Liver-specific inducible promoters and methods of use thereof

Abstract

The present invention relates to inducible regulatory elements, promoters and vectors, in particular gene therapy vectors, and methods of use thereof.

Description

Technical Field

[0001] This invention relates to liver-specific inducible promoters and vectors, particularly gene therapy vectors containing them, and methods of using them. Background Technology

[0002] The following discussion is provided to help readers understand this disclosure and does not constitute any admission of the content or relevance of prior art.

[0003] The metabolism of hepatic microsomal cytochrome P450 enzymes (CYPs) plays a crucial role in the detoxification of exogenous chemicals such as drugs and environmental pollutants. Gene transcription induced by exposure to xenochemicals is a characteristic of CYPs, enhancing the organism's defenses against toxicity and carcinogenicity. Based on the discovery of PB induction of the CYP2B gene, PB has become a prototype of a large group of structurally and functionally diverse xenochemicals that induce the CYP2B gene. A 51 bp element, the PB response enhancer module (PBREM), was identified in mouse Cyp2b10 and rat CYP2B1, and a nearly identical DNA element was identified in rat CYP2B2. A PBREM sequence has also been found in humans, associated with CYP2B6. The nuclear receptor heterodimer CAR-RXR has been identified as the transactivator of PBREM. (See Negishi et al., "The Repressed Nuclear Receptor CAR Responds to Phenobarbital in Activating the Human CYP2B6 Gene"; J. Biol. Chem 1999, 274:6043-6046).

[0004] In many fields, including gene therapy, there is a desire to provide regulatory nucleic acid sequences that can drive gene expression to produce protein or nucleic acid expression products in desired cells, tissues, or organs.

[0005] Gene expression in the liver is of particular interest because it involves a wide range of fundamental functions in the body, including the synthesis of many proteins involved in metabolism, hemostasis, and infection prevention. Given that many diseases are associated with disruptions in gene expression in the liver, there is great interest in developing gene therapy strategies that allow transgenes to be expressed in the liver to produce therapeutic expression products. Examples of liver diseases associated with abnormal gene expression include hemophilia (including hemophilia A or B), familial hypercholesterolemia, ornithine transcarbamate deficiency, alpha-antitrypsin deficiency, hepatitis virus infection, nonviral hepatitis, liver cancer, and various other liver diseases such as nonalcoholic fatty liver disease (NAFLD) and alcoholic liver disease (ARLD).

[0006] A major challenge in using gene therapy to treat liver diseases is providing the ability to express liver-specific (also known as liver-specific) therapeutic genes. Targeting mammalian hepatocytes is known by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein. Adenovirus vectors have been reported to primarily target the liver in mice. However, they can also infect other tissues, particularly the lungs and skeletal muscle, leading to “off-target” effects. Certain forms of adeno-associated virus vectors (AAV) or lentiviral vectors preferentially transduce hepatocytes, but off-target effects can also occur.

[0007] Therefore, there is a need for systems that regulate gene expression in a liver-specific manner. Ideally, such systems should be highly specific to the liver (thus avoiding or minimizing off-target expression in non-target tissues) and also powerful enough to drive high expression levels in the liver. The use of cis-acting regulatory elements has been proposed to provide both specificity and activity. Typically, this involves cis-regulatory enhancer sequences, i.e., nucleic acid sequences that increase promoter activity cis-actingly. Enhancers are generally active regardless of their orientation; in some cases, they can function at a distance of several thousand bases from the promoter, although they typically function even closer to the promoter.

[0008] It is also desirable to provide a gene expression induction system that can induce gene expression as needed. Inducibility refers to the ability to induce the expression of therapeutic gene expression products when required. Furthermore, if the induction is dose-dependent, the expression level of the therapeutic gene expression product can be modulated by adjusting the amount of inducer administered.

[0009] Therefore, regulatory sequences are needed in many cases to control gene expression, especially in therapeutic gene expression, such as in gene therapy. In particular, there is a need to provide regulatory sequences for inducible gene expression. Providing regulatory sequences for inducible gene expression in the liver is of particular interest. Summary of the Invention

[0010] In a first aspect, the present invention provides a gene therapy vector comprising an expression cassette including a synthetic liver-specific inducible promoter operatively linked to a gene, the synthetic liver-specific inducible promoter including a cis-regulatory element (CRE) capable of being bound and activated by heterodimers of CAR and RXR.

[0011] Constitutive androstanyl receptors (CARs) are members of the nuclear receptor superfamily and are key regulators of both xenobiotic and endobiotic metabolism. Unlike most nuclear receptors, CARs possess constitutive activity in the absence of a ligand and are regulated by agonists and inverse agonists. Activation leads to the translocation of the CAR from the cytoplasm to the nucleus, where the protein can bind to specific DNA sites (called response elements). Binding occurs both as a monomer and in conjunction with the retinoid X receptor (RXR), resulting in either activation or repression of target gene transcription.

[0012] The retinoid X receptor (RXR) is a member of the nuclear receptor superfamily and is activated by 9-cis-retinoic acid and 9-cis-13,14-dihydro-retinoic acid.

[0013] When CAR is activated (through direct or indirect activation), it translocates to the cell nucleus, where CAR and RXR form a heterodimer (referred to herein as "CAR-RXR heterodimer" or "CAR-RXR"), which can bind to an activating gene containing the appropriate target sequence.

[0014] As described above, CAR-RXR binds to and induces target genes via a so-called PB response enhancer submodule (PBREM). Therefore, in some preferred embodiments of the invention, the CREs that can be bound and activated by CAR-RXR heterodimers contain PBREM elements or functional variants thereof.

[0015] The mouse PBREM sequence is shown in SEQ ID NO:1. The human PBREM sequence is shown in SEQ ID NO:2. In some embodiments of the present invention, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises a functional variant of SEQ ID NO:1 or SEQ ID NO:2, or a functional variant of SEQ ID NO:1 or SEQ ID NO:2, or a functional variant of SEQ ID NO:1 or SEQ ID NO:2. Therefore, in some embodiments, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises a PBREM element or a functional variant thereof, or is composed of a PBREM element or a functional variant thereof.

[0016] The sequences and alignments of mouse and human PBREM elements are shown below, with the so-called NR1 motif underlined, the NH1 motif in italics, and the NR2 motif in bold (SEQ ID NO is shown in parentheses):

[0017]

[0018] PBREM is a 51-bp DNA inducible enhancer composed of two nuclear receptor DR4 motifs (NR1 and NR2) flanking the NF1 binding site. This alignment shows that the NR1 motif exhibits very high sequence conservation between mouse and human PBREMs. The 16-bp NR1 motif of human PBREM differs from the mouse NR1 motif by only one base, making NR1 the most conserved sequence between human and mouse PBREM elements. The literature suggests that the NR1 sequence is the binding site for the CAR-RXR heterodimer, with the remaining sequences being partially or completely redundant. The triplet repeat of NR1 was demonstrated to be both maintained and inducible in Sueyoshi et al. (J. BIOL. CHEM. Vol. 274, 10, pp. 6043-6046, 1999). However, it is believed that portions other than NR1 may play a role in making PBREM elements more specific and inducible (e.g., reducing background, constitutive expression, and allowing for greater induction).

[0019] Therefore, CREs capable of being bound and activated by CAR-RXR heterodimers suitably contain at least one NR1 motif. Suitably, the NR1 motif comprises the sequence TGTACT-X-TGACC[C / T] (SEQ ID NO:#) or consists of the sequence TGTACT-X-TGACC[C / T] (SEQ ID NO:#), where X represents any sequence of 3-6 nucleotides in length (preferably 4-5 nucleotides, suitably 4 nucleotides). In some preferred embodiments, X comprises the sequence TTCC, and suitably comprises or consists of the sequences TTCC or TTTCC. When a nucleotide is shown in square brackets, it indicates that one of the nucleotides indicated within the square brackets is present at that location.

[0020] In some embodiments, the NR1 motif comprises the sequence TGTACTTTCCTGACCN (SEQ ID NO:20) (e.g., TGTACTTTCCTGACCT (SEQ ID NO:3) or TGTACTTTCCTGACCC (SEQ ID NO:4)) or a sequence different from the sequence TGTACTTTCCTGACCN (SEQ ID NO:20) at no more than two, preferably no more than one nucleotide position, or is composed of the sequence TGTACTTTCCTGACCN (SEQ ID NO:20). Preferably, the functional variant of the PBREM element comprises the sequence CTGTACTTTCCTGACCN (SEQ ID NO:21) (e.g., CTGTACTTTCCTGACC[T / C] (SEQ ID NO:22), i.e., CTGTACTTTCCTGACCT (SEQ ID NO:23) or CTGTACTTTCCTGACCC (SEQ ID NO:24)), or a sequence different from the sequence SEQ ID NO:21 at no more than two, preferably no more than one nucleotide position; this sequence includes the conserved C at the 5' of the NR1 sequence in human and mouse PBREMs, as shown above. Suitable, functional variants of the PBREM sequence comprise the sequence NCTGTACTTTCCTGACCNTG (SEQ ID NO:25) (e.g., [T / A]CTGTACTTTCCTGACC[C / T]TG (SEQ ID NO:26), TCTGTACTTTCCTGACCTTG (SEQ ID NO:27), or ACTGTACTTTCCTGACCCTG (SEQ ID NO:28)), or a sequence different from sequence SEQ ID NO:25 at no more than two, preferably no more than one, nucleotide positions; as described above, this sequence comprises two nucleotides located at 5' and 3' of the human and mouse PBREM NR1 sequence. When N is present in the nucleic acid sequence herein, it represents any nucleotide. When a nucleotide is shown in square brackets, it indicates that one of the nucleotides indicated in the square brackets is present at that position.

[0021] In some implementations, functional variants of the PBREM element suitably include two or more, or three or more, operatively connected sequences containing NR1 motifs.

[0022] Therefore, in some embodiments, a CRE capable of being bound and activated by a CAR-RXR heterodimer suitably comprises two or more, preferably three or more, operatively linked NR1 motifs. In some embodiments, NR1 motifs may be provided adjacent to each other (e.g., tandemly), and they may be adjacent to each other or separated by spacers. Thus, a CRE capable of being bound and activated by a CAR-RXR heterodimer suitably comprises the general structure NR1-S-NR1, where NR1 represents any NR1 motif discussed herein, and S represents an optional spacer. When a spacer is present, it can have any sequence and any suitable length, such as 2 to 50, 3 to 40, 4 to 30, 5 to 20, 6 to 10, 7 to 9, or 8 nucleotides.

[0023] In some embodiments of the present invention, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises or is composed of a functional variant of the PBREM sequence, wherein the functional variant of the PBREM sequence comprises one of the following sequences:

[0024] -[TGTACTTTCCTGACCN-S-] n (SEQ ID NO:29);

[0025] -[CTGTACTTTCCTGACCN-S-] n (SEQ ID NO:30);

[0026] -[NCTGTACTTTCCTGACCNTG-S-] n (SEQ ID NO:31),

[0027] Where S is an optional spacer, and n is 1-5, optionally 2-4, and preferably 3. Therefore, functional variants of the PBREM sequence can comprise polymers containing the NR1 motif sequence. Various preferred NR1 motifs have been discussed above, and they can certainly be used in this embodiment. In some embodiments, n is 1 to 10, 1 to 6, or 2 to 4. In some embodiments of the invention, n is 3.

[0028] In some preferred embodiments, the spacer is present between adjacent sequences containing the NR1 motif. When a spacer is present, it can be of any suitable length, such as 2 to 50, 3 to 40, 4 to 30, 5 to 20, 6 to 10, 7 to 9, or 8 nucleotides.

[0029] In some embodiments of the present invention, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises or is composed of a functional variant of the PBREM sequence, wherein the functional variant of the PBREM sequence comprises one of the following sequences:

[0030] -TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN (SEQ ID NO: 32);

[0031] -TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN (SEQ ID NO: 33);

[0032] -CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN (SEQ ID NO: 34);

[0033] -CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN (SEQ ID NO: 35);

[0034] -NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG (SEQ ID NO: 36); and

[0035] -NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG(SEQ ID NO:37),

[0036] Where S is an optional spacer. When a spacer is present, it can be of any suitable length, for example, 2 to 50, 3 to 40, 4 to 30, 5 to 20, 6 to 10, 7 to 9, or 8 nucleotides. Various preferred NR1 motifs have been discussed above, and they can certainly be used in this embodiment.

[0037] In some embodiments of the invention, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises or is composed of a functional variant of the PBREM sequence, wherein the functional variant of the PBREM sequence suitably comprises one of the following sequences:

[0038] -TCTGTACTTTCCTGACCTTG-S-TCTGTACTTTCCTGACCTTG-S-TCTGTACTTTCCTGACCTTG (SEQ ID NO: 38); or

[0039] -ACTGTACTTTCCTGACCCTG-S-ACTGTACTTTCCTGACCCTG-S-ACTGTACTTTCCTGACCCTG (SEQ ID NO: 39),

[0040] As mentioned above, S is an optional spacer.

[0041] In some cases, the spacer may have the sequence GATCGATC (SEQ ID NO:40), but any other suitable spacer sequence may be used.

[0042] In other embodiments of the invention, the CREs capable of being bound and activated by the CAR-RXR heterodimer include each of the NR1, NF1, and NR2 elements. Suitably, they are present in the order NR1-NF1-NR2. The NR1 element suitably comprises or consists of the sequence described above. The NF1 element suitably comprises the sequence TGGCACAGTGCCA (SEQ ID NO:55) or TGAAGAGGTGGCA (SEQ ID NO:56), or a sequence differing from SEQ ID NO:55 or 56 by 7 or fewer nucleotides (e.g., 6, 5, 4, 3, 2, or 1 nucleotide), or consists of the sequence TGGCACAGTGCCA (SEQ ID NO:55) or TGAAGAGGTGGCA (SEQ ID NO:56), or a sequence differing from SEQ ID NO:55 or 56 by 7 or fewer nucleotides (e.g., 6, 5, 4, 3, 2, or 1 nucleotide). The NR2 element suitably comprises the sequence TCAACTTGCCTGACAC (SEQ ID NO:57) or TGGACTTTCCTGAACC (SEQ ID NO:58), or a sequence differing from SEQ ID NO:57 or 58 by 5 or fewer nucleotides (e.g., 4, 3, 2 or 1 nucleotides), or is composed of the sequence TCAACTTGCCTGACAC (SEQ ID NO:57) or TGGACTTTCCTGAACC (SEQ ID NO:58), or a sequence differing from SEQ ID NO:57 or 58 by 5 or fewer nucleotides (e.g., 4, 3, 2 or 1 nucleotides).

[0043] In some embodiments of the invention, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises or is composed of functional variants of the PBREM sequence, said functional variant containing at least 60% sequence identity with SEQ ID NO:1 or SEQ ID NO:2, preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with SEQ ID NO:1 or SEQ ID NO:2. Mouse PBREM (SEQ ID NO:1) and human PBREM (SEQ ID NO:2) share 71% identity in their full length (i.e., 51 nucleotides). Mouse PBREM retains function in human cells, while human PBREM retains function in mouse cells. Therefore, this overall level of sequence difference across PBREM elements is at least tolerable.

[0044] However, as mentioned above, there is a very high level of conservation in the NR1 motif; therefore, it is generally preferred that the functional variant of the PBREM sequence contains at least 90%, preferably at least 95%, and more preferably completely identical sequences to the sequences TCTGTACTTTCCTGACCTTG (SEQ ID NO:27) or ACTGTACTTTCCTGACCC TG (SEQ ID NO:28), and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical sequences to the remainder of SEQ ID NO:1 or SEQ ID NO:2. Preferably, the total sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to SEQ ID NO:1 or SEQ ID NO:2.

[0045] Therefore, in a preferred embodiment, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises or is composed of a functional variant of the PBREM sequence, said functional variant comprising at least 90%, preferably at least 95%, more preferably identical to SEQ ID NO:1 or SEQ ID NO:2 in the region spanning nucleotides 3 to 18 (preferably spanning nucleotides 1 to 20), and at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to the remainder of SEQ ID NO:1 or SEQ ID NO:2 (i.e., nucleotides 1, 2, and 19 to 51, or nucleotides 21 to 51). The nucleotides are, of course, referenced to SEQ ID NO:1 or SEQ ID NO:2. Preferably, the total sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to SEQ ID NO:1 or SEQ ID NO:2.

[0046] In some preferred embodiments of the present invention, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises or consists of the following sequences:

[0047] NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO:41), or a sequence that is at least 90%, preferably 9.5%, more preferably 99% identical to it. In this case, identity is calculated relative to a specifically defined nucleotide rather than an undefined “Ns”. Functional variants of the PBREM sequence in which one or more nucleotides identified as N are deleted are particularly considered as part of such embodiments of the invention, for example, in which up to 7, 6, 5, 4, 3, 2, or 1 nucleotide labeled N are deleted. Furthermore, functional variants of the PBREM sequence with the insertion of one or more nucleotides are particularly considered as part of these embodiments of the invention, for example, with the insertion of up to 7, 6, 5, 4, 3, 2, or 1 nucleotide. As a specific example, a rat PBREM element from the CYP2B2 gene includes a T inserted between T and C at positions 10-11, i.e., within the NR1 motif of the PBREM element. Substitution, deletion, or insertion of nucleotides outside the NR1 motif may be well tolerated.

[0048] In some cases, functional variants of PBREM sequences that are more similar to wild-type mouse or human PBREM elements (SEQ ID NO:1 or SEQ ID NO:2) are preferred because they are believed to exhibit particularly desirable properties of low background expression and high inducibility levels. This property is generally ideal when background expression of the gene provided in the vector of the present invention is kept to a minimum, i.e., when no induction of expression occurs.

[0049] In some embodiments of the invention, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises or consists of a portion of a PBREM element from each of two or more different species (suitably from two or more different genera, e.g., two different mammals). Such an element may be referred to as a “hybrid PBREM element.” A heterozygous PBREM element typically comprises all the motifs (i.e., NR1, NF1, and NR2 motifs) of a wild-type PBREM element, but these motifs originate from two or more different species. In some embodiments, the heterozygous PBREM element comprises a portion (e.g., NR1, NF1, and NR2 motifs) from a first species, and a corresponding portion (e.g., the corresponding NR1, NF1, and NR2 motifs) from a second species. As a non-limiting example, a heterozygous PBREM element may comprise portions (e.g., NR1, NF1, and NR2 motifs) of primate (e.g., human) and rodent (e.g., mouse) PBREM elements. For example, a heterozygous PBREM element may contain an NR1 motif from primates (e.g., humans) and an NR2 motif from rodents (e.g., mice), or an NR1 motif from rodents (e.g., mice) and an NR2 motif from primates (e.g., humans). The NR1 and NR2 motifs from primates or rodents may also be combined with the NF1 motif of the corresponding species.

[0050] In some embodiments, the hybrid PBREM element comprises one of the following combinations of PBREM motifs: hNR1-mNF1-hNR2, hNR1-mNF1-mNR2, mNR1-hNF1-mNR2, or mNR1-hNF1-hNR2 (where “h” represents a human motif and m represents a mouse motif). Exemplary hybrid PBREM element sequences are underlined in SEQ ID Nos: 61 to 64 of Table 3; functional variations of these sequences may of course be used, such as sequences having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the underlined hybrid PBREM element sequences in SEQ ID Nos: 61 to 64, optionally having a higher level of identity in the NR1 motif, as described above.

[0051] As described above, and not wishing to be bound by theory, the induction of gene expression by a PBREM element or its variants is considered to depend on the binding of a CAR-RXR heterodimer to it. The ability of any given CRE that can be bound and activated by a CAR-RXR heterodimer (e.g., a variant of a PBREM element) to function as desired—that is, to be induced in the same manner as a wild-type mouse or human PBREM element, although not necessarily to the same degree—can be readily determined experimentally. For example, a variant CRE can be inserted into the construct described in the following examples in place of SEQ ID NO:1, and the ability of the construct to be induced when SEQ ID NO:1 is included can be compared. For example, as described in Example 2, a variant CRE can be provided in place of SEQ ID NO:1 in the PB1-MinTK construct and tested in hepatocytes, preferably primary hepatocytes, such as AXOL assay-ready expanded (ARE) hepatocytes (Axol, ax3701) induced by 1 μM CITCO. Alternatively, as described in Example 4, the variant can be inserted into the pAAV-PB1-MinTk construct. Alternatively, the experimental method used in Sueyoshi, et al. (J. BIOL. CHEM. Vol. 274, 10, pp. 6043-6046, 1999) can be used, i.e., the putative PBREM variant sequence can be cloned before the tk promoter (BglII site) in the pGL3-based vector containing the firefly luciferase reporter gene (Promega) to obtain the PBREM VARIANT-tk-luciferase and reporter gene plasmid. Typically, the functional variant of CRE should provide at least 50%, preferably 75%, more preferably 80%, 85%, 90%, or 95% inducibility (measured by the fold increase in expression induced, i.e., a 2-fold increase in gene expression reported upon induction is considered 50% of a 4-fold increase in inducibility) when compared to an equivalent construct containing wild-type PBREM elements (e.g., SEQ ID NO: 1). Typically, the functional variant is expected to provide at least a 2-fold increase in induction, more preferably a 3-fold, 4-fold, 5-fold, 6-fold, or 7-fold increase, when provided in place of wild-type mouse PBREM in the PB1-MinTK construct described above and tested in hepatocytes, preferably primary hepatocytes, for example, AXOL assay-ready expanded (ARE) hepatocytes (AXOL, ax3701) induced by 1 μM CITCO, as described in Example 2 below. Compared to an equivalent construct containing wild-type mouse PBREM elements (e.g., again in the PB1-MinTK construct and tested in ARE hepatocytes), the functional variant preferably results in a background expression level of no more than three-fold, preferably no more than two-fold, and more preferably no more than 1.5-fold.

[0052] It should be noted that PBREM elements or their functional variants can exist in either orientation. Therefore, the reverse complementarity of the aforementioned PBREM elements constitutes part of this invention. It is noteworthy that human PBREM elements naturally exist in the opposite orientation compared to mouse PBREM elements, and in the study of Sueyoshi, et al. (J. BIOL. CHEM. Vol. 274, 10, pp. 6043-6046, 1999), human PBREM elements were shown to maintain function in the “opposite” orientation (i.e., the same orientation as mouse PBREM).

[0053] In some embodiments of the invention, the synthetic liver-specific inducible promoter suitably comprises a plurality of CREs, each CRE capable of being bound to and activated by heterodimers of CAR and RXR. Therefore, in some embodiments, the invention provides a synthetic liver-specific inducible promoter comprising multimers of CREs, each multimer capable of being bound to and activated by heterodimers of CAR and RXR. Alternatively, the synthetic liver-specific inducible promoter suitably comprises a cis-regulatory module (CRM) comprising a plurality of CREs, each CRE capable of being bound to and activated by heterodimers of CAR and RXR. The CREs capable of being bound to and activated by heterodimers of CAR and RXR may be the same or different from each other.

[0054] In such embodiments, the synthetic liver-specific inducible promoter suitably comprises 2-10 CREs, each CRE capable of being bound to and activated by the heterodimers of CAR and RXR. The inducible promoter suitably comprises 2-7 CREs, 2-5 CREs, 2-4 CREs, optionally 2 or 3 CREs, and in some embodiments, preferably 3 CREs, each capable of being bound to and activated by the heterodimers of CAR and RXR.

[0055] As described above, the CREs that can be bound and activated by the heterodimers of CAR and RXR are preferably PBREM elements or functional variants thereof. Therefore, in a preferred embodiment, the synthesized liver-specific inducible promoter suitably comprises 2 to 5, more preferably 2 to 4, and even more preferably 3 PBREM elements comprising SEQ ID NO:1 or SEQ ID NO:2 or functional variants thereof. Various PBREM elements and their functional variants have been discussed in detail above.

[0056] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises 2 to 4, optionally 2 or 3, operatively linked CRE copies, wherein the CRE copies comprise SEQ ID NO:1 or SEQ ID NO:2, or a functional variant of SEQ ID NO:1 or SEQ ID NO:2.

[0057] CREs that can be bound and activated by heterodimers of CAR and RXR can be separated by spacer sequences. Spacers can have any suitable length, such as 2 to 100 nucleotides, 3 to 50 nucleotides, 5 to 30 nucleotides, and 10 to 25 nucleotides. In some embodiments, the length of the spacer is a multiple of 5. Spacers of approximately 20 nucleotides in length have been found to be suitable (e.g., 18-22 nucleotides in length).

[0058] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises a CRM, which contains one or consists of one of the following sequences:

[0059] -NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN(SEQ ID NO:42); or

[0060] -NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN(SEQ ID NO:43),

[0061] Where S is an optional spacer. The spacer separates adjacent PBREM elements or functional variants thereof. The choice of spacer is as described above. In some embodiments, the spacer is approximately 20 nucleotides in length. Variants containing at least 90%, preferably 95%, more preferably 99% identical sequences to the PBREM element NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 41) are also part of the invention. In this case, identity is calculated relative to a specifically defined nucleotide rather than an undefined “Ns”. Functional variants of the PBREM sequence in which one or more nucleotides identified as N are deleted are particularly considered as part of such embodiments of the invention, for example, in which up to 7, 6, 5, 4, 3, 2, or 1 nucleotide labeled N are deleted. Furthermore, functional variants of the PBREM sequence with the insertion of one or more nucleotides are particularly considered as part of these embodiments of the invention, for example, with the insertion of up to 7, 6, 5, 4, 3, 2, or 1 nucleotide. As a specific example, rat PBREM elements derived from the CYP2B2 gene include a T inserted between the T and C at positions 10-11, i.e., within the NR1 motif of the PBREM element. Substitutions, deletions, or insertions of nucleotides outside the NR1 motif are likely to be well tolerated.

[0062] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises a CRM, which contains one or consists of one of the following sequences:

[0063] -TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 44);

[0064] -TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 45);

[0065] -ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 46); or

[0066] -ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA(SEQ ID NO:47),

[0067] Where S is an optional spacer. The choice of spacer is as described above. In some embodiments, the spacer is approximately 20 nucleotides in length.

[0068] The synthetic liver-specific inducible promoters of the present invention suitably contain little or no nucleic acid sequence that would result in constitutive expression or expression in non-hepatocytes (or, depending on the case, in cells that do not express CAR and RXR). Therefore, background expression and expression in non-hepatocytes (or cells that do not express CAR and RXR) are minimized or completely avoided.

[0069] Synthetic liver-specific inducible promoters typically contain a CRE that can be bound to and activated by a heterodimer of CAR and RXR, which is operatively linked to a minimal or proximal promoter, preferably a minimal promoter. When using a proximal promoter, it is preferably liver-specific. Generally, a minimal promoter is preferred because proximal promoters tend to drive at least some level of background expression. However, in some cases, a certain amount of background expression may be required.

[0070] The minimum promoter can be any suitable minimum promoter. A wide range of minimum promoters are known in the art. Suitable minimum promoters include, but are not limited to, the HSV thymidine kinase minimum promoter (MinTK), the CMV minimum promoter (CMVmp), and the SV40 minimum promoter (SV40mp). The minimum promoter can be a synthetic minimum promoter.

[0071] In some preferred embodiments of the invention, the synthetic liver-specific inducible promoter comprises a CRE capable of binding to and activating a heterodimer of a CAR and an RXR operatively linked to a MinTK minimal promoter. This combination has been shown to provide an ideal combination of low background expression and inducibility. Some particularly preferred embodiments comprise two or three CREs capable of binding to and activating a heterodimer of a CAR and an RXR operatively linked to MinTK; such promoters exhibit particularly strong inducibility and low background.

[0072] In some preferred embodiments of the invention, the synthetic liver-specific inducible promoter comprises a CRE capable of binding to and activating a heterodimer of CAR and RXR operably linked to the SV40 minimal promoter. This combination has been shown to provide a high level of inducibility despite an increase in background expression levels. Some particularly preferred embodiments comprise two or three CREs capable of binding to and activating a heterodimer of CAR and RXR operably linked to the minimal promoter; such promoters exhibit particularly strong inducibility.

[0073] In some preferred embodiments, the CREs capable of being bound and activated by the heterodimers of CAR and RXR are separated from the minimum or proximal promoter by a spacer sequence. The spacer sequence can have any suitable length. For example, the spacer between the CRE capable of being bound and activated by the heterodimers of CAR and RXR (or, when multiple CREs are present, the closest CRE) and the minimum or closest promoter can have a length of 10 to 200 nucleotides. Spacers of various lengths (e.g., including 20, 46, 80, and 100 nucleotides) have been successfully used in the examples listed below.

[0074] In some embodiments of the invention, the synthetic liver-specific inducible promoter comprises a sequence according to any one of SEQ ID NO:7 to 18, or a functional variant thereof. This functional variant is suitably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to any one of SEQ ID NO:7 to 18. As described above, 90%, 95%, or 99% or higher sequence identity is preferred in the region corresponding to the NR1 motif.

[0075] In some preferred embodiments of the invention, the synthetic liver-specific inducible promoter comprises a sequence according to SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or a functional variant thereof. This functional variant suitably has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with any one of SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. As mentioned above, 90%, 95%, or 99% or higher sequence identity is preferred in the region corresponding to the NR1 motif. These promoters comprise 1, 2, 3, and 4 copies of mouse PBREM linked to the MinTK minimal promoter, respectively. SEQ ID NO:10 and SEQ ID NO:11, or functional variants thereof, are particularly preferred embodiments of the invention due to their particularly desirable properties in terms of high inducibility and low background expression levels.

[0076] In some embodiments of the invention, the synthetic liver-specific inducible promoter comprises or consists of a sequence according to any one of SEQ ID NO:59 to 71 or a functional variant thereof, or is composed of a sequence according to any one of SEQ ID NO:59 to 71 or a functional variant thereof. The functional variant suitably is at least 60%, 70%, 80%, 90%, 95%, or 99% identical to any one of SEQ ID NO:59 to 71. As described above, 90%, 95%, or 99% or higher sequence identity is preferred in the region corresponding to the NR1 motif.

[0077] In some preferred embodiments of the invention, the synthetic liver-specific inducible promoter comprises a sequence according to any one of SEQ ID NO: 68, 69, 70, or 71, or a functional variant thereof. This functional variant suitably has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with any one of SEQ ID NO: 60 or 61. As described above, 90%, 95%, or 99% or higher sequence identity is preferred in the region corresponding to the NR1 motif. These promoters comprise 2x MHM or 3x human PBREM elements.

[0078] Suitablely, the expression cassette contains sequences that provide or encode one or more, preferably all, ribosome binding sites, start codons, stop codons, and transcription termination sequences. Suitablely, the expression cassette contains nucleic acids encoding post-transcriptional regulatory elements. Suitablely, the expression cassette contains nucleic acids encoding polyA elements.

[0079] The gene used in this invention typically encodes the desired gene expression product, such as a polypeptide (protein) or RNA. The gene can be a full-length cDNA or genomic DNA sequence, or any fragment, subunit, or mutant thereof, possessing at least some desired biological activity.

[0080] When a gene encodes a protein, it can be virtually any type of protein. As a non-limiting example, the protein can be an enzyme, an antibody or antibody fragment (e.g., a monoclonal antibody), a viral protein (e.g., REP, CAP, REV, VSV-G, or RD114), a therapeutic protein, or a toxic protein (e.g., caspase 3, 8, or 9).

[0081] In some preferred embodiments of the invention, the gene encodes a therapeutic expression product, preferably a therapeutic protein suitable for treating liver-related diseases or conditions. Such a gene may be referred to as a "therapeutic gene." The therapeutic expression product can be a protein, such as a secretible protein, such as a coagulation factor (e.g., factor IX or factor VIII), cytokine, growth factor, antibody or nanobody, chemokine, plasma factor, insulin, erythropoietin, lipoprotein lipase, or toxic protein. Alternatively, the therapeutic expression product can be RNA, such as siRNA or miRNA. A non-exhaustive list of the therapeutic expression products (and sequences encoding them) contemplated for use in the present invention includes: factor VIII, factor IX, factor VII, factor X, von Willebrand factor. Interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-11 (IL-11), interleukin-12 (IL-12), chemokine (CXC motif) ligand 5 (CXCL5), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), stem cell factor (SCF), keratinocyte growth factor (KGF), monocyte chemoattractant protein-1 (MCP-1), tumor necrosis factor (TN) F), afamin (AFM), α1-antitrypsin, α-galactosidase A, α-L-idurosidase, ATP7b, ornithine transcarbamoylase, phenylalanine hydroxylase, lipoprotein lipase, aromatic amino acid decarboxylase (AADC), ATPase sarcoplasmic / endoplasmic reticulum Ca2+ transporter 2 (ATP2A2), cystic fibrosis transmembrane transport regulator (CTFR), glutamate decarboxylase 65kDa protein (GAD65), glutamate decarboxylase 67kDa protein (GAD67), lipoprotein lipase (LPL), nerve growth factor (NGF), neurotrophic factor (NTN), porphyrinogen deaminase (PBGD), inotropic α (SGCA), soluble fms-like tyrosine kinase-1 (sFLT-1), apolipoprotein, low-density lipoprotein receptor (LDL-R), albumin, glucose-6-phosphatase, antibody, nanobody, aptamer, antiviral dominant-negative proteins and their functional fragments, subunits or mutants. Preferably, the protein is a primate protein, more preferably a human protein.

[0082] The protein or polypeptide of interest may be, for example, an antibody, an enzyme or fragment thereof, a viral protein, a cytokine, a lymphokine, an adhesion molecule, a receptor or its derivative or fragment thereof, a protein antibiotic, a toxin fusion protein, a carbohydrate-protein conjugate, a structural protein, a regulatory protein, a vaccine and vaccine-like proteins or particles, a processing enzyme, a growth factor, a hormone, and any other polypeptide that can be used as an agonist or antagonist and / or has therapeutic or diagnostic uses. According to a preferred embodiment, the protein is an immunoglobulin, preferably an antibody or antibody fragment, most preferably a Fab or scFv antibody. According to another preferred embodiment, the protein is a viral protein.

[0083] In some embodiments of the invention, the synthetic liver-specific expression cassette contains a gene for gene editing, such as a gene encoding a site-specific nuclease, like a macronuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector-based nuclease (TALEN), or a clustered, regularly spaced short palindromic repeat system (CRISPR-Cas). Suitably, the site-specific nuclease is adapted to edit the desired target genomic site by cleavage (typically a site-specific double-strand break), followed by repair of the cleavage via non-homologous end joining (NHEJ) or homology-dependent repair (HDR), thereby producing the desired edit. The edit can be a partial or complete repair of a dysfunctional gene, or a knock-down or knockout of a functional gene.

[0084] Products of interest can also be nucleic acids, such as RNA, such as antisense RNA, microRNA, siRNA, tRNA, rRNA, guide RNA, or any other regulatory, therapeutic, or other useful RNA.

[0085] In some preferred embodiments of the invention, the gene therapy vector is a viral vector, such as a retrovirus, lentivirus, adenovirus, or adeno-associated virus (AAV) vector, but other forms of gene therapy vectors are also contemplated. In some preferred embodiments, the vector is an AAV vector. In some preferred embodiments, the AAV has a serotype suitable for liver transduction. In some embodiments, the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, or derivatives thereof. To overcome a limiting step in AAV transduction (i.e., single-stranded to double-stranded AAV conversion), the AAV vector is suitable for use as a self-complementary double-stranded AAV vector (scAAV), although the use of single-stranded AAV vectors (ssAAV) is also included herein. In some embodiments of the invention, the AAV vector is chimeric, meaning it contains components from at least two AAV serotypes, such as ITRs of AAV2 and capsid proteins of AAV5.

[0086] In some embodiments of the present invention, the vector is a plasmid. Such a plasmid may include a variety of other functional nucleic acid sequences, such as one or more selectable markers, one or more origins of replication, multiple cloning sites, etc.

[0087] On the other hand, the present invention provides an expression cassette comprising a synthetic liver-specific inducible promoter operatively linked to a gene, the synthetic liver-specific inducible promoter comprising a CRE capable of being bound and activated by heterodimers of CAR and RXR. Various synthetic inducible promoters have been discussed above in the context of gene therapy vectors, which can be used in this aspect of the invention. Therefore, the present invention also includes, in expression cassettes in gene therapy vectors (detailed above) and other cases, the synthetic liver-specific promoter as described in the first aspect.

[0088] In some embodiments of the invention, the expression cassette is contained in an expression vector expressed in eukaryotic cells. Examples of eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXTl, and pSG, available from Stratagene; pSVK3, pBPV, pMSG, and pSVL, available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, pIRES2-DsRed2, pDsRed2-Mito, and pCMV-EGFP, available from Clontech. Many other vectors are well known and commercially available. For mammalian cell adenovirus vectors, the pSV and pCMV family of vectors are particularly well-known, non-limiting examples. There are many well-known yeast expression vectors, including but not limited to yeast integration plasmids (YIp) and yeast replication plasmids (YRp). For plants, the Agrobacterium Ti plasmid is a typical expression vector, and plant viruses also provide suitable expression vectors, such as tobacco mosaic virus (TMV), potato virus X, and cowpea mosaic virus.

[0089] In embodiments of this aspect of the invention, the gene is preferably not a reporter gene. Suitably, the gene encodes a therapeutic expression product (e.g., as described above) or another expression product useful in industry or research. Therefore, in some preferred embodiments of the invention, the expression cassette is used to express a product that is not a reporter protein (such as a fluorescent protein, luminescent protein, or chromogenic protein), and is preferably used to express a therapeutic expression product. Various suitable expression products have been discussed above. Other useful expression products will be apparent to those skilled in the art.

[0090] On the other hand, the present invention also provides a synthetic liver-specific inducible promoter comprising a CRE capable of being bound and activated by heterodimers of CAR and RXR. Various synthetic inducible promoters discussed in the context of gene therapy vectors are considered embodiments of this aspect of the invention. In other words, the aforementioned promoters are considered embodiments of this aspect of the invention regardless of whether they are in the context of a gene therapy vector. Specifically, various synthetic liver-specific inducible promoters with beneficial properties are disclosed and are not disclosed in the art. These promoters are useful in gene therapy, but also have wide applications in other settings, such as cell culture and bioprocessing, as discussed further below.

[0091] In particular, but not exclusively, embodiments of this invention include synthesizing a liver-specific inducible promoter comprising a sequence according to any one of SEQ ID NO:7 to 18, or a functional variant thereof. The functional variant suitably shares at least 60%, 70%, 80%, 90%, 95%, or 99% identity with any one of SEQ ID NO:7 to 18. As described above, 90%, 95%, or 99% or higher sequence identity is preferred in the region corresponding to the NR1 motif.

[0092] In some preferred embodiments, the synthetic liver-specific inducible promoter comprises a sequence according to SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or a functional variant thereof. This functional variant suitably shares at least 60%, 70%, 80%, 90%, 95%, or 99% identity with any one of SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. These promoters comprise 1, 2, 3, and 4 copies of mouse PBREM, respectively, linked to the MinTK minimal promoter.

[0093] In some embodiments of the invention, the synthetic liver-specific inducible promoter comprises or consists of a sequence according to any one of SEQ ID NO:59 to 71 or a functional variant thereof, or is composed of a sequence according to any one of SEQ ID NO:59 to 71 or a functional variant thereof. The functional variant suitably is at least 60%, 70%, 80%, 90%, 95%, or 99% identical to any one of SEQ ID NO:59 to 71. As described above, 90%, 95%, or 99% or higher sequence identity is preferred in the region corresponding to the NR1 motif.

[0094] In some preferred embodiments of the invention, the synthetic liver-specific inducible promoter comprises a sequence according to any one of SEQ ID NO: 68, 69, 70, or 71, or a functional variant thereof. The functional variant suitably shares at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with any one of SEQ ID NO: 68, 69, 70, or 71. As described above, 90%, 95%, or 99% or higher sequence identity in the region corresponding to the NR1 motif is preferred. These promoters comprise 2x MHM or 3x human PBREM elements.

[0095] In another aspect of the invention, a CRE is provided that can be bound and activated by a CAR-RXR heterodimer comprising a functional variant of a PBREM element or a functional variant of a PBREM element. Suitably, the variant PBREM is a variant of PBREM that is not naturally occurring, i.e., it contains a sequence not found in nature. For example, the variant does not contain a sequence of a human, mouse, or rat PBREM element (e.g., SEQ ID NO:1 or SEQ ID NO:2). Various non-natural CREs capable of being bound and activated by a CAR-RXR heterodimer have been described above with respect to a first aspect of the invention, and these provide exemplary embodiments of this aspect.

[0096] In some embodiments, as described above, the CRE of the present invention comprises or is composed of heterozygous PBREM elements. As a non-limiting embodiment, the heterozygous PBREM element may include portions of primate (e.g., human) and rodent (e.g., mouse) PBREM elements. For example, the heterozygous PBREM element may comprise an NR1 motif from a human and an NR2 motif from a mouse, or an NR1 motif from a mouse and an NR2 motif from a human. The mouse or human NR1 and NR2 motifs may also be combined with the NR1 motif of the corresponding species. In some embodiments, the heterozygous PBREM element comprises one of the following combinations of PBREM motifs: hNR1-mNF1-hNR2, hNR1-mNF1-mNR2, mNR1-hNF1-mNR2, or mNR1-hNF1-hNR2 (where “h” represents a human motif and m represents a mouse motif). Exemplary hybrid PBREM element sequences are underlined in SEQ ID NO:61 to 64 of Table 3; of course, functional variations of these sequences may be used, such as sequences having 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the underlined hybrid PBREM element sequences in SEQ ID NO:61 to 64.

[0097] In some implementations, the CRE capable of being bound and activated by the CAR-RXR heterodimer comprises one or consists of one of the following sequences:

[0098] ACTGTACTTTCCTGACCCTGAAGAGACTGTACTTTCCTGACCCTGAAGAGACTGTACTTTCCTGACCCTGAAGAG (SEQ ID NO: #; human NR1x3);

[0099] ACTGTACTTTCCTGACCCTGGCACAGTGCCACCATGGACTTTCCTGAACCA (SEQ ID NO: 72; HMH heterozygous);

[0100] ACTGTACTTTCCTGACCCTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 73; HMM heterozygous);

[0101] TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC (SEQ ID NO:74; MHM heterozygous); or

[0102] TCTGTACTTTCCTGACCTTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO:75; MHH heterozygous),

[0103] Or a functional variant thereof. A functional variant suitably comprises a sequence that is 80%, 85%, 90%, 95%, or 99% identical to any of the stated sequences.

[0104] In another aspect of the invention, a CRM comprising two or more CREs is provided, wherein the CREs are capable of binding and activation by a CAR-RXR heterodimer comprising a functional variant of a PBREM element or a functional variant of a PBREM element. Various CRMs comprising two or more CREs capable of binding and activation by a CAR-RXR heterodimer have been described above and with respect to the first aspect of the invention, and these provide exemplary embodiments of this aspect. In some embodiments, the CRM comprises at least one non-natural CRE as described above, such as at least one heterozygous CRE.

[0105] In some implementations, CRM includes one of the following sequences:

[0106] TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-CTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO:76; 2x murine PBREM CREs);

[0107] TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO:77; 3x murine PBREM CREs);

[0108] CTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC (SEQ ID NO:78; 2x MHM heterozygous CREs);

[0109] ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO:79; 2x human PBREM CREs);

[0110] ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO:80; 3x human PBREM CREs);

[0111] Or any functional variant thereof. A suitable functional variant comprises 80%, 90%, 95%, or 99% of the same sequence as any of the stated sequences, and wherein S is an optional spacer. When present, the spacer may have any suitable length, such as 2 to 100 nucleotides, 3 to 50 nucleotides, 5 to 30 nucleotides, and 10 to 25 nucleotides. In some embodiments, the length of the mentioned spacer is a multiple of 5. Spacers of approximately 20 nucleotides in length have been found to be suitable (e.g., 18-22 nucleotides in length).

[0112] In some implementations, CRM includes one of the following sequences:

[0113] TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 81; 2x mouse PBREM CREs);

[0114] TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTC CTCAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCTGACCTCCTGCCAGCAATATCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC(SEQ ID NO: 82; 3x mouse PBREM) CTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC (SEQ ID NO: 83; 2xMHM heterozygous);

[0115] OR

[0116] ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACATTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCAGCACTGAAGGTCCTCAATCGACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 85; 3x human PBREM),

[0117] Or any functional variant thereof. A functional variant suitably contains 80%, 90%, 95%, or 99% of the same sequence as any of the stated sequences.

[0118] In one implementation, the cis-regulatory elements, cis-regulatory modules, or promoters or variants thereof provided herein can enhance or drive gene expression in tissues other than the liver or of non-hepatic origin (e.g., spleen, muscle, heart, lung, and brain). Gene expression in non-hepatic tissues can be exclusive, or in addition to expression in hepatocytes. When gene expression is driven in both non-hepatic and hepatic tissues, the expression level in non-hepatic tissues can be equal to or greater than the expression level in hepatic tissues. For example, the promoters or variants thereof provided herein can drive equivalent gene expression in both the liver and heart.

[0119] In another aspect, the present invention provides recombinant viral particles (viral particles) comprising a gene therapy vector according to the present invention. The viral particles may be, for example, AAV particles, retroviral particles, lentiviral particles, or some other form of gene therapy viral particle.

[0120] The gene therapy vector or virus of the present invention can be formulated into a pharmaceutical composition together with pharmaceutically acceptable excipients (i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc.). The pharmaceutical composition can be provided in the form of a kit.

[0121] Therefore, in another aspect, the present invention provides a pharmaceutical composition comprising the gene therapy vector or viral particles as described above. The gene therapy vector or viral body of the present invention can be formulated into a pharmaceutical composition together with pharmaceutically acceptable excipients (i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc.). The pharmaceutical composition can be provided in the form of a kit.

[0122] According to another aspect of the invention, a cell is provided comprising a gene therapy vector, expression cassette, promoter, CRE, or CRM according to various aspects of the invention.

[0123] The appropriate cell is a eukaryotic cell. The eukaryotic cell may suitably be a fungal cell (e.g., yeast cell), an animal (metazoan) cell (e.g., mammalian cell), or a plant cell. Alternatively, the cell may be a prokaryotic cell.

[0124] In some embodiments of the invention, the cells are ex vivo, for example, in a cell culture. In other embodiments of the invention, the cells may be part of a tissue or a multicellular organism.

[0125] In a preferred embodiment, the cell is a hepatocyte (liver cell), which can be ex vivo or in vivo. The hepatocyte can be a primary hepatocyte or a cell from a liver-derived cell line, such as an immortalized cell line. The cell can be present in a liver tissue environment (e.g., in the liver) or can be isolated from liver tissue, for example, it can be in a cell culture. Suitable cells are human cells. Typically, hepatocytes express both CAR and RXR. However, some liver-derived cell lines do not express CAR (e.g., the Huh7 cell line), in which case it is necessary to provide exogenous CAR. This can be achieved by providing the cell with a suitable expression construct containing nucleic acid encoding the CAR, which is operatively linked to a promoter, such as a constitutively active promoter. Suitable methods are known in the art and are described in the examples.

[0126] In some embodiments, the cell has been modified to express CAR and / or RXR. In such embodiments, suitable cells are those that do not normally express CAR, RXR, or CAR and RXR. Suitable cells are not hepatocytes. Therefore, in some embodiments of the invention, the promoter, expression cassette, and vector of the invention are used for non-hepatocyte cells that normally (i.e., in their natural state) do not express CAR and / or RXR; thus, the promoter of the invention is generally inactive in such cells. However, the cell has been modified to express CAR and RXR, so that the promoter can be induced. As a non-limiting example, the cell can be any type of primary animal cell or animal cell line.

[0127] Gene therapy vectors, expression cassettes, promoters, CREs or CRMs according to various aspects of the present invention can be inserted into the genome of a cell, or they can exist in an episome vector.

[0128] Cells suitable for use in this invention include, but are not limited to, eukaryotic cells (such as yeast), plant, insect, or mammalian cells. For example, the cells can be any type of differentiated cell, or can be oocytes, embryonic stem cells, hematopoietic stem cells, or other forms. In some embodiments, the cells are animal (metazoan) cells (e.g., mammalian cells). In some preferred embodiments, the cells are hepatocytes (e.g., Huh7 cells, HepaRG cells, HEPG2 cells, etc.; various hepatocytes can be obtained from ATCC, DSMZ, and other sources). In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human, ape, mouse, rat, rabbit, hamster, goat, cow, sheep, or pig cells. Some cells or "host cells" used to produce the product of interest are human, mouse, rat, monkey, or rodent cell lines. In some embodiments, hamster cells are preferred, such as BHK21 and BHK TK. - CHO, CHO-K1, CHO-DUKX, CHO-DUKX B1, CHO-S, and CHO-DG44 cells, or any derivatives / progeny of such cell lines. In alternative embodiments, the cells may be human cells. In some preferred embodiments, the human cells may be human embryonic kidney (HEK) cells, preferably HEK 293 cells. In another preferred embodiment of the invention, the cells may be retinal cells, such as retinal pigment epithelial cells, for example ARPE-19 (ATCC CRL-2302). Furthermore, mouse myeloma cells, preferably NSO and Sp2 / O cells, or any derivatives / progeny of such cell lines, are also well-known cell lines for biopharmaceutical protein production. Non-limiting examples of cell lines and their sources that can be used in the present invention are summarized in Table 1. Suitable host cells are commercially available, for example, from culture collections such as DSMZ (Deutsche Sammlung von Mikroorganismen and Zeilkuituren GmbH, Braunschweig, Germany) or the American Type Culture Collection (ATCC).

[0129] For bioprocessing applications, it is likely preferable to establish, adapt, and fully culture cells under serum-free conditions, and optionally in a medium free of any animal-derived proteins / peptides. Commercially available media, such as Ham's F12 (Sigma, Deisenhofen, Germany), RPMI-1640 (Sigma), Dulbecco's Modified Eagle's Medium (DMEM; Sigma), Minimal Essential Medium (MEM; Sigma), Iscove's Modified Dulbecco's Medium (IMDM; Sigma), CD-CHO (Invitrogen, Carlsbad, CA), CHO-S-SFMII (Invitrogen), serum-free CHO medium (Sigma), protein-free CHO medium (Sigma), EX-CELL medium (SAFC), CDM4CHO, and SFM4CHO (HyClone), are exemplary suitable nutrient solutions. Any culture medium can be supplemented with various compounds as needed, such as hormones and / or other growth factors (e.g., insulin, transferrin, epidermal growth factor, insulin-like growth factor), salts (e.g., sodium chloride, calcium, magnesium, phosphate), buffers (e.g., HEPES), nucleosides (e.g., adenosine, thymidine), glutamine, glucose or other equivalent energy sources, antibiotics, and trace elements. In this invention, serum-free culture media are preferred, but media supplemented with an appropriate amount of serum can also be used to culture host cells. For the growth and selection of genetically modified cells expressing selectable genes, suitable selectants are added to the culture medium.

[0130] The cells can be prokaryotic cells, such as bacterial cells. In some embodiments of the invention, the cells can be prokaryotic cells; although prokaryotic cells do not possess the CAR / RXR system associated with the invention, they can still be used in other steps of producing vectors or vector processing, transportation, or storage.

[0131] In some embodiments, the cells are packaging or production cells for producing viral vectors. For example, the cells may be packaging or production cells for producing AAV vectors. Various packaging or production cell lines are known in the art. In the packaging or production cell lines, preferably, the promoter of the present invention is operatively linked to a viral protein, such as Rep or Cap, or other viral structural or non-structural genes.

[0132] In another aspect of the invention, the promoter of the invention can be operatively associated with a gene or RNA encoding a viral protein. The viral protein can be a structural protein or a non-structural protein. As a non-limiting example, the viral protein can be an AAV protein, such as Rep or Cap protein, or it can be a viral accessory protein, such as E1A, E1B, E2A, or E4. In other embodiments, the viral protein can be REV, VSV-G, or RD114.

[0133] In another aspect of the invention, gene therapy vectors, expression cassettes, promoters, virions, or pharmaceutical compositions according to various aspects of the invention are provided for treating diseases, preferably diseases associated with abnormal gene expression, optionally in the liver (e.g., hereditary liver diseases).

[0134] Gene expression in the liver is of particular interest because it involves a wide range of fundamental functions in the body, including the synthesis of many proteins involved in metabolism, hemostasis, and infection prevention. Given that many diseases are associated with disruption of gene expression in the liver, there is great interest in developing gene therapy strategies that allow transgenes to be expressed in the liver to produce therapeutic expression products. Diseases associated with abnormal gene expression include, but are not limited to, hemophilia (including hemophilia A or B), familial hypercholesterolemia, ornithine transcarbamate deficiency, phenylketonuria, ornithine transcarbamate deficiency, glycogen storage disease, α1-antitrypsin deficiency, hereditary hemochromatosis, tyrosinemia type 1, argininosuccinic aciduria, hepatitis virus infection, nonviral hepatitis, liver cancer, hereditary cholestasis, Wilson's disease, and various other liver diseases (such as non-alcoholic fatty liver disease (NAFLD) and alcohol-related liver disease (ARLD)). Preferred embodiments for treating hemophilia A or B represent aspects of this invention.

[0135] On the other hand, the present invention provides a method for producing an expression product, preferably a therapeutic expression product, in cells, suitable for use in hepatocytes, the method comprising:

[0136] - Provides cells containing an expression cassette comprising a synthetic liver-specific inducible promoter operatively linked to a gene, the synthetic liver-specific inducible promoter comprising a cis-regulatory element (CRE) capable of being bound and activated by heterodimers of CAR and RXR; and

[0137] - The cells are given an inducing agent that induces the expression of the expression product of a gene operatively linked to an inducible promoter in the expression cassette.

[0138] This method suitably includes maintaining the cells under suitable conditions to express an expression product derived from a gene. In culture, this may include incubating cells or tissues containing cells under suitable culture conditions. The cells can, of course, be in vivo, for example, in one or more cells of a subject's liver. Therefore, this aspect of the invention particularly provides a method for producing a product of interest or expressing a therapeutic product (e.g., in a subject or ex vivo) in a cell culture (e.g., in a bioprocessing application). Various cells suitable for this aspect have been discussed above.

[0139] Suitablely, the method includes the step of introducing the expression cassette into the liver. Various methods of transfecting hepatocytes are well known in the art. A preferred method of transfecting hepatocytes is to transduce the cells using a viral vector (e.g., an AAV vector) containing a synthetic liver-specific expression cassette. Details of the various vectors used in this invention are described below.

[0140] This method may include collecting or isolating expression products. Suitable methods for collecting or isolating various expression products (e.g., proteins or nucleic acids) are well known to those skilled in the art.

[0141] In some implementations, the cells are hepatocytes. Hepatocytes typically express both CAR and RXR. However, some liver-derived cell lines do not express CAR (e.g., the Huh7 cell line), in which case it is necessary to provide exogenous CAR. This can be achieved by providing a suitable expression construct for CAR expression in cells, for example, containing nucleic acids encoding the CAR that are operatively linked to a suitable promoter. Suitable expression vectors and other methods for expressing CAR in any given cell are well known in the art.

[0142] Natural expression of CARs is generally limited to hepatocytes. Therefore, in cells that do not express CARs (which is typical for non-hepatocytes), it is usually necessary to provide the cells with exogenous CARs. As mentioned above, this can be achieved by providing suitable expression constructs for CAR expression in cells, such as nucleic acids encoding CARs that are operatively linked to a suitable promoter. Suitable expression vectors and other methods for expressing CARs in any given cell are well known in the art.

[0143] The inducer used in this invention can be any agent suitable for inducing CAR activation and CAR-RXR heterodimer formation. Such an inducer can induce the expression of PBREM elements in cells where an expression cassette is present. A variety of expression inducers derived from mouse and human PBREM elements are known in the prior art (e.g., see HONKAKOSKI, et al., Molecular Pharmacology, 53:597-601 (1998), and Cherian et al. “Small-molecule modulators of the constitutive androstane receptor”, Expert Opin Drug Metab Toxicol. 2015 July; 11(7):1099–1114; Banerjee et al. “Targeting xenobiotic receptors PXR and CAR in human diseases”, Drug Discov. Today. 2015 May; 20(5):618–628; Omiecinski et al., “Multi-species Analyses of Direct Activators of the Constitutive Androstane Receptor” Toxicological Sciences, 123(2), 550–562 (2011)). Typically, these inducers are activating ligands of CAR. CARs are characterized by their broad specificity to a wide range of endogenous and exogenous ligands with different chemical structures, making them xenobiotic sensors. Table 1 by Cherian et al. lists various activators of CARs from various species, which can be used as inducers in any aspect of this invention.

[0144] For example, but not limited to, the inducing agent suitably comprises one or more reagents selected from the following list:

[0145] Phenobarbital (PB); flavonoids, such as flavonoids, scutellarin, baicalin, or galangin; 1,4-bis[2-(3,5-dichloropyridinoxy)]benzene (TCPOBOP); 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazolyl-5-carboxaldehyde-O-(3,4-dichlorobenzyl)oxime (CITCO); acetaminophen; buprenorphine; phenytoin; carbamazepine; valproic acid; artemisinin and its derivatives; chlorpromazine; efavirenz; nevirapine; rilpivirine; etravirine; diazepam; cyclophosphamide; ifosfamide; sildenafil; simvastatin; lovastatin; substituted sulfonamides; thiazolidin-4-one; estradiol Alcohols; estrone and its analogues; 17α-ethynyl-3; 17β-estradiol (EE2); dehydroepiandrosterone (DHEA); 5β-pregnane-3,20-dione; diethylstilbestrol; ginkgo extract; galangin; baicalin; diallyl sulfide; ellagic acid; resveratrol; squalane-1; ginkgolide; triclocarban; triclosan; dichlorodiphenyltrichloroethane (DDT); dieldrin; methoxychloride; metoprolol; permethrin; pyrethrin; sulfadiazine; diethylhexyl phthalate (DEHP); cyproconazole; fluconazole; propiconazole; FL81; trimethylphenyl phosphate (TMPP); UM104 and UM145.

[0146] In some preferred embodiments, the inducer is a drug (pharmaceutical), such as a drug that has been regulatory approved in at least one country (preferably the United States or a member of the European Union) for the treatment of at least one medical condition in humans or animals (preferably humans). Alternatively, the inducer may preferably have a Generally Recognized As Safe (GRAS) status in at least one country (preferably the United States or a member of the European Union). In some preferred embodiments, the inducer comprises one or more agents selected from the following:

[0147] Phenobarbital; flavonoids, such as flavonoids, scutellarin, baicalin, or galangin; acetaminophen; buprenorphine; phenobarbital; phenytoin; carbamazepine; valproic acid; artemisinin and its derivatives; chlorpromazine; efavirenz; nevirapine; rilpivirine; etravirine; diazepam; cyclophosphamide; ifosfamide; silivastatin; simvastatin; lovastatin; substituted sulfonamides; and thiazolidin-4-ones.

[0148] These compounds are all known drugs or are considered GRAS for human use, and therefore can generally be used to induce human expression with appropriate safety.

[0149] In some embodiments of the invention, the inducer is phenobarbital. In some other embodiments, the inducer is CITCO or TCPOBOP. In some other embodiments, the inducer is a flavonoid, such as a flavonoid.

[0150] Inducers can be administered to cells in any suitable manner. For example, in cell culture, inducers can be added to the culture medium. When cells are in vivo, such as in the liver of an animal, inducers can be administered to the cells by systemic administration to the animal or by local application to a target tissue (e.g., the liver). Those skilled in the art can readily determine the appropriate dose rate for any given inducer. Therefore, those skilled in the art can readily determine the appropriate manner and appropriate concentration for delivering the inducer to cells for any inducer. In the case of CITCO, the following examples have demonstrated that administering a concentration of 0.5 μM to 3 μM (e.g., about 1 μM) to the cells is suitable for inducing expression. In the case of TCPOBOP, the following examples have demonstrated that administering a concentration of 50 nM to 150 nM to the cells is suitable for inducing expression. In the case of flavonoids, the following examples have demonstrated that administering a concentration of 30 μM to the cells is suitable for inducing expression. However, other suitable concentrations can be used, and those skilled in the art can determine the necessary dose to be given to the patient. Therefore, in some embodiments, the present invention contemplates exposing cells containing the expression cassette to 0.1 μM to 15 μM of CITCO to induce expression, for example, 0.25 μM to 6 μM, 0.5 μM to 3 μM. In some embodiments, the present invention contemplates exposing cells containing the expression cassette to 10 nM or 750 nM of TCPOBOP to induce expression, for example, 25 nM to 300 nM, or 50 nM to 150 nM. In some embodiments, the present invention contemplates exposing cells containing the expression cassette to 6 μM to 150 μM of flavonoids to induce expression, for example, 15 to 150 μM, or 25 to 35 μM.

[0151] This method may suitably include discontinuing the administration of the inducer. Discontinuing the administration of the inducer will result in at least a reduction in the expression of the expression product. Typically, the expression of the expression product will recover to baseline levels over time.

[0152] This method can suitably include varying the concentration of the inducer applied to the cells over time. This can be used to modulate the expression level of the expression product.

[0153] In some embodiments of the invention, the concentration of the inducer administered to the cells is varied over time to adjust the dosage of the therapeutic gene product delivered to the subject or to alter the production of the expressed product in the cell culture. In cases where the subject is being treated (discussed in more detail below), the concentration of the inducer may vary in response to changes in the subject's condition, the level of biomarkers in the subject, or any other reason.

[0154] In some implementations, the method includes administering an inhibitor to the cells. The inhibitor can be any agent suitable for inhibiting or reducing CAR activation and CAR-RXR heterodimer formation. Adding an inhibitor can be used to reduce or eliminate the expression of the expression product (i.e., downregulate or shut down expression). As a non-limiting example, metformin is a known CAR antagonist that can be used as an inhibitor. Furthermore, androstanol and several isomers of androstanol, androstane, are known to be endogenous CAR antagonists, and these can be administered as inhibitors. Various CAR inhibitors are discussed in Cherian et al., “Small-molecule modulators of the constitutive androstane receptor”, Expert Opin Drug Metab Toxicol. 2015 July; 11(7):1099–1114 (see...). Figure 1 This has been discussed in [the literature], which discloses various human, mouse, and rat CAR inhibitors. Those skilled in the art will certainly be able to identify other CAR (or RXR) inhibitors suitable for inhibiting or reducing the formation of CAR-RXR heterodimers that can be used in this invention. Those skilled in the art can readily determine the appropriate dose rate for any given inhibitor.

[0155] On the other hand, the present invention provides a method for expressing a therapeutic transgene in hepatocytes, the method comprising introducing a gene therapy vector according to the invention into hepatocytes, and then administering an inducer to the cells. Suitable inducers are as described above. Hepatocytes can be in vivo or ex vivo. As described above, the concentration of the inducer administered to the cells can vary over time. Exemplary therapeutic genes for this purpose have been discussed above.

[0156] It will be apparent to those skilled in the art that gene therapy vectors, expression cassettes, virions, or pharmaceutical compositions according to various aspects of the present invention can be used in gene therapy. Therefore, the use of such gene therapy vectors, expression cassettes, virions, or pharmaceutical compositions in gene therapy constitutes a part of the present invention. Accordingly, one aspect of the present invention provides gene therapy vectors, expression cassettes, virions, or pharmaceutical compositions as described herein for gene therapy, preferably gene therapy via liver-specific expression of a therapeutic gene, suitable for treating diseases involving abnormal gene expression in the liver.

[0157] On the other hand, the present invention provides a method for gene therapy to a subject in need, preferably a human, the method comprising:

[0158] - Introducing the gene therapy vector, expression cassette, or virion of the present invention into the liver of a subject, which contains a gene encoding a therapeutic product; and

[0159] - Administer an inducing agent to the subject so that a therapeutically effective amount of the therapeutic product is expressed in the subject.

[0160] Suitable therapeutic genes have also been discussed above. Treatable conditions have also been discussed above, including but not limited to hemophilia (including hemophilia A or B), familial hypercholesterolemia, ornithine carbamate deficiency, phenylketonuria, ornithine carbamate deficiency, glycogen storage disease, α1-antitrypsin deficiency, hereditary hemochromatosis, tyrosinemia type 1, argininodia, hepatitis virus infection, nonviral hepatitis, liver cancer, hereditary cholestasis, Wilson's disease, and various other liver diseases (such as nonalcoholic fatty liver disease (NAFLD), alcoholic liver disease (ARLD), and lysosomal storage disorders).

[0161] The method suitably includes expressing a therapeutically effective amount of a therapeutic product derived from the gene in the liver of the subject. The therapeutic product may have a therapeutic effect in the liver or other sites on the subject. For example, the therapeutic product may be released into the bloodstream.

[0162] Suitable inducers and methods of administration are listed above. As mentioned above, the administration of the inducer can be stopped after a period of time, such as after achieving a suitable therapeutic effect. Alternatively, the amount of inducer given to the subject can be varied over time. The amount of inducer given to the subject can be adjusted to obtain the desired amount (dosage) of therapeutic product expression. Therefore, when a clinical need arises to increase the amount of therapeutic product (e.g., due to insufficient response in the subject), the amount of inducer given to the subject can be increased, and vice versa (e.g., due to overreaction or undesirable side effects).

[0163] In some implementations, the method may include the following steps:

[0164] - Determine the amount of the therapeutic product expressed in the subject or assess the subject's response to the therapeutic product;

[0165] a) When a higher amount of the therapeutic product is required in the subject, increase the amount of inducer administered to the subject, or

[0166] b) When a lower amount of the therapeutic product is required in the subject, reduce the amount of inducer administered to the subject.

[0167] Standard laboratory techniques can be used to determine the amount of therapeutic products in a subject's body.

[0168] When considering that the amount of inducing agent administered to a subject may vary over time, it should be understood that the inducing agent is typically not administered to the patient continuously, but rather at a given dose level at given time intervals. Therefore, the present invention contemplates varying the amount of inducing agent administered to a subject over time by adjusting the dose, adjusting the time interval between doses, or both. Thus, for example, to increase the amount of inducing agent administered to a subject, the dose may be increased while the time interval between doses remains constant; the dose may remain constant while the time interval between doses decreases; or the dose may be increased and the time interval between doses decreases. To reduce the amount of inducing agent administered to a subject, the dose may be reduced while the time interval between doses remains constant; the dose may be kept constant while the time interval between doses decreases; or the dose may be reduced and the time interval between doses increased.

[0169] Alternatively or additionally, the method may include altering the inducer to change the amount of the therapeutic product in the subject. For example, a weak inducer may be replaced with a strong inducer, and vice versa.

[0170] The method may also include, for example, changing the inducer if the subject has an adverse reaction to it or if the inducer is found to be ineffective for the subject.

[0171] The method may also include administering an inhibitor to the subject. Suitable inhibitors applicable to the present invention have been discussed above. Inhibitors may be added to reduce or stop the production of the therapeutic product in the subject. The amount of inhibitor administered to the subject may be adjusted to obtain the desired amount (dosage) of therapeutic product expression.

[0172] Genes encoding suitable therapeutic gene products have been discussed above. However, therapeutic proteins, such as factors VIII and IX used to treat hemophilia, can be specifically mentioned.

[0173] The method appropriately includes administering the vector or virus according to the invention to the subject. A suitable vector is a viral gene therapy vector, preferably an AAV vector.

[0174] In some embodiments, the method includes systemic administration of the viral gene therapy vector. Systemic administration can be enteric (e.g., oral, sublingual, and rectal) or parenteral (e.g., injection). Preferred injection routes include intravenous, intramuscular, subcutaneous, intra-articular, intra-articular, intrathecal, and intradermal injection.

[0175] In some implementations, the viral gene therapy vector may be administered simultaneously or sequentially with one or more additional therapeutic agents or one or more saturants, the saturants being designed to prevent the vector from being cleared by the reticuloendothelial system.

[0176] When the carrier is an AAV carrier, the dose of the carrier can be 1x10.10 gc / kg to 1x10 15 gc / kg or higher, 1x10 is appropriate. 12 gc / kg to 1x10 14 gc / kg, the appropriate value is 5 x 10 12 gc / kg up to 5x10 13 gc / kg.

[0177] Generally, the subjects required will be mammals, preferably primates, and more preferably humans. Typically, the subjects in need will exhibit symptoms specific to the disease. The method usually involves improving the symptoms exhibited by the subjects in need by expressing therapeutic amounts of the therapeutic product.

[0178] Gene therapy protocols for therapeutic gene expression in target cells, both in vitro and in vivo, are well-known in the art and will not be discussed in detail here. In short, they include intramuscular injection, interstitial injection, airway infusion, intravenous or intra-arterial administration (e.g., intrahepatic artery, intrahepatic vein) of the endothelium, liver parenchyma, and plasmid DNA vectors (naked or in liposomes) or viral vectors. Various devices have been developed to enhance the utilization of DNA by target cells. While a simple approach involves physical contact between target cells and a catheter or implantable material containing the relevant vector, more sophisticated methods may utilize jet injection devices, etc. Gene transfer to mammalian hepatocytes has been performed using both in vitro and in vivo procedures. In vitro methods typically require harvesting hepatocytes, transducing them in vitro with a suitable expression vector, and then reintroducing the transduced hepatocytes into the liver. In vivo gene transfer is achieved by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein.

[0179] In another aspect of the invention, the use of synthetic inducible promoters, synthetic expression cassettes, vectors or virions according to various aspects of the invention in the preparation of pharmaceutical compositions for treating any of the conditions or diseases mentioned herein is provided.

[0180] On the other hand, the present invention provides a method for producing an expression product, the method comprising the following steps:

[0181] (a) Provide a population of eukaryotic cells, preferably animal cells, more preferably mammalian cells, and more preferably hepatocytes, the population of eukaryotic cells comprising an expression cassette comprising a synthetic liver-specific inducible promoter operatively linked to a gene, the synthetic liver-specific inducible promoter comprising a cis-regulatory element (CRE) capable of being bound and activated by heterodimers of CAR and RXR.

[0182] (b) Culturing the cell population; and

[0183] (c) Administering an inducing agent to the cells, the inducing agent being capable of inducing the expression of an expression product of a gene operatively linked to an inducible promoter in the expression cassette; and

[0184] (d) Recover the expressed product.

[0185] This method is preferably a bioprocessing method, i.e., a process using living cells to obtain the desired expression product. Preferred transgenes and their encoded products of interest have been discussed above. The expression products can be used in therapeutic, cosmetic, research, or other industrial processes. Suitable inducers and cells for this purpose have been discussed above.

[0186] Step (b) typically involves maintaining the cell population under conditions suitable for cell proliferation. During induction in step (c), these conditions typically prepare the cells to express the expression product derived from the transgene. Those skilled in the art should be aware of suitable conditions for various cell types. Therefore, the method suitably includes incubating the cell population under conditions suitable for cell growth prior to treating the cell population in step (c) to induce expression.

[0187] The steps for recovering the expression product typically involve isolating the expression product from the cell population, and in some cases from other components of the cell culture medium. The method preferably includes a step of purifying the expression product. Suitable methods for recovering and / or purifying the expression product are conventional in the art and depend on the specific properties of the expression product.

[0188] Obviously, this invention allows the production of the expression product to be delayed until the desired point in the cell culture process. For example, this can allow the cell population to expand until the desired cell number or concentration is reached, or the desired growth stage is achieved. This may be desirable for many reasons, such as allowing cells to grow under optimal conditions before expressing the transgene, where expression might inhibit growth. For example, in the case of toxic proteins, the production of toxic expression products can be avoided until the cell culture system is at the desired stage. Once a toxic protein is expressed, the cells will certainly be adversely affected or killed. However, even for non-toxic expression products, there may be considerable efficiency advantages in delaying the expression of the transgene to the desired point in time.

[0189] These methods can be carried out in any suitable reactor, including but not limited to stirred tanks, airlift reactors, fiber, microfiber, hollow fiber, ceramic matrix, fluidized bed, fixed bed, and / or sputtered bed bioreactors. As used herein, "reactor" may include a fermenter or fermentation unit, or any other reaction vessel, and the term "reactor" may be used interchangeably with "fermentation tank." For example, in some aspects, an exemplary bioreactor unit may perform one or more or all of the following: supply of nutrients and / or carbon sources, injection of suitable gases (e.g., oxygen), inflow and outflow of fermentation or cell culture media, separation of gas and liquid phases, temperature maintenance, maintenance of oxygen and CO2 levels, pH maintenance, agitation (e.g., stirring), and / or cleaning / sterilization. An exemplary reactor unit, such as a fermentation unit, may contain multiple reactors within the unit, for example, the unit may have 1 to 10 or more bioreactors in each unit. In various embodiments, the bioreactor may be suitable for batch, semi-batch, fed-batch, perfusion, and / or continuous fermentation processes. In some embodiments, the bioreactor can have a volume of about 100 ml to about 50,000 liters, preferably 10 liters or more. Additionally, suitable reactors can be multi-purpose, single-purpose, disposable, or non-disposable, and can be formed from any suitable material. U.S. Patent Publications 2013 / 0280797, 2012 / 0077429, 2011 / 0280797, 2009 / 0305626 and U.S. Patents 8,298,054, 7,629,167, and 5,656,491 (incorporated herein by reference in their entirety) describe example systems that can be used in this invention.

[0190] In some preferred embodiments of the invention, the method is used to produce gene therapy viral vectors, such as rAAV viral particles. In this embodiment, the cells are suitably packaging or production cells, and one of the auxiliary functions is under the control of an inducible promoter. As a non-limiting example, Rep, Cap, E1A, E1B, E2A, E4, and VA RNA genes can be placed under the control of an inducible promoter. Controlling Rep expression is particularly meaningful due to its toxicity. Therefore, in another aspect of the invention, the use of promoters as described herein in controlling viral protein expression in methods for producing viral gene therapy products, preferably viral accessory proteins, more preferably the Rep gene, is provided.

[0191] On the other hand, the present invention provides a reactor vessel comprising a cell culture containing the cells of the present invention and a culture medium sufficient to support cell growth. Various reactors suitable for the present invention have been described above.

[0192] In another aspect of the invention, the use of the bioprocessing carrier or cell of the invention in a bioprocessing method for manufacturing a desired product (e.g., a therapeutic product) is provided. Attached Figure Description

[0193] Figure 1 A shows the measurement of luciferase expression from the PB1-MinTK construct after transfection into Huh7 cells and treatment with DMSO, 50 nM, 150 nM, and 250 nM TCPOBOP.

[0194] Figure 1 B shows the measurement of luciferase expression from the PB1-MinTK construct after transfection into Huh7 cells, with or without CAR transfection.

[0195] Figure 1 C shows from Figure 1 The data for A represents the ratio of the strong virus promoter CMV-IE. Figure 1 C also showed that in the absence of CAR, there was no luciferase expression. A PBREM element binding to the MinTK promoter drove expression to a maximum of 40% of CMV-IE gene expression.

[0196] Figure 1 Figure D shows the measurement of EPO expression from the PB1-MinTK construct after transfection into Huh7 cells and treatment with DMSO, 0.5 μM, 1 μM, 2 μM, and 3 μM CITCO. The figure also shows that the addition of CITCO did not alter EPO expression in the CMV-MP promoter.

[0197] Figure 2 A shows the measurement results of luciferase expression from PB1-MinTK, PB1-CMV-MP and PB1-SV40-MP constructs after transfection into AXOL ARE-hepatocytes and treatment with DMSO (left) or 1 μM CITCO (right).

[0198] Figure 2 B shows from Figure 2 The data for A represents the ratio of the strong virus promoter CMV-IE.

[0199] Figure 3 A shows luciferase expression from the PB1-SV40, PB1-1-SV40, PB1-2-SV40, and PB1-3-SV40 constructs, which contain 1, 2, 3, and 4 PBREM elements, respectively. The combination of the PBREM multimer with the SV40 promoter is inducible and increases expression levels, but can only contain a maximum of 3 PBREM elements.

[0200] Figure 3 B shows luciferase expression from PB1-CMV, PB1-1-CMV, PB1-2-CMV, and PB1-3-CMV constructs containing 1, 2, 3, and 4 PBREM elements, respectively. The combination of the PBREM multimer with the CMV promoter is inducible and increases expression levels, but only a maximum of 3 copies of the PBREM elements can be obtained.

[0201] Figure 3 C shows luciferase expression from the PB1-MinTK, PB1-1-MinTK, PB1-2-MinTK, and PB1-3-MinTK constructs, which contain 1, 2, 3, and 4 PBREM elements, respectively. The combination of the PBREM multimer with the MinTK promoter is inducible and increases expression levels, but only a maximum of 3 copies of the PBREM elements can be obtained.

[0202] Figure 4 A shows the luciferase expression of the PB1-MinTK construct in the pGL4.10 vector of AXOL ARE-hepatocytes, the PB1-MinTK construct in the pAAV vector of Huh7 cells, and the PB1-MinTK construct in the pAAV vector of AXOL ARE-hepatocytes. Luciferase expression induced from the PB1-MinTK construct is comparable across different vectors and cell types.

[0203] Figure 4 B shows the luciferase expression of the PB1-2-MinTK construct in the pGL4.10 vector of AXOL ARE-hepatocytes, the PB1-2-MinTK construct in the pAAV vector of Huh7 cells, and the PB1-2-MinTK construct in the pAAV vector of AXOL ARE-hepatocytes. Luciferase expression induced from the PB1-2-MinTK construct is comparable across different vectors and cell types.

[0204] Figure 5 The luciferase expression of the pAAV vector in AXOL ARE-hepatocytes was shown by the PB1-MinTK and PB1-2-MinTK constructs in the absence of CITCO, CITCO (1 μM) induction, and CITCO withdrawal.

[0205] Figure 6 The mouse PBREM element is shown.

[0206] Figure 7 The plasmid map of the pGL4.10 vector is shown.

[0207] Figure 8 shows the in vivo results for the PB1 and PB1-2 constructs. a) Bioluminescence imaging of representative mice from 0 to 48 hours post-induction, b) Bioluminescence mapping to show different induction kinetics, c) folding induction observed for each construct (n=5).

[0208] Figure 9 The effects of CITCO and flavonoids on the induction of PBREM heterozygotes in the HUH7 cell line stably expressing human CAR were demonstrated.

[0209] Figure 10 The effects of CITCO and flavonoids on the induction of PBREM heterozygotes in primary hepatocytes were demonstrated.

[0210] Figure 11 The effects of CITCO and flavonoids on the induction of PBREM heterozygote multimers in the Huh7 cell line stably expressing human CAR were demonstrated.

[0211] Figure 12 The effects of CITCO and flavonoids on the induction of multimers of PBREM heterozygotes in primary hepatocytes were demonstrated. Detailed Implementation

[0212] Although the preparation and use of various embodiments of the present invention are discussed in detail below, it should be understood that the present invention provides many applicable inventive concepts that can be embodied in a wide variety of specific environments. The specific embodiments discussed herein are merely illustrative of specific ways of making and using the present invention and do not limit the scope of the invention.

[0213] Unless otherwise stated, the practice of this invention will employ conventional techniques within the scope of the art, including cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology. These techniques are well explained in the literature. For example, see Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and Son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (MJ Gait ed., 1984); US Pat. No. 4,683,195; Nucleic Acid Hybridization (Harries and Higgins. 1984); Transcription and Translation (Hames and Higgins eds. 1984); Culture of Animal Cells (Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells and Enzymes (IRL) Press, 1986); Perbal, A Practical Guide to Molecular Cloning (1984); theseries, Methods in Enzymology (Abelson and Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols.154 and 155 (Wu et al. eds.) and Vol.185, "GeneExpression Technology" (Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (Miller and Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook of Experimental Immunology, Vols. I-IV (Weir and Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). .

[0214] This document includes a discussion of the background of the invention to explain the context of the invention. This should not be construed as an admission that any material mentioned was disclosed, known, or part of general common knowledge in any country prior to the priority date of any claim.

[0215] In this disclosure, various publications, patents, and published patent specifications are cited by way of identification. All documents cited in this specification are incorporated herein by reference in their entirety. In particular, the teachings or sections of such documents specifically mentioned herein are incorporated by reference.

[0216] To facilitate understanding of the invention, a number of terms are defined below. The terms defined herein have meanings commonly understood by one of ordinary skill in the art related to this invention. Terms such as “a,” “an,” and “the” are not intended to refer to a single entity only, but rather to include general categories for which specific examples may be used to illustrate the invention. The terms used herein are used to describe specific embodiments of the invention, but their use does not limit the invention unless set forth in the claims.

[0217] The terms “cis-regulatory element” or “CRE” are well-known to those skilled in the art and refer to nucleic acid sequences, such as enhancers, promoters, insulators, or silencers, that can regulate or modulate the transcription of adjacent genes (i.e., cis-regulatory sequences). CREs are found near the genes they regulate. CREs typically regulate gene transcription by binding to TFs, i.e., they include TFBSs. A single TF can bind to many CREs, thereby controlling the expression of many genes (pleiotropic). CREs are usually, but not always, located upstream of the transcription start site (TSS) of the gene they regulate. An “enhancer” is a CRE that enhances (i.e. upregulates) the transcription of a gene it is operationally linked to, and can be found upstream, downstream, or even introns of the gene it regulates. Multiple enhancers can work synergistically to regulate the transcription of a gene. In this article, a “silencer” is associated with a CRE that binds to a TF called a repressor, which acts to prevent or downregulate gene transcription. The term "silencer" can also refer to a region in the 3' untranslated region of messenger RNA that binds to proteins that inhibit the translation of that mRNA molecule, but this usage differs from its use in describing CREs. Typically, the CREs of this invention are liver-specific inducible enhancers. In this document, preferably, the CRE is located 1500 nucleotides or less from the transcription start site, more preferably 1000 nucleotides or less, even more preferably 500 nucleotides or less, and suitably 250, 200, 150, or 100 nucleotides or less from the transcription start site. The CREs of this invention are preferably relatively short, preferably 100 nucleotides or less, for example, 90, 80, 70, 60 nucleotides or less.

[0218] The term "cis-regulatory module" or "CRM" refers to a functional module consisting of two or more CREs; in this invention, CREs are typically liver-specific inducible enhancers. Therefore, in this application, a CRM typically includes multiple liver-specific inducible CREs. Typically, multiple CREs in a CRM act together (e.g., additionally or synergistically) to enhance the transcription of genes operatively linked by the CRM. Within a CRM, the spacing between CREs can be adjusted (i.e., reordered), reversed (i.e., reversed direction), and altered. Therefore, functional variations of the CRM of this invention include variations of the reference CRM in which the CREs within them have been adjusted and / or reversed, and / or the spacing between CREs has been altered.

[0219] As used herein, the term "promoter" refers to a DNA region typically located upstream of the nucleic acid sequence to be transcribed, which is required for transcription to occur; that is, the region that initiates transcription. A promoter allows for the appropriate activation or repression of transcription of a coding sequence under its control. Promoters typically contain specific sequences that are recognized and bound by multiple transcription factors. The binding of a transcription factor (TF) to the promoter sequence leads to the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of a gene. Many promoters are known in the art. The inducible promoters of the present invention typically drive low levels of expression before induction and, upon induction, drive significantly higher levels of expression (e.g., an increase of 2, 3, 4, 5, 6, 7, 8, 9, or even 10-fold after induction).

[0220] The promoter of this invention is a synthetic promoter. As used herein, the term "synthetic promoter" refers to a promoter that does not exist in nature. Herein, it generally includes the synthetic CRE and / or CRM of this invention, operatively linked to a minimal (or core) promoter or a liver-specific proximal promoter. The CRE and / or CRM of this invention are used to provide inducible liver-specific transcription of a gene operatively linked to a promoter. A portion of the synthetic promoter may be naturally occurring (e.g., a minimal promoter or one or more CREs within a promoter), but the synthetic promoter as a complete entity is not naturally occurring.

[0221] As used herein, a “minimum promoter” (also known as a “core promoter”) is a short DNA fragment that is inactive or largely inactive on its own, but can mediate transcription when it binds to other transcriptional regulatory elements. Minimum promoter sequences can originate from a variety of different sources, including prokaryotic and eukaryotic genes. Examples of minimum promoters, as mentioned above, include the dopamine β-hydroxylase gene minimum promoter, the cytomegalovirus (CMV) early gene minimum promoter (CMV-MP), the SV40 minimum promoter (SV40-MP), and the herpes simplex thymidine kinase minimum promoter (MinTK). However, proximal promoters can be synthetic. Minimum promoters typically contain a transcription start site (TSS) and directly upstream elements, an RNA polymerase II binding site, and a general transcription factor binding site (usually a TATA box).

[0222] As used herein, a “proximal promoter” refers to a minimal promoter plus a proximal sequence upstream of a gene that tends to contain primary regulatory elements. It typically extends approximately 250 base pairs upstream of the TSS and includes specific TFBS. In the present case, the proximal promoter is suitably a naturally occurring liver-specific proximal promoter that can bind to one or more CREs or CRMs of the present invention. However, proximal promoters can be synthetic.

[0223] In the context of this invention, a “functional variant” of a cis-regulatory element, cis-regulatory module, promoter, or other nucleic acid sequence is a variant of a reference sequence that retains the ability to function in the same manner as the reference sequence, for example, as an inducible liver-specific cis-regulatory enhancer element, an inducible liver-specific cis-regulatory module, or an inducible liver-specific promoter. Alternative terms for such functional variants include “bioequivalent” or “equivalent”.

[0224] It should be understood that, as mentioned above, the ability of a given cis-regulatory element to act as an inducible liver-specific enhancer depends primarily on its ability to bind to the CAR-RXR heterodimer and thus induce expression. Therefore, in most cases, functional variants of cis-regulatory elements will contain suitable binding sites for the CAR-RXR heterodimer. The CAR-RXR heterodimer is thought to bind to the NR1 motif in wild-type PBREM elements, thus requiring a sequence that functions as the NR1 motif. There is high sequence conservation between mouse and human PBREMs in the NR1 motif, so maintaining a high degree of identity with the NR1 motif in any functional variant is generally desirable. Additional sequences in wild-type PBREM elements may help minimize background expression and provide high levels of inducibility, so functional variants are generally preferred to contain at least some degree of sequence identity in these other regions. Therefore, the level of sequence identity between the functional variant and the reference sequence can be an indicator or a preserved function. High levels of sequence identity in the NR1 motif of cis-regulatory elements are generally more important than sequence identity in other regions (e.g., NF1 and NR2, which have much less need for any sequence conservation, if any).

[0225] The ability of a CAR-RXR heterodimer to bind to a given CRE can be determined by any relevant method known in the art, including but not limited to, the electric mobility assay (EMSA), binding assay, chromatin immunoprecipitation (ChIP), and ChIP sequencing (ChIP-seq). In a preferred embodiment, the ability of a CAR-RXR heterodimer to bind to a given functional variant is determined by EMSA. Methods for performing EMSA are well known in the art. Suitable methods are described in the article by Sambrook et al. cited above. There are many relevant articles describing this process, such as Hellman and Fried, Nat Protoc. 2007; 2(8):1849–1861.

[0226] "Liver-specific" or "liver-specific expression" refers to the ability of cis-regulatory elements, cis-regulatory modules, or promoters to preferentially or primarily enhance or drive gene expression in the liver (or liver-derived cells) compared to other tissues (such as the spleen, muscle, heart, lungs, and brain). In the context of this invention, expression should be inducible, meaning that gene expression occurs or significantly increases only upon application of a suitable inducer (inducers used in all aspects of this invention have been discussed above). Gene expression can be in the form of mRNA or protein. In a preferred embodiment, liver-specific expression makes expression in other (i.e., non-liver) tissues or cells negligible, i.e., expression is highly liver-specific.

[0227] Those skilled in the art can readily assess the ability of a promoter to function as a liver-specific inducible promoter. Therefore, those skilled in the art can readily determine whether any variant of a particular promoter illustrated herein still possesses functionality (i.e., it is a functional variant as defined above). For example, any given CRE to be evaluated can be operatively linked to a minimal promoter (e.g., upstream of MinTK), and the ability of the cis-regulatory element to provide inducible liver-specific expression of a gene (typically a reporter gene) can be measured. Alternatively, a variant of the CRE can be replaced with an inducible liver-specific promoter instead of a reference CRE, and the effect on identifiable liver-specific expression driven by the modified promoter can be determined and compared to the unmodified form. Similarly, those skilled in the art can readily assess the ability of a promoter to induce liver-specific expression (e.g., as described in the examples below). The expression levels and inducibility of genes driven by variants of the reference promoter can be compared to the expression levels and inducibility of the reference sequence, and suitable methods are discussed above.

[0228] Liver-specificity can be identified, where genes (e.g., therapeutic genes or reporter genes) are preferentially or primarily expressed in liver-derived cells upon induction. Preferred or primary expression can be defined, for example, when induced, the expression level in liver-derived cells is significantly higher than in other cell types (i.e., non-liver-derived cells). For example, when induced, expression in liver-derived cells is suitably at least 5-fold higher than in non-liver cells, preferably at least 10-fold higher, and in some cases, 50-fold or more higher. For convenience, liver-specific expression can be suitably demonstrated by comparing expression levels in hepatocyte lines (e.g., liver-derived cell lines such as Huh7 and / or HepG2 cells) or primary liver cells with expression levels in kidney-derived cell lines (e.g., HEK-293), cervical tissue-derived cell lines (e.g., HeLa), and / or lung-derived cell lines (e.g., A549).

[0229] The liver-specific inducible promoter of the present invention preferably has an expression level at least 4-fold lower than that of the CMV-IE promoter in non-liver-derived cells, suitablely in HEK-293, HeLa and / or A549 cells.

[0230] The liver-specific inducible promoter of the present invention is preferably adapted to promote expression in the liver of a subject, for example, to drive the liver-specific expression of a transgene, preferably a therapeutic transgene.

[0231] It should also be noted that, in certain circumstances, the liver-specific promoter of the present invention can be used in non-hepatocytes. Normally, non-hepatocytes do not express CARs, therefore the promoter of the present invention does not function in these cells. However, when non-hepatocytes are engineered to express CARs (or RXR if they do not naturally express RXR), these non-hepatocytes can be induced to express genes associated with the promoter of the present invention. In other words, with respect to CAR and RXR expression, the liver-specific promoter of the present invention can also function in non-hepatocytes that have been modified to have a liver-like phenotype. The term "liver-specific" should be interpreted accordingly. When hepatocytes do not express CARs (e.g., the Huh-7 cell line) or RXR, they can also be modified to express the relevant proteins.

[0232] As used herein, the term "nucleic acid" generally refers to oligomers or polymers (preferably linear polymers) of any length that are essentially composed of nucleotides. A nucleotide unit typically includes a heterocyclic base, a sugar group, and at least one, such as one, two, or three phosphate groups, including modified or substituted phosphate groups. Heterocyclic bases may in particular include purine and pyrimidine bases, such as adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), which are widely found in naturally occurring nucleic acids, other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and chemically or biochemically modified (e.g., methylated), non-natural, or derived bases. Sugar groups may in particular include pentose (pentofuranose) groups, such as the preferred ribose and / or 2-deoxyribose commonly found in naturally occurring nucleic acids, or arabinose, 2-deoxyarabinose, threonose, or hexose sugar groups, as well as modified or substituted sugar groups. Nucleic acids contemplated herein may include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides may include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. Modifications to phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or other useful properties. The term "nucleic acid" further preferably includes DNA, RNA, and DNA-RNA hybrid molecules, specifically including hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA, or DNA-RNA hybrids. Nucleic acids may be naturally occurring, such as those present in or isolated from nature; or they may be non-natural, such as recombinant, i.e., produced by recombinant DNA technology, and / or partially or wholly chemically or biochemically synthesized. "Nucleic acid" may be double-stranded, partially double-stranded, or single-stranded. In the case of single-stranded nucleic acids, the nucleic acid may be a sense strand or an antisense strand. Furthermore, nucleic acids may be circular or linear.

[0233] The terms “identity” and “sameness” refer to the sequence similarity between two aggregate molecules, such as two nucleic acid molecules or two DNA molecules. Sequence alignment and determination of sequence identity can be performed, for example, using the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215:403-10), or the “Blast 2sequences” algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174:247-250).

[0234] Methods for aligning sequences are well known in the art. Various procedures and alignment algorithms are described in, for example: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et al. (1994) Methods Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174: 247-50. A detailed consideration of sequence alignment methods and homology calculations can be found in, eg, Altschul et al. (1990) J. Mol. Biol. 215: 403-10.

[0235] The Basic Local Alignment Search Tool (BLAST) from the National Center for Biotechnology Information (NCBI) TM Altschul et al. (1990) are available from several sources, including the National Center for Biotechnology Information (Bethesda, MD) and the Internet, for use in conjunction with various sequence analysis programs. Instructions on how to use this program to determine sequence identity are available on the Internet via BLAST. TM The "Help" section can be found there. To compare nucleic acid sequences, you can use BLAST with the default parameters. TM The "Blast 2 sequences" function in the (Blastn) program. When evaluated using this method, nucleic acid sequences with greater similarity to a reference sequence will show an increased percentage of identity. Typically, percentage sequence identity is calculated over the entire sequence length.

[0236] For example, the globally optimal alignment can be appropriately found using the Needleman-Wunsch algorithm with the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap spread 2. The identity percentage of the resulting optimal global alignment is appropriately calculated by multiplying the ratio of the number of aligned bases to the total alignment length, where the alignment length includes both matches and mismatches, by 100.

[0237] In this application, "synthetic" refers to nucleic acid molecules that do not exist in nature. The synthetic nucleic acid expression constructs of this invention are typically produced artificially using recombinant technology. Such synthetic nucleic acids may contain naturally occurring sequences (e.g., promoters, enhancers, introns, and other such regulatory sequences), but they exist in non-natural environments. For example, synthetic genes (or portions of genes) typically contain one or more inherently discontinuous nucleic acid sequences (chimeric sequences), and / or may include substitutions, insertions, and deletions, and combinations thereof.

[0238] As used in this article, "complementarity" or "complementarity" refers to the Watson-Crick base pairing of two nucleic acid sequences. For example, the sequence 5′-AGT-3′ binds to its complementary sequence 3′-TCA-5′. The complementarity between two nucleic acid sequences can be "partial," where only some bases bind to their complementary sequences, or it can be complete when every base in the sequence binds to its complementary base. The degree of complementarity between nucleic acid strands has a significant impact on the efficiency and strength of hybridization between nucleic acid strands.

[0239] In this application, "transfection" broadly refers to any process that intentionally introduces nucleic acids into cells, encompassing the introduction of viral and non-viral vectors, and also includes terms and processes such as transformation and transduction. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation (Fromm et al. (1986) Nature 319:791-3); lipid transfection (Feigner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7); microinjection (Mueller et al. (1978) Cell 15:579-85); Agrobacterium-mediated transfer (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA uptake; whisker-mediated transformation; and microjet bombardment (Klein et al. (1987) Nature 327:70).

[0240] As used herein, the phrase “transgenic” refers to a foreign nucleic acid sequence. In one example, a transgenic is a gene encoding a compound that is industrially or pharmaceutically useful, or a gene encoding a desired trait. In yet another example, a transgenic encodes an antisense nucleic acid sequence in which the expression of the antisense sequence suppresses the expression of the target nucleic acid sequence.

[0241] The term "vector" is well known in the art and, as used herein, refers to a nucleic acid molecule, such as double-stranded DNA, into which a nucleic acid sequence according to the invention may have been inserted. A vector is suitable for transporting the inserted nucleic acid molecule into a suitable host cell. A vector typically contains all the necessary elements to allow transcription of the inserted nucleic acid molecule, and preferably to translate the transcript into a polypeptide. A vector typically contains all the necessary elements such that, once the vector enters the host cell, it can replicate independently of or synchronously with the host chromosomal DNA; several copies of the vector and its inserted nucleic acid molecule can be produced. The vectors of the present invention can be additional vectors (i.e., not integrated into the host cell genome) or vectors integrated into the host cell genome. This definition includes both non-viral and viral vectors. Non-viral vectors include, but are not limited to, plasmid vectors (e.g., pMA-RQ, pUC vectors, bluescript vectors (pBS), and pBR322 or derivatives thereof that do not contain bacterial sequences (microcircles)), transposon-based vectors (e.g., PigyBac (PB) vectors or Sleeping Beauty (SB) vectors), etc. Larger vectors, such as artificial chromosomes (bacterial (BAC), yeast (YAC), or human (HAC)), can be used to accommodate larger inserts. Viral vectors are derived from viruses, including but not limited to retroviruses, lentiviruses, adeno-associated viruses, adenoviruses, herpesviruses, hepatitis virus vectors, etc. Typically, but not necessarily, viral vectors are replication-deficient because they have lost the ability to reproduce in a given cell, as the viral genes necessary for replication have been removed from the viral vector. However, some viral vectors can also be adapted to replicate specifically in a given cell (e.g., cancer cells) and are often used to trigger cell-specific (tumor cell lysis) lysis (cancer). Virosomes are non-limiting examples of vectors containing both viral and non-viral elements, particularly those that bind liposomes to inactivated HIV or influenza viruses (Yamada et al., 2003). Another example includes viral vectors mixed with cationic lipids.

[0242] As used herein, the terms "operably linked," "operably connected," or equivalent expressions refer to the arrangement of various nucleic acid elements relative to each other such that these elements are functionally linked and able to interact in a desired manner. These elements may include, but are not limited to, promoters, enhancers, and / or regulatory elements, polyadenylated sequences, one or more introns and / or exons, and the coding sequence of the gene of interest to be expressed. When properly oriented or operably linked, nucleic acid sequence elements work together to regulate each other's activity and may ultimately affect the expression level of the expression product. Regulation refers to increasing, decreasing, or maintaining the activity level of a particular element. The position of each element relative to other elements can be represented by the 5' and 3' ends of each element, and the distance between any particular element can be represented by the number of nucleotides or base pairs inserted between the elements. As will be understood by those skilled in the art, operable linking implies functional activity and is not necessarily related to the native position of the link. In fact, when used in nucleic acid expression cassettes, cis-regulatory elements are typically located immediately upstream of the promoter (although this is usually the case, it should absolutely not be interpreted as limiting or excluding locations within the nucleic acid expression cassette), but this is not necessarily the case in vivo. For example, regulatory element sequences naturally present downstream of a gene, when located upstream of the promoter, can affect the genes whose transcription they influence in the same way. Therefore, depending on the specific implementation, the regulatory or enhancing effect of a regulatory element is location-independent.

[0243] The term "spacer sequence" or "spacer" as used in this article refers to a nucleic acid sequence that separates two functional nucleic acid sequences (e.g., TFBS, CRE, CRM, minimal promoters, etc.). It can be virtually any sequence, as long as it does not prevent the functional nucleic acid sequence (e.g., cis-regulatory elements) from functioning as intended (e.g., if it includes a silencing sequence, preventing the binding of desired transcription factors, etc., this could happen). Typically, it is non-functional, as its presence is solely for separating adjacent functional nucleic acid sequences from each other.

[0244] The term “pharmaceutically acceptable” as used herein, in accordance with the art, means that it is compatible with other components of a pharmaceutical composition and is harmless to its recipient.

[0245] "Therapeutic effective dose" and similar phrases refer to a dose or plasma concentration that provides the desired specific pharmacological effect in a subject, such as the expression of a therapeutic gene in the liver. It is important to emphasize that a therapeutic effective dose is not always effective in treating the conditions described herein, even if such a dose is considered therapeutically effective by someone skilled in the art. Therapeutic effective doses can vary depending on the route of administration and dosage form, the age and weight of the subject, and / or the disease or condition being treated.

[0246] The term “treatment” refers to the reduction, improvement or elimination of one or more signs, symptoms or effects of a disease or condition.

[0247] The terms “individual,” “subject,” and “patient” are used interchangeably to refer to any individual subject suffering from a disease or condition requiring treatment. For the purposes of this disclosure, the subject may be a primate, preferably a human, or another mammal such as a dog, cat, horse, pig, goat, or cow.

[0248] Technical Introduction

[0249] nuclear receptors

[0250] Nuclear receptors play a crucial role in translating chemical changes in the cellular environment into transcriptional and biological changes. This function is essential not only for maintaining cellular homeostasis but also for maintaining homeostasis throughout the organism. Nuclear receptors are found only in metazoans, and their numbers vary greatly among different species; for example, humans have 48, while *C. elegans* has 270.

[0251] Since their discovery, the importance and number of nuclear receptors have increased dramatically, and these proteins are now considered a superfamily of proteins. This family includes receptors that bind to and respond to steroids, thyroid hormones, nutrients, and xenobiotic chemicals. Once bound by a ligand, the receptor undergoes a conformational change and binds to DNA, thereby initiating or inhibiting gene expression. This ability to bind to genomic DNA is crucial for the function of the receptor and its importance in cell fate, individual development, and metabolism. The number of ligands shown to bind to nuclear receptors is constantly increasing, masking the function of homologous receptors. From endogenous hormones to vitamins and exogenous substances, their importance in cellular metabolism and homeostasis has been highlighted. Due to the profound influence of these receptors on the transcriptome, they are excellent targets for drug therapy; it is estimated that approximately 13% of FDA-approved drugs target nuclear receptors.

[0252] structure

[0253] The nuclear receptor has a mass between 50-100 kDa, and the mature polypeptide consists of 5 domains:

[0254] A / B: The receptor ratio is highly variable. It contains activating function 1 (AF-1), which acts as a weak transcriptional activator in the absence of a ligand, but as a strong activator when ligand-bound. This is due to the interaction with AF-2 in the E domain.

[0255] C: A highly conserved domain containing two zinc fingers that bind to DNA reaction elements.

[0256] D: A flexible domain that connects the LBD and DBD and allows their interaction. Important in cellular transport and subcellular distribution.

[0257] E: The structure is highly conserved, but the sequence is only moderately conserved. It contains a ligand-binding cavity and confers receptor ligand specificity. It forms a dimerization interface with DBD and also binds coactivators and repressors. It contains activator 2 (AF2), whose function depends on ligand binding.

[0258] F: Highly variable C-terminal structural domain.

[0259] Mechanism of action

[0260] Based on their mechanism of action, nuclear receptors can be divided into four types. The following is a summary of each type:

[0261] Type I: These receptors are found in the cytoplasm of inactivated cells. Ligand binding leads to the dissociation, homodimerization, and translocation of heat shock proteins (HSPs) to the nucleus, where they bind to the receptor's DNA reactive motif. These receptors bind to the DNA motif, which consists of 2... 1 The receptor consists of two sites, separated by variable-length DNA (direct repeats 1-5 (DR1-5)), where the second half-site is an inverted repeat of the first. Some of these receptors bind to the direct repeat sequence and can bind as a monomer / dimer, or as a heterodimer in the case of constitutive androstenedane receptors, to the RXR.

[0262] Type II: These receptors, whether inactive or active, are located in the cell nucleus. They typically bind to DNA as heterodimers with RXR. In the absence of ligands, these receptors usually complex with co-repressor proteins.

[0263] Type III: Similar to type I receptor, but only binds to direct repeat sequences of DNA.

[0264] Type IV: They can bind as dimer monomers, but only a single DNA-binding domain binds to a single half-site on the DNA.

[0265] Constitutive androstenedione receptor (CAR)

[0266] Constitutive androstenedione receptors (CARs)—or nuclear receptor subfamily 1, group I, member 3—are members of the nuclear receptor superfamily and are expressed almost exclusively in hepatocytes. It is here that CARs synergize with another nuclear receptor, the pregnane X receptor (PXR), as sensors for both endogenous and exogenous chemicals. Once activated and bound, these receptors regulate the activity of many genes, including cytochrome p450s, and are therefore responsible for the metabolism and excretion of these compounds. It is through this binding and gene activation activity that CARs and PXRs play a crucial role in the detoxification of exogenous chemicals in the body.

[0267] Function:

[0268] As mentioned above, CARs function as key regulators of both xenobiotic and endogenous metabolism. There are 24 transcripts of it in the liver. It has been shown that some of these transcripts are responsible for low-level constitutive activity of the receptor, while others are inducible. Constitutive activity is thought to be regulated through interaction with transcriptional coactivators such as steroid receptor coactivator 1 (SRC1). This activity can be inhibited by binding to inverse agonists such as androstenedinines.

[0269] Ligand activation:

[0270] Inactive CARs are phosphorylated and reside in the cytoplasm of the cell. Here, they form a complex with heat shock protein 90 (hsp90) and cytoplasmic CAR retention protein (CCRP), a binding that keeps the CAR inactive in the cytoplasm. This inactive CAR can be activated in two ways: 1) by direct binding of a mouse CAR ligand via TCPOBOP, or 2) by indirect activation via phenobarbital. Both pathways result in the dissociation of the CAR from the multiprotein complex, allowing it to translocate to the nucleus. In the nucleus, the CAR can exist as a monomer or form a heterodimer with the retinoid X receptor (RXR). The nuclear CAR binds to DNA at the phenobarbital response element (PBREM), through which it activates CAR-regulated genes such as the CYP2B, CYP2C, and CYP3A subfamilies.

[0271] Direct activation:

[0272] TCPOBOP is thought to bind directly to mouse CARs and induce their translocation to the cell nucleus. However, this chemical does not bind to human CARs, therefore CITCO is an equivalent compound in human studies.

[0273] Indirect activation:

[0274] Indirect activation of the CAR by the anticonvulsant phenobarbital (PB) is a widely accepted mode of indirect CAR activation. PB induces CAR dephosphorylation through activation of the phosphatase PP2A. The exact mechanism of PP2A activation is unclear; however, PB activates an AMP-activated protein kinase, which may activate PP2A, which is then recruited by a multi-protein complex.

[0275] Another theory is that PB competes with epidermal growth factor (EGF) for its receptor, the epidermal growth factor receptor (EGFR). The dissociation of EGF and EGFR inactivates SRC1, which leads to dephosphorylation of the activated C-kinase 1 (RACK 1) receptor, thereby stimulating PP2A.

[0276] PBREM components:

[0277] The DNA binding site of the mouse CAR homologue was determined by Honkakoski et al. (MOLECULARPHARMACOLOGY, 53:597-601 (1998)). In this study, they found that the RXR and CAR heterodimer binds to a site in the phenobarbital response enhancer module (PBREM) of the cytochrome P-450 Cyp2b10 gene in response to phenobarbital induction. Expression of RXR and CAR in mammalian cell lines activates the PBREM, indicating that the CAR-RXR heterodimer is a trans-acting factor of the Cyp2b10 gene. It was also shown that this heterodimer binds to two incomplete direct repeat-4 motifs, and that these motifs are conserved in humans. PBREM elements such as... Figure 6 As shown, NR1 and NR2 are nuclear receptor binding sites; incomplete direct repetitions are shown in bold. The NFI binding site is shown. The CAR-RXR heterodimer appears to bind to the NR1 site.

[0278] Human PBREM elements have also been identified, Sueyoshi et al. (J. BIOL. CHEM. Vol. 274, 10, pp. 6043-6046, 1999).

[0279] The sequences and alignments of mouse and human PBREM elements are shown below, with the so-called NR1 motif in each element underlined (SEQ ID NO shown in parentheses):

[0280]

[0281] It can be seen that there is a very high level of conservation in the NR1 motif, while there is a much lower level of identity in other regions.

[0282] This invention is based on the surprising discovery that PBREM elements and their functional variants can be used to provide inducible expression, for example, when provided in gene therapy vectors. This invention allows for both useful levels of inducible expression and low levels of background (constitutive) expression.

[0283] Example 1

[0284] The PBREM enhancer, together with the MinTK promoter, is used to drive the expression of luciferase and EPO.

[0285] Material

[0286] -Huh7 cells are a human hepatocyte cell line

[0287] -DPBS: CaCl2-free, MgCl2-free (Gibco, 14190-094)

[0288] -DMEM(Sigma,D6546)

[0289] -FBS(Sigma,F9665)

[0290] -Pen-Strep(Sigma,P4333)

[0291] -Promega Fugene-HD (E2311)

[0292] -TCPOBOP(Sigma,T2320)

[0293] -CITCO(Cayman Chemicals Company,16027)

[0294] - The pcDNA6 plasmid containing the β-galactosidase gene was used as an internal control for transfection efficiency (Thermofisher, V22020).

[0295] - The mouse CAR expression plasmid was obtained from Jouan et al., 2016 (BioCat GmbH, EX-Z4288-M51-10-GC). This is because Huh7 lacks CAR.

[0296] β-galactosidase substrate solution (Thermofisher, 75707 / 75710)

[0297] -Pierce BCA Reagent Kit (23225)

[0298] -LARII (Dual-luciferase reporter 1000 analysis system, Promega, E1980)

[0299] -EPO ELISA kit (Abcam, ab119522)

[0300] method:

[0301] Day 1

[0302] Cells were seeded at a density of 25,000 cells / 300 μl in 48-well plates.

[0303] Day 2

[0304] - On the day of transfection, dilute the DNA to be transfected (CAR plasmid / PB1-MinTK can be operatively ligated to luciferase or EPO / pcDNA6 plasmid for internal control) to 100 ng / μl stock solution.

[0305] Transfection per 48 wells:

[0306] Mix 45 ng of DNA (15 ng each of plasmid, pcDNA6, CAR and test plasmid) with 4.1 μl of Optimem medium.

[0307] Mix 0.5 μl of Fusion HD with 4 μl of Optimem medium.

[0308] Mix the two solutions and incubate at room temperature for 15 minutes.

[0309] -Then the final solution is added dropwise into the well.

[0310] - Three hours after transfection, add the inducer TCPOBOP to the appropriate wells at the specified concentration.

[0311] Day 3

[0312] - Remove the culture medium from the cells 24 hours after induction.

[0313] - Wash cells once in 300 μl of DPBS.

[0314] Lyse cells using 100 μl of passive lysis buffer and incubate with shaking for 15 minutes.

[0315] - Cell debris was precipitated by centrifuging plates at maximum speed for 1 minute in a benchtop centrifuge.

[0316] - For luciferase, transfer 10 μl of sample to a white 96-well plate and measure luminescence by injecting 50 μl of LARII substrate.

[0317] - Using 25 μl of the lysate, measure β-galactosidase activity according to the manufacturer's instructions (Mammalian β-galactosidase Assay Kit, 75707 / 75710, Thermo Scientific). Transfer 25 μl of the lysate to a well of a microplate and mix with 25 μl of the β-galactosidase assay reagent. Equilibrate to room temperature. Incubate the mixture at 37 °C for 30 min and measure the absorbance at 405 nm.

[0318] -According to the manufacturer's instructions (Pierce) TM The BCA Protein Assay Kit (23225 / 23227, Thermo Scientific) uses 25 μl of lysate to measure protein concentration. Transfer 25 μl of lysate to the wells of a microplate and mix with 200 μl of working solution. Incubate the mixture at 37 °C for 30 min, cool to room temperature, and then measure the absorbance at approximately 562 nm. Calculate the protein concentration relative to a protein standard curve prepared from assay standards with known protein concentrations.

[0319] Luciferase readings were normalized to the concentrations of β-galactosidase and protein in the lysate to produce normalized relative photometric units (RLUs).

[0320] To make comparisons between experiments, the strength of the promoter was compared with that of the CMV-IE promoter, which drives the same gene as the construct containing PBREM, which was included in each experiment.

[0321] Transfection using PB1-MinTk-EPO was performed as described above, except that EPO was secreted into the culture medium. Therefore, the culture medium was collected, and the EPO concentration was measured using an ELISA kit according to the manufacturer's instructions (ab119522 Erythropoietin (EPO) Human ELISA Kit, Abcam). 50 μl of culture medium was transferred to pre-washed microplate wells and mixed with 50 μl of 1x biotin-binding antibody. The mixture was incubated at room temperature for 1 hour. The wells were washed, and 100 μl of streptavidin-HRP was added. The plates were incubated at room temperature for 15 minutes. The wells were then washed with 100 μl of TMB substrate solution. The mixture was incubated at room temperature for 10 minutes. The enzyme reaction was terminated by adding 100 μl of stop solution, and the absorbance was read at 450 nm. The EPO concentration was calculated based on an EPO standard curve prepared from standards with known EPO concentrations.

[0322] The PB1-MinTk construct was cloned into the vector pGL4.10 using KpnI and NcoI restriction sites. This places the promoter directly upstream of the firefly luciferase reporter gene. The PB1-MinTK construct contains a 51 bp enhancer and a minimal MinTK promoter from the herpes thymidine kinase gene.

[0323] result:

[0324] Figure 1 Luciferase expression in the PB1-MinTk construct in cell A showed that the promoter exhibited almost no measurable luciferase activity when cells were treated with the vector (DMSO). This activity corresponds to leaky expression of the promoter. Addition of 50 nM or 150 nM TCPOBOP resulted in strong induction of the promoter, with measured induction up to 6-fold. Addition of 250 nM TCPOBOP did not elicit an anomalous response from the promoter, suggesting that homeostatic control mechanisms may have been activated to prevent cellular overload. Therefore, the addition of TCPOBOP induced the PB1-MinTK construct in Huh7 cells. This induction was tunable, depending on the concentration of TCPOBOP, but decreased at higher concentrations.

[0325] exist Figure 1In B, luciferase expression from the PB1-MinTK construct was high in the presence of CAR and 150 nM TCPOBOP, as previously observed. Figure 1 As seen in A. However, when cells were transfected with PB1-MinTK but without CAR, no measurable activity was observed upon the addition of 150 nm of TCPOBOP. This could be explained by the fact that TCPOBOP has no receptor to bind to in the absence of CAR. Therefore, induction is CAR-dependent and appears to be a highly liver-specific process.

[0326] In summary, these results indicate that the PB1-MinTk construct can be induced by the addition of TCPOBOP in Huh7 cells, the induction is tunable and CAR-dependent, and expression from a single element is sufficient to drive 40% of CMV-IE gene expression.

[0327] Figure 1 The experimental data shown in A are... Figure 1 C represents the percentage of luciferase expression in the strong viral promoter CMV-IE. This indicates that luciferase expression from a single PBREM element linked to the MinTK promoter is sufficient to drive 40% of the luciferase expression in the CMV-IE promoter. Figure 1 C also showed that, in the absence of CAR, there was no luciferase expression from the PB1-MInTK construct.

[0328] The PB1-MinkTK promoter was then used to drive the expression of the protein EPO, which is of therapeutic interest. Expression was driven in Huh7 cells transfected with the PB1-MinTK promoter, which is operatively linked to the EPO protein and a CAR plasmid. Transfection was performed as described previously, but EPO expression was induced by the human CAR inducer CITCO.

[0329] The human CAR inducer CITCO was used instead of the mouse inducer TCPOBOP because TCPOBOP does not activate human CAR. This means that TCPOBOP cannot be used in human cells, which are the ultimate target of this invention. This is also to ensure that mouse PBREM elements can be activated by human CAR, which is induced using the human CAR inducer CITCO.

[0330] After transfection into Huh7 cells and treatment with DMSO, 0.5 μM, 1 μM, 2 μM, and 3 μM CITCO, EPO expression from the PB1-MinTK construct was as follows: Figure 1Figure D shows that EPO expression was very low without the drug, but EPO production increased significantly with the addition of up to 2 μM CITCO. This returned to the baseline activity at the highest concentration. The figure also shows that the addition of CITCO did not alter EPO expression from the promoter CMV-MP. In this example, the total EPO expression level of PB1-MinTk was approximately 22% of the EPO expression of CMV-IE (data not shown). This is consistent with previous findings. Figure 1 The 40% difference observed in C is due to CITCO being a weaker CAR activity inducer than TCPOBOP.

[0331] PB1-MinTk was used to successfully drive the regulated expression of luciferase and EPO.

[0332] Example 2

[0333] The PBREM element was then used in combination with two other minimal promoters to test inducibility and expression. PBREM was cloned prior to the CMV, MinTK, and SV40 minimal promoters and introduced into AXOL ARE-hepatocytes.

[0334] Axol Assay-Ready Expanded (ARE) hepatocytes are primary human hepatocytes that have already been expanded in vitro. They are available in large quantities (up to 2000 vials), ensuring a reliable, ready-to-use, and consistent source of primary hepatocytes. ARE hepatocytes express CYP enzymes, are metabolically active, are polarized, and can be infected with hepatitis C virus. AXOL ARE hepatocytes express CAR, eliminating the need for CAR-expressing plasmid transfection.

[0335] Material:

[0336] -AXOL assay-ready expanded (ARE) hepatocytes (Axol, ax3701)

[0337] -ARE hepatocyte thawing medium (Axol, AX3705)

[0338] -ARE maintenance medium (Axol, ax3710)

[0339] -Virimer red transfection reagent (Lipocalyx, VR04-02-15)

[0340] -CITCO, luciferase, β-galactosidase, and BCA kits as described above

[0341] method:

[0342] Culture and transfect ARE hepatocytes according to the manufacturer's instructions.

[0343] 200,000 cells were seeded in 2 ml of culture medium in collagen-coated 6-well plates. Cells were incubated at 37°C and 5% CO2 for 4 hours to achieve sufficient adhesion. 200 μl of a transfection mixture containing the DNA to be transfected (PB1-MinTK / PB1-CMV / PB1-SV40 operatively linked to a promoter containing luciferase and β-galactosidase) was added, and cells were incubated at 37°C and 5% CO2 on an orbital oscillator at 100 rpm for 3 hours. Three hours after transfection, CITCO was added to the appropriate wells. Cells were incubated overnight at 37°C and 5% CO2 under static conditions, and the medium was replaced with fresh ARE hepatocyte maintenance medium in the morning. Readings were taken 24 hours after induction.

[0344] result:

[0345] Figure 2 Luciferase expression from the PB1-MinTK, PB1-CMV-MP, and PB1-SV40-MP constructs in data A showed that each minimal promoter supported expression from the PBREM element after the addition of 1 μM CITCO. SV40 and MinTK showed approximately 7-fold induction, while the CMV-IE promoter showed 2-fold induction. Compared to CMV-IE, the expression levels of each construct (PB1-MinTK, PB1-CMV, and PB1-SV40) were 20%, 10%, and 55%, respectively. SV40 drove the highest expression, but at the cost of higher background levels. The CMV minimal promoter showed little or no expression. Based on these data, the original MinTk construct appears to offer the best trade-off between expression levels, induction, and tight control (i.e., minimizing background expression).

[0346] PBREM can be used in combination with various minimal promoters to drive inducible expression.

[0347] Example 3

[0348] This experiment was conducted to examine whether the poly-NR binding sites subsequently increased promoter activity. Therefore, we cloned 2, 3, and 4 replicates of the PBREM element preceding the MinTk, CMV, and SV40 minimal promoters. An important consideration here was the spacing between elements; we followed the general rule of a 5 bp spacing, meaning elements spaced 5 bp apart would not spatially obstruct each other. Utilizing internal knowledge from previous inducible promoter designs, we cloned elements spaced 20 bp apart. These multimers were cloned into the previously described pGL4.10 plasmid. These constructs were then tested in AXOL ARE hepatocytes, as previously described.

[0349] MinTK promoter:

[0350] PB1-MinTK, PB1-1-MinTK, PB1-2-MinTK, and PB1-3-MinTK contain 1, 2, 3, and 4 PBREM elements combined with the MinTK minimal promoter, respectively. Upon induction with 1 μl CITCO, luciferase expression from the PB1-1-MinTK, PB1-2-MinTK, and PB1-3-MinTK constructs was [data missing]. Figure 3 C shows that the multimer was induced and its expression level increased. However, this increase in expression level was only observed in the three copies of the PBREM element (PB1-2), as the addition of another element appears to have an adverse effect on induction and expression levels. Each multimer was induced to CMV-IE at 1.5, 4.1, and 2.66, respectively. However, the induction levels were similar to the original PB1-MinTK structure described here as PB1. This is due to increased background activity of the promoter. Results are expressed as a ratio to CMV-IE. Results are the average of three biological replicates.

[0351] SV40 Minimum Starter:

[0352] PB1-SV40, PB1-1-SV40, PB1-2-SV40, and PB1-3-SV40 contain 1, 2, 3, and 4 elements respectively, combining PBREM with the SV40 minimum promoter. Figure 3In A, luciferase expression from the PB1-1-SV40, PB1-2-SV40, and PB1-3-SV40 constructs was induced with 1 μl CITCO, showing that the multimers were indeed induced and their expression levels increased. However, as previously described, an increase in the expression level of only 3 copies of the PBREM element was observed because the addition of another element appeared to have an adverse effect on induction and expression levels. Each multimer was induced to CMV-IE at 2.6, 3.6, and 2.57, respectively. The induction level was higher than the 6-fold increase seen with the MinTk minimal promoter, and the induction level was up to 9-fold. Similarly, background expression levels were also increased, but this was much lower than with the CMV-MP promoter described below. Results are expressed as a ratio to CMV-IE. Results are the average of 3 biological replicates.

[0353] CMV promoter:

[0354] PB1-CMV, PB1-1-CMV, PB1-2-CMV, and PB1-3-CMV contain 1, 2, 3, and 4 PBREM elements associated with the CMV minimum promoter, respectively. Figure 3 In B, luciferase expression from the PB1-1-CMV, PB1-2-CMV, and PB1-3-CMV constructs induced with 1 μl CITCO showed that the multimers were induced and indeed showed increased expression levels. However, as previously noted, this increase in expression levels was only observed in the three copies of the PBREM element, as adding another element appeared to have no effect on induction and expression levels. Each multimer was induced to CMV-IE values ​​of 1.9, 2.67, and 2.67, respectively. The induction levels were lower than those observed with the MinTk or SV40 minimal promoter, up to a maximum of 5-fold. Using the CMV minimal promoter appears to raise background expression levels to very high levels, thus it is likely the worst candidate to be evaluated.

[0355] Increasing the number of PBREM elements can raise the expression level to 3 PBREM elements. Further increasing the number of PBREM elements to 4 leads to a decrease in luciferase expression.

[0356] Example 4

[0357] Based on Example 3, it was decided to use PB1-MinTK and PB1-2-MinTk for in vivo studies. To facilitate this, the two constructs were cloned into the pAAV vector (Takara, Clontech) to prepare AAV virus. The insert fragment was cloned using restriction digestion of the pAAV plasmid and PCR amplification of the original pGL4.10 construct.

[0358] We investigated the effect of inverted terminal repeat (ITR) sequences on promoter activity. This was because we observed interference with AAV ITRs in other projects. To this end, as previously described, pAAV-PB1-MinTk and pAAV-PB1-2-MinTk were transfected into Huh7 and ARE primary cells, and their activity was evaluated.

[0359] The results of these experiments can be found Figure 4 See A and 4B. These figures represent the average of three biological replications and show that the ITR does not affect promoter performance. Luciferase expression induction from the PB1-MinTK and PB1-2-MinTK constructs is comparable across vectors and cell types. These constructs are very robust, and the plasmid backbone appears to have no effect on activity.

[0360] Example 5

[0361] Luciferase expression in the pAAV vector of AXOL ARE hepatocytes, specifically the PB1-MinTK and PB1-2-MinTK constructs, was induced by CITCO (1 μM), but decreased upon removal of CITCO. Figure 5 As shown in the figure, this indicates that drug removal reduces promoter activity to near baseline levels.

[0362] Example 6 - In vivo experiments using AAV induced by PB1 and PB1-2

[0363] From the previous application, constructs PB1 (a single mouse PBREM element and a Min-TK promoter) and PB1-2 (3xPBREM and a Min-TK promoter) were selected for in vivo testing in mice. This was done as follows.

[0364] The AAV constructs from the previously filed PB1 and PB1-2, with sequences as follows (SEQ ID NO 49 and 50, Table 3), are used to manufacture AAV viruses.

[0365] AAV production

[0366] Day 1:

[0367] - Seed HEK 293-AAV cells into 15cm plates. 70-80% confluence on the day of transfection. - Final volume per plate: 15ml

[0368] Day 2: Preparation of transfection mixture:

[0369] - DNA mixture / plate: PDG9 (packaging plasmid for AAV 9): 10.5 μg / pHGTI (Ad. helper plasmid): 31.5 μg / vector plasmid: 10.5 μg / prepared in DMEM / Optimem-free serum.

[0370] - Transfer mixture / plate: PEI: 125 μl / prepared in DMEM / Optimem-free serum.

[0371] Add the DNA mixture to the transfection mixture. Mix and incubate at room temperature for 15-20 minutes.

[0372] - will 3 ml Add the transfection mixture dropwise to each plate and disperse gently. Incubate for 24 hours.

[0373] Day 3:

[0374] Replace the culture medium with 15 ml DMEM and add P / S and 2% FCS. Incubate for 48 hours.

[0375] Day 5:

[0376] Collect the supernatant and store it in 50ml test tubes, 25ml per tube. Store at -20℃.

[0377] - Collect cells: Add 5 ml of PBS to each plate → scrape and collect in a 50 ml test tube.

[0378] - To clean the plate, add 1 ml of PBS and collect it.

[0379] - Rotate at 1500 rpm for 5 minutes.

[0380] - Remove the supernatant and resuspend the precipitated cells in 1 ml / plate TD lysis buffer → pool

[0381] Store at -80℃.

[0382] Nucleotide endonuclease treatment

[0383] cell:

[0384] - Freeze and thaw the precipitate 5 times → about 20 minutes at 37°C, then about 20 minutes in dry ice (or -80°C).

[0385] - Add 25 μl / ml of 20% deoxycholate to the cells (or 50 μl / ml of 10% deoxycholate).

[0386] - Add 8 μl / ml of benzo[a]ase to the cells.

[0387] - Incubate at 37°C for 30 minutes.

[0388] - Spin at 4K rpm for 30 minutes.

[0389] - Filter the supernatant using a 0.45μM filter.

[0390] - Store at 4°C for a maximum of 24 hours.

[0391] Supernatant:

[0392] Add 2.5 μl / 25 ml of benzo[a]ase to the supernatant.

[0393] Add 50 μl / 25 ml of MgSO4 to the supernatant.

[0394] - Incubate at 37°C for 30 minutes.

[0395] - Spin at 4K rpm for 30 minutes.

[0396] - Filter the supernatant using a 0.45μM filter.

[0397] - Store at 4°C for a maximum of 24 hours.

[0398] HPLC purification

[0399] - Immerse both pipelines in 20% ETOH → Template → System Cleaning

[0400] Place tubing A in PBS and tubing B in glycine → Template → System cleaning

[0401] - Place the column in the machine → Run manually → Flow rate: 5 ml / min → Run for 25 ml or until the UV line flattens.

[0402] -Prepare FACS tubes (10 cells, more supernatant): Add 30 μl / tube of Tris → Place in the machine to collect the vector.

[0403] - Place the waste liquid line in a separate test tube so that it can pass through the chromatographic column again.

[0404] - Run the sample (low flow rate, depending on the system speed and sample concentration; slower for cells, higher for supernatant).

[0405] - After passing the waste through the chromatographic column, wash with PBS → flow rate: 5 ml / min until the UV line flattens.

[0406] -Settings → Fraction size: 1ml; Flow rate: 1ml / min; Concentration %B: 100% → Run.

[0407] - Begin collection: Look for peaks. Peaks indicate vector purification. Label the tubes containing these vectors.

[0408] Save the program before exiting.

[0409] Wash with PBS → 75ml, 5ml / min

[0410] - Wash with Na3PO4 (store the column in it) → 75 ml, 5 ml / min

[0411] Remove the chromatographic column and store it at 4°C.

[0412] - Clean the machine with PBS → Template → System cleaning

[0413] Clean the machine with 20% ETOH → template → system cleaning

[0414] - Place both tubing lines in 20% ETOH, then shut off.

[0415] Add 2L of PBS to the large container and place it into the dialysis box (Side-A-Lyzer; Thermo Scientific) for perfusion.

[0416] - Collect the carrier from the labeled FACS tube using a syringe and needle and add it to the dialysis cassette → Remove excess air from the membrane, carefully place the rubber on top of the cassette and let it float in a bucket containing PBS → Incubate overnight at room temperature on a slowly rotating rotor.

[0417] The next day:

[0418] - Prepare the membrane by adding 5 ml of PBS to the centrifuge filter (Amico Ultra 15; MERCK) → Rotate at 4,000 rpm for 5 minutes.

[0419] - Remove excess PBS from the membrane.

[0420] - Remove the carrier from the box and load it onto the membrane → Rotate at 4,000 rpm for 5 minutes

[0421] - Wash the membrane several times with the carrier inside, then collect it into a 2ml centrifuge tube and filter it with 0.22μM (Spin-X; COSTAR).

[0422] - Rotate at 13Krpm for 3 minutes.

[0423] - Remove the filter and divide it into equal portions: 1 x 100 μl (for injection) and the remaining 10-2 μl.

[0424] Store at -80℃.

[0425] Virus quantification was performed using primers and probes for qRT-PCR and the luciferase gene.

[0426] Mouse experiment

[0427] The chosen AAV serotype was AAV9 because it exhibits chemotaxis to most tissues and organs, thus allowing us to understand the specificity of our promoter (avoiding AAV chemotaxis issues). The experimental output was luciferase activity measured using the first read count on day 5 post-injection. Mice were then monitored weekly, and after 35 days, once the control vector AAV9 with CMVIE showed consistent, stable results, a baseline induction profile was established. At this point, the inducer was added, and measurements were taken before and after induction. See below for more details.

[0428] Mice:

[0429] Adult (8-week-old) male CD1 mice were injected with the AAV9 vector via the tail vein.

[0430] - A total of 5x10 doses were administered to each mouse. 11 Number of vector genome copies / ml.

[0431] - Imaging of mice was performed 5 days after injection. They were first anesthetized and received an intraperitoneal injection of fluorescein (300 μl of fluorescein stock solution at 15 mg / ml). Five minutes later, the mice were placed in an IVIS machine and images were acquired.

[0432] Imaging:

[0433] - Exposure times for the image are 1 second and 10 seconds.

[0434] - Images are taken weekly.

[0435] - In addition, the mice were imaged daily for four days before being given the inducer or inhibitor.

[0436] Inducement:

[0437] - The concentration of the inducer (phenobarbital) was 5 mg / ml. 10 μl was administered intraperitoneally to mice, which is equivalent to 50 micrograms per mouse (each mouse weighs approximately 30 g).

[0438] result

[0439] The experimental results are shown in Figure 8. Figure 8ARepresentative mice from each test construct are shown. Here we can see that PB1 and PB1-2 expression is confined to the liver, while the CMV-IE promoter is expressed in almost all mouse tissues. Furthermore, at 0 hours, PB1 and PB1-2 mice showed no expression of the luciferase gene, indicating that expression was tightly controlled. However, upon addition of the inducer phenobarbital, we can see an increase in the expression of both PB1 and PB1-2. The magnitude and duration of induction varied. For example, PB1 was induced approximately 10-fold, reaching maximum activity at 9 hours, with induction completed at 24 hours, while PB1-2 showed a maximum activity increase of approximately 50-fold at 24 hours, with induction not completed until 48 hours post-injection. Figure 8B and 8C These data confirm the findings observed in model cell lines and further demonstrate the potential of this induction system for in vivo applications. The system exhibits low background and good inducibility, even when the dose of inducer is 10 times lower than the recommended human dose.

[0440] Example 7 – Variant of PBREM Element

[0441] As mentioned above, the nuclear receptor CAR binds to the DNA sequences of humans and mice. Sequence alignment reveals some sequence differences between species. The 51bp modular PBREM element itself can be divided into three distinct parts (see table below): 1) the NR1 region (containing the NR1 element), which is believed to be responsible for most of the induction activity; 2) the NF1 region (containing the NF1 element), which binds to other nuclear receptors and may be responsible for reducing background levels in the absence of activated CAR; and 3) the NR2 region (containing the NR2 element), which again participates in CAR induction activity.

[0442] The comparison and depiction of the components that make up a PBREM element are shown below:

[0443] MouseTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC 51

[0444] Human ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA 51

[0445] **************** ** *** ** *** **** ***** *

[0446] (Mouse = SEQ ID NO:1, Human = SEQ ID NO:2)

[0447] Table 4 – Mouse and Human PBREM Sequences:

[0448]

[0449] In the preceding example, the promoter variant used contained a mouse PBREM element. To confirm our expectation that a human PBREM element could also be used, we also evaluated the inducibility of human PBREM; this is likely relevant because one of the goals of this project is to provide inducible promoters for human gene therapy, and human sequences may offer some advantages. Furthermore, we evaluated human and mouse heterozygotes of the PBREM element to determine if we could modulate or improve the promoter's inducibility and background levels. This novel combination is not found in any natural environment and may possess novel characteristics, such as background and inducibility levels. As previously mentioned, the constructs were tested in the PGL4.10 backbone and are listed in Table 2 below. They are: human NR1x3-Min TK (3x human NR1 region with MinTK minimum promoter); human PBREM-minTK (human PBREM with MinTK minimum promoter); hNR1-mNFI-hNR2-Min TK (human-mouse-human hybrid with MinTK minimum promoter); hNR1-mNFI mNR2-Min TK (human-mouse-mouse hybrid with MinTK minimum promoter); mNR1-hNFI-mNR2-Min TK (mouse-human-mouse hybrid with MinTK minimum promoter); mNR1-hNFI-hNR2-Min TK (mouse-human-mouse hybrid with MinTK minimum promoter); mNR1-hNFI-hNR2-Min TK (mouse-human-human hybrid with MinTK minimum promoter); hPB-SV40 (human PBREM with SV40 minimum promoter); and MHM-SV40 (mouse-human-mouse hybrid with SV40 minimum promoter) — SEQ ID NO: 59 to 66, respectively.

[0450] As previously mentioned, these constructs were tested in stable Huh7 cell lines and primary hepatocytes. In addition, to test the constructs using the conventional human CAR activator CITCO, we also tested the natural compound flavonoid. This is a GRAS (Generally Recognized As Safe) product, previously reported to activate human CARs, and may be a useful agent for gene therapy applications due to its non-toxic nature and few side effects. CITCO is predicted to be relatively unstable in vivo, and there is no data on its safety for use in humans; therefore, it is preferred for use only in tissue cultures. Furthermore, the above in vivo results used phenobarbital as an inducer. In some cases, the use of phenobarbital may be undesirable, even at doses 10 times lower than recommended (which seems possible given the data above). Therefore, flavonoids may be a more ideal inducer to alleviate any safety or regulatory concerns.

[0451] The results of these experiments can be found Figure 9 and 10 These figures show a comparison with PB1 as tested in vivo. In the Huh7 cell line stably expressing CAR (… Figure 9 ) and primary cells ( Figure 10 In the study, human PBREM (hPB) behaved almost identically to mouse PBREM (PB1), suggesting they are interchangeable with the min-TK and SV40 minimal promoters. Among the heterozygotes tested, all except the MHM heterozygote were induced to levels similar to PB1 and to similar backgrounds. It exhibited lower background and lower overall activity but good inducibility, suggesting it may have tighter expression control than the PB1 construct; this is independent of the minimal promoter environment, as its hybridization with min-TK and SV40 showed similar results. Flavonoid-induced levels in all constructs were similar to CITCO, indicating that this compound is indeed a useful inducer for PBREM constructs. A slight anomaly in these experiments was the construct consisting of 3x NR1 from human PBREM. It had a relatively high background and was induced only in stable cell lines, with less induction in primary cells.

[0452] Similar methods to those used in the examples above were applied in these experiments. The best monomers, human PBREM and MHM hybrids, were polymerized and tested using the Min-Tk minimal promoter and the SV40 minimal promoter. The sequences of these polymers are shown in Table 3. The promoters are: 2xhPB SV40 (2x human PBREM element with SV40 minimal promoter); 2xMHM-MinTK (2x mouse-human-mouse hybrid with MinTK minimal promoter); 2xMHM-SV40 (2x mouse-human-mouse hybrid with SV40 minimal promoter); 3xhPB minTK (3x human PBREM element with MinTK minimal promoter); and xhPB-SV40 (3x human PBREM element with SV40 minimal promoter) - SEQ ID NOs are 67 to 71, respectively.

[0453] As previously described, promoter expression and induction were assessed using CITCO and flavonoids in stable Huh7 CAR cell lines and primary hepatocytes.

[0454] See results Figure 11 and 12The comparison here is with the earlier example PB1-2. It can be observed that both multimeric promoters are highly inducible to both compounds, and they exhibit very low background regardless of the minimum promoter used. Furthermore, 2xMHM and 3xhPB performed best, with overall expression levels higher than those observed in PB1-2 and comparable background levels. This suggests that some new promoters may perform better in vivo and provide more options for controlling gene expression as needed.

[0455] sequence

[0456] Table 1 – PBREM Components, Variants and Parts

[0457]

[0458]

[0459] The NR1 motif is underlined, the NF1 motif is bolded, and the NF2 motif is double-underlined.

[0460] Table 2 – Inducible promoters containing mouse PBREM elements

[0461]

[0462]

[0463]

[0464]

[0465]

[0466]

[0467]

[0468]

[0469]

[0470] PBREM elements are underlined; the smallest promoter is indicated in bold; gene sequences are double underlined.

[0471] Table 3 – Constructs and other sequences.

[0472]

[0473]

[0474]

[0475]

[0476]

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483]

[0484]

[0485]

[0486]

[0487]

[0488]

[0489]

[0490]

[0491]

[0492]

[0493]

[0494]

[0495]

[0496]

[0497] sequence list <110> Sepulmax Ltd. <120> Liver-specific inducible promoters and their usage <130> P265002WO <150> GB1900741.8 <151> 2019-01-18 <160> 91 <170> PatentIn version 3.5 <210> 1 <211> 51 <212> DNA <213> mouse muscle <400> 1 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac c 51 <210> 2 <211> 51 <212> DNA <213> Homo sapiens <400> 2 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc a 51 <210> 3 <211> 16 <212> DNA <213> mouse muscle <400> 3 tgtactttcc tgacct 16 <210> 4 <211> 16 <212> DNA <213> Homo sapiens <400> 4 tgtactttcc tgaccc 16 <210> 5 <211> 84 <212> DNA <213> Artificial sequence <220> <223> 3x NR1 sequences (mice) <400> 5 gatctctgta ctttcctgac cttggatcga tctctgtact ttcctgacct tggatcgatc 60 tctgtacttt cctgaccttg gatc 84 <210> 6 <211> 84 <212> DNA <213> Artificial sequence <220> <223> 3x NR1 sequence (human) <400> 6 gatcactgta ctttcctgac cctggatcga tcactgtact ttcctgaccc tggatcgatc 60 actgtacttt cctgaccctg gatc 84 <210> 7 <211> 262 <212> DNA <213> Artificial sequence <220> <223> PB1-MinTK <400> 7 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac cgatccggcc 60 ccgcccagcg tcttgtcatt ggcgaattcg aacacgcaga tgcagtcggg gcggcgcggt 120 ccgaggtcca cttcgcatat taaggtgacg cgtgtggcct cgaacaccga gcgaccctgc 180 agcgacccgc ttaacagcgt caacagcgtg ccgcagatct cgaggagctt ggcgagattt 240 tcaggagcta aggaagctaa ac 262 <210> 8 <211> 180 <212> DNA <213> Artificial sequence <220> <223> PB1-CMV-MP <400> 8 60. tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac cgctggggagt tcgtagcgg together ccatatgcag gtctatataa gcagagctcg tttagtgaac cgtcagatcg cctagatacg cctccacgc tgttttgacc tccatagaag atcgccaccc 180 <210> 9 <211> 330 <212> DNA <213> The snowstorm <220> <223> PB1‐SV40‐MP <400> 9 60. tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac cgctggggagt 120. tcgtagcgg actagcccgg gctcgagatc tgcgatctgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct 180 ccgccccatc gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct 240 gagctattcc agaagtagtg aggaggcttt tttggaggcc tagcttttg caaaaaagctt ggcattccgg tactgttggt aaagccaccc 330 <210> 10 <211> 353 <212> DNA <213> The snowstorm <220> <223> PB1‐1‐MinTk (2xPBREM) <400> 10 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgctgggag ttcgtagacg gagatccggc cccgcccagc gtcttgtcat tggcgaattc 180 gaacacgcag atgcagtcgg ggcggcgcgg tccgaggtcc acttcgcata ttaaggtgac 240 gcgtgtggcc tcgaacaccg agcgaccctg cagcgacccg cttaacagcg tcaacagcgt 300 gccgcagatc tcgaggagct tggcgagatt ttcaggagct aaggaagcta aac 353 <210> 11 <211> 424 <212> DNA <213> Artificial Sequence <220> <223> PB1-2-MinTk (3xPBREM) <400> 11 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgcactgaa ggtcctcaat cgtctgtact ttcctgacct tggcacagtg ccaccatcaa 180 cttgcctgac accgctggga gttcgtagac ggagatccgg ccccgcccag cgtcttgtca 240 ttggcgaatt cgaacacgca gatgcagtcg gggcggcgcg gtccgaggtc cacttcgcat 300 attaaggtga cgcgtgtggc ctcgaacacc gagcgaccct gcagcgaccc gcttaacagc 360 gtcaacagcg tgccgcagat ctcgaggagc ttggcgagat tttcaggagc taaggaagct 420 aaac 424 <210> 12 <211> 495 <212> DNA <213> Artificial sequence <220> <223> PB1-3-MinTk <400> 12 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgcactgaa ggtcctcaat cgtctgtact ttcctgacct tggcacagtg ccaccatcaa 180 cttgcctgac accctgacct cctgccagca atatctgtac tttcctgacc ttggcacagt 240 gccaccatca acttgcctga caccgctggg agttcgtaga cggagatccg gccccgccca 300 gcgtcttgtc attggcgaat tcgaacacgc agatgcagtc ggggcggcgc ggtccgaggt 360 ccacttcgca tattaaggtg acgcgtgtgg cctcgaacac cgagcgaccc tgcagcgacc 420 cgcttaacag cgtcaacagc gtgccgcaga tctcgaggag cttggcgaga ttttcaggag 480 ctaaggaagc taaac 495 <210> 13 <211> 401 <212> DNA <213> Artificial sequence <220> <223> PB1-1-SV40 <400> 13 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgctgggag ttcgtagacg gactagcccg ggctcgagat ctgcgatctg catctcaatt 180 agtcagcaac catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt 240 ccgcccattc tccgccccat cgctgactaa ttttttttat ttatgcagag gccgaggccg 300 cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt 360 gcaaaaagct tggcattccg gtactgttgg taaagccacc c 401 <210> 14 <211> 472 <212> DNA <213> Artificial sequence <220> <223> PB1-2-SV40 <400> 14 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgcactgaa ggtcctcaat cgtctgtact ttcctgacct tggcacagtg ccaccatcaa 180 cttgcctgac accgctggga gttcgtagac ggactagccc gggctcgaga tctgcgatct 240 gcatctcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac 300 tccgcccagt tccgcccatt ctccgcccca tcgctgacta atttttttta tttatgcaga 360 ggccgaggcc gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg 420 cctaggcttt tgcaaaaagc ttggcattcc ggtactgttg gtaaagccac cc 472 <210> 15 <211> 543 <212> DNA <213> Artificial Sequence <220> <223> PB1-3-SV40 <400> 15 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgcactgaa ggtcctcaat cgtctgtact ttcctgacct tggcacagtg ccaccatcaa 180 cttgcctgac accctgacct cctgccagca atatctgtac tttcctgacc ttggcacagt 240 gccaccatca acttgcctga caccgctggg agttcgtaga cggactagcc cgggctcgag 300 atctgcgatc tgcatctcaa ttagtcagca accatagtcc cgcccctaac tccgcccatc 360 ccgcccctaa ctccgcccag ttccgcccat tctccgcccc atcgctgact aatttttttt 420 atttatgcag aggccgaggc cgcctcggcc tctgagctat tccagaagta gtgaggaggc 480 ttttttggag gcctaggctt ttgcaaaaag cttggcattc cggtactgtt ggtaaagcca 540 ccc 543 <210> 16 <211> 251 <212> DNA <213> Artificial sequence <220> <223> PB1-1-CMV <400> 16 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgctgggag ttcgtagacg gagcgattaa tccatatgca ggtctatata agcagagctc 180 gtttagtgaa ccgtcagatc gcctagatac gccatccacg ctgttttgac ctccatagaa 240 gatcgccacc c 251 <210> 17 <211> 322 <212> DNA <213> Artificial sequence <220> <223> PB1-2-CMV <400> 17 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgcactgaa ggtcctcaat cgtctgtact ttcctgacct tggcacagtg ccaccatcaa 180 cttgcctgac accgctggga gttcgtagac ggagcgatta atccatatgc aggtctatat 240 aagcagagct cgtttagtga accgtcagat cgcctagata cgccatccac gctgttttga 300 cctccataga agatcgccac cc 322 <210> 18 <211> 393 <212> DNA <213> Artificial sequence <220> <223> PB1-3-CMV <400> 18 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgcactgaa ggtcctcaat cgtctgtact ttcctgacct tggcacagtg ccaccatcaa 180 cttgcctgac accctgacct cctgccagca atatctgtac tttcctgacc ttggcacagt 240 gccaccatca acttgcctga caccgctggg agttcgtaga cggagcgatt aatccatatg 300 caggtctata taagcagagc tcgtttagtg aaccgtcaga tcgcctagat acgccatcca 360 cgctgttttg acctccatag aagatcgcca ccc 393 <210> 19 <211> 1023 <212> DNA <213> Artificial Sequence <220> <223> PB1 - MinTK and EPO <400> 19 ggcctaactg gccggtactc tgtactttcc tgaccttggc acagtgccac catcaacttg 60 cctgacaccg atccggcccc gcccagcgtc ttgtcattgg cgaattcgaa cacgcagatg 120 cagtcggggc ggcgcggtcc gaggtccact tcgcatatta aggtgacgcg tgtggcctcg 180 aacaccgagc gaccctgcag cgacccgctt aacagcgtca acagcgtgcc gcagatctcg 240 aggagcttgg cgagattttc aggagctaag gaagctaaac atgggggtgc acgaatgtcc 300 tgcctggctg tggcttctcc tgtccctgct gtcgctccct ctgggcctcc cagtcctggg 360 cgccccacca cgcctcatct gtgacagccg agtcctggag aggtacctct tggaggccaa 420 ggaggccgag aatatcacga cgggctgtgc tgaacactgc agcttgaatg agaatatcac 480 tgtcccagac accaaagtta atttctatgc ctggaagagg atggaggtcg ggcagcaggc 540 cgtagaagtc tggcagggcc tggccctgct gtcggaagct gtcctgcggg gccaggccct 600 gttggtcaac tcttcccagc cgtgggagcc cctgcagctg catgtggata aagccgtcag 660 tggccttcgc agcctcacca ctctgcttcg ggctctggga gcccagaagg aagccatctc 720 ccctccagat gcggcctcag ctgctccact ccgaacaatc actgctgaca ctttccgcaa 780 actcttccga gtctactcca atttcctccg gggaaagctg aagctgtaca caggggaggc 840 ctgcaggaca ggggacagat gatctagagt cggggcggcc ggccgcttcg agcagacatg 900 ataagataca ttgatgagtt tggacaaacc acaactagaa tgcagtgaaa aaaatgcttt 960 atttgtgaaa tttgtgatgc tattgcttta tttgtaacca ttataagctg caataaacaa 1020 gtt 1023 <210> 20 <211> 16 <212> DNA <213> Artificial sequence <220> <223> NR1 motif from PBREM <220> <221> misc_feature <222> (16)..(16) <223> n is a, c, g, or t <400> 20 tgtactttcc tgaccn 16 <210> twenty one <211> 17 <212> DNA <213> Artificial sequence <220> <223> Preferred sequences included in functional variants of PBREM elements <220> <221> misc_feature <222> (17)..(17) <223> n is a, c, g, or t <400> twenty one ctgtactttc ctgaccn 17 <210> twenty two <211> 17 <212> DNA <213> Artificial sequence <220> <223> Preferred sequences included in functional variants of PBREM elements <400> twenty two ctgtactttc ctgaccy 17 <210> twenty three <211> 17 <212> DNA <213> Artificial sequence <220> <223> Preferred sequences included in functional variants of PBREM elements <400> twenty three ctgtactttc ctgacct 17 <210> twenty four <211> 17 <212> DNA <213> Artificial sequence <220> <223> Preferred sequences included in functional variants of PBREM elements <400> twenty four ctgtactttc ctgaccc 17 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g, or t <220> <221> misc_feature <222> (18)..(18) <223> n is a, c, g, or t <400> 25 nctgtacttt cctgaccntg 20 <210> 26 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <400> 26 wctgtacttt cctgaccytg 20 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <400> 27 tctgtacttt cctgaccttg 20 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <400> 28 actgtacttt cctgaccctg 20 <210> 29 <211> 16 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (16)..(16) <223> Optional spacers <220> <221> misc_feature <222> (16)..(16) <223> n is a, c, g, or t <400> 29 tgtactttcc tgaccn 16 <210> 30 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (17)..(17) <223> Optional spacers <220> <221> misc_feature <222> (17)..(17) <223> n is a, c, g, or t <400> 30 ctgtactttc ctgaccn 17 <210> 31 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g, or t <220> <221> misc_feature <222> (18)..(18) <223> n is a, c, g, or t <220> <221> misc_feature <222> (20)..(20) <223> Optional spacers <400> 31 nctgtacttt cctgaccntg 20 <210> 32 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (16) (17) <223> Optional spacers <220> <221> misc_feature <222> (16)..(16) <223> n is a, c, g, or t <220> <221> misc_feature <222> (32)..(32) <223> n is a, c, g, or t <400> 32 tgtactttcc tgaccntgta ctttcctgac cn 32 <210> 33 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (16) (17) <223> Optional spacers <220> <221> misc_feature <222> (16)..(16) <223> n is a, c, g, or t <220> <221> misc_feature <222> (32)..(32) <223> n is a, c, g, or t <220> <221> misc_feature <222> (32) (33) <223> Optional spacers <220> <221> misc_feature <222> (48)..(48) <223> n is a, c, g, or t <400> 33 tgtactttcc tgaccntgta ctttcctgac cntgtacttt cctgaccn 48 <210> 34 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (17) (18) <223> Optional spacers <220> <221> misc_feature <222> (17)..(17) <223> n is a, c, g, or t <220> <221> misc_feature <222> (34)..(34) <223> n is a, c, g, or t <400> 34 ctgtactttc ctgaccnctg tactttcctg accn 34 <210> 35 <211> 51 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (17) (18) <223> Optional spacers <220> <221> misc_feature <222> (17)..(17) <223> n is a, c, g, or t <220> <221> misc_feature <222> (34)..(34) <223> n is a, c, g, or t <220> <221> misc_feature <222> (34) (35) <223> Optional spacers <220> <221> misc_feature <222> (51)..(51) <223> n is a, c, g, or t <400> 35 ctgtactttc ctgaccnctg tactttcctg accnctgtac tttcctgacc n 51 <210> 36 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g, or t <220> <221> misc_feature <222> (18)..(18) <223> n is a, c, g, or t <220> <221> misc_feature <222> (20) (21) <223> Optional spacers <220> <221> misc_feature <222> (21)..(21) <223> n is a, c, g, or t <220> <221> misc_feature <222> (38)..(38) <223> n is a, c, g, or t <400> 36 nctgtacttt cctgaccntg nctgtacttt cctgaccntg 40 <210> 37 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g, or t <220> <221> misc_feature <222> (18)..(18) <223> n is a, c, g, or t <220> <221> misc_feature <222> (20) (21) <223> Optional spacers <220> <221> misc_feature <222> (21)..(21) <223> n is a, c, g, or t <220> <221> misc_feature <222> (38)..(38) <223> n is a, c, g, or t <220> <221> misc_feature <222> (40) (41) <223> Optional spacers <220> <221> misc_feature <222> (41)..(41) <223> n is a, c, g, or t <220> <221> misc_feature <222> (58)..(58) <223> n is a, c, g, or t <400> 37 nctgtacttt cctgaccntg nctgtacttt cctgaccntg nctgtacttt cctgaccntg 60 <210> 38 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (20) (21) <223> Optional spacers <220> <221> misc_feature <222> (40) (41) <223> Optional spacers <400> 38 tctgtacttt cctgaccttg tctgtacttt cctgaccttg tctgtacttt cctgaccttg 60 <210> 39 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Sequences appropriately included in functional variants of the PBREM sequence <220> <221> misc_feature <222> (20) (21) <223> Optional spacers <220> <221> misc_feature <222> (40) (41) <223> Optional spacers <400> 39 actgtacttt cctgaccctg actgtacttt cctgaccctg actgtacttt cctgaccctg 60 <210> 40 <211> 8 <212> DNA <213> Artificial sequence <220> <223> spacer <400> 40 gatcgatc 8 <210> 41 <211> 51 <212> DNA <213> Artificial sequence <220> <223> The sequence is preferably included in the functional variant of the PBREM element. <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g, or t <220> <221> misc_feature <222> (18)..(18) <223> n is a, c, g, or t <220> <221> misc_feature <222> (21)..(25) <223> n is a, c, g, or t <220> <221> misc_feature <222> (29)..(29) <223> n is a, c, g, or t <220> <221> misc_feature <222> (32)..(32) <223> n is a, c, g, or t <220> <221> misc_feature <222> (36) (37) <223> n is a, c, g, or t <220> <221> misc_feature <222> (42)..(42) <223> n is a, c, g, or t <220> <221> misc_feature <222> (48) (49) <223> n is a, c, g, or t <220> <221> misc_feature <222> (51)..(51) <223> n is a, c, g, or t <400> 41 nctgtacttt cctgaccntg nnnnngtgnc ancatnnact tncctgannc n 51 <210> 42 <211> 102 <212> DNA <213> Artificial sequence <220> <223> CRM <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g, or t <220> <221> misc_feature <222> (18)..(18) <223> n is a, c, g, or t <220> <221> misc_feature <222> (21)..(25) <223> n is a, c, g, or t <220> <221> misc_feature <222> (29)..(29) <223> n is a, c, g, or t <220> <221> misc_feature <222> (32)..(32) <223> n is a, c, g, or t <220> <221> misc_feature <222> (36) (37) <223> n is a, c, g, or t <220> <221> misc_feature <222> (42)..(42) <223> n is a, c, g, or t <220> <221> misc_feature <222> (48) (49) <223> n is a, c, g, or t <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <220> <221> misc_feature <222> (51)..(51) <223> n is a, c, g, or t <220> <221> misc_feature <222> (52)..(52) <223> n is a, c, g, or t <220> <221> misc_feature <222> (69)..(69) <223> n is a, c, g, or t <220> <221> misc_feature <222> (72) (76) <223> n is a, c, g, or t <220> <221> misc_feature <222> (80)..(80) <223> n is a, c, g, or t <220> <221> misc_feature <222> (83)..(83) <223> n is a, c, g, or t <220> <221> misc_feature <222> (87) (88) <223> n is a, c, g, or t <220> <221> misc_feature <222> (93)..(93) <223> n is a, c, g, or t <220> <221> misc_feature <222> (99) (100) <223> n is a, c, g, or t <220> <221> misc_feature <222> (102)..(102) <223> n is a, c, g, or t <400> 42 nctgtacttt cctgaccntg nnnnngtgnc ancatnnact tncctgannc nnctgtactt 60 tcctgaccnt gnnnnngtgn cancatnnac ttncctgann cn 102 <210> 43 <211> 153 <212> DNA <213> Artificial sequence <220> <223> CRM <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g, or t <220> <221> misc_feature <222> (18)..(18) <223> n is a, c, g, or t <220> <221> misc_feature <222> (21)..(25) <223> n is a, c, g, or t <220> <221> misc_feature <222> (29)..(29) <223> n is a, c, g, or t <220> <221> misc_feature <222> (32)..(32) <223> n is a, c, g, or t <220> <221> misc_feature <222> (36) (37) <223> n is a, c, g, or t <220> <221> misc_feature <222> (42)..(42) <223> n is a, c, g, or t <220> <221> misc_feature <222> (48) (49) <223> n is a, c, g, or t <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <220> <221> misc_feature <222> (51)..(51) <223> n is a, c, g, or t <220> <221> misc_feature <222> (52)..(52) <223> n is a, c, g, or t <220> <221> misc_feature <222> (69)..(69) <223> n is a, c, g, or t <220> <221> misc_feature <222> (72) (76) <223> n is a, c, g, or t <220> <221> misc_feature <222> (80)..(80) <223> n is a, c, g, or t <220> <221> misc_feature <222> (83)..(83) <223> n is a, c, g, or t <220> <221> misc_feature <222> (87) (88) <223> n is a, c, g, or t <220> <221> misc_feature <222> (93)..(93) <223> n is a, c, g, or t <220> <221> misc_feature <222> (99) (100) <223> n is a, c, g, or t <220> <221> misc_feature <222> (102)..(102) <223> n is a, c, g, or t <220> <221> misc_feature <222> (102) (103) <223> Optional spacers <220> <221> misc_feature <222> (103)..(103) <223> n is a, c, g, or t <220> <221> misc_feature <222> (120) <223> n is a, c, g, or t <220> <221> misc_feature <222> (123) (127) <223> n is a, c, g, or t <220> <221> misc_feature <222> (131)..(131) <223> n is a, c, g, or t <220> <221> misc_feature <222> (134)..(134) <223> n is a, c, g, or t <220> <221> misc_feature <222> (138) (139) <223> n is a, c, g, or t <220> <221> misc_feature <222> (144)..(144) <223> n is a, c, g, or t <220> <221> misc_feature <222> (150)...(151) <223> n is a, c, g, or t <220> <221> misc_feature <222> (153)..(153) <223> n is a, c, g, or t <400> 43 nctgtacttt cctgaccntg nnnnngtgnc ancatnnact tncctgannc nnctgtactt 60 tcctgaccnt gnnnnngtgn cancatnnac ttncctgann cnnctgtact ttcctgaccn 120 tgnnnnnngtg ncancatnna cttncctgan ncn 153 <210> 44 <211> 102 <212> DNA <213> Artificial sequence <220> <223> CRM <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <400> 44 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ctctgtactt 60 tcctgacctt ggcacagtgc caccatcaac ttgcctgaca cc 102 <210> 45 <211> 153 <212> DNA <213> Artificial sequence <220> <223> CRM <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <220> <221> misc_feature <222> (102) (103) <223> Optional spacers <400> 45 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ctctgtactt 60 tcctgacctt ggcacagtgc caccatcaac ttgcctgaca cctctgtact ttcctgacct 120 tggcacagtg ccaccatcaa cttgcctgac acc 153 <210> 46 <211> 153 <212> DNA <213> Artificial sequence <220> <223> CRM <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <220> <221> misc_feature <222> (102) (103) <223> Optional spacers <400> 46 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc aactgtactt 60 tcctgaccct gaagaggtgg cagcatggac tttcctgaac caactgtact ttcctgaccc 120 tgaagaggtg gcagcatgga ctttcctgaa cca 153 <210> 47 <211> 102 <212> DNA <213> Artificial sequence <220> <223> CRM <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <400> 47 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc aactgtactt 60 tcctgaccct gaagaggtgg cagcatggac tttcctgaac ca 102 <210> 48 <211> 5716 <212> DNA <213> Artificial sequence <220> <223> pAAV-ZsGreen original plasmid <400> 48 agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60 acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120 tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180 ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gaattgcctg 240 caggcagctg cgcgctcgct cgctcactga ggccgcccgg gcaaagcccg ggcgtcgggc 300 gacctttggt cgcccggcct cagtgagcga gcgagcgcgc agagagggag tggccaactc 360 catcactagg ggttcctatc gatatcaagc tttaatagta atcaattacg gggtcattag 420 ttcatagccc atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct 480 gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc 540 caatagggac tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg 600 cagtacatca agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat 660 ggcccgcctg gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 720 tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 780 gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 840 gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 900 tgacgcaaat gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctggtttag 960 tggatatcct taagggccca gccggcccga atcccggccg ggaacggtgc attggaacgc 1020 ggattccccg tgccaagagt gacgtaagta ccgcctatag agtctatagg cccacaaaaa 1080 atgctttctt cttttaatat acttttttgt ttatcttatt tctaatactt tccctaatct 1140 ctttctttca gggcaataat gatacaatgt atcatgcctc tttgcaccat tctaaagaat 1200 aacagtgata atttctgggt taaggcaata gcaatatttc tgcatataaa tatttctgca 1260 tataaattgt aactgatgta agaggtttca tattgctaat agcagctaca atccagctac 1320 cattctgctt ttattttatg gttgggataa ggctggatta ttctgagtcc aagctaggcc 1380 cttttgctaa tcatgttcat acctcttatc ttcctcccac agctcctggg caacgtgctg 1440 gtctgtgtgc tggcccatca ctttggcaaa gaattgggat tcgcgagaat tcgccaccat 1500 ggcccagtcc aagcacggcc tgaccaagga gatgaccatg aagtaccgca tggagggctg 1560 cgtggacggc cacaagttcg tgatcaccgg cgagggcatc ggctacccct tcaagggcaa 1620 gcaggccatc aacctgtgcg tggtggaggg cggccccttg cccttcgccg aggacatctt 1680 gtccgccgcc ttcatgtacg gcaaccgcgt gttcaccgag tacccccagg acatcgtcga 1740 ctacttcaag aactcctgcc ccgccggcta cacctgggac cgctccttcc tgttcgagga 1800 cggcgccgtg tgcatctgca acgccgacat caccgtgagc gtggaggaga actgcatgta 1860 ccacgagtcc aagttctacg gcgtgaactt ccccgccgac ggccccgtga tgaagaagat 1920 gaccgacaac tgggagccct cctgcgagaa gatcatcccc gtgcccaagc agggcatctt 1980 gaagggcgac gtgagcatgt acctgctgct gaaggacggt ggccgcttgc gctgccagtt 2040 cgacaccgtg tacaaggcca agtccgtgcc ccgcaagatg cccgactggc acttcatcca 2100 gcacaagctg acccgcgagg accgcagcga cgccaagaac cagaagtggc acctgaccga 2160 gcacgccatc gcctccggct ccgccttgcc ctgataagga tccacgggtg gcatccctgt 2220 gaccctccc cagtgcctct cctggccctg gaagttgcca ctccagtgcc caccagcctt 2280 gtcctaataa aattaagttg catcatttg tctgactagg tgtccttcta tatattatg 2340 gggtggaggg gggtggtatg gagcaagggg caagttggga agacaacctg tagggcctgc 2400 ggggtctatt gggaaccaag ctggagtgca gtggcacaat cttggctcac tgcaatctcc 2460 gcctcctggg ttcaagcgat tctcctgcct cagcctcccg agttgttggg attccaggca 2520 tgcatgacca ggctcagcta atttttgttt ttttggtaga gacggggttt caccatattg 2580 gccaggctgg tctccaactc ctaatctcag gtgatctacc caccttggcc tcccaaattg 2640 ctgggattac aggcgtgaac cactgctccc ttccctgtcc ttatcgatag atctaggaac 2700 ccctagtgat ggagttggcc actccctctc tgcgcgctg ctcgctcact gaggccgggc 2760 gaccaaaggt cgcccgacgc ccgggctttg cccgggcggc ctcagtgagc gagcgagcgc 2820 gcagctgcct gcaggcagct tggcactggc cgtcgtttta caacgtcgtg actgggaaaa 2880 ccctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca gctggcgtaa 2940 tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgaatg 3000 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatacgtca 3060 aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg 3120 cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct 3180 tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta 3240 gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgattt gggtgatggt 3300 tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg 3360 ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat ctcgggctat 3420 tcttttgatt tataagggat tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt 3480 taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt ttacaatttt atggtgcact 3540 ctcagtacaa tctgctctga tgccgcatag ttaagccagc cccgacaccc gccaacaccc 3600 gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg cttacagaca agctgtgacc 3660 gtctccggga gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgagacga 3720 aagggcctcg tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag 3780 acgtcaggtg gcactttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa 3840 atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat 3900 tgaaaaagga agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg 3960 gcatttgcc ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa 4020 gatcagttgg gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt 4080 gagagttttc gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt 4140 ggcgcggtat tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat 4200 tctcagaatg acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg 4260 acagtaagag aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta 4320 cttctgacaa cgatcggagg accgaaggag ctaaccgcttt ttttgcacaa catgggggat 4380 catgtaactc gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag 4440 cgtgacacca cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa 4500 ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca 4560 ggaccacttc tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc 4620 ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt 4680 atcgtagtta tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc 4740 gctgagatag gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat 4800 atactttaga ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt 4860 tttgataatc tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac 4920 cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 4980 ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 5040 actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgttcttcta 5100 gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 5160 ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 5220 gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 5280 acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta 5340 tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 5400 gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 5460 cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 5520 cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 5580 ccttttgctc acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc 5640 gcctttgagt gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg 5700 agcgaggaag cggaag 5716 <210> 49 <211> 5857 <212> DNA <213> Artificial sequence <220> <223> pAAV-PB1-MinTk <400> 49 tgcctgcagg cagctgcgcg ctcgctcgct cactgaggcc gcccgggcaa agcccgggcg 60 tcgggcgacc tttggtcgcc cggcctcagt gagcgagcga gcgcgcagag agggagtggc 120 caactccatc actaggggtt cctatcgata tcaagcttct gtactttcct gaccttggca 180 cagtgccacc atcaacttgc ctgacaccga tccggccccg cccagcgtct tgtcattggc 240 gaattcgaac acgcagatgc agtcggggcg gcgcggtccg aggtccactt cgcatattaa 300 ggtgacgcgt gtggcctcga acaccgagcg accctgcagc gacccgctta acagcgtcaa 360 cagcgtgccg cagatctcga ggagcttggc gagattttca ggagctaagg aagctaaaca 420 tggaagatgc caaaaacatt aagaagggcc cagcgccatt ctacccactc gaagacggga 480 ccgccggcga gcagctgcac aaagccatga agcgctacgc cctggtgccc ggcaccatcg 540 cctttaccga cgcacatatc gaggtggaca ttacctacgc cgagtacttc gagatgagcg 600 ttcggctggc agaagctatg aagcgctatg ggctgaatac aaaccatcgg atcgtggtgt 660 gcagcgagaa tagcttgcag ttcttcatgc ccgtgttggg tgccctgttc atcggtgtgg 720 ctgtggcccc agctacgac atctacaacg agcgcgagct gctgaacagc atgggcatca 780. gccagcccac cgtcgtattc gtgagcaaga aagggctgca aaagatcctc aacgtgcaaa 840 aagagctacc gatcatacaa aagatcatca tcatggatag caagaccgac taccagggct tccaaagcat gtacaccttc gtgacttccc atttgccacc cggcttcaac gagtacgact 960 tcgtgcccga gagcttcgac cgggacaaaa ccatcgccct gatcatgac agtagtggca gtaccggatt gcccaagggc gtagccctac cgcaccgcac cgcttgtgtc cgattcagtc 1080 atgcccgcga ccccatcttc ggcaaccaga tcatccccga caccgctatc ctcagcgtgg tgccatttca ccacggcttc ggcatgttca ccacgctggg ctacttgatc tgcggctttc gggtcgtgct catgtaccgc ttcgaggagg agctattctt gcgcagcttg caagactata 1260 together tgccctgctg gtgcccacac tatttagctt cttcgctaag agcactctca 1320. tcgacaagta cgacctaagc aacttgcacg agatcgccag cggcggggcg ccgctcagca aggaggtagg tgaggccgtg gccaaacgct tccacctacc aggcatccgc cagggctacg 1440 gcctgacaga aacaaccagc gccattctga tcacccccga aggggacgac aagcctggcg cagtaggcaa ggtggtgccc ttcttcgagg ctaaggtggt ggacttggac accggtaaga cactgggtgt gaaccagcgc ggcgagctgt gcgtccgtgg ccccatgatc atgagcggct 1620 acgttaacaa ccccgaggct acaaacgctc tcatcgacaa ggacggctgg ctgcacagcg gcgacatcgc ctactgggac gaggacgagc acttcttcat cgtggaccgg ctgaagagcc 1740 tgatcaaata caagggctac caggtagccc cagccgaact ggagagcatc ctgctgcaac accccaacat cttcgacgcc ggggtcgccg gcctgcccga cgacgatgcc ggcgagctgc 1860. ccgccgcagt cgtcgtgctg gaacacggta aaaccatgac cgagaaggag atcgtggact atgtggccag ccaggttaca accgccaaga agctgcgcgg tggtgttgtg ttcgtggacg aggtgcctaa aggctgacc ggcaagttgg acgcccgcaa gatccgcgag attctcatta aggccaagaa gggcggcaag atcgccgtgt aatcgcgaga attctctaga gtcgacacta gtgcggatcc acgggtggca tccctgtgac ccctccccag tgcctctcct ggccctggaa 2160 gttgccactc cagtgcccac cagccttgtc ctaataaaat tagttgcat cattttgtct 2220 gactaggtgt ccttctataa tattatgggg tggaggggg tggtatggag caaggggcaa 2280 gttgggaaga caacctgtag ggcctgcggg gtctattggg aaccaagctg gagtgcagtg 2340 gcacaatctt ggctcactgc aatctccgcc tctgggttc aagcgattct cctgcctcag 2400 cctcccgagt tgttgggatt ccaggcatgc atgaccaggc tcagctaatt tttgtttttt 2460 tggtagagac ggggtttcac catattggcc aggctggtct ccaactccta atctcaggtg 2520 atctacccac cttggcctcc caaattgctg ggattacagg cgtgaaccac tgctcccttc 2580 cctgtcctta tcgatagatc taggaacccc tagtgatgga gttggccact ccctctgc 2640 gcgctcgctc gctcactgag gccgggcgac caaaggtcgc ccgacgcccg gctttgccc 2700 gggcggcctc agtgagcgag cgagcgcgca gctgcctgca ggcagcttgg cactggccgt 2760 cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc 2820 acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca 2880 acagttgcgc agcctgaatg gcgaatggcg cctgatgcgg tattttctcc ttacgcatct 2940 gtgcggtatt tcacaccgca tacgtcaaag caaccatagt acgcgccctg tagcggcgca 3000 ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta 3060 gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg ctttccccgt 3120 caagctctaa atcggggct ccctttaggg ttccgattta gtgctttacg gcacctcgac 3180 cccaaaaaac ttgatttggg tgatggttca cgtagtgggc catcgccctg atagacggtt 3240 tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt ccaaactgga 3300 acaacactca accctatctc gggctattct tttgatttat aagggatttt gccgatttcg 3360 gcctattggt taaaaaatga gctgatttaa caaaaattta acgcgaattt taacaaaata 3420 ttaacgttta caattttatg gtgcactctc agtacaatct gctctgatgc cgcatagtta 3480 agccagcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg 3540 gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca 3600 ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt tttataggtt 3660 aatgtcatga taataatggt ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc 3720 ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa 3780 taaccctgat aaatgcttca saamattga aaaaggaaga gtatgagtat tcaacatttc 3840 cgtgtcgccc ttatccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa 3900 acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa 3960 ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg 4020 atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa 4080 gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc 4140 acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc 4200 atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta 4260 accgcttttt tgcacaacat ggggatcat gtaactcgcc ttgatcgttg ggaaccggag 4320 ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca 4380 acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca acaattaata 4440 gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc 4500 tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca 4560 ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca 4620 actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg 4680 taactgtcag accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa 4740 tttaaaagga tctaggtgaa gatcctttt gataatctca tgaccaaaat cccttaacgt 4800 gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat 4860 cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg 4920 gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga 4980 gcgcagatac caaatactgt tcttctagtg tagccgtagt taggccacca cttcaagaac 5040 tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt 5100 ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag 5160 cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc 5220 gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag 5280 gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca 5340 gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt 5400 cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc 5460 tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc 5520 cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc 5580 cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc aatacgcaaa 5640 ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag gtttcccgac 5700 tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt agctcactca ttaggcaccc 5760 caggctttac actttatgct tccggctcgt atgttgtgtg gaattgtgag cggataacaa 5820 tttcacacag gaaacagcta tgaccatgat tacgaat 5857 <210> 50 <211> 6044 <212> DNA <213> Artificial Sequence <220> <223> pAAV‑PB1‑2‑MinTk <400> 50 gcctgcaggc agctgcgcgc tcgctcgctc actgaggccg cccgggcaaa gcccgggcgt 60 cgggcgacct ttggtcgccc ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc 120 aactccatca ctaggggttc ctatcgatat caagcttttc tctggcctaa ctggccggta 180 ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca cccattactc 240 gcatccattc tctctgtact ttcctgacct tggcacagtg ccaccatcaa cttgcctgac 300 accgcactga aggtcctcaa tcgtctgtac tttcctgacc ttggcacagt gccaccatca 360 acttgcctga caccgctggg agttcgtaga cggagatccg gccccgccca gcgtcttgtc 420 attggcgaat tcgaacacgc agatgcagtc ggggcggcgc ggtccgaggt ccacttcgca 480 tattaaggtg acgcgtgtgg cctcgaacac cgagcgaccc tgcagcgacc cgcttaacag 540 cgtcaacagc gtgccgcaga tctcgaggag cttggcgaga ttttcaggag ctaaggaagc 600 taaacatgga agatgccaaa aacattaaga agggcccagc gccattctac ccactcgaag 660 acgggaccgc cggcgagcag ctgcacaaag ccatgaagcg ctacgccctg gtgcccggca 720 ccatcgcctt taccgacgca catatcgagg tggacattac ctacgccgag tacttcgaga 780 tgagcgttcg gctggcagaa gctatgaagc gctatgggct gaatacaaac catcggatcg 840 tggtgtgcag cgagaatagc ttgcagttct tcatgcccgt gttgggtgcc ctgttcatcg 900 gtgtggctgt ggccccagct aacgacatct acaacgagcg cgagctgctg aacagcatgg 960 gcatcagcca gcccaccgtc gtattcgtga gcaagaaagg gctgcaaaag atcctcaacg 1020 tgcaaaagaa gctaccgatc atacaaaaga tcatcatcat ggatagcaag accgactacc 1080 agggcttcca aagcatgtac accttcgtga cttcccattt gccacccggc ttcaacgagt 1140 acgacttcgt gcccgagagc ttcgaccggg acaaaaccat cgccctgatc atgaacagta gtggcagtac cggattgccc aagggcgtag ccctaccgca ccgcaccgct tgtgtccgat tcagtcatgc ccgcgacccc atcttcggca accagatcat ccccgacacc gctatcctca 1320 gcgtggtgcc atttcaccac ggcttcggca tgttcaccac gctgggctac ttgatctgcg gctttcgggt cgtgctcatg taccgcttcg aggaggagct attcttgcgc agcttgcaag 1440 actatagat tcaatctgcc ctgctggtgc ccacactatt tagcttcttc gctaagagca ctctcatcga caagtacgac ctaagcaact tgcacgagat cgccagcggc ggggcgccgc tcagcaagga ggtaggtgag gccgtggcca aacgcttcca cctaccaggc atccgccagg 1620 gctacggcct gacagaaaca accagcgcca ttctgatcac ccccgaaggg gacgacaagc ctggcgcagt aggcaaggtg gtgcccttct tcgaggctaa ggtggtggac ttggacaccg 1740. gtaagacact gggtgtgaac cagcgcggcg agctgtgcgt ccgtggcccc atgatcatga gcggctacgt taacaacccc gaggctacaa acgctctcat cgacaaggac ggctggctgc acagcggcga catcgcctac tgggacgagg acgagcactt cttcatcgtg gaccggctga 1920 1980 tgcaacaccc caacatcttc gacgccgggg tcgccggcct gcccgacgac gatgccggcg 2040 agctgcccgc cgcagtcgtc gtgctggaac acggtaaaac catgaccgag aaggagatcg 2100 tggactatgt ggccagccag gttacaaccg ccaagaagct gcgcggtggt gttgtgttcg 2160 tggacgaggt gcctaagga ctgaccggca agttggacgc ccgcaagatc cgcgagattc 2220 tcattaaggc caagaagggc ggcaagatcg ccgtgtaatc gcgagaattc tctagagtcg 2280 acactagtgc ggatccacgg gtggcatccc tgtgacccct ccccagtgcc tctcctggcc 2340 ctggaagttg ccactccagt gcccaccagc cttgtcctaa taaaattaag ttgcatcatt 2400 ttgtctgact aggtgtcctt ctataatatt atggggtgga ggggggtggt atggagcaag 2460 gggcaagttg ggaagacaac ctgtagggcc tgcggggtct attgggaacc aagctgggagt 2520 gcagtggcac aatcttggct cactgcaatc tccgcctcct gggttcaagc gattctcctg 2580 cctcagcctc ccgagttgtt gggattccag gcatgcatga ccaggctcag ctaatttttg 2640 tttttttggt agagacgggg tttcaccata ttggccaggc tggtctccaa ctcctaatct 2700 caggtgatct acccaccttg gcctcccaaa ttgctgggat tacaggcgtg aaccactgct 2760 cccttccctg tccttatcga tagatctagg aacccctagt gatggagttg gccactccct 2820 ctctgcgcgc tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct 2880 ttgcccgggc ggcctcagtg agcgagcgag cgcgcagctg cctgcaggca gcttggcact 2940 ggccgtcgtt ttacaacgtc gtgactggga aaaccctggc gttacccaac ttaatcgcct 3000 tgcagcacat ccccctttcg ccagctggcg taatagcgaa gaggcccgca ccgatcgccc 3060 ttcccaacag ttgcgcagcc tgaatggcga atggcgcctg atgcggtatt ttctccttac 3120 gcatctgtgc ggtatttcac accgcatacg tcaaagcaac catagtacgc gccctgtagc 3180 ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc 3240 gccctagcgc ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt 3300 ccccgtcaag ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac 3360 ctcgacccca aaaaacttga tttgggtgat ggttcacgta gtgggccatc gccctgatag 3420 acggtttttc gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa 3480 actggaacaa cactcaaccc tatctcgggc tattcttttg atttataagg gattttgccg 3540 atttcggcct attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattttaac 3600 aaaatattaa cgtttacaat tttatggtgc actctcagta caatctgctc tgatgccgca 3660 tagttaagcc agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg 3720 ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg 3780 ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg cctattttta 3840 taggttaatg tcatgataat aatggtttct tagacgtcag gtggcacttt tcggggaaat 3900 gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg 3960 agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa 4020 catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac 4080 ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac 4140 atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt 4200 ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc 4260 gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca 4320 ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc 4380 ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag 4440 gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa 4500 ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg 4560 gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa 4620 ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg 4680 gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt 4740 gcagcactgg ggccagatgg tagccctcc cgtatcgtag ttatctacac gacggggagt 4800 caggcaacta tggatgaacg aatagacag atcgctgaga taggtgcctc actgattaag cattggtac tgtcagacca agtttactca fathercttt agttgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc 5160 agcagagcgc agataccaaa tactgttctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc 5400. 5460. tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag 5520 cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt 5580 gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac 5640 gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg 5700 ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc 5760 cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcccaata 5820 cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 5880 cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct cactcattag 5940 gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga 6000 taacaatttc acacaggaaa cagctatgac catgattacg aatt 6044 <210> 51 <211> 4242 <212> DNA <213> Artificial Sequence <220> <223> pGL4.10 Plasmid Backbone <400> 51 60. ggcctaactg gccggtacct gagctcgcta gcctcgagga tatcaagatc tggcctcggc ggccaagctt ggcaatccgg tactgttggt aaagccacca tggaagatgc caaaaacatt aagaagggcc cagcgccatt ctacccactc gaagacgggga ccgccggcga gcagctgcac 180 aaagccatga agcgctacgc cctggtgccc ggcaccatcg cctttaccga cgcacatatc gaggtggaca ttacctacgc cgagtacttc gagatgagcg ttcggctggc agaagctatg 360. aagcgctatg ggctgaatac aaaccatcgg atcgtggtgt gcagcgagaa tagcttgcag ttcttcatgc ccgtgttggg tgccctgttc atcggtgtgg ctgtggcccc agctaacgac 420 atctacaacg agcgcgagct gctgaacagc atgggcatca gccagcccac cgtcgtattc 480. gtgagcaaga aagggctgca aagatcctc aacgtgcaaa agaagctacc gatcatacaa aagatcatca tcatggatag caagaccgac taccagggct tccaaagcat gtacaccttc gtgacttccc atttgccacc cggcttcaac gagtacgac tcgtgcccga gagcttcgac 660 cgggacaaaa ccatcgccct gatcatgac agtagtggca gtaccggatt gcccaagggc 720 gtagccctac cgcaccgcac cgcttgtgtc cgattcagtc atgcccgcga ccccatcttc 780 ggcaaccaga tcatccccga caccgctatc ctcagcgtgg tgccatttca ccacggcttc 840 ggcatgttca ccacgctggg ctacttgatc tgcggctttc gggtcgtgct catgtaccgc900 ttcgaggagg agctattctt gcgcagcttg caagactata agcctcaatc tgccctgctg 960 gtgcccacac tatttagctt cttcgctaag agcactctca tcgacaagta cgacctaagc aacttgcacg agatcgccag cggcggggcg ccgctcagca aggaggtagg tgaggccgtg 1080 gccaaacgct tccacctacc aggcatccgc cagggctacg gcctgacaga aacaaccagc gccattctga tcacccccga aggggacgac aagcctggcg cagtaggcaa ggtggtgccc ttcttcgagg ctaaggtggt ggacttggac accggtaaga cactgggtgt gaaccagcgc ggcgagctgt gcgtccgtgg ccccatgatc atgagcggct acgttaacaa ccccgaggct acaaacgctc tcatcgacaa ggacggctgg ctgcacagcg gcgacatcgc ctactgggac gaggacgagc acttcttcat cgtggaccgg ctgaagagcc tgatcaaata caagggctac caggtagccc cagccgaact ggagagcatc ctgctgcaac accccaacat cttcgacgcc 1500 gggtcgccg gcctgcccga cgacgatgcc ggcgagctgc ccgccgcagt cgtcgtgctg 1560 gaacacggta aaaccatgac cgagaaggag atcgtggact atgtggccag ccaggttaca 1620 accgccaaga agctgcgcgg tggtgttgtg ttcgtggacg aggtgcctaa aggactgacc 1680 ggcaagttgg acgcccgcaa gatccgcgag attctcatta aggccaagaa gggcggcaag 1740 atcgccgtgt aataattcta gagtcggggc ggccggccgc ttcgagcaga catgataaga 1800 tacattgatg agtttggaca aaccacaact agaatgcagt gaaaaaaatg ctttatttgt 1860 gaaatttgtg atgctattgc tttatttgta accattataa gctgcaataa acaagttaac 1920 aacaacaatt gcattcattt tatgtttcag gttcaggggg aggtgtggga ggttttttaa 1980 agcaagtaaa acctctacaa atgtggtaaa atcgataagg atccgtcgac cgatgccctt 2040 gagagccttc aacccagtca gctccttccg gtgggcgcgg ggcatgacta tcgtcgcgc 2100 acttatgact gtcttcttta tcatgcaact cgtaggacag gtgccggcag cgctcttccg 2160 cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc 2220 actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt 2280 gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc 2340 ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa 2400 acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc 2460 ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg 2520 cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc 2580 tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc 2640 gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca 2700 ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact 2760 acggctcac tagagaaca gtatttggta tctgcgctct gctgaagcca gttaccttcg 2820 gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt 2880 ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct 2940 tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga 3000 gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa 3060 tctaaagtat atatgagtaa acttggtctg acagcggccg caaatgctaa accactgcag 3120 tggttaccag tgcttgatca gtgaggcacc gatctcagcg atctgcctat ttcgttcgtc 3180 catagtggcc tgactccccg tcgtgtagat cactacgatt cgtgagggct taccatcagg 3240 ccccagcgca gcaatgatgc cgcgagagcc gcgttcaccg gccccgatt tgtcagcaat 3300 gaaccagcca gcagggaggg ccgagcgaag aagtggtcct gctactttgt ccgcctccat 3360 ccagtctatg agctgctgtc gtgatgctag agtaagaagt tcgccagtga gtagttccg 3420 aagagtgtg gccattgcta ctggcatcgt ggtatcacgc tcgtcgttcg gtatggcttc 3480 gttcaactct ggttcccagc ggtcaagccg ggtcacatga tcacccatat tatgaagaaa 3540 tgcagtcagc tccttagggc ctccgatcgt tgtcagaagt aagttggccg cggtgttgtc 3600 gctcatggta atggcagcac tacacaattc tcttaccgtc atgccatccg taagatgctt 3660 ttccgtgacc ggcgagtact caaccaagtc gttttgtgag tagtgtatac ggcgaccaag 3720 ctgctcttgc ccggcgtcta tacgggacaa caccgcgcca catagcagta ctttgaaagt 3780 gctcatcatc gggaatcgtt cttcggggcg gaaagactca aggatcttgc cgctattgag 3840 atccagttcg atatagccca ctcttgcacc cagttgatct tcagcatctt ttactttcac 3900 cagcgtttcg gggtgtgcaa aaacaggcaa gcaaaatgcc gcaaagaagg gaatgagtgc 3960 gacacgaaaa tgttggatgc tcatactcgt cctttttcaa tattattgaa gcatttatca 4020 gggttactag tacgtctctc aaggataagt aagtaatatt aaggtacggg aggtattgga 4080 caggccgcaa taaaatatct ttattttcat tacatctgtg tgttggtttt ttgtgtgaat 4140 cgatagtact aacatacgct ctccatcaaa acaaaacgaa acaaaacaaa ctagcaaaat 4200 aggctgtccc cagtgcaagt gcaggtgcca gaacatttct ct 4242 <210> 52 <211> 584 <212> DNA <213> Artificial Sequence <220> <223> CMV-IE comparative promoter <400> 52 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 240 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 420 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 480 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 540 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agct 584 <210> 53 <211> 8191 <212> DNA <213> Artificial sequence <220> <223> pcDNA6.0 β-galactosidase transfection control <400> 53 gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480 atcatatgcc aagtacgcccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720 780. aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840 ctgcttactg gcttatcga attack ctcactatag ggagacccaa gctggctagc gtttaaactt aagcttggta ccgagctcgg atccactagt ccagtgtggt ggaattctgc agatcgaaac gatgatagat cccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa tggcgctttg cctggtttcc ggcaccagaa gcggtgccgg aaagctggct ggagtgcgat cttcctgagg ccgatactgt cgtcgtcccc tcaaactggc agatgcacgg ttacgatgcg cccatctaca 1260 ccaacgtgac ctatcccatt acggtcaatc cgccgtttgt tcccacggag aatccgacgg 1320 gttgttactc gctcacattt aatgttgatg aaagctggct acaggaaggc cagacgcgaa ttatttttga tggcgttaac tcggcgtttc atctgtggtg caacggggcgc tgggtcggtt 1440 acggccagga cagtcgtttg ccgtctgaat ttgacctgag cgcattttta cgcgccggag 1500 aaaaccgcct cgcggtgatg gtgctgcgct ggagtgacgg cagttatctg gaagatcagg 1560 atatgtggcg gatgagcggc attttccgtg acgtctcgtt gctgcataaa ccgactacac 1620 aaatcagcga tttccatgtt gccactcgct ttaatgatga tttcagccgc gctgtactgg 1680 aggctgaagt tcagatgtgc ggcgagttgc gtgactacct acgggtaaca gtttctttat 1740 ggcagggtga aacgcaggtc gccagcggca ccgcgccttt cggcggtgaa attatcgatg 1800 agcgtggtgg ttatgccgat cgcgtcacac tacgtctgaa cgtcgaaaac ccgaaactgt 1860 ggagcgccga aatcccgaat ctctatcgtg cggtggttga actgcacacc gccgacggca 1920 cgctgattga agcagaagcc tgcgatgtcg gtttccgcga ggtgcggatt gaaaatggtc 1980 tgctgctgct gaacggcaag ccgttgctga ttcgaggcgt taaccgtcac gagcatcatc 2040 ctctgcatgg tcaggtcatg gatgagcaga cgatggtgca ggatatcctg ctgatgaagc 2100 agaacaactt taacgccgtg cgctgttcgc attatccgaa ccatccgctg tggtacacgc 2160 tgtgcgaccg ctacggcctg tatgtggtgg atgaagccaa tattgaaacc cacggcatgg tgccaatgaa tcgtctgacc gatgatccgc gctggctacc ggcgatgagc gaacgcgtaa cgcgaatggt gcagcgcgat cgtaatcacc cgagtgtgat catctggtcg ctggggaatg aatcaggcca cggcgctaat cacgacgcgc tgtatcgctg gatcaaatct gtcgatcctt cccgcccggt gcagtatgaa ggcggcggag ccgacaccac ggccaccgat attttgcc 2460. cgatgtacgc gcgcgtggat gaagaccagc ccttcccggc tgtgccgaaa tggtccatca aaaaatggct ttcgctacct ggagagacgc gcccgctgat cctttgcgaa tacgcccacg cgatgggtaa cagtcttggc ggtttcgcta aatactggca ggcgtttcgt cagtatcccc gtttacaggg cggcttcgtc tgggactggg tggatcagtc gctgattaaa tatgatgaaa acggcaaccc gtggtcggct tacggcggtg attttggcga tacgccgac gatcgccagt 2760 tctgtatgaa cggtctggtc tttgccgacc gcacgccgca tccagcgctg acggaagcaa aacaccagca gcagtttttc cagttccgtt tatccgggca aaccatcgaa gtgaccagcg aatacctgtt ccgtcatagc gataacgagc tcctgcactg gatggtggcg ctggatggta 2940 agccgctggc aagcggtgaa gtgcctctgg atgtcgctcc acaaggtaaa cagttgattg 3000 aactgcctga actaccgcag ccggagagcg ccgggcaact ctggctcaca gtacgcgtag 3060 tgcaaccgaa cgcgaccgca tggtcagaag ccgggcacat cagcgcctgg cagcagtggc 3120 gtctggcgga aaacctcagt gtgacgctcc ccgccgcgtc ccacgccatc ccgcatctga 3180 ccaccagcga aatggatttt tgcatcgagc tgggtaataa gcgttggcaa tttaaccgcc 3240 agtcaggctc tctttcacag atgtggattg gcgataaaaa ccaactgctg acgccgctgc 3300 gcgatcagtt cacccgtgca ccgctggata acgacattgg cgtaagtgaa gcgacccgca 3360 ttgaccctaa cgcctgggtc gaacgctgga aggcggcggg ccattaccag gccgaagcag 3420 cgttgttgca gtgcacggca gatacacttg ctgatgcggt gctgattacg accgctcacg 3480 cgtggcagca tcagggaaa accttattta tcagccggaa aacctaccgg attgatggta 3540 gtggtcaaat ggcgattacc gttgatgttg aagtggcgag cgatacaccg catccggcgc 3600 ggattggcct gaactgccag ctggcgcagg tagcagagcg ggtaaactgg ctcggattag 3660 ggccgcaaga aaactatccc gaccgcctta ctgccgcctg ttttgaccgc tgggatctgc 3720 cattgtcaga catgtatacc ccgtacgtct tcccgagcga aaacggtctg cgctgcggga 3780 cgcgcgaatt gaattatggc ccacaccagt ggcgcggcga cttccagttc aacatcagcc 3840 gctacagtca acagcaactg atggaaacca gccatcgcca tctgctgcac gcggaagaag 3900 gcacatggct gaatatcgac ggtttccata tggggattgg tggcgacgac tcctggagcc 3960 cgtcagtatc ggcggaattc cagctgagcg ccggtcgcta ccattaccag ttggtctggt 4020 gtcaaaaagc ggccgctcga ggtcacccat tcgaaggtaa gcctatccct aaccctctcc 4080 tcggtctcga ttctacgcgt accggtcatc atcaccatca ccattgagtt taaacccgct 4140 gatcagcctc gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc 4200 cttccttgac cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg 4260 catcgcattg tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca 4320 agggggagga ttgggaagac aatagcaggc atgctgggga tgcggtgggc tctatggctt 4380 ctgaggcgga aagaaccagc tggggctcta gggggtatcc ccacgcgccc tgtagcggcg 4440 cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc 4500 tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 4560 gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg 4620 accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 4680 tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 4740 gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt 4800 cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat taattctgtg 4860 gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca 4920 aagcatgcat ctcaattagt cagcaaccag gtgtggaaag tccccaggct ccccagcagg 4980 cagaagtatg caaagcatgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc 5040 gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg gctgactaat 5100 tttttttatt tatgcagagg ccgaggccgc ctctgcctct gagctattcc agaagtagtg 5160 aggaggcttt tttggaggcc taggcttttg caaaaagctc ccgggagctt gtatatccat 5220 tttcggatct gatcagcacg tgttgacaat taatcatcgg catagtatat cggcatagta 5280 taatacgaca aggtgaggaa ctaaaccatg gccaagcctt tgtctcaaga agaatccacc 5340 ctcattgaaa gagcaacggc tacaatcaac agcatcccca tctctgaaga ctacagcgtc 5400 gccagcgcag ctctctctag cgacggccgc atcttcactg gtgtcaatgt atatcatttt 5460 actgggggac cttgtgcaga actcgtggtg ctgggcactg ctgctgctgc ggcagctggc 5520 aacctgactt gtatcgtcgc gatcggaaat gagaacaggg gcatcttgag cccctgcgga 5580 cggtgccgac aggtgcttct cgatctgcat cctgggatca aagccatagt gaaggacagt 5640 gatggacagc cgacggcagt tgggattcgt gaattgctgc cctctggtta tgtgtgggag 5700 ggctaagcac ttcgtggccg aggagcagga ctgacacgtg ctacgagatt tcgattccac 5760 cgccgccttc tatgaaaggt tgggcttcgg aatcgttttc cgggacgccg gctggatgat 5820 cctccagcgc ggggatctca tgctggagtt cttcgcccac cccaacttgt ttattgcagc 5880 ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc 5940 actgcattct agttgtggtt tgtccaaact catcaatgta tcttatcatg tctgtatacc 6000 gtcgacctct agctagagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg 6060 ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg 6120 tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc 6180 gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt 6240 gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct 6300 gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga 6360 taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc 6420 cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg 6480 ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg 6540 aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt 6600 tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tttaggtatc tcagttcggt 6660 gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg 6720 cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact 6780 ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt 6840 cttgaagtgg tggcctaact acggctcac tagagaaca gtatttggta tctgcgctct 6900 gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac 6960 cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc 7020 tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg 7080 ttaagggatt ttggtcatga gattatcaaa aggatcttc acctagatcc ttttaaatta 7140 aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca 7200 atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc 7260 ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc 7320 tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc 7380 agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat 7440 taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt 7500 tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc 7560 cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag 7620 ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt 7680 tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac 7740 tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg 7800 cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat 7860 tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc 7920 gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc 7980 tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa 8040 atgttgaata ctcatactct tcctttttca atattattga agcatttatc agggttattg 8100 tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg 8160 cacatttccc cgaaaagtgc cacctgacgt c 8191 <210> 54 <211> 3196 <212> DNA <213> Artificial sequence <220> <223> pGL4.10-CMV-MP-EPO <400> � ggcctaactg gccggtaccg tcgacgatat cggatccagg tctatataag cagagctcgt 60 ttagtgaacc gtcagatcgc ctagatacgc catccacgct gttttgacct ccatagaaga 120 tcgccaccat gggggtgcac gaatgtcctg cctggctgtg gcttctcctg tccctgctgt 180 cgctccctct gggcctccca gtcctgggcg ccccaccacg cctcatctgt gacagccgag 240 tcctggagag gtacctcttg gaggccaagg aggccgagaa tatcacgacg ggctgtgctg 300 aacactgcag cttgaatgag aatatcactg tcccagacac caaagttaat ttctatgcct 360 ggagaaggat ggaggtcggg cagcaggccg tagaagtctg gcagggcctg gccctgctgt 420 cggaagctgt cctgcggggc caggccctgt tggtcaactc ttcccagccg tgggagcccc 480 tgcagctgca tgtggataaa gccgtcagtg gccttcgcag cctcaccact ctgcttcggg 540 ctctgggagc ccagaaggaa gccatctccc ctccagatgc ggcctcagct gctccactcc 600 gaacaatcac tgctgacact ttccgcaaac tcttccgagt ctactccaat ttcctccggg 660 gaaagctgaa gctgtacaca gggagaggcct gcaggacagg ggacagatga tctagagtcg 720 ggggcggccgg ccgcttcgag cagacatgat aagatacatt gatgagtttg gacaaccac 780 aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt 840 tgtaaccatt ataagctgca ataaacaagt taacaacaac aattgcattc attttatgtt 900 tcaggttcag ggggaggtgt gggaggttt ttaaagcaag taaaacctct acaaatgtgg 960 taaaatcgat aggatccgt cgaccgatgc ccttgagagc cttcaaccca gtcagctcct 1020 tccggtgggc gcggggcatg actatcgtcg ccgcacttat gactgtcttc tttatcatgc 1080 aactcgtagg acaggtgccg gcagcgctct tccgcttcct cgctcactga ctcgctgcgc 1140 tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc 1200 acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg 1260 aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 1320 cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 1380 gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 1440 tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 1500 tatctcagtt cggtgtaggt cgttcgctcc aagctggggct gtgtgcacga accccccgtt 1560 cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 1620 gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 1680 ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag aacagtattt 1740 ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 1800 ggcaaaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 1860 agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg 1920 aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag 1980 atccttttaa attaaaaatg aagtttaaa tcaatctaaa gtatatatga gtaaacttgg 2040 tctgacagcg gccgcaaatg ctaaaccact gcagtggtta ccagtgcttg atcagtgagg 2100 caccgatctc agcgatctgc ctatttcgtt cgtccatagt ggcctgactc cccgtcgtgt 2160 agatcactac gattcgtgag ggcttaccat caggccccag cgcagcaatg atgccgcgag 2220 agccgcgttc accggccccc gatttgtcag caatgaacca gccagcaggg agggccgagc 2280 gagaagtgg tcctgctact ttgtccgcct ccatccagtc tatgagctgc tgtcgtgatg 2340 ctagagtag aagttcgcca gtgagtagtt tccgaagagt tgtggccatt gctactggca 2400 tcgtggtatc acgctcgtcg ttcggtatgg cttcgttcaa ctctggttcc cagcggtcaa 2460 gccgggtcac atgatcaccc atattatgaa gaaatgcagt cagctcctta gggcctccga 2520 tcgttgtcag aagtaagttg gccgcggtgt tgtcgctcat ggtaatggca gcactacaca 2580 attctcttac cgtcatgcca tccgtaagat gcttttccgt gaccggcgag tactcaacca 2640 agtcgttttg tgagtagtgt atacggcgac caagctgctc ttgcccggcg tctatacggg 2700 acaacaccgc gccacatagc agtactttga aagtgctcat catcgggaat cgttcttcgg 2760 ggcggaaaga ctcaaggatc ttgccgctat tgagatccag ttcgatatag cccactcttg 2820 cacccagttg atcttcagca tcttttactt tcaccagcgt ttcggggtgt gcaaaaacag 2880 gcaagcaaaa tgccgcaaag aagggaatga gtgcgacacg aaaatgttgg atgctcatac 2940 tcgtcctttt tcaatattat tgaagcattt atcagggtta ctagtacgtc tctcaaggat 3000 aagtaagtaa tattaaggta cgggaggtat tggacaggcc gcaataaaat atctttattt 3060 tcattacatc tgtgtgttgg ttttttgtgt gaatcgatag tactaacata cgctctccat 3120 caaaacaaaa cgaaacaaaa caaactagca aaataggctg tccccagtgc aagtgcaggt 3180 gccagaacat ttctct 3196 <210> 55 <211> 13 <212> DNA <213> mouse muscle <400> 55 tggcacagtg cca 13 <210> 56 <211> 13 <212> DNA <213> Homo sapiens <400> 56 tgaagaggtg gca 13 <210> 57 <211> 16 <212> DNA <213> mouse muscle <400> 57 tcaacttgcc tgacac 16 <210> 58 <211> 16 <212> DNA <213> Homo sapiens <400> 58 tggactttcc tgaacc 16 <210> 59 <211> 273 <212> DNA <213> Artificial sequence <220> <223> Human NR1x3-Min TK <400> 59 actgtacttt cctgaccctg aagagactgt actttcctga ccctgaagag actgtacttt 60 cctgaccctg aagaggatcc ggccccgccc agcgtcttgt cattggcgaa ttcgaacacg 120 cagatgcagt cggggcggcg cggtccgagg tccacttcgc atattaaggt gacgcgtgtg 180 gcctcgaaca ccgagcgacc ctgcagcgac ccgcttaaca gcgtcaacag cgtgccgcag 240 atctcgagga gcttggcgag attttcagga gct 273 <210> 60 <211> 286 <212> DNA <213> Artificial sequence <220> <223> Human PBREM‑MinTK <400> 60 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc agatccggcc 60 ccgcccagcg tcttgtcatt ggcgaattcg aacacgcaga tgcagtcggg gcggcgcggt 120 ccgaggtcca cttcgcatat taaggtgacg cgtgtggcct cgaacaccga gcgaccctgc 180 agcgacccgc ttaacagcgt caacagcgtg ccgcagatct cgaggagctt ggcgagattt 240 tcaggagcta aggaagctaa acatggaaga tgccaaaaac attaag 286 <210> 61 <211> 286 <212> DNA <213> Artificial sequence <220> <223> hNR1‑mNFI‑hNR2‑Min TK (HMH MinTK) <400> 61 actgtacttt cctgaccctg gcacagtgcc accatggact ttcctgaacc agatccggcc 60 ccgcccagcg tcttgtcatt ggcgaattcg aacacgcaga tgcagtcggg gcggcgcggt 120 ccgaggtcca cttcgcatat taaggtgacg cgtgtggcct cgaacaccga gcgaccctgc 180 agcgacccgc ttaacagcgt caacagcgtg ccgcagatct cgaggagctt ggcgagattt 240 tcaggagcta aggaagctaa acatggaaga tgccaaaaac attaag 286 <210> 62 <211> 286 <212> DNA <213> Artificial sequence <220> <223> hNR1‑mNFI mNR2‑Min TK (HMM MinTK) <400> 62 actgtacttt cctgaccctg gcacagtgcc accatcaact tgcctgacac cgatccggcc 60 ccgcccagcg tcttgtcatt ggcgaattcg aacacgcaga tgcagtcggg gcggcgcggt 120 ccgaggtcca cttcgcatat taaggtgacg cgtgtggcct cgaacaccga gcgaccctgc 180 agcgacccgc ttaacagcgt caacagcgtg ccgcagatct cgaggagctt ggcgagattt 240 tcaggagcta aggaagctaa acatggaaga tgccaaaaac attaag 286 <210> 63 <211> 286 <212> DNA <213> Artificial sequence <220> <223> mNR1-hNFI-mNR2-Min TK (MHM MinTK) <400> 63 tctgtacttt cctgaccttg aagaggtggc accatcaact tgcctgacac cgatccggcc 60 ccgcccagcg tcttgtcatt ggcgaattcg aacacgcaga tgcagtcggg gcggcgcggt 120 ccgaggtcca cttcgcatat taaggtgacg cgtgtggcct cgaacaccga gcgaccctgc 180 agcgacccgc ttaacagcgt caacagcgtg ccgcagatct cgaggagctt ggcgagattt 240 tcaggagcta aggaagctaa acatggaaga tgccaaaaac attaag 286 <210> 64 <211> 286 <212> DNA <213> Artificial sequence <220> <223> mNR1-hNFI hNR2-Min TK (MHH MinTK) <400> 64 tctgtacttt cctgaccttg aagaggtggc agcatggact ttcctgaacc agatccggcc 60 ccgcccagcg tcttgtcatt ggcgaattcg aacacgcaga tgcagtcggg gcggcgcggt 120 ccgaggtcca cttcgcatat taaggtgacg cgtgtggcct cgaacaccga gcgaccctgc 180 agcgacccgc ttaacagcgt caacagcgtg ccgcagatct cgaggagctt ggcgagattt 240 tcaggagcta aggaagctaa acatggaaga tgccaaaaac attaag 286 <210> 65 <211> 330 <212> DNA <213> Artificial sequence <220> <223> hPB-SV40 <400> 65 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc agctgggagt 60 tcgtagacgg actagcccgg gctcgagatc tgcgatctgc atctcaatta gtcagcaacc 120 atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct 180 ccgccccatc gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct 240 gagctattcc agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctt 300 ggcattccgg tactgttggt aaagccaccc 330 <210> 66 <211> 330 <212> DNA <213> Artificial sequence <220> <223> MHM-SV40 <400> 66 tctgtacttt cctgaccttg aagaggtggc accatcaact tgcctgacac cgctgggagt 60 tcgtagacgg actagcccgg gctcgagatc tgcgatctgc atctcaatta gtcagcaacc 120 atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct 180 ccgccccatc gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct 240 gagctattcc agaagtagtg aggaggcttt tttggaggcc tagcttttg caaaaaagctt ggcattccgg tactgttggt aaagccaccc 330 <210> 67 <211> 401 <212> DNA <213> The snowstorm <220> <223> 2xhPB SV40 <400> 67 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc acattactcg catccattct cactgtactt tcctgaccct gaagaggtgg cagcatggac tttcctgaac cagctgggag ttcgtagcg gactagcccg ggctcgagat ctgcgatctg catctcaatt 180 agtcagcaac catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt 240 ccgcccattc tccgccccat cgctgactaa ttttttttat ttatgcagag gccgaggccg 300 cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt 360 gcaaaagct tggcattccg gtactgttgg taaagccacc c <210> 68 <211> 353 <212> DNA <213> Artificial sequence <220> <223> 2xMHM‑MinTK <400> 68 tctgtacttt cctgaccttg aagaggtggc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt gaagaggtgg caccatcaac ttgcctgaca 120 ccgctgggag ttcgtagacg gagatccggc cccgcccagc gtcttgtcat tggcgaattc 180 gaacacgcag atgcagtcgg ggcggcgcgg tccgaggtcc acttcgcata ttaaggtgac 240 gcgtgtggcc tcgaacaccg agcgaccctg cagcgacccg cttaacagcg tcaacagcgt 300 gccgcagatc tcgaggagct tggcgagatt ttcaggagct aaggaagcta aac 353 <210> 69 <211> 401 <212> DNA <213> Artificial sequence <220> <223> 2xMHM‑SV40 <400> 69 tctgtacttt cctgaccttg aagaggtggc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt gaagaggtgg caccatcaac ttgcctgaca 120 ccgctgggag ttcgtagacg gactagcccg ggctcgagat ctgcgatctg catctcaatt 180 ccgctgggag ttcgtagacg gactagcccg ggctcgagat ctgcgatctg catctcaatt 180 agtcagcaac catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt 240 agtcagcaac catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt 240 ccgcccattc tccgccccat cgctgactaa ttttttttat ttatgcagag gccgaggccg 300 ccgcccattc tccgccccat cgctgactaa ttttttttat ttatgcagag gccgaggccg 300 cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt 360 cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt 360 gcaaaaagct tggcattccg gtactgttgg taaagccacc c 401 gcaaaaagct tggcattccg gtactgttgg taaagccacc c 401 <210> 70<210> 70 <211> 424<211> 424 <212> DNA<212> DNA <213> Artificial sequence<213> Artificial sequence <220><220> <223> 3xhPB‑minTK <223> 3xhPB‑minTK <400> 70 <400> 70 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc acattactcg 60 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc acattactcg 60 catccattct cactgtactt tcctgaccct gaagaggtgg cagcatggac tttcctgaac 120 catccattct cactgtactt tcctgaccct gaagaggtgg cagcatggac tttcctgaac 120 cagcactgaa ggtcctcaat cgactgtact ttcctgaccc tgaagaggtg gcagcatgga 180 cagcactgaa ggtcctcaat cgactgtact ttcctgaccc tgaagaggtg gcagcatgga 180 ctttcctgaa ccagctggga gttcgtagac ggagatccgg ccccgcccag cgtcttgtca 240 ctttcctgaa ccagctggga gttcgtagac ggagatccgg ccccgcccag cgtcttgtca 240 ttggcgaatt cgaacacgca gatgcagtcg gggcggcgcg gtccgaggtc cacttcgcat 300 ttggcgaatt cgaacacgca gatgcagtcg gggcggcgcg gtccgaggtc cacttcgcat 300 attaaggtga cgcgtgtggc ctcgaacacc gagcgaccct gcagcgaccc gcttaacagc 360 gtcaacagcg tgccgcagat ctcgaggagc ttggcgagat tttcaggagc taaggaagct 420 aaac 424 <210> 71 <211> 472 <212> DNA <213> Artificial sequence <220> <223> 3xhPB‑SV40 <400> 71 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc acattactcg 60 catccattct cactgtactt tcctgaccct gaagaggtgg cagcatggac tttcctgaac 120 cagcactgaa ggtcctcaat cgactgtact ttcctgaccc tgaagaggtg gcagcatgga 180 ctttcctgaa ccagctggga gttcgtagac ggactagccc gggctcgaga tctgcgatct 240 gcatctcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac 300 tccgcccagt tccgcccatt ctccgcccca tcgctgacta atttttttta tttatgcaga 360 ggccgaggcc gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg 420 cctaggcttt tgcaaaaagc ttggcattcc ggtactgttg gtaaagccac cc 472 <210> 72 <211> 51 <212> DNA <213> Artificial sequence <220> <223> HMH heterozygous <400> 72 actgtacttt cctgaccctg gcacagtgcc accatggact ttcctgaacc a 51 <210> 73 <211> 51 <212> DNA <213> Artificial sequence <220> <223> HMM heterozygote <400> 73 actgtacttt cctgaccctg gcacagtgcc accatcaact tgcctgacac c 51 <210> 74 <211> 51 <212> DNA <213> Artificial sequence <220> <223> MHM hybrid <400> 74 tctgtacttt cctgaccttg aagaggtggc accatcaact tgcctgacac c 51 <210> 75 <211> 51 <212> DNA <213> Artificial sequence <220> <223> MHH hybrid <400> 75 tctgtacttt cctgaccttg aagaggtggc agcatggact ttcctgaacc a 51 <210> 76 <211> 101 <212> DNA <213> Artificial sequence <220> <223> 2x mouse PBREM CREs <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <400> 76 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac cctgtacttt 60 cctgaccttg gcacagtgcc accatcaact tgcctgacac c 101 <210> 77 <211> 204 <212> DNA <213> Artificial sequence <220> <223> 3x mouse PBREM CREs <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <220> <221> misc_feature <222> (102) (103) <223> Optional spacers <220> <221> misc_feature <222> (153) (154) <223> Optional spacers <400> 77 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ctctgtactt 60 tcctgacctt ggcacagtgc caccatcaac ttgcctgaca cctctgtact ttcctgacct 120 tggcacagtg ccaccatcaa cttgcctgac acctctgtac tttcctgacc ttggcacagt 180 gccaccatca acttgcctga cacc 204 <210> 78 <211> 101 <212> DNA <213> Artificial sequence <220> <223> 2x MHM heterozygous CREs <220> <221> misc_feature <222> (50) (51) <223> Optional spacers <400> 78 ctgtactttc ctgaccttga agaggtggca ccatcaactt gcctgacacc tctgtacttt 60 cctgaccttg aagaggtggc accatcaact tgcctgacac c 101 <210> 79 <211> 102 <212> DNA <213> Artificial sequence <220> <223> 2x people PBREM CREs <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <400> 79 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc aactgtactt 60 tcctgaccct gaagaggtgg cagcatggac tttcctgaac ca 102 <210> 80 <211> 153 <212> DNA <213> Artificial sequence <220> <223> 3x people PBREM CREs <220> <221> misc_feature <222> (51)..(52) <223> Optional spacers <220> <221> misc_feature <222> (102) (103) <223> Optional spacers <400> 80 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc aactgtactt 60 tcctgaccct gaagaggtgg cagcatggac tttcctgaac caactgtact ttcctgaccc 120 tgaagaggtg gcagcatgga ctttcctgaa cca 153 <210> 81 <211> 122 <212> DNA <213> Artificial sequence <220> <223> 2x mouse PBREM CREs <400> 81 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 cc 122 <210> 82 <211> 264 <212> DNA <213> Artificial sequence <220> <223> 3x mouse PBREM <400> 82 tctgtacttt cctgaccttg gcacagtgcc accatcaact tgcctgacac ccattactcg 60 catccattct ctctgtactt tcctgacctt ggcacagtgc caccatcaac ttgcctgaca 120 ccgcactgaa ggtcctcaat cgtctgtact ttcctgacct tggcacagtg ccaccatcaa 180 cttgcctgac accctgacct cctgccagca atatctgtac tttcctgacc ttggcacagt 240 gccaccatca acttgcctga cacc 264 <210> 83 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 2x MHM Hybrid <400> 83 ctgtactttc ctgaccttga agaggtggca ccatcaactt gcctgacacc cattactcgc 60 atccattctc tctgtacttt cctgaccttg aagaggtggc accatcaact tgcctgacac 120 c 121 <210> 84 <211> 122 <212> DNA <213> Artificial Sequence <220> <223> 2x Human PBREM <400> 84 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc acattactcg 60 catccattct cactgtactt tcctgaccct gaagaggtgg cagcatggac tttcctgaac 120 ca 122 <210> 85 <211> 193 <212> DNA <213> Artificial sequence <220> <223> 3x people PBREM <400> 85 actgtacttt cctgaccctg aagaggtggc agcatggact ttcctgaacc acattactcg 60 catccattct cactgtactt tcctgaccct gaagaggtgg cagcatggac tttcctgaac 120 cagcactgaa ggtcctcaat cgactgtact ttcctgaccc tgaagaggtg gcagcatgga 180 ctttcctgaa cca 193 <210> 86 <211> 18 <212> DNA <213> mouse muscle <400> 86 tctgtacttt cctgacct 18 <210> 87 <211> 18 <212> DNA <213> Homo sapiens <400> 87 actgtacttt cctgaccc 18 <210> 88 <211> 16 <212> DNA <213> mouse muscle <400> 88 tggcacagtg ccacca 16 <210> 89 <211> 16 <212> DNA <213> Homo sapiens <400> 89 tgaagaggtg gcagca 16 <210> 90 <211> 17 <212> DNA <213> mouse muscle <400> 90 tcaacttgcc tgacacc 17 <210> 91 <211> 17 <212> DNA <213> Homo sapiens <400> 91 tggactttcc tgaacca 17

Claims

1. A gene therapy vector comprising an expression cassette, the expression cassette comprising a synthetic liver-specific inducible promoter operatively linked to a gene, wherein the gene encodes a therapeutic expression product, and the synthetic liver-specific inducible promoter comprises a cis-regulatory element capable of being bound and activated by heterodimers of CAR and RXR. The cis-regulatory elements that can be bound to and activated by the CAR-RXR heterodimer consist of functional variants of SEQ ID NO: 1 or SEQ ID NO: 2; The functional variant of SEQ ID NO: 1 or SEQ ID NO: 2 consists of one of the following sequences: -[TGTACTTTCCTGACCN-S-] n (SEQ ID NO: 29); -[CTGTACTTTCCTGACCN-S-] n (SEQ ID NO: 30); and -[NCTGTACTTTCCTGACCNTG-S-] n (SEQ ID NO: 31), Where S is an arbitrary spacer, and n is 1-5, or The functional variant of SEQ ID NO: 1 or SEQ ID NO: 2 consists of one of the following sequences composition: -TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN (SEQ ID NO: 32); -TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN (SEQ ID NO: 33); -CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN (SEQ ID NO: 34); -CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN (SEQ ID NO:35); -NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG (SEQ ID NO: 36); -NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG (SEQID NO: 37); -TCTGTACTTTCCTGACCTTG-S-TCTGTACTTTCCTGACCTTG-S-TCTGTACTTTCCTGACCTTG (SEQID NO: 38); or -ACTGTACTTTCCTGACCCTG-S-ACTGTACTTTCCTGACCCTG-S-ACTGTACTTTCCTGACCCTG (SEQID NO: 39), Where S is an optional spacer.

2. The gene therapy vector according to claim 1, comprising 2 to 4 cis-regulatory elements, each cis-regulatory element being capable of being bound to and activated by heterodimers of CAR and RXR.

3. The gene therapy vector according to claim 1, comprising 2 or 3 cis-regulatory elements, each of which can be bound to and activated by heterodimers of CAR and RXR.

4. The gene therapy vector according to claim 1, comprising a synthetic liver-specific inducible promoter, said promoter comprising a cis-regulatory module, said cis-regulatory module comprising one of the following sequences composition: -NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S- NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 42); and -NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S- NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S- NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 43), Where S is an optional spacer.

5. The gene therapy vector according to claim 1, comprising a synthetic liver-specific inducible promoter, said promoter comprising a cis-regulatory module, said cis-regulatory module comprising one of the following sequences: -TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 44); -TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 45); and -ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S- ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 47), Where S is an optional spacer.

6. The gene therapy vector of claim 1, comprising a cis-regulatory element capable of being bound and activated by a heterodimer of CAR and RXR, said heterodimer being operatively linked to a minimal promoter or a proximal promoter.

7. The gene therapy vector according to claim 6, wherein the minimal promoter is the HSV thymidine kinase minimal promoter (MinTK), the CMV minimal promoter (CMVmp), or the SV40 minimal promoter (SV40mp).

8. The gene therapy vector according to claim 1, wherein it comprises one of the following sequences: SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO:

71.

9. The gene therapy vector according to claim 1, wherein it comprises one of the following sequences: SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 or SEQ ID NO:

71.

10. The gene therapy vector of claim 1, wherein the expression cassette comprises a sequence providing or encoding one or more of a ribosome binding site, a start codon, a stop codon, a transcription termination sequence, a nucleic acid encoding a post-transcriptional regulatory element, and / or a polyA element.

11. The gene therapy vector according to claim 1, wherein the gene encodes a protein or RNA.

12. The gene therapy vector of claim 1, wherein the therapeutic expression product is a therapeutic protein suitable for treating diseases or conditions associated with abnormal gene expression in the liver.

13. The gene therapy vector according to claim 1, wherein the gene coding site-specific nuclease.

14. The gene therapy vector according to claim 1, wherein it is a viral vector.

15. The gene therapy vector according to claim 1, wherein it is an AAV vector.

16. The gene therapy vector according to claim 15, wherein the AAV vector is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, and AAV9.

17. The gene therapy vector according to claim 15, wherein the AAV vector is selected from AAV8 and AAV9.

18. The gene therapy vector according to claim 1, wherein it is a plasmid.

19. An expression cassette comprising a synthetic liver-specific inducible promoter operatively linked to a gene, wherein the gene encodes a therapeutic expression product, the synthetic liver-specific inducible promoter comprising, according to any one of claims 1 to 18, a cis-regulatory element capable of being bound to and activated by heterodimers of CAR and RXR.

20. The expression cassette of claim 19, wherein the gene is not a reporter gene.

21. A synthetic liver-specific inducible promoter comprising a cis-regulatory module, said cis-regulatory module being composed of one of the following sequences: -NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-SNCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 42); or -NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-SNCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-SNCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 43); -TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 44); -TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 45); -ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 46); or -ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 47), Where S is an optional spacer.

22. The synthetic liver-specific inducible promoter according to claim 21, wherein the synthetic liver-specific inducible promoter comprises one of the following sequences: SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO:

71.

23. A recombinant virion comprising a gene therapy vector according to any one of claims 1 to 18, an expression cassette according to any one of claims 19 or 20, or a promoter according to any one of claims 21 or 22.

24. A pharmaceutical composition comprising a gene therapy vector according to any one of claims 1 to 18, an expression cassette according to any one of claims 19 or 20, or a virion according to claim 23.

25. A cell comprising a gene therapy vector according to any one of claims 1 to 18, an expression cassette according to any one of claims 19 or 20, a promoter according to any one of claims 21 or 22, or a virion according to claim 23.

26. The cell according to claim 25, wherein it is a hepatocyte.

27. Use of the gene therapy vector according to any one of claims 1 to 18, the expression cassette according to any one of claims 19 or 20, the virion according to claim 23, or the pharmaceutical composition according to claim 24 in the preparation of a medicament for treating diseases associated with abnormal gene expression in the liver.

28. A method for producing a therapeutic expression product in in vitro cells, the method comprising: - Provide a cell comprising an expression cassette of any one of claims 1 to 18, the expression cassette comprising a synthetic liver-specific inducible promoter operatively linked to a gene, the synthetic liver-specific inducible promoter comprising a cis-regulatory element capable of being bound to and activated by heterodimers of CAR and RXR. and - The cells are given an inducing agent that induces the expression of the expression product of a gene operatively linked to an inducible promoter in the expression cassette.

29. The method of claim 28, wherein the cell is a hepatocyte, and the method comprises maintaining the hepatocyte under suitable conditions to express an expression product derived from a gene.

30. The method of claim 28, wherein the inducing agent comprises one or more reagents selected from the group consisting of: Phenobarbital (PB); and flavonoids.

31. The method of claim 28, further comprising stopping the administration of the inducer.

32. The method of claim 28, further comprising varying the concentration of the inducer administered to the cells over time.

33. The method of claim 28, further comprising the step of introducing the synthetic liver-specific expression cassette into the cells.

34. A method for producing a therapeutic expression product in vitro, the method comprising the following steps: a) Provide a population of eukaryotic cells comprising an expression cassette according to any one of claims 1 to 18, the expression cassette comprising a synthetic liver-specific inducible promoter operatively linked to a gene, the synthetic liver-specific inducible promoter comprising a cis-regulatory element capable of being bound to and activated by heterodimers of CAR and RXR. b) Culture the cell population; and c) Applying an inducing agent to the cell population, the inducing agent being capable of inducing the expression of the expression product of a gene operatively linked to an inducible promoter in the expression cassette; and d) Recover the expression product.

Images