups is then used together with standard aminophosphite solid phase synthesis techniques. See, for example, SA Scaringe, FE Wincott, and MH Caruthers, J. Am. Chem. Soc. , 120 (45), 11820-11821 (1998); International PCT Application WO / 1996 / 041809; MD Matteucci, MH Caruthers, J. Am. Chem. Soc. , 103, 3185-3191 (1981); SL ​​Beaucage, MH Caruthers, Tetrahedron Lett . 22, 1859-1862 (1981), the entire contents of each of which are expressly incorporated herein. Exemplary modified miR-194 nucleic acids or any other modified microRNAs replacing uracil with 5-halouracil can be synthesized in the same manner as described herein.

[0120] Some exemplary structures of currently used protected and functionalized ribonucleoside phosphoramidates are shown below:

[0121]

[0122] The modified miR incorporating gemcitabine into miR-194 by replacing the cytosine residue in its guide strand with gemcitabine (2', 2'-difluoro-2'-deoxycytidine) was synthesized as follows. 5'-Dimethoxytrityl-N4-benzoyl-2', 2'-difluoro-2'-deoxycytidine (1 eq., 0.4 mM, 270 mg) was dissolved in anhydrous acetonitrile (6 ml). A 0.5 M solution of ethylthiotetrazole (1.6 eq., 0.65 mM, 1.3 ml) in anhydrous acetonitrile and 2-cyanoethyl-di-(N,N'-diisopropropyl)phosphoamidate (1.43 eq., 0.57 mmol, 0.2 ml) was added and the reaction mixture was stirred at room temperature for 1 h. The results of the analysis were analyzed by TLC and 31 The progress of the reaction was monitored by P NMR. When 5'-dimethoxytrityl-N4-benzoyl-2',2'-difluoro-2'-deoxycytidine was consumed in about 2 hours, the mixture was applied to a silica gel column and the product was eluted with 20% hexane in CH2Cl2 followed by MeOH in CHCl3 (0-5% gradient). 31 PNMR (CDCl3) identified the desired product: δ 154.1, 152.1. As in K. Sipa, et al., RNA (2007) 13, described in the 1301-1316 pages (its entire content is incorporated herein by reference), on Gene World DNA synthesizer, according to the aminophosphite scheme, all unmodified and RNA oligonucleotides containing gemcitabine units are synthesized.Use thymidine, cytidine, uridine, guanosine, adenosine and 2 ', the aminophosphite derivatives of the appropriate protection of 2 '-difluoro-2 '-deoxycytidine, LCA-CPG (as solid support) and 5-benzyl mercapto tetrazolium in anhydrous acetonitrile (0.25 M) (as activator), synthesize on 200nmol scale.For modified unit, synthesis has the coupling time (at the most 600 seconds) of extension.Determine coupling efficiency by DMT-cation determination.

[0123] Cell cultureHuman pancreatic cancer cell lines ASPC-1, HS766T, and Panc-1 were obtained from the American Type Culture Collection (ATCC) and maintained in different types of culture media. Specifically, HS766T and PANC1 cells were cultured in DMEM-containing media, and APSC-1 cells were maintained in RPMI media (Thermo Fischer). The culture media was supplemented with 10% fetal bovine serum (Thermo Fischer).

[0124] Western blot analysis 24 hours before transfection, 1x10 5 Cells were plated in 6-well plates. Cells were transfected with 50 nM control miRNA (Thermo Fischer), miR-194, or one of three miR-194 mimics using Oligofectamine (Thermo Fischer) or without transfection vehicle. Three days after transfection, proteins were collected in RIPA buffer containing protease inhibitors (Sigma). As described in Laemmli UK. Nature Equal amounts of protein (15 µg) were separated on 10% sodium dodecyl sulfate-polyacrylamide gels as described in Cell Signaling Technologies, Inc. 1970; 227(5259) pp. 680-685 (the entire contents of which are incorporated herein by reference). Proteins were probed with anti-SET8 or BMI-1 (1:500) (Cell Signaling Technologies) and anti-GAPDH (1:100000) antibodies. Horseradish peroxidase-conjugated mouse or rabbit antibodies (1:5000, Santa Cruz Biotech Inc.) were used as secondary antibodies. Protein bands were visualized with autoradiographic film using SuperSignal West PicoChemiluminescent Substrate (Thermo Fischer).

[0125] Cell viability assay. Cells were plated at 1000 cells per well in 96-well plates. After 24 hours, the cell culture medium was replaced with DFBS-supplemented medium containing 50, 25, 12.5, 6.25, 3.125, or 1.5625 nM control miRNA (Thermo Fischer), miR-194, 5-FU-miR-194, Gem-mIR-194, or 5-FU-Gem-miR-194. After 24 hours, the medium was again replaced with fresh medium supplemented with DFBS. Six days after treatment, cell number was assessed using WST-1 dye (Roche). Cells were incubated with 10 μl of WST-1 dye per 100 μl of culture medium for 1 hour, and the absorbance was read at 450 and 630 nm. The optical density (OD) was calculated by subtracting the absorbance at 630 nm from the absorbance at 450 nm. IC was calculated using CompuSyn software (ComboSyn, Inc). 50 value.

[0126] Mouse subcutaneous tumor implantation model For in vivo miRNA delivery experiments, pancreatic cancer cells expressing the lenti-luc reporter gene were created by infecting parental pancreatic cancer cells with recombinant lentivirus. HS766T cells expressing luciferase (2.0x10 per mouse) were 6 cells) were suspended in 0.1 mL PBS solution and injected through the tail vein of each mouse. Four days after the injection of pancreatic cancer cells, mice were treated with 80 µg of negative control or modified miR packaged with in vivo injection PEI (PolyplusTransfection) through the tail vein. Mice were treated every other day for 2 weeks (8 times). After treatment, mice were screened using the IVIS Spectrum In Vivo Imaging System (IVIS) (PerkinElmer).

[0127] Statistical analysis. All experiments were repeated at least 3 times. All statistical analyses were performed using SigmaPlot software. t- The statistical significance between the two groups was determined by test (paired t-test for clinical samples and unpaired t-test for all other samples). For comparison of more than two groups, one-way ANOVA and subsequent Bonferroni-Dunn test were used. Data are expressed as mean ± standard error of the mean (SEM). Statistical significance is described in the legend or indicated with an asterisk (*). * = P < 0.05; ** = P < 0.01; *** = P < 0.001.

[0128] Example 2: The modified miR-194 nucleic acid has anticancer activity.

[0129] In the following experiments, all five cytosine bases in the guide strand of natural miR-194 (SEQ ID NO: 1) were replaced by gemcitabine to form the exemplary modified microRNA shown in SEQ ID NO: 2. Figure 1C Another modified microRNA is formed by replacing all uracil bases in the guide strand of the native miR-194 nucleic acid with 5-FU molecules, as shown in SEQ ID NO. 4. Figure 1B In one experiment, all U bases in miR-194 were replaced by 5-FU, and all cytosines (C bases) were replaced by gemcitabine molecules, as in Figure 1D As shown in the provided structure and as shown in SEQ ID NO: 3.

[0130] Target specificity analysis: The results of Western blotting experiments in pancreatic cells confirmed that the exemplary modified miR-194 polynucleotides of the present disclosure were able to maintain their target specificity for SET8 and BMI1. The results are shown in Figures 2A to 2D , which shows the results of the following nucleic acids: an exemplary modified miR-194 nucleic acid having all U bases replaced by 5-FU, as shown in SEQ ID. NO: 4 (5-FU-miR-194); an exemplary modified miR-194 nucleic acid having all U bases replaced by 5-FU and all C bases replaced by gemcitabine, as shown in SEQ ID. NO: 3 (5-FU-Gem-miR-194); and an exemplary modified miR-194 nucleic acid having all C bases replaced by a gemcitabine molecule, as shown in SEQ ID. NO: 2 (Gem-miR-194). More importantly, the exemplary modified miR-194 nucleic acids were found to be effective in reducing SET8 (as shown in Figure 2A ) and BMI1 (as shown in Figure 2C When no transfection vehicle was used, each of the modified miR-194 molecules retained the ability to inhibit SET8 ( Figure 2B ) and BMI1 expression ( Figure 2D The data confirmed that both 5-FU modification and gemcitabine modification allowed the modified miR-194 to enter cells without any transfection vehicle, and that these modifications did not destroy the ability of miR-194 to regulate target expression.

[0131] Exemplary modified microRNAs of the present disclosure inhibit tumor development and cell viabilityThe effect of each modified miR-194 molecule was tested in three different pancreatic cancer cell lines, ASPC1, PANC1 and HS766T, and the results of such experiments were shown in Figures 3A-3C In. As in Figure 3A As shown in, when exogenously expressed in ASPC1 cells, all three modified miR-194 mimetics exhibited efficacy in inhibiting cell viability compared to exogenously expressed native miR-194. In ASPC1 cells, the IC50 of an exemplary modified miR-194 nucleic acid (5-FU-miR-194) having all U bases replaced by 5-FU as shown in SEQ ID. NO: 4 was 6.06 nM. The IC50 of an exemplary modified miR-194 nucleic acid (Gem-miR-194) having all C bases replaced by gemcitabine molecules as shown in SEQ ID. NO: 2 is 4.29 nM, and the IC50 of an exemplary modified miR-194 nucleic acid (5-FU-Gem-miR-194) having all U bases replaced by 5-FU and all C bases replaced by gemcitabine as shown in SEQ ID. NO: 3 is 2.88 nM (Table 1).

[0132] As in Figure 3B As shown in, when exogenously expressed in PANC1 cells, the exemplary modified miR-194 nucleic acid with all U bases replaced by 5-FU (5-FU-miR-194) has a significant difference in effect compared with the following two nucleic acids: as shown in SEQ ID. NO: 2, the exemplary modified miR-194 nucleic acid with all C bases replaced by gemcitabine molecules (Gem-miR-194), and as shown in SEQ ID. NO: 3, the exemplary modified miR-194 nucleic acid with all U bases replaced by 5-FU and all C bases replaced by gemcitabine (5-FU-Gem-miR-194). Specifically, the IC50 of 5-FU-miR-194 is 16 nM, while the IC50 of Gem-miR-194 and 5-FU-Gem-miR-194 are 1.92 and 0.93, respectively (Table 1).

[0133] In addition and as Figure 3CAs shown in, when exogenously expressed in HS766T cells, the greatest difference between 5-FU modified miR-194 and the following two nucleic acids was observed: as shown in SEQ ID. NO: 2, an exemplary modified miR-194 nucleic acid with all C bases replaced by gemcitabine molecules (Gem-miR-194), and as shown in SEQ ID. NO: 3, an exemplary modified miR-194 nucleic acid with all U bases replaced by 5-FU and all C bases replaced by gemcitabine (5-FU-Gem-miR-194). Here, the IC50 of 5-FU-miR-194 was 26.45 nM, while the IC50s of Gem-mir-194 and 5-FU-Gem-miR-194 were 3.57 and 2.46 nM, respectively (Table 1).

[0134] Table 1: IC50 (nM) of each exemplary modified miR-194 nucleic acid in three different pancreatic cancer cell lines.

[0135]

[0136] In summary, these data show that, compared with microRNA modified by replacing U base with 5-FU alone, the incorporation of gemcitabine in miR-194 enhances its effect of inhibiting the viability of pancreatic cancer cells. In addition, the data reveal that miR-194 (5-FU-Gem-miR-194) with all U bases replaced by 5-FU and all C bases replaced by gemcitabine as shown in SEQ ID.NO: 3 has the greatest efficacy in treating pancreatic cancer.

[0137] Modified miR-194 inhibits cancer growth in vivo . As in Figure 4 As shown in , a mouse xenograft model comprising pancreatic cancer cells was established. Four days after the establishment of the metastasis, 80 μg of the modified miR-194 nucleic acid composition (SEQ ID NO: 2, Gem-miR-194) or a negative control microRNA (control) was delivered by intravenous injection at a treatment frequency of injection every other day for 2 weeks. As in Figure 4 As shown in , exemplary modified miR-194 nucleic acids were able to inhibit metastatic pancreatic cancer growth compared to controls. In addition, mice treated with modified miR-194 nucleic acids did not show any toxicity.

[0138] The data presented herein support the feasibility of a new modification in which gemcitabine is incorporated into miRNA nucleic acid sequences to enhance the chemotherapeutic function of the native microRNA molecule with or without the use of other chemotherapeutic agents.

Claims

1. A nucleic acid composition comprising a modified microRNA nucleotide sequence, wherein the modified microRNA nucleotide sequence is selected from SEQ ID NO: 2 and SEQ ID NO:

3.

2. A pharmaceutical composition comprising the nucleic acid composition of claim 1.

3. Use of the nucleic acid composition of claim 1 in the preparation of a medicament for treating pancreatic cancer in a subject, wherein the progression of the pancreatic cancer is inhibited.

4. The use of claim 3, wherein the subject is a human.

5. The use of claim 3, wherein the nucleic acid composition is administered to the subject by injection.

6. The use of claim 5, wherein the nucleic acid composition is injected intravenously.

Images