Rapamycin derivatives containing isothiazolidine 1,1-dioxide and 1,4-butanesultone and uses thereof
By developing rapamycin derivatives with the (I) structure, the problem of uneven efficacy, stability, and bioavailability of existing rapamycin drugs in the treatment of age-related diseases has been solved, providing a treatment option with better therapeutic effects and fewer side effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NOVARTIS AG
- Filing Date
- 2020-03-25
- Publication Date
- 2026-04-28
AI Technical Summary
Existing rapamycin-based drugs have issues with uneven efficacy, stability, and bioavailability in treating age-related diseases and disorders, and have many side effects, making them difficult to use effectively in humans.
Develop C16-rapamycin derivatives with the structure of formula (I). These compounds selectively inhibit mTORC1 by binding to FKBP12, thereby providing better therapeutic effects and fewer side effects.
It achieves a balance between appropriate efficacy, stability and bioavailability, effectively treating age-related diseases and disorders while reducing side effects.
Smart Images

Figure CN113614090B_ABST
Abstract
Description
[0001] Priority requirements
[0002] This application claims priority to USSN 62 / 824,190, filed March 26, 2019, the contents of which are incorporated herein by reference in their entirety.
[0003] sequence list
[0004] This application contains a sequence list that has been electronically filed in ASCII format, and the entire sequence list is hereby incorporated by reference. The ASCII copy was created on August 11, 2021, and is named PAT058487_SL.txt with a size of 785 bytes. Technical Field
[0005] This disclosure relates to C16-rapamycin derivatives as mTORC1 inhibitors. Background Technology
[0006] In mammalian cells, the target of rapamycin (mTOR) kinase exists as two distinct multiprotein complexes, known as the mTORC1 and mTORC2 complexes, both of which sense nutrient and energy availability and integrate inputs from growth factors and stress signals. mTORC1 integrates signals from growth factors and nutrients and regulates cell growth and metabolism (Laplante M. et al., Cell., (2012) 149(2): 274-93). mTORC1 is a key regulator of protein translation and autophagy. mTORC1 is sensitive to allosteric mTOR inhibitors, such as rapamycin and rapamycin analogs (so-called "rapalogs"). Rapamycin and previously produced rapamycin analogs act by forming an intracellular complex with FK506-binding proteins (such as FKBP12, FKBP12.6, FKBP13, FKBP25, FKBP51, or FKBP52) (these FKBPs are referred to herein as “FKBPs”), and then the FKBP-rapamycin analog complex binds to the FRB (FK506-rapamycin-binding) domain of mTOR. AM et al., Mol Cell Biol. [Molecular Cell Biology] (2013) 33(7): 1357-1367. This interaction between the FKBP-rapamycin analog complex and mTORC1 leads to allosteric inhibition of mTORC1. Rapamycin and rapamycin analogs (such as RAD001 (everolimus); Clinical relevance was achieved by inhibiting the activity of mTORC1, which is associated with benign and malignant proliferative disorders. Royce ME et al., Breast Cancer (Auckl). (2015) 9:73-79; Pleniceanu O. et al., Kidney Int Rep. (International Kidney Reports) (2018) 3(1):155-159, and many other indications.
[0007] Rapamycin is a known macrolide antibiotic produced by *Streptomyces hygoscopius*, see, for example, McAlpine, JB et al., *Journal of Antibiotics*, (1991) 44:688; Schreiber, SL et al., *Journal of the American Chemical Society*, (1991) 113:7433; U.S. Patent No. 3,929,992. The following numbering conventions apply to rapamycin and its derivatives as used in this document:
[0008]
[0009] Rapamycin is a potent immunosuppressant and has also been shown to possess antitumor and antifungal activities. It has been shown to be useful for the prevention or treatment of systemic lupus erythematosus, lung inflammation, insulin-dependent diabetes mellitus, skin disorders such as psoriasis, smooth muscle cell proliferation and endothelial thickening following vascular injury, adult T-cell leukemia / lymphoma, malignant cancer, inflammatory cardiac diseases, anemia, and neurogenesis. However, its practicality as a medicine is limited by its extremely low and variable bioavailability. Furthermore, the formulation of rapamycin is challenging, making it difficult to obtain stable galenic compositions.
[0010] In animal models, rapamycin and rapamycin analogues prolong lifespan and / or delay the onset of age-related diseases. Like other biological processes, aging is regulated by signaling pathways such as the TOR pathway (in this case, named "TOR" to include the yeast and *C. elegans* system) and, in mammals, by the mTORC1 pathway. Regulation of TOR and mTORC1 signaling prolongs lifespan and delays the onset of age-related diseases in a variety of organisms from flies to mammals. For example, inhibition of the TOR pathway through gene mutations has prolonged the lifespan of yeast, *C. elegans*, and fruit flies, while inhibition of the mTORC1 pathway has prolonged the lifespan of mice (Kaeberlein et al., *Science*, (2005) 310:1193-1196; Kapahi et al., *Curr Biol*, (2004) 14:885-890; Selman et al., *Science*, (2009) 326:140-144; Velai et al., *Nature*, (2003) 426:620; RAMiller et al., *Aging Cell*, (2014) 13(3):468-477). Furthermore, the mTORC1 inhibitor rapamycin has prolonged the lifespan of mice, even in later years (Harrison et al., *Nature*, (2009) 460(7253):392-395). These data increase the likelihood that drugs targeting the mammalian TOR (mTOR) pathway will have therapeutic effects on human aging and age-related diseases. M. Leslie described a clinical trial report of rapamycin in older men in Science, 2013, 342. J. Mannick et al. described mTORC1 inhibition improving immune function in older adults in Sci Transl Med. (2014) 6(268):268ra179. However, researchers have been cautious about using currently available mTORC1 inhibitors in human aging trials due to their side effects, including immunosuppression, cytopenia, stomatitis, gastrointestinal discomfort, and interstitial pneumonia.
[0011] Pharmacological inhibition of the mTORC1 pathway, either before or immediately after nerve injury, can prevent pathological changes in the animal brain and the progression of spontaneous recurrent seizures in acquired epilepsy models (Zeng et al., The mammalian target of rapamycin signaling pathway mediates epileptogenesis in a model of temporal lobe epilepsy; J. Neurosci., (2009) 6964-6972). Therefore, rapamycin and rapamycin analogues are considered to have potential value in such indications.
[0012] Rapamycin analogues have been shown to be effective for symptoms of liver and kidney fibrosis in humans at low doses.
[0013] Mitochondrial myopathy (MM) is the most common manifestation of adult-onset mitochondrial disease and exhibits multifaceted tissue-specific stress responses: (1) transcriptional responses, including the metabolic cytokines FGF21 and GDF15; (2) remodeling of one-carbon metabolism; and (3) mitochondrial unfolded protein responses. These processes, described by Khan et al. in Cell Metabolism 26, 419-428, August 1, 2017, are part of an integrated mitochondrial stress response (ISRmt) controlled by mTORC1 in skeletal muscle. Defects in mtDNA replication activate mTORC1, which drives the integrated mitochondrial stress response via ATF4 activation, thereby inducing de novo synthesis of nucleotides and serines, the 1C cycle, and the production of FGF21 and GDF15. Inhibition of mTORC1 by rapamycin downregulated all components of the aforementioned ISRmt (integrated mitochondrial stress response), improved all MM markers, and even reversed the progression of late MM without inducing mitochondrial biogenesis. Therefore, rapamycin and rapamycin analogues are considered to have potential value in this type of indication.
[0014] Therefore, there is still a need to provide new mTORC1 inhibitors that are improved candidates that demonstrate a good balance in terms of potency, stability and bioavailability. Summary of the Invention
[0015] Compounds having formula (I) are mTORC1 inhibitors and can be used to treat disorders, particularly age-related disorders, or diseases and disorders currently approved for treatment with rapamycin or any rapamycin analogue. As described herein, the substitution of the C16 methoxy group provides a compound exhibiting a balance in terms of appropriate potency, stability, and bioavailability. When FKBP12 levels are sufficient to inhibit mTORC1, compounds having formula (I) effectively inhibit mTORC1 by selectively binding to FKBP12.
[0016] In one respect, this disclosure provides compounds having formula (I) or pharmaceutically acceptable salts thereof, wherein:
[0017]
[0018] R 1 Choose from the following groups: hydrogen, C 1-6 Alkyl, hydroxyl C 1-6 Alkyl and heterocarbon 1-6 Alkyl; and
[0019] R 2 yes Where n is 1, 2 or 3.
[0020] In one embodiment, this disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.
[0021] In one embodiment, this disclosure provides a pharmaceutical combination comprising a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, and one or more therapeutically active agents.
[0022] On the other hand, this disclosure provides a method for treating a disorder or disease mediated by the mTOR pathway in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0023] On the other hand, this disclosure provides a method for treating a subject’s disease or disorder, wherein a target tissue, organ or cell associated with the pathology of the disease or disorder has an FKBP12 level sufficient to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0024] On the other hand, this disclosure provides a method for treating a subject with or having been determined to have FKBP12 levels sufficient to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0025] On the other hand, this disclosure provides a method for treating an age-related disease or disorder in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0026] In one embodiment, the age-related disease or disorder is selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, and hypertension. Pressure), cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment (e.g., weakness), cognitive decline, tendon stiffness, cardiac dysfunction (e.g., cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension and / or dilated cardiomyopathy), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as kidney failure, blindness, and neuropathy).
[0027] On the other hand, this disclosure provides a method for treating a disease or disorder in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, wherein the disease or disorder is selected from:
[0028] - Transplant vascular disease;
[0029] - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration;
[0030] - Autoimmune diseases and inflammatory conditions;
[0031] -asthma;
[0032] - Multidrug resistance (MDR);
[0033] - Fungal infection;
[0034] -Inflammation;
[0035] -Infect;
[0036] - Age-related diseases;
[0037] - Neurodegenerative diseases;
[0038] - Proliferative disorders, such as cancer;
[0039] - Seizures and disorders associated with seizures; and
[0040] - Mitochondrial myopathy and mitochondrial stress.
[0041] On the other hand, this disclosure provides a method for treating cancer in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0042] In one embodiment, the method further includes a PD-1 / PDL-1 inhibitor.
[0043] In one embodiment, the cancer is selected from kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, astrocytoma, adenocarcinoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and cervical cancer.
[0044] In one embodiment, the impairment is a liver impairment that includes fibrotic and / or inflammatory processes, such as liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis.
[0045] In one embodiment, the impairment is a kidney disorder involving fibrosis or inflammation in the kidneys, such as renal fibrosis or glomerulosclerosis, which occurs as a result of acute kidney injury leading to chronic kidney disease. In one embodiment, the kidney impairment is chronic kidney disease arising from diabetic nephropathy. In one embodiment, the chronic kidney disease leads to kidney failure.
[0046] In one embodiment, the impairment is a cardiac dysfunction, such as myocardial infarction or cardiac hypertrophy. In one embodiment, the cardiac dysfunction is a systolic and / or diastolic dysfunction. In one embodiment, the cardiac dysfunction is hypertension. In one embodiment, the cardiac dysfunction results in a reduced ejection fraction. In one embodiment, heart failure may have a preserved ejection fraction. In one embodiment, the cardiac dysfunction results in dilated cardiomyopathy.
[0047] In one embodiment, the barrier is due to cancer-causing immune aging caused by reduced immune surveillance.
[0048] In one embodiment, the barrier is cancer, including tumors treated with immunotherapy. In one embodiment, the subject has previously been treated with rapamycin, RAD001, or another rapamycin analog. In one embodiment, the cancer includes tumors showing activation of the mTOR pathway, including cases where a mutation is present in the Tsc1 gene, or cases where the tumor microenvironment has been appropriately treated with a rapamycin analog.
[0049] This document sets forth details of one or more embodiments of the present disclosure. Other features, objectives, and advantages of this disclosure will become apparent from the accompanying drawings, detailed description, examples, and claims. Attached Figure Description
[0050] Figure 1A and 1B A line graph was drawn, showing the difference between wild-type (…) after treatment with compound 1 (solid line) and RAD001 (dashed line). Figure 1A ) and FKBP12 knockout ( Figure 1B Inhibition of S6K1 (Thr389) in 293T cells. Cells were treated in triplicate. The Y-axis represents the percentage inhibition of pS6K1 (Thr389) relative to the level in cells treated with rapamycin-free medium (medium with DMSO). The X-axis represents the concentrations of compound 1 and RAD001. Detailed Implementation
[0051] definition
[0052] Unless otherwise specified, the term "compounds of the disclosure" means compounds having formula (I) and example compounds, their salts, and all stereoisomers (including diastereomers and enantiomers), rotational isomers, tautomers and isotopically labeled compounds (including deuterated derivatives) and the inherently formed portions.
[0053] The term "therapeuticly effective amount" in this disclosure refers to an amount of the compound that will elicit a biological or medical response in a subject (e.g., reduction or inhibition of enzyme or protein activity, or improvement of symptoms, relief of symptoms, slowing or delaying disease progression, or prevention of disease). In one embodiment, the term "therapeuticly effective amount" refers to an amount of the compound that, when administered to a subject, effectively (1) at least partially relieves or improves (i) a symptom or disorder or disease mediated by the mTOR pathway, or (ii) is associated with mTOR activity, or (iii) is characterized by (normal or abnormal) mTOR activity; or (2) reduces or inhibits mTOR activity; or (3) reduces or inhibits mTOR expression. In another embodiment, the term "therapeuticly effective amount" refers to an amount of the compound that, when administered to cells, or tissues, or noncellular biological materials, or media, effectively reduces or inhibits mTOR activity; or at least partially reduces or inhibits mTOR expression.
[0054] As used herein, the term "subject" refers to a primate (e.g., a human (male or female)), dog, cat, rabbit, guinea pig, pig, rat, and mouse. In some embodiments, the subject is a primate. In still other embodiments, the subject is a human.
[0055] As used herein, the term "administer (administering or administration)" means the introduction of the compound of the present invention or a pharmaceutical composition thereof into the body by means of implantation, absorption, ingestion, injection, inhalation or other means.
[0056] As used herein, the term “inhibit (inhibition or inhibiting)” means the reduction or suppression of a given condition, symptom or disorder, or disease, or a significant reduction in baseline activity of a biological activity or process.
[0057] As used herein, the term "treatment" for any disease or disorder means the relief, delay of onset, or improvement of the disease or disorder (i.e., slowing or halting the development of the disease or at least one of its clinical symptoms); or the relief or improvement of at least one physical parameter or biomarker associated with the disease or disorder, including those that the patient may not be able to identify. In one embodiment, "treatment" requires signs or symptoms of a disease, disorder, or condition that have been developed or observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of a disease or condition. For example, treatment may be administered to a susceptible individual before the onset of symptoms (e.g., based on a history of symptoms and / or based on genetic or other susceptibility factors). Treatment may also continue after symptoms have subsided, for example, to delay or prevent recurrence.
[0058] As used herein, the term “prevent, preventing, or prevention” for any disease or disorder refers to preventive treatment of the disease or disorder; or delaying the onset or progression of the disease or disorder.
[0059] As used herein, “age-related disease or disorder” means any disease or disorder whose prevalence in a population or severity in an individual is associated with the progression of age. More specifically, an age-related disease or disorder is one whose prevalence is at least 1.5 times higher in individuals aged 65 and older than in individuals aged 25–35. Examples of age-related disorders include, but are not limited to: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic disorders, renal vascular disease, hearing loss, and mobility impairment (e.g., frailty). Cognitive decline, tendon stiffness, cardiac dysfunction (such as cardiomegaly, systolic or diastolic dysfunction, hypertension, dilated cardiomyopathy), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as renal failure, blindness, and neuropathy).
[0060] As used in this article, a subject is considered "needing" the treatment if the subject will benefit from it biologically, medically, or in terms of quality of life.
[0061] As used herein, the terms “a”, “the”, and similar terms used in the context of this disclosure (particularly in the context of the claims) should be interpreted as covering both the singular and the plural, unless otherwise indicated or clearly contradicted by the context.
[0062] The term "alkyl" refers to a group having a straight-chain or branched saturated hydrocarbon group having 1 to 6 carbon atoms ("C"). 1-6 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 5 carbon atoms (“C”). 1-5 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 4 carbon atoms (“C”). 1-4 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 3 carbon atoms (“C”). 1-3 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 2 carbon atoms (“C”). 1-2 Alkyl group (“C1 alkyl”). In some embodiments, the alkyl group has 1 carbon atom (“C1 alkyl”). In some embodiments, the alkyl group has 2 to 6 carbon atoms (“C1 alkyl”). 2-6 Alkyl group). C 1-6 Examples of alkyl groups include methyl (C1), ethyl (C2), propyl (C3) (e.g., n-propyl, isopropyl), butyl (C4) (e.g., n-butyl, tert-butyl, sec-butyl, isobutyl), pentyl (C5) (e.g., n-pentyl, 3-pentyl, pentylyl, neopentyl, 3-methyl-2-butylyl, tert-pentyl), and hexyl (C6) (e.g., n-hexyl).
[0063] "Heteroalkyl" refers to an alkyl group that further includes at least one heteroatom selected from oxygen, nitrogen, or sulfur (e.g., 1, 2, 3, or 4 heteroatoms) located at one or more terminal positions of the parent chain (i.e., inserted between adjacent carbon atoms) and / or at one or more terminal positions of the parent chain. In some embodiments, the heteroalkyl group is a saturated group ("heteroalkyl") having 1 to 6 carbon atoms and 1 or more heteroatoms within the parent chain. 1-6 Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group (“heteroalkyl”) having 1 to 5 carbon atoms and 1 or 2 heteroatoms within the parent chain. 1-5 Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group (“heteroalkyl”) having 1 to 4 carbon atoms and 1 or 2 heteroatoms within the parent chain. 1-4 Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group (“heteroalkyl”) having 1 to 3 carbon atoms and 1 heteroatom within the parent chain. 1-3Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group (“heteroalkyl”) having 1 to 2 carbon atoms and 1 heteroatom in the parent chain. 1-2 Alkyl group (“heteroalkyl”). In some embodiments, the heteroalkyl group is a saturated group having one carbon atom and one heteroatom (“heteroC1 alkyl”). In some embodiments, the heteroalkyl group is a saturated group having two to six carbon atoms and one or two heteroatoms within the parent chain (“heteroC1 alkyl”). 2-6 alkyl").
[0064] Hydroxy C 1-6 "Alkyl" refers to an alkyl group that has been substituted by one or more -OH groups. Hydroxyl group (C) 1-6 Examples of alkyl groups include HO-CH2-, HO-CH2CH2-, and -CH2-CH(OH)CH3.
[0065] "Hydroxyl" (hydroxy or hydroxyl) refers to -OH.
[0066] "Halo" or "halogen" refers to fluorine (fluorinated, -F), chlorine (chlorinated, -Cl), bromine (bromine, -Br), or iodine (iodinated, -I). In one embodiment, halogen refers to fluorine, chlorine, or bromine.
[0067] As used herein, when each expression (e.g., alkyl, m, n, etc.) appears more than once in any structure, its definition is intended to be independent of its definition in other positions in the same structure.
[0068] The following describes the definitions of specific functional groups and chemical terms in more detail. Chemical elements are identified according to the periodic table, CAS version, Handbook of Chemistry and Physics, 75th edition, inside cover, and specific functional groups are generally defined as described therein. In addition, general principles of organic chemistry, as well as descriptions of specific functional parts and reactivity, are found in Thomas Sorrell, Organic Chemistry, University Science Books, Sosalito, 1999; Smith and March, March's Advanced Organic Chemistry, 5th ed., John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3rd ed., Cambridge University Press, Cambridge, 1987.
[0069] Certain compounds disclosed herein may exist in specific geometric or stereoisomeric forms. For example, if a specific enantiomer of a disclosed compound is desired, it may be prepared by asymmetric synthesis or by derivatization with a chiral auxiliary agent, wherein the resulting mixture of diastereomers is separated and the auxiliary group is cleaved to provide the desired pure enantiomer. Alternatively, in the case where the molecule contains a basic functional group (e.g., amino) or an acidic functional group (e.g., carboxyl), the diastereomers formed are separated by forming a diastereomeric salt with a suitable optically active acid or base, followed by stepwise crystallization or chromatographic methods well known in the art, and subsequently the pure enantiomers are recovered.
[0070] Unless otherwise stated, the structures described herein also imply the inclusion of geometric (or conformational) forms of such structures; for example, R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers of the disclosed compounds, as well as enantiomers, diastereomers, and mixtures of geometric (or conformations), are all within the scope of this disclosure. Unless otherwise stated, all tautomer forms of the disclosed compounds are within the scope of this disclosure. Additionally, unless otherwise stated, the structures described herein are also intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the structures disclosed herein include those with hydrogen replaced by deuterium or tritium, or those enriched with... 13 C- or 14 Carbon substitutions for carbon in C- are all within the scope of this disclosure. Such compounds may be used, for example, as analytical tools, as probes in biological assays, or as therapeutic agents according to this disclosure.
[0071] The “enantiomer excess” or “% enantiomer excess” of the composition can be calculated using the equation shown below. In the example shown below, the composition contains 90% of one enantiomer (e.g., the S enantiomer) and 10% of another enantiomer (i.e., the R enantiomer).
[0072] ee=(90-10) / 100*100=80%.
[0073] Therefore, a composition containing 90% of one enantiomer and 10% of the other enantiomer is believed to have an 80% enantiomer excess. The compounds or compositions described herein may contain at least 50%, 75%, 90%, 95%, or 99% enantiomer excess of one form of the compound (e.g., the S-enantiomer). In other words, such compounds or compositions contain an enantiomer excess of the S enantiomer over the R enantiomer.
[0074] Where a particular enantiomer is preferred, in some embodiments it may be substantially free of the corresponding enantiomer and may also be provided as “optically enriched.” As used herein, “optically enriched” means that the compound consists of a significantly larger proportion of one enantiomer. In some embodiments, the compound consists of at least about 90% by weight of the preferred enantiomer. In other embodiments, the compound consists of at least about 95%, 98%, or 99% by weight of the preferred enantiomer. The preferred enantiomers can be separated from the racemic mixture by any method known to those skilled in the art, including chiral high-performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts, or prepared by asymmetric synthesis. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); Wilen, Tables of Resolving Agents and Optical Resolutions, p. 268 (Ellie Liel, ed., Univ. of Notre Dame Press, Notre Dame, IN 1972).
[0075] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise obviously contradicted by the context. Any and all instances or exemplary language (such as "for example") provided herein are intended only to better illustrate this disclosure and do not limit the scope of this disclosure as otherwise claimed.
[0076] Any resulting mixture of isomers can be separated into pure or substantially pure geometric or optical isomers, diastereomers, or racemates based on the physicochemical differences of the components, for example by chromatography and / or fractional crystallization.
[0077] Racemic derivatives of any resulting final product or intermediate can be resolved into optically active enantiomers using known methods, such as by separating their diastereomer salts obtained with optically active acids or bases and releasing the optically active acidic or basic compounds. In particular, the compounds disclosed herein can therefore be resolved into their optical enantiomers using basic fractions, for example by fractional crystallization with salts formed from optically active acids, such as tartaric acid, dibenzoyltartaric acid, diacetyltartaric acid, di-O,O'-p-toluyltartaric acid, mandelic acid, malic acid, or camphor-10-sulfonic acid. Racemic products can also be separated by chiral chromatography, such as high-performance liquid chromatography (HPLC) using chiral adsorbents.
[0078] The compounds disclosed herein may also contain atomic isotopes in non-natural proportions at one or more atoms constituting such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as deuterium (…). 2 H), tritium ( 3 H), carbon-13 ( 13 C) or carbon-14 ( 14 C). All isotopic variants of the compounds disclosed herein, whether radioactive or not, are intended to be covered within the scope of this disclosure. Furthermore, all tautomeric forms of the compounds described herein are intended to fall within the scope of this disclosure.
[0079] The term "tautomer" refers to a specific compound structure that has interchangeable forms and varies in terms of hydrogen atom and electron shifts. Thus, the two structures can be in equilibrium through the movement of π electrons and atoms (usually H). For example, enols and ketones are tautomers because they rapidly interconvert by treatment with an acid or base. Another example of tautomerism is the acid- and nitro-forms of phenylnitromethane, which are also formed by treatment with an acid or base. Tautomerism can be associated with obtaining optimal chemical reactivity and biological activity of the desired compound.
[0080] compound
[0081] In one respect, this disclosure provides compounds having formula (I) or pharmaceutically acceptable salts thereof, wherein:
[0082]
[0083] R 1 Choose from the following groups: hydrogen, C 1-6 Alkyl, hydroxyl C 1-6 Alkyl and heterocarbon 1-6 Alkyl; and
[0084] R 2 yes Where n is 1, 2 or 3.
[0085] In one embodiment, R 1 Choose free hydroxyl groups and A group that is formed.
[0086] In one embodiment, R2 is
[0087] In one embodiment, R2 is
[0088] In one embodiment, R2 is
[0089] In one embodiment, R 1 Choose free hydroxyl groups and The group consists of; and R2 is
[0090] In one embodiment, the compound or a pharmaceutically acceptable salt thereof is selected from:
[0091]
[0092]
[0093] Pharmaceutically acceptable salts
[0094] Pharmaceutically acceptable salts of these compounds may also be considered for use in the purposes described herein. As used herein, the term "salt" (or "salts") refers to an acid addition salt or a base addition salt of the compounds disclosed herein. "Salt" specifically includes "pharmaceutically acceptable salts." The term "pharmaceutically acceptable salt" means a salt that retains the bioavailability and properties of the compounds disclosed herein, and these salts are typically not biologically or otherwise undesirable. In many cases, the compounds disclosed herein are capable of forming acid and / or base salts due to the presence of amino and / or carboxyl groups or similar groups.
[0095] Pharmaceutically acceptable acid addition salts can be formed from inorganic and organic acids.
[0096] Inorganic acids that can form salts include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid.
[0097] Organic acids that can be used to derive salts include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicylic acid, etc.
[0098] Pharmaceutically acceptable base addition salts can be formed using inorganic and organic bases.
[0099] Inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I through XII of the periodic table. In some embodiments, salts are derived from sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium salts, potassium salts, sodium salts, calcium salts, and magnesium salts.
[0100] Organic bases that can derive salts include, for example, primary, secondary, and tertiary amines; substituted amines (including naturally occurring substituted amines); cyclic amines; and basic ion exchange resins. Some organic amines include isopropylamine, benzylamine, choline salts, diethanolamine, diethylamine, lysine, meglumine, piperazine, and tromethamine.
[0101] On the other hand, this disclosure provides compounds having formula (I) in the following forms: acetate, ascorbate, adipic acid salt, aspartate, benzoate, benzenesulfonate, bromide / hydrobromide, bicarbonate / carbonate, bisulfate / sulfate, camphorsulfonate, decanoate, chloride / hydrochloride, chlortheophyllonate, citrate, ethanedisulfonate, fumarate, glucohepanoate, glucuronate, glucuronate, glutamate, glutamate, glycolic acid, hippurate, hydroiodide / Iodides, hydroxyethyl sulfonates, lactates, lacturonates, dodecyl sulfates, malates, maleates, malonates, mandelates, methanesulfonates, methyl sulfates, mucilages, naphthates, naphthalenesulfonates, nicotinates, nitrates, octadecanoates, oleates, oxalates, palmitates, dihydroxynaphthalates, phosphates / hydrogen phosphates / dihydrogen phosphates, polygalacturonates, propionates, sebates, stearates, succinates, sulfosalicylates, sulfates, tartrates, toluenesulfonates, trifluoromethanesulfonates, trifluoroacetates, or sine salts.
[0102] Pharmaceutical Composition
[0103] On the other hand, this disclosure provides pharmaceutical compositions comprising one or more compounds having formula (I) or pharmaceutically acceptable salts thereof, and one or more pharmaceutically acceptable carriers. The term “pharmaceutically acceptable carrier” refers to a pharmaceutically acceptable material, composition, or medium, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulation material, relating to carrying or transporting any subject composition or its components. Each carrier must be “acceptable” in the sense of being compatible with the subject composition and its components and harmless to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered astragalus gum; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and so on. Soybean oil, etc.; (10) glycols, such as propylene glycol; (11) polyols, such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) phosphate buffer; and (21) other non-toxic compatible substances used in pharmaceutical preparations.
[0104] The compositions disclosed herein can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or via an implanted reservoir. As used herein, the term “parenterally” includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intraosseous, intrasheathic, intrahepatic, intralesional, and intracranial injection or infusion techniques. In some embodiments, the compositions disclosed herein are administered orally, intraperitoneally, or intravenously. The sterile injectable form of the compositions disclosed herein can be an aqueous or oily suspension. These suspensions can be formulated using suitable dispersants or wetting agents and suspending agents according to techniques known in the art. The sterile injectable formulation can also be a sterile injectable solution or suspension in a non-toxic, parenterally acceptable diluent or solvent (e.g., a solution in 1,3-butanediol). Water, Ringer's solution, and isotonic sodium chloride solution are acceptable media and solvents. In addition, sterile, non-volatile oils can routinely be used as solvents or suspension media.
[0105] For this purpose, any mild, non-volatile oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids (such as oleic acid and its glyceride derivatives) are pharmaceutically acceptable oils (such as olive oil or castor oil) because they are natural, and especially their polyoxyethylene forms, can also be used to prepare injectable formulations. These oil solutions or suspensions may also contain long-chain alcohol diluents or dispersants (such as carboxymethyl cellulose or similar dispersants), which are commonly used to formulate pharmaceutically acceptable dosage forms (including emulsions and suspensions). Other commonly used surfactants, such as..., can also be used for formulation purposes. Spans and other emulsifiers or bioavailability enhancers are commonly used to prepare pharmaceutically acceptable solid, liquid or other dosage forms.
[0106] The pharmaceutically acceptable compositions disclosed herein can be administered orally in any orally acceptable dosage form, including but not limited to capsules, tablets, aqueous suspensions, or solutions. For tablets used orally, common carriers include lactose and corn starch. Lubricants, such as magnesium stearate, are typically added. For oral administration in capsule form, useful diluents include lactose and dried corn starch. When an oral aqueous suspension is required, the active ingredient is mixed with an emulsifier and a suspending agent. Sweeteners, flavoring agents, or coloring agents may also be added if desired.
[0107] Alternatively, the pharmaceutically acceptable compositions disclosed herein may be administered rectally in suppository form. These can be prepared by mixing the pharmaceutical preparation with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature, and thus melts in the rectum to release the drug. These materials include cocoa butter, beeswax, and polyethylene glycol.
[0108] The pharmaceutically acceptable compositions disclosed herein can also be applied topically, particularly when the target of treatment includes areas or organs easily accessible by topical application (including eye, skin, or lower bowel diseases). Suitable topical formulations are readily prepared for each of these areas or organs. Topical application to the lower bowel can be performed using rectal suppository formulations (see above) or as suitable enema formulations. Topical transdermal patches may also be used.
[0109] For topical application, pharmaceutically acceptable compositions may be formulated into suitable ointments containing an active ingredient suspended or dissolved in one or more carriers. Carriers for the topical application of the disclosed compounds include, but are not limited to, mineral oils, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsified waxes, and water. Alternatively, pharmaceutically acceptable compositions may be formulated into suitable lotions or creams containing an active ingredient suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include, but are not limited to, mineral oils, sorbitan monostearate, polysorbate 60, cetyl wax, cetearyl alcohol, 2-octyldodecanool, benzyl alcohol, and water.
[0110] The pharmaceutically acceptable compositions disclosed herein can also be administered via nasal spray or inhalation. Such compositions are prepared according to techniques well known in the field of pharmaceutical formulation and can be prepared in the form of a saline solution using benzyl alcohol or other suitable preservatives, bioavailability enhancers, fluorocarbons, and / or other conventional solubilizers or dispersants. The amount of the disclosed compounds that can be combined with a carrier material to produce a single dosage form of the composition will vary depending on the host being treated and the specific route of administration. Preferably, the compositions should be formulated such that an inhibitor can be administered to a patient receiving these compositions at a dose of 0.01-100 mg / kg body weight / day.
[0111] Isotope-labeled compounds
[0112] The presence of formula (I) or a pharmaceutically acceptable salt thereof is also intended to represent the unlabeled form as well as the isotopically labeled form of the compound. The isotopically labeled compound has a structure represented by the formula given herein, except that one or more atoms are replaced by atoms having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into the compounds disclosed herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, for example, […]. 2 H, 3 H, 11 C 13 C 14 C 15 N、 18 F, 31 P, 32 P, 35 S, 36 Cl、 123 I, 124 I, 125 I. This disclosure includes compounds labeled with various isotopes as defined herein, such as those containing radioactive isotopes (e.g., 3 H and 14 Those compounds in C), or those containing non-radioactive isotopes (e.g. 2 H and 13Those compounds in C). These isotopically labeled compounds can be used for metabolic studies (using...) 14 C) Reaction kinetic studies (e.g., using...) 2 H or 3 H), detection or imaging techniques (such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT), including drug or substrate tissue distribution assays), or for use in the patient's radiation therapy. Specifically, 18 F or labeled compounds may be particularly desirable for PET or SPECT studies. Isotopically labeled compounds having formula (I), (Ia), or (Ib) or pharmaceutically acceptable salts thereof can generally be prepared by conventional techniques known to those skilled in the art or by methods similar to those described in the appended examples and preparations, using an appropriate isotopically labeled reagent instead of an unlabeled previously used reagent.
[0113] In addition, heavier isotopes, especially deuterium (i.e., 2 H or D substitution can provide certain therapeutic advantages arising from greater metabolic stability, such as prolonged in vivo half-life, reduced dose requirement, or improved therapeutic index. It should be understood that, in this context, deuterium is considered to have a substituent of formula (I) or a pharmaceutically acceptable salt thereof. The concentration of such heavier isotopes (particularly deuterium) can be defined by an isotope enrichment factor. As used herein, the term "isotope enrichment factor" refers to the ratio between the isotope abundance and the natural abundance of a particular isotope. If the substituents in the compounds disclosed herein indicate deuterium, such compounds have an isotopic enrichment factor for each specified deuterium atom of at least 3500 (52.5% deuterium doping on each specified deuterium atom), at least 4000 (60% deuterium doping), at least 4500 (67.5% deuterium doping), at least 5000 (75% deuterium doping), at least 5500 (82.5% deuterium doping), at least 6000 (90% deuterium doping), at least 6333.3 (95% deuterium doping), at least 6466.7 (97% deuterium doping), at least 6600 (99% deuterium doping), or at least 6633.3 (99.5% deuterium doping).
[0114] dose
[0115] The toxicity and therapeutic efficacy of the disclosed compounds (including pharmaceutically acceptable salts and deuterated variants) can be determined in cell cultures or laboratory animals using standard pharmaceutical procedures. LD 50 ED50 is the lethal dose for 50% of the population. ED50 is the therapeutically effective dose for 50% of the population. The dose ratio between toxicity and therapeutic effect (LD50) 50 / ED 50The therapeutic index is the highest possible value. Compounds exhibiting a high therapeutic index are preferred. Although compounds exhibiting toxic side effects can be used, delivery systems for targeting such compounds to affected tissue sites should be carefully designed to minimize potential damage to uninfected cells and thereby reduce side effects.
[0116] Data obtained from cell culture assays and animal studies can be used to formulate a range of dosages for human use. Dosages of these compounds are in the range including ED (Extracorporeal Therapy). 50 The dose is within a range of circulating concentrations with very low or no toxicity. This dose may vary within this range depending on the dosage form and route of administration. For any compound, the therapeutically effective dose can be initially estimated based on cell culture assays. Doses can be formulated in animal models to achieve the range of circulating plasma concentrations determined in cell culture, including the IC50 range. 50 (That is, the concentration at which the test compound achieves half-maximal symptom inhibition). This type of information can be used to more accurately determine the dosage that is useful in humans. The level in plasma can be measured, for example, by high-performance liquid chromatography.
[0117] It should also be understood that the specific dosage and treatment regimen for any particular patient will depend on a variety of factors, including the activity of the specific compound used, age, weight, general health condition, sex, diet, timing of administration, excretion rate, drug combination, the judgment of the treating physician, and the severity of the specific disease being treated. The amount of the disclosed compounds in the composition will also depend on the specific compounds in the composition.
[0118] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise obviously contradicted by the context. Any and all instances or exemplary language (such as "for example") provided herein are intended only to better illustrate this disclosure and do not limit the scope of this disclosure as otherwise claimed.
[0119] Any asymmetric atom (e.g., carbon, etc.) of one or more compounds disclosed herein may be present in a racemic or enantiomerically enriched form, such as (R)-, (S)-, or (R,S)- configuration. In some embodiments, each asymmetric atom has an enantiomerically abundant (R)- or (S)- configuration of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% enantiomerically abundant. If possible, substituents on atoms having unsaturated double bonds may be present in cis-(Z)- or trans-(E)- form.
[0120] Therefore, as used herein, the compounds disclosed herein may be in the form of one of the following possible stereoisomers, rotational isomers, tautomers, tautomers or mixtures thereof, for example, as substantially pure geometric (cis or trans) stereoisomers, diastereomers, optical isomers (enantiomers), racemates or mixtures thereof.
[0121] Any resulting mixture of stereoisomers can be separated into pure or substantially pure geometric or optical isomers, diastereomers, or racemates based on the physicochemical differences of the components, for example by chromatography and / or fractional crystallization.
[0122] Any racemic mixture of the compounds or intermediates of this disclosure can be resolved into optically active enantiomers by known methods, for example, by separating their diastereomer salts obtained with optically active acids or bases, releasing optically active acidic or basic compounds. In particular, the compounds of this disclosure can therefore be resolved into their optical enantiomers using basic fractions, for example, by fractional crystallization with salts formed from optically active acids, such as tartaric acid, dibenzoyltartaric acid, diacetyltartaric acid, di-O,O'-p-toluyltartaric acid, mandelic acid, malic acid, or camphor-10-sulfonic acid. The racemic compounds or racemic intermediates of this disclosure can also be resolved by chiral chromatography (e.g., high-performance liquid chromatography (HPLC) using chiral adsorbents).
[0123] Diseases and Disabilities
[0124] Compounds having formula (I) can be used to treat diseases or disorders selected from the following:
[0125] Transplant vascular disease;
[0126] It leads to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and proliferation and migration of smooth muscle cells.
[0127] Autoimmune diseases and inflammatory conditions;
[0128] asthma;
[0129] Multidrug resistance (MDR);
[0130] Fungal infection;
[0131] Inflammation;
[0132] Infect;
[0133] Age-related diseases;
[0134] Neurodegenerative diseases;
[0135] Proliferative disorders, such as cancer;
[0136] Seizures and disorders associated with seizures; and
[0137] Mitochondrial myopathy and mitochondrial stress.
[0138] On the other hand, the compounds disclosed herein can be used to treat conditions that have been shown to increase the likelihood of age-related diseases, such as an increase in aging-inducing cytokines (e.g., IL6).
[0139] On the other hand, the compounds disclosed herein can be used to treat disorders including fibrosis and / or inflammatory processes, such as liver and kidney disorders. Examples include liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis. Another example is kidney fibrosis, which occurs as a result of acute kidney injury leading to chronic kidney disease. Diabetic nephropathy can induce kidney fibrosis and inflammation. Kidney disease often causes heart failure due to elevated blood pressure; this may also be associated with cardiac fibrosis.
[0140] On the other hand, the compounds disclosed herein can be used to treat heart failure. (Buss, SJ et al., Beneficial effects of Mammalian target of rapamycin inhibition on left ventricular remodeling after myocardial infarction. J Am Coll Cardiol. (2009) 54(25): 2435-46; Buss, SJ et al., Augmentation of autophagy by mTOR-inhibition in myocardial infarction: When size matters. Autophagy. (2010) 6(2): 304-6.)
[0141] On the other hand, the compounds disclosed herein can be used to treat liver fibrosis in patients who have undergone liver transplantation. (Villamil, FG et al. Fibrosis progression in maintenance liver transplant patients with hepatitis C recurrence: a randomized study of RAD001 vs. calcineurin inhibitors. Liver Int. (2014) 34(10): 1513-21).
[0142] Transplant vascular disease includes atherosclerosis.
[0143] Autoimmune diseases and inflammatory conditions specifically include inflammatory conditions with etiologies including autoimmune components, such as arthritis (e.g., rheumatoid arthritis, chronic aplastic arthritis, and osteoarthritis) and rheumatic diseases. Specific autoimmune diseases for which compounds of formula (I) may be used include autoimmune hematologic disorders (e.g., hemolytic anemia, aplastic anemia, simple erythrocytic anemia, and idiopathic thrombocytopenic purpura), systemic lupus erythematosus, polychondritis, scleroderma, Wegener's granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, psoriasis, Stevens-Johnson syndrome, idiopathic diarrhea, and autoimmune inflammatory bowel diseases (e.g., ulcerative colitis and Crohn's disease). Diseases including endocrine eye diseases, Graves' disease, sarcoidosis, multiple sclerosis, primary biliary cirrhosis, juvenile diabetes (type I diabetes), uveitis (anterior and posterior uveitis), keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial pulmonary fibrosis, psoriatic arthritis, glomerulonephritis (with and without nephrotic syndrome, including idiopathic nephrotic syndrome or minimal change disease), and juvenile dermatomyositis.
[0144] The disclosed compounds can also be used to treat multidrug resistance (MDR), including enhancing the efficacy of other chemotherapeutic agents in treating and controlling MDR conditions such as multidrug-resistant cancer or multidrug-resistant AIDS. MDR is particularly problematic in cancer patients and AIDS patients who do not respond to conventional chemotherapy because the drug is pumped out of the cells via Pgp.
[0145] The compounds disclosed herein may also be used to treat infections, including those caused by pathogens with Mip or Mip-like factors.
[0146] Age-related diseases also include: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic disorders, renal vascular disease, hearing loss, mobility impairment (e.g., weakness), and cognitive decline. Tendon stiffness, cardiac dysfunction (such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension and / or dilated cardiomyopathy), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as renal failure, blindness, and neuropathy).
[0147] Neurodegenerative diseases include Huntington's disease, Parkinson's disease, spinocerebellar ataxia type 3, Alzheimer's disease, motor neuron disease, and peripheral neuropathy.
[0148] Proliferative disorders include cancers. These include those listed in U.S. Patent No. 9,669,032, such as kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, stomach cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, astrocytoma, adenocarcinoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and cervical cancer.
[0149] Seizures and seizure-related disorders include Wester syndrome, focal cortical dysplasia (FCD), tuberous sclerosis (TSC), childhood absence epilepsy, benign focal epilepsy of childhood, juvenile myoclonic epilepsy (JME), temporal lobe epilepsy, frontal lobe epilepsy, refractory epilepsy, Lennox-Gastaut syndrome, occipital lobe epilepsy, Protes syndrome, hemimegaencephaly syndrome (HMEG), megalencephaly syndrome (MEG), megalencephalic-capillary malformation (MCAP), and megalencephaly-polymicrogyri-polydactyly-hydrocephalus syndrome (MPPH).
[0150] Mitochondrial myopathy and mitochondrial stress are mitochondrial disorders, as described in the following literature: Chinnery, PF (2015); EMBO Mol. Med. [Molecular Medicine Journal of the European Society for Molecular Biology] 7, 1503-1512; Koopman, WJ et al. (2016); EMBO Mol. Med. [Molecular Medicine Journal of the European Society for Molecular Biology] 8, 311-327 and Young, MJ and Yound with Copeland, WC (2016); Curr. Opin. Genet. Dev. [Recent Perspectives on Genetics and Development]. 38, 52-62.
[0151] Treatable conditions that have been shown to increase the likelihood of age-related diseases include aging, such as immunosenescence. This can be diagnosed by: (i) an increase in circulating cytokines (such as IL-6); (ii) senescent cells found in muscles, kidneys, liver, brain, neurons, pancreas, or heart; or (iii) a decline in DNA repair efficiency, which can be demonstrated by an increase in the transcription of repetitive elements, including transposon-encoding genes.
[0152] How to use
[0153] This disclosure provides for the use of compounds having formula (I) or pharmaceutically acceptable salts thereof for the treatment of diseases and disorders described herein, such as age-related disorders, or diseases and disorders currently approved for treatment with rapamycin analogs (e.g., RAD001).
[0154] In one aspect, this disclosure provides a method for treating a disorder or disease mediated by the mTOR pathway in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0155] On the other hand, this disclosure provides a method for treating a subject’s disease or disorder, wherein a target tissue, organ or cell associated with the pathology of the disease or disorder has an FKBP12 level sufficient to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0156] On the other hand, this disclosure provides a method for treating a subject with or having been determined to have FKBP12 levels sufficient to inhibit mTORC1, the method comprising administering to the subject in need a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0157] In one embodiment, the disease or disorder is selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction (such as cardiomegaly, systolic or diastolic dysfunction, hypertension, dilated cardiomyopathy), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infection due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as renal failure, blindness, and neuropathy).
[0158] In one embodiment, the obstacle is liver fibrosis.
[0159] On the other hand, this disclosure provides a method for treating a disease or disorder in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, wherein the disorder or disease is selected from:
[0160] - Transplant vascular disease;
[0161] - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration;
[0162] - Autoimmune diseases and inflammatory conditions;
[0163] -asthma;
[0164] - Multidrug resistance (MDR);
[0165] - Fungal infection;
[0166] -Inflammation;
[0167] -Infect;
[0168] - Age-related diseases;
[0169] - Neurodegenerative diseases;
[0170] - Proliferative disorders, especially cancer;
[0171] - Seizures and disorders associated with seizures; and
[0172] - Mitochondrial myopathy and mitochondrial stress.
[0173] In one embodiment, the barrier is an obstacle that includes fibrosis and / or inflammatory processes.
[0174] In one embodiment, the disorder is selected from liver and kidney disorders.
[0175] In one embodiment, the liver disorder is selected from: liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis.
[0176] In one embodiment, the kidney disorder is kidney fibrosis.
[0177] In one embodiment, the renal fibrosis occurs as a result of acute kidney injury.
[0178] In one embodiment, the kidney disorder is a chronic kidney disorder.
[0179] In one embodiment, the kidney disorder is diabetic nephropathy.
[0180] On the other hand, this disclosure provides a method for treating age-related disorders or diseases in subjects in need, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, wherein the disorder or disease is selected from: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, Diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction (such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as renal failure, blindness, and neuropathy).
[0181] On the other hand, this disclosure provides a method for treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof.
[0182] In one embodiment, the method further includes a PD-1 / PDL-1 inhibitor.
[0183] In one embodiment, the cancer is selected from kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and cervical cancer.
[0184] On the other hand, this disclosure provides a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, for use as a medicine.
[0185] On the other hand, this disclosure provides a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, for the prevention or treatment of disorders or diseases mediated by the mTOR pathway.
[0186] On the other hand, this disclosure provides a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, for the prevention or treatment of disorders or diseases selected from:
[0187] - Transplant vascular disease;
[0188] - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration;
[0189] - Autoimmune diseases and inflammatory conditions;
[0190] -asthma;
[0191] - Multidrug resistance (MDR);
[0192] - Fungal infection;
[0193] -Inflammation;
[0194] -Infect;
[0195] - Age-related diseases;
[0196] - Neurodegenerative diseases;
[0197] - Proliferative disorders, especially cancer;
[0198] - Seizures and disorders associated with seizures; and
[0199] - Mitochondrial myopathy and mitochondrial stress.
[0200] On the other hand, this disclosure provides a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, for the prevention or treatment of disorders or diseases including fibrosis and / or inflammatory processes.
[0201] In one embodiment, the disorder is selected from liver and kidney disorders.
[0202] In one embodiment, the liver disorder is selected from: liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis.
[0203] In one embodiment, the kidney disorder is renal fibrosis, which occurs as a result of acute kidney injury.
[0204] In one embodiment, the kidney disorder is a chronic kidney disorder.
[0205] In one embodiment, the kidney disorder is diabetic nephropathy.
[0206] On the other hand, this disclosure provides a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, for the treatment of age-related disorders or diseases selected from: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, Autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment (e.g., weakness), cognitive decline, tendon stiffness, cardiac dysfunction (e.g., cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension and / or dilated cardiomyopathy), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as renal failure, blindness, and neuropathy).
[0207] On the other hand, this disclosure provides a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, for the treatment of cancer.
[0208] On the other hand, this disclosure provides a compound having formula (I) or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound having formula (I) or a pharmaceutically acceptable salt thereof, for the treatment of renal cell carcinoma, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or cervical cancer.
[0209] On the other hand, this disclosure provides the use of a compound having formula (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament.
[0210] On the other hand, this disclosure provides the use of a compound having formula (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament for treating a disorder or disease mediated by the mTOR pathway.
[0211] On the other hand, this disclosure provides the use of a compound having formula (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament for treating a disorder or disease selected from:
[0212] - Transplant vascular disease;
[0213] - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration;
[0214] - Autoimmune diseases and inflammatory conditions;
[0215] -asthma;
[0216] - Multidrug resistance (MDR);
[0217] - Fungal infection;
[0218] -Inflammation;
[0219] -Infect;
[0220] - Age-related diseases;
[0221] - Neurodegenerative diseases;
[0222] - Proliferative disorders, such as cancer;
[0223] - Seizures and disorders associated with seizures; and
[0224] - Mitochondrial myopathy and mitochondrial stress.
[0225] On the other hand, this disclosure provides the use of a compound having formula (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament for treating disorders or diseases including fibrosis or inflammatory processes.
[0226] In one embodiment, the disorder is selected from liver and kidney disorders.
[0227] In one embodiment, the liver disorder is selected from: liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis or NASH; and alcoholic steatosis.
[0228] In one embodiment, the kidney disorder is renal fibrosis, which occurs as a result of acute kidney injury.
[0229] In one embodiment, the kidney disorder is a chronic kidney disorder.
[0230] In one embodiment, the kidney disorder is diabetic nephropathy.
[0231] On the other hand, this disclosure provides the use of a compound having formula (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament for the prevention or treatment of age-related disorders or diseases selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, impaired liver function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction. Impaired function, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction (such as cardiomegaly and / or systolic and / or diastolic dysfunction and / or hypertension and / or dilated cardiomyopathy), cardiac dysfunction leading to reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, carcinogenic immunosenescence due to reduced immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications of diabetes such as renal failure, blindness, and neuropathy).
[0232] On the other hand, this disclosure provides the use of a compound having formula (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament for the prevention or treatment of cancer.
[0233] On the other hand, this disclosure provides the use of a compound having formula (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament for treating the following cancers: renal cell carcinoma, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or cervical cancer.
[0234] Method for preparing compounds having formula (I)
[0235] On the other hand, this disclosure provides methods for preparing the compounds disclosed according to schemes 1 and 2.
[0236] Option 1:
[0237]
[0238] In the presence of a suitable reagent (e.g., p-toluenesulfonic acid) and a suitable solvent (e.g., dichloromethane), a compound having formula (I) (wherein R) is reacted with a suitable reagent for the substitution reaction. 1 It is hydrogen and R 2 As defined in formula (I), rapamycin can be used to react with R2 -H (where R) 2 The reaction is obtained as defined in equation (I). For example, suitable conditions are as follows:
[0239] 1) R2-H, p-toluenesulfonic acid-H2O, dichloromethane, room temperature
[0240] 2) R2-H, trifluoroacetic acid, -40℃, dichloromethane (see EP 1212331 B1)
[0241] 3) R2-H, 5M LiClO4, Et2O (0.1M), room temperature (see TL, 1995, 43, 7823)
[0242] 4) R2-H, Cp2HfCl2-AgClO4 (Suzuki's catalyst), 4A MS, dichloromethane, room temperature (see TL, 1995, 43, 7823)
[0243] 5) R2-H, BF3-OEt2 or Zn(OTf)2, THF, 0℃ (see TL, 1994, 37, 6835)
[0244] 6) R2-H, ZnCl2, dichloromethane, 0℃ (see JOC, 1994, 59, 6512).
[0245] Option 2:
[0246]
[0247] Compounds having formula (I), wherein R 1 Choose from the following groups: C 1-6 Alkyl, hydroxyl C 1-6 Alkyl and heterocarbon 1-6 Alkyl; and R 2 As defined in formula (I), rapamycin can be reacted with R 1 -H or R 1 -X reaction to provide intermediate 1, then with R 2 The reaction is obtained by -H reaction. In one embodiment, rapamycin is reacted with R... 1 -H or R 1 -X reacts under alkylation conditions to provide intermediate 1. In one embodiment, intermediate 1 reacts with R under substitution reaction conditions, such as those provided herein. 2 -H reaction to give a compound having formula (I).
[0248] Example
[0249] This disclosure sets forth the following examples. Synthetic and biological examples described in this application are provided to illustrate the compounds, pharmaceutical compositions, and methods presented herein, and these examples should not be construed as limiting their scope in any way.
[0250] The compounds provided herein can be prepared from readily available starting materials using modifications of the specific synthetic schemes listed below, as is well known to those skilled in the art. It should be recognized that, unless otherwise stated, other process conditions may be used, given typical or preferred process conditions (i.e., reaction temperature, time, molar ratio of reactants, solvent, pressure, etc.). Optimal reaction conditions may vary depending on the specific reactants or solvents used, but such conditions can be determined by those skilled in the art through conventional optimization procedures.
[0251] Furthermore, as will be apparent to those skilled in the art, conventional protecting groups are essential for protecting certain functional groups from undesirable reactions. The selection of suitable protecting groups for specific functional groups, as well as suitable conditions for protection and deprotection, is well known in the art. For example, numerous protecting groups and their introduction and removal are described in Greene et al., Protecting Groups in Organic Synthesis, 2nd ed., Wiley Publishers, New York, 1991, and the references cited therein.
[0252] Rapamycin and its derivatives, such as compounds having formula (I), exist in solvent- and pH-dependent equilibrium hexa- and hepta-ketals, as shown in A, B, and C below (Scheme 3). See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-90; and Tetrahedron Letters (1992) 33(33):4139-4142. Rapamycin and its derivatives also exist in mixtures of cis- and trans-amides as shown in A and C below. [See Mierke, DF, Schmieder, P., Karuso, P., and Kessler, H. (1991), Conformational Analysis of the cis-and trans-Isomers of FK506 by NMR and Molecular Dynamics. Helvetica Chimica Acta, 74: 1027-1047]. The NMR characterization data shown in the examples correspond only to the major equilibrium forms observed under the reported deuterated solvent conditions.
[0253] Option 3:
[0254]
[0255] in:
[0256] R 1 Choose from the following groups: hydrogen, C 1-6 Alkyl, hydroxyl C 1-6 Alkyl and heterocarbon 1-6 Alkyl; and
[0257] R 2 yes Where n is 1, 2 or 3.
[0258] Preparation of compounds
[0259] The compounds disclosed herein can be prepared as described in the following examples.
[0260] List of abbreviations
[0261] The following abbreviations used below have their corresponding meanings:
[0262] A
[0263] Cat. Catalytic
[0264] ACN Acetonitrile
[0265] d Double peak
[0266] dd Double peak
[0267] DCM dichloromethane
[0268] DMSO (dimethyl sulfoxide)
[0269] ESIMS Electrospray Ionization Mass Spectrometry
[0270] EtOAc (ethyl acetate)
[0271] eq equivalent
[0272] FA Formic acid
[0273] HSQC NMR Heteronuclear Single Quantum Coherent Nuclear Magnetic Resonance
[0274] HPLC (High Performance Liquid Chromatography)
[0275] HRMS (High-Resolution Mass Spectrometry)
[0276] h hours
[0277] Hz Hertz
[0278] MeCN Acetonitrile
[0279] MeOH (methanol)
[0280] M Moore
[0281] m multiplet
[0282] mg
[0283] MHz
[0284] mL
[0285] min. minutes
[0286] mmol millimole
[0287] NMR (Nuclear Magnetic Resonance)
[0288] PEI (Polyethyleneimine)
[0289] PPU propylpyridylurea
[0290] q Quadruple Peak
[0291] rt room temperature
[0292] μL
[0293] μM micromolar
[0294] s Single peak
[0295] SFC Supercritical Fluid Chromatography
[0296] TLC (Thin Layer Chromatography)
[0297] t triple peak
[0298] TsOH p-Toluenesulfonic acid monohydrate
[0299] Methods used in the purification of the instance
[0300] The intermediates and final products are purified by normal-phase or reversed-phase chromatography.
[0301] Rapid chromatography
[0302] Normal phase chromatography uses pre-packed SiO2 columns (e.g., from Teledyne Isco, Inc.). Rf column), eluted with a gradient of a suitable solvent system (e.g., hexane and ethyl acetate; DCM and MeOH; or unless otherwise indicated).
[0303] Example 1. Synthesis of Compound 1
[0304] Rapamycin (0.549 g, 0.601 mmol) was combined with isothiazolidine 1,1-dioxide (0.728 g, 6.01 mmol) in anhydrous acetonitrile (3.0 mL) in a reaction vial. TsOH (0.011 g, 0.060 mmol) was added and the reaction mixture was stirred at room temperature for 50 minutes. The reaction mixture was diluted with brine and extracted three times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted and concentrated to give a yellow oily crude product (approximately 1 g). The crude product was purified by silica gel rapid column chromatography (0 to 50% acetone-heptane, ISCO combiflash gradient elution, 40 g Silicycle silica gel 15–40 μm FLH-R10017B-ISO40, TLC 40% acetone-heptane, UV visible). Fractions containing the product were examined by LCMS. Fractions with the highest purity were combined and concentrated to give compound 1 as a white solid (0.315 g, 0.298 mmol, 49.7% yield).
[0305] Compound 1: ESIMS[M+NH4] + 1020.7, [MH] - 1001.8
[0306] HRMS: [M+Na]+1025.5367.
[0307] 1H NMR (400MHz, chloroform-d) δ6.39 (dd, J=14.7, 10.7Hz, 1H), 6.22 (dd, J=14.7, 10.6Hz, 1H), 6.07 (dd, J=1 4.9,10.6Hz,1H),6.00(d,J=10.9Hz,1H),5.40(d,J=10.0Hz,1H),5.33(dd,J=14.8,9.8Hz,1H), 5.24-5.17(m,1H),5.00(td,J=5.9,3.5Hz,1H),4.57(dd,J=10.8,2.4Hz,2H),4.27(d,J=3.8Hz, 1H),4.05-3.94(m,2H),3.63-3.48(m,2H),3.39(s,3H),3.33(s,4H),3.30-3.16(m,2H),3.11-2. 98(m,2H),2.98-2.85(m,2H),2.68(dd,J=17.5,6.5Hz,1H),2.52(dd,J=17.3,5.4Hz,1H),2.47- 2.38(m,2H),2.38-2.31(m,1H),2.31-2.25(m,2H),2.23-2.15(m,1H),1.99(m,2H),1.92-1.85(m ,1H),1.82(m,5H),1.76-1.70(m,6H),1.64(m,4H),1.58-1.43(m,3H),1.40(m,1H),1.34(m,1H) ,1.25(m,2H),1.18-1.11(m,1H),1.11-1.00(m,10H),1.00-0.84(m,7H),0.57(q,J=11.9Hz,1H).
[0308] Example 2. Synthesis of compounds 2 and 3
[0309]
[0310] In a reaction flask, RAD001 (everolimus, 1.0 g, 1.044 mmol) was combined with isothiazolidine 1,1-dioxide (1.264 g, 10.44 mmol) in anhydrous dichloromethane (5.2 mL). TsOH (0.020 g, 0.104 mmol) was added in a single addition. The reaction was stirred at room temperature for 22 minutes.
[0311] The reaction mixture was diluted with saturated aqueous NaHCO3 and then extracted four times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted and concentrated to give an orange crude tar product (2.181 g).
[0312] A portion of the crude product (1.436 g) was purified by silica gel rapid column chromatography (15% to 50% acetone-heptane, ISCO compbiflash gradient elution, 40 g Silicycle silica gel 15-40 μm FLH-R10017B-ISO40, TLC 40% acetone-heptane, visible under UV). Two spots were observed by TLC elution.
[0313] Fractions containing the product were examined by LCMS. The fractions with the highest purity from the first elution peak were combined and concentrated to give compound 2 as a white solid (0.080 g, 0.073 mmol, 6.95% yield).
[0314] Compound 2: ESIMS[M+NH4] + 1064.8, [MH] - 1046.3.
[0315] HRMS: Experimental value of C55H86N2O15SNa: 1069.5248.
[0316] 1 ¹H NMR (400MHz, chloroform-d) δ 6.45–6.24 (m, 2H), 6.13 (dd, J = 15.1, 9.7 Hz, 1H), 5.96 (d, J = 9.8 Hz, 1H), 5.62 (dd, J = 15.1, 8.6 Hz, 1H), 5.48–5.37 (m, 1H), 5.30 (d, J = 5.9 Hz, 1H) ,5.20(s,1H),5.14(q,J=5.9Hz,1H),4.14(d,J=6.5Hz,1H),3.88-3.72(m,3H),3. 72-3.65(m,2H),3.62-3.56(m,2H),3.50-3.47(m,1H),3.45-3.38(m,5H),3.33(s ,3H),3.28-3.04(m,6H),3.04-2.89(m,2H),2.89-2.71(m,1H),2.71(d,J=5.6Hz, 1H),2.34-2.21(m,4H),2.14-2.08(m,1H),2.07-1.98(m,2H),1.97-1.83(m,3H), 1.82(m,1H),1.77-1.69(m,7H),1.63-1.48(m,4H),1.44-1.37(m,3H),1.34-1.18 (m,5H),1.14-1.09(dd,J=6.8,2.9Hz,4H),1.08-0.83(m,14H),0.75-0.64(m,1H).
[0317] The fractions containing the product were examined by LCMS. The fractions with the highest purity from the second elution peak were combined and concentrated to give compound 3 (0.085 g, 0.077 mmol, 7.39%) as a white solid.
[0318] Compound 3: ESIMS[M+NH4] + 1064.7, [MH] - 1046.1.
[0319] HRMS: Experimental value of C55H86N2O15SNa: 1069.5630.
[0320] 1 ¹H NMR (400MHz, chloroform-d) δ 6.39 (dd, J = 14.7, 10.8 Hz, 1H), 6.22 (dd, J = 14.7, 10.6 Hz, 1H), 6.07 (dd, J = 14.9, 10.6 Hz, 1H), 6.00 (d, J = 10.8 Hz, 1H), 5.41 (dt, J = 10.0, 1.5 Hz, 1H). 5.33(dd,J=14.9,9.8Hz,1H),5.23-5.17(m,1H),5.00(m,1H),4.59-4.51(m,2H),4. 27(m,1H),4.04-3.94(m,2H),3.81-3.72(m,1H),3.69(m,2H),3.63-3.49(m,3H),3. 43(s,3H),3.32(s,3H),3.28-2.89(m,6H),2.68(dd,J=17.4,6.4Hz,1H),2.55-2.23 (m,8H),2.19(d,J=16.0Hz,1H),2.05-1.97(m,2H),1.92-1.77(m,5H),1.76-1.68(m ,6H),1.68-1.58(m,4H),1.57-1.47(m,2H),1.47-1.34(m,2H),1.33-1.20(m,3H),1 .16-1.10(m,1H),1.04(t,J=6.5Hz,7H),0.99-0.84(m,11H),0.64(q,J=12.0Hz,1H).
[0321] Example 3. Synthesis of Compound 4
[0322]
[0323] In a reaction flask, rapamycin (0.464 g, 0.508 mmol) and 1,4-butanesulfonamide (0.892 g, 6.60 mmol) were combined. The solids were dissolved in anhydrous dichloromethane (2.5 mL). TsOH (9.65 mg, 0.051 mmol) was added in a single dose. The reaction was stirred at room temperature for three hours.
[0324] The reaction mixture was diluted with saturated aqueous NaHCO3 and extracted four times with EtOAc. The organic extracts were combined, dried over Na2SO4, filtered through diatomaceous earth under vacuum, and concentrated to give an orange-yellow solid crude product (approximately 1.2 g).
[0325] The crude product was purified by silica gel rapid column chromatography (0-70% acetone-heptane, Isco CombiFlash gradient elution, 40 g RediSep GOLD silica column, TLC with 50% acetone-heptane, visible under UV) to give compound 4 as a yellow solid (0.060 g, 0.056 mmol, 11.0% yield).
[0326] Compound 4: ESIMS[M+NH4] + 1037.7, [MH] - 1015.7.
[0327] HRMS: Experimental value of C54H84N2O14SNa: 1039.5544.
[0328] 1H NMR (600MHz, chloroform-d) δ6.38(dd,J=14.8,10.8Hz,1H),6.22(dd,J=14.8,10.6Hz,1H),6.07(dd,J =15.0,10.6Hz,1H),5.96(d,J=10.8Hz,1H),5.37(d,J=10.1Hz,1H),5.33(dd,J=15.0,9.9Hz, 1H),5.19(d,J=5.6Hz,1H),5.06(dt,J=9.7,4.4Hz,1H),4.84-4.78(m,1H),4.30(t,J=2.4Hz, 1H),4.18(s,1H),4.07(m,1H),4.03(m,1H),3.66(d,J=13.9Hz,1H),3.39(s,3H),3.37-3.29(m ,5H),3.22(dq,J=10.1,6.6Hz,1H),3.16-3.12(m,1H),3.09-3.04(m,1H),3.02-2.97(m,2H), 2.96-2.89(m,1H),2.69(dd,J=17.7,5.5Hz,1H),2.45-2.38(m,2H),2.33-2.16(m,5H),2.04- 1.94(m,2H),1.82(s,3H),1.81-1.68(m,8H),1.65-1.59(m,7H),1.56-1.42(m,4H),1.41-1.2 0(m,5H),1.13-0.96(m,9H),0.93(dd,J=8.9,6.6Hz,6H),0.88(m,3H),0.57(q,J=11.9Hz,1H).
[0329] Example 4. Biological assays and data
[0330] The activity of the compounds according to this disclosure was evaluated using the following in vitro methods.
[0331] Pharmacological characterization
[0332] Materials and Methods
[0333] Cell-based assays for determining the potency of rapamycin analogs. The potency of rapamycin analogs was determined using an assay based on MEF TSC1- / - cells. MEF TSC1- / - cells are mouse embryonic fibroblasts deficient in the tuberous sclerosis complex 1-TSC1, which negatively regulates mTORC1 signaling and thus exhibits constitutive mTORC1 activation, leading to phosphorylation (activation) of downstream molecules. This cell-based assay was used to measure the inhibitory effect (dephosphorylation) of rapamycin analogs or other mTOR inhibitors on S6 and 4EBP1.
[0334] MEF TSC1- / - cells were plated on poly-D-lysine-coated 384-well Griener clear plates and incubated overnight at 37°C and 5% CO2. The next day, cells were washed eight times with "Hard Starve" solution (1 L DPBS + 1 g D-(+) glucose + 10 ml 7.5% sodium bicarbonate + 20 ml 1 M HEPES) and incubated for another 2 hours in the same solution. Cells were then treated with a gradually decreasing concentration of the compound (8-point dilution, 3.16-fold dilution) and incubated for 2 hours at 37°C and 5% CO2. Cells were fixed with 4% paraformaldehyde for 30 min, washed five times with TBS-EDTA, and then immunostained with antibodies labeled with fluorescent markers targeting pS6 (Ser240 / 244) (Cell Signaling #9468) and p4EBP1 (Thr 37 / 46) (Cell Signaling #5123). Cell nuclei were visualized using Hoechst (Thermo Fisher Scientific #H3570) staining. Cells were imaged using their respective fluorescence channels (InCell 600) and analyzed via pS6 IC50. 50 (nM) defines the potency of mTOR inhibitors.
[0335] FKPB12 knockout 293T cell generation. 4D-Nucleofector TM The X kit (Lonza, V4XC-2032) was used to deliver a ribonucleoprotein complex containing a guide RNA (gRNA) sequence targeting FKBP12 (GCCACTACTCACCGTCTCCT (SEQ ID NO:1)) into 293T cells using a CRISPR / Cas9 system. Cell clones were screened by Western blotting with an anti-FKBP12 antibody (Novus, NB300-508), and single clones exhibiting complete FKBP12 knockout (no measurable FKBP12) were selected.
[0336] Wild-type (WT) and FKBP12 knockout 293T cells were treated with RAD001 and Compound 1. WT and FKBP12 knockout 293T cells were seeded at a density of 30,000 cells per well in DuPont modified Eagle's medium (Thermo Fisher Scientific, #11995-065) supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, #16140-071) in poly-D-lysine-coated 96-well plates (Corning, #354461). Cells were incubated at 37°C and 5% CO2 for 48 hours until they reached approximately 80% confluence. Cells were treated in duplicate with RAD001 and Compound 1 at 12-point dose ranges from 1000 nM to 0.0033 nM at 37°C for 2 hours. Medium supplemented with blank dimethyl sulfoxide (DMSO) was used as a control for both compounds. According to the manufacturer's protocol, the amount of phosphorylated S6K1 (Thr389) was detected using a sandwich ELISA kit (Cell Signaling, Inc., #7063C).
[0337] SPR assay for determining the binding affinity to FK506-binding protein (FKBP).
[0338] FKBP fusions of FKBP12, FKBP51, and FKBP52, labeled with N-terminus avi-his6 (“his6” disclosed as SEQ ID NO:2), were expressed in *E. coli* and purified using standard chromatography. Each protein was then immobilized on a strepto-antibiotic chip in a Biacore 8K SPR instrument (GE Healthcare). Using single-cycle kinetics, composite titrations were performed at 45 μL / min across each surface in a buffer containing 50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT / 2% DMSO, with a 2-minute associative phase and a 30-minute dissociation phase. Data were fitted using low molecular weight (LMW) single-cycle kinetics. The equilibrium dissociation constant (K0) is reported. D ).
[0339] Different pharmacology of rapamycin analogs can be achieved in different cell or tissue types, depending on 1) the relative abundance of FKBP homologs in these cells / tissues, and 2) the specificity of rapamycin analogs binding to these different FKBP homologs (Mol. Cell Biol. [Molecular and Cell Biology], (2013) 33: 1357-1367).
[0340] result
[0341] The in vitro potency of the mTOR inhibitor was determined by pS6 IC50 in MEF TSC1- / - cells targeting the compounds disclosed herein. 50 (nM)(Table 1) definition.
[0342] Table 1
[0343] compound IC50(nM) Rapamycin 0.050 RAD001 0.050 1 1.36 2 22.5 3 8.3 4 3.4
[0344] The IC50 value is calculated as the average of multiple measurements.
[0345] The equilibrium dissociation constants (K) of FKBP12, FKBP51 and FKBP52 of the compounds disclosed herein D The results are listed in Table 2.
[0346] Table 2
[0347]
[0348] The inhibition of mTORC1 by compound 1 is particularly dependent on FKBP12, while other FKBPs besides FKBP12 may enhance the effect of RAD001.
[0349] Phosphorylation of S6K1 (Thr389) was measured in wild-type and FKBP12 knockout 293T cells treated with compound 1 or RAD001. S6K1 is a downstream target of mTORC1, and phosphorylation at its rapamycin analog-sensitive Thr389 site was used as a functional readout of mTORC1 activity (Lee, CH, Inoki, K. and Guan, KL (2007). mTOR pathway as a target in tissue hypertrophy. [mTOR pathway as a target in tissue hypertrophy] Annu. Rev. Pharmacol. Toxicol. [Annual Review of Pharmacology and Toxicology] 47, 443-467). In wild-type 293T cells, both compound 1 and RAD001 inhibited S6K1 (Thr389) phosphorylation by approximately 70%-80%. Figure 1A In the absence of FKBP12, compound 1 no longer inhibited the phosphorylation of S6K1 (Thr389) at any tested concentration, while RAD001 showed an inhibition of up to approximately 50% against S6K1 (Thr389), demonstrating that RAD001 can function through other FKBPs besides FKBP1, while compound 1 requires FKBP12 for its activity. Figure 1B ).
[0350] Without being bound by theory, these results indicate that the mTORC1 inhibition of compound 1 is mediated solely through FKBP12; that is, compound 1 is highly selective for FKBP12, and therefore mTORC1 inhibition requires FKBP12. Conversely, in the case of RAD001, other FKBPs besides FKBP12 enhanced its ability to inhibit mTORC1. Based on the high specificity of compound 1 for FKBP12, the pharmacological action of compound 1 may be selective for cells in which FKBP12 is the major homolog and in which FKBP12 is expressed at sufficient levels, while avoiding mTORC1 inhibition in cells with low (insufficient) FKBP12 expression.
[0351] Having described several aspects of various embodiments, it should be understood that various changes, modifications, and improvements will readily occur to those skilled in the art. These changes, modifications, and improvements are intended to be part of this disclosure and are intended to fall within the spirit and scope of this disclosure. Therefore, the foregoing description and drawings are merely illustrative.
Claims
1. A compound having formula (I) or a pharmaceutically acceptable salt thereof, wherein: (I) R 1 Choose from the group consisting of: hydrogen and hydroxyl C. 1-6 Alkyl; and R 2 yes , where n is 1, 2 or 3.
2. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R 1 Choose free hydrogen and A group that is formed.
3. The compound of claim 1 or 2 or a pharmaceutically acceptable salt thereof, wherein R2 is .
4. The compound of claim 1 or 2 or a pharmaceutically acceptable salt thereof, wherein R2 is .
5. A compound having the following structural formula: Or its pharmaceutically acceptable salt.
6. A compound having the following structural formula: Or its pharmaceutically acceptable salt.
7. A compound having the following structural formula: Or its pharmaceutically acceptable salt.
8. A pharmaceutical composition comprising a therapeutically effective amount of any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.
9. A pharmaceutical combination comprising a therapeutically effective amount of any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, and one or more therapeutically active agents.
10. Use of a therapeutically effective amount of any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of claim 8, or a pharmaceutical composition of claim 9, in the preparation of a medicament for treating, in a subject in need, a disorder or disease mediated by the mTORC1 pathway.
11. Use of a therapeutically effective amount of any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 8, or the pharmaceutical composition of claim 9, in the preparation of a medicament for treating a disease or disorder in a subject in need, wherein the target tissue, organ, or cell associated with the pathology of said disease or disorder has an FKBP12 level sufficient to inhibit mTORC1.
12. Use of a therapeutically effective amount of any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 8, or the pharmaceutical composition of claim 9, in the preparation of a medicament for treating a disease or disorder in a subject in need, wherein the subject has, or the subject has been determined to have, an FKBP12 level sufficient to inhibit mTORC1.
13. The use according to any one of claims 10 to 12, wherein the disease or disorder is selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy, arteriosclerosis, emphysema, cataracts, macular degeneration, glaucoma, cerebrovascular disease, chronic kidney disease, impaired liver function, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, infections due to decreased immune function, chronic obstructive pulmonary disease, obesity, loss of taste, loss of smell, arthritis, and complications of diabetes.
14. The use of claim 13, wherein the impairment is liver fibrosis, atherosclerosis, osteoporosis, osteoarthritis, hypertension, stroke, type II diabetes, autoimmune hepatitis, cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or dilated cardiomyopathy, cardiac dysfunction leading to reduced ejection fraction, carcinogenic immunosenescence due to reduced immune surveillance, diabetic nephropathy, or diabetic blindness and neuropathy.
15. Use of a therapeutically effective amount of any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of claim 8, or a pharmaceutical combination of claim 9, in the preparation of a medicament for treating, in a subject of need, a disease or disorder mediated by the mTORC1 pathway, wherein said disorder or disease is selected from: - Acute or chronic organ or tissue transplant rejection; - Transplant vascular disease; - Leading to thickening of the vascular intima, vascular occlusion, obstructive coronary atherosclerosis, restenosis, and smooth muscle cell proliferation and migration; - Autoimmune diseases; -asthma; -Multidrug resistance; -Inflammation; -Infect; - Age-related diseases; - Neurodegenerative diseases; - Proliferative disorders; - Seizures and disorders associated with seizures; and - Mitochondrial myopathy and mitochondrial stress.
16. The use of claim 15, wherein the obstacle is an obstacle including fibrosis and / or inflammatory processes, or fungal infection, or cancer.
17. The use of claim 16, wherein the disorder is selected from liver and kidney disorders.
18. The use of claim 17, wherein the liver disorder is selected from: liver fibrosis occurring in end-stage liver disease; cirrhosis; toxic liver failure; non-alcoholic steatosis; and alcoholic steatosis.
19. The use of claim 17, wherein the liver disorder is NASH.
20. The use according to claim 17, wherein the renal disorder is renal fibrosis.
21. The use of claim 20, wherein the renal fibrosis occurs as a result of acute kidney injury.
22. The use of claim 17, wherein the renal impairment is a chronic renal impairment.
23. The use according to claim 17, wherein the renal disorder is diabetic nephropathy.
24. Use of a therapeutically effective amount of any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of claim 8, or a pharmaceutical composition of claim 9, in the preparation of a medicament for treating, in a subject of need, an age-related disorder or disease mediated by the mTORC1 pathway, wherein said disorder or disease is selected from: sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy, arteriosclerosis, emphysema, cataracts, macular degeneration, glaucoma, cerebrovascular disease, chronic kidney disease, diabetes-related kidney disease, impaired liver function, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, infections due to decreased immune function, chronic obstructive pulmonary disease, obesity, loss of taste, loss of smell, and arthritis.
25. The use of claim 24, wherein the disorder or disease is selected from atherosclerosis, osteoporosis, osteoarthritis, hypertension, stroke, liver fibrosis, autoimmune hepatitis, cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or dilated cardiomyopathy, cardiac dysfunction leading to reduced ejection fraction, carcinogenic immunosenescence due to reduced immune surveillance, and type II diabetes.
26. Use in the preparation of a medicament for treating mTORC1-mediated cancer in subjects in need of a therapeutically effective amount of any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of claim 8, or a pharmaceutical composition of claim 9.
27. The use of claim 26, wherein the method further comprises a PD-1 / PDL-1 inhibitor.
28. The use according to claim 26 or 27, wherein the cancer is selected from kidney cancer, colorectal cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and cervical cancer.
29. The use according to claim 26 or 27, wherein the cancer is selected from renal cell carcinoma, uterine sarcoma, endometrial carcinoma, and fibrosarcoma.
30. Use of the compound of any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 8, or the pharmaceutical combination of claim 9, in the preparation of a medicament for treating a disorder or disease mediated by the mTORC1 pathway, including fibrotic or inflammatory processes.
Citation Information
Patent Citations
Boiler stay-bolt.
US1137433A
Rapamycin and process of preparation
US3929992A
Enhanced treatment regimens using mTOR inhibitors
US9669032B2
Rapamycin derivatives
WO2019064182A1