CSFV subunit vaccine

Abstract

The present invention relates to the field of animal health. In particular, the present invention relates to a recombinant classical swine fever virus E2 protein comprising at least one mutation at an epitope specifically recognized by the 6B8 monoclonal antibody. In addition, the present invention provides an immunogenic composition comprising the recombinant E2 protein of the present invention and the use of the immunogenic composition in preventing and / or treating diseases associated with CSFV in animals. Moreover, the present invention provides a kit for distinguishing animals infected with CSFV from animals vaccinated with an immunogenic composition according to the present invention.

Description

Technical Field

[0001] This invention relates to the field of animal health. In particular, this invention relates to a recombinant classical swine fever virus (CSFV) E2 protein containing at least one mutation at an epitope specifically recognized by a 6B8 monoclonal antibody. Furthermore, this invention provides an immunogenic composition comprising the recombinant E2 protein of this invention, and the use of this immunogenic composition in the prevention and / or treatment of CSFV-related diseases in animals. Additionally, this invention provides methods and kits for distinguishing CSFV-infected animals from animals vaccinated with the immunogenic composition of this invention. Background Technology

[0002] Classical swine fever (CSF) is a serious infectious disease of pigs and wild boars, causing significant economic losses. The pathogen is the classical swine fever virus (CSFV). In China, a combined strategy of vaccination and eradication is employed to control CSF outbreaks. However, sporadic CSF outbreaks and persistent infections are still reported in most parts of China.

[0003] There is still a need in this field for a new CSFV vaccine that is safe, effective, and whose vaccinated animals can be distinguished from those infected with wild-type strains. Summary of the Invention

[0004] In one aspect, the present invention provides a recombinant CSFV (classical swine fever virus) E2 protein containing at least one mutation within the 6B8 epitope of the E2 protein, wherein the (unmodified) 6B8 epitope is specifically recognized by a 6B8 monoclonal antibody.

[0005] In one aspect, the present invention provides an isolated nucleic acid encoding the recombinant CSFV E2 protein of the present invention.

[0006] In one aspect, the present invention provides a vector comprising the nucleic acid of the present invention.

[0007] In one aspect, the present invention provides an immunogenic composition comprising, respectively, a recombinant CSFVE2 protein according to the present invention, a nucleic acid encoding the recombinant CSFVE2 protein, or a vector encoding such nucleic acid.

[0008] In one aspect, the present invention provides a method for preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering the immunogenic composition of the present invention to animals in need.

[0009] In one aspect, the present invention provides a method for distinguishing between animals infected with CSFV and animals inoculated with the immunogenic composition of the present invention, comprising:

[0010] a) Obtaining samples from animals; and

[0011] b) Analyze the sample in an immunoassay.

[0012] In one aspect, the present invention provides a kit for distinguishing between animals infected with CSFV and animals vaccinated with the immunogenic composition of the present invention. Attached Figure Description

[0013] Figure 1 CSFV E2 structure and key amino acids at the 6B8 epitope.

[0014] Figure 2 : Construct wild-type CSFV E2 and mutant CSFV E2 with various substitutions in the 6B8 epitope.

[0015] Figure 3 The purification results of wt-E2 and E2-KARD or E2-KRD were confirmed by SDS PAGE and Western blotting.

[0016] Figure 4 Purified E2-KARD or E2-KRD showed negative results for 6B8 staining.

[0017] Figure 5 :mAb 6B8 recognizes most CSFV strains but does not react with BVDV.

[0018] Figure 6 Sequence alignment of CSFV isolates, BVDV strains and other plague viruses.

[0019] Figure 7 IFA results showed that amino acid residues at positions 14, 22, or 24 / 25 are crucial for the binding of mAb 6B8.

[0020] Figure 8 Post-attack body temperature in efficacy studies.

[0021] Figure 9 White blood cell count after attack in efficacy studies.

[0022] Figure 10 Post-attack mortality rate in effectiveness studies.

[0023] Figure 11 Post-attack clinical score in efficacy studies.

[0024] Figure 12 Serological response during efficacy studies. Detailed Implementation

[0025] Before describing various aspects of the invention, it must be noted that, as used herein and in the appended claims, singular forms include plural references unless the context clearly indicates otherwise. Thus, for example, a reference to “epitope” includes multiple epitopes, a reference to “virus” is a reference to one or more viruses and their equivalents known to those skilled in the art, and so on. The term “and / or” is intended to include any combination of items connected by the term, equivalent to listing all combinations individually. For example, “A, B, and / or C” includes “A,” “B,” “C,” “A and B,” “A and C,” “B and C,” and “A and B and C.” Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of the invention, preferred methods, apparatus, and materials are now described. All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing viral strains, cell lines, vectors, and methods reported in publications that may be used in the invention. Nothing herein should be construed as an admission that the invention is not entitled to precede such disclosure by virtue of prior invention.

[0026] In one aspect, the present invention provides a recombinant CSFV (classical swine fever virus) E2 protein containing at least one mutation within the 6B8 epitope of the E2 protein, wherein the (unmodified) 6B8 epitope is specifically recognized by a 6B8 monoclonal antibody.

[0027] The term “CSFV” used in this article refers to all viruses belonging to the classical swine fever virus (CSFV) species in the genus Plasminovirus of the family Flaviviridae.

[0028] The term "recombination" refers to proteins or nucleic acids that have been altered, rearranged, or modified through genetic engineering. However, this term does not refer to changes in polynucleotide, amino acid, or nucleotide sequences caused by naturally occurring events such as spontaneous mutations.

[0029] In one aspect, the recombinant CSFV E2 protein was isolated.

[0030] A polypeptide or nucleic acid molecule is considered "isolated"—for example, when compared to its natural biological source and / or the reaction medium or culture medium from which it is obtained—when it has been separated from at least one other component (e.g., another protein / peptide, another nucleic acid, another biological component or macromolecule, or at least one contaminant, impurity, or minor component) in the source or medium to which it is actually associated. In particular, a polypeptide or nucleic acid molecule is considered "isolated" when it has been purified at least 2-fold, especially at least 10-fold, more particularly at least 100-fold, and up to 1000-fold or more. The "isolated form" of the polypeptide or nucleic acid molecule is preferably substantially homogeneous, as determined using suitable techniques, such as suitable chromatographic techniques, such as polyacrylamide gel electrophoresis.

[0031] The term "6B8 epitope of E2 protein" in this article also refers to the epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody disclosed herein. The 6B8 epitope may contain at least the amino acid sequence STNEIGPLGAEG (SEQ ID NO:1) or STDEIGLLGAGG (SEQ ID NO:2).

[0032] The term "6B8 monoclonal antibody" refers to a 6B8 monoclonal antibody or its antigen-binding fragment, wherein the 6B8 monoclonal antibody specifically recognizes the 6B8 epitope, particularly the 6B8 epitope containing at least the amino acid sequence STNEIGPLGAEG (SEQ ID NO:1) or STDEIGLLGAGG (SEQ ID NO:2). Preferably, the term 6B8 monoclonal antibody refers to a monoclonal antibody containing a CDR of a monoclonal antibody produced by a hybridoma deposited at CCTCC with accession number CCTCC C2018120. Preferably, the term 6B8 monoclonal antibody refers to a monoclonal antibody comprising VHCDR1 containing the amino acid sequence shown in SEQ ID NO:3, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:4, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:5, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:6, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:7, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:8. More preferably, the term 6B8 monoclonal antibody refers to a heavy chain variable region (V) containing the amino acid sequence described in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence described in SEQ ID NO:10 L ) monoclonal antibody. More preferably, the term 6B8 monoclonal antibody refers to a monoclonal antibody produced from a hybridoma deposited in CCTCC with accession number CCTCC C2018120.

[0033] As used herein, “antibody” means immunoglobulin and immunoglobulin fragments, whether natural or partially or wholly synthetic, such as recombinant, produced, including any fragment containing at least a portion of the variable region of an immunoglobulin molecule that retains the binding specificity of the full-length immunoglobulin. Therefore, an antibody includes any protein having a binding domain homologous or substantially homologous to an immunoglobulin antigen-binding domain (antibody binding site). Antibodies include antibody fragments. Therefore, as used herein, the term antibody includes synthetic antibodies, recombinant antibodies, multispecific antibodies (e.g., bispecific antibodies), human antibodies, non-human antibodies, humanized antibodies, chimeric antibodies, in vivo antibodies, and antibody fragments. The antibodies described herein include members of any immunoglobulin type (e.g., IgG, IgM, IgD, IgE, IgA, and IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass (e.g., IgG2a and IgG2b).

[0034] As used herein, the term "variable region" refers to an immunoglobulin domain consisting essentially of four "framework regions," referred to in the art and hereinafter as "framework region 1" or "FR1"; "framework region 2" or "FR2"; "framework region 3" or "FR3"; and "framework region 4" or "FR4," which are interrupted by three "complementarity-determining regions" or "CDRs," referred to in the art and hereinafter as "complementarity-determining region 1" or "CDR1"; "complementarity-determining region 2" or "CDR2"; and "complementarity-determining region 3" or "CDR3," respectively. Therefore, the general structure or sequence of an immunoglobulin variable region can be indicated as follows: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. VH or VH refers to the heavy chain variable region, and VL or VL refers to the light chain variable region. Similarly, VH CDR1, VH CDR2, and VH CDR3 refer to CDR1, CDR2, and CDR3 of the heavy chain variable region, respectively. VL CDR1, VL CDR2, and VL CDR3 refer to CDR1, CDR2, and CDR3 of the light chain variable region, respectively.

[0035] As used herein, an "antibody fragment" or "antigen-binding fragment" of an antibody refers to any portion of a full-length antibody that is smaller than the full length but contains at least a portion of a variable region of the antibody that binds an antigen (e.g., one or more CDRs and / or one or more antibody binding sites) and thus maintains binding specificity, and at least a portion of the specific binding capacity of the full-length antibody. Therefore, an antigen-binding fragment refers to an antibody fragment containing an antigen-binding portion that binds to the same antigen as the derived antibody fragment. Antibody fragments include antibody derivatives produced by enzymatic treatment of a full-length antibody, as well as synthetic derivatives, such as those produced by recombinant synthesis. Antibody fragments are included in the antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab")2, single-chain Fv (scFv), Fv, dsFv, bifunctional antibodies, Fd and Fd' fragments, and other fragments, including modified fragments (e.g., see Molecular Biology Methods, Vol. 207: Recombinant Antibodies for Cancer Therapeutic Methods and Protocols (2003); Chapter 1; pp. 3-25, Kipriyanov). The fragment may include, for example, multiple chains linked together by disulfide bridges and / or peptide linkers. Antigen-binding fragments include any antibody fragment that, upon insertion into an antibody framework (e.g., by replacing a corresponding region), generates an immune-specific binding to the antigen (i.e., exhibiting at least or at least about 10). 7 -10 8 M -1 Antibodies against Ka.

[0036] The term "antigen-binding fragment of a 6B8 monoclonal antibody" refers to a fragment of a 6B8 monoclonal antibody or at least an amino acid sequence encoding a 6B8 epitope that specifically recognizes the 6B8 epitope, particularly a 6B8 epitope containing at least the amino acid sequences STNEIGPLGAEG (SEQ ID NO:1) or STDEIGLLGAGG (SEQ ID NO:2). This term also includes amino acid fragments encoding VH CDR1 containing the amino acid sequence shown in SEQ ID NO:3, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:4, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:5, and / or VL CDR1 containing the amino acid sequence shown in SEQ ID NO:6, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:7, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:8. Furthermore, this term also includes amino acid fragments comprising a heavy chain variable region (V) having the amino acid sequence shown in SEQ ID NO:9. H ) and / or a light chain variable region (V) having an amino acid sequence as shown in SEQ ID NO:10 LMore preferably, the term includes an amino acid fragment encoded by a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, which specifically binds to the 6B8 epitope.

[0037] The term "mutation" includes the substitution, deletion, or addition of one or more amino acids. The term mutation is well known to those skilled in the art, and mutations can be generated effortlessly by those skilled in the art.

[0038] In one aspect, at least one mutation within the 6B8 epitope of the E2 protein of the present invention results in specific inhibition of the binding of a 6B8 monoclonal antibody to such mutated 6B8 epitope.

[0039] The term "specific inhibition" refers to the fact that the affinity of a 6B8 antibody for a mutated 6B8 epitope is at least 2-fold, preferably 5-fold, more preferably 10-fold, and even more preferably 50-fold lower than that for an unmodified 6B8 epitope, particularly an unmodified 6B8 epitope having the amino acid sequences STNEIGPLGAEG (SEQ ID NO:1) or STDEIGLLGAGG (SEQ ID NO:2). "Affinity" is the interaction between a single antigen-binding site and a single epitope on an antibody molecule. It is expressed by the association constant KA = kass / kdiss or the dissociation constant KD = kdiss / kass. More preferably, the term "specific inhibition" refers to the undetectable binding of the mutated 6B8 epitope according to the invention by a 6B8 monoclonal antibody, particularly a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, in a specific immunofluorescence assay, preferably as described in Example 5, or in a specific dot blot assay, preferably as described in Example 6. Both specific immunofluorescence assays and specific dot blot assays can be used to determine specific inhibition; however, if conflicting results are obtained from these two assays, the result of the dot blot assay shall prevail.

[0040] The term "substitution" refers to the replacement of one amino acid with another amino acid at the same position. Therefore, the term substitution encompasses the removal / deletion of one amino acid and the insertion of another amino acid at the same position.

[0041] The term "E2 protein" refers to the processed E2 protein, which is produced as the final cleavage product of a multi-protein (Npro-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B) derived from CSFV. Those skilled in the art will recognize that any E2 protein from CSFV can be used in this invention. In one aspect of the invention, the recombinant E2 protein is derived from a wild-type E2 protein having a 6B8 epitope specifically recognized by a 6B8 monoclonal antibody. For example, the E2 protein may be derived from a known CSFV strain such as the C- strain, or from a novel isolate such as QZ07 or GD18 as defined herein. For example, the E2 protein of wild-type strain QZ07 has the amino acid sequence shown in SEQ ID NO:11, the E2 protein of wild-type strain GD18 has the amino acid sequence shown in SEQ ID NO:12, the E2 protein of wild-type strain GD191 has the amino acid sequence shown in SEQ ID NO:42, and the E2 protein of C-strain has the amino acid sequence shown in SEQ ID NO:29.

[0042] In one aspect of the invention, the recombinant E2 protein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any one of the sequences in SEQ ID NO: 11, 12, 42, and 29, but containing at least one mutation disclosed herein within the 6B8 epitope.

[0043] The “sequence identity” between two polypeptide sequences represents the percentage of identical amino acids between the sequences. Methods for assessing the level of sequence identity between amino acid or nucleotide sequences are known in the art. For example, sequence analysis software is frequently used to determine the identity of amino acid sequences. Identity can be determined, for example, by using the BLAST program in the NCBI database. For determinations of sequence identity, see, for example, Computational Molecular Biology, Lesk, AM, Ed., Oxford University Press, New York, 1988; Biocomputation: Informatics and the Genome Project, Smith, DW (eds.), Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG (eds.), Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, Feng, G., Academic Press, 1987; and Primers for Sequence Analysis, Griskov, M. and Devereux, J. (eds.), M Stockton Press, New York, 1991.

[0044] In a preferred aspect of the invention, recombinant E2 proteins having at least one mutation in the 6B8 epitope, as disclosed herein, are immunogenic and preferably confer protective immunity against CSFV. The E2 protein contains four antigenic domains, A, B, C, and D domains, all of which are located at the N-terminus of the E2 protein. These four domains form two separate antigenic units: one is a B / C domain unit, and the other includes an A / D domain. The B / C domain is located at amino acid positions 1 to 84 / 111, and the D / A domain is located at amino acid positions 77 to 111 / 177. Furthermore, the B / C domain is linked by a putative disulfide bond between amino acids 4C and 48C, while the D / A unit is formed by two disulfide bonds, one between amino acids 103C and 167C, and the other between amino acids 129C and 139C. These cysteine ​​residues are crucial to the conformational antigenic structure of the E2 protein. The antigenic motif (82-85LLFD) is an important antigenic structure for the binding of the E2 protein to convalescent serum. Another motif (RYLASLHKKALPT, amino acid positions 64 to 76) was also identified, which is important for the structural integrity of conformational epitope recognition of the E2 protein. Furthermore, it has been reported that E2 proteins containing only one of the aforementioned antigenic domains still possess immunogenicity and can protect pigs from infectious CSFV challenge. Therefore, in a preferred aspect of the invention, recombinant E2 proteins having at least one modification within the 6B8 epitope described herein retain at least one, preferably at least one, antigenic domain as described above. Preferably, the recombinant E2 protein of the present invention can confer protective immunity against CSFV. In one aspect, at least one mutation within the 6B8 epitope as defined herein can be introduced without substantially affecting the protective immunogenicity of the recombinant E2 protein against CSFV.

[0045] In one aspect of the invention, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues at positions 14, 22, 24 and / or 24 and 25 (“24 / 25”) of the E2 protein.

[0046] In one aspect of the invention, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by amino acid residues S14, G22, E24, and / or E24 / G25 of the E2 protein, for example, for isolates QZ07, GD18, or GD191. In another aspect of the invention, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by amino acid residues S14, G22, G24, and / or G24 / G25 of the E2 protein, for example, for strain C.

[0047] The amino acid residue number refers to the amino acid position in the processed E2 protein, starting from the N-terminus, for example, as exemplarily represented by the amino acid positions provided in SEQ ID NO: 11 or 12. However, the amino acid positions may be further defined relative to the multiprotein (containing Npro-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B), for example, relative to the amino acid positions provided exemplarily in SEQ ID NO: 13 or 14. For example, the amino acid residues at positions 14, 22, 24, and 25 of the E2 protein correspond to the amino acid residues at positions 703, 711, 713, and 714 of the multiprotein.

[0048] In one aspect of the invention, the 6B8 epitope of the recombinant E2 protein specifically recognized by a 6B8 monoclonal antibody is defined at least by the amino acid sequence STNEIGPLGAEG (SEQ ID NO:1) (e.g., for isolates QZ07, GD18, or GD191) or STDEIGLLGAGG (SEQ ID NO:2) (e.g., for strain C). In one aspect of the invention, the 6B8 epitope of the recombinant E2 protein specifically recognized by a 6B8 monoclonal antibody is defined at least by the amino acid sequence STNEIGPLGAEG (SEQ ID NO:1) (e.g., for isolates QZ07, GD18, or GD191). In one aspect of the invention, the 6B8 epitope of the recombinant E2 protein specifically recognized by a 6B8 monoclonal antibody is defined at least by the amino acid sequence STDEIGLLGAGG (SEQ ID NO:2) (e.g., for strain C).

[0049] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid positions 24 / 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and / or a substitution at amino acid position 22 of the E2 protein.

[0050] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes a substitution at amino acid position 24 and a substitution at amino acid position 25 of the E2 protein.

[0051] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes a substitution at amino acid position 24 and a substitution at amino acid position 14 of the E2 protein.

[0052] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes a substitution at amino acid position 24, a substitution at amino acid position 25, and a substitution at amino acid position 14 of the E2 protein.

[0053] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes a substitution at amino acid position 24 and a substitution at amino acid position 22 of the E2 protein.

[0054] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes a substitution at amino acid position 24, a substitution at amino acid position 25, and a substitution at amino acid position 22 of the E2 protein.

[0055] In one aspect of the invention, the recombinant CSFV according to the invention includes a substitution at amino acid position 14 of the E2 protein and a substitution at amino acid position 22 of the E2 protein.

[0056] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and a substitution at amino acid position 22 of the E2 protein.

[0057] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes a substitution at amino acid position 24, a substitution at amino acid position 25, a substitution at amino acid position 14, and a substitution at amino acid position 22 of the E2 protein.

[0058] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the 24th amino acid of the E2 protein is substituted with R or K, the 25th amino acid of the E2 protein is substituted with D, the 14th amino acid of the E2 protein is substituted with K, Q or R, and / or the 22nd amino acid of the E2 protein is substituted with A, R, Q or E, preferably A and R.

[0059] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, and the amino acid at position 25 of the E2 protein is replaced with D.

[0060] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, and the amino acid at position 14 of the E2 protein is replaced with K, Q or R.

[0061] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 25 of the E2 protein is replaced with D, and the amino acid at position 14 of the E2 protein is replaced with K, Q, or R.

[0062] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, preferably A and R.

[0063] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 25 of the E2 protein is replaced with D, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, preferably A and R.

[0064] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the amino acid at position 14 of the E2 protein is replaced with K, Q or R, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, preferably A and R.

[0065] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 14 of the E2 protein is replaced with K, Q or R, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, preferably A and R.

[0066] In one aspect of the invention, in the recombinant CSFV E2 protein according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 25 of the E2 protein is replaced with D, the amino acid at position 14 of the E2 protein is replaced with K, Q or R, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, preferably A and R.

[0067] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes replacing E or G at amino acid position 24 of the E2 protein with R or K, replacing E or G at amino acid position 24 with R or K, replacing G at amino acid position 25 of the E2 protein with D, replacing S at amino acid position 14 of the E2 protein with K, Q or R, and / or replacing G at amino acid position 22 of the E2 protein with A, R, Q or E, preferably A and R.

[0068] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes replacing E or G at amino acid position 24 of the E2 protein with R or K, and replacing G at amino acid position 25 of the E2 protein with D.

[0069] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes an E or G substitution at amino acid position 24 of the E2 protein for R or K, and an S substitution at amino acid position 14 of the E2 protein for K, Q, or R.

[0070] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes an E or G substitution at amino acid position 24 of the E2 protein for R or K, a G substitution at amino acid position 25 of the E2 protein for D, and an S substitution at amino acid position 14 of the E2 protein for K, Q, or R.

[0071] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes an E or G substitution at amino acid position 24 of the E2 protein for R or K, and a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0072] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes an E or G substitution at amino acid position 24 of the E2 protein for R or K, a G substitution at amino acid position 25 of the E2 protein for D, and a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0073] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes an S substitution at amino acid position 14 of the E2 protein for K, Q or R, and a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0074] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes an E or G substitution at amino acid position 24 of the E2 protein for R or K, an S substitution at amino acid position 14 of the E2 protein for K, Q or R, and a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0075] In one aspect of the invention, the recombinant CSFV E2 protein according to the invention includes an E or G substitution at amino acid position 24 of the E2 protein for R or K, a G substitution at amino acid position 25 of the E2 protein for D, an S substitution at amino acid position 14 of the E2 protein for K, Q or R, and a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0076] In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein according to the invention results in a mutated 6B8 epitope sequence KTNEIGPLGARD (SEQ ID NO:15), KTNEIGPLLAARD (SEQ ID NO:16), STNEIGPLGARD (SEQ ID NO:17), STDEIGLLGARD (SEQ ID NO:18), KTDEIGLLAARD (SEQ ID NO:19), or KTDEIGLLAARD (SEQ ID NO:20). In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence KTNEIGPLGARD (SEQ ID NO:15). In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence KTNEIGPLAARD (SEQ ID NO:16). In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence STNEIGPLGARD (SEQ ID NO:17). In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in the mutated 6B8 epitope sequence STDEIGLLGARD (SEQ ID NO:18). In another aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in the mutated 6B8 epitope sequence KTDEIGLLGARD (SEQ ID NO:19). In another aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in the mutated 6B8 epitope sequence KTDEIGLLAARD (SEQ ID NO:20).

[0077] Those skilled in the art will recognize that the recombinant CSFV E2 protein of the present invention can be derived from various CSFV isolates because the 6B8 epitope is evolutionarily conserved among different CSFV strains.

[0078] In one aspect of the invention, the recombinant CSFV E2 protein of the present invention is derived from an isolate of genotype 2.1. In another aspect of the invention, the recombinant CSFV E2 protein is derived from, for example, wild-type strains GD18 or QZ07. Wild-type strain QZ07 has the full-length nucleotide sequence shown in SEQ ID NO:21, or contains or expresses a multiprotein having the amino acid sequence shown in SEQ ID NO:13. Wild-type strain GD18 has the full-length nucleotide sequence shown in SEQ ID NO:22, or contains or expresses a multiprotein having the amino acid sequence shown in SEQ ID NO:14.

[0079] In one aspect of the invention, the recombinant CSFV E2 protein of the present invention is derived from an isolate of genotype 1. In another aspect of the invention, the recombinant CSFV E2 protein is derived from a C- strain known in the art.

[0080] In one aspect of the invention, the recombinant CSFV E2 protein is derived from, for example, wild-type strain QZ07 or GD18, and includes an E substitution at amino acid position 24 of the E2 protein for R or K, and optionally includes an S substitution at amino acid position 14 of the E2 protein for K, Q or R, and / or a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0081] In one aspect of the invention, the recombinant CSFV E2 protein is derived from, for example, wild-type strain QZ07 or GD18, and includes an E substitution at amino acid position 24 of the E2 protein for R or K, and a G substitution at amino acid position 25 of the E2 protein for D, and optionally includes an S substitution at amino acid position 14 of the E2 protein for K, Q or R, and / or a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0082] In one aspect of the invention, the recombinant CSFV E2 protein is derived from, for example, wild-type strain GD18, and includes an E substitution at amino acid position 24 of the E2 protein for R or K, and optionally includes an S substitution at amino acid position 14 of the E2 protein for K, Q, or R, and / or a G substitution at amino acid position 22 of the E2 protein for A, R, Q, or E, preferably A and R.

[0083] In one aspect of the invention, the recombinant CSFV E2 protein is derived from, for example, wild-type strain GD18, and includes an E substitution at amino acid position 24 of the E2 protein for R or K, and a G substitution at amino acid position 25 of the E2 protein for D, and optionally includes an S substitution at amino acid position 14 of the E2 protein for K, Q or R, and / or a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0084] In one aspect of the invention, the recombinant CSFV E2 protein is derived from, for example, strain C, and includes a G substitution at amino acid position 24 of the E2 protein for R or K, and optionally includes an S substitution at amino acid position 14 of the E2 protein for K, Q, or R, and / or a G substitution at amino acid position 22 of the E2 protein for A, R, Q, or E, preferably A and R.

[0085] In one aspect of the invention, the recombinant CSFV E2 protein is derived from, for example, strain C, and includes a G substitution at amino acid position 24 of the E2 protein for R or K, and a G substitution at amino acid position 25 of the E2 protein for D, and optionally includes an S substitution at amino acid position 14 of the E2 protein for K, Q, or R, and / or a G substitution at amino acid position 22 of the E2 protein for A, R, Q, or E, preferably A and R.

[0086] In one aspect of the invention, to obtain a soluble E2 protein, the recombinant E2 protein according to the invention can be truncated to remove the transmembrane domain. For example, the last 40 amino acids (e.g., 42 or 43 amino acids) of the C-terminus of the complete E2 protein according to the invention can be omitted.

[0087] In one aspect of the invention, to obtain the secretory form of the recombinant E2 protein according to the invention, a signal peptide may be added to the N-terminus of the E2 protein. For example, the last 20 or so amino acids from the E1 protein, particularly the last 16 amino acids (e.g., for C-strain) or 21 amino acids (e.g., for GD18 or QZ07) may be added to the N-terminus of the recombinant E2 protein according to the invention. In one aspect, the signal peptide may comprise an amino acid sequence selected from SEQ ID NO:49-51. Those skilled in the art will recognize that other signal peptides that allow secretory expression may also be used in the invention.

[0088] In one aspect of the invention, the E2 protein can be truncated to remove the transmembrane domain, and a signal peptide can be added to the N-terminus of the E2 protein to obtain a soluble and secretible E2 protein. For example, the last 43 amino acids of the complete E2 protein can be deleted, and the last 16 or 21 amino acids from the E1 protein can be added to the N-terminus of the E2 protein.

[0089] In one aspect of the invention, the recombinant E2 protein may further include a fusion tag for identification and / or purification. Such tags are well known in the art, such as His tags or FLAG tags.

[0090] In one aspect of the invention, the recombinant CSFV E2 protein comprises an amino acid sequence selected from one of SEQ ID NO:23-28, 30-41 and 43-48.

[0091] In one aspect of the invention, the recombinant E2 protein of the invention comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any one of SEQ ID NO23-28, 30-41, and 43-48, and comprising at least one mutation within the 6B8 epitope.

[0092] On the one hand, the present invention also provides an immunogenic composition comprising the recombinant CSFV E2 protein according to the present invention.

[0093] As used herein, the term "immunogenic composition" refers to a composition comprising at least one antigen that elicits an immune response in a host upon administration of the immunogenic composition. This immune response may be a cellular and / or antibody-mediated immune response to the immunogenic composition of the present invention. The host is also described as a "subject." Preferably, any host or subject described or mentioned herein is an animal.

[0094] Typically, an "immune response" includes, but is not limited to, one or more of the following effects: the generation or activation of antibodies specifically targeting the antigens included in the immunogenic compositions of the present invention, B cells, helper T cells, suppressor T cells and / or cytotoxic T cells and / or γ-δ T cells. Preferably, the host will exhibit a protective immune response or a therapeutic response.

[0095] "Protective immune response" will be demonstrated by a reduction or absence of clinical symptoms typically exhibited by the infected host, faster recovery time and / or reduced duration of infectivity, or a decrease in pathogen titers in the infected host's tissues, body fluids or excretions.

[0096] As used in this article, “antigen” refers to, but is not limited to, a component that elicits an immune response in a host to an immunogenic composition or a vaccine of interest containing such antigen or an immunogenic component thereof.

[0097] An immunogenic composition is described as a "vaccine" when the host exhibits a protective immune response that enhances resistance to new infections and / or reduces the clinical severity of the disease.

[0098] In one aspect, the immunogenic composition of the present invention is a vaccine.

[0099] As understood in this article, the term "vaccine" refers to a veterinary vaccine containing antigenic material, administered for the purpose of inducing specific and active immunity against disease caused by CSFV infection.

[0100] Preferably, the vaccine according to the invention is a subunit CSFV vaccine comprising a recombinant CSFV E2 protein, preferably as described herein, that elicits a protective immune response in a host animal.

[0101] Vaccines may be supplemented with other components typical of pharmaceutical compositions.

[0102] Additional components that enhance the immune response are components commonly referred to as “adjuvants,” either added to a vaccine or produced by the body after induction by such additional components (e.g., but not limited to interferons, interleukins, or growth factors). As used herein, “adjuvants” may include aluminum hydroxide and aluminum phosphate, saponins such as Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsions, oil-in-water emulsions, and water-in-oil-in-water emulsions. The emulsion can be based, in particular, on light liquid paraffin oils (European Pharmacopoeia type); isoprene-like oils, such as squalane or squalene; oils derived from the oligomerization of olefins, especially isobutylene or decene; esters of acids or alcohols containing straight-chain alkyl groups, more particularly vegetable oils, ethyl oleate, propylene glycol di-(caprylate / caprylate), glyceryl tri-(caprylate / caprylate), or propylene glycol dioleate; esters of branched fatty acids or alcohols, especially isostearates. The oil is used in combination with an emulsifier to form the emulsion. The emulsifier is preferably a nonionic surfactant, particularly sorbitol esters, mannitol esters (e.g., mannitol oleate), glycol esters, polyglycerol esters, propylene glycol esters, and optionally ethoxylated oleic acid, isostearates, castor oil oleate, or hydroxystearates, as well as polyoxypropylene-polyoxyethylene copolymer blocks, particularly Pluronic products, especially L121. See Hunter et al., Theory and Practical Applications of Adjuvants (Ed Stewart-Tull, DES), John Wiley and Sons, NY, pp. 51–94 (1995) and Todd et al., Vaccines 15:564–570 (1997). Exemplary adjuvants are the SPT emulsion described on page 147 of “Vaccine Design, Subunits and Adjuvant Methods” edited by M. Powell and M. Newman, Plenum Press, 1995, and the emulsion MF59 described on page 183 of the same book.

[0103] Another example of an adjuvant is a compound selected from polymers of acrylic acid or methacrylic acid, as well as copolymers of maleic anhydride and alkenyl derivatives. Advantageous adjuvant compounds are crosslinked polymers of acrylic acid or methacrylic acid, particularly polymers crosslinked with polyolefin ethers of sugars or polyols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Those skilled in the art may also refer to U.S. Patent 2,909,462, which describes an acrylic polymer crosslinked with a polyhydroxylated compound having at least three hydroxyl groups, preferably no more than eight hydroxyl groups, wherein the hydrogen atoms of the at least three hydroxyl groups are replaced by unsaturated aliphatic groups having at least two carbon atoms. Preferred groups are those containing two to four carbon atoms, such as vinyl, allyl, and other olefinic unsaturated groups. The unsaturated group itself may contain other substituents, such as methyl. Products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly suitable. They are crosslinked with allyl sucrose or allyl pentaerythritol. Among these, Carbopol 974P, 934P, and 971P can be mentioned. Carbopol 971P is the most preferred. Among copolymers of maleic anhydride and alkenyl derivatives is the copolymer EMA (Monsanto), which is a copolymer of maleic anhydride and ethylene. The dissolution of these polymers in water results in an acidic solution, which is then neutralized, preferably to a physiological pH, to provide an adjuvant solution into which the immunogenicity, immunological, or vaccine composition itself is incorporated.

[0104] Other suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), block copolymers (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophospholipid A, Avridine lipid amine adjuvant, heat-labile enterotoxins (recombinant or other) from Escherichia coli, cholera toxin, IMS 1314 or murine aminoacyl dipeptide, or natural or recombinant cytokines or analogues or stimulants for the release of endogenous cytokines.

[0105] In one aspect, the immunogenic composition is formulated into a water-in-oil emulsion with a suitable adjuvant. The adjuvant may include oils and surfactants. In one aspect, the adjuvant is MONTANIDE. TMISA 71R VG (manufactured by Seppic Inc., catalog number: 365187). In one aspect, the adjuvant is Seppic ISA 206. The amount of adjuvant added can be from about 100 μg to about 10 mg per dose. Even more preferably, the amount of adjuvant added is from about 100 μg to about 10 mg per dose. Even more preferably, the amount of adjuvant added is from about 500 μg to about 5 mg per dose. Even more preferably, the amount of adjuvant added is from about 750 μg to about 2.5 mg per dose. The most preferred adjuvant is added at an amount of about 1 mg per dose. In one embodiment, each dose of the immunogenic composition of the present invention comprises about 7 parts of an oil phase containing the adjuvant and about 3 parts of an aqueous phase containing the E2 protein of the present invention.

[0106] In one aspect of the invention, as defined above, at least one mutation within the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody, such as a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid positions 24 / 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and / or a substitution at amino acid position 22 of the E2 protein, is used as a marker.

[0107] As used herein, the term "marker" refers to the mutant 6B8 epitope according to the present invention. The mutant 6B8 epitope according to the present invention differs from the 6B8 epitope sequence of the wild-type CSFV E2 protein (the unmodified 6B8 epitope). Therefore, the mutant 6B8 epitope according to the present invention allows for the differentiation, by exemplary immunoassay and / or genomic analysis, of naturally infected animals with the unmutated 6B8 epitope from inoculated animals with the mutant 6B8 epitope according to the present invention.

[0108] In one aspect of the invention, the immunogenic composition of the invention is a labeled vaccine or a DIVA (distinguishing between infected and vaccinated animals) vaccine.

[0109] The terms "labeled vaccine" or "DIVA (Distinguishing Infected from Vaccinated Animals)" refer to vaccines bearing the aforementioned label. Therefore, labeled vaccines can be used to distinguish vaccinated animals from naturally infected animals. The immunogenic composition of the present invention is used as a labeled vaccine because, in contrast to infection with wild-type CSFV, the substituted 6B8 epitope according to the present invention can be detected in animals vaccinated with the vaccine of the present invention. The substituted 6B8 epitope according to the present invention can be distinguished from the 6B8 epitope sequence of wild-type CSFV (the unmodified 6B8 epitope) by exemplary immunoassay and / or genomic analysis. Finally, the labeled epitope should be specific to the pathogen to avoid false-positive serological results induced by other organisms that may be present in livestock. However, since the 6B8 epitope is evolutionarily conserved (by sequence alignment) and specific to CSFV (6B8 mAb does not bind BVDV), the substituted 6B8 epitope according to the present invention is highly suitable for labeling vaccines.

[0110] A key advantage of effectively marker vaccines is that they allow for the detection of acutely infected or infected pigs at some point before sampling is taken from the vaccinated herd (e.g., at least about 3 weeks), thus providing the possibility of monitoring the spread or reintroduction of CSFV in the herd. Therefore, based on laboratory test results, it is possible to declare, with a certain degree of confidence, that a vaccinated herd is free of CSFV.

[0111] The marked vaccine of this invention is ideally suited for emergency vaccination in the event of swine fever detection or outbreak. The marked vaccine facilitates rapid and effective administration and allows differentiation between animals infected with wild-type (disease-associated) viruses and vaccinated animals.

[0112] In one aspect of the invention, animals treated with the immunogenic composition of the invention can be distinguished from animals infected with naturally occurring classical swine fever virus by analyzing samples obtained from said animals using immunologic tests and / or genomic analysis tests.

[0113] The term "sample" refers to a sample of body fluids, a sample of isolated cells, or a sample from a tissue or organ. Body fluid samples can be obtained using known techniques and preferably include samples of blood, plasma, serum, or urine; more preferably, samples of blood, plasma, or serum. Tissue or organ samples can be obtained from any tissue or organ, for example, through a biopsy. Isolated cells can be obtained from body fluids, tissues, or organs using separation techniques such as centrifugation or cell sorting.

[0114] The term “obtain” may include separation and / or purification steps known to those skilled in the art, preferably using precipitation, columns, etc.

[0115] The terms "immunization test" and "genomic analysis test" are defined as follows. However, the analysis of the "immunization test" and "genomic analysis test" respectively is the basis for distinguishing between animals inoculated with the immunogenic composition according to the present invention and animals infected with naturally occurring (disease-related) classical swine fever virus.

[0116] In one aspect of the invention, the immunogenic composition is formulated for single-dose administration.

[0117] Advantageously, the experimental data provided by this invention disclose that a single dose of the immunogenic composition of this invention reliably and effectively stimulates a protective immune response. Therefore, in one aspect of this invention, the immunogenic composition is formulated for single-dose administration and is effective by single-dose administration.

[0118] Furthermore, the present invention provides the use of the immunogenic compositions of the present invention as pharmaceuticals.

[0119] In one aspect, the present invention provides a method for preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering the immunogenic composition of the present invention to animals in need. In one aspect, the CSFV-related disease is CSF.

[0120] The present invention also relates to a method for immunizing animals, comprising administering to such animals any immunogenic composition according to the invention. The present invention further relates to a method for immunizing animals, comprising administering any immunogenic composition of the invention to such animals alone. Preferably, the method for immunizing animals is effective by administering the immunogenic composition according to the invention to such animals in a single application.

[0121] The term "immunity" refers to active immunization, which involves administering an immunogenic composition to an animal to be immunized, thereby evoking an immune response against an antigen contained in such an immunogenic composition.

[0122] Immunization results in a reduction in the incidence of a specific CSFV infection in the herd, or a reduction in the severity of clinical symptoms caused by or associated with a specific CSFV infection. Preferably, by a single administration of the immunogenic composition according to the invention, immunization results in a reduction in the incidence of a specific CSFV infection in the herd, or a reduction in the severity of clinical symptoms caused by or associated with a specific CSFV infection.

[0123] According to one aspect of the invention, immunization of desired animals with the immunogenic composition provided herein results in prevention of infection of the subject via CSFV, preferably by a single administration of the immunogenic composition of the invention. Even more preferably, immunization results in an effective and durable immune response against CSFV infection. It should be understood that the time period will last for more than 2 months, preferably more than 3 months, more preferably more than 4 months, more preferably more than 5 months, and more preferably more than 6 months. It should be understood that immunization may not be effective in all immunized animals. However, this term requires that a substantial proportion of the animals in the herd be effectively immunized.

[0124] Preferably, a group of animals is envisioned herein, which typically (i.e., in the absence of immunization) will develop clinical symptoms usually caused by or associated with CSFV infection. Whether the animals in the herd are effectively immunized can be determined by those skilled in the art without further ADO. Preferably, immunization will be effective if, compared to animals immunized or not immunized with an immunogenic composition available prior to the present invention but subsequently infected with CSFV, at least 33%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the animals in a given herd, clinical symptoms are reduced by at least 10%, more preferably at least 20%, even more preferably at least 30%, even more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%.

[0125] In one aspect of the invention, the animal is a pig. In another aspect, the animal is a piglet. Piglets are typically less than 3 to 4 weeks old. In one aspect, piglets are vaccinated between 1 and 4 weeks of age. In one aspect, the animal is a sow. In another aspect, the animal is a pregnant sow.

[0126] In one aspect of the invention, the immunogenic composition is administered intradermally, intratracheally, intravaginally, intramuscularly, intranasally, intravenously, intraarterially, intraperitoneally, orally, intrathecally, subcutaneously, intradermally, intracardiacly, intralobarly, intramedullaryly, intrapulmonaryly, and combinations thereof. However, depending on the nature of the compound and its mode of action, the immunogenic composition may also be administered via other routes.

[0127] The present invention also provides a method for reducing the incidence or severity of one or more CSF-related clinical symptoms in animals, the method comprising the step of administering an immunogenic composition according to the invention to animals in need of it, wherein the reduction in the incidence or severity of the one or more clinical symptoms is associated with animals not receiving the immunogenic composition. Preferably, the method comprises administering a single dose of the immunogenic composition, and such a single administration of the immunogenic composition effectively reduces the incidence or severity of one or more clinical symptoms.

[0128] The term “clinical symptoms” as used herein refers to the symptoms observed in animals infected with CSFV. Clinical symptoms are further defined below. However, clinical symptoms also include, but are not limited to, those that can be directly observed in live animals. Examples of clinical symptoms that can be directly observed in live animals include nasal and ocular discharge, lethargy, coughing, wheezing, thrashing, high fever, weight gain or loss, dehydration, diarrhea, joint swelling, lameness, emaciation, pale skin, and gluttony. Mittelholzer et al. (Vet. Microbiol., 2000. 74(4): p. 293-308) developed a checklist for determining clinical scores in CSF animal experiments. This checklist includes parameters such as vitality, body tone, body size, respiration, gait, skin, eyes / conjunctiva, appetite, defecation, and residues left during feeding.

[0129] Compared with subjects who were treated with immunogenic compositions not available prior to the present invention or who were treated with immunogenic compositions but subsequently infected with CSFV, preferably, the incidence or severity of clinical symptoms is reduced by at least 10%, more preferably at least 20%, even more preferably at least 30%, even more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%.

[0130] In one aspect of the invention, the immunogenic composition is applied once, and is effective by such a single application.

[0131] However, while single-dose administration is preferred, the immunogenic composition may also be administered two or more times, with the first dose administered before the second (enhancer) dose. Preferably, the second dose is administered at least 15 days after the first dose. More preferably, the second dose is administered between 15 and 40 days after the first dose. Even more preferably, the second dose is administered at least 17 days after the first dose. Still more preferably, the second dose is administered between 17 and 30 days after the first dose. Even more preferably, the second dose is administered at least 19 days after the first dose. Still more preferably, the second dose is administered between 19 and 25 days after the first dose. Most preferably, the second dose is administered at least 21 days after the first dose. In a preferred aspect of the two-dose regimen, both the first and second doses of the immunogenic composition are administered in the same amount. In addition to the first and second dose regimens, alternative embodiments include further subsequent doses. For example, a third, fourth, or fifth dose may be administered in these respects. Preferably, the subsequent third, fourth, and fifth dose regimens are administered in the same amount as the first dose, with the time range between doses corresponding to the time range between the first and second doses described above.

[0132] In one aspect of the invention, the one or more clinical symptoms are selected from the group consisting of: respiratory distress, dyspnea, cough, sneezing, rhinitis, tachypnea, dyspnea, pneumonia, red / blue discoloration of the ears and vulva, jaundice, lymphocytic infiltration, lymphadenopathy, hepatitis, nephritis, anorexia, fever, lethargy, agalactia, diarrhea, nasal discharge, conjunctivitis, progressive weight loss, weight loss, pale skin, gastric ulcer, macroscopic and microscopic lesions of organs and tissues, lymphoid lesions, mortality, viral abortion, stillbirth, piglet malformation, mummification, and combinations thereof.

[0133] In one aspect, the invention also provides a method for distinguishing between animals infected with CSFV and animals vaccinated with the immunogenic composition according to the invention, comprising:

[0134] a) Obtaining samples, and

[0135] b) Detect the sample in an immunoassay.

[0136] The term "immunoassay" refers to the detection of an antibody specific to the 6B8 epitope of the CSFV E2 protein. The antibody may be specific to the mutant 6B8 epitope according to the invention or the 6B8 epitope of the wild-type CSFV E2 protein (the unmodified 6B8 epitope). However, the term "immunoassay" also refers to the detection of a peptide containing the mutant 6B8 epitope according to the invention or the 6B8 epitope peptide of the wild-type CSFVE2 protein (the unmodified 6B8 epitope). Examples of immunoassays include any enzyme immunoassay or immunochemical assay, such as ELISA (enzyme-linked immunosorbent assay), EIA (enzyme immunoassay), RIA (radioimmunoassay), sandwich enzyme immunoassay, fluorescent antibody assay (FAT), electrochemiluminescence sandwich immunoassay (ECLIA), dissociation-enhanced lanthanide fluorine immunoassay (DELFIA), or solid-phase immunoassay, immunofluorescence assay (IFT), immunohistochemical staining, Western blot analysis, or any other suitable method available to those skilled in the art. Depending on the assay used, the antigen or antibody may be labeled with an enzyme, fluorophore, or radioisotope. For example, see Coligan et al., Current Protocols in Immunology, John Wiley & Sons Inc., New York, NY (1994); and Frye et al., Oncogen 4:1153-1157, 1987.

[0137] Preferably, an antibody specific to the 6B8 epitope of the wild-type CSFV E2 protein is used to detect serum cells (e.g., leukocytes) or isolated organs (e.g., tonsils, spleen, kidneys, lymph nodes, distal ileum) from animals suspected of being infected with wild-type CSFV (e.g., pigs) or animals vaccinated with recombinant CSFV E2 protein according to the invention (e.g., pigs). In this case, only animal samples infected with wild-type CSFV will show a positive result for the 6B8 epitope-specific antibody. Conversely, samples from animals vaccinated with recombinant CSFV E2 protein according to the invention will not show a result for the 6B8 epitope-specific antibody due to mutations within the 6B8 epitope according to the invention. In another assay, CSFV is isolated from organs (e.g., tonsils) or serum cells (e.g., leukocytes) from animals, for example, infected, suspected of being infected with wild-type CSFV, or vaccinated, and incubated with a suitable cell line (e.g., SK-6 cells or PK-15 cells) for virus infection. Subsequently, the replicating virus was detected in cells using a 6B8 epitope-specific antibody, which distinguishes between field-specific (wild-type, disease-associated) CSFV and recombinant CSFV according to the invention. Furthermore, peptides can be used to block nonspecific cross-reactivity. Additionally, antibodies specific to other epitopes of wild-type CSFV can be used as positive controls.

[0138] More preferably, an ELISA is used in which an antibody specifically targeting the 6B8 epitope (unmodified 6B8 epitope) of the wild-type CSFV E2 protein is cross-linked to a microplate to distinguish infected pigs from pigs vaccinated with the vaccine of the present invention. The cross-linking is preferably performed via an anchoring protein such as poly-L-lysine. ELISAs using this cross-linking are generally more sensitive than ELISAs employing passive coating techniques. Wild-type (disease-associated) CSFV binds to an antibody specifically targeting the 6B8 epitope (unmodified 6B8 epitope) of the wild-type CSFV E2 protein. Detection of the binding of wild-type CSFV virus to an antibody specifically targeting the 6B8 epitope of wild-type CSFV can be performed using additional antibodies against CSFV. In this case, only samples from infected pigs will show a positive result for the 6B8 epitope-specific antibody. Furthermore, peptides can be used to block non-specific cross-reactivity. Additionally, antibodies specific to other epitopes of wild-type CSFV can be used as positive controls.

[0139] Alternatively, the microplate can be cross-linked with a CSFV-specific antibody, rather than a 6B8 epitope-specific antibody (the unmodified 6B8 epitope) of the wild-type CSFV E2 protein. Wild-type (disease-associated) CSFV binds to the cross-linked antibody. Detection of the binding of wild-type CSFV to the cross-linked antibody can be performed using an antibody specifically targeting the 6B8 epitope (the unmodified 6B8 epitope) of the wild-type CSFV E2 protein.

[0140] As mentioned above, the 6B8 epitope is evolutionarily conserved and specific to wild-type CSFV.

[0141] Therefore, more preferably, the ELISA is used to detect antibodies against the mutant 6B8 epitope according to the invention or the 6B8 epitope (unmodified 6B8 epitope) of wild-type CSFV in a sample. Such detection includes the mutant 6B8 epitope peptide according to the invention or the 6B8 epitope peptide (unmodified 6B8 epitope) of wild-type CSFV.

[0142] For example, such a assay may include wells having a substituted 6B8 epitope according to the invention or a 6B8 epitope of wild-type CSFV cross-linked with a microplate (the unmodified 6B8 epitope). The cross-linking is preferably performed via an anchoring protein, such as poly-L-lysine. Expression systems for obtaining mutant or wild-type 6B8 epitopes are well known to those skilled in the art. Alternatively, the 6B8 epitope may be chemically synthesized. It must be understood that while mutant or wild-type 6B8 epitopes can be used in the assays of the invention, it is convenient to use a protein containing the complete E2 protein or a fragment of the E2 protein containing the 6B8 epitope, rather than the relatively short epitope itself. Particularly when the epitope is used, for example, for coating wells in a standard ELISA assay, using a larger protein containing the epitope may be more efficient for the coating step.

[0143] Animals vaccinated with the recombinant CSFV E2 protein according to the invention did not produce antibodies against the wild-type 6B8 epitope. However, according to the invention, these animals produced antibodies against the substituted 6B8 epitope. As a result, no antibodies bound to the wells coated with the wild-type 6B8 epitope. Conversely, if the wells were coated with the mutant 6B8 epitope of the invention, antibodies bound to the mutant 6B8 epitope.

[0144] However, animals infected with wild-type CSFV will produce antibodies against the wild-type epitope of CSFV. However, according to the present invention, these animals do not produce antibodies against the mutant 6B8 epitope. As a result, no antibodies bind to the wells coated with the mutant 6B8 epitope of the present invention. Conversely, if the wells have been coated with the wild-type 6B8 epitope, antibodies bind to the wild-type 6B8 epitope.

[0145] The binding of the antibody to the mutant 6B8 epitope according to the present invention or the 6B8 epitope of wild-type CSFV (the unmodified 6B8 epitope) can be performed by methods known to those skilled in the art.

[0146] Preferably, the ELISA is a sandwich ELISA. More preferably, the ELISA is a competitive ELISA. Most preferably, the ELISA is a dual-competitive ELISA. However, different ELISA techniques are well known to those skilled in the art. ELLSA is exemplarily described in Wensvoort G. et al., 1988 (Vet. Microbiol. 17(2):129-140), Robiolo b. et al., 2010 (J. Virol. Methods. 166(1-2):21-27), and Colijn, EO et al., 1997 (Vet. Microbiology 59:15-25).

[0147] In one aspect of the invention, the immunoassay includes detecting whether an antibody that specifically recognizes the intact 6B8 epitope of the CSFV E2 protein binds to the CSFV E2 protein in a sample. In another aspect of the invention, the immunoassay includes detecting the presence in a sample of an antibody that specifically recognizes the 6B8 epitope of the CSFV E2 protein, and / or detecting the presence in a sample of an antibody that specifically recognizes a mutated 6B8 epitope of the CSFV E2 protein. Such a mutated 6B8 epitope includes mutations in 6B8 epitopes as defined herein.

[0148] In one aspect of the invention, the immunological assay is EIA (enzyme immunoassay) or ELISA (enzyme-linked immunosorbent assay). In another aspect of the invention, the ELISA is an indirect ELISA, a sandwich ELISA, a competitive ELISA, or a dual-competitive ELISA, preferably a dual-competitive ELISA.

[0149] In one aspect, the present invention also provides a nucleic acid encoding the recombinant CSFV E2 protein according to the present invention.

[0150] The term "nucleic acid" refers to polynucleotides, including DNA molecules, RNA molecules, cDNA molecules, or derivatives. This term includes single-stranded and double-stranded polynucleotides. The nucleic acids of this invention include recombinant polynucleotides (i.e., recombinants derived from their natural background) and genetically modified forms. Furthermore, chemically modified polynucleotides are also included, including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides, or artificially modified polynucleotides such as biotinylated polynucleotides. Moreover, it should be understood that, due to the degenerate genetic code, the recombinant CSFV E2 protein of this invention can be encoded by a large number of polynucleotides.

[0151] In one aspect, the invention also provides a vector comprising nucleic acid encoding the recombinant CSFV E2 protein according to the invention. In another aspect, the vector is an expression vector.

[0152] The term "vector" includes bacteriophages, plasmids, viral or retroviral vectors, and artificial chromosomes, such as bacterial or yeast artificial chromosomes. Furthermore, the term also refers to targeted constructs that allow random or site-specific integration into genomic DNA. Such targeted constructs preferably contain DNA of sufficient length for homologous or heterologous recombination, as described in detail below. Preferably, the vector containing the nucleic acid of the present invention also includes a selective marker for replication and / or selection in the host. The vector can be incorporated into host cells using various techniques known in the art. For example, plasmid vectors can be introduced into precipitates such as calcium phosphate or rubidium chloride precipitates, or into complexes with charged lipids, or into carbon-based clusters such as fullerenes. Alternatively, plasmid vectors can be introduced using thermal shock or electroporation techniques. If the vector is a virus, it can be packaged in vitro using a suitable packaging cell line before application to host cells. Retroviral vectors can be replication-capable or replication-deficient. In the latter case, viral replication typically occurs only in complementary host / cells. More preferably, the polynucleotide is operatively linked to an expression control sequence that allows expression in prokaryotic or eukaryotic cells or their isolated fractions. The expression of the polynucleotide includes transcription of the polynucleotide, preferably into translatable mRNA. Regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells, are well known in the art. These preferably include regulatory sequences ensuring transcription initiation and optionally poly-A signals ensuring transcription termination and transcript stability. Additional regulatory elements may include transcription and translation enhancers. Possible regulatory elements allowing expression in prokaryotic host cells include, for example, the lac, trp, or tac promoters in *E. coli*, and examples of regulatory elements allowing expression in eukaryotic host cells are the AOX1 or GAL1 promoters in yeast, or CMV-, SV40-, RSV- promoters (Rous sarcoma virus), CMV-enhancers, SV40-enhancers, or globin introns in mammalian and other animal cells. Furthermore, inducible expression control sequences may be used in the expression vectors included in this invention. Such inducible vectors may include tet or lac operon sequences or sequences induced by heat shock or other environmental factors. Suitable expression control sequences are well known in the art. For example, these techniques are described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989), NY, and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1994). Preferably, the vector of the present invention is a baculovirus vector.

[0153] On the one hand, the present invention also provides a host cell comprising the nucleic acid or vector of the present invention. The host cell may be a prokaryotic cell, such as Escherichia coli, or a eukaryotic cell, such as an intercalated cell. Preferably, the host cell is an SF9 cell.

[0154] In one aspect, the present invention also provides a method for producing the recombinant CSFV E2 protein of the present invention, comprising:

[0155] (i) Culture host cells as defined herein under conditions suitable for expression of CSFV E2 protein, and

[0156] (ii) Isolate and optionally purify CSFV E2 protein.

[0157] In one aspect, the present invention also provides a method for preparing an immunogenic composition, comprising: (i) culturing cells containing an expression vector capable of expressing an E2 protein; and (ii) harvesting the E2 protein or a whole-cell culture containing the E2 protein, wherein the E2 protein contains at least one mutation in the 6B8 epitope of the E2 protein that is specifically recognized by a 6B8 monoclonal antibody as defined above.

[0158] In one aspect of the invention, the expression vector is a recombinant baculovirus comprising the nucleic acid molecules of the invention. In one aspect, the recombinant baculovirus is derived from a commercial product. In one aspect, the recombinant baculovirus is derived from a commercial product sold under the trademark Sapphire™ Baculovirus (Allele Biotechnology). In one aspect, the cell is an insect cell. In one aspect, the insect cell is an SF+ cell. In one embodiment, the SF+ cell is a commercial product sold by Protein Sciences, Inc. (Meriden, CT).

[0159] In one aspect of the invention, the method includes the step of preparing a recombinant baculovirus comprising the nucleic acid molecule of the invention. In one aspect, the recombinant baculovirus is derived from a commercial product. In another aspect, the recombinant baculovirus is derived from a commercial product sold under the trademark Sapphire™ Baculovirus (Allele Biotechnology).

[0160] In one aspect of the invention, the method includes the step of infecting cells with the recombinant baculovirus of the invention. In one embodiment, the cells are insect cells. In one embodiment, the insect cells are SF+ cells. In one embodiment, SF+ cells are a commercial product sold by Protein Sciences, Inc. (Meriden, CT).

[0161] In one aspect of the invention, the method includes preparing a recombinant baculovirus comprising the nucleic acid molecules of the invention and infecting insect cells with the recombinant baculovirus. In one embodiment, the recombinant baculovirus is derived from a commercial product sold under the trademark Sapphire™ Baculovirus (Allele Biotechnology). In one embodiment, the insect cells are SF+ cells. In one embodiment, SF+ cells are a commercial product sold by Protein Sciences, Inc. (Meriden, CT).

[0162] In one aspect of the invention, the method includes: (i) preparing a recombinant baculovirus comprising the nucleic acid molecule of the present invention; (ii) infecting insect cells with the recombinant baculovirus; (iii) culturing the insect cells in a culture medium; and (iv) harvesting the E2 protein of the present invention or a whole-cell culture comprising the E2 protein of the present invention. In one embodiment, the recombinant baculovirus is derived from a commercial product sold under the trademark Sapphire™ Baculovirus (Allele Biotechnology). In one embodiment, the insect cells are SF+ cells. In one embodiment, SF+ cells are a commercial product sold by Protein Sciences, Inc. (Meriden, CT).

[0163] In one aspect of the invention, the culture medium used to culture the cells of the invention will be determined by those skilled in the art. In one aspect, the culture medium is a serum-free insect cell culture medium. In another aspect, the culture medium is Ex-CELL 420 (for insect cells). 420 serum-free medium, Sigma-Aldrich, Cat. 14420C).

[0164] In one aspect of the invention, insect cells are cultured under conditions suitable for expressing the E2 protein. In one aspect, the insect cells are incubated for up to 10 days, preferably from about 2 days to about 10 days, more preferably from about 4 days to about 9 days, and even more preferably from about 5 days to about 8 days. In one aspect, suitable conditions for culturing insect cells include a temperature of about 22-32°C, preferably about 24-30°C, more preferably about 25-29°C, even more preferably about 26-28°C, and most preferably about 27°C.

[0165] In one aspect of the invention, the method further includes the step of inactivating the cell culture of the invention. Any conventional inactivation method can be used for the purposes of the invention, including but not limited to chemical and / or physical treatments.

[0166] In one aspect, the inactivation step includes adding a cyclized diethyleneimine (BEI), preferably at a concentration of about 1 to about 20 mM, more preferably at a concentration of about 2 to about 10 mM, and even more preferably at a concentration of about 5 mM or 10 mM. In one embodiment, the inactivation step includes adding a solution of 2-bromoethyleneimine hydrobromide, which will cyclize in NaOH to form BEI.

[0167] In one aspect, the inactivation step is carried out at a temperature between 25 and 40°C, preferably between 28 and 39°C, more preferably between 30 and 39°C, and even more preferably between 35 and 39°C. In one embodiment, the inactivation step is carried out for 24 to 72 hours, preferably 30 to 72 hours, and more preferably 48 to 72 hours. Typically, the inactivation step is carried out until viral vector replication is undetectable.

[0168] In one aspect of the invention, the method further includes a neutralization step following the inactivation step. The neutralization step includes adding an equal volume of the inactivating agent to the neutralization solution. In one embodiment, the inactivating agent is BEI. In one aspect, the neutralizing agent is sodium thiosulfate. In one aspect, when the inactivating agent is BEI, an equal volume of sodium thiosulfate is added. For example, if BEI is added to a final concentration of 5 mM, 1.0 M sodium thiosulfate solution is added to obtain a final minimum concentration of 5 mM to neutralize any residual BEI. In one aspect, the neutralization step includes adding sodium thiosulfate solution to a final concentration of 1 to 20 mM, preferably 2 to 10 mM, more preferably 5 mM or 10 mM, when the inactivating agent is BEI. In one aspect, the neutralizing agent is added after the inactivation step is completed, meaning that viral vector replication cannot be detected. In one aspect, the neutralizing agent is added 24 hours after the inactivation step. In one aspect, the neutralizing agent is added 30 hours after the inactivation step. In one aspect, a neutralizing agent is added 48 hours after the inactivation step. In another aspect, a neutralizing agent is added 72 hours after the inactivation step.

[0169] In one aspect, the invention also provides a kit for distinguishing between animals infected with CSFV and animals vaccinated with the immunogenic composition according to the invention. In one aspect, the kit comprises an antibody or an antigen-binding fragment thereof as defined herein, a recombinant E2 protein of the invention having a mutation at the 6B8 epitope, and / or a wild-type E2 protein of CSFV containing the 6B8 epitope as defined herein. The kit may also include instructions for use.

[0170] The following terms are also described herein and are part of the disclosure of this invention:

[0171] 1. A recombinant CSFV (classical swine fever virus) E2 protein containing at least one mutation within the 6B8 epitope, wherein the unmodified 6B8 epitope is specifically recognized by the 6B8 monoclonal antibody.

[0172] 2. The recombinant CSFV E2 protein according to Clause 1, wherein at least one mutation within the 6B8 epitope of the E2 protein results in specific inhibition of the binding of a 6B8 monoclonal antibody to such mutated 6B8 epitope.

[0173] 3. The recombinant CSFV E2 protein according to clause 1 or 2, wherein the 6B8 monoclonal antibody

[0174] (i) Produced by a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0175] (ii) Containing a heavy chain variable region (V) having the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10 L ),or

[0176] (iii) A CDR containing a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0177] (iv) VH CDR1 containing the amino acid sequence shown in SEQ ID NO:3, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:4, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:5, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:6, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:7, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:8.

[0178] 4. The recombinant CSFV E2 protein according to any one of clauses 1 to 3, wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues at positions 14, 22, 24 and / or 24 / 25 of the E2 protein.

[0179] 5. The recombinant CSFV E2 protein according to any one of clauses 1 to 3, wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by amino acid residues S14, G22, E24 and / or E24 / G25 of the E2 protein, or at least by amino acid residues S14, G22, G24 and / or G24 / G25 of the E2 protein.

[0180] 6. The recombinant CSFV E2 protein according to any one of claims 1 to 3, wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by at least the amino acid sequence STNEIGPLGAEG or STDEIGLLGAGG.

[0181] 7. The recombinant CSFV E2 protein according to any one of Clauses 1 to 6, comprising substitution at amino acid position 24 of the E2 protein, substitution at amino acid positions 24 / 25 of the E2 protein, substitution at amino acid position 14 of the E2 protein, and / or substitution at amino acid position 22 of the E2 protein.

[0182] 8. The recombinant CSFV E2 protein according to any one of clauses 1 to 7, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acids at positions 24 and 25 of the E2 protein are substituted with R or K and D, respectively, the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and / or the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E, preferably A and R.

[0183] 9. The recombinant CSFV E2 protein according to any one of clauses 1 to 8, comprising replacing E or G at amino acid position 24 of the E2 protein with R or K, replacing E or G at amino acid position 24 of the E2 protein with R or K, replacing G at amino acid position 25 with D, replacing S at amino acid position 14 of the E2 protein with K, Q or R, and / or replacing G at amino acid position 22 of the E2 protein with A, R, Q or E, preferably A and R.

[0184] 10. The recombinant CSFV E2 protein according to any one of clauses 1 to 9, wherein an amino acid substitution within the 6B8 epitope results in a mutated 6B8 epitope sequence in any one of SEQ ID No: 15-20.

[0185] 11. The recombinant CSFV E2 protein according to any one of clauses 1 to 10, wherein the recombinant CSFV E2 protein is derived from strain C or wild-type strain QZ07 or GD18.

[0186] 12. The recombinant CSFV E2 protein according to any one of clauses 1 to 11, wherein the recombinant CSFV E2 protein is derived from wild-type strain QZ07 and includes an E substitution at amino acid position 24 of the E2 protein for R or K, or an E substitution at amino acid position 24 of the E2 protein for R or K, and a G substitution at amino acid position 25 for D, and optionally also includes an S substitution at amino acid position 14 of the E2 protein for K, Q or R, and / or a G substitution at amino acid position 22 of the E2 protein for A, R, Q or E, preferably A and R.

[0187] 13. The recombinant CSFV E2 protein according to any one of clauses 1 to 11, wherein the recombinant CSFV E2 protein is derived from wild-type strain GD18 and includes an E substitution at amino acid position 24 of the E2 protein for R or K, or an E substitution at amino acid position 24 of the E2 protein for R or K, and a G substitution at amino acid position 25 of the E2 protein for D, and optionally also includes an S substitution at amino acid position 14 of the E2 protein for K, Q or R, and / or a G substitution at amino acid position 22 of the E2 protein for A.

[0188] 14. The recombinant CSFV E2 protein according to any one of clauses 1 to 11, wherein the recombinant CSFV E2 protein is derived from strain C and includes a G substitution of R at amino acid position 24 of the E2 protein and a G substitution of D at amino acid position 25 of the E2 protein, and optionally includes an S substitution of K at amino acid position 14 of the E2 protein and / or a G substitution of A, R, Q or E at amino acid position 22 of the E2 protein, preferably A and R.

[0189] 15. The recombinant CSFV E2 protein according to any one of clauses 1 to 11, wherein the recombinant CSFV E2 protein comprises an amino acid sequence selected from one of SEQ ID NO: 23-28, 30-41 and 43-48.

[0190] 16. A recombinant nucleic acid encoding a recombinant CSFV E2 protein according to any one of clauses 1 to 15.

[0191] 17. A vector comprising the nucleic acid of clause 16.

[0192] 18. A host cell comprising the nucleic acid of clause 16 or the vector of clause 17.

[0193] 19. A method for producing recombinant CSFV E2 protein according to any one of clauses 1 to 15, comprising:

[0194] (i) Culture the host cells of Clause 18 under conditions suitable for the expression of CSFV E2 protein, and

[0195] (ii) Isolate and optionally purify CSFV E2 protein.

[0196] 20. An immunogenic composition comprising the recombinant CSFV E2 protein according to any one of Clauses 1 to 15, the recombinant nucleic acid according to Clause 16, or the vector according to Clause 17.

[0197] 21. The immunogenic composition according to Clause 20, wherein the immunogenic composition is a vaccine, preferably a labeled vaccine or a DIVA (distinguishing between infected and vaccinated animals) vaccine.

[0198] 22. A method for preventing and / or treating CSFV-related diseases in animals using an immunogenic composition according to clause 20 or 21, the method comprising the step of administering the immunogenic composition according to clause 20 or 21 to the animal.

[0199] 23. A method for preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein the animal is a pig, using an immunogenic composition according to Clause 20 or 21.

[0200] 24. A method for preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21 using an immunogenic composition according to Clause 20 or 21, wherein said animal is a piglet.

[0201] 25. A method for preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21 using an immunogenic composition according to Clause 20 or 21, wherein said animals are piglets aged 1 to 4 weeks.

[0202] 26. A method for preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21 using an immunogenic composition according to Clause 20 or 21, wherein said animal is a sow.

[0203] 27. A method for preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21 using an immunogenic composition according to Clause 20 or 21, wherein said animal is a pregnant sow.

[0204] 28. A method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21 using an immunogenic composition according to Clause 20 or 21, wherein said immunogenic composition is administered only once.

[0205] 29. A method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21 using an immunogenic composition according to Clause 20 or 21, wherein the immunogenic composition is administered to the animal only once, and effectively prevents and / or treats CSFV-related diseases after the single administration of the immunogenic composition.

[0206] 30. A method of using an immunogenic composition according to Clause 20 or 21 for the prevention and / or treatment of CSFV-related diseases in animals according to Clause 20 or 21, wherein said immunogenic composition is administered once or multiple times.

[0207] 31. A method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21 using an immunogenic composition according to Clause 20 or 21, wherein the immunogenic composition is administered to the animal once or multiple times and effectively prevents and / or treats CSFV-related diseases following a single or multiple administration of the immunogenic composition.

[0208] 32. A method for preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering an immunogenic composition according to clause 20 or 21 to an animal in need.

[0209] 33. A method for distinguishing between animals infected with CSFV and animals vaccinated with the immunogenic composition of any one of clauses 20 or 21, comprising:

[0210] a) Obtaining samples, and

[0211] b) Detect the sample in an immunoassay.

[0212] 34. The method according to Clause 33, wherein the immunoassay includes detecting whether an antibody that specifically recognizes the 6B8 epitope of the CSFV E2 protein or its antigen-binding fragment is able to bind to the CSFV E2 protein in the sample.

[0213] 35. The method according to Clause 33 or 34, wherein the immunoassay includes detecting the presence in the sample of an antibody that specifically recognizes the 6B8 epitope of the CSFV E2 protein, and / or detecting the presence in the sample of an antibody that specifically recognizes the mutant 6B8 epitope of the recombinant CSFV E2 protein.

[0214] 36. The method according to any one of clauses 33 to 35, wherein the immunoassay is EIA (enzyme immunoassay) or ELISA (enzyme-linked immunosorbent assay), preferably a dual-competitive ELISA.

[0215] 37. The method according to any one of clauses 34 to 36, wherein an antibody specifically recognizes the 6B8 epitope.

[0216] (i) Produced by a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0217] (ii) comprising a heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO:9 and a light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO:10, or

[0218] (iii) A CDR containing a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0219] (iv) VH CDR1 containing the amino acid sequence shown in SEQ ID NO:3, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:4, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:5, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:6, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:7, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:8.

[0220] 38. A kit for distinguishing between animals infected with CSFV and animals inoculated with an immunogenic composition of any one of clauses 19 or 20, comprising an antibody or an antigen-binding fragment thereof that specifically recognizes the 6B8 epitope of the CSFV E2 protein.

[0221] Example

[0222] The following embodiments further illustrate the invention by way of example. It should be understood that the invention is not limited to any of the embodiments described below. Those skilled in the art will understand that, in view of the general description of the invention, the performance, results, and findings of these embodiments can be adapted and applied in a broader sense.

[0223] Materials and methods

[0224] 1. Cell Culture

[0225] sf9 cells were cultured in Excell 420 medium containing 5% fetal bovine serum (FBS) at 27°C in the absence of CO2.

[0226] SF+ cells were cultured in Excel 420 medium on a shaker at 27°C and 120 rpm.

[0227] The PK / WRL cell line was cultured with 10% fetal bovine serum (FBS) and incubated at 37°C and 5% CO2.

[0228] 2. Construction of pVL1393 shuttle plasmid

[0229] The QZ07-E2, QZ07-E2-KRD, and QZ07-E2-KARD sequences were all codon-optimized (SEQ ID NO: 52-54) and synthesized according to an insect expression system. To obtain a soluble and secret form of the E2 protein, the last 43 amino acids (aa) of E2 were deleted from the final optimized sequence, while the last 21 amino acids from the E1 protein were added as a signal peptide. A schematic diagram of the E2 structure to be expressed is shown below. Figure 1As shown. Each synthesized sequence was cloned into the pVL1393 shuttle plasmid using BamHI and EcoRI to complete the pVL1393 shuttle plasmid for further co-transfection. The complete construction process of CSFV E2 and CSFV E2 with the 6B8 epitope mutation is described in [link to documentation]. Figure 2 KARD refers to the S14K, G22A, and E24R / G25D mutations, and the amino acid number refers to the E2 protein, such as SEQ ID NO:11. Other mutation combinations, such as KRD (S14K and E24R / G25D), have also been introduced into the E2 protein.

[0230] The C-E2 and C-E2-KARD sequences (SEQ ID NO: 55 and 56, respectively) were synthesized separately. To obtain a soluble and secret form of the E2 protein, the last 42 amino acids (aa) of E2 were deleted from the final sequence, while the last 16 amino acids from the E1 protein were added as a signal peptide. A schematic diagram of the E2 structure to be expressed is shown below. Figure 1 As shown. Each synthesized sequence was cloned into the pVL1393 shuttle plasmid using BamHI and EcoRI to complete the pVL1393 shuttle plasmid for further co-transfection. The complete construction process of CSFV E2 and CSFV E2 with the 6B8 epitope mutation is described in [link to documentation]. Figure 2 KARD refers to the S14K, G22A, and G24R / G25D mutations, and the amino acid number refers to the E2 protein, such as SEQ ID NO:29.

[0231] 3. Construction of E2 expression cassette recombinant baculovirus

[0232] Prepare one well (1.0 x 10⁻⁶) of SF9 cells in a six-well plate. 6One well was used for transfection, and another well was used as a cell control. After incubation for 1 hour, the cells were evenly distributed on the surface. A DNA liposome transfection mixture was prepared by mixing 0.5 ml of serum-free Grace's insect medium (unreplenished) and 3 μl of DNA shuttle transfection agent in one tube; in another tube, 1 μl of sapphire baculovirus DNA, 1 μg of transfer plasmid, and 0.5 ml of serum-free Grace's insect medium (unreplenished) were added; the contents of the two tubes were combined and gently mixed, and incubated at room temperature for 20 minutes. The medium was removed from the cells, and the monolayer was washed twice each time with 1 ml of serum-free Grace's insect medium (unreplenished), then the medium was removed from the cells and the DNA / transfection agent mixture was added. The cell monolayer was incubated at 27°C for 4–5 hours, and the transfection mixture was replaced with 2 ml of Excell 420 containing 5% FBS. Incubation continued at 27°C for 5–6 days. Cells and cell culture medium were collected by centrifugation at 3000 rpm for 10 minutes at 4°C.

[0233] 4. Plaque purification process for recombinant baculovirus

[0234] Preparation of sf9 cells (1.5 × 10⁻⁶) 6 Fill six-well plates (cells / well) and incubate at room temperature for 1 hour. Prepare serial 10-fold dilutions of each virus (50 μL virus and 450 μL culture medium), from 10⁻¹ to 10⁻⁶. Remove the cell culture medium from the plates and place the 10⁻⁶ dilutions into the plates. -3 Up to 10 -6 100 μL of virus per well was added dropwise to the center of each culture dish (two wells infected per dilution). The plates were then incubated at room temperature for 1 hour. During incubation, 1% (w / v) LGT agarose medium was prepared in a 37°C water bath. The virus inoculum was removed from each well, and 2 ml of 1% (w / v) LGT agarose medium was pipetted and covered each well. The plates were incubated at room temperature for approximately 15 minutes until solidified. Then, 1 ml of insect cell culture medium was added to the top of the agarose cover per well and incubated at 27°C for 5 days. Finally, the liquid cover was removed, and 1 ml of neutral red (1:20 plus medium) was added to each well and incubated at 27°C for 2 to 4 hours. To remove plaques, the culture dishes were placed in the dark in an inverted position for 4 hours. The number of plaques was counted and the virus titer was calculated. Individual plaques were picked up with a pipette tip and dissolved in 200 μL of medium, stored at 4°C until propagation.

[0235] 5E2 protein purification

[0236] Centrifuge 300 ml of culture supernatant and then filter. Incubate the filtered supernatant with Ni agarose gel Excel beads for 2 hours to capture the target protein. Wash the beads with buffered PBS (pH 7.4), and then with buffers containing 20 mM, 50 mM, and 80 mM imidazole, respectively, and finally elute with buffers containing 200 mM and 500 mM imidazole. Perform SDS-PAGE and Western blotting to check the purity and concentration of the target protein.

[0237] Example 1: Identification and introduction of DIVA sites

[0238] The core feature of the new vaccine required is its ability to distinguish between vaccinated and infected animals (DIVA). The DIVA characteristic would be a significant improvement over traditional CSFV E2 subunit vaccines and offers important technological advantages. The strategy for introducing the DIVA characteristic is to alter one or more key epitopes on the surface of the immunodominant E2 protein and use ELISA to demonstrate the absence of antibodies recognizing wild-type epitopes as an indicator of vaccination (negative DIVA).

[0239] To implement this strategy, the inventors selected strongly neutralizing mouse mAb 6B8. The hybridoma that produced monoclonal antibody 6B8 was obtained from Zhejiang University and deposited on June 13, 2018, at CCTCC (China Center for Type Culture Collection) (Wuhan University, Wuhan 430072, PRChina) with accession number CCTCC C2018120. Sequencing of monoclonal antibody 6B8 revealed that it possesses a heavy chain variable region (VH) and a light chain variable region (VL), wherein the heavy chain variable region (VH) has the amino acid sequence shown in SEQ ID NO:9, and the light chain variable region has the amino acid sequence shown in SEQ ID NO:10. The CDR of this antibody can be readily determined by various methods known in the art, such as the Kabat method. For example, mAb6B8 contains VH CDR1 of the amino acid sequence shown in SEQ ID NO:3, VH CDR2 of the amino acid sequence shown in SEQ ID NO:4, VH CDR3 of the amino acid sequence shown in SEQ ID NO:5, VL CDR1 of the amino acid sequence shown in SEQ ID NO:6, VL CDR2 of the amino acid sequence shown in SEQ ID NO:7, and VL CDR3 of the amino acid sequence shown in SEQ ID NO:8.

[0240] Features of 1.6B8 mAb

[0241] To investigate whether mAb 6B8 can be used for most CSFVs, the inventors tested the binding of mAb 6B8 to various CSF viruses, such as those from group 1 (including Shimen strain and strain C) and group 2 (including QZ07 and GD18), with two BVDVs serving as controls. The results are as follows... Figure 5 As shown. Eight additional field CSFV isolates from genotype 2 were also found to be 6B8 mAb positive (data not shown). These data indicate that 6B8 recognizes conserved epitopes present on most CSF viruses but does not react with BVDV virus.

[0242] 2.6 Identification of key amino acids bound to B8

[0243] In the presence of mAb 6B8, C strain virus, after successive passages in PK / WRL cell cultures, exhibited escape mutants that could grow even in the presence of neutralizing concentrations of 6B8 antibody. Four such escape mutant clones were obtained, all of which evaded 6B8 binding. Sequencing of their E2 genes revealed two nucleotide mutations in two codons (GGAGGT to AGAGAGAT). These changes translated into two amino acid mutations at consecutive positions 24 and 25 (Gly-Gly to Arg-Asp, or GG to RD).

[0244] Then, BVDV was compared with other plague virus E2 sequences (QZ07, GD18, GD191, and C strains) to identify other potential key amino acids for 6B8 binding. Figure 6 This method identified other potential key amino acids, such as those at positions 14 and 22.

[0245] All these potential mutations (S14K, G22a, E24R / G25D) were introduced into E2 expression vectors to examine their effects on 6B8 binding. The E2 gene was cloned into the pCI-neo-Tag vector (Promega, cat#E1841) to generate expression vectors. After confirming proper expression of the E2 protein, all mutations were introduced into the E2 expression vectors. These vectors were then transfected into PK / WRL cells in 24-well plates using Lipofectamine 3000 (Invitrogen, cat#L3000015). Twenty-four hours after transfection, cells were fixed with 4% formaldehyde and then treated with 0.1% Triton X-100. Cells were then treated with mAb 6B8 or rabbit polyclonal antibody against CSFV (used as a positive control to detect CSFV with modified 6B8 epitopes) and the corresponding Alexa antibody. The 488-conjugated second antibody (Invitrogen cat#21206) was used to stain cells in IFA (immunofluorescence assay). Figure 7 As shown in Figure A, microscopic examination revealed that the S14K, G22A, and E24R / G25D mutations are crucial for eliminating 6B8 binding.

[0246] The inventors also examined the effects of other mutations at positions 14, 22, 24, and 25 on binding to the 6B8 antibody. For example... Figure 7 As shown in Figure B, mutations S14Q, S14R, and G22R completely eliminate the binding of 6B8, while G22E and G22Q partially affect the binding of 6B8, further indicating that positions 14 and 22 are crucial for the binding of 6B8. Figure 7 As shown in C, the single mutation G24K (for strain C) completely eliminates 6B8 binding and also supports the view that position 24 is crucial for 6B8 binding. G25S alone does not eliminate 6B8 binding. However, since the position 25Gly to Asp mutation occurs together with the mutation at position 24, these two mutations can be considered as a single mutation (24 / 25 mutation).

[0247] The results showed that mutations at positions 14, 22, 24, and / or 24 / 25 could be used for DIVA. The results also indicated that mutations at the 6B8 epitope did not substantially alter the overall immunogenicity of the E2 protein, as the mutated E2 protein could still be recognized by anti-CSFV polyclonal antibodies.

[0248] Example 2: Construction of Baculovirus Expression System

[0249] Sf9 cells were co-transfected with pVL1393-QZ07-E2, QZ07-E2-KARD, QZ07-E2-KRD, C-E2, and C-E2-KARD baculovirus genomic DNA. Baculovirus expression systems for each construct were established using a commercially available kit (Sapphire Baculovirus DNA and Transfection Kit: Allele Biotech Cat#ABP-BVD-100029). Recombinant baculoviruses containing each E2 expression cassette were then purified as plaques in the Sf9 cell line. Transfected cells were cultured in 6-well plates and incubated at 27°C for 5 days. The supernatant from each transfected sample was collected and stored at 4°C for further plaque purification.

[0250] Then, as described in the method, the supernatant collected for each construct was subjected to plaque purification assay. After two rounds of purification, the final recombinant baculovirus with each E2 expression cassette was successfully constructed.

[0251] Example 3: Scale-up of expression and purification of E2 and E2-KARD or E2-KRD

[0252] Recombinant baculoviruses expressing QZ07-E2, QZ07-E2-KARD, QZ07-E2-KRD, C-E2, and C-E2-KARD cassettes were amplified by infection of SF+ cell lines with MOI 5. 300 ml of supernatant collected from each infected SF+ cell line was used for purification as described in the Methods section.

[0253] The final product was validated by SDS-PAGE and Western blotting analysis. The purified E2 showed the correct molecular weight at 110 kDa in a dimer form and 55 kDa in a monomer form, as indicated by... Figure 3 .

[0254] Further Dot blot analysis showed that purified QZ07-E2-KARD, QZ07-E2-KRD, and C-E2-KARD did not react with 6B8 mAb. Figure 4 This indicates that each DIVA form of E2 was successfully purified and can be further used as a subunit vaccine. The results also show that mutations at the 6B8 epitope do not substantially alter the overall immunogenicity of the E2 protein, as the mutated E2 protein can still be recognized by various convalescent swine serums and serums vaccinated with strain C.

[0255] Example 4: Efficacy assessment of E2 and E2-KARD

[0256] The purpose of this example is to evaluate the efficacy of the candidate subunit vaccine in 3-week-old piglets.

[0257] The potency of the two IVPs (investigation veterinary products) of adjuvanted C-E2 and C-E2-KARD expressed in Example 2 was evaluated.

[0258] In short, 20 three-week-old piglets were divided into four groups (groups 1, 2, 3, and 4). Five piglets from group 1 (C-E2) and five from group 2 (C-E2-KARD) were used for IVP testing, while the remaining five piglets from group 3 served as challenge controls. The remaining five piglets from group 4 served as strict (negative) controls. On day 0, animals in groups 1 and 2 were inoculated with either C-E2 (54.2 μg / ml) or C-E2-KARD (55.2 μg / ml) with 2 mL of Seppic ISA 206 adjuvant (IM). Group 3 was inoculated with 2 mL of PBS + adjuvant (Seppic ISA 206) on day 0 (IM) as a challenge control. Animals in groups 1, 2, and 3 were inoculated with CSFV Shimen strain (IM) on day 21 at a dose ≥105 MLD / mL. All piglets were clinically healthy on day 0, free of CSFV and PRRSV antibodies, and free of antigens such as BVDV and PRV. All animals were healthy at the time of immunization.

[0259] Rectal temperature and clinical observation were collected daily from day 21 to day 37. Serum samples were collected every 7 days starting from day 7. Whole blood and nasal swab samples were collected from all animals on days 21, 24, 28, 31, and 37 (DPC 0, 3, 7, 10, 16).

[0260] body temperature

[0261] like Figure 8 As shown, the mean body temperature of the challenge control group (Group 3) fluctuated greatly after the challenge, and decreased when the pigs were near death. The body temperatures of Groups 1 and 2 increased in the days following the challenge (D2-D4), but quickly dropped to levels similar to those of the strict control group.

[0262] White blood cell count

[0263] like Figure 9 As shown, the white blood cell count in the challenge control group decreased significantly after the challenge, while the white blood cell count in the inoculated group decreased slightly after the challenge and then increased.

[0264] mortality rate

[0265] like Figure 10 As shown, all piglets in the attack control group (Group 3) died; no piglets died in other groups.

[0266] Clinical observation

[0267] Clinical observation included assessment of activity, body tone (rigidity, spasticity), body shape (body condition, thinning muscles), respiration, gait, skin, conjunctival appearance, appetite, and defecation, as shown in Table 1. Zero indicated the absence of clinical symptoms, and increasing clinical scores indicated an increase in the severity of clinical symptoms. An individual animal exhibiting a total clinical score higher than 2 for three consecutive observation points was considered to have CSF-related clinical symptoms.

[0268] Table 1 Clinical scoring guidelines

[0269]

[0270]

[0271] like Figure 11 As shown, the mean clinical score of the attack control group (Group 3) increased after the attack; during the study period, the mean clinical scores of Groups 1, 2 and 4 were all 0.

[0272] Virus isolation

[0273] Virus isolation in whole blood, nasal swabs, and tonsil samples was determined using standard methods in the art. The results are shown in Table 2 below. All samples from Group 1 and Group 2 were negative for VI (virus isolation) from all collected samples.

[0274] Table 2

[0275]

[0276] WB: Whole blood; NS: Nasal swab; *: All piglets in group 3 died before DPC16.

[0277] Serological reaction

[0278] The antibody titer of the sample was detected using the IDEXX ELISA (catalog number 99-43220). Figure 12 As shown, the antibody titers in both IVP groups were positive (>40%) at D21.

[0279] in conclusion

[0280] Pigs were protected after vaccination with both IVPs, with 0% mortality and morbidity. No viremia or shielding was detected in the IVP group, and CSFV positivity was not found in tonsillar tissue. Serum from both IVP groups was positive on day 21. The introduction of the DIVA mutation (in the 6B8 epitope) had no effect on efficacy.

[0281] Example 5: Immunofluorescence assay (IFA) was used to determine the binding of 6B8 mAb to the mutated 6B8 epitope.

[0282] The binding of 6B8 mAb to the mutated 6B8 epitope (in the test sample) was determined by immunofluorescence assay (IFA) according to the following steps:

[0283] 1. In a 96-well microtiter plate, use 1.0 × 10 6 SF9 cells were seeded per well and then infected with the following recombinant baculovirus with an MOI of 0.01, in duplicate:

[0284] (i) Detection sample: recombinant baculovirus expressing E2 protein with modified 6B8 epitope;

[0285] (ii) Positive control: Recombinant baculovirus expressing the E2 protein with the wild-type 6B8 epitope;

[0286] (iii) Negative control: Recombinant baculovirus expressing the E2 protein with the KARD mutation in the 6B8 epitope described herein.

[0287] Cells infected with baculovirus were stored in an incubator at approximately 27°C for 5 days.

[0288] 2. Discard the culture medium and rinse the cells once with 1xPBS (200 to 250 μL / well).

[0289] 3. Add 100 μl of cold methanol / acetone (50:50) to each well and incubate at room temperature for 10 minutes.

[0290] 4. Dispose of the fixative in a designated waste container and dry it under a fume hood for 15-30 minutes.

[0291] 5. Dilute the 6B8-specific mAb (such as the hybridoma-derived antibody preserved in CCTCC, accession number CCTCC C2018120) to 1:500 to 1:1000 with PBS containing 5% BSA, and then add it to the assay plate at a rate of 50 μL / well. Cap the plate and incubate at 37°C for 1–2 hours.

[0292] 6. Rinse the analysis plate three times with 1x PBS (250 μL / well).

[0293] 7. Secondary antibody Alexa 488-conjugated donkey anti-mouse antibody, specifically binding to 6B8 antibody (Invitrogen, cat#21202), was diluted 400-fold with PBS containing 5% BSA and added to the assay plate at a rate of 50 μL / well. The plate was capped and incubated at 37°C for 1 hour.

[0294] 8. Rinse the analysis plate three times with 1xPBS (250 μL / well). Finally, add 100 μL of 1xPBS per well. Read the final fluorescence signal using an inverted fluorescence microscope.

[0295] The negative results of the samples tested in this IFA (in two replicates) indicate that one or more mutations in the 6B8 epitope of the E2 protein result in specific inhibition of the binding of the 6B8 monoclonal antibody to this mutated 6B8 epitope.

[0296] Example 6: Dot blot analysis for determining the binding of 6B8 mAb to the mutated 6B8 epitope

[0297] The binding of 6B8 mAb to the mutated 6B8 epitope (in the test sample) was determined by dot blot assay according to the following steps:

[0298] 1. Spot 1-5 μg of each purified protein diluted in PBS onto an NC membrane (Pall, cat#66485) and air dry in a fume hood for 30 minutes or longer.

[0299] (i) Detection sample: recombinant baculovirus expressing E2 protein with modified 6B8 epitope;

[0300] (ii) Positive control: Recombinant baculovirus expressing the E2 protein with the wild-type 6B8 epitope;

[0301] 2. Block the membrane with blocking solution (5% skim milk in PBST) for 1 hour at room temperature.

[0302] 3. Dilute the 6B8-specific mAb (such as the hybridoma-derived antibody preserved in CCTCC, accession number CCTCC2018120) with PBST containing 5% skim milk to a concentration of 1:800 to 1:1000, then add 10 ml / membrane to each dotted membrane. Seal the membrane with the cap and incubate at 37°C for 1–2 hours.

[0303] 4. Discard the primary antibody and wash each membrane three times with 3*PBST.

[0304] 5. The second antibody that specifically binds to the 6B8 antibody, HRP-conjugated anti-mouse antibody (Bio-Rad, STAR117P), was diluted 2000-fold with PBST containing 5% skim milk, and 10 ml was added to each dotted membrane. The membranes were sealed with caps and incubated at 37°C for 1 hour.

[0305] 6. Discard the secondary antibody and wash each membrane three times with 3*PBST.

[0306] Seven blot signals for each membrane were developed at room temperature using a 1-5 mL SuperSignal Kit (Thermo, CAT#34080).

[0307] 8. The development time is 1-10 seconds, and the photos are taken using chemdoc (Bio-Rad).

[0308] The negative result of testing the sample in the dot blot indicates that one or more mutations in the 6B8 epitope of the E2 protein result in specific inhibition of the binding of the 6B8 monoclonal antibody to this mutated 6B8 epitope. sequence list <110> Boehringer Ingelheim Animal Health (China) Co., Ltd. <120> CSFV subunit vaccine <130> P20193024 <160> 56 <170> PatentIn version 3.5 <210> 1 <211> 12 <212> PRT <213> Artificial sequence <220> <223> 6B8 position of GD18, QZ07, or GD191 <400> 1 Ser Thr Asn Glu Ile Gly Pro Leu Gly Ala Glu Gly 1 5 10 <210> 2 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Epitope 6B8 of strain C <400> 2 Ser Thr Asp Glu Ile Gly Leu Leu Gly Ala Gly Gly 1 5 10 <210> 3 <211> 5 <212> PRT <213> Artificial sequence <220> <223> VH CDR1 <400> 3 Ser Phe Gly Met His 1 5 <210> 4 <211> 17 <212> PRT <213> Artificial sequence <220> <223> VH CDR2 <400> 4 Tyr Ile Ser Ser Asp Ser Phe Thr Ile Tyr Tyr Ala Asp Thr Met Lys 1 5 10 15 Gly <210> 5 <211> 7 <212> PRT <213> Artificial sequence <220> <223> VH CDR3 <400> 5 Gly Asp Leu Pro Phe Ala Tyr 1 5 <210> 6 <211> 11 <212> PRT <213> Artificial sequence <220> <223> VL CDR1 <400> 6 Lys Ala Ser Gln Ala Val Gly Thr Ala Val Ala 1 5 10 <210> 7 <211> 7 <212> PRT <213> Artificial sequence <220> <223> VL CDR2 <400> 7 Trp Ala Ser Thr Arg His Thr 1 5 <210> 8 <211> 9 <212> PRT <213> Artificial sequence <220> <223> VL CDR3 <400> 8 His Gln Tyr Ser Ser Tyr Pro Leu Thr 1 5 <210> 9 <211> 135 <212> PRT <213> Artificial sequence <220> <223> Heavy chain variable region of mAb 6B8 <400> 9 Met Asp Ser Arg Leu Asn Leu Val Phe Leu Val Leu Ile Leu Lys Gly 1 5 10 15 Val Gln Cys Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 20 25 30 Pro Gly Gly Ser Arg Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 35 40 45 Ser Ser Phe Gly Met His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu 50 55 60 Glu Trp Val Ala Tyr Ile Ser Ser Asp Ser Phe Thr Ile Tyr Tyr Ala 65 70 75 80 Asp Thr Met Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Pro Gln Asn 85 90 95 Thr Leu Phe Leu Gln Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met 100 105 110 Tyr Tyr Cys Ala Arg Gly Asp Leu Pro Phe Ala Tyr Trp Gly Gln Gly 115 120 125 Thr Leu Val Thr Val Ser Ala 130 135 <210> 10 <211> 131 <212> PRT <213> Artificial Sequence <220> <223> Light Chain Variable Region of mAb 6B8 <400> 10 Met Gly Ile Lys Met Glu Thr His Ser Gln Val Phe Val Tyr Met Leu 1 5 10 15 Leu Trp Leu Ser Gly Val Glu Gly Asp Ile Val Met Thr Gln Ser His 20 25 30 Lys Phe Met Ser Thr Ser Val Gly Asp Arg Val Ser Ile Thr Cys Lys 35 40 45 Ala Ser Gln Ala Val Gly Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro 50 55 60 Gly Gln Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg His Thr 65 70 75 80 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr 85 90 95 Leu Thr Ile Ser Asn Val Gln Ser Glu Asp Leu Ala Asp Tyr Phe Cys 100 105 110 His Gln Tyr Ser Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu 115 120 125 Glu Leu Lys 130 <210> 11 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> QZ07-E2 <400> 11 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Ile Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 12 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> GD18-E2 <400> 12 Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asp 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 13 <211> 3898 <212> PRT <213> Artificial sequence <220> <223> Multiprotein of QZ07 <400> 13 Met Glu Leu Asn His Phe Glu Leu Leu Tyr Lys Thr Asn Lys Gln Lys 1 5 10 15 Pro Met Gly Val Glu Glu Pro Val Tyr Asp Ile Ala Gly Arg Pro Leu 20 25 30 Phe Gly Asp Pro Ser Glu Val His Pro Gln Ser Thr Leu Lys Leu Pro 35 40 45 His Asp Arg Gly Arg Gly Asn Ile Arg Thr Thr Leu Lys Asp Leu Pro 50 55 60 Arg Lys Gly Asp Cys Arg Ser Gly Asn His Leu Gly Pro Val Ser Gly 65 70 75 80 Ile Tyr Val Lys Pro Gly Pro Val Phe Tyr Gln Asp Tyr Met Gly Pro 85 90 95 Val Tyr His Arg Ala Pro Leu Glu Phe Phe Gly Glu Ala Gln Phe Cys 100 105 110 Glu Val Thr Lys Arg Ile Gly Arg Val Thr Gly Ser Asp Gly Lys Leu 115 120 125 Tyr His Ile Tyr Val Cys Ile Asp Gly Cys Ile Leu Leu Lys Leu Ala 130 135 140 Lys Arg Gly Ala Pro Arg Ser Leu Lys Trp Thr Arg Asn Phe Thr Asp 145 150 155 160 Cys Pro Leu Trp Val Thr Ser Cys Ser Asp Asp Gly Thr Gly Asp Ser 165 170 175 Lys Asp Lys Lys Pro Asp Arg Met Asn Lys Gly Lys Leu Lys Ile Ala 180 185 190 Pro Lys Glu His Glu Lys Asp Ser Lys Thr Lys Pro Pro Asp Ala Thr 195 200 205 Ile Val Val Glu Gly Val Lys Tyr Gln Val Lys Lys Lys Gly Lys Val 210 215 220 Lys Gly Lys Asn Thr Gln Asp Gly Leu Tyr His Asn Lys Asn Lys Pro 225 230 235 240 Pro Glu Ser Arg Lys Lys Leu Glu Lys Ala Leu Leu Ala Trp Ala Val 245 250 255 Ile Ala Ile Val Leu Tyr Gln Pro Val Ala Ala Glu Asn Ile Thr Gln 260 265 270 Trp Asn Leu Ser Asp Asn Gly Thr Ser Gly Ile Gln Gln Ala Met Tyr 275 280 285 Leu Arg Gly Val Asn Arg Ser Leu His Gly Ile Trp Pro Glu Lys Ile 290 295 300 Cys Lys Gly Val Pro Thr His Leu Ala Thr Asp Thr Glu Leu Thr Glu 305 310 315 320 Ile Arg Gly Met Met Asp Ala Ser Glu Arg Thr Asn Tyr Thr Cys Cys 325 330 335 Arg Leu Gln Arg His Glu Trp Asn Lys His Gly Trp Cys Asn Trp Tyr 340 345 350 Asn Ile Asp Pro Trp Ile Gln Leu Met Asn Arg Thr Gln Ala Asn Leu 355 360 365 Thr Glu Gly Pro Pro Asp Lys Glu Cys Ala Val Thr Cys Arg Tyr Asp 370 375 380 Lys Asn Thr Asp Val Asn Val Val Thr Gln Ala Arg Asn Arg Pro Thr 385 390 395 400 Thr Leu Thr Gly Cys Lys Lys Gly Lys Asn Phe Ser Phe Ala Gly Thr 405 410 415 Val Ile Glu Gly Pro Cys Asn Phe Asn Val Ser Val Glu Asp Ile Leu 420 425 430 Tyr Gly Asp His Glu Cys Gly Ser Leu Phe Gln Asp Thr Ala Leu Tyr 435 440 445 Leu Leu Asp Gly Met Thr Asn Thr Ile Glu Lys Ala Arg Gln Gly Ala 450 455 460 Ala Arg Val Thr Ser Trp Leu Gly Arg Gln Leu Arg Thr Thr Gly Lys 465 470 475 480 Lys Leu Glu Arg Gly Ser Lys Thr Trp Phe Gly Ala Tyr Ala Leu Ser 485 490 495 Pro Tyr Cys Asn Val Thr Arg Lys Ile Gly Tyr Ile Trp Tyr Thr Asn 500 505 510 Asn Cys Thr Pro Ala Cys Leu Pro Lys Asn Thr Lys Ile Ile Gly Pro 515 520 525 Gly Lys Phe Asp Thr Asn Ala Glu Asp Gly Lys Ile Leu His Glu Met 530 535 540 Gly Gly His Leu Ser Glu Phe Leu Leu Leu Ser Leu Val Val Leu Ser 545 550 555 560 Asp Phe Ala Pro Glu Thr Ala Ser Thr Leu Tyr Leu Ile Leu His Tyr 565 570 575 Ala Ile Pro Gln Ser Arg Asp Glu Pro Glu Val Cys Asp Thr Asn Gln 580 585 590 Leu Asn Leu Thr Val Gly Leu Arg Thr Glu Asp Val Val Pro Ser Ser 595 600 605 Val Trp Asn Ile Gly Lys Tyr Val Cys Val Arg Pro Asp Trp Trp Pro 610 615 620 Tyr Glu Thr Lys Val Ala Leu Leu Phe Glu Glu Ala Gly Gln Val Ile 625 630 635 640 Lys Leu Ala Leu Arg Ala Leu Arg Asp Leu Thr Arg Val Trp Asn Ser 645 650 655 Ala Ser Thr Thr Ala Phe Leu Ile Cys Leu Ile Lys Ile Leu Arg Gly 660 665 670 Gln Val Val Gln Gly Ile Ile Trp Leu Leu Leu Val Thr Gly Ala Gln 675 680 685 Gly Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr 690 695 700 Asn Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys 705 710 715 720 Glu Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile 725 730 735 Cys Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg 740 745 750 Arg Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr 755 760 765 Phe Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly 770 775 780 Asp Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val 785 790 795 800 Lys Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu 805 810 815 Val Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser 820 825 830 Pro Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys 835 840 845 Pro Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu 850 855 860 Asp Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly 865 870 875 880 Asn Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys 885 890 895 Gly Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly 900 905 910 Lys Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr 915 920 925 Asp Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu 930 935 940 Cys Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg 945 950 955 960 Leu Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly 965 970 975 Pro Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg 980 985 990 Asn Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu 995 1000 1005 Lys Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His 1010 1015 1020 His Thr Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala 1025 1030 1035 Leu Leu Gly Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val 1040 1045 1050 Ile Leu Thr Glu Gln Leu Ala Ala Gly Leu Gln Leu Gly Gln Gly 1055 1060 1065 Glu Val Val Leu Ile Gly Asn Leu Ile Thr His Thr Asp Asn Glu 1070 1075 1080 Val Val Val Tyr Phe Leu Leu Leu Tyr Leu Ile Ile Arg Asp Glu 1085 1090 1095 Pro Ile Lys Lys Trp Ile Leu Leu Leu Phe His Ala Met Thr Asn 1100 1105 1110 Asn Pro Val Lys Thr Met Thr Val Ala Leu Leu Met Ile Ser Gly 1115 1120 1125 Val Ala Lys Gly Gly Lys Thr Asp Gly Gly Trp Gln Arg Gln Pro 1130 1135 1140 Glu Thr Asn Phe Asp Ile Gln Leu Ala Leu Ala Val Ile Val Val 1145 1150 1155 Val Val Met Leu Leu Ala Lys Arg Asp Pro Thr Thr Phe Pro Leu 1160 1165 1170 Val Ile Thr Val Ala Thr Leu Arg Thr Ala Lys Ile Thr Asn Gly 1175 1180 1185 Phe Ser Thr Asp Leu Ala Ile Ala Thr Val Ser Ala Ala Leu Leu 1190 1195 1200 Thr Trp Thr Tyr Ile Ser Asp Tyr Tyr Lys Tyr Lys Thr Trp Leu 1205 1210 1215 Gln Tyr Leu Ile Ser Thr Val Thr Gly Ile Phe Leu Ile Arg Val 1220 1225 1230 Leu Lys Gly Ile Gly Glu Leu Asp Met His Ala Pro Thr Leu Pro 1235 1240 1245 Ser His Arg Pro Leu Phe Tyr Ile Leu Val Tyr Leu Ile Ser Thr 1250 1255 1260 Ala Val Val Thr Arg Trp Asn Leu Asp Val Ala Gly Leu Leu Leu 1265 1270 1275 Gln Cys Val Pro Thr Leu Leu Met Val Phe Thr Met Trp Ala Asp 1280 1285 1290 Ile Leu Thr Leu Ile Leu Val Leu Pro Thr Tyr Glu Leu Ala Lys 1295 1300 1305 Leu Tyr Tyr Leu Lys Glu Val Lys Ile Gly Thr Glu Arg Gly Trp 1310 1315 1320 Leu Trp Lys Thr Asn Tyr Lys Arg Val Asn Asp Ile Tyr Glu Val 1325 1330 1335 Asp Gln Ala Gly Glu Gly Val Tyr Leu Phe Pro Ser Lys Gln Lys 1340 1345 1350 Thr Ser Ala Ile Thr Ser Thr Met Leu Pro Leu Ile Lys Ala Ile 1355 1360 1365 Leu Ile Ser Cys Ile Ser Asn Lys Trp Gln Leu Ile Tyr Leu Leu 1370 1375 1380 Tyr Leu Ile Phe Glu Val Ser Tyr Tyr Leu His Lys Lys Val Ile 1385 1390 1395 Asp Glu Ile Ala Gly Gly Thr Asn Phe Val Ser Arg Leu Val Ala 1400 1405 1410 Ala Leu Ile Glu Val Asn Trp Ala Phe Asp Asn Glu Glu Val Lys 1415 1420 1425 Gly Leu Lys Lys Phe Phe Leu Leu Ser Ser Arg Val Lys Glu Leu 1430 1435 1440 Val Ile Lys His Lys Val Arg Asn Glu Val Val Ala Arg Trp Phe 1445 1450 1455 Gly Asp Glu Glu Ile Tyr Gly Met Pro Lys Leu Ile Gly Leu Val 1460 1465 1470 Lys Ala Ala Thr Leu Ser Lys Asn Lys His Cys Ile Leu Cys Thr 1475 1480 1485 Val Cys Glu Asp Arg Asp Trp Arg Gly Glu Thr Cys Pro Lys Cys 1490 1495 1500 Gly Arg Phe Gly Pro Pro Val Ile Cys Gly Met Thr Leu Ala Asp 1505 1510 1515 Phe Glu Glu Lys His Tyr Lys Arg Ile Phe Ile Arg Glu Asp Gln 1520 1525 1530 Ser Asp Gly Pro Leu Arg Glu Glu Arg Ala Gly Tyr Leu Gln Tyr 1535 1540 1545 Arg Ala Arg Gly Gln Leu Phe Leu Arg Asn Leu Pro Val Leu Ala 1550 1555 1560 Thr Lys Val Lys Met Leu Leu Val Gly Asn Leu Gly Thr Glu Val 1565 1570 1575 Gly Asp Leu Glu His Leu Gly Trp Val Leu Arg Gly Pro Ala Val 1580 1585 1590 Cys Lys Lys Val Thr Glu His Glu Lys Cys Ala Thr Ser Ile Met 1595 1600 1605 Asp Lys Leu Thr Ala Phe Phe Gly Val Met Pro Arg Gly Thr Thr 1610 1615 1620 Pro Arg Ala Pro Val Arg Phe Pro Thr Ser Leu Leu Lys Ile Arg 1625 1630 1635 Arg Gly Leu Glu Thr Gly Trp Ala Tyr Thr His Gln Gly Gly Ile 1640 1645 1650 Ser Ser Val Asp His Val Thr Cys Gly Lys Asp Leu Leu Val Cys 1655 1660 1665 Asp Thr Met Gly Arg Thr Arg Val Val Cys Gln Ser Asn Asn Lys 1670 1675 1680 Met Thr Asp Glu Ser Glu Tyr Gly Val Lys Thr Asp Ser Gly Cys 1685 1690 1695 Pro Glu Gly Ala Arg Cys Tyr Val Phe Asn Pro Glu Ala Val Asn 1700 1705 1710 Ile Ser Gly Thr Lys Gly Ala Met Val His Leu Gln Lys Thr Gly 1715 1720 1725 Gly Glu Phe Thr Cys Val Thr Ala Ser Gly Thr Pro Ala Phe Phe 1730 1735 1740 Asp Leu Lys Asn Leu Lys Gly Trp Ser Gly Leu Pro Ile Phe Glu 1745 1750 1755 Ala Ser Ser Gly Arg Val Val Gly Arg Val Lys Val Gly Lys Asn 1760 1765 1770 Asp Asp Ser Lys Pro Thr Lys Leu Met Ser Gly Ile Gln Thr Val 1775 1780 1785 Ser Lys Ser Ala Thr Asp Leu Thr Glu Met Val Lys Lys Ile Thr 1790 1795 1800 Thr Met Asn Arg Gly Glu Phe Arg Gln Ile Thr Leu Ala Thr Gly 1805 1810 1815 Ala Gly Lys Thr Thr Glu Leu Pro Arg Ser Val Ile Glu Glu Ile 1820 1825 1830 Gly Arg His Lys Arg Val Leu Val Leu Ile Pro Leu Arg Ala Ala 1835 1840 1845 Ala Glu Ser Val Tyr Gln Tyr Met Arg Gln Lys His Pro Ser Ile 1850 1855 1860 Ala Phe Asn Leu Arg Ile Gly Glu Met Lys Glu Gly His Met Ala 1865 1870 1875 Thr Gly Ile Thr Tyr Ala Ser Tyr Gly Tyr Phe Cys Gln Met Pro 1880 1885 1890 Gln Pro Lys Leu Arg Ala Ala Met Val Glu Tyr Ser Tyr Ile Phe 1895 1900 1905 Leu Asp Glu Tyr His Cys Ala Thr Pro Glu Gln Leu Ala Ile Met 1910 1915 1920 Gly Lys Ile His Arg Phe Ser Glu Asn Leu Arg Val Val Ala Met 1925 1930 1935 Thr Ala Thr Pro Ala Gly Thr Val Thr Thr Thr Gly Gln Lys His 1940 1945 1950 Pro Ile Glu Glu Phe Ile Ala Pro Glu Val Met Lys Gly Glu Asp 1955 1960 1965 Leu Gly Ser Glu Tyr Leu Asp Ile Ala Gly Leu Lys Ile Pro Val 1970 1975 1980 Glu Glu Met Lys Asn Asn Met Leu Val Phe Val Pro Thr Arg Asn 1985 1990 1995 Met Ala Val Glu Ala Ala Lys Lys Leu Lys Ala Lys Gly Tyr Asn 2000 2005 2010 Ser Gly Tyr Tyr Tyr Ser Gly Glu Asp Pro Ser Asn Leu Arg Val 2015 2020 2025 Val Thr Ser Gln Ser Pro Tyr Val Val Val Ala Thr Asn Ala Ile 2030 2035 2040 Glu Ser Gly Val Thr Leu Pro Asp Leu Asp Val Val Val Asp Thr 2045 2050 2055 Gly Leu Lys Cys Glu Lys Arg Ile Arg Leu Ser Pro Lys Met Pro 2060 2065 2070 Phe Ile Val Thr Gly Leu Lys Arg Met Ala Val Thr Ile Gly Glu 2075 2080 2085 Gln Ala Gln Arg Arg Gly Arg Val Gly Arg Val Lys Pro Gly Arg 2090 2095 2100 Tyr Tyr Arg Ser Gln Glu Thr Pro Val Gly Ser Lys Asp Tyr His 2105 2110 2115 Tyr Asp Leu Leu Gln Ala Gln Arg Tyr Gly Ile Glu Asp Gly Ile 2120 2125 2130 Asn Ile Thr Lys Ser Phe Arg Glu Met Asn Tyr Asp Trp Ser Leu 2135 2140 2145 Tyr Glu Glu Asp Ser Leu Met Ile Thr Gln Leu Glu Ile Leu Asn 2150 2155 2160 Asn Leu Leu Ile Ser Glu Glu Leu Pro Val Ala Val Lys Asn Ile 2165 2170 2175 Met Ala Arg Thr Asp His Pro Glu Pro Ile Gln Leu Ala Tyr Asn 2180 2185 2190 Ser Tyr Glu Thr Gln Val Pro Val Leu Phe Pro Lys Ile Arg Asn 2195 2200 2205 Gly Glu Val Thr Asp Thr Tyr Asp Thr Tyr Thr Phe Ile Asn Ala 2210 2215 2220 Arg Lys Leu Gly Asp Asp Val Pro Pro Tyr Val Tyr Ala Thr Glu 2225 2230 2235 Asp Glu Asp Leu Ala Val Glu Leu Leu Gly Leu Asp Trp Pro Asp 2240 2245 2250 Pro Gly Asn Gln Gly Thr Val Glu Ala Gly Arg Ala Leu Lys Gln 2255 2260 2265 Val Val Gly Leu Ser Thr Ala Glu Asn Ala Leu Leu Val Ala Leu 2270 2275 2280 Phe Gly Tyr Val Gly Tyr Gln Ala Leu Ser Lys Arg His Ile Pro 2285 2290 2295 Val Val Thr Asp Ile Tyr Ser Val Glu Asp His Arg Leu Glu Asp 2300 2305 2310 Thr Thr His Leu Gln Tyr Ala Pro Asn Ala Ile Lys Thr Glu Gly 2315 2320 2325 Lys Glu Thr Glu Leu Lys Glu Leu Ala Gln Gly Asp Val Gln Arg 2330 2335 2340 Cys Val Glu Ala Met Thr Asn Tyr Ala Arg Gly Gly Ile Gln Phe 2345 2350 2355 Met Lys Ser Gln Ala Leu Gln Val Arg Glu Thr Pro Thr Tyr Lys 2360 2365 2370 Glu Thr Met Asn Thr Val Ala Asp Tyr Val Lys Lys Phe Ile Glu 2375 2380 2385 Ala Leu Ser Asp Ser Lys Glu Asp Ile Leu Lys Tyr Gly Leu Trp 2390 2395 2400 Gly Val His Thr Ala Leu Tyr Lys Ser Ile Gly Ala Arg Leu Gly 2405 2410 2415 His Glu Thr Ala Phe Ala Thr Leu Ala Val Lys Trp Leu Ala Phe 2420 2425 2430 Gly Gly Glu Ser Ile Ala Asp His Ile Lys Gln Ala Ala Thr Asp 2435 2440 2445 Leu Val Val Tyr Tyr Ile Ile Asn Arg Pro Gln Phe Pro Gly Asp 2450 2455 2460 Thr Glu Thr Gln Gln Glu Gly Arg Asn Phe Val Ala Ser Leu Leu 2465 2470 2475 Val Ser Ala Leu Ala Thr Tyr Thr Tyr Lys Ser Trp Asn Tyr Asn 2480 2485 2490 Asn Leu Ser Lys Ile Val Glu Pro Ala Leu Ala Thr Leu Pro Tyr 2495 2500 2505 Ala Ala Lys Ala Leu Lys Leu Phe Ala Pro Thr Arg Leu Glu Ser 2510 2515 2520 Val Val Ile Leu Ser Thr Ala Ile Tyr Lys Thr Tyr Leu Ser Ile 2525 2530 2535 Arg Arg Gly Lys Ser Asp Gly Leu Leu Gly Thr Gly Val Ser Ala 2540 2545 2550 Ala Met Glu Ile Met Ser Gln Asn Pro Val Ser Val Gly Ile Ala 2555 2560 2565 Val Met Leu Gly Val Gly Ala Val Ala Ala His Asn Ala Ile Glu 2570 2575 2580 Ala Ser Glu Gln Lys Arg Thr Leu Leu Met Lys Val Phe Val Lys 2585 ​​2590 2595 Asn Phe Leu Asp Gln Ala Ala Thr Asp Glu Leu Val Lys Glu Ser 2600 2605 2610 Pro Glu Lys Ile Ile Met Ala Leu Phe Glu Ala Val Gln Thr Val 2615 2620 2625 Gly Asn Pro Leu Arg Leu Val Tyr His Leu Tyr Gly Val Phe Tyr 2630 2635 2640 Lys Gly Trp Glu Ala Lys Glu Leu Ala Gln Arg Thr Ala Gly Arg 2645 2650 2655 Asn Leu Phe Thr Leu Ile Met Phe Glu Ala Val Glu Leu Leu Gly 2660 2665 2670 Val Asp Ser Glu Gly Lys Ile Arg Gln Leu Ser Ser Asn Tyr Ile 2675 2680 2685 Leu Glu Leu Leu Tyr Lys Phe Arg Asp Ser Ile Lys Ser Ser Val 2690 2695 2700 Arg Glu Ile Ala Ile Ser Trp Ala Pro Ala Pro Phe Ser Cys Asp 2705 2710 2715 Trp Thr Pro Thr Asp Asp Arg Ile Gly Leu Pro His Asn Asn Tyr 2720 2725 2730 Leu Gln Met Glu Thr Arg Cys Pro Cys Gly Tyr Arg Met Lys Ala 2735 2740 2745 Val Lys Thr Cys Ala Gly Glu Leu Arg Leu Leu Glu Glu Gly Gly 2750 2755 2760 Ser Phe Leu Cys Arg Asn Lys Phe Gly Arg Gly Ser Arg Asn Tyr 2765 2770 2775 Arg Val Thr Lys Tyr Tyr Asp Asp Asn Leu Ser Glu Ile Lys Pro 2780 2785 2790 Val Ile Arg Met Glu Gly His Val Glu Leu Tyr Tyr Lys Gly Ala 2795 2800 2805 Thr Ile Lys Leu Asp Phe Asn Asn Ser Lys Thr Val Leu Ala Thr 2810 2815 2820 Asp Lys Trp Glu Val Asp His Ser Thr Leu Val Arg Ala Leu Lys 2825 2830 2835 Arg His Thr Gly Ala Gly Tyr Gln Gly Ala Tyr Met Gly Glu Lys 2840 2845 2850 Pro Asn His Lys His Leu Ile Glu Arg Asp Cys Ala Thr Ile Thr 2855 2860 2865 Lys Asp Lys Val Tyr Phe Ile Lys Met Lys Arg Gly Cys Ala Phe 2870 2875 2880 Thr Tyr Asp Leu Ser Leu His Asn Leu Thr Arg Leu Ile Glu Leu 2885 2890 2895 Val His Lys Asn Asp Leu Glu Asp Arg Glu Ile Pro Ala Val Thr 2900 2905 2910 Val Thr Thr Trp Leu Ala Tyr Thr Phe Val Asn Glu Asp Ile Gly 2915 2920 2925 Thr Ile Lys Pro Val Phe Gly Glu Lys Val Thr Pro Glu Lys Gln 2930 2935 2940 Glu Glu Val Ala Leu Gln Pro Ala Val Val Val Asp Thr Thr Asp 2945 2950 2955 Val Ala Val Thr Val Val Gly Glu Thr Ser Thr Met Thr Thr Gly 2960 2965 2970 Glu Thr Pro Thr Ala Phe Thr Ser Leu Gly Ser Asp Ser Lys Val 2975 2980 2985 Gln Gln Val Leu Lys Leu Gly Val Asp Glu Gly Gln Tyr Pro Gly 2990 2995 3000 Pro Ser Gln Gln Arg Ala Ser Leu Leu Asp Ala Ile Gln Gly Val 3005 3010 3015 Asp Glu Arg Pro Ser Val Leu Ile Leu Gly Ser Asp Lys Ala Thr 3020 3025 3030 Ser Asn Arg Val Lys Thr Ala Lys Asn Val Lys Ile Phe Arg Ser 3035 3040 3045 Arg Asp Pro Leu Glu Leu Arg Glu Met Met Arg Arg Gly Lys Ile 3050 3055 3060 Leu Val Ile Ala Leu Cys Lys Val Asp Thr Ala Leu Leu Lys Phe 3065 3070 3075 Val Asp Tyr Lys Gly Thr Phe Leu Thr Arg Glu Thr Leu Glu Ala 3080 3085 3090 Leu Ser Leu Gly Lys Pro Lys Lys Lys Asn Ile Thr Lys Thr Glu 3095 3100 3105 Ala Gln Trp Leu Leu Cys Leu Glu Asn Gln Ile Glu Glu Leu Pro 3110 3115 3120 Asp Trp Phe Ala Ala Glu Glu Pro Val Phe Leu Glu Ala Asn Ile 3125 3130 3135 Lys Arg Asp Lys Tyr His Leu Val Gly Asp Ile Ala Thr Ile Lys 3140 3145 3150 Glu Lys Ala Lys Gln Leu Gly Ala Thr Asp Ser Thr Lys Ile Ser 3155 3160 3165 Lys Glu Val Gly Ala Lys Val Tyr Ser Met Lys Leu Ser Asn Trp 3170 3175 3180 Val Ile Gln Glu Glu Asn Lys Gln Gly Ser Leu Ala Pro Leu Phe 3185 3190 3195 Glu Glu Leu Leu Gln Gln Cys Pro Pro Gly Gly Gln Asn Lys Thr 3200 3205 3210 Thr His Met Val Ser Ala Tyr Gln Leu Ala Gln Gly Asn Trp Met 3215 3220 3225 Pro Val Gly Cys His Val Phe Met Gly Thr Ile Pro Ala Arg Arg 3230 3235 3240 Thr Lys Thr His Pro Tyr Glu Ala Tyr Val Lys Leu Arg Glu Leu 3245 3250 3255 Val Asp Glu Tyr Lys Met Lys Thr Leu Cys Gly Gly Ser Gly Leu 3260 3265 3270 Ser Lys His Asn Glu Trp Val Ile Arg Lys Ile Lys His Gln Gly 3275 3280 3285 Asn Leu Arg Thr Lys His Met Leu Asn Pro Gly Lys Val Ala Glu 3290 3295 3300 Gln Leu Leu Arg Glu Gly His Arg His Asn Val Tyr Asn Lys Thr 3305 3310 3315 Ile Gly Ser Val Met Thr Ala Thr Gly Ile Arg Leu Glu Lys Leu 3320 3325 3330 Pro Val Val Arg Ala Gln Thr Asp Thr Thr Asn Phe His Gln Ala 3335 3340 3345 Ile Arg Asp Lys Ile Asp Lys Glu Glu Asn Leu Gln Thr Pro Gly 3350 3355 3360 Leu His Lys Lys Leu Met Glu Val Phe Asn Ala Leu Lys Arg Pro 3365 3370 3375 Asp Leu Glu Ala Ser Tyr Asp Ala Val Glu Trp Glu Glu Leu Glu 3380 3385 3390 Lys Gly Ile Asn Arg Lys Gly Ala Ala Gly Phe Phe Glu His Lys 3395 3400 3405 Asn Ile Gly Glu Val Leu Asp Ser Glu Lys Asn Lys Val Glu Glu 3410 3415 3420 Ile Ile Asp Ser Leu Arg Lys Gly Arg Ser Ile Arg Tyr Tyr Glu 3425 3430 3435 Thr Ala Ile Pro Lys Asn Glu Lys Arg Asp Val Asn Asp Asp Trp 3440 3445 3450 Thr Ala Gly Asp Phe Val Asp Glu Lys Lys Pro Arg Val Ile Gln 3455 3460 3465 Tyr Pro Glu Ala Lys Thr Arg Leu Ala Ile Thr Lys Val Met Tyr 3470 3475 3480 Lys Trp Val Lys Gln Lys Pro Val Val Ile Pro Gly Tyr Glu Gly 3485 3490 3495 Lys Thr Pro Leu Phe Gln Ile Phe Asp Lys Val Lys Lys Glu Trp 3500 3505 3510 Asp Gln Phe Gln Asn Pro Val Ala Val Ser Phe Asp Thr Lys Ala 3515 3520 3525 Trp Asp Thr Gln Val Thr Thr Gly Asp Leu Glu Leu Ile Arg Asp 3530 3535 3540 Ile Gln Lys Phe Tyr Phe Lys Lys Lys Trp His Lys Phe Ile Asp 3545 3550 3555 Thr Leu Thr Met His Met Ser Glu Val Pro Val Ile Ser Ala Asp 3560 3565 3570 Gly Glu Val Tyr Ile Arg Lys Gly Gln Arg Gly Ser Gly Gln Pro 3575 3580 3585 Asp Thr Ser Ala Gly Asn Ser Met Leu Asn Val Leu Thr Met Val 3590 3595 3600 Tyr Ala Phe Cys Glu Ala Thr Gly Val Pro Tyr Lys Ser Phe Asp 3605 3610 3615 Arg Val Ala Lys Ile His Val Cys Gly Asp Asp Gly Phe Leu Ile 3620 3625 3630 Thr Glu Arg Ala Leu Gly Glu Lys Phe Ser Ser Lys Gly Val Gln 3635 3640 3645 Ile Leu Tyr Glu Ala Gly Lys Pro Gln Lys Ile Thr Glu Gly Asp 3650 3655 3660 Lys Met Lys Val Ala Tyr Gln Phe Asp Asp Ile Glu Phe Cys Ser 3665 3670 3675 His Thr Pro Val Gln Val Arg Trp Ser Asp Asn Thr Ser Ser Tyr 3680 3685 3690 Met Pro Gly Arg Asn Thr Thr Thr Ile Leu Ala Lys Met Ala Thr 3695 3700 3705 Arg Leu Asp Ser Ser Gly Glu Arg Gly Thr Ile Ala Tyr Glu Lys 3710 3715 3720 Ala Val Ala Phe Ser Phe Leu Leu Met Tyr Ser Trp Asn Pro Leu 3725 3730 3735 Ile Arg Arg Ile Cys Leu Leu Val Leu Ser Thr Glu Leu Gln Val 3740 3745 3750 Arg Pro Gly Lys Ser Thr Thr Tyr Tyr Tyr Glu Gly Asp Pro Ile 3755 3760 3765 Ser Ala Tyr Lys Glu Val Ile Gly His Asn Leu Phe Asp Leu Lys 3770 3775 3780 Arg Thr Ser Phe Glu Lys Leu Ala Lys Leu Asn Leu Ser Met Ser 3785 3790 3795 Thr Leu Gly Val Trp Thr Arg His Thr Ser Lys Arg Leu Leu Gln 3800 3805 3810 Asp Cys Val Asn Val Gly Thr Lys Glu Gly Asn Trp Leu Val Asn 3815 3820 3825 Ala Asp Arg Leu Val Ser Ser Lys Thr Gly Asn Arg Tyr Ile Pro 3830 3835 3840 Gly Glu Gly His Thr Gln Gln Gly Lys His Tyr Glu Glu Leu Ile 3845 3850 3855 Leu Ala Arg Lys Pro Ile Ser Asn Phe Glu Gly Thr Asp Arg Tyr 3860 3865 3870 Asn Leu Gly Pro Ile Val Asn Val Val Leu Arg Arg Leu Arg Val 3875 3880 3885 Met Met Met Ala Leu Ile Gly Arg Gly Val 3890 3895 <210> 14 <211> 3898 <212> PRT <213> Artificial sequence <220> <223> GD18 polyprotein <400> 14 Met Glu Leu Asn His Phe Glu Leu Leu Tyr Lys Thr Asn Lys Gln Lys 1 5 10 15 Pro Ile Gly Val Glu Glu Pro Val Tyr Asp Ile Ala Gly Arg Pro Phe 20 25 30 Phe Gly Asp Pro Ser Glu Val His Pro Gln Ser Thr Leu Lys Leu Pro 35 40 45 His Asp Arg Gly Arg Gly Asn Ile Arg Thr Thr Leu Lys Asn Leu Pro 50 55 60 Arg Lys Gly Asp Cys Arg Ser Gly Asn His Leu Gly Pro Val Ser Gly 65 70 75 80 Ile Tyr Val Lys Pro Gly Pro Val Phe Tyr Gln Asp Tyr Met Gly Pro 85 90 95 Val Tyr His Arg Ala Pro Leu Glu Phe Phe Glu Glu Ala Gln Leu Cys 100 105 110 Glu Val Thr Lys Arg Ile Gly Arg Val Thr Gly Ser Asp Gly Lys Leu 115 120 125 Tyr His Ile Tyr Val Cys Ile Asp Gly Cys Ile Leu Leu Lys Leu Ala 130 135 140 Lys Arg Gly Thr Pro Arg Ser Leu Lys Trp Thr Arg Asn Phe Thr Asp 145 150 155 160 Cys Pro Leu Trp Val Thr Ser Cys Ser Asp Asp Gly Ala Gly Gly Ser 165 170 175 Lys Asp Lys Lys Pro Asp Arg Met Asn Lys Gly Lys Leu Lys Ile Ala 180 185 190 Pro Lys Glu His Glu Lys Asp Ser Lys Thr Lys Pro Pro Asp Ala Thr 195 200 205 Ile Val Val Glu Gly Val Lys Tyr Gln Val Lys Lys Lys Gly Lys Val 210 215 220 Lys Gly Lys Asn Thr Gln Asp Gly Leu Tyr His Asn Lys Asn Lys Pro 225 230 235 240 Pro Glu Ser Arg Lys Lys Leu Glu Lys Ala Leu Leu Ala Trp Ala Val 245 250 255 Ile Thr Ile Val Leu Tyr Gln Pro Val Ala Ala Glu Asn Ile Thr Gln 260 265 270 Trp Asn Leu Ser Asp Asn Gly Thr Ser Gly Ile Gln Gln Ala Met Tyr 275 280 285 Leu Arg Gly Val Asn Arg Ser Leu His Gly Ile Trp Pro Glu Lys Ile 290 295 300 Cys Lys Gly Val Pro Thr His Leu Ala Thr Asp Thr Glu Leu Thr Glu 305 310 315 320 Ile Arg Gly Met Met Asp Ala Ser Glu Arg Thr Asn Tyr Thr Cys Cys 325 330 335 Arg Leu Gln Arg His Glu Trp Asn Lys His Gly Trp Cys Asn Trp Tyr 340 345 350 Asn Ile Asp Pro Trp Ile Gln Leu Met Asn Arg Thr Gln Ala Asn Leu 355 360 365 Thr Glu Gly Pro Pro Asp Lys Glu Cys Ala Val Thr Cys Arg Tyr Asp 370 375 380 Lys Asn Ala Asp Val Asn Val Val Thr Gln Ala Arg Asn Arg Pro Thr 385 390 395 400 Thr Leu Thr Gly Cys Lys Lys Gly Lys Asn Phe Ser Phe Ala Gly Thr 405 410 415 Ile Ile Glu Gly Pro Cys Asn Phe Asn Val Ser Val Glu Asp Ile Leu 420 425 430 Tyr Gly Asp His Glu Cys Gly Ser Leu Phe Gln Asp Thr Ala Leu Tyr 435 440 445 Leu Leu Asp Gly Met Thr Asn Thr Ile Glu Lys Ala Arg Gln Gly Ala 450 455 460 Ala Arg Val Thr Ser Trp Leu Gly Arg Gln Leu Ser Thr Thr Gly Lys 465 470 475 480 Lys Leu Glu Arg Gly Ser Lys Thr Trp Phe Gly Ala Tyr Ala Leu Ser 485 490 495 Pro Tyr Cys Asn Val Thr Arg Lys Val Gly Tyr Ile Trp Tyr Thr Asn 500 505 510 Asn Cys Thr Pro Ala Cys Leu Pro Lys Asn Thr Lys Ile Ile Gly Pro 515 520 525 Gly Lys Phe Asp Thr Asn Ala Glu Asp Gly Lys Ile Leu His Glu Met 530 535 540 Gly Gly His Leu Ser Glu Phe Leu Leu Leu Ser Leu Val Ile Leu Ser 545 550 555 560 Asp Phe Ala Pro Glu Thr Ala Ser Thr Leu Tyr Leu Ile Leu His Tyr 565 570 575 Ala Ile Pro Gln Ser His Glu Glu Pro Glu Gly Cys Asp Thr Asn Gln 580 585 590 Leu Asn Leu Thr Val Gly Leu Arg Thr Glu Asp Val Val Pro Ser Ser 595 600 605 Val Trp Asn Ile Gly Lys Tyr Val Cys Val Arg Pro Asp Trp Trp Pro 610 615 620 Tyr Glu Thr Lys Val Ala Leu Leu Phe Glu Glu Ala Gly Gln Val Ile 625 630 635 640 Lys Leu Ala Leu Arg Ala Leu Arg Asp Leu Thr Arg Val Trp Asn Ser 645 650 655 Ala Ser Thr Thr Ala Phe Leu Ile Cys Leu Ile Lys Ile Leu Arg Gly 660 665 670 Gln Val Val Gln Gly Ile Ile Trp Leu Leu Leu Val Thr Gly Ala Gln 675 680 685 Gly Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr 690 695 700 Asn Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys 705 710 715 720 Glu Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr 725 730 735 Cys Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg 740 745 750 Arg Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr 755 760 765 Phe Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly 770 775 780 Asp Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val 785 790 795 800 Lys Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu 805 810 815 Val Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser 820 825 830 Pro Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys 835 840 845 Pro Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu 850 855 860 Asp Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly 865 870 875 880 Asp Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys 885 890 895 Gly Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly 900 905 910 Lys Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr 915 920 925 Asp Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu 930 935 940 Cys Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg 945 950 955 960 Leu Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly 965 970 975 Pro Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg 980 985 990 Asn Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu 995 1000 1005 Lys Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His 1010 1015 1020 His Thr Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala 1025 1030 1035 Leu Leu Gly Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile 1040 1045 1050 Val Leu Thr Glu Gln Leu Ala Ala Gly Leu Gln Leu Gly Gln Gly 1055 1060 1065 Glu Val Val Leu Ile Gly Asn Leu Ile Thr His Met Asp Asn Glu 1070 1075 1080 Val Val Val Tyr Phe Leu Leu Leu Tyr Leu Ile Ile Arg Asp Glu 1085 1090 1095 Pro Ile Lys Lys Trp Ile Leu Leu Leu Phe His Ala Met Thr Asn 1100 1105 1110 Asn Pro Val Lys Thr Met Thr Val Ala Leu Leu Met Ile Ser Gly 1115 1120 1125 Val Ala Lys Gly Gly Lys Ile Asp Gly Gly Trp Gln Arg Gln Pro 1130 1135 1140 Glu Thr Asn Phe Asp Ile Gln Phe Ala Leu Ala Val Ile Ile Val 1145 1150 1155 Val Val Met Leu Leu Ala Lys Arg Asp Pro Thr Thr Phe Pro Leu 1160 1165 1170 Val Ile Thr Val Ala Thr Leu Arg Thr Ala Lys Ile Thr Ser Gly 1175 1180 1185 Phe Ser Thr Asp Leu Ala Ile Ala Thr Val Ser Ala Thr Leu Leu 1190 1195 1200 Thr Trp Thr Tyr Ile Ser Asp Tyr Tyr Lys Tyr Lys Thr Trp Leu 1205 1210 1215 Gln Tyr Leu Ile Ser Thr Val Thr Gly Ile Phe Leu Ile Arg Val 1220 1225 1230 Leu Lys Gly Val Gly Glu Leu Asp Leu His Ala Pro Thr Leu Pro 1235 1240 1245 Ser His Arg Pro Leu Phe Tyr Ile Leu Val Tyr Leu Ile Ser Thr 1250 1255 1260 Ala Val Val Thr Arg Trp Asn Leu Asp Val Ala Gly Ile Leu Leu 1265 1270 1275 Gln Cys Ala Pro Thr Leu Leu Met Val Phe Thr Met Trp Ala Asp 1280 1285 1290 Ile Leu Thr Leu Ile Leu Ile Leu Pro Thr Tyr Glu Leu Thr Lys 1295 1300 1305 Leu Tyr Tyr Leu Lys Glu Val Lys Ile Gly Thr Glu Arg Gly Trp 1310 1315 1320 Leu Trp Lys Thr Asn Tyr Lys Arg Val Asn Asp Ile Tyr Glu Val 1325 1330 1335 Asp Gln Ala Gly Glu Gly Val Tyr Leu Phe Pro Ser Lys Gln Lys 1340 1345 1350 Thr Gly Ala Ile Thr Ser Thr Val Leu Pro Leu Ile Lys Ala Ile 1355 1360 1365 Leu Ile Ser Cys Ile Ser Asn Lys Trp Gln Phe Ile Tyr Leu Leu 1370 1375 1380 Tyr Leu Ile Phe Glu Val Ser Tyr Tyr Leu His Lys Lys Ile Ile 1385 1390 1395 Asp Glu Ile Ala Gly Gly Thr Asn Phe Val Ser Arg Leu Val Ala 1400 1405 1410 Ala Leu Ile Glu Val Asn Trp Ala Leu Asp Asn Glu Glu Val Lys 1415 1420 1425 Gly Leu Lys Lys Phe Phe Leu Leu Ser Ser Arg Val Lys Glu Leu 1430 1435 1440 Val Ile Lys His Lys Val Arg Asn Glu Val Met Val Arg Trp Phe 1445 1450 1455 Glu Asp Glu Glu Ile Tyr Gly Met Pro Lys Leu Ile Gly Leu Val 1460 1465 1470 Lys Ala Ala Thr Leu Ser Lys Asn Lys His Cys Ile Leu Cys Thr 1475 1480 1485 Val Cys Glu Asp Arg Asp Trp Arg Gly Glu Thr Cys Pro Lys Cys 1490 1495 1500 Gly Arg Phe Gly Pro Pro Val Ile Cys Gly Met Thr Leu Ala Asp 1505 1510 1515 Phe Glu Glu Lys His Tyr Lys Arg Ile Phe Ile Arg Glu Asp Gln 1520 1525 1530 Ser Asp Gly Pro Leu Arg Glu Glu His Ala Gly Tyr Leu Gln Tyr 1535 1540 1545 Lys Ala Arg Gly Gln Leu Phe Leu Arg Asn Leu Pro Val Leu Ala 1550 1555 1560 Thr Lys Val Lys Met Leu Leu Val Gly Asn Leu Gly Thr Glu Val 1565 1570 1575 Gly Asp Leu Glu His Leu Gly Trp Val Leu Arg Gly Pro Ala Val 1580 1585 1590 Cys Lys Lys Val Thr Glu His Glu Lys Cys Ala Thr Ser Ile Met 1595 1600 1605 Asp Lys Leu Thr Ala Phe Phe Gly Val Met Pro Arg Gly Thr Thr 1610 1615 1620 Pro Arg Ala Pro Val Arg Phe Pro Thr Ser Leu Leu Lys Ile Arg 1625 1630 1635 Arg Gly Leu Glu Thr Gly Trp Ala Tyr Thr His Gln Gly Gly Ile 1640 1645 1650 Ser Ser Val Asp His Val Thr Cys Gly Lys Asp Leu Leu Val Cys 1655 1660 1665 Asp Thr Met Gly Arg Thr Arg Val Val Cys Gln Ser Asn Asn Lys 1670 1675 1680 Met Thr Asp Glu Ser Glu Tyr Gly Val Lys Thr Asp Ser Gly Cys 1685 1690 1695 Pro Glu Gly Ala Arg Cys Tyr Val Phe Asn Pro Glu Ala Val Asn 1700 1705 1710 Ile Ser Gly Thr Lys Gly Ala Met Val His Leu Gln Lys Thr Gly 1715 1720 1725 Gly Glu Phe Thr Cys Val Thr Ala Ser Gly Thr Pro Ala Phe Phe 1730 1735 1740 Asp Leu Lys Asn Leu Lys Gly Trp Ser Gly Leu Pro Ile Phe Glu 1745 1750 1755 Ala Ser Ser Gly Arg Val Val Gly Arg Val Lys Val Gly Lys Asn 1760 1765 1770 Glu Asp Ser Lys Pro Thr Lys Leu Met Ser Gly Ile Gln Thr Val 1775 1780 1785 Ser Lys Ser Ala Thr Asp Leu Thr Glu Met Val Lys Lys Ile Thr 1790 1795 1800 Thr Met Asn Arg Gly Glu Phe Arg Gln Ile Thr Leu Ala Thr Gly 1805 1810 1815 Ala Gly Lys Thr Thr Glu Leu Pro Arg Ser Val Ile Glu Glu Ile 1820 1825 1830 Gly Arg His Lys Arg Val Leu Val Leu Ile Pro Leu Arg Ala Ala 1835 1840 1845 Ala Glu Ser Val Tyr Gln Tyr Met Arg Gln Lys His Pro Ser Ile 1850 1855 1860 Ala Phe Asn Leu Arg Ile Gly Glu Met Glu Glu Gly Tyr Met Ala 1865 1870 1875 Thr Gly Ile Thr Tyr Ala Ser Tyr Gly Tyr Phe Cys Gln Met Pro 1880 1885 1890 Gln Pro Lys Leu Arg Ala Ala Met Val Glu Tyr Ser Tyr Ile Phe 1895 1900 1905 Leu Asp Glu Tyr His Cys Ala Thr Pro Glu Gln Leu Ala Ile Met 1910 1915 1920 Gly Lys Ile His Arg Phe Ser Glu Asn Leu Arg Val Val Ala Met 1925 1930 1935 Thr Ala Thr Pro Ala Gly Thr Val Thr Thr Thr Gly Gln Lys His 1940 1945 1950 Pro Ile Glu Glu Phe Ile Ala Pro Glu Val Met Lys Gly Glu Asp 1955 1960 1965 Leu Gly Ser Glu Tyr Leu Asp Ile Ala Gly Leu Lys Ile Pro Val 1970 1975 1980 Glu Glu Met Lys Asn Asn Met Leu Val Phe Val Pro Thr Arg Asn 1985 1990 1995 Met Ala Val Glu Ala Ala Lys Lys Leu Lys Ala Lys Gly Tyr Asn 2000 2005 2010 Ser Gly Tyr Tyr Tyr Ser Gly Glu Asp Pro Ser Asn Leu Arg Val 2015 2020 2025 Val Thr Ser Gln Ser Pro Tyr Val Val Val Ala Thr Asn Ala Ile 2030 2035 2040 Glu Ser Gly Val Thr Leu Pro Asp Leu Asp Val Val Val Asp Thr 2045 2050 2055 Gly Leu Lys Cys Glu Lys Arg Ile Arg Leu Ser Pro Lys Met Pro 2060 2065 2070 Phe Ile Val Thr Gly Leu Lys Arg Met Ala Val Thr Ile Gly Glu 2075 2080 2085 Gln Ala Gln Arg Arg Gly Arg Val Gly Arg Val Lys Pro Gly Arg 2090 2095 2100 Tyr Tyr Arg Ser Gln Glu Thr Pro Val Gly Ser Lys Asp Tyr His 2105 2110 2115 Tyr Asp Leu Leu Gln Ala Gln Arg Tyr Gly Ile Glu Asp Gly Ile 2120 2125 2130 Asn Ile Thr Lys Ser Phe Arg Glu Met Asn Tyr Asp Trp Ser Leu 2135 2140 2145 Tyr Glu Glu Asp Ser Leu Met Ile Thr Gln Leu Glu Ile Leu Asn 2150 2155 2160 Asn Leu Leu Ile Ser Glu Glu Leu Pro Val Ala Val Lys Asn Ile 2165 2170 2175 Met Ala Arg Thr Asp His Pro Glu Pro Ile Gln Leu Ala Tyr Asn 2180 2185 2190 Ser Tyr Glu Thr Gln Val Pro Val Leu Phe Pro Lys Ile Arg Asn 2195 2200 2205 Gly Glu Val Thr Asp Thr Tyr Asp Asn Tyr Thr Phe Leu Asn Ala 2210 2215 2220 Arg Lys Leu Gly Asp Asp Val Pro Pro Tyr Val Tyr Ala Thr Glu 2225 2230 2235 Asp Glu Asp Leu Ala Val Glu Leu Leu Gly Leu Asp Trp Pro Asp 2240 2245 2250 Pro Gly Asn Gln Gly Thr Val Glu Ala Gly Arg Ala Leu Lys Gln 2255 2260 2265 Val Val Gly Leu Ser Thr Ala Glu Asn Ala Leu Leu Val Ala Leu 2270 2275 2280 Phe Gly Tyr Val Gly Tyr Gln Ala Leu Ser Lys Arg His Ile Pro 2285 2290 2295 Val Val Thr Asp Ile Tyr Ser Val Glu Asp His Arg Leu Glu Asp 2300 2305 2310 Thr Thr His Leu Gln Tyr Ala Pro Asn Ala Ile Lys Thr Glu Gly 2315 2320 2325 Lys Glu Thr Glu Leu Lys Glu Leu Ala Gln Gly Asp Val Gln Arg 2330 2335 2340 Cys Val Glu Ala Val Ala Asn Tyr Ala Ser Glu Gly Ile Gln Phe 2345 2350 2355 Ile Lys Ser Gln Ala Leu Lys Val Arg Glu Thr Pro Thr Tyr Lys 2360 2365 2370 Glu Thr Met Asn Thr Val Ala Asp Tyr Val Lys Lys Phe Ile Glu 2375 2380 2385 Ala Leu Ser Asp Ser Lys Glu Asp Ile Leu Lys Tyr Gly Leu Trp 2390 2395 2400 Gly Val His Thr Ala Leu Tyr Lys Ser Ile Gly Ala Arg Leu Gly 2405 2410 2415 His Glu Thr Ala Phe Ala Thr Leu Val Val Lys Trp Leu Ala Phe 2420 2425 2430 Gly Gly Glu Ser Val Thr Asp His Ile Lys Gln Ala Ala Thr Asp 2435 2440 2445 Leu Val Val Tyr Tyr Ile Ile Asn Arg Pro Gln Phe Pro Gly Asp 2450 2455 2460 Thr Glu Thr Gln Gln Glu Gly Arg Lys Phe Val Ala Ser Leu Leu 2465 2470 2475 Val Ser Ala Leu Ala Thr Tyr Thr Tyr Lys Ser Trp Asn Tyr Asn 2480 2485 2490 Asn Leu Ser Lys Ile Val Glu Pro Ala Leu Ala Thr Leu Pro Tyr 2495 2500 2505 Ala Ala Lys Ala Leu Lys Leu Phe Ala Pro Thr Arg Leu Glu Ser 2510 2515 2520 Val Val Ile Leu Ser Thr Ala Ile Tyr Lys Thr Tyr Leu Ser Ile 2525 2530 2535 Arg Arg Gly Lys Ser Asp Gly Leu Leu Gly Thr Gly Val Ser Ala 2540 2545 2550 Ala Met Glu Ile Met Ser Gln Asn Pro Val Ser Val Gly Ile Ala 2555 2560 2565 Val Met Leu Gly Val Gly Ala Val Ala Ala His Asn Ala Ile Glu 2570 2575 2580 Ala Ser Glu Gln Lys Arg Thr Leu Leu Met Lys Val Phe Val Lys 2585 ​​2590 2595 Asn Phe Leu Asp Gln Ala Ala Thr Asp Glu Leu Val Lys Glu Ser 2600 2605 2610 Pro Glu Lys Ile Ile Met Ala Leu Phe Glu Ala Val Gln Thr Val 2615 2620 2625 Gly Asn Pro Leu Arg Leu Val Tyr His Leu Tyr Gly Val Phe Tyr 2630 2635 2640 Lys Gly Trp Glu Ala Lys Glu Leu Ala Gln Arg Thr Ala Gly Arg 2645 2650 2655 Asn Leu Phe Thr Leu Ile Met Phe Glu Ala Val Glu Leu Leu Gly 2660 2665 2670 Val Asp Ser Glu Gly Lys Ile Arg Gln Leu Ser Ser Asn Tyr Ile 2675 2680 2685 Leu Glu Leu Leu Tyr Lys Phe Arg Asp Asp Ile Lys Ser Ser Val 2690 2695 2700 Arg Glu Ile Ala Ile Ser Trp Ala Pro Ala Pro Phe Ser Cys Asp 2705 ​​2710 2715 Trp Thr Pro Thr Asp Asp Arg Ile Gly Leu Pro His Asp Asn Tyr 2720 2725 2730 Leu Gln Met Glu Thr Arg Cys Pro Cys Gly Tyr Arg Met Lys Ala 2735 2740 2745 Val Lys Thr Cys Ala Gly Glu Leu Arg Leu Leu Glu Glu Gly Gly 2750 2755 2760 Ser Phe Leu Cys Arg Asn Lys Phe Gly Arg Gly Ser Arg Asn Tyr 2765 2770 2775 Arg Val Thr Lys Tyr Tyr Asp Asp Asn Leu Ser Glu Ile Lys Pro 2780 2785 2790 Val Ile Arg Met Glu Gly His Val Glu Leu Tyr His Lys Gly Ala 2795 2800 2805 Thr Phe Lys Leu Asp Phe Asp Asn Ser Lys Thr Val Leu Ala Thr 2810 2815 2820 Asp Arg Trp Glu Val Asp His Ser Thr Leu Ile Arg Val Leu Lys 2825 2830 2835 Arg His Thr Gly Ala Gly Phe Gln Gly Ala Tyr Leu Gly Glu Lys 2840 2845 2850 Pro Asn His Lys His Leu Ile Glu Arg Asp Cys Ala Thr Ile Thr 2855 2860 2865 Lys Asp Lys Val Cys Phe Ile Lys Met Lys Arg Gly Cys Ala Phe 2870 2875 2880 Thr Tyr Asp Leu Ser Leu His Asn Leu Thr Arg Leu Ile Glu Leu 2885 2890 2895 Val His Lys Asn Asn Leu Asp Asp Arg Glu Ile Pro Ala Val Thr 2900 2905 2910 Val Thr Thr Trp Leu Ala Tyr Thr Phe Val Asn Glu Asp Ile Gly 2915 2920 2925 Thr Ile Lys Pro Val Phe Gly Glu Lys Val Thr Pro Glu Lys Gln 2930 2935 2940 Glu Glu Val Ala Leu Gln Pro Ala Val Val Val Asp Thr Thr Asp 2945 2950 2955 Val Ala Val Thr Val Val Gly Glu Thr Ser Thr Met Thr Thr Gly 2960 2965 2970 Glu Thr Pro Thr Ile Phe Thr Ser Leu Gly Ser Asp Ser Lys Phe 2975 2980 2985 Gln Gln Val Leu Lys Leu Gly Val Asp Glu Gly Gln Tyr Pro Gly 2990 2995 3000 Pro Arg Gln Gln Arg Ala Ser Leu Leu Glu Ala Val Gln Gly Val 3005 3010 3015 Asp Glu Arg Pro Ser Val Leu Ile Leu Gly Ser Asp Lys Ala Thr 3020 3025 3030 Ser Asn Arg Val Lys Thr Ala Lys Asn Val Lys Ile Phe Arg Ser 3035 3040 3045 Arg Asp Pro Leu Glu Leu Arg Glu Met Met Arg Arg Gly Lys Ile 3050 3055 3060 Leu Ile Ile Ala Leu Cys Lys Val Asp Thr Ala Leu Leu Lys Phe 3065 3070 3075 Val Asp Tyr Lys Gly Thr Phe Leu Thr Arg Glu Thr Leu Glu Ala 3080 3085 3090 Leu Ser Leu Gly Lys Pro Lys Lys Arg Asp Ile Thr Lys Thr Glu 3095 3100 3105 Ala Arg Trp Leu Leu Cys Leu Glu Gly Gln Leu Glu Glu Leu Pro 3110 3115 3120 Asp Trp Phe Ala Ala Lys Glu Pro Ile Phe Leu Glu Ala Asn Ile 3125 3130 3135 Lys Arg Asp Lys Tyr His Leu Val Gly Asp Ile Ala Thr Ile Lys 3140 3145 3150 Glu Lys Ala Lys Gln Leu Gly Ala Thr Asp Ser Thr Lys Ile Ser 3155 3160 3165 Lys Glu Val Gly Ala Lys Val Tyr Ser Met Lys Leu Ser Asn Trp 3170 3175 3180 Val Ile Gln Glu Glu Asn Lys Gln Gly Ser Leu Thr Pro Leu Phe 3185 3190 3195 Glu Glu Leu Leu Gln Gln Cys Pro Pro Gly Gly Gln Asn Lys Thr 3200 3205 3210 Thr His Met Ala Ser Ala Tyr Gln Leu Ala Gln Gly Asn Trp Met 3215 3220 3225 Pro Val Gly Cys His Val Phe Met Gly Thr Ile Pro Ala Arg Arg 3230 3235 3240 Thr Lys Thr His Pro Tyr Glu Ala Tyr Val Lys Leu Arg Glu Leu 3245 3250 3255 Val Glu Glu His Lys Met Lys Thr Ser Cys Gly Gly Ser Gly Leu 3260 3265 3270 Cys Lys His Asn Glu Trp Val Ile Arg Lys Ile Lys His Gln Gly 3275 3280 3285 Asn Leu Arg Thr Arg His Met Leu Asn Pro Gly Lys Ile Ala Glu 3290 3295 3300 Gln Leu Asp Arg Glu Gly His Arg His Asn Val Tyr Asn Lys Thr 3305 3310 3315 Ile Gly Ser Val Met Thr Ala Thr Gly Ile Arg Leu Glu Lys Leu 3320 3325 3330 Pro Val Val Arg Ala Gln Thr Asp Thr Thr Asn Phe His Gln Ala 3335 3340 3345 Ile Arg Asp Lys Ile Asp Lys Glu Glu Asn Leu Gln Thr Pro Gly 3350 3355 3360 Leu His Lys Lys Leu Met Glu Val Phe Asn Ala Leu Lys Arg Pro 3365 3370 3375 Glu Leu Glu Ala Ser Tyr Asp Ala Val Glu Trp Glu Glu Leu Glu 3380 3385 3390 Arg Gly Ile Asn Arg Lys Gly Ala Ala Gly Phe Phe Glu Arg Lys 3395 3400 3405 Asn Ile Gly Glu Val Leu Asp Ser Glu Lys Tyr Lys Val Glu Glu 3410 3415 3420 Ile Ile Asp Ser Leu Lys Lys Gly Arg Ser Ile Lys Tyr Tyr Glu 3425 3430 3435 Thr Ala Ile Pro Lys Asn Glu Lys Arg Asp Val Asn Asp Asp Trp 3440 3445 3450 Thr Ala Gly Asp Phe Val Asp Glu Lys Lys Pro Arg Val Ile Gln 3455 3460 3465 Tyr Pro Glu Ala Lys Thr Arg Leu Ala Ile Thr Lys Val Met Tyr 3470 3475 3480 Lys Trp Val Lys Gln Lys Pro Val Val Ile Pro Gly Tyr Glu Gly 3485 3490 3495 Lys Thr Pro Leu Phe Gln Ile Phe Asp Lys Val Lys Lys Glu Trp 3500 3505 3510 Asn Gln Phe Gln Asn Pro Val Ala Val Ser Phe Asp Thr Lys Ala 3515 3520 3525 Trp Asp Thr Gln Val Thr Thr Arg Asp Leu Glu Leu Ile Arg Asp 3530 3535 3540 Ile Gln Lys Phe Tyr Phe Lys Lys Lys Trp His Lys Phe Ile Asp 3545 3550 3555 Thr Leu Thr Met His Met Ser Glu Val Pro Val Ile Ser Ala Asp 3560 3565 3570 Gly Glu Val Tyr Ile Arg Lys Gly Gln Arg Gly Ser Gly Gln Pro 3575 3580 3585 Asp Thr Ser Ala Gly Asn Ser Met Leu Asn Val Leu Thr Met Val 3590 3595 3600 Tyr Ala Phe Cys Glu Ala Thr Gly Val Pro Tyr Lys Ser Phe Asp 3605 3610 3615 Arg Val Ala Lys Ile His Val Cys Gly Asp Asp Gly Phe Leu Ile 3620 3625 3630 Thr Glu Arg Ala Leu Gly Glu Lys Phe Ala Ser Arg Gly Val Gln 3635 3640 3645 Ile Leu Tyr Glu Ala Gly Lys Pro Gln Lys Ile Thr Glu Gly Asp 3650 3655 3660 Asn Met Lys Val Ala Tyr Gln Phe Asp Asp Ile Glu Phe Cys Ser 3665 3670 3675 His Thr Pro Val Gln Val Arg Trp Ser Asp Asn Thr Ser Ser Tyr 3680 3685 3690 Met Pro Gly Arg Asn Thr Thr Thr Ile Leu Ala Lys Met Ala Thr 3695 3700 3705 Arg Leu Asp Ser Ser Gly Glu Arg Gly Thr Ile Ala Tyr Glu Lys 3710 3715 3720 Ala Val Ala Phe Ser Phe Leu Leu Met Tyr Ser Trp Asn Pro Leu 3725 3730 3735 Ile Arg Arg Ile Cys Leu Leu Val Leu Ser Thr Glu Met Gln Val 3740 3745 3750 Arg Pro Gly Lys Ser Thr Thr Tyr Tyr Tyr Glu Gly Asp Pro Ile 3755 3760 3765 Ser Ala Tyr Lys Glu Val Ile Gly His Asn Leu Phe Asp Leu Lys 3770 3775 3780 Arg Thr Ser Phe Glu Lys Leu Ala Lys Leu Asn Leu Ser Met Ser 3785 3790 3795 Thr Leu Gly Val Trp Thr Arg His Thr Ser Lys Arg Leu Leu Gln 3800 3805 3810 Asp Cys Val Asn Val Gly Thr Lys Glu Gly Asn Trp Leu Val Asn 3815 3820 3825 Ala Asp Arg Leu Val Ser Ser Lys Thr Gly Asn Arg Tyr Ile Pro 3830 3835 3840 Gly Glu Gly His Thr Gln Gln Gly Lys His Tyr Glu Glu Leu Val 3845 3850 3855 Leu Ala Arg Lys Pro Thr Ser Asn Phe Glu Gly Thr Asp Arg Tyr 3860 3865 3870 Asn Leu Gly Pro Ile Val Asn Val Val Leu Arg Arg Leu Arg Val 3875 3880 3885 Met Met Met Ala Leu Ile Gly Arg Gly Val 3890 3895 <210> 15 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> mutated 6B8 epitope with KRD for GD18 or QZ07 or GD191 <400> 15 Lys Thr Asn Glu Ile Gly Pro Leu Gly Ala Arg Asp 1 5 10 <210> 16 <211> 12 <212> PRT <213> Artificial sequence <220> <223> The 6B8 epitope of GD18, QZ07, or GD191 with the KARD mutation. <400> 16 Lys Thr Asn Glu Ile Gly Pro Leu Ala Ala Arg Asp 1 5 10 <210> 17 <211> 12 <212> PRT <213> Artificial sequence <220> <223> 6B8 epitopes with RD mutations in GD18, QZ07, or GD191 <400> 17 Ser Thr Asn Glu Ile Gly Pro Leu Gly Ala Arg Asp 1 5 10 <210> 18 <211> 12 <212> PRT <213> Artificial sequence <220> <223> The 6B8 epitope of strain C with the RD mutation <400> 18 Ser Thr Asp Glu Ile Gly Leu Leu Gly Ala Arg Asp 1 5 10 <210> 19 <211> 12 <212> PRT <213> Artificial sequence <220> <223> The 6B8 epitope of strain C with a KRD mutation <400> 19 Lys Thr Asp Glu Ile Gly Leu Leu Gly Ala Arg Asp 1 5 10 <210> 20 <211> 12 <212> PRT <213> Artificial sequence <220> <223> The 6B8 epitope of strain C with the KARD mutation <400> 20 Lys Thr Asp Glu Ile Gly Leu Leu Ala Ala Arg Asp 1 5 10 <210> twenty one <211> 12296 <212> DNA <213> Artificial sequence <220> <223> QZ07-wt <400> twenty one gtatacgagg ttagttcgtt ctcgtgtaca atattggaca aaacaaaatt ccgatttggc 60 ctagggcacc cctccagcga cggccgaact gggctagcca tgccccacagt aggactagca 120 aacggaggga ctagccgtag tggcgagctc cctgggtggt ctaagtcctg agtacaggac 180 agtcgtcagt agttcgacgt gagcaggagc ccacctcgag atgctatgtg gacgagggca 240 tgcccaagac acaccttaac cctggcgggg gtcgccaggg tgaaatcaca ccatgtgatg 300 ggggtacgac ctgatagggc gctgcagagg cccactaca ggctagtata aaaatctctg 360 ctgtacatgg cacatggagt tgaatcatttt tgaactattg tataaaaaaaaaaaaaaa 420 accaatggga gtggaggaac cggtgtatga catcgcaggg agaccattat ttggggaccc 480 aagtgaggta butterflies storm gctaccacc gagggaa gaggtaat 540 cagaactaca ctgaggacc tacctaggaa agcgactgc aggagtgga accacctagg 600 accagttagt gggatatacg taaagcctgg ccctgtctc tatcaggact acatgggccc 660 tgtctaccat agagccccat tagattttt tggtgaggcc caatttgtg aggtgaccaa 720 gaggataggt agggtgacgg gtagtgacgg aaagcttac cacatatatg tgtgcatcga 780 cggttgcata ctgttgaagt tagccaaag gggcgcgccc agatccctaa agtggactag 840 gaacttcacc gactgtccac tgtgggtcac tagttgttct gatgatggca caggtgacag 900 chaaaaaaaaaaaaaaaaaaaaaaaaaattaaaaaaaaaaaaaaaaaachacha 960 tgagaaggac agtaagacca agccacctga tgctacaatt gtggtagagg gagtaaaata 1020 ccaagtaaaaaaaggca aagtcaagg gagaacact ccagatggcc tgtaccataa 1080 taagaaaaa ccaccagagt ccaggaaa actagaaaaa gccctattgg cctggggcagt 1140 gatagcaata gtgctgtacc agcctgtagc agccgagaat ataacccaat ggaacctgag 1200 tgacaacggc acagcggca tccagcaagc tatgtatctc agaggggtca ataggagctt 1260 gcatgggatc tggctgaaa aatatgcaa gggggtccct accatctgg ccactgacac 1320 ggaactgaca gagatacgcg ggatgatgga cgccagtgag aggacgaact acacgtgttg 1380 taggttgcag agacacgaat ggacaaca tggctgtgc aactgtaca acatagaccc 1440 ctggattcag ttaatgaca ggacccaagc aaatttgaca gaaggccctc cagataaga 1500 gtgtgccgtg acttgcaggt atgacaaaa taccgatgtt aacgtggtca cccaggccag 1560 gatagacct actactctga ctggctgcaa gaaagggaaaatttcat ttgcaggtac 1620 ggtcatagag ggcccatgca atttcaacgt atccgtggag gatacttat atggcgacca 1680 tgagtgtgc agcctgttcc aggacacggc tctgtaccta ttagatggaa tgaccacac 1740 tatagagaaa gccaggcagg gtgcggcaag agtcacatct tggctcggga gacaactcag 1800 aaccacagg aagaagttgg agaagagaag caaaacctgg ttcggtgcct atgccctgtc 1860 accttactgc aatgtaacaa ggaaaatagg gtacatatgg tacacgaaca attgcactcc 1920 ggcatgcctc ccaaaaaaca caaaaataat aggcccagga aagtttgaca ccaatgcaga 1980 agacgggaag attcttcatg aaatgggggg ccacctatca gaattcttgt tgctttctct 2040 ggtagtcctg tctgacttcg ccccagaaac ggccagtaca ttatacctaa tcttacacta 2100 tgcaatccct cagtcccgtg acgaacccga ggtttgcgat acaaaccagc tcaacctaac 2160 agtgggactt aggacagaag atgtggtacc atcatcagtc tggaatattg gcaaatatgt 2220 gtgtgttaga ccagattggt ggccgtatga aactaaggtg gctctactgt ttgaagaggc 2280 gggacaggtc ataaagttag ctctacgggc actgagggat ttaactagag tctggaacag 2340 tgcatcaact actgcgttcc tcatctgctt gataaaaata ttaagaggac aggttgtgca 2400 aggtataata tggctgctgc tggtgactgg ggcacaaggg cggttgtcct gcaaggaaga 2460 ctacaggtat gcgatatcat caaccaatga gatagggccg ctaggggctg aaggtctcac 2520 caccacctgg aaaagaata accatggttt gcagctggat gacgggactg tcagggccat 2580 ttgcactgca gggtccttta aagttatagc acttaatgtg gtcagtagga ggtacctggc 2640 atcattacac aagagggctt tacccacttc agtaacattt gaactcctat ttgatgggac 2700 tagtccagca attgaggaga tgggagatga ctttggattt gggctgtgcc cttttgacac 2760 aacccccgtg gtcaaagga agtacaatac cactttatta aacggtagtg ctttctatct 2820 agtctgccca ataggatgga cgggtgtcat agagtgcacg gcagtaagcc ctacaacctt 2880 gagaacagaa gtggtgaaga ccttcaagag agaaagcct ttcccacaca gagtgggtttg 2940 cgtgaccact gttgtagaaa aagaagacct gttctactgc aagtgggggg gtaattggac 3000 atgtgtaaaa ggcaacccgg tgacctacat gggggggcaa gtaaaacaat gcagatggtg 3060 cggttttgac ttcaaggagc ccgatgggct cccacactac cccataggca agtgcatcct 3120 agcaaatgag acgggttaca gggtagtgga ttccacagac tgcaatagag atggcgtcgt 3180 tatcagcact gaaggtgaac acgagtgctt gattggcaac accaccgtca aggtgcacgc gttggatgga agactgggcc ctatgccgtg cagacccaaa gaatcgtct ctagcgcagg acctgtaagg aaaacttcct gcaccttcaa ctacacaaag acactaaga aacagtacta tgaacccagg gacagctatt tccagcaata tatgcttaag ggcgagtacc aatactggtt tgatctggac gtgaccgacc accacacaga ctactttgcc gaatttgttg tcttggtggt agtggcacta ttagggggga ggtacgtcct atggctaata gtgacctatg taattttaac agagcaactc gctgccggtt tacagctggg ccaaggcgag gtagtactga tagggaactt aattacccac acggacaatg aggtagtggt attacktctta ctgctctacc father agacgagcct father ggatactact gctgtttcat gccatgacca acaacccagt 3720. taagaccatg acagtagcat tgctgatgat cagtggggtc gccaagggtg ggaaaacaga tggtggttgg cagaggcagc cggagaccaa ttttgacatt caactcgcac tggcagttat agtagtcgtt gtgatgttac tggcaaagag agcccgact acttttcccc tggtgatcac 3900. agtggcaacc ttagaacag ctaagataac caatggttttc agcacagatc tagctatagc 3960 cacagtgtcg gcagctttgc taacctggac ttatatcagt gactac atatagac 4020 ttggctacag tacctcatca gcacggtgac tgggatctc ctaataaggg tactgaaggg 4080 ataggcgag ctagacatgc acgccccaac tttgccatct cacagacccc tttctacat 4140 cctcgtgtac ctcatctcca ctgctgtggt gactagatgg aacctggacg tagccggact 4200 gctgctacag tgtgtcccaa cactctaat ggtgttcacg atgtgggctg acatctcac 4260 cctaatccctc gtgttaccca cttatgaact ggcaagttg tattacctta aggaagtgaa 4320 gatcggaacc gaaagaggat ggctgtgga actaacta aagagggtaa atgacatcta 4380 tgaagtcgac caagctggcg agggggtcta cctctccct tcgaaacaaa agactagtgc 4440 tatacaagc accatgttgc cattgatcaa agccatactc attagctgca tcagtacaa 4500 gtggcaactc atatatttac tgtacctgat attcgaagtg tcctactacc ttcacaagaa 4560 agtcatagat gaaatagctg gtgggaccaa cttcgtttca aggctagtgg cagccttaat 4620 tgaagttaat tggccttcg acatgaga agttaaaggc ctaaagaagt tctttttgct 4680 gtccagtaga gttaaagaat tggtcatcaa acacaagtg aggaatgaag tagtggcccg 4740 ctggttcgga gatgagaga tctatgggat gcccaagttg atcggcttg tcaggcagc 4800 aactctaagt aaaaataac actgtatctt gtgcaccgtc tgcgaggaca gagattggag 4860 aggagaaacc tgcccaaat gtgggcgttt cggaccacca gtgatctgtg gtgaccct 4920 agccgacttc gaggagaagc attaagag gatattcatc agggaggacc aatcagatgg 4980 accgctcagg gaggagcgtg cagggtactt acagtacaga gctaggggtc aactgtttct 5040 gaggaatctc ccagtgttgg cgacaaagt cagatgctc ctggttggta acccgggac 5100 ggaggttggg gatttggagc accttggctg ggtgcttaga gggcctgctg tctgcaagaa 5160 ggttactgaa catgaaagt gtgctacgtc tataatgat aagttgactg ctttcttcgg 5220 cgttatgcca agaggtacca cccccagagc ccccgtgaga ttcccacct ccctcctaaa 5280 gataagaga gggctagaga cggggttggggc ttacacat caggtggca ttagctcagt 5340 tgaccatgtg acttgtggga aagacttgct ggtgtgtgac actatgggcc ggacaagggt 5400 cgtttgccaa tcaaataata agatgactga cgaatccgaa tacggggtca aaaccgactc 5460 agggtgccca gaaggggcca gatgttatgt gttcaaccct gaggcagtta acatatcagg 5520 cactaaaggg gccatggtcc acttacaaaa aactggtggg gagttcacct gcgtaacagc 5580 atcaggaacc ccggccttct ttgatctcaa gaacctcaag ggctggtcag ggctaccgat 5640 attcgaagca tcgagtggaa gggtagtcgg aagggtcaag gtcgggaaga acgatgactc 5700 taaaccaacc aaactcatga gtgggataca aacggtctct aaaagtgcca ctgacctgac 5760 ggagatggta aagaagataa caactatgaa caggggagag ttcagacaga taaccttggc 5820 cacaggtgct gggaaaacta cagagctccc caggtcagtc atagaagaga tagggaca 5880 caaaagggtg ttggtattga tccccttgag ggccgcagca gaatcagtat accaatatat 5940 gaggcagaaa cacccaagta tagcattcaa cctgaggata ggggagatga aggaaggtca 6000 catggccacg gggataacct atgcctccta cggttacttt tgccagatgc cacaacctaa 6060 gctgaggggcc gcaatggtag agtactccta catcttcta gatgagtacc attgtgccac 6120 cccagaacaa ctggctatca tggggagat ccacagattc tcagagaacc tgcggtggt 6180 agctatgaca gcgacaccag caggcagt aacaactact gggcagaac accctataga 6240 ggagttcata gccccggaag tatgaagg agagactta ggttcagagt acttagacat 6300 tgccggacta aagataccag tagaggagat gagacaac atgctttt ttgtaccac 6360 taggaatag gcggtagagg cggcaagaa actgaaagct aaggataca actcaggcta 6420 ttactacagt ggtgaggatc catctaacct gagggtagtc acatcgcagt cccatacgt 6480 ggttgtagcg accaacgcga tagaatcagg cgtcactctc ccggaccttg acgtggtcgt 6540 tgacacggga ctcaagtgtg agaaaagaat ccgattgtca cccagatgc ctttcatagt 6600 gactggccta aaagaatgg ctgttaccat tggggacaa gcccagagaa gaggggggt 6660 tggaagta aagcccggga gatacag gagccaagaa acccctgtcg gctctagga 6720 ctaccactac gatttattgc aagcccagag gtacggtata gagatggga taaatatcac 6780 caatccttc aggaatga actatgatg gagccctt gaggagata gcctgatgat 6840 aacacaattg gaatcctca acaatctact gatatcagag gagctgccgg tggcagtaaa 6900 aaatataatg gctaggactg accaccaga accaattcaa ctagcatata atagctacga 6960 gabacaagtg cctgtgttgt tcccaaaat aagaatgga gaggtgactg acacttacga 7020 tacttacacc ttcatcaatg caagaaaatt gggagatgat gtacctccct acgtgtatgc 7080 cacagagat gaggacttgg cagtggact gttgggccta gattggccgg accctgggaa 7140 ccaaggcact gtggaggccg gcagagcact aaaacaggtg gtcggtctat ccaagccga 7200 gatgccctg ttagtagcct tgtttggcta cgtagggtac caggccctct caagaggca 7260 tatacctgtg gtcacacaca tatactcagt tgagatcac aggtagagg acaccaca 7320 cctacagtac gctccgaatg ccatcagac ggagggag gagactgaat tgaggagtt 7380 ggctcagggg gatgtgcaga gatgcgtgga agcgatgacc aattacgcga gaggggcat 7440 ccaatttatg aagtcacagg cactgcaggt gagagaacc cccacttata aagagacaat 7500 gaatactgta gcagactatg tgaaaaagtt tatcgaggca ctgtctgata gcaaggaaga 7560 catcttgaaa tatgggctgt ggggcgtaca tacggccttg tacaagagca ttggtgccag 7620 gcttggtcac gaaaccgcgt tcgcaaccct agccgtgaaa tggctggcat ttggggggga 7680 atcaatagca gatcatataa aacaagcggc tacagacttg gtcgtctact atatcatcaa 7740 cagacctcag ttcccaggag acacagagac acaacaggag gggagaaatt ttgtggccag 7800 cctactggtc tcagccctag caacttacac atataaaagc tggaactata ataacctgtc 7860 caagatagta gaaccggctt tggccaccct gccctatgcc gctaaagccc ttaaattatt 7920 tgcccctacc aggctagaga gcgtcgtcat attgagcacc gcaatctaca aaacatacct 7980 atcaatcagg cgaggcaaaa gcgatggatt gctaggtaca ggggttagtg cggctatgga 8040 gattatgtca caaaatccgg tatcagtggg catagcagtt atgctggggg ttggggctgt 8100 agcagcacac aacgcaattg aagccagtga gcagaagaga acactactta tgaaagtttt 8160 tgtaaagaac ttcttggacc aagcagccac agatgaacta gtcaaagaga gccctgagaa 8220 aataataatg gccttgtttg aagcagtgca aacagtaggc aatcctctta ggctagtgta 8280 ccacctttac ggggtttttt ataaagggtg ggaagcaaaa gagttggccc aaaggacagc 8340 cggcaggaat cttttcacct tgataatgtt tgaggccgtg gaactattgg gagtagatag 8400 cgaaggaaaa atccgccaac tatcgagtaa ttacatatta gagctcctgt ataagttccg 8460 tgacagtatc aaatctagtg tgagggagat agcaatcagc tgggcccctg ccccctttag 8520 ttgcgattgg acaccaacag atgacagaat agggcttccc cataacaatt acctccaaat 8580 ggagacaaga tgcccttgtg gctacaggat gaaagcagta aaaacctgtg ctggggagtt 8640 gagacttctg gaagagggag gttcattcct ctgcaggaat aaattcggta gagggtcacg 8700 gaactatagg gtgacaaaat actatgatga caatttatca gaaataaaac cagtgataag 8760 aatggaagga catgtggaac tatattataa gggggccact atcaaactgg actttaacaa 8820 cagtaaaaca gtactggcaa ccgacaaatg ggaggttgac cattccaccc tggtcagggc 8880 gctcaagagg cacacagggg ctgggtacca aggagcgtat atgggtgaga aacctaacca 8940 caacatctg atagagagag actgtgcaac gatcacaaa haaggtttt acttcatca 9000 gatgaagagg gggtgtgcgt tcacttatga cttgtccctc cacaacctca cccggttaat 9060 cgaattgta cacaaaacg acctggaaga tagagaatc cctgctgtta cggttacaac 9120 ctggctggcc tacacattg tgaatgaga catagggacc ataaaccag ttttgggga 9180 aaagtaaca ccggaaaac aggaggt agccttgcag cctgctgtgg tggtggacac 9240 aacagatgtg gccgtgaccg tggtgggg aacctctact atgactacag gggagacccc 9300 aacggcattc accagcttag gttcagactc taaagttca caagttctga agttaggggt 9360 ggatgaggggt caataccccg ggcccagtca gcagagagca agcttgctcg acgctataca 9420 aggcgtggat gaaaggccct cggtattgat attgggatct gataaggcca cctccaatag 9480 ggtgaagacc gcaagaatg tcagatatt caggacaga gaccccctgg aactgagaga 9540 aatgatgaga agagggaga tcctggtcat agccctatgt aaggtcgaca ctgctctact 9600 gaaatttgtt gattacaaag gcaccttcct gaccagagaa accctagagg cattaagtttt 9660 gggtaagcct aagaaaaaaa acataaccaa gacagaggca caatggttgt tgtgcctcga 9720 aaaccaaata gaagagctgc ctgactggtt cgcagctgag gagcccgtat ttctggaagc 9780 aacatcaaa cgtgacaagt atcacctagt gggggatata gctactatca aagaaaaagc 9840 taaacaactg ggggcaacag actccacaaa gatatcaaaa gaggttggag ctaaagtata 9900 ttctatgaag ctgagtaact gggtgataca aagaagagaat aaacagggca gcttagcccc 9960 tttgtttgaa gagctcctgc aacagtgccc acctggggc cagaataaaa ccacacatat 10020 ggtctcagcc taccaactgg ctcaagggaa ctggatgcca gttggttgtc acgtgttcat 10080 ggggaccata cccgccagaa gaaccaagac ccatccctat gaggcatacg tcaagctgag 10140 ggagttggta gatgaatata agatgaaac gctatgtggc ggttcaggcc tagtaagca 10200 caacgaatgg gtaattcgta agatcaagca tcaagggaac ctgaggacca aacacatgtt 10260 gaacccgggg aaggttgcag agcaactgct tagagaagga cagacaca atgtatataa 10320 taagactata ggctcagtga tgacagcaac tggtatcagg ctggaaaagt taccccgtggt 10380 caggggcccaa acagacaaaaaaaaaagaaaaagaaagga 10440 agagaactta cagactccag gcttacaca gagttaatg gaagtctctca atgcattaaa 10500 aagacccgat cttgaggcct cttacgacgc tgtggagtgg gaggaattgg agaaggaat 10560 aaataggaag gtgctgcag gttctttga acacagaat ataggagg ttctggattc 10620 agaaaaaaac aaggttgaag agatcataga cagttttgaga aaggtagga gtatcaggta 10680 ctatgaaact gcaatcccaa aaacgagaa gagggacgtc atgatgact ggactgccgg 10740 tgacttgta gacgagaaaa agcccagggt gatacatac cctgaggcta aaaccaggtt 10800 ggccatcact aaagtaatgt acagtggt gaagcagaaa ccagtagtca tacccggcta 10860 tgaagtaag acaccctgt tccaaatctt tgacaagtg aagaagaat gggaccaatt 10920 ccaaaatcca gtggctgtga gcttgacac caaagcgtgg vakacccagg tgactacagg 10980 agacctggaa ctaataagggg atacagaa gttctacttc aagagaagt ggcacaaatt 11040 cattgacacc ctaaccatgc acatgtcaga agtacccgta attagtgccg acggggaggt 11100 gtacataagg aaggggcaga gaggcagtgg acaacctgat acgagcgcag gcaacagcat 11160 gttgaatgta ttaacaatgg tttatgcctt ctgtgaggcc acgggagtgc cctataagag 11220 ttttgacaga gtggcaaaga tccacgtctg cggggatgat ggtttcttga tcactgaaag 11280 ggctcttggt gaaaaatttt cgagtaaagg agtccagatc ctatatgaag ctggtaagcc 11340 ccaaaaaatt acagaagggg ataagatgaa agtggcctac cagtttgatg acatcgagtt 11400 ctgctcccat acaccagtgc aagtaaggtg gtcagacaat acttccagtt atatgccggg 11460 gaggaacacg actacaatcc tggcaaaaat ggctacaagg ttagattcca gtggtgagag 11520 gggcactata gcatatgaga aggcggtggc gtttagcttc ttatgatgt actcctggaa 11580 cccactgatc agaaggatat gcttactggt gttgtcaact gaactgcaag tgagaccagg 11640 gaagtcaacc acctattact atgaagggga cccaatttct gcttacaagg aggtcatagg 11700 ccataatctc tttgacctta aaagaacaag ctttgagaaa ctagctaagt taaatcttag 11760 tatgtccaca ctcggggtat ggaccagaca caccagcaaa agattactac aagactgtgt 11820 caacgtcggc actaaagagg gcaactggct ggttaatgca gacagactgg tgagtagcaa 11880 gacaggaaat aggtatatac ctggagaggg tcatacccag caagggaaac attatgaaga 11940 actgatattg gcaaggaagc cgatcagcaa ttttgaaggg actgatagat acaatttggg 12000 cccaatagtc aacgtagtgt tgaggaggct gagagtcatg atgatggctc ttataggaag 12060 gggggtgtaa gcatggccgg cccttaaccg ggccctatca gtagaaccct gttgtaaata 12120 acactaactt attatttatt taaatactat tatttattta tttatttatt tattgaatga 12180 gcaaggattg gtacaaacta cctcatgtta ccacactaca ctcattttaa cagcacttta 12240 gctggaggga aaatcctgac gtccatagtt ggactaaggt aatttcctaa cggccc 12296 <210> 22 <211> 12299 <212> DNA <213> Artificial Sequence <220> <223> GD18-wt <220> <221> misc_feature <222> (12256)..(12256) <223> n is a, c, g, or t <400> 22 gtatacgagg ttagttcgtt ctcgtgtaca atattggaca agaccaaaat tccgatttgg 60 cctagggcac ccctccagcg acggccgac tgggctagcc atgcccacag taggactagc 120 aaacggaggg actagccgta gtggcgagct ccctgggtgg tctaagtcct gagtacagga 180 cagtcgtcag tagttcgacg tgagcaggag cccacctcga gatgctatgt ggacgagggc 240 atgcccaaga cacaccttaa ccctggcggg ggtcgccagg gtgaaatcac accatgtgat 300 gggggtacga cctgataggg tgctgcagag gcccactaac aggctatt aaaaaatctc 360 tgctgtacat ggcacatgga gttgaatcat tttgaactac tatacaaac aataaacaa 420 aaaccaatag gagtggagga accggtgtat gatacgcag gagaccatt ttcggggac 480 ccaagtgagg tacaccaca atcacactg aagctgccac atgacagggg gagaggtaat 540 atcagaacta cactgaagaa cctacctagg aaaggcgact gtaggagtgg aaaccaccta 600 ggaccagtca gtgggatata tgtaaaaccc ggccctgtct tctatcagga ctacatgggc 660 cctgtctatc atagagctcc attggagttt ttgaagagg cccagctgtg tgaggtgact 720 aagagaatag gtagggtgac gggtagtgat gggaagcttt accacatata tgtgtgcatt 780 gacggttgca tactgctgaa gttagccaaa aggggcacgc ctagatccct aaagtggact 840 aggaacttca ccgactgtcc actatgggtc actagttgtt ctgatgatgg cgcaggtggc 900 agcaaggata agaaaccaga caggatgaac aagggtaaat taaaatagc cccaaaagag 960 catgagaagg acagcaaaac caagccacct gatgccacga tcgtggtaga gggagtaaaa 1020 taccaagtga aaaagaaagg caaagtcaaa gggaagaaca ctcaagatgg cctataccat 1080 aataagaaca aaccaccaga gtccaggaag aaactagaaa aagccctact ggcttgggca 1140 gtgataacaa tcgtactgta ccagcctgta gcggccgaga atataactca gtggaacctg 1200 agtgacaatg gcacaagcgg tatccagcaa gccatgtatc ttagaggggt tataggagt 1260 ctacatggga tctggcctga aaaaatatgc aaaggggtcc ctactcacct ggctactgat 1320 acggagctga cagagatacg agggatgatg gacgccagcg agaggacaaa ctatacgtgt 1380 tgcaggttgc agagacacga atggaataaa catggatggt gtaactggta caacatagac 1440 ccctggattc aattaatgaa caggacccaa gcaaatctga cagaaggccc cccggataag 1500 gagtgcgccg tgacttgcag gtatgacaaa aatgctgacg ttaacgtggt cacccaggcc 1560 aggaatagac caaccactct gaccggctgc aagaaaggaa aaaacttttc atttgcaggt 1620 acgattatag agggcccatg caatttcaac gtctccgtgg aggacatcct atatggggac 1680 catgagtgtg gcagcctgtt ccaggacaca gctctgtacc tattagatgg aatgaccaac 1740 actatagaga aagccaggca gggtgcggca agagttacat cctggcttgg gaggcaactc 1800 agcaccacag ggaagaagtt ggagagagga agcaaaacct ggttcggcgc ctacgccctg 1860 tcaccttact gtaacgtaac aaggaaagtg gggtacatat ggtatacgaa caattgcact 1920 ccggcatgtc tcccaaaaaa cacgaaaata ataggtccag gaaaattcga taccaacgcg 1980 gaagatggga agatacttca tgaaatgggg ggccacctat cagaattttt gttgctttct 2040 ttagtaatcc tgtctgactt cgccccggag acggccagta cgctatacct aatcttacac 2100 tatgcaatcc ctcagtccca tgaagagcct gaaggttgcg atacgaacca gctcaatcta 2160 acagtgggac ttaggacaga agatgtggta ccatcatcag tttggaatat cggcaaatat 2220 gtgtgtgtca gaccagactg gtggccgtat gaaactaagg tggctttgct gtttgaggag 2280 gcaggacagg ttataaaact agctctacgg gcactgagag atttaactag agtctggaac 2340 agtgcatcaa ctactgcgtt cctcatctgc ttgataaaaa tattaagagg acaggttgtg 2400 caaggtataa tatggctgct gctggtaact ggggcacaag ggcggttgac ctgtaaggaa 2460 gactacaggt atgcgatatc atcaaccaat gagatagggc cgcttggagc tgaaggtctc 2520 actaccacct ggaaagaata caaccatggt ttacagctgg atgacgggac tgtcagggcc 2580 acttgcactg cagggtcctt taaagttata gcacttaatg tggttagtag gaggtacctg 2640 gcatcattac acaagagggc tttgcccacc tcagtaacat ttgaactcct atttgatggg 2700 accagcccag taattgagga gatgggagac gactttggat ttgggctgtg cccttttgac 2760 acgatccctg tggtcaaagg gaagtataac accaccttat taaacggcag tgctttctat 2820 ctagtctgcc ctataggatg gacgggtgtt atagagtgca cggcagtaag ccccacaacc 2880 ttgagaacag aagtggtgaa gaccttcaag agagagaagc cttccctca cagagtggac 2940 tgcgtgacca ctatagtaga aaaagaagac ctgttctatt gcaggctggg gggtaattgg 3000 acatgcgtga aaggtgaccc ggtgacctac acggggggcc aagtaaaaca atgcaggtgg 3060 tgcggttca acttcaagga gcctgatggg ctcccacact accccatagg caagtgcatc 3120 ctagcaaatg agacgggata cagggtagtg gactccacag actgcaacag agacggcgtc 3180 gtcatcggca ctgaaggaga gcatgagtgc ttgatcggca acaccaccgt caaggtgcac 3240 gcgctggacg gaagactggc ccctatgcct tgcagaccca aagaaatcgt atctagtgcg 3300 ggacctgtaa ggaaaacttc ctgcacattt aactatacaa agactttgag gaacaagtac 3360 tatgagccca gggacagcta cttccagcaa tacatgctta agggcgagta tcaatactgg 3420 tttgatctgg acgtgacaga ccaccacaca gactacttcg ccgagtttgt tgtctttggtg 3480 gtagtggcac tattaggggg aaggtacgtc ctgtggctaa tagtgaccta tatagttcta 3540 acagagcaac tcgctgctgg tttacagcta ggccagggcg aggtggtgct gatagggaac 3600 ttaatcaccc acatggacaa cgaggtagtg gtatacttct tactgcttta cctaataata 3660 agagacgagc ccataaagaa atggatacta ctgctgttcc atgccatgac caacaaccca 3720 gttaagacca tgacagtagc attgctaatg ataagcgggg tagccaaggg tgggaaaata 3780 gatggtggtt ggcagaggca gccggagacc aattttgaca tccaattcgc actggcagtc 3840 ataatagtcg tcgtgatgtt gttggcaaag agagatccga ctacttttcc cctggtgatc 3900 actgtggcaa ccttgagaac ggctaagata accagtggtt tcagcacaga tctagccata 3960 gccacagtgt cggcaacttt gctaacctgg acttatatca gtgactacta caaatacaag 4020 acttggctac agtacctcat cagcacggtg actggaattt ttctgataag ggtactgaag 4080 ggggtcggcg agttggacct acacgccccg actctgccat cccacagacc ccttttctac 4140 atccttgtgt acctcatctc cactgccgtg gtaacgagat ggaacttgga cgtagccgga 4200 atactgctac agtgcgcccc aacacttcta atggtattca cgatgtgggc tgacatcctc 4260 accctaattc tcatactgcc cacctatgag ttgacaaagt tatattacct taaggaagtg 4320 aagataggga ctgaaagagg atggctgtgg aaaactaatt acaagagggt aaatgacatc 4380 tatgaagtcg accaagctgg cgaaggggtt tacctcttcc cttcgaaaca aaagactgga 4440 gctataacga gcaccgtgtt gccgttgatc aaagccatac tcattagctg catcagtaac 4500 aagtggcaat tcatatattt actgtacttg atatttgagg tgtcctacta ccttcacaag 4560 aaaatcatag atgagatagc cggcgggacc aacttcgttt cgagactagt ggcggcttta 4620 attgaagtta attgggctct agacaatgaa gaagtcaaag gcctaaagaa gtttttcttg 4680 ttgtctagta gggtcaaaga gttggttatc aaacacaaag tgaggaatga agtaatggtc 4740 cgctggtttg aagatgaaga gatctacggg atgccaaagc tgatcggcct ggttaaggca 4800 gcaacactga gcaaaaacaa acactgtatt ttgtgcaccg tctgtgagga cagagattgg 4860 cggggagaaa cttgcccgaa atgcgggcgt tttggaccac cagtgatctg tggtatgacc 4920 ctagctgact tcgaggaaaa acactataag aggattttca tcagggagga ccaatcagac 4980 gggccgctca gggaggagca tgcagggtac ttgcagtaca aagctagggg tcaattgttt 5040 ctgaggaatc tcccagtgtt ggcaacaaaa gtcaagatgc ttctggttgg caacctaggg 5100 acagaggttg gggacctgga gcaccttggc tgggtgctca gagggcccgc tgtctgcaag 5160 aaggttactg aacatgaaaa gtgtgctacg tctataatgg ataagttgac tgccttcttt 5220 ggtgtcatgc caaggggtac cacccccaga gctcctgtaa gatttcccac ctcccttcta 5280 aagataagaa gagggctgga gacgggttgg gcttatacac accaaggcgg tatcagctca 5340 gttgaccatg ttacttgcgg gaaagacctg ctagtgtgtg acaccatggg tcggacaagg 5400 gttgtctgcc aatcgaataa caagatgact gacgagtctg aatacggagt caaaacccgac 5460 tcagggtgcc cagagggagc caggtgctac gtgttcaacc ctgaggcagt taatatca 5520 ggcactaaag gagccatggt ccacttacag aaaactggtg gagaattcac ctgtgtaaca 5580 gcatcaggga ccccagcttt cttcgatctc aagaacctca agggttggtc agggctaccg 5640 atatttgaag catcgagtgg aagggtagtc ggaagggtca aggtcgggaa gaacgaagac 5700 tctaaaccaa ccaactcat gagtgggata caaacggtct ctaaaagtgc cactgattg 5760 acggagatgg tgaagagat aaaaccatg aacagggggg agttcagaca ataaccttg 5820 gccacaggtg ctggaaaaac tacagagcta cccaggtcag tcatagaaga gatagggaga 5880 cacaaaggg tgctgtatt gatccccctt agggccgcag cagaatcagt attackacatac 5940 acaccgag tagcattc aacctgagg tagggagat ggaggaagg 6000 tacatggcca cgggaataac ctatgcttct tatggttact tttgccagat gccacaaccc 6060 aagttgagag ccgcaatggt agagtattcc tacatctttc tagacgagta ccattgcgcc 6120 accccggaac aattggctat catggggaag atccacagat tctcagagaa cctgcgggtg 6180 gtcgctatga cagcgacgcc ggcaggcacg gtaacaacta ctgggcagaa acaccctata 6240 gaggagttca tagccccgga agtgatgaaa gagagact taggttcaga gtacttagac 6300 atcgccggac tAAagatacc agtagaggag atgagaac acatgctagt tttgtacca 6360 actaggaaca tggcagtgga ggcggcaag aaattgaag ccaaggata taactcaggc 6420 tattactaca gtggtgagga cccatccac ctgaggtag ttacatcgca gtcccatac 6480 gtggtggtag cgaccacgc atagaatca ggcgtcactc tcccagacct tgatgtggtc 6540 gttgacacag gactcaagtg tgagaaaga atccgactgt cacccagat gcctttcata 6600 gtgactggcc tgaaagaat ggccgtcact attgggac aagcccagag agagggagg 6660 gttggaagag taaagcccgg gagatactac aggagccaag aaactccagt cggctctaag 6720 gactaccact atgacttgct gcaagcccaa aggtacggta tagagatgg gataataatc 6780 accaaatcct tcagagagat gaactacgat tggacctttt atgaggaag tagcctgatg 6840 atacacaac tggaatcct siacaatctg ttgatatcag aggagctgcc ggtagcagta 6900 aaaaatataa tggctaggac tgaccaccca gaaccattc aactagcgta taatagctac 6960 gagacacagg taccagtgtt gttcccaag ataaggaatg gagaggtgac tgacacttac 7020 gandactaca ccttcctcaa tgcaagaaaa ttgggagatg atgtaccccc ctatgtgtat 7080 gccacagaag atgaggactt ggcagtggaa ctgttaggcc tagattggcc agaccctgga 7140 aaccaaggca ctgtggaggc tggcagagca ctaaaacagg tggtcggcct atcaacagcc gagaatgccc tgctagtggc cttgtttggc tacgtagggt accaggccct ctcaaaaagg 7260 catatacctg tagtcacaga catatattca gttgaagatc acaggttgga agatacaaca cacctacagt atgccccgaa cgccatcaag acggagggga aggagactga attgaaggag 7380 ttggctcaag gggatgtgca gagatgtgtg gaagcagtgg ccaattatgc gagtgagggc atccaattta ttaagtcaca ggcactgaag gtgagagaga ccccgactta caaagagaca atgaatacag tggcagacta tgtgaaaaag ttcattgagg cactgtcaga tagcaagga 7620. gacatcttga aatatgggct gtggggtgta cacacggcct tgtataagag cattggtgcc agactaggtc acgaaactgc gttcgcaact ttagtcgtga aatggttggc atttgggggg 7680 7740. gccacagact tggttgttta ctatattatc aacagacctc aattcccagg ggacacggag acacaacaag aagggagga atttgtggcc agcttactgg tctcagccct agcacctac acatacaaaa gctggacta cacaatctg tccaagatag ttgaacctgc tttggccact ttgccctacg ccgccaaagc ccttaaatta 7920 ttcgccccta cccgactgga gagcgtcgtc atattgagca ccgcaatcta caaaacatat 7980 ctatcaatca ggcgaggcaa aagtgatgga ttgcttggta caggggttag tgcggctatg 8040 gagattatgt cacaaaatcc agtatcagtg ggcatagcag tcatgctggg ggttggggct 8100 gtagcagccc ataatgcaat tgaagccagt gagcagaaga gaacactact aatgaaagtc 8160 tttgtgaaaa acttcttgga ccaagcagcc acggatgaac tagtcaaaga gagccctgag 8220 aaaataataa tggccctgtt tgaagcagtg cagacggtag gcaaccctct cagactggtg 8280 taccacctat atggagtttt ttataaaggg tgggaagcaa aagagttggc ccaaaggaca 8340 gccggcagga acctcttcac cttaataatg ttcgaggctg tggaactact gggagtagat 8400 agtgaaggga aaatccgcca gctctcaagt aactacatat tagagctcct gtacaagttc 8460 cgtgacgaca tcaaatctag tgtgagggag atagcaatca gttgggcccc tgcccccttc 8520 agctgcgact ggacaccaac agatgacaga ataggacttc cccatgacaa ttatctccag 8580 atggagacaa gatgtccttg tggttacagg atgaagcag taaaaacctg tgccgggg 8640 ttgagactcc tggagggg gggttcattc ctctgcagga ataattcgg cagagggtca 8700 cggaattta gggtgacaaa attatgat xaacttat cagaataa accagtgata 8760 agaatggaag gandacgtgga actgtatcat aaaggggcca ctttcaact ggactttgac 8820 aacagtaaaa cagtactggc aacagataga tgggagtcg accattccac cctgatcagg 8880 gtgctcaaga ggcacacagg ggctggattt caggggcgt atctgggtga gaaacccaat 8940 cacaagcacc tgatagagag agactgtgca acgatcacaa aagacaaggt ctgcttcatc 9000 aaaatgaaga gggggtgcgc gttcacctat gacttatcac tccacacct tacccggct 9060 atcgaattgg tacatagaa cacctggat gagagaaa tccctgccgt tacggtcaca 9120 acctggctgg cctacacatt cgtgaatgaa gatagga ccataaaacc agtcttcggg 9180 gaaaagtaa caccggagaa gcaggaggag gtagccttgc agcctgcagt ggtggtggac 9240 acacagatg tggccgtgac cgtggtgggg gaaacctcca ctatgaccac agggagacc 9300 cccacaatat ttaccagctt aggttcggac tctaagtttc aacaagtcct gaaactgggg 9360 gtggatgagg gtcaatcc cggggcccagg cagcagagag caagtttgct cgaagctgta 9420 caggtgtag atgagaggcc ctcggtacta atattggggt ctgataaggc cacctccaat 9480 agggtgaga ccgcaagaa tgtgagata ttcaggagca gagaccccct ggaactgaga 9540 gagatgatga gagaggga gatcctaatc atagccctgt gtaggtgga caccgctctg 9600 ctgaaatttg ttgattacaa aggtaccttc ctgaccagag agacctaga ggcattaagt 9660 ctgggcaaac ctaagaaaag agacatact aagacagagg cacgatggtt gttgtgccctc 9720 gaaggtcaat tagagagct gcctgactgg tttgcagcca aggagccat attcttagaa 9780 gccaacatca aacgtgacaa gtatcatctg gtgggagaca tagctacaat caaaaaaa 9840 gccaagcaac tgggggcaac agactccaca aagatatcaa aagaggttgg cgcgaaagtg 9900 tattctatga agttgagtaa ctgggtgata caggagaga ataacaggg cagcttaacc 9960 cccttgtttg aagagctccct gcaacagtgc ccgcccgggg gccagaataa aaccacat 10020 atggcctcag cctaccaatt ggctcagggg aactggatgc cagttggttg ccacgtgttc 10080 atggggacca tacccgctag aagaaccaag actcatccct acgaggcata tgtcaagttg 10140 agggagttgg tggagaca tagatgaag acatcatgtg gcggttcagg cctatgtaag 10200 cacaacgaat gggtattcg windowcag catcaaggga acctgaggac cacacacatg 10260 ctgaaccccg gaagattgc tgagcaactg gagagaag ggcacagaca caatgtgtac 10320 aacaagacca taggctcagt aatgacagcg actggcatca ggctggaaaa gttacccgtg 10380 gttagagccc agacagatac aactaatttc caccaagcaa tagggaata atagacaag 10440 gagagaacc tacagacccc aggcttacac agaagttaa tggaggtatt caatgcatta 10500 aaagacctg agcttgaggc ctcttacgac gccgtggagt gggaggatt ggagagagga 10560 aaatagga agggtgctgc agggttctc gaacgcaaga ataggaga ggtcctagat 10620 tcagaaaaat aataggttga agagatcata gaagttttga agaaggtag gagtattaaa 10680 tattatgaaa ctgcaatccc aaagaacgaa aagagggatg tcaatgatga ctggactgcc 10740 ggagactttg tggatgagaa aaaacccagg gtgatacaat atcctgaggc caaaaccagg 10800 ttagccatca ctaaagtgat gtataagtgg gtgaaacaga aaccagtagt catacccggc 10860 tatgaaggta agacacctct gttccaaatt tttgacaaag tgaaaaaaga atggaaccaa 10920 ttccaaaatc cagtggcagt gagctttgac actaaagcat gggataccca ggtgactaca 10980 agagacctgg aactaataag ggatatacag aagttctatt tcaagaagaa gtggcacaaa 11040 ttcatcgaca ccctaaccat gcacatgtca gaagtacccg tgattagtgc cgacggggag 11100 gtgtatataa ggaaagggca gagaggcagt gggcaacctg atacgagcgc aggcaacagt 11160 atgctgaatg tgttaacaat ggtttatgcc ttctgtgagg ccacggggt accctataaa 11220 agtttcgaca gagtggcaaa gatccacgtc tgtggggatg atggcttctt gattactgaa 11280 agggctcttg gtgaaaaatt tgcaagtaga ggagtccaga tcctatatga agccgggaag 11340 ccccaaaaaa tcactgaagg ggacaatatg aaagtggcct atcagtttga cgacatcgag 11400 ttctgctccc atacaccagt gcaggtaagg tggtcagaca acacctccag ttacatgccg 11460 gggaggaaca caaccacaat actggcaaaa atggctacaa ggttggattc cagtggtgag 11520 agaggcacta tagcatatga gaaggcagtg gcattcagtt tcttgttgat gtactcctgg 11580 aacccactga ttagaaggat atgcttattg gtgttatcaa ctgaaatgca agtgagacca 11640 gggaagtcaa ccacctatta ctatgaagga gacccaatat ctgcttacaa ggaggtcatc 11700 ggccataatc tctttgacct taaaagaaca agtttcgaga agctagctaa gctaaatctt 11760 agtatgtcca cactcggggt atggaccagg cataccagca aaagattact acaagactgt 11820 gtcaatgtcg gcaccaaaga gggcaactgg ctggttaacg cagacagact ggtgagtagt 11880 aagacaggga ataggtatat acctggagag ggtcataccc aacaaggaaa acattatgaa 11940 gagctggtat tggcaagaaa accgaccagt aattttgaag ggactgatag atataatttg 12000 ggcccaatag tcaacgtagt gttgaggagg ctgagagtca tgatgatggc tcttatagga 12060 aggggggtgt gagagcggcc ggctcttgac cgggccctat cagtataacc ctgttgtaaa 12120 taacactaac ttattattta tctagacact actatttatt tatttattta tttattgaat 12180 gagcaaggaa tggtacgaac tacctcatgt taccacacta cactcatttt aacagcactt 12240 tagctgagga aaaaantcct gacgtccata gttggactaa ggtaatttcc taacggccc 12299 <210> 23 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> Mutated E2 of QZ07 with KRD <400> 23 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Ile Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 24 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> E2 with mutated KARD of QZ07 <400> 24 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Ala Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Ile Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 25 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> E2 with RD mutation of QZ07 <400> 25 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Ile Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 26 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> E2 with RD mutation of GD18 <400> 26 Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asp 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 27 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> Mutated E2 of GD18 with KRD <400> 27 Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asp 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 28 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> GD18 has a mutated E2 of KARD <400> 28 Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Ala Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asp 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 29 <211> 373 <212> PRT <213> Artificial sequence <220> <223> C-strain E2 <400> 29 Arg Leu Ala Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asp 1 5 10 15 Glu Ile Gly Leu Leu Gly Ala Gly Gly Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Asp Leu Gln Leu Asn Asp Gly Thr Val Lys Ala Ser Cys 35 40 45 Val Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Lys Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Asn Pro Ser Thr Glu Glu Met Gly Asp 85 90 95 Asp Phe Arg Ser Gly Leu Cys Pro Phe Asp Thr Ser Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Arg Arg Asp Lys Pro 145 150 155 160 Phe Pro His Arg Met Asp Cys Val Thr Thr Thr Val Glu Asn Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Glu 180 185 190 Pro Val Val Tyr Thr Gly Gly Val Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Asp Gly Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Ile Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Ser His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Ser Asp Glu Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Lys Asn 290 295 300 Arg Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala Thr Asp Arg His Ser 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 30 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> E2 with RD mutations in C strain <400> 30 Arg Leu Ala Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asp 1 5 10 15 Glu Ile Gly Leu Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Asp Leu Gln Leu Asn Asp Gly Thr Val Lys Ala Ser Cys 35 40 45 Val Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Lys Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Asn Pro Ser Thr Glu Glu Met Gly Asp 85 90 95 Asp Phe Arg Ser Gly Leu Cys Pro Phe Asp Thr Ser Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Arg Arg Asp Lys Pro 145 150 155 160 Phe Pro His Arg Met Asp Cys Val Thr Thr Thr Val Glu Asn Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Glu 180 185 190 Pro Val Val Tyr Thr Gly Gly Val Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Asp Gly Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Ile Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Ser His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Ser Asp Glu Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Lys Asn 290 295 300 Arg Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala Thr Asp Arg His Ser 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 31 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> E2 with KRD mutations in C strain <400> 31 Arg Leu Ala Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asp 1 5 10 15 Glu Ile Gly Leu Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Asp Leu Gln Leu Asn Asp Gly Thr Val Lys Ala Ser Cys 35 40 45 Val Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Lys Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Asn Pro Ser Thr Glu Glu Met Gly Asp 85 90 95 Asp Phe Arg Ser Gly Leu Cys Pro Phe Asp Thr Ser Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Arg Arg Asp Lys Pro 145 150 155 160 Phe Pro His Arg Met Asp Cys Val Thr Thr Thr Val Glu Asn Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Glu 180 185 190 Pro Val Val Tyr Thr Gly Gly Val Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Asp Gly Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Ile Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Ser His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Ser Asp Glu Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Lys Asn 290 295 300 Arg Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala Thr Asp Arg His Ser 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 32 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> E2 of C strain with mutated KARD <400> 32 Arg Leu Ala Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asp 1 5 10 15 Glu Ile Gly Leu Leu Ala Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Asp Leu Gln Leu Asn Asp Gly Thr Val Lys Ala Ser Cys 35 40 45 Val Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Lys Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Asn Pro Ser Thr Glu Glu Met Gly Asp 85 90 95 Asp Phe Arg Ser Gly Leu Cys Pro Phe Asp Thr Ser Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Arg Arg Asp Lys Pro 145 150 155 160 Phe Pro His Arg Met Asp Cys Val Thr Thr Thr Val Glu Asn Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Glu 180 185 190 Pro Val Val Tyr Thr Gly Gly Val Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Asp Gly Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Ile Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Ser His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Ser Asp Glu Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Lys Asn 290 295 300 Arg Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala Thr Asp Arg His Ser 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 33 <211> 330 <212> PRT <213> Artificial Sequence <220> <223> Truncated and KRD - mutated E2 of QZ07 <400> 33 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 34 <211> 330 <212> PRT <213> Artificial sequence <220> <223> QZ07 truncated and E2 with KARD mutation <400> 34 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Ala Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 35 <211> 330 <212> PRT <213> Artificial sequence <220> <223> Truncated and RD-mutated E2 of QZ07 <400> 35 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 36 <211> 330 <212> PRT <213> Synthetic Sequence <220> <223> GD18-truncated and RD-mutated E2 <400> 36 Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asp 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 37 <211> 330 <212> PRT <213> Synthetic Sequence <220> <223> GD18 Truncated and Mutated E2 with KRD <400> 37 Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asp 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 38 <211> 330 <212> PRT <213> Artificial sequence <220> <223> GD18 truncated and E2 with KARD mutation <400> 38 Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Ala Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asp 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 39 <211> 331 <212> PRT <213> Artificial sequence <220> <223> C strain truncated and E2 with RD mutation <400> 39 Arg Leu Ala Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asp 1 5 10 15 Glu Ile Gly Leu Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Asp Leu Gln Leu Asn Asp Gly Thr Val Lys Ala Ser Cys 35 40 45 Val Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Lys Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Asn Pro Ser Thr Glu Glu Met Gly Asp 85 90 95 Asp Phe Arg Ser Gly Leu Cys Pro Phe Asp Thr Ser Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Arg Arg Asp Lys Pro 145 150 155 160 Phe Pro His Arg Met Asp Cys Val Thr Thr Thr Val Glu Asn Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Glu 180 185 190 Pro Val Val Tyr Thr Gly Gly Val Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Asp Gly Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Ile Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Ser His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Ser Asp Glu Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Lys Asn 290 295 300 Arg Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala 325 330 <210> 40 <211> 331 <212> PRT <213> Artificial sequence <220> <223> C strain truncated and E2 with KRD mutation <400> 40 Arg Leu Ala Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asp 1 5 10 15 Glu Ile Gly Leu Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Asp Leu Gln Leu Asn Asp Gly Thr Val Lys Ala Ser Cys 35 40 45 Val Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Lys Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Asn Pro Ser Thr Glu Glu Met Gly Asp 85 90 95 Asp Phe Arg Ser Gly Leu Cys Pro Phe Asp Thr Ser Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Arg Arg Asp Lys Pro 145 150 155 160 Phe Pro His Arg Met Asp Cys Val Thr Thr Thr Val Glu Asn Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Glu 180 185 190 Pro Val Val Tyr Thr Gly Gly Val Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Asp Gly Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Ile Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Ser His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Ser Asp Glu Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Lys Asn 290 295 300 Arg Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala 325 330 <210> 41 <211> 331 <212> PRT <213> Artificial sequence <220> <223> C strain truncated and E2 with KARD mutation <400> 41 Arg Leu Ala Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asp 1 5 10 15 Glu Ile Gly Leu Leu Ala Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Asp Leu Gln Leu Asn Asp Gly Thr Val Lys Ala Ser Cys 35 40 45 Val Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Lys Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Asn Pro Ser Thr Glu Glu Met Gly Asp 85 90 95 Asp Phe Arg Ser Gly Leu Cys Pro Phe Asp Thr Ser Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Arg Arg Asp Lys Pro 145 150 155 160 Phe Pro His Arg Met Asp Cys Val Thr Thr Thr Val Glu Asn Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Glu 180 185 190 Pro Val Val Tyr Thr Gly Gly Val Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Asp Gly Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Ile Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Ser His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Ser Asp Glu Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Lys Asn 290 295 300 Arg Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala 325 330 <210> 42 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> GD191 E2 <400> 42 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Thr Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Thr Pro Ala Val Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Lys 130 135 140 Asp Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Val Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Ile Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Ile Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 43 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> GD191 with mutated E2 having RD <400> 43 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Thr Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Thr Pro Ala Val Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Lys 130 135 140 Asp Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Val Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Ile Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Ile Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 44 <211> 373 <212> PRT <213> Artificial sequence <220> <223> E2 with a mutated KRD of GD191 <400> 44 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Thr Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Thr Pro Ala Val Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Lys 130 135 140 Asp Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Val Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Ile Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Ile Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 45 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> E2 with a Mutation of KARD in GD191 <400> 45 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Ala Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Thr Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Thr Pro Ala Val Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Lys 130 135 140 Asp Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Val Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Ile Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Ile Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 46 <211> 330 <212> PRT <213> Artificial sequence <220> <223> GD191 truncated and E2 with RD mutation <400> 46 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Thr Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Thr Pro Ala Val Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Lys 130 135 140 Asp Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Val Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Ile Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 47 <211> 330 <212> PRT <213> Artificial sequence <220> <223> GD191 truncated and E2 with KRD mutations <400> 47 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Thr Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Thr Pro Ala Val Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Lys 130 135 140 Asp Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Val Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Ile Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 48 <211> 330 <212> PRT <213> Artificial sequence <220> <223> GD191 truncated and E2 with KARD mutation <400> 48 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Lys Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Ala Ala Arg Asp Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Thr Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Thr Pro Ala Val Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Lys 130 135 140 Asp Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Val Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Ile Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp 325 330 <210> 49 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> 16aa Signal Peptide of Strain C <400> 49 Ile Val Gln Gly Val Val Trp Leu Leu Leu Val Thr Gly Ala Gln Gly 1 5 10 15 <210> 50 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> 21aa signal peptides of QZ07 and GD18 <400> 50 Ile Leu Arg Gly Gln Val Val Gln Gly Ile Ile Trp Leu Leu Leu Val 1 5 10 15 Thr Gly Ala Gln Gly 20 <210> 51 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> GD191 21aa signal peptide <400> 51 Val Leu Arg Gly Gln Val Val Gln Gly Val Ile Trp Leu Leu Leu Val 1 5 10 15 Thr Gly Ala Gln Gly 20 <210> 52 <211> 1095 <212> DNA <213> Artificial sequence <220> <223> QZ07-E2 DNA for BACULO expression <400> 52 atgatcctgc gtggtcaggt ggtccagggc atcatctggc tcctgctcgt gactggtgct 60 cagggaaggc tgtcttgcaa ggaagactac cgttacgcta tctccagcac caacgaaatc 120 ggacctctcg gtgctgaggg actgaccact acctggaagg agtacaacca cggactgcaa 180 ctggacgacg gtactgtgcg cgctatctgc accgccggtt ccttcaaggt catcgctctg 240 aacgtggtct cccgccgtta cctggctagc ctgcacaagc gtgccctgcc cacttctgtg 300 accttcgaac tgctgttcga cggtacctca ccagccatcg aggaaatggg cgacgacttc 360 ggcttcggac tgtgcccttt cgacactacc cccgtggtca agggaaagta caacactacc 420 ctgctgaacg gttccgcttt ctacctggtc tgccctatcg gatggactgg tgtgatcgag 480 tgcaccgccg tcagccccac taccctgagg actgaagtgg tcaagacctt caagagggag 540 aagcctttcc cccacagagt gggatgcgtc actaccgtgg tcgagaagga agacctgttc 600 tactgcaagt ggggtggcaa ctggacttgc gtgaagggca acccagtcac ctacatggga 660 ggtcaagtga agcagtgcag atggtgcgga ttcgacttca aggaacctga cggcctgccc 720 cactacccaa tcggaaagtg catcctggct aacgagactg gctacagggt ggtcgactcc 780 accgactgca acagagacgg tgtggtcatc agcaccgagg gcgaacacga gtgcctgatc 840 ggaaacacta ctgtgaaggt ccacgctctg gacggaaggc tgggaccaat gccttgccgt 900 ccaaaggaaa tcgtgtcttc agccggtcct gtccgcaaga cttcttgcac cttcaactac 960 actaagaccc tgaggaacaa gtactacgaa cctagagact catacttcca gcagtacatg 1020 ctgaagggcg agtaccagta ctggttcgac ctggacgcgg gttcgggtgg ctcaggtcat 1080 catcatcatc atcac 1095 <210> 53 <211> 1095 <212> DNA <213> Artificial Sequence <220> <223> QZ07 - E2 - KRD - DNA for BACULO - expression <400> 53 atgatcctgc gtggtcaggt ggtccagggc atcatctggc tcctgctcgt gactggtgct 60 cagggaaggc tgtcttgcaa ggaagactac cgttacgcta tctccaagac caacgaaatc 120 ggacctctcg gtgctagaga cctgaccact acctggaagg agtacaacca cggactgcaa 180 ctggacgacg gtactgtgcg cgctatctgc accgccggtt ccttcaaggt catcgctctg 240 aacgtggtct cccgccgtta cctggctagc ctgcacaagc gtgccctgcc cacttctgtg 300 accttcgaac tgctgttcga cggtacctca ccagccatcg aggaaatggg cgacgacttc 360 ggcttcggac tgtgcccttt cgacactacc cccgtggtca agggaaagta caacactacc 420 ctgctgaacg gttccgcttt ctacctggtc tgccctatcg gatggactgg tgtgatcgag 480 tgcaccgccg tcagcaagga caccctgagg actgaagtgg tcaagacctt caagagggag 540 aagcctttcc cccacagagt gggatgcgtc actaccgtgg tcgagaagga agacctgttc 600 tactgcaagt ggggtggcaa ctggacttgc gtgaagggca acccagtcac ctacatggga 660 ggtcaagtga agcagtgcag atggtgcgga ttcgacttca aggaacctga cggcctgccc 720 cactacccaa tcggaaagtg catcctggct aacgagactg gctacagggt ggtcgactcc 780 accgactgca acagagacgg tgtggtcatc agcaccgagg gcgaacacga gtgcctgatc 840 ggaaacacta ctgtgaaggt ccacgctctg gacggaaggc tgggaccaat gccttgccgt 900 ccaaaggaaa tcgtgtcttc agccggtcct gtccgcaaga cttcttgcac cttcaactac 960 actaagaccc tgaggaacaa gtactacgaa cctagagact catacttcca gcagtacatg 1020 ctgaagggcg agtaccagta ctggttcgac ctggacgcgg gttcgggtgg ctcaggtcat 1080 catcatcatc atcac 1095 <210> 54 <211> 1095 <212> DNA <213> Artificial sequence <220> <223> QZ07-E2-KARD-DNA for BACULO-expression <400> 54 atgatcctgc gtggtcaggt ggtccagggc atcatctggc tcctgctcgt gactggtgct 60 cagggaaggc tgtcttgcaa ggaagactac cgttacgcta tctccaagac caacgaaatc 120 ggacctctcg cagctagaga cctgaccact acctggaagg agtacaacca cggactgcaa 180 ctggacgacg gtactgtgcg cgctatctgc accgccggtt ccttcaaggt catcgctctg 240 aacgtggtct cccgccgtta cctggctagc ctgcacaagc gtgccctgcc cacttctgtg 300 accttcgaac tgctgttcga cggtacctca ccagccatcg aggaaatggg cgacgacttc 360 ggcttcggac tgtgcccttt cgacactacc cccgtggtca agggaaagta caacactacc 420 ctgctgaacg gttccgcttt ctacctggtc tgccctatcg gatggactgg tgtgatcgag 480 tgcaccgccg tcagcaagga caccctgagg actgaagtgg tcaagacctt caagagggag 540 aagcctttcc cccacagagt gggatgcgtc actaccgtgg tcgagaagga agacctgttc 600 tactgcaagt ggggtggcaa ctggacttgc gtgaagggca acccagtcac ctacatggga 660 ggtcaagtga agcagtgcag atggtgcgga ttcgacttca aggaacctga cggcctgccc 720 cactacccaa tcggaaagtg catcctggct aacgagactg gctacagggt ggtcgactcc 780 accgactgca acagagacgg tgtggtcatc agcaccgagg gcgaacacga gtgcctgatc 840 ggaaacta ctgtgaaggt ccacgctctg gacggaaggc tgggaccaat gccttgccgt 900 ccaaaggaaa tcgtgtcttc agccggtcct gtccgcaaga cttcttgcac cttcaactac 960 actaagaccc tgaggaacaa gtactacgaa cttagagact catacttcca gcagtacatg 1020 ctgaagggcg agtaccagta ctggttcgac ctggacgcgg gttcgggtgg ctcaggtcat 1080 catcatc atcac 1095 <210> 55 <211> 1152 <212> DNA <213> Artificial sequence <220> <223> C strain E2 - DNA for BACULO - expression <400> 55 atgatcgtgc aaggtgtggt atggctgtta ctagtaactg gggcacaagg ccggctagcc 60 tgcaaggaag attacaggta cgcaatatcg tcaaccgatg agatagggct acttggggcc 120 ggaggtctca ccaccacctg gaaggaatac aaccacgatt tgcaactgaa tgacgggacc 180 gtcaaggcca gttgcgtggc aggttccttt aaagtcatag cacttaatgt ggtcagtagg 240 agatatttgg cgtcattgca taagaaggct ttacccactt ccgtgacatt cgagctcctg 300 ttcgacggga ccaacccatc aactgaggaa atgggagatg acttcaggtc cgggctgtgc 360 ccgtttgata cgagtcccgt tgttaaggga aagtacaata cgaccttgtt gaacggtagt 420 gctttctatc ttgtctgccc aatagggtgg acgggtgtca tagagtgcac agcagtgagc 480 ccaacaactc tgaggacaga agtggtaaag accttcagga gagacaagcc ctttccgcac 540 agaatggatt gtgtgaccac cacagtggaa aatgaagatt tattctattg taagttgggg 600 ggcaactgga catgtgtgaa aggcgagcca gtggtctaca cagggggggt agtaaaacaa 660 tgtagatggt gtggcttcga cttcgatggg cctgacggac tcccgcatta ccccataggt 720 aagtgcattt tggcaaatga gacaggttac agaatagtag attcaacgga ctgtaacaga 780 gatggcgttg taatcagcac agaggggagt catgagtgct tgatcggtaa cacgactgtc 840 aaggtgcatg catcagatga aagactgggc cctatgccat gcagacctaa agagattgtc 900 tctagtgctg gtcctgtaag gaaaacctcc tgtacattca actacacaaa aactttgaag 960 aacaggtact atgagcccag ggacagctac ttccagcaat atatgcttaa gggtgagtat 1020 cagtactggt ttgacctgga tgcggaattc ggttccggag gctccggtga ctacaaagac 1080 catgacggtg attataaaga tcatgacatc gattacaagg atgacgatga caagcatcat 1140 caccatcacc at 1152 <210> 56 <211> 1152 <212> DNA <213> Artificial Sequence <220> <223> C Strain E2-KARD-DNA for BACULO Expression <400> 56 atgatcgtgc aaggtgtggt atggctgtta ctagtaactg gggcacaagg ccggctagcc 60 tgcaggaag attacaggta cgcaatcg aaaaccgatg agatagggct acttgcagcc 120 agagatctca ccaccacctg gaaggaatac aaccacgatt tgcaactgaa tgacgggacc 180 gtcaaggcca gttgcgtggc aggttccttt aaagtcatag cacttaatgt ggtcagtagg 240 agatattgg cgtcattgca tagaaggct tacccactt ccgtgacatt cgagctcctg 300 ttcgacggga ccaacccatc aactgaggaa atgggagat acttcaggtc cgggctgtgc 360 ccgtttgata cgagtcccgt tgttaaggga aagtacaata cgaccttgtt gaacggtagt 420 gctttctatc ttgtctgccc ataggttgg acgggtgtca tagagtgcac agcagtgagc 480 ccaacaactc tgaggacaga agtggtaag accttcagga gagacaagcc ctttccgcac 540 agaatggatt gtgtgaccac cacagtggaa aatgagatt tattctattg taagttgggg 600 ggcaactgga catgtgtgaa aggcgagcca gtggtctaca cagggggggt agtaaaacaa 660 tgtagatggt gtggcttcga cttcgatggg cctgacggac tccgcatta cccataggt 720 aagtgcattt tggcaatga gandaggttac agatagtag attcaacgga ctgtaacaga 780 gatggcgttg taatcagcac agagggagt catgagtgct tgatcggtaa cacgactgtc 840 aaggtgcatg catcagatga aagactgggc cctatgccat gcagacctaa agagattgtc 900 tctagtgctg gtcctgtaag gaaaacctcc tgtacattca actacacaa aactttgaag 960 aacaggtact atgagcccag ggacagctac ttccagcaat atatgcttaa gggtgagtat 1020 cagtactggt tgacctgga tgcggaattc ggttccggag gctccggtga ctacaagac 1080 catgacggtg attataaga tcatgacatc catcacaagg atgacgatga caagcatcat 1140 tickles at 1152

Claims

1. A recombinant classical swine fever virus E2 protein comprising at least one mutation within the 6B8 epitope, wherein the unmodified 6B8 epitope is specifically recognized by the 6B8 monoclonal antibody, wherein at least one mutation within the 6B8 epitope of the E2 protein results in specific inhibition of binding of the 6B8 monoclonal antibody to such mutated 6B8 epitope; and The unmodified 6B8 epitope is defined by the amino acid sequence STNEIGPLGAEG, and The 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues S14, G22, E24 and / or E24 / G25 of the E2 protein, and the numbering of the amino acid residues refers to the amino acid positions of SEQ ID NO: 11; or The unmodified 6B8 epitope is defined by the amino acid sequence STDEIGLLGAGG, and The 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues S14, G22, G24 and / or G24 / G25 of the E2 protein, and the numbering of the amino acid residues refers to the amino acid positions of SEQ ID NO: 29; and It includes a substitution at amino acid position 24 of the E2 protein and the amino acid at position 24 of the E2 protein is substituted with K, a substitution at amino acid position 24 / 25 of the E2 protein and the amino acids at positions 24 and 25 of the E2 protein are substituted with R and D or K and D, respectively, a substitution at amino acid position 14 of the E2 protein and the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and / or a substitution at amino acid position 22 of the E2 protein and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E.

2. The recombinant classical swine fever virus E2 protein according to claim 1, wherein the 6B8 monoclonal antibody (i) produced by a hybridoma deposited in CCTCC under the accession number CCTCC C2018120, (ii) comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:9 and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO:10, or (iii) comprises a heavy chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO:3, a heavy chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO:4, a heavy chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:5, a light chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO:6, a light chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO:7, and a light chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:

8.

3. The recombinant classical swine fever virus E2 protein according to claim 1, comprising a) a substitution at amino acid position 24 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with K; b) a substitution at amino acid position 14 of the E2 protein, wherein the amino acid at position 14 of the E2 protein is substituted with K, Q or R; or c) a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E.

4. The recombinant classical swine fever virus E2 protein according to claim 1, comprising a) a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 25 of the E2 protein, wherein the amino acids at positions 24 and 25 of the E2 protein are substituted with R and D or K and D, respectively; b) a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 14 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 14 of the E2 protein is substituted with K, Q or R; c) a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 25 of the E2 protein, and a substitution at amino acid position 14 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, and the amino acid at position 14 of the E2 protein is substituted with K, Q or R; d) a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E; e) a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 25 of the E2 protein, and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E; f) a substitution at amino acid position 14 of the E2 protein and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E; g) a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E; or h) substitution at amino acid position 24 of the E2 protein, substitution at amino acid position 25 of the E2 protein, substitution at amino acid position 14 of the E2 protein, and substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E.

5. The recombinant classical swine fever virus E2 protein according to any one of claims 1 to 4, wherein the amino acid substitution within the 6B8 epitope results in a mutant 6B8 epitope sequence as shown in any one of SEQ ID Nos: 15-20.

6. The recombinant classical swine fever virus E2 protein according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus E2 protein is from strain C.

7. The recombinant classical swine fever virus E2 protein according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus E2 protein is from the wild strain QZ07.

8. The recombinant classical swine fever virus E2 protein according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus E2 protein is from the wild strain GD18.

9. The recombinant classical swine fever virus E2 protein according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus E2 protein is from the wild strain QZ07 and comprises a substitution of E at amino acid position 24 of the E2 protein with K; or a substitution of E at amino acid position 24 of the E2 protein with R or K and a substitution of G at amino acid position 25 with D.

10. The recombinant classical swine fever virus E2 protein according to claim 9, wherein the recombinant classical swine fever virus E2 protein further comprises a substitution of S at amino acid position 14 of the E2 protein with K, Q or R, and / or a substitution of G at amino acid position 22 of the E2 protein with A, R, Q or E.

11. The recombinant classical swine fever virus E2 protein according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus E2 protein is from the wild strain GD18, and comprises that E at amino acid position 24 of the E2 protein is substituted with K; or E at amino acid position 24 of the E2 protein is substituted with R or K and G at amino acid position 25 is substituted with D.

12. The recombinant classical swine fever virus E2 protein according to claim 11, wherein the recombinant classical swine fever virus E2 protein further comprises S at amino acid position 14 of the E2 protein replaced by K, Q or R, and / or G at amino acid position 22 of the E2 protein replaced by A.

13. The recombinant classical swine fever virus E2 protein according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus E2 protein is from strain C and comprises a substitution of G at amino acid position 24 of the E2 protein with R, and a substitution of G at amino acid position 25 of the E2 protein with D.

14. The recombinant classical swine fever virus E2 protein according to claim 13, wherein the recombinant classical swine fever virus E2 protein further comprises a substitution of S at amino acid position 14 of the E2 protein with K, and / or a substitution of G at amino acid position 22 of the E2 protein with A, R, Q or E.

15. The recombinant classical swine fever virus E2 protein according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus E2 protein consists of an amino acid sequence selected from one of SEQ ID NOs: 23-28, 30-41 and 43-48.

16. A recombinant nucleic acid encoding the recombinant classical swine fever virus E2 protein according to any one of claims 1 to 15.

17. A vector comprising the recombinant nucleic acid of claim 16.

18. A host cell comprising the recombinant nucleic acid of claim 16 or the vector of claim 17.

19. A method for producing a recombinant classical swine fever virus E2 protein according to any one of claims 1 to 15, comprising: (i) culturing the host cell of claim 18 under conditions suitable for expressing the recombinant classical swine fever virus E2 protein, and (ii) isolating and optionally purifying the recombinant classical swine fever virus E2 protein.

20. An immunogenic composition comprising a recombinant classical swine fever virus E2 protein according to any one of claims 1 to 15, a recombinant nucleic acid according to claim 16 or a vector according to claim 17.

21. The immunogenic composition according to claim 20, wherein the immunogenic composition is a marker vaccine or a vaccine to differentiate infected from vaccinated pigs.

22. Use of a recombinant classical swine fever virus E2 protein according to any one of claims 1 to 15 or an immunogenic composition according to claim 20 or 21 in the manufacture of a medicament for preventing classical swine fever virus infection in pigs.

23. Use of a monoclonal antibody that specifically recognizes the 6B8 epitope of the E2 protein of classical swine fever virus, a recombinant classical swine fever virus E2 protein according to any one of claims 1 to 15, and a wild-type E2 protein of classical swine fever virus comprising the 6B8 epitope in the manufacture of a kit for distinguishing between pigs infected with classical swine fever virus and pigs vaccinated with the immunogenic composition of any one of claims 20 or 21, the method comprising a) obtaining a sample, and b) testing the sample in an immunoassay.

24. The use according to claim 23, wherein the monoclonal antibody specifically recognizes the 6B8 epitope (i) produced by a hybridoma deposited in CCTCC under the accession number CCTCC C2018120, (ii) comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:9 and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO:10, or (iii) comprises a heavy chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO:3, a heavy chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO:4, a heavy chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:5, a light chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO:6, a light chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO:7, and a light chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:

8.

25. A kit for distinguishing pigs infected with classical swine fever virus from pigs vaccinated with the immunogenic composition of claim 20 or 21, comprising a monoclonal antibody that specifically recognizes the 6B8 epitope of the E2 protein of the classical swine fever virus, a recombinant E2 protein according to any one of claims 1 to 15, and a wild-type E2 protein of the classical swine fever virus comprising the 6B8 epitope.

26. The kit according to claim 25, wherein the monoclonal antibody specifically recognizes the 6B8 epitope (i) produced by a hybridoma deposited in CCTCC under the accession number CCTCC C2018120, (ii) comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:9 and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO:10, or (iii) comprises a heavy chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO:3, a heavy chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO:4, a heavy chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:5, a light chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO:6, a light chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO:7, and a light chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:8.

Images