Recombinant classical swine fever virus

Abstract

The present invention relates to the field of animal health. In particular, the present invention relates to a recombinant classical swine fever virus comprising at least one substitution within the epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody. In addition, the present invention provides an immunogenic composition comprising the CSFV of the present invention and the use of the immunogenic composition for preventing and / or treating CSFV-related diseases in animals. In addition, the present invention provides a method or kit for distinguishing CSFV-infected animals from animals vaccinated with the immunogenic composition of the present invention. The present invention also provides an attenuated classical swine fever virus.

Description

Technical Field

[0001] This invention relates to the field of animal health. Specifically, it relates to a recombinant classical swine fever virus containing at least one mutation within the 6B8 epitope of the E2 protein, wherein the (unmodified) 6B8 epitope is specifically recognized by a 6B8 monoclonal antibody. Furthermore, this invention provides an immunogenic composition comprising the recombinant CSFV of this invention, and the use of this immunogenic composition for the prevention and / or treatment of CSFV-related diseases in animals. Additionally, this invention provides methods and kits for distinguishing CSFV-infected animals from animals vaccinated with the immunogenic composition of this invention. Background Technology

[0002] Classical swine fever (CSF) is a highly contagious disease of pigs and wild boars that causes significant economic losses. The pathogen is the classical swine fever virus (CSFV). In China, a combination of preventative vaccination and culling strategies is implemented to control CSF outbreaks. However, sporadic CSF outbreaks and persistent infections are still reported in most parts of China.

[0003] Currently available CSFV vaccines are based on the C strain, which has been attenuated through successive passages in rabbits and has been proven safe and effective against CSF. A strong immune response is elicited within 5 days of vaccination, providing reliable protection. However, one limitation is that animals infected with the wild-type strain cannot be distinguished from those vaccinated using standard serological methods.

[0004] There is still a need in the field for a new CSFV vaccine that is safe, effective, and whose inoculated animals can be distinguished from those infected with wild-type strains. Summary of the Invention

[0005] In one aspect, the present invention provides a recombinant CSFV (classical swine fever virus) containing at least one mutation within the 6B8 epitope of the E2 protein, wherein the (unmodified) 6B8 epitope is specifically recognized by a 6B8 monoclonal antibody, and wherein the 6B8 monoclonal antibody is produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or wherein the 6B8 monoclonal antibody contains a heavy chain variable region (V) having the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L), or wherein the 6B8 monoclonal antibody comprises a CDR of a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC2018120, or wherein the 6B8 monoclonal antibody comprises VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VHCDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0006] In one aspect, the present invention provides an attenuated CSFV that may or may not contain one or more mutations in the 6B8 epitope of the E2 protein as disclosed herein. In another aspect, the present invention provides an attenuated CSFV having at least one mutation in the Erns protein and / or a mutation in the Npro protein that causes attenuation. Preferably, the mutation in the Erns protein is a deletion at amino acid position 79 and / or a deletion at amino acid position 171, and the mutation in the Npro protein is a deletion of the Npro protein except for the first four amino-terminal amino acids. In another aspect, the present invention provides an attenuated CSFV having at least one mutation in the Erns protein and / or a mutation in the Npro protein that causes attenuation as disclosed herein, and a mutation in the 6B8 epitope of the E2 protein as provided herein. In another aspect, the attenuated CSFV according to the present invention, which may or may not contain one or more mutations in the 6B8 epitope of the E2 protein as disclosed herein, is derived from strain C or wild-type strain QZ07 or GD18.

[0007] In one aspect, the present invention provides isolated nucleic acids encoding the recombinant CSFV of the present invention.

[0008] In one aspect, the present invention provides a vector comprising the nucleic acid of the present invention.

[0009] In one aspect, the present invention provides an immunogenic composition comprising recombinant CSFV according to the present invention.

[0010] In one aspect, the present invention provides a method for preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering the immunogenic composition of the present invention to animals in need of such treatment.

[0011] In one aspect, the present invention provides a method for labeling a CSFV vaccine, the method comprising introducing at least one mutation within the 6B8 epitope of the E2 protein in CSFV, wherein the (unmodified) 6B8 epitope is specifically recognized by a 6B8 monoclonal antibody, and wherein the 6B8 monoclonal antibody is generated from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or wherein the 6B8 monoclonal antibody comprises a heavy chain variable region (V) having the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L ), or wherein the 6B8 monoclonal antibody comprises a CDR of a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or wherein the 6B8 monoclonal antibody comprises VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0012] In one aspect, the present invention provides a method for distinguishing CSFV-infected animals from animals inoculated with the immunogenic composition of the present invention, the method comprising a) obtaining a sample from the animal; and b) analyzing the sample in an immune test.

[0013] In one aspect, the present invention provides an antibody or an antigen-binding fragment thereof, wherein the antibody is generated from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or wherein the antibody comprises a heavy chain variable region (V) having an amino acid sequence as shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L), or wherein the antibody comprises a CDR of a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or wherein the antibody comprises VHCDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0014] In one aspect, the present invention provides a kit for distinguishing CSFV-infected animals from animals inoculated with the immunogenic composition of the present invention, comprising the antibody of the present invention or an antigen-binding fragment thereof. Attached Figure Description

[0015] Figure 1 : Growth characteristics of attenuated candidate viruses with double or single deletions.

[0016] Figure 2 mAb 6B8 recognizes most CSFV strains but does not react with BVDV.

[0017] Figure 3 Sequence alignment of CSFV isolates, BVDV strains, and some other plagueviruses.

[0018] Figure 4 The IFA results showed that amino acid residues at positions 14, 22, or 24 / 25 are crucial for mAb 6B8 binding.

[0019] Figure 5 IFA results of rescued viruses with various DIVA mutations in GD18-ddNpro-ErnsH.

[0020] Figure 6 Growth curves of GD18-ddNpro-ErnsH P10 virus with various DIVA mutations. Different 6B8 epitope mutations produced live GD18 candidates in vitro and showed growth capabilities comparable to the original attenuated GD18-ddNpro-ErnsH candidate.

[0021] Figure 7 IFA results of rescued viruses from various attenuated candidates with the DIVA-mutated KARD. Candidates containing the four-amino acid mutant KARD were infectious in vitro and did not react with 6B8 mAb.

[0022] Figure 8 Body temperature (average) during safety experiments.

[0023] Figure 9 Body temperature (average) during efficacy experiments.

[0024] Figure 10 Total clinical score (mean) in efficacy trials.

[0025] Figure 11 The 6B8 dcELISA results showed that different mutational forms of the 6B8 epitope, RD, KRD, and KARD, were all feasible as DIVA selections.

[0026] Figure 12 Comparison of DIVA cELISA and dcELISA. The distinction between overdose vaccine serum and challenge serum can be achieved using DIVA dcELISA. Detailed Implementation

[0027] Before describing aspects of the invention, it must be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “described” include plural references unless the context clearly indicates otherwise. Thus, for example, reference to “a or an epitope” includes multiple epitopes, and reference to “virus” is a reference to one or more viruses and their equivalents known to those skilled in the art. The term “and / or” is intended to cover any combination of items connected by the term, which is equivalent to listing all combinations individually. For example, “A, B, and / or C” covers “A,” “B,” “C,” “A and B,” “A and C,” “B and C,” and “A and B and C.” Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of the invention, preferred methods, apparatus, and materials are now described. For the purpose of describing and disclosing viral strains, cell lines, vectors, and methods reported in publications, all publications mentioned herein are incorporated herein by reference and may be used in conjunction with the invention. This document should not be construed as an admission that the present invention is not entitled to precede such disclosure by prior invention.

[0028] In one aspect, the present invention provides a recombinant CSFV (classical classical swine fever virus) containing at least one mutation within the 6B8 epitope of the E2 protein, wherein the (unmodified) 6B8 epitope is specifically recognized by a 6B8 monoclonal antibody. In one aspect, the recombinant CSFV of the present invention is derived from a wild-type CSFV having a 6B8 epitope in its E2 protein that is specifically recognized by the 6B8 monoclonal antibody. In one aspect, the 6B8 monoclonal antibody is produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or the 6B8 monoclonal antibody comprises a heavy chain variable region (V) having the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L ), or the 6B8 monoclonal antibody comprises a CDR of a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or the 6B8 monoclonal antibody comprises VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0029] As used in this article, the term "CSFV" refers to all viruses belonging to the genus *Pestivirus* within the family Flaviviridae.

[0030] The term "recombinant" refers to CSFVs that have been altered, rearranged, or modified through genetic engineering. However, the term does not refer to changes in polynucleotide or amino acid sequences caused by naturally occurring events such as spontaneous mutations.

[0031] The “6B8 epitope of E2 protein” in this article also refers to an epitope of the E2 protein that is specifically recognized by a 6B8 monoclonal antibody as defined herein. The 6B8 epitope may contain at least the amino acid sequence STNEIGPLGAEG (SEQ ID NO:11) or STDEIGLLGAGG (SEQ ID NO:12).

[0032] The term "6B8 monoclonal antibody" refers to a 6B8 monoclonal antibody or its antigen-binding fragment, wherein the 6B8 monoclonal antibody specifically recognizes the 6B8 epitope, particularly a 6B8 epitope containing at least the amino acid sequence STNEIGPLGAEG (SEQ ID NO:11) or STDEIGLLGAGG (SEQ ID NO:12). Preferably, the term 6B8 monoclonal antibody refers to a monoclonal antibody containing VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30. More preferably, the term 6B8 monoclonal antibody refers to a heavy chain variable region (V) having the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L ) monoclonal antibody. More preferably, the term 6B8 monoclonal antibody refers to a monoclonal antibody produced from a hybridoma deposited in CCTCC with accession number CCTCC2018120.

[0033] The term "antigen-binding fragment of a 6B8 monoclonal antibody" refers to a fragment of a 6B8 monoclonal antibody, or at least an amino acid sequence encoding a 6B8 epitope that specifically recognizes 6B8, particularly containing at least the amino acid sequence STNEIGPLGAEG (SEQ ID NO:11) or STDEIGLLGAGG (SEQ ID NO:12). This term also covers amino acid fragments encoding VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, and / or VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30. Furthermore, this term also covers amino acid fragments containing a heavy chain variable region (VLCR) having the amino acid sequence shown in SEQ ID NO:9. H ) and / or a light chain variable region (V) having an amino acid sequence as shown in SEQ ID NO:10 LMore preferably, the term encompasses an amino acid fragment encoded by a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, which specifically binds to the 6B8 epitope.

[0034] The term "mutation" includes the substitution, deletion, or addition of one or more amino acids. The term mutation is well known to those skilled in the art, and those skilled in the art can generate mutations effortlessly.

[0035] In one aspect, at least one mutation in the 6B8 epitope of the E2 protein of the present invention results in specific inhibition of the binding of 6B8 monoclonal antibodies to such mutated 6B8 epitopes.

[0036] The term "specific inhibition" or "specific inhibition" means that the affinity of a 6B8 antibody for a mutated 6B8 epitope is at least 2-fold, preferably 5-fold, more preferably 10-fold, and even more preferably 50-fold lower than that for an unmodified 6B8 epitope, particularly an unmodified 6B8 epitope having the amino acid sequences STNEIGPLGAEG (SEQ ID NO:1) or STDEIGLLGAGG (SEQ ID NO:2). "Affinity" is the interaction between a single antigen-binding site on an antibody molecule and a single epitope. It is expressed by the binding constant KA = kass / kdiss or the dissociation constant KD = kdiss / kass. More preferably, the term "specifically inhibited" or "specifically inhibited" means that in a particular immunofluorescence assay, preferably in the particular immunofluorescence assay described in Example 6, a 6B8 monoclonal antibody as defined herein, particularly a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, does not detectably bind to the mutated 6B8 epitope according to the invention.

[0037] The term "substitution" refers to the replacement of one amino acid with another amino acid at the same position. Therefore, the term "substitution" encompasses the removal / deletion of one amino acid and the insertion of another amino acid at the same position.

[0038] The term "E2 protein" refers to the processed E2 protein as the final cleavage product of the multi-protein (Npro-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B) derived from CSFV. For example, the E2 protein of wild-type strain QZ07 has the amino acid sequence shown in SEQ ID NO:7, the E2 protein of wild-type strain GD18 has the amino acid sequence shown in SEQ ID NO:8, and the E2 protein of strain C has the amino acid sequence shown in SEQ ID NO:35.

[0039] In one aspect of the invention, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues at positions 14, 22, 24 and / or 24 and 25 (“24 / 25”) of the E2 protein.

[0040] In one aspect of the invention, such as for isolates QZ07, GD18, or GD191, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by amino acid residues S14, G22, E24, and / or E24 / G25 of the E2 protein. In another aspect of the invention, such as for strain C, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by amino acid residues S14, G22, G24, and / or G24 / G25 of the E2 protein.

[0041] The amino acid residue number refers to the amino acid position in the processed E2 protein starting from the N-terminus, for example, as provided in SEQ ID NO:7 in an exemplary manner. However, the amino acid position can also be defined with respect to a multiprotein (containing Npro-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B).

[0042] In one aspect of the invention, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by the amino acid sequence STNEIGPLGAEG (SEQ ID NO:11) (such as for isolates QZ07, GD18, or GD191) or STDEIGLLGAGG (such as for strain C). In another aspect of the invention, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by the amino acid sequence STNEIGPLGAEG (SEQ ID NO:11) (such as for isolates QZ07, GD18, or GD191). In yet another aspect of the invention, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by the amino acid sequence STDEIGLLGAGG (SEQ ID NO:12) (such as for strain C).

[0043] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid positions 24 / 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and / or a substitution at amino acid position 22 of the E2 protein.

[0044] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 25 of the E2 protein.

[0045] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 14 of the E2 protein.

[0046] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 25 of the E2 protein, and a substitution at amino acid position 14 of the E2 protein.

[0047] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 22 of the E2 protein.

[0048] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 24, a substitution at amino acid position 25, and a substitution at amino acid position 22 of the E2 protein.

[0049] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 14 of the E2 protein and a substitution at amino acid position 22 of the E2 protein.

[0050] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and a substitution at amino acid position 22 of the E2 protein.

[0051] In one aspect of the invention, the recombinant CSFV according to the invention comprises a substitution at amino acid position 24, a substitution at amino acid position 25, a substitution at amino acid position 14, and a substitution at amino acid position 22 of the E2 protein.

[0052] In one aspect of the invention, in the recombinant CSFV according to the invention, the amino acid at position 24 of the E2 protein is substituted with R or K, respectively, the amino acid at position 24 is substituted with R or K and the amino acid at position 25 of the E2 protein is substituted with D, the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and / or the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E, wherein A and R are preferred.

[0053] In one aspect of the invention, in the recombinant CSFV according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, and the amino acid at position 25 of the E2 protein is replaced with D.

[0054] In one aspect of the invention, in the recombinant CSFV according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, and the amino acid at position 14 of the E2 protein is replaced with K, Q or R.

[0055] In one aspect of the invention, in the recombinant CSFV according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 25 of the E2 protein is replaced with D, and the amino acid at position 14 of the E2 protein is replaced with K, Q, or R.

[0056] In one aspect of the invention, in the recombinant CSFV according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q, or E, wherein A and R are preferred.

[0057] In one aspect of the invention, in the recombinant CSFV according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 25 of the E2 protein is replaced with D, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q, or E, wherein A and R are preferred.

[0058] In one aspect of the invention, in the recombinant CSFV according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 14 of the E2 protein is replaced with K, Q or R, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, wherein A and R are preferred.

[0059] In one aspect of the invention, in the recombinant CSFV according to the invention, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 25 of the E2 protein is replaced with D, the amino acid at position 14 of the E2 protein is replaced with K, Q or R, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, wherein A and R are preferred.

[0060] In one aspect of the invention, the recombinant CSFV according to the invention comprises E or G at amino acid position 24 of the E2 protein being replaced with R or K, E or G at amino acid position 24 of the E2 protein being replaced with R or K and G at amino acid position 25 of the E2 protein being replaced with D, S at amino acid position 14 of the E2 protein being replaced with K, Q or R, and / or G at amino acid position 22 of the E2 protein being replaced with A, R, Q or E, wherein A and R are preferred.

[0061] In one aspect of the invention, the recombinant CSFV according to the invention comprises replacing E or G at amino acid position 24 of the E2 protein with R or K, and replacing G at amino acid position 25 of the E2 protein with D.

[0062] In one aspect of the invention, the recombinant CSFV according to the invention comprises replacing E or G at amino acid position 24 of the E2 protein with R or K, and replacing S at amino acid position 14 of the E2 protein with K, Q or R.

[0063] In one aspect of the invention, the recombinant CSFV according to the invention comprises replacing E or G at amino acid position 24 of the E2 protein with R or K, replacing G at amino acid position 25 of the E2 protein with D, and replacing S at amino acid position 14 of the E2 protein with K, Q, or R.

[0064] In one aspect of the invention, the recombinant CSFV according to the invention comprises replacing E or G at amino acid position 24 of the E2 protein with R or K, replacing S at amino acid position 14 of the E2 protein with K, Q or R, and replacing G at amino acid position 22 of the E2 protein with A, R, Q or E, wherein A and R are preferred.

[0065] In one aspect of the invention, the recombinant CSFV according to the invention comprises replacing E or G at amino acid position 24 of the E2 protein with R or K, replacing G at amino acid position 25 of the E2 protein with D, replacing S at amino acid position 14 of the E2 protein with K, Q or R, and replacing G at amino acid position 22 of the E2 protein with A, R, Q or E, wherein A and R are preferred.

[0066] In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein of the recombinant CSFV according to the invention results in a mutated 6B8 epitope sequence KTNEIGPLGARD (SEQ ID NO:13), KTNEIGPLAARD (SEQ ID NO:14), STNEIGPLGARD (SEQ ID NO:31), STDEIGLLGARD (SEQ ID NO:32), KTDEIGLLGARD (SEQ ID NO:33), or KTDEIGLLAARD (SEQ ID NO:34). In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence KTNEIGPLGARD (SEQ ID NO:13). In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence KTNEIGPLAARD (SEQ ID NO:14). In one aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in the mutated 6B8 epitope sequence STNEIGPLGARD (SEQ ID NO:31). In another aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in the mutated 6B8 epitope sequence STDEIGLLGARD (SEQ ID NO:32). In another aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in the mutated 6B8 epitope sequence KTDEIGLLGARD (SEQ ID NO:33). In another aspect of the invention, an amino acid substitution within the 6B8 epitope of the E2 protein results in the mutated 6B8 epitope sequence KTDEIGLLAARD (SEQ ID NO:34).

[0067] In one aspect of the invention, the E2 protein of the recombinant CSFV of the invention comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any one of SEQ ID NO: 7, 8, and 35, but comprising a mutation within the 6B8 epitope as defined above.

[0068] In a preferred aspect of the invention, an E2 protein having at least one mutation within the 6B8 epitope as disclosed herein is immunogenic and preferably confers protective immunity against CSFV. The E2 protein contains four antigenic domains, namely A, B, C, and D domains, all of which are located at the N-terminus of the E2 protein. These four domains constitute two separate antigenic units, one containing the B / C domain and the other containing the A / D domain. The B / C domain extends from amino acid positions 1 to 84 / 111, and the D / A domain extends from amino acid positions 77 to 111 / 177. Furthermore, the B / C domain is linked by a putative disulfide bond between amino acids 4C and 48C, while the D / A unit is formed by two disulfide bonds, one between amino acids 103C and 167C, and the other between amino acids 129C and 139C. These cysteine ​​residues are crucial for the conformational antigenic structure of the E2 protein. Regarding convalescent serum binding, the antigenic motif (82-85LLFD) is important for the antigenic structure of the E2 protein. Another motif (RYLASLHKKALPT, amino acid positions 64-76) has also been identified as important for the structural integrity of the E2 protein's conformational epitope recognition. Furthermore, E2 proteins containing only one of the aforementioned antigenic domains have been reported to retain immunogenicity and protect pigs from infectious CSFV challenge. Therefore, in a preferred aspect of the invention, an E2 protein having at least one modification within the 6B8 epitope as described herein retains at least one, preferably at least one, antigenic domain as described above. Preferably, the E2 protein of the invention confers protective immunity against CSFV. In one aspect, at least one mutation within the 6B8 epitope as defined herein may be introduced without substantially affecting the protective immunogenicity of the E2 protein against CSFV.

[0069] Sequence identity between two polypeptide sequences indicates the percentage of identical amino acids between the sequences. Methods for evaluating the level of sequence identity between amino acid or nucleotide sequences are known in the art. For example, sequence analysis software is commonly used to determine the identity of amino acid sequences. For instance, identity can be determined by using the BLAST procedure in the NCBI database. For determining sequence identity... See, for example, Computational Molecular Biology, Lesk, AM (ed.), Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW (ed.), Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG (ed.), Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J. (ed.), Stockton Press, New York, 1991.

[0070] In one aspect of the invention, the amino acid substitution at the 6B8 epitope of the E2 protein is a stable amino acid substitution. This stable amino acid substitution results in a stable recombinant CSFV according to the invention.

[0071] The term "stable amino acid substitution" refers to amino acid substitutions that persist after several passages of CSFV virus in cell culture. Preferably, the amino acid substitutions at the 6B8 epitope of the E2 protein persist after at least 3 passages, more preferably after at least 6 passages, even more preferably after at least 9 passages, even more preferably after at least 12 passages, even more preferably after at least 15 passages, even more preferably after at least 20 passages, even more preferably after at least 30 passages, even more preferably after at least 50 passages, even more preferably after 100 passages, and most preferably after 250 passages of CSFV in cell culture. The terms "cell culture" or "passage in cell culture" are known to those skilled in the art. This term relates to the proliferation of a virus in cells cultured in vitro. The term also refers to the proliferation of cells in a cell system in vitro. Such cell systems comprise host cells (such as SK-6 cells, ST cells, or PK-15 cells) and a cell culture medium suitable for the proliferation of such cells in vitro. Suitable cell culture media are known to those skilled in the art and are commercially available. They may contain nutrients, salts, growth factors, antibiotics, serum (e.g., fetal bovine serum), and pH indicators (e.g., phenol red). Whether amino acids are still present in the 6B8 epitope of the E2 protein can be determined effortlessly by those skilled in the art. Furthermore, the term "stable amino acid substitutions" also refers to amino acid substitutions that remain after re-isolation of CSFV from vaccinated animals previously vaccinated with the CSFV of the present invention. Preferably, the amino acid substitutions within the 6B8 epitope of the E2 protein remain for at least 3 days, more preferably at least 4 days, even more preferably at least 5 days, even more preferably at least 6 days, even more preferably at least 7 days, even more preferably at least 8 days, even more preferably at least 9 days, even more preferably at least 10 days, even more preferably at least 12 days, even more preferably at least 15 days, even more preferably at least 20 days, even more preferably at least 25 days, even more preferably at least 35 days, even more preferably at least 50 days, and most preferably at least 100 days, following vaccination with CSFV, re-isolation, and determination of whether amino acids remain within the 6B8 epitope of the E2 protein.

[0072] Surprisingly, the substitution within the 6B8 epitope of the E2 protein has been found to be highly suitable for generating markers or DIVA vaccines due to the stability of said substitution. The substitution within the 6B8 epitope according to the invention is stable after several passages of the CSFV virus according to the invention in cell culture. Furthermore, it has been shown that the substitution within the 6B8 epitope according to the invention cannot be recognized by antibodies specific to the intact (wild-type) 6B8 epitope of the E2 protein. Therefore, the substitution within the 6B8 epitope according to the invention can be used as a negative marker for generating markers or DIVA vaccines. In one aspect, said at least one substitution within the 6B8 epitope of the E2 protein specifically recognized by a 6B8 monoclonal antibody inhibits the binding of 6B8 to the E2 protein.

[0073] In one aspect of the invention, the recombinant CSFV is attenuated.

[0074] The term "attenuated" means that the virulence of CSFV has been reduced. In this invention, "attenuated" is synonymous with "non-toxic." In this invention, an attenuated CSFV is a CSFV whose virulence has been reduced to such a degree that it does not cause clinical signs of CSFV infection but can induce an immune response in target animals. However, it can also mean a reduction in the incidence or severity of clinical signs in animals infected with attenuated CSFV compared to a "control group" of animals infected with non-attenuated CSFV and not receiving attenuated virus. In this document, the term "reduced / decreased" means a reduction of at least 10%, preferably 25%, even more preferably 50%, and most preferably more than 100% compared to the control group as defined above. Therefore, an attenuated CSFV strain is suitable for introduction into immunogenic compositions.

[0075] Attenuation of CSFV can be achieved through continuous passage. Attenuation of CSFV through continuous passage in cell culture is well known to those skilled in the art and can be performed effortlessly by those skilled in the art.

[0076] Alternatively, attenuation can be achieved by mutating CSFV. Attenuated CSFV strains can be generated through the following methods: mutations in the Erns gene (WO 99 / 64604, WO2005 / 111201, WO 2009 / 156448 A1, Mayer et al., 2003. VirusRes. 98:105-16, Meyers et al., 1999. J. Virol. 73:10224-10235, Widjojoatmodjo et al., 2000. J. Virol. 74:2973-80), deletion of Npro in virulent CSFV strains (Tratschin, J. et al., 1998. J. Virol. 72:7681-7684), combination of mutations in Erns with deletion of Npro (WO2005 / 111201, WO2009 / 156448 A1), and combination of mutations in Erns and E2 (van Gen). Nip et al., 2004. J. Virol, 78:3812-3823), mutations in the E1 gene (Risatti et al., 2005. Virology 343:116-127), and mutations in the E2 gene (Risatti et al., 2007. Virology 364:371-82).

[0077] In one aspect of the invention, the recombinant CSFV has at least one mutation in the Erns protein and / or at least one mutation in the Npro protein. In one aspect, said at least one mutation in the Erns protein and / or at least one mutation in the Npro protein results in attenuation of the recombinant CSFV. Mutations within the sequences of Npro and Erns have been described in the prior art as shown above (see exemplary WO 99 / 64604, WO2005 / 111201 A, WO2009 / 156448 A1).

[0078] In one aspect of the invention, the mutation in the Erns protein is the deletion of amino acid position 79 and / or amino acid position 171 of the Erns protein. In another aspect of the invention, the mutation in the Npro protein is the deletion of all amino acids except the first four N-terminal amino acids of the Npro protein. The amino acid positions refer to positions in the processed Erns protein (e.g., exemplarily indicated as the amino acid positions provided in SEQ ID NO:16) or the processed Npro protein (e.g., exemplarily indicated as the amino acid positions provided in SEQ ID NO:15).

[0079] In one aspect of the invention, recombinant CSFV has a deletion of amino acid position 79 of the Erns protein. In another aspect of the invention, recombinant CSFV has a deletion of amino acid position 79 of the Erns protein and a deletion of amino acid position 171 of the Erns protein. In another aspect of the invention, recombinant CSFV has a deletion of amino acid position 79 of the Erns protein and a deletion of Npro protein except for the first four N-terminal amino acids. In another aspect of the invention, recombinant CSFV has a deletion of amino acid position 79 of the Erns protein, a deletion of amino acid position 171 of the Erns protein, and a deletion of Npro protein except for the first four N-terminal amino acids.

[0080] As understood herein, the term “Npro” refers to the first protein encoded by the viral open reading frame and which itself is cleaved from the remainder of the synthetic multiprotein (Stark et al., J. Virol. 67:7088-7093 (1993); Wiskerchen et al., Virol. 65:4508-4514 (1991)). Depending on the context, the term may also refer to the “Npro” amino acids remaining after sequence mutations of the protein itself. For example, the amino acid sequence of the Npro protein of wild-type strain GD18 is shown in SEQ ID NO:15, and the amino acid sequence of the Npro protein of wild-type strain QZ07 is shown in SEQ ID NO:18.

[0081] As used herein, “Erns” refers to the glycoprotein Erns, which represents a structural component of the genus *Phethorax* viral particle (Thiel et al., 1991. *J. Virol.* 65:4705-4712). Erns lacks a typical membrane anchoring site and is secreted from infected cells in considerable quantities; the protein has been reported to exhibit RNase activity (Hulst et al., 1994. *Virology* 200:558-565; Schneider et al., 1993. *Science* 261:1169-1171; Windisch et al., 1996. *J. Virol.* 70:352-358). It should be noted that in publications, the term glycoprotein E0 is often used synonymously with glycoprotein Erns. Depending on the context, the term may also refer to mutant “Erns” proteins. For example, the amino acid sequence of the Erns protein of wild-type strain GD18 is shown in SEQ ID NO:16, and the amino acid sequence of the Erns protein of wild-type strain QZ07 is shown in SEQ ID NO:19.

[0082] As used herein, the term “deletion of Npro protein except for the first four N-terminal amino acids” refers to the near-complete deletion of the Npro coding region; however, the four N-terminal amino acids are retained.

[0083] Those skilled in the art will recognize that the recombinant CSFV of the present invention can be derived from various CSFV isolates because the 6B8 epitope is evolutionarily conserved in different CSFV strains.

[0084] In one aspect of the invention, the recombinant CSFV is derived from isolates of genogroup 2.1. In another aspect of the invention, the recombinant CSFV is derived from, for example, wild-type strains GD18 or QZ07. Wild-type strain QZ07 has the full-length nucleotide sequence shown in SEQ ID NO:1, or contains or expresses a polyprotein having the amino acid sequence shown in SEQ ID NO:20. Wild-type strain GD18 has the full-length nucleotide sequence shown in SEQ ID NO:2, or contains or expresses a polyprotein having the amino acid sequence shown in SEQ ID NO:17.

[0085] In one aspect of the invention, the recombinant CSFV is derived from an isolate of genotype 1. In another aspect of the invention, the recombinant CSFV is derived from strain C, which is known in the art.

[0086] In one aspect, the present invention provides a recombinant CSFV comprising a deletion of amino acid position 79 of the Erns protein and at least one mutation in the 6B8 epitope of the E2 protein as disclosed herein.

[0087] In one aspect of the invention, the recombinant CSFV is derived from, for example, wild-type strain QZ07, and includes a deletion of amino acid at amino acid position 79 of the Erns protein, an E substitution at amino acid position 24 of the E2 protein for R or K, or an E substitution at amino acid position 24 of the E2 protein for R or K and a G substitution at amino acid position 25 of the E2 protein for D, and optionally also includes an S substitution at amino acid position 14 of the E2 protein for K, Q, or R, and / or a G substitution at amino acid position 22 of the E2 protein for A, R, Q, or E, wherein A and R are preferred.

[0088] In one respect, the recombinant CSFV has a full-length nucleotide sequence as shown in SEQ ID NO:3, or contains or expresses a multiprotein having an amino acid sequence as shown in SEQ ID NO:21.

[0089] In one aspect, the present invention provides a recombinant CSFV comprising a deletion of amino acid position 79 and amino acid position 171 of the Erns protein, and at least one mutation in the 6B8 epitope of the E2 protein as disclosed herein.

[0090] In one aspect of the invention, the recombinant CSFV is derived from, for example, wild-type strain QZ07, and includes the deletion of amino acid 79 of the Erns protein, the deletion of amino acid 171 of the Erns protein, the substitution of E for R or K at amino acid 24 of the E2 protein, or the substitution of E for R or K at amino acid 24 of the E2 protein and the substitution of G for D at amino acid 25 of the E2 protein, and optionally also includes the substitution of S for K, Q or R at amino acid 14 of the E2 protein, and / or the substitution of G for A, R, Q or E at amino acid 22 of the E2 protein, wherein A and R are preferred.

[0091] In one respect, the recombinant CSFV has a full-length nucleotide sequence as shown in SEQ ID NO:4, or contains or expresses a multiprotein having an amino acid sequence as shown in SEQ ID NO:22.

[0092] In one aspect, the present invention provides a recombinant CSFV comprising a deletion of amino acid position 79 of the Erns protein and a deletion of the Npro protein except for the first four amino-terminal amino acids, and at least one other mutation in the 6B8 epitope of the E2 protein as disclosed herein.

[0093] In one aspect of the invention, the recombinant CSFV is derived from, for example, wild-type strain GD18, and includes the deletion of amino acid 79 of the Erns protein, the deletion of Npro protein except for the first four amino-terminal amino acids, the substitution of E for R or K at amino acid 24 of the E2 protein, or the substitution of E for R or K at amino acid 24 of the E2 protein and the substitution of G for D at amino acid 25 of the E2 protein, and optionally also includes the substitution of S for K, Q or R at amino acid 14 of the E2 protein, and / or the substitution of G for A, R, Q or E at amino acid 22 of the E2 protein, wherein A and R are preferred.

[0094] In one respect, the recombinant CSFV has a full-length nucleotide sequence as shown in SEQ ID NO:5, or contains or expresses a multiprotein having an amino acid sequence as shown in SEQ ID NO:23.

[0095] In one aspect of the invention, the recombinant CSFV is derived from, for example, wild-type strain GD18, and includes the deletion of amino acid at amino acid position 79 of the Erns protein, the deletion of amino acid at amino acid position 171 of the Erns protein, the substitution of E for R or K at amino acid position 24 of the E2 protein, or the substitution of E for R or K at amino acid position 24 of the E2 protein and the substitution of G for D at amino acid position 25 of the E2 protein, and optionally also includes the substitution of S for K, Q or R at amino acid position 14 of the E2 protein, and / or the substitution of G for A, R, Q or E at amino acid position 22 of the E2 protein, wherein A and R are preferred.

[0096] In one respect, the recombinant CSFV has a full-length nucleotide sequence as shown in SEQ ID NO:6, or contains or expresses a multiprotein having an amino acid sequence as shown in SEQ ID NO:24.

[0097] In one aspect, the present invention also provides a nucleic acid encoding a recombinant CSFV according to the present invention.

[0098] The term "nucleic acid" refers to polynucleotides, including DNA molecules, RN molecules, cDNA molecules, or derivatives. This term encompasses both single-stranded and double-stranded polynucleotides. The nucleic acids of this invention encompass isolated polynucleotides (i.e., isolated from their natural environment) as well as genetically modified forms. Furthermore, it includes chemically modified polynucleotides, including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides, or artificially modified polynucleotides such as biotinylated polynucleotides. Additionally, it should be understood that, due to the degenerate genetic code, the CSFV of this invention can be encoded by a large number of polynucleotides.

[0099] In one aspect, the present invention also provides a vector comprising a nucleic acid encoding a recombinant CSFV according to the present invention.

[0100] The term "vector" encompasses bacteriophages, plasmids, viral or retroviral vectors, and artificial chromosomes, such as bacterial or yeast artificial chromosomes. Furthermore, the term also refers to target constructs that allow random or site-specific integration of the target construct into genomic DNA. Such target constructs preferably contain DNA of sufficient length for homologous or heterologous recombination, as detailed below. Vectors encompassing the nucleic acids of the present invention preferably also contain selective markers for proliferation and / or selection in the host. Vectors can be introduced into host cells using various techniques known in the art. For example, plasmid vectors can be introduced as precipitates such as calcium phosphate precipitates or rubidium chloride precipitates, or as complexes with charged lipids or carbon-based clusters such as fullerenes. Alternatively, plasmid vectors can be introduced using heat shock or electroporation techniques. If the vector is a virus, it can be packaged in vitro using a suitable packaging cell line prior to administration to host cells. Retroviral vectors can be replicative or replication-deficient. In the latter case, viral replication typically occurs only in complementary host / cells. More preferably, the polynucleotide is operatively linked to an expression control sequence that allows expression in prokaryotic or eukaryotic cells or their isolated fractions. The expression of the polynucleotide includes transcription of the polynucleotide, preferably into translatable mRNA. Regulatory elements ensuring expression in eukaryotic cells (preferably mammalian cells) are well known in the art. They preferably contain a regulatory sequence ensuring transcription initiation, and optionally a polyadenylate signal ensuring transcription termination and transcript stability. Additional regulatory elements may include transcriptional and translational enhancers. Possible regulatory elements allowing expression in prokaryotic host cells include, for example, the lac, trp, or tac promoters in *E. coli*, and examples of regulatory elements allowing expression in eukaryotic host cells are the AOX1 or GAL1 promoters in yeast or the CMV-, SV40-, RSV- promoters (Rous sarcoma virus), CMV-enhancers, SV40-enhancers, or globin introns in mammalian and other animal cells. Furthermore, inducible expression control sequences can be used in the expression vectors covered by this invention. Such inducible vectors may contain tet or lac operon sequences or sequences that can be induced by heat shock or other environmental factors. Suitable expression control sequences are well known in the art. For example, this technique is described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989), NY, and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1994).

[0101] In one aspect, the present invention also provides an immunogenic composition comprising a recombinant CSFV according to the invention, or a nucleic acid encoding a recombinant CSFV according to the invention, or a vector containing a nucleic acid encoding a recombinant CSFV according to the invention. In one aspect, the recombinant CSFV as part of the immunogenic composition according to the invention is attenuated, preferably as described herein.

[0102] As used herein, the term "immunogenic composition" refers to a composition comprising at least one antigen that elicits an immune response in a host to which the immunogenic composition is administered. Such an immune response may be a cell- and / or antibody-mediated immune response to the immunogenic composition of the present invention. The host is also described as a "subject". Preferably, any host or subject described or mentioned herein is an animal.

[0103] Typically, an "immune response" includes, but is not limited to, one or more of the following effects: the generation or activation of antibodies specifically targeting one or more antigens included in the immunogenic composition of the present invention, B cells, helper T cells, suppressor T cells and / or cytotoxic T cells and / or γδ T cells. Preferably, the host will exhibit a protective immune response or a therapeutic response.

[0104] A “protective immune response” will be demonstrated by a reduction or absence of clinical signs typically seen in the infected host, faster recovery time and / or reduced duration of infectivity, or reduced pathogen titer in the infected host’s tissues, fluids or excretions.

[0105] As used herein, "antigen" means, but is not limited to, a component that elicits an immune response in a host to an immunogenic composition or vaccine of interest containing such antigen or an immunogenic component thereof. An antigen or immunogenic component may be a complete (inactivated or attenuated live) microorganism, or any fragment or portion thereof, which, if administered to a host, can elicit an immune response in the host. An antigen may be, or may include, a complete live organism in its original form or an attenuated organism as in a so-called modified live vaccine (MLV). An antigen may also include suitable elements of the organism (subunit vaccine), whereby these elements are generated as follows: by disrupting the growth culture of the complete organism or such organism and subsequent purification steps, thereby producing one or more desired structures, or by a synthetic process induced by appropriate manipulation of a suitable system, such as, but not limited to, bacteria, insects, mammals, or other species, and optionally by subsequent isolation and purification processes, or by inducing the synthetic process in animals requiring the vaccine by directly introducing genetic material using a suitable pharmaceutical composition (polynucleotide vaccination). An antigen may include a complete organism inactivated by appropriate methods in a so-called dead vaccine (KV).

[0106] An immunogenic composition is described as a "vaccine" when the host exhibits a protective immune response that enhances resistance to new infections and / or reduces the clinical severity of the disease.

[0107] In one aspect, the immunogenic composition of the present invention is a vaccine.

[0108] As understood in this article, the term "vaccine" refers to a veterinary vaccine containing antigenic material, administered for the purpose of inducing specific and active immunity against disease caused by CSFV infection.

[0109] Preferably, the vaccine according to the invention is a live attenuated CSFV vaccine, comprising preferably live attenuated CSFV as described herein, which elicits a protective immune response in a host animal but does not cause viral disease due to mutations in its genome. Live attenuated vaccines have the advantage of more closely mimicking natural infection than inactivated vaccines. Therefore, they generally provide a higher level of protection than their inactivated counterparts. The attenuated CSFV as described herein confers active immunity that can be passively transmitted via maternal antibodies against the immunogen contained in the attenuated CSFV, and sometimes against the antigen-associated organism. The vaccine of the invention refers to a vaccine as defined above, wherein one of the immunologically active components is CSFV, either derived from a plague virus or derived from a nucleotide sequence that is more than 70% homologous to any known plague virus sequence (sense or antisense). However, the invention also relates to vaccines comprising inactivated CSFV according to the invention.

[0110] Vaccines may also contain other components typical of pharmaceutical compositions.

[0111] Additional components that enhance the immune response are ingredients commonly referred to as “adjuvants,” such as aluminum hydroxide, mineral oil or other oils or auxiliary molecules added to vaccines, or generated by the body after being induced by such additional components, such as, but not limited to, interferons, interleukins or growth factors.

[0112] In one aspect of the invention, for example, at least one mutation in the 6B8 epitope of the E2 protein as defined herein, such as a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid positions 24 / 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and / or a substitution at amino acid position 22 of the E2 protein, is used as a marker.

[0113] As used herein, the term "marker" refers to the mutant 6B8 epitope according to the invention. The mutant 6B8 epitope according to the invention differs from the 6B8 epitope sequence of wild-type CSFV (the unmodified 6B8 epitope). Therefore, the mutant 6B8 epitope according to the invention allows for the differentiation of naturally infected animals with the non-mutated 6B8 epitope from vaccinated animals with the mutant 6B8 epitope according to the invention by exemplary immune tests and / or genomic analysis tests.

[0114] In one aspect of the invention, the immunogenic composition of the invention is a labeled vaccine or a DIVA (distinguishing between infected and vaccinated animals) vaccine.

[0115] The term "labeled vaccine" or "DIVA (Distinguishing Infected from Vaccinated Animals)" refers to a vaccine with the labeling shown above. Therefore, labeled vaccines can be used to distinguish vaccinated animals from naturally infected animals. The immunogenic composition of the present invention acts as a labeled vaccine because, in animals vaccinated with the CSFV of the present invention, the substituted 6B8 epitope according to the present invention can be specifically detected in animals vaccinated with the CSFV of the present invention, compared to infection with wild-type CSFV as a control. The substituted 6B8 epitope according to the present invention can be distinguished from the 6B8 epitope sequence of wild-type CSFV (the unmodified 6B8 epitope) by exemplary immunoassays and / or genomic analysis. Finally, the labeled epitope should be specific to the pathogen, thereby avoiding false-positive serological results induced by other organisms that may be present in livestock. However, as shown in the examples, the 6B8 epitope is evolutionarily conserved (sequence alignment) and specific to CSFV (6B8 mAb does not bind BVDV). Therefore, the substituted 6B8 epitope according to the present invention is highly suitable for use in labeled vaccines.

[0116] Preferably, the labeled vaccine according to the invention is a live attenuated vaccine comprising live attenuated CSFV, which elicits a protective immune response in a host animal but does not cause viral disease due to mutations in its genome. Live attenuated vaccines have the advantage of more closely mimicking natural infection than inactivated vaccines. Therefore, they typically provide a higher level of protection than their inactivated counterparts. Suitable live attenuated CSFV labeled vaccines according to the invention contain mutations within the Erns and / or Npro proteins, as well as the mutant 6B8 epitope, each as disclosed herein.

[0117] However, this does not necessarily mean that the vaccine must replicate in the target animal to function as a vaccine. The recombinant CSFV according to the invention inherently carries its marker-characteristics (e.g., the mutant 6B8 epitope according to the invention). Therefore, the virus serves as a marker vaccine in the target animal regardless of whether it replicates. Therefore, the invention also relates to marker vaccines comprising inactivated CSFV according to the invention.

[0118] (Non-labeled) live attenuated CSFV viruses have been described in the art and are even commercially available. Therefore, such viruses constitute a very suitable starting material for constructing viruses according to the invention (i.e., replicative CSFVs with mutations in the 6B8 epitope according to the invention). These viruses do indeed inherently exhibit attenuation compared to their wild-type counterparts, and they can therefore be used as the basis for labeled viruses in labeled vaccines.

[0119] The main advantage of an effective marker vaccine is that it allows for the detection of pigs that were infected acutely or at some point prior to obtaining samples from the vaccinated herd (e.g., at least about 3 weeks prior), thus providing the possibility of monitoring the spread or reintroduction of CSFV in the pig population. Therefore, it is possible to claim with a certain degree of confidence that a vaccinated pig population is free of CSFV based on laboratory test results.

[0120] The marked vaccine of this invention is ideally suited for emergency vaccination in cases of swine fever detection or outbreaks. The marked vaccine facilitates rapid and effective administration and allows for differentiation between infected (disease-associated) animals and vaccinated animals.

[0121] In one aspect of the invention, animals treated with the immunogenic composition of the invention can be distinguished from animals infected with naturally occurring classical swine fever virus by analyzing samples obtained from said animals using immunoassay and / or genomic analysis tests.

[0122] The term "sample" refers to a body fluid sample, an isolated cell sample, or a sample from a tissue or organ. Body fluid samples can be obtained using known techniques and preferably include samples of blood, plasma, serum, or urine, more preferably blood, plasma, or serum. Tissue or organ samples can be obtained from any tissue or organ, for example, through a biopsy. Isolated cells can be obtained from body fluids, tissues, or organs using separation techniques such as centrifugation or cell sorting.

[0123] The term "obtain" may include separation and / or purification steps known to those skilled in the art, preferably using precipitation, columns, etc.

[0124] The terms "immune test" and "genomic analysis test" are specified below. However, the analyses described in the "immune test" and "genomic analysis test" are respectively the basis for distinguishing animals vaccinated with the immunogenic composition according to the invention from animals infected with naturally occurring (disease-associated) classical swine fever virus.

[0125] In one aspect of the invention, the immunogenic composition is formulated for single-dose administration.

[0126] Advantageously, the experimental data provided by this invention disclose that a single dose of the immunogenic composition of this invention reliably and effectively stimulates a protective immune response. Therefore, in one aspect of this invention, the immunogenic composition is formulated for single-dose administration and is effective by single-dose administration.

[0127] Furthermore, the present invention provides the use of the immunogenic composition of the present invention as a medicine.

[0128] In one aspect, the present invention provides a method for preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering an immunogenic composition according to the invention to an animal in need of such treatment. In one aspect, the CSFV-related disease is CSF.

[0129] The present invention also relates to a method for immunizing animals, the method comprising administering to such animals any immunogenic composition according to the invention. The present invention further relates to a method for immunizing animals, the method comprising administering to such animals a single immunogenic composition according to the invention. Preferably, the method for immunizing animals is effective by administering a single immunogenic composition according to the invention to such animals.

[0130] The term "immunity" refers to active immunization by administering an immunogenic composition to an animal to be immunized, thereby evoking an immune response against an antigen contained in such an immunogenic composition.

[0131] Immunization reduces the incidence of a specific CSFV infection in a herd, or reduces the severity of clinical signs caused by or associated with a specific CSFV infection. Preferably, immunization reduces the incidence of a specific CSFV infection in a herd, or reduces the severity of clinical signs caused by or associated with a specific CSFV infection, by a single administration of the immunogenic composition according to the invention.

[0132] According to one aspect of the invention, preferably by a single administration of the immunogenic composition according to the invention, immunization of the desired animal with the immunogenic composition as provided herein results in prevention of CSFV infection in the subject. Even more preferably, immunization results in an effective and durable immune response against CSFV infection. It should be understood that the time period will last for more than 2 months, preferably more than 3 months, more preferably more than 4 months, more preferably more than 5 months, and more preferably more than 6 months. It should be understood that immunization may not be effective for all immunized animals. However, this term requires that the majority of the animals in the herd be effectively immunized.

[0133] Preferably, in this context, we envision animal herds that typically (i.e., without immunity) develop clinical signs usually caused or associated with CSFV infection. Whether the animals in a herd have been effectively immunized is something that a person skilled in the art can determine effortlessly. Preferably, immunization is effective if, compared to unimmunized animals or animals immunized with an immunogenic composition available prior to the present invention but subsequently infected with CSFV, the incidence or severity of clinical signs is reduced by at least 10%, more preferably at least 20%, even more preferably at least 30%, even more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%.

[0134] In one aspect of the invention, the animal is a pig. In another aspect, the animal is a piglet. Piglets are typically less than 3 to 4 weeks old. In one aspect, piglets aged 1 to 4 weeks are vaccinated. In one aspect, the animal is a sow. In another aspect, the animal is a pregnant sow.

[0135] In one aspect of the invention, the immunogenic composition is administered intradermally, intratracheally, intravaginally, intramuscularly, intranasally, intravenously, intraarterially, intraperitoneally, orally, intrathecally, subcutaneously, intradermally, intracardiacly, intralobularly, intramedullaryly, intrapulmonaryly, and in combinations thereof. However, depending on the nature of the compound and its mode of action, the immunogenic composition may also be administered via other routes.

[0136] The present invention also provides a method for reducing the incidence or severity of one or more clinical signs associated with CSF in animals, the method comprising the step of administering an immunogenic composition according to the invention to an animal in need, wherein the reduction in the incidence or severity of one or more clinical signs is relative to animals that have not received the immunogenic composition. Preferably, the method comprises administering a single dose of the immunogenic composition, and the incidence or severity of one or more clinical signs is effectively reduced by such a single administration of the immunogenic composition.

[0137] As used herein, the term “clinical signs” refers to the signs of CSFV infection in animals. Clinical signs are further defined as follows. However, clinical signs also include, but are not limited to, clinical signs that can be directly observed in living animals. Examples of clinical signs that can be directly observed in living animals include nasal and ocular discharge, lethargy, coughing, wheezing, swine lung disease, high fever, weight gain or loss, dehydration, diarrhea, joint swelling, lameness, emaciation, pale skin, and emaciation. Mittelholzer et al. (Vet. Microbiol., 2000. 74(4): pp. 293-308) developed a checklist for determining clinical scores in CSF animal experiments. This checklist includes parameters such as activity level, body tension, body shape, respiration, gait, skin, eyes / conjunctiva, appetite, defecation, and anorexia.

[0138] Preferably, compared with untreated subjects or subjects treated with an immunogenic composition available prior to the present invention but subsequently infected with CSFV, the incidence or severity of clinical signs is reduced by at least 10%, more preferably at least 20%, even more preferably at least 30%, even more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%.

[0139] In one aspect of the invention, the immunogenic composition is administered only once, and such single-dose administration is effective.

[0140] As shown in the examples, the immunogenic compositions provided herein have been proven effective after a single dose of the immunogenic composition was administered to animals in need.

[0141] However, while single-dose administration is preferred, the immunogenic composition may also be administered two or more times, with the first dose administered before the second (boost) dose. Preferably, the second dose is administered at least 15 days after the first dose. More preferably, the second dose is administered 15 to 40 days after the first dose. Even more preferably, the second dose is administered at least 17 days after the first dose. Still more preferably, the second dose is administered 17 to 30 days after the first dose. Even more preferably, the second dose is administered at least 19 days after the first dose. Even more preferably, the second dose is administered 19 to 25 days after the first dose. Most preferably, the second dose is administered at least 21 days after the first dose. In a preferred aspect of the two-dose regimen, both the first and second doses of the immunogenic composition are administered in the same amount. In addition to the first and second dose regimens, alternative embodiments include subsequent doses. For example, a third, fourth, or fifth dose may be administered in these aspects. Preferably, the subsequent third, fourth, and fifth dose regimens are administered in the same amount as the first dose, and the time range between each dose is consistent with the time range between the first and second doses mentioned above.

[0142] The amount of CSFV to be administered can be the amount of virus that elicits or can elicit an immune response in animals at the dose of the virus administered. If inactivated or attenuated live virus formulations are used, a dose of approximately 10 [units of something] is recommended. 2 To about 10 9 TCID 50 (50% endpoint of tissue culture infection dose), more preferably 10 4 To about 10 8 TCID 50 Furthermore, approximately 10 4 To about 10 6 TCID 50 The amount of vaccine.

[0143] Preferably, a single dose has a total volume of about 0.5 ml to 2.5 mL, more preferably about 0.6 ml to 2.0 mL, even more preferably about 0.7 ml to 1.75 mL, even more preferably about 0.8 ml to 1.5 mL, and even more preferably about 0.9 ml to 1.25 mL, wherein a single dose of 1.0 ml is most preferred.

[0144] In one aspect of the invention, one or more clinical signs are selected from: respiratory distress, labored breathing, cough, sneezing, rhinitis, tachypnea, dyspnea, pneumonia, red / blue discoloration of the ears and vulva, jaundice, lymphocytic infiltration, lymphadenopathy, hepatitis, nephritis, anorexia, fever, somnolence, agalactia, diarrhea, nasal discharge, conjunctivitis, progressive emaciation, reduced weight gain, pale skin, gastric ulcer, macroscopic and microscopic lesions of organs and tissues, lymphoid lesions, mortality, virus-induced abortion, stillbirth, piglet malformation, mummification, and combinations thereof.

[0145] In one aspect, the present invention also provides a method for labeling a CSFV vaccine, the method comprising introducing at least one mutation within the 6B8 epitope of the E2 protein in CSFV, wherein the (unmodified) 6B8 epitope is specifically recognized by a 6B8 monoclonal antibody. In one aspect, the 6B8 monoclonal antibody is produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or the 6B8 monoclonal antibody comprises a heavy chain variable region (V) having the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L The 6B8 monoclonal antibody may comprise a CDR of a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or the 6B8 monoclonal antibody may comprise a VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, a VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, a VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, a VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, a VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and a VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30. In one aspect, the mutated 6B8 epitope is one of the modified 6B8 epitopes disclosed herein.

[0146] In one aspect, the mutation is a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid positions 24 / 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and / or a substitution at amino acid position 22 of the E2 protein. In one aspect, the mutation is a substitution at amino acid position 24 and a substitution at amino acid position 25 of the E2 protein. In one aspect, the mutation is a substitution at amino acid position 24 and a substitution at amino acid position 14 of the E2 protein. In one aspect, the mutation is a substitution at amino acid position 24, a substitution at amino acid position 25 of the E2 protein, and a substitution at amino acid position 14 of the E2 protein. In one aspect, the mutation is a substitution at amino acid position 24 and a substitution at amino acid position 22 of the E2 protein. In one aspect, the mutation is a substitution at amino acid position 24, a substitution at amino acid position 25 of the E2 protein, and a substitution at amino acid position 22 of the E2 protein. In one aspect, the mutation is a substitution at amino acid position 24, amino acid position 14, and amino acid position 22 of the E2 protein. In another aspect, the mutation is a substitution at amino acid position 24, amino acid position 25, amino acid position 14, and amino acid position 22 of the E2 protein.

[0147] In one aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acids at positions 24 / 25 of the E2 protein are substituted with R / D or K / D, the amino acid at position 14 of the E2 protein is substituted with K, Q, or R, and / or the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred. In one aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 25 of the E2 protein is substituted with D. In one aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 14 of the E2 protein is substituted with K, Q, or R. In one aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, and the amino acid at position 14 of the E2 protein is substituted with K, Q, or R.

[0148] In one aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred. In another aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred.

[0149] In one aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 14 of the E2 protein is substituted with K, Q, or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred. In another aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, the amino acid at position 14 of the E2 protein is substituted with K, Q, or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred.

[0150] In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, the substitution of E or G at amino acid position 24 of the E2 protein for R or K, the substitution of G at amino acid position 25 of the E2 protein for D, the substitution of S at amino acid position 14 of the E2 protein for K, Q, or R, and / or the substitution of G at amino acid position 22 of the E2 protein for A, R, Q, or E, wherein A and R are preferred. In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, and the substitution of G at amino acid position 25 of the E2 protein for D. In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, and the substitution of S at amino acid position 14 of the E2 protein for K, Q, or R. In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, the substitution of G at amino acid position 25 of the E2 protein for D, and the substitution of S at amino acid position 14 of the E2 protein for K, Q, or R. In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, and the substitution of G at amino acid position 22 of the E2 protein for A, R, Q, or E, wherein A and R are preferred. In another aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, the substitution of G at amino acid position 25 of the E2 protein for D, and the substitution of G at amino acid position 22 of the E2 protein for A, R, Q, or E, wherein A and R are preferred.

[0151] In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, the substitution of S at amino acid position 14 of the E2 protein for K, Q, or R, and the substitution of G at amino acid position 22 of the E2 protein for A, R, Q, or E, wherein A and R are preferred. In another aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, the substitution of G at amino acid position 25 of the E2 protein for D, the substitution of S at amino acid position 14 of the E2 protein for K, Q, or R, and the substitution of G at amino acid position 22 of the E2 protein for A, R, Q, or E, wherein A and R are preferred.

[0152] As used herein, the term "marker" refers to the introduction of a "marker" as defined above into CSFV or a CSFV vaccine. Therefore, it must be understood that the method of this invention also refers to the marking of CSFV and is not limited to the method of preparing a CSFV vaccine.

[0153] Therefore, a "labeled vaccine" or "DIVA vaccine" as defined above can be produced by labeling a CSFV vaccine according to the method of the present invention. In one aspect of the invention, the CSFV vaccine is an attenuated vaccine.

[0154] Attenuated CSFV vaccines have already been defined above. Furthermore, it must be understood that the method according to the invention is not limited to the production of attenuated CSFV vaccines. In contrast, as shown above, the virus is used as a marker vaccine in the target animal regardless of whether the virus replicates in the target animal. Therefore, the invention also relates to marker vaccines comprising inactivated CSFV according to the invention.

[0155] In another aspect, the present invention also provides a method for distinguishing CSFV-infected animals from animals vaccinated with the immunogenic composition according to the present invention, the method comprising:

[0156] a) Obtaining samples, and

[0157] b) Test the sample in an immune test and / or a genomic analysis test.

[0158] The term "immunoassay" refers to a test comprising an antibody specific to the 6B8 epitope of the E2 protein of CSFV. This antibody may be specific for the mutant 6B8 epitope according to the invention or the 6B8 epitope of wild-type CSFV (the unmodified 6B8 epitope). However, the term "immunoassay" also refers to a test comprising the mutant 6B8 epitope peptide according to the invention or the 6B8 epitope peptide of wild-type CSFV (the unmodified 6B8 epitope). Examples of immunoassays include any enzyme-immunoassay or immunochemical assay, such as ELISA (enzyme-linked immunosorbent assay), EIA (enzyme immunoassay), RIA (radioimmunoassay), sandwich enzyme immunoassay, fluorescent antibody assay (FAT), electrochemiluminescence sandwich immunoassay (ECLIA), dissociation amplified lanthanide fluorescence immunoassay (DELFIA), or solid-phase immunoassay, immunofluorescence assay (IFT), immunohistochemical staining, Western blot analysis, or any other suitable method available to those skilled in the art. Depending on the assay used, the antigen or antibody may be labeled with an enzyme, fluorophore, or radioisotope. See, for example, Coligan et al., Current Protocols in Immunology, John Wiley & Sons Inc., New York, NY (1994); and Frye et al., Oncogen 4:1153-1157, 1987.

[0159] Preferably, an antibody specific to the 6B8 epitope of wild-type CSFV is used to detect CSFV antigen in serum cells (such as leukocytes) or frozen sections from isolated organs (such as tonsils, spleen, kidneys, lymph nodes, and distal ileum) of animals (such as pigs) suspected of being infected with wild-type CSFV or vaccinated with a vaccine containing recombinant CSFV according to the invention. In this case, only samples from animals infected with wild-type CSFV will show a positive result for the 6B8 epitope-specific antibody. In contrast, samples from animals vaccinated with a vaccine containing recombinant CSFV according to the invention do not show a result for the 6B8 epitope-specific antibody due to mutations within the 6B8 epitope according to the invention. In an alternative test, CSFV is isolated from, for example, organs (such as tonsils) or serum cells (such as leukocytes) infected or suspected of being infected with wild-type CSFV, or from vaccinated animals, and incubated with a suitable cell line (such as SK-6 cells or PK-15 cells) to infect the cells with the virus. Subsequently, replicating virus was detected in cells using a 6B8 epitope-specific antibody that distinguishes between wild-type, disease-associated CSFV and the recombinant CSFV according to the invention. Furthermore, peptides can be used to block nonspecific cross-reactivity. Additionally, antibodies specific to other epitopes of wild-type CSFV can be used as positive controls.

[0160] More preferably, an ELISA is used, wherein an antibody specific to the 6B8 epitope of wild-type CSFV (the unmodified 6B8 epitope) is cross-linked with a microplate to distinguish infected pigs from pigs vaccinated with the vaccine according to the invention. The cross-linking is preferably performed, for example, by anchoring a protein such as poly-L-lysine. ELISAs employing this type of cross-linking are generally more sensitive than ELISAs using passive coating techniques. Wild-type (disease-associated) CSFV binds to an antibody specific to the 6B8 epitope of wild-type CSFV (the unmodified 6B8 epitope). Detection of the binding of wild-type CSFV to the wild-type CSFV 6B8 epitope-specific antibody can be performed using another CSFV-specific antibody. In this case, only samples from infected pigs will show a positive result for the 6B8 epitope-specific antibody. In contrast, recombinant CSFV in pigs vaccinated with the vaccine according to the invention will express only the mutant 6B8 epitope and therefore will not bind to antibodies specific to the 6B8 epitope (the unmodified 6B8 epitope) of wild-type CSFV cross-linked with the microplate. Furthermore, the peptide can be used to block nonspecific cross-reactivity. Additionally, antibodies specific to other epitopes of wild-type CSFV can be used as positive controls.

[0161] Alternatively, the microplate can be cross-linked with CSFV-specific antibodies other than those specific to the wild-type CSFV 6B8 epitope (unmodified 6B8 epitope). Wild-type (disease-associated) CSFV binds to the cross-linked antibody. Detection of the binding of wild-type CSFV to the cross-linked antibody can be performed using a wild-type CSFV 6B8 epitope (unmodified 6B8 epitope) specific antibody.

[0162] As shown above, the 6B8 epitope is evolutionarily conserved and specific to wild-type CSFV.

[0163] Therefore, more preferably, the ELISA is used to detect antibodies in a sample against the mutant 6B8 epitope according to the invention or the 6B8 epitope of wild-type CSFV (unmodified 6B8 epitope). Such tests include the mutant 6B8 epitope peptide according to the invention or the 6B8 epitope peptide of wild-type CSFV (unmodified 6B8 epitope).

[0164] Such assays may, for example, include wells having a substituted 6B8 epitope according to the invention or a 6B8 epitope of wild-type CSFV cross-linked with a microplate (the unmodified 6B8 epitope). The cross-linking is preferably performed, for example, by anchoring a protein such as poly-L-lysine. Expression systems for obtaining mutant or wild-type 6B8 epitopes are well known to those skilled in the art. Alternatively, the 6B8 epitope can be chemically synthesized. It must be understood that while such mutant or wild-type 6B8 epitopes can be used in the assays according to the invention, it is convenient to use proteins comprising the complete E2 protein or fragments of the E2 protein containing the 6B8 epitope, rather than relatively short epitopes themselves. Especially when the epitope is used, for example, to coat wells in a standard ELISA assay, it may be more efficient to use a larger protein containing the epitope in the coating step.

[0165] Animals vaccinated with a vaccine containing the recombinant CSFV according to the invention did not produce antibodies against the wild-type 6B8 epitope. However, such animals produced antibodies against the substituted 6B8 epitope according to the invention. Therefore, no antibodies bound to wells coated with the wild-type 6B8 epitope. In contrast, if the wells were coated with the mutant 6B8 epitope according to the invention, antibodies bound to the mutant 6B8 epitope.

[0166] However, animals infected with wild-type CSFV will produce antibodies against the wild-type epitope of CSFV. However, such animals do not produce antibodies against the mutant 6B8 epitope according to the invention. Therefore, no antibodies bind to wells coated with the mutant 6B8 epitope according to the invention. In contrast, if the wells are coated with the wild-type 6B8 epitope, antibodies bind to the wild-type 6B8 epitope.

[0167] The binding of the antibody to the mutant 6B8 epitope according to the present invention or the 6B8 epitope of wild-type CSFV (unmodified 6B8 epitope) can be performed by methods known to those skilled in the art.

[0168] Preferably, the ELISA is a sandwich ELISA. More preferably, the ELISA is a competitive ELISA. Most preferably, the ELISA is a dual-competitive ELISA. However, different ELISA techniques are well known to those skilled in the art. ELISA has been exemplarily described by Wensvoort G. et al., 1988 (Vet. Microbiol. 17(2):129-140), Robiolo B. et al., 2010 (J. Virol. Methods. 166(1-2):21-27), and Colijn, EO et al., 1997 (Vet. Microbiology 59:15-25).

[0169] The term "genomic analysis assay" refers to genomic analysis methods based on polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time PCR (r-PCR) or real-time reverse transcription PCR (rRT-PCR), Templex-PCR, nucleic acid sequence-based amplification (NASBA), and isothermal amplification methods using polymerases and specific oligonucleotides as primers. The aforementioned amplification methods are well known in the art.

[0170] Preferably, a test for distinguishing animals infected with wild-type CSFV or vaccinated with the recombinant CSFV of the present invention is provided by CSFV RNA isolation and reverse transcription followed by cDNA amplification. The cDNA is then sequenced to detect whether the 6B8 epitope is intact and whether it refers to wild-type CSFV. In this case, the pigs are infected with wild-type CSFV. However, if the sequence of the 6B8 epitope is replaced according to the present invention, the animals are vaccinated with the vaccine of the present invention.

[0171] Furthermore, when using any real-time based technique, primers and / or probes can be used to identify modified (mutants according to the invention) and / or disease-associated (wild-type) viral nucleotide sequences of the 6B8 epitope. However, such methods are well known in the art.

[0172] In one aspect of the invention, the immunoassay includes testing whether an antibody specifically recognizing the intact 6B8 epitope of the CSFV E2 protein binds to the CSFV E2 protein in a sample. In another aspect of the invention, the immunoassay includes testing the presence of an antibody specifically recognizing the 6B8 epitope of the CSFV E2 protein in the sample, and / or testing the presence of an antibody specifically recognizing a mutated 6B8 epitope of the CSFV E2 protein in the sample. Such mutated 6B8 epitopes include one or more mutations of the 6B8 epitopes disclosed herein.

[0173] In one aspect of the invention, the immunoassay is an EIA (enzyme immunoassay) or an ELISA (enzyme-linked immunosorbent assay). In one aspect of the invention, the ELISA is an indirect ELISA, a sandwich ELISA, a competitive ELISA, or a double-competitive ELISA, preferably a double-competitive ELISA. In one aspect of the invention, the genomic analysis assay is a PCR (polymerase chain reaction), RT-PCR (reverse transcriptase polymerase chain reaction), or real-time PCR (polymerase chain reaction). In one aspect of the invention, the sample is a serum sample. In one aspect of the invention, the animal is a pig.

[0174] In one aspect, the present invention relates to an antibody or an antigen-binding fragment thereof, wherein the antibody specifically recognizes the 6B8 epitope as defined above. In one aspect, the present invention relates to an antibody or an antigen-binding fragment thereof, wherein the antibody is generated from a hybridoma deposited at CCTCC with accession number CCTCC C2018120. In one aspect, the present invention relates to an antibody or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (V0) having the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L In one aspect, the present invention relates to an antibody or an antigen-binding fragment thereof, wherein the antibody comprises a CDR of a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120. In another aspect, the present invention relates to an antibody or an antigen-binding fragment thereof, wherein the antibody comprises a VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, a VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, a VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, a VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, a VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and a VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0175] The antibody, also known as “6B8” or “6B8 monoclonal antibody”, is capable of specifically binding to the E2 protein of classical swine fever virus (CSFV) and can therefore be used to develop labeled or DIVA vaccines against CSFV.

[0176] As used herein, “antibody” refers to immunoglobulins and immunoglobulin fragments, whether natural or partially or fully synthetic, such as recombinant-derived, including any fragment containing at least a portion of the variable region of an immunoglobulin molecule, which retains the binding specificity of the full-length immunoglobulin. Therefore, an antibody includes any protein having a binding domain homologous or substantially homologous to an immunoglobulin antigen-binding domain (antibody binding site). Antibodies include antibody fragments. Therefore, as used herein, the term antibody includes synthetic antibodies, recombinant-derived antibodies, multispecific antibodies (e.g., bispecific antibodies), human antibodies, non-human antibodies, humanized antibodies, chimeric antibodies, endoantibodies, and antibody fragments. The antibodies described herein include members of any immunoglobulin type (e.g., IgG, IgM, IgD, IgE, IgA, and IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass (e.g., IgG2a and IgG2b).

[0177] As used herein, the term "variable region" refers to an immunoglobulin domain consisting essentially of four "frame regions," referred to in the art and hereinafter as "frame region 1" or "FR1"; "frame region 2" or "FR2"; "frame region 3" or "FR3"; and "frame region 4" or "FR4," interspersed with three "complementarity-determining regions" or "CDRs," referred to in the art and hereinafter as "complementarity-determining region 1" or "CDR1"; "complementarity-determining region 2" or "CDR2"; and "complementarity-determining region 3" or "CDR3," respectively. Therefore, the general structure or sequence of an immunoglobulin variable region can be represented as follows: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. VH or V H This refers to the variable region of the heavy chain, and VL or V L This refers to the variable regions of the light chain. Similarly, VH CDR1, VHCDR2, and VH CDR3 refer to the CDR1, CDR2, and CDR3 of the variable regions of the heavy chain, respectively. VL CDR1, VL CDR2, and VL CDR3 refer to the CDR1, CDR2, and CDR3 of the variable regions of the light chain, respectively.

[0178] As used herein, an "antibody fragment" or an "antigen-binding fragment" of an antibody means any portion of a full-length antibody that is smaller than the full length but contains at least a portion of the variable region of the antibody that binds to the antigen (e.g., one or more CDRs and / or one or more antibody binding sites) and thus retains binding specificity; and at least a portion of the specific binding capacity of the full-length antibody. Therefore, an antigen-binding fragment refers to an antibody fragment containing an antigen-binding portion that binds to the same antigen as the antibody of the derived antibody fragment. Antibody fragments include antibody derivatives produced by enzymatic treatment of a full-length antibody, as well as derivatives produced synthetically, such as recombinantly. Antibody fragments are included within antibodies. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, single-chain Fv (scFv), Fv, dsFv, biantibodies, Fd and Fd' fragments, and other fragments, including modified fragments (see, for example, Methods in Molecular Biology, Vol. 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Chapter 1; pp. 3-25, Kipriyanov). Fragments may include multiple chains linked together, such as by disulfide bridges and / or peptide linkers. Antigen-binding fragments include any antibody fragment that, when inserted into an antibody framework (e.g., by substituting a corresponding region), produces immune-specific binding (i.e., exhibiting at least or at least about 10...). 7 -10 8 M-1 Antibodies against the Ka antigen.

[0179] In one aspect, the present invention also provides a mutant E2 protein of CSFV for use in the DIVA method of the present invention, comprising at least one mutation within the 6B8 epitope. The 6B8 epitope has been defined above.

[0180] In one aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid positions 24 / 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and / or a substitution at amino acid position 22 of the E2 protein.

[0181] In one aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 24 and a substitution at amino acid position 25 of the E2 protein.

[0182] In one aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 24 and a substitution at amino acid position 14 of the E2 protein. In another aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 24, a substitution at amino acid position 25, and a substitution at amino acid position 14 of the E2 protein.

[0183] In one aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 24 and a substitution at amino acid position 22 of the E2 protein. In another aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 24, a substitution at amino acid position 25, and a substitution at amino acid position 22 of the E2 protein.

[0184] In one aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 14 of the E2 protein and a substitution at amino acid position 22 of the E2 protein.

[0185] In one aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 24, a substitution at amino acid position 14, and a substitution at amino acid position 22 of the E2 protein. In another aspect, the mutant E2 protein used in the DIVA method of the present invention comprises a substitution at amino acid position 24, a substitution at amino acid position 25, a substitution at amino acid position 14, and a substitution at amino acid position 22 of the E2 protein.

[0186] In one aspect, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acids at positions 24 / 25 of the E2 protein are replaced with R / D or K / D, the amino acid at position 14 of the E2 protein is replaced with K, Q or R, and / or the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, wherein A and R are preferred.

[0187] In one aspect, the amino acid at position 24 of the E2 protein is replaced with R or K, and the amino acid at position 25 of the E2 protein is replaced with D.

[0188] In one aspect, the amino acid at position 24 of the E2 protein is replaced with R or K, and the amino acid at position 14 of the E2 protein is replaced with K, Q, or R. In another aspect, the amino acid at position 24 of the E2 protein is replaced with R or K, the amino acid at position 25 of the E2 protein is replaced with D, and the amino acid at position 14 of the E2 protein is replaced with K, Q, or R.

[0189] In one aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred. In another aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred.

[0190] In one aspect, the amino acid at position 14 of the E2 protein is replaced with K, Q or R, and the amino acid at position 22 of the E2 protein is replaced with A, R, Q or E, wherein A and R are preferred.

[0191] In one aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 14 of the E2 protein is substituted with K, Q, or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred. In another aspect, the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, the amino acid at position 14 of the E2 protein is substituted with K, Q, or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q, or E, wherein A and R are preferred.

[0192] In one aspect, the mutant E2 protein comprises an E or G substitution at amino acid position 24 of the E2 protein to R or K, an E or G substitution at amino acid position 24 of the E2 protein to R or K, a G substitution at amino acid position 25 of the E2 protein to D, an S substitution at amino acid position 14 of the E2 protein to K, Q or R, and / or a G substitution at amino acid position 22 of the E2 protein to A, R, Q or E, wherein A and R are preferred.

[0193] In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, and the substitution of G at amino acid position 25 of the E2 protein for D.

[0194] In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, and the substitution of S at amino acid position 14 of the E2 protein for K, Q, or R. In another aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, the substitution of G at amino acid position 25 of the E2 protein for D, and the substitution of S at amino acid position 14 of the E2 protein for K, Q, or R.

[0195] In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, and the substitution of G at amino acid position 22 of the E2 protein for A, R, Q, or E, wherein A and R are preferred. In another aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein for R or K, the substitution of G at amino acid position 25 of the E2 protein for D, and the substitution of G at amino acid position 22 of the E2 protein for A, R, Q, or E, wherein A and R are preferred.

[0196] In one aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein with R, the substitution of S at amino acid position 14 of the E2 protein with K, Q, or R, and the substitution of G at amino acid position 22 of the E2 protein with A, R, Q, or E, wherein A and R are preferred. In another aspect, the mutation is the substitution of E or G at amino acid position 24 of the E2 protein with R, the substitution of G at amino acid position 25 of the E2 protein with D, the substitution of S at amino acid position 14 of the E2 protein with K, Q, or R, and the substitution of G at amino acid position 22 of the E2 protein with A, R, Q, or E, wherein A and R are preferred.

[0197] The mutant E2 protein of the present invention is particularly suitable for the DIVA method of the present invention, for example, by a dual-competitive ELISA.

[0198] In one aspect, the mutant E2 protein of CSFV used in the DIVA method of the present invention may be a truncated version of the full-length E2 protein, for example, the transmembrane region may be missing.

[0199] In one aspect, the present invention provides a kit for distinguishing CSFV-infected animals from animals inoculated with the immunogenic composition of the present invention, comprising an antibody of the present invention or an antigen-binding fragment thereof, a mutant E2 protein of the present invention, and / or a wild-type E2 polypeptide of CSFV comprising the 6B8 epitope as defined herein. The kit may also include instructions for use.

[0200] In one aspect, the present invention provides an attenuated CSFV, wherein the attenuated CSFV is derived from wild-type strain QZ07 or wild-type strain GD18 or strain C.

[0201] In one aspect, the attenuated CSFV contains at least one mutation in the Erns protein. Preferably, such attenuated CSFV has one or more mutations within the 6B8 epitope of the E2 protein as disclosed herein.

[0202] Such mutations in the Erns protein can be a deletion of amino acid position 79 and / or amino acid position 171. (This text is repeated three times in the original.)

[0203] In one aspect, the attenuated CSFV contains at least one mutation in the Npro protein. Preferably, such attenuated CSFV has one or more mutations within the 6B8 epitope of the E2 protein as disclosed herein.

[0204] Such mutations in the Npro protein can be deletions of all but the first four amino-terminal amino acids. Other modifications for attenuation can also be introduced.

[0205] In one aspect, the attenuated CSFV contains at least one mutation in the Erns protein and / or at least one mutation in the Npro protein. Preferably, such attenuated CSFV has one or more mutations within the 6B8 epitope of the E2 protein as disclosed herein.

[0206] In one aspect, the attenuated CSFV is derived from the wild-type strain QZ07 and contains a deletion of amino acid position 79 of the Erns protein. Preferably, such attenuated CSFV has one or more mutations within the 6B8 epitope of the E2 protein as disclosed herein.

[0207] In one aspect, the attenuated CSFV is derived from the wild-type strain QZ07 and includes the deletion of amino acid position 79 and amino acid position 171 of the Erns protein. Preferably, such attenuated CSFV has one or more mutations within the 6B8 epitope of the E2 protein as disclosed herein.

[0208] In one aspect, the attenuated CSFV is derived from the wild-type strain QZ07 and includes a deletion of amino acid position 79 of the Erns protein and a deletion of the Npro protein except for the first four N-terminal amino acids. Preferably, such attenuated CSFV has one or more mutations within the 6B8 epitope of the E2 protein as disclosed herein.

[0209] In one aspect, the attenuated CSFV is derived from the wild-type strain QZ07 and includes the deletion of amino acid position 79 and amino acid position 171 of the Erns protein, as well as the deletion of the Npro protein except for the first four N-terminal amino acids. Preferably, such attenuated CSFV has one or more mutations in the 6B8 epitope of the E2 protein as disclosed herein.

[0210] In one aspect, the attenuated CSFV is derived from the wild-type strain GD18 and includes a deletion of amino acid position 79 of the Erns protein and a deletion of the Npro protein except for the first four N-terminal amino acids. Preferably, such attenuated CSFV has one or more mutations within the 6B8 epitope of the E2 protein as disclosed herein.

[0211] In one aspect, the attenuated CSFV is derived from the wild-type strain GD18 and includes the deletion of amino acid position 79 and amino acid position 171 of the Erns protein. Preferably, such attenuated CSFV has one or more mutations within the 6B8 epitope of the E2 protein as disclosed herein.

[0212] In one aspect, the attenuated CSFV is derived from the wild-type strain GD18 and includes the deletion of amino acid position 79 and amino acid position 171 of the Erns protein, as well as the deletion of the Npro protein except for the first four N-terminal amino acids. Preferably, such attenuated CSFV has one or more mutations in the 6B8 epitope of the E2 protein as disclosed herein.

[0213] This document also describes the following terms and portions of the disclosure of this invention:

[0214] 1. A recombinant CSFV (swine fever virus) containing at least one mutation in the 6B8 epitope of the E2 protein, wherein the unmodified 6B8 epitope is specifically recognized by a 6B8 monoclonal antibody.

[0215] 2. The recombinant CSFV according to Clause 1, wherein at least one mutation in the 6B8 epitope of the E2 protein results in specific inhibition of the binding of the 6B8 monoclonal antibody to such mutated 6B8 epitope.

[0216] 3. The recombinant CSFV according to clause 1 or 2, wherein the 6B8 monoclonal antibody

[0217] i) Produced by a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0218] ii) Contains a heavy chain variable region (V) having an amino acid sequence as shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L ),or

[0219] iii) A CDR containing a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0220] iv) VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0221] 4. The recombinant CSFV according to any one of Clauses 1 to 3, wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues at positions 14, 22, 24 and / or 24 / 25 of the E2 protein.

[0222] 5. The recombinant CSFV according to any one of Clauses 1 to 3, wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by amino acid residues S14, G22, E24 and / or E24 / G25 of the E2 protein, or at least by amino acid residues S14, G22, G24 and / or G24 / G25 of the E2 protein.

[0223] 6. The recombinant CSFV according to any one of Clauses 1 to 3, wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by at least the amino acid sequence STNEIGPLGAEG or STDEIGLLGAGG.

[0224] 7. The recombinant CSFV according to any one of Clauses 1 to 6, comprising a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid positions 24 / 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and / or a substitution at amino acid position 22 of the E2 protein.

[0225] 8. The recombinant CSFV according to any one of clauses 1 to 7, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at positions 24 / 25 of the E2 protein is substituted with R / D or K / D, the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and / or the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E, wherein A and R are preferred.

[0226] 9. The recombinant CSFV according to any one of clauses 1 to 8, comprising an E or G substitution at amino acid position 24 of the E2 protein to R or K, an E or G substitution at amino acid position 24 to R or K, a G substitution at amino acid position 25 of the E2 protein to D, an S substitution at amino acid position 14 of the E2 protein to K, Q or R, and / or a G substitution at amino acid position 22 of the E2 protein to A, R, Q or E, wherein A and R are preferred.

[0227] 10. The recombinant CSFV according to any one of clauses 1 to 9, wherein the amino acid substitution within the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence of any one of SEQ ID No: 13-14, 31-34.

[0228] 11. The recombinant CSFV according to any one of Clauses 1 to 10, wherein the recombinant CSFV is attenuated.

[0229] 12. The recombinant CSFV according to any one of clauses 1 to 11, wherein the recombinant CSFV has at least one mutation in the Erns protein and / or at least one mutation in the Npro protein; preferably, such mutation in the Erns protein is a deletion of amino acid at amino acid position 79 and / or a deletion of amino acid at amino acid position 171 of the Erns protein, and the mutation in the Npro protein is a deletion of the Npro protein except for the first four amino-terminal amino acids.

[0230] 13. The recombinant CSFV according to any one of clauses 1 to 12, wherein the recombinant CSFV is derived from strain C or wild-type strains QZ07, GD191 or GD18.

[0231] 14. The recombinant CSFV according to any one of clauses 1 to 13, wherein the recombinant CSFV is derived from wild-type strain QZ07, and

[0232] (i) The deletion of amino acid position 79, which contains the Erns protein, and

[0233] (ii) The E at amino acid position 24 of the E2 protein is substituted with R or K, or the E at amino acid position 24 is substituted with R or K and the G at amino acid position 25 of the E2 protein is substituted with D, and optionally also includes the S at amino acid position 14 of the E2 protein being substituted with K, Q or R, and / or the G at amino acid position 22 of the E2 protein being substituted with A, R, Q or E, wherein A and R are preferred.

[0234] 15. The recombinant CSFV according to any one of clauses 1 to 13, wherein the recombinant CSFV is derived from wild-type strain QZ07, and

[0235] (i) Includes the deletion of amino acid position 79 and amino acid position 171 of the Erns protein.

[0236] (ii) The E at amino acid position 24 of the E2 protein is substituted with R or K, or the E at amino acid position 24 is substituted with R or K and the G at amino acid position 25 of the E2 protein is substituted with D, and optionally also includes the S at amino acid position 14 of the E2 protein being substituted with K, Q or R, and / or the G at amino acid position 22 of the E2 protein being substituted with A, R, Q or E, wherein A and R are preferred.

[0237] 16. The recombinant CSFV according to any one of clauses 1 to 13, wherein the recombinant CSFV is derived from the wild-type strain GD18, and

[0238] (i) The deletion of amino acid position 79 of the Erns protein, the deletion of the Npro protein except for the first four amino-terminal amino acids, and

[0239] (ii) The E at amino acid position 24 of the E2 protein is substituted with R or K, or the E at amino acid position 24 is substituted with R or K and the G at amino acid position 25 of the E2 protein is substituted with D, and optionally also includes the S at amino acid position 14 of the E2 protein being substituted with K, Q or R, and / or the G at amino acid position 22 of the E2 protein being substituted with A, R, Q or E, wherein A and R are preferred.

[0240] 17. The recombinant CSFV according to any one of clauses 1 to 13, wherein the recombinant CSFV is derived from the wild-type strain GD18, and

[0241] (i) Contains the deletion of amino acid position 79 of the Erns protein, the deletion of amino acid position 171 of the Erns protein, and

[0242] (ii) The E at amino acid position 24 of the E2 protein is substituted with R or K, or the E at amino acid position 24 is substituted with R or K and the G at amino acid position 25 of the E2 protein is substituted with D, and optionally also includes the S at amino acid position 14 of the E2 protein being substituted with K, Q or R, and / or the G at amino acid position 22 of the E2 protein being substituted with A, R, Q or E, wherein A and R are preferred.

[0243] 18. An isolated nucleic acid encoding a recombinant CSFV according to any one of clauses 1 to 17.

[0244] 19. A vector comprising the nucleic acid as described in Clause 18.

[0245] 20. An immunogenic composition comprising any one of recombinant CSFV according to 1 to 16, an isolated nucleic acid encoding the recombinant CSFV according to clause 17, or a vector according to clause 19.

[0246] 21. The immunogenic composition according to Clause 20, wherein the immunogenic composition is a labeled vaccine or a DIVA (distinguishing infected and vaccinated animals) vaccine.

[0247] 22. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering the immunogenic composition according to Clause 20 or 21 to an animal.

[0248] 23. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein said animals are pigs.

[0249] 24. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein said animals are piglets.

[0250] 25. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein said animals are piglets aged 1 to 4 weeks.

[0251] 26. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein said animals are sows.

[0252] 27. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein said animals are pregnant sows.

[0253] 28. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein the immunogenic composition is administered only once.

[0254] 29. An immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related disease in an animal according to Clause 20 or 21, wherein the immunogenic composition is administered to the animal only once and effectively prevents and / or treats CSFV-related disease after the single administration of the immunogenic composition.

[0255] 30. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein the immunogenic composition is administered once or several times.

[0256] 31. The immunogenic composition according to Clause 20 or 21, used in a method of preventing and / or treating CSFV-related diseases in animals according to Clause 20 or 21, wherein the immunogenic composition is administered to the animals once or several times, and effectively prevents and / or treats CSFV-related diseases following the single or multiple administrations of the immunogenic composition.

[0257] 32. A method for preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering an immunogenic composition according to clause 20 or 21 to an animal in need of such treatment.

[0258] 33. A method for preparing a CSFV vaccine, comprising introducing at least one mutation in the 6B8 epitope of the E2 protein, which is specifically recognized by the 6B8 monoclonal antibody, into the CSFV.

[0259] 34. The method according to clause 33, wherein the 6B8 monoclonal antibody

[0260] i) Produced by a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0261] ii) Contains a heavy chain variable region (V) having an amino acid sequence as shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L ),or

[0262] iii) A CDR containing a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0263] iv) VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0264] 35. The method according to clause 33 or 34, wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by amino acid residues at positions 14, 22, 24 and / or 24 / 25 of the E2 protein, for example, the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined at least by amino acid residues S14, G22, E24 and / or E24 / G25 of the E2 protein, or at least by amino acid residues S14, G22, G24 and / or G24 / G25 of the E2 protein.

[0265] 36. The method according to clause 33 or 34, wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by at least the amino acid sequence STNEIGPLGAEG or STDEIGLLGAGG.

[0266] 37. The method according to clause 33 or 34, wherein the mutation is a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid positions 24 / 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and / or a substitution at amino acid position 22 of the E2 protein.

[0267] 38. The method according to clause 33 or 34, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, and respectively, the amino acid at position 24 of the E2 protein is substituted with R or K and the amino acid at position 25 of the E2 protein is substituted with D, the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and / or the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E, wherein A and R are preferred.

[0268] 39. The method according to clause 33 or 34, wherein the mutation is an E or G substitution at amino acid position 24 of the E2 protein to R or K, an E or G substitution at amino acid position 24 to R or K and a G substitution at amino acid position 25 of the E2 protein to D, an S substitution at amino acid position 14 of the E2 protein to K, Q or R, and / or a G substitution at amino acid position 22 of the E2 protein to A, R, Q or E, wherein A and R are preferred.

[0269] 40. The method according to clause 33 or 34, wherein the mutation in the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence of any one of SEQ ID No: 13-14, 31-34.

[0270] 41. The method according to clause 33 or 34, wherein the CSFV vaccine is an attenuated vaccine.

[0271] 42. The method according to clause 33 or 34, wherein the CSFV is derived from strain C or wild-type strain QZ07 or GD18.

[0272] 43. A method for distinguishing CSFV-infected animals from animals vaccinated with an immunogenic composition according to any one of clauses 20 or 21, comprising:

[0273] a) Obtaining samples, and

[0274] b) Test the sample in an immune test.

[0275] 44. The method according to Clause 43, wherein the immune test comprises testing whether an antibody that specifically recognizes the 6B8 epitope of the CSFV E2 protein can bind to the CSFV E2 protein in the sample.

[0276] 45. The method according to clause 43, wherein the antibody specifically recognizes the 6B8 epitope.

[0277] i) Produced by a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0278] ii) Contains a heavy chain variable region (V) having an amino acid sequence as shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L ),or

[0279] iii) A CDR containing a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or

[0280] iv) VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0281] 46. ​​The method according to Clause 43, wherein the immune test comprises testing the presence of an antibody that specifically recognizes the 6B8 epitope of the CSFV E2 protein in the sample, and / or testing the presence of an antibody that specifically recognizes a mutated 6B8 epitope of the CSFV E2 protein in the sample.

[0282] 47. The method according to any one of clauses 43 to 46, wherein the immune test is EIA (enzyme immunoassay) or ELISA (enzyme-linked immunosorbent assay), preferably a dual-competitive ELISA.

[0283] 48. An antibody or an antigen-binding fragment thereof, wherein the antibody is generated from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or wherein the antibody comprises a heavy chain variable region (V) having the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L ), or wherein the antibody comprises a CDR of a monoclonal antibody produced from a hybridoma deposited at CCTCC with accession number CCTCC C2018120, or wherein the antibody comprises VH CDR1 containing the amino acid sequence shown in SEQ ID NO:25, VH CDR2 containing the amino acid sequence shown in SEQ ID NO:26, VH CDR3 containing the amino acid sequence shown in SEQ ID NO:27, VL CDR1 containing the amino acid sequence shown in SEQ ID NO:28, VL CDR2 containing the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 containing the amino acid sequence shown in SEQ ID NO:30.

[0284] 49. A kit for distinguishing CSFV-infected animals from animals vaccinated with an immunogenic composition according to any one of clauses 20 or 21, comprising an antibody or an antigen-binding fragment thereof as described in 39.

[0285] 50. A recombinant attenuated CSFV, wherein the recombinant attenuated CSFV has at least one mutation in the Erns protein and / or at least one mutation in the Npro protein; preferably, such a mutation in the Erns protein is a deletion of amino acid at amino acid position 79 and / or a deletion of amino acid at amino acid position 171 of the Erns protein, and the mutation in the Npro protein is a deletion of the Npro protein except for the first four amino-terminal amino acids.

[0286] 51. The recombinant attenuated CSFV as described in Clause 50, wherein the recombinant attenuated CSFV is derived from strain C or wild-type strain QZ07 or GD18.

[0287] 52. The recombinant attenuated CSFV according to Clause 51, wherein the recombinant attenuated CSFV is derived from wild-type strain QZ07 and contains the deletion of amino acid position 79 of the Erns protein.

[0288] 53. The recombinant attenuated CSFV according to Clause 51, wherein the recombinant CSFV is derived from wild-type strain QZ07 and contains a deletion of amino acid position 79 and a deletion of amino acid position 171 of the Erns protein.

[0289] 54. The recombinant attenuated CSFV according to Clause 51, wherein the recombinant CSFV is derived from wild-type strain GD18 and includes the deletion of amino acid position 79 of the Erns protein and the deletion of the Npro protein except for the first four amino-terminal amino acids.

[0290] 55. The recombinant attenuated CSFV according to Clause 51, wherein the recombinant CSFV is derived from wild-type strain GD18 and contains a deletion of amino acid position 79 and a deletion of amino acid position 171 of the Erns protein.

[0291] 56. An isolated nucleic acid encoding a recombinant attenuated CSFV according to any one of clauses 51 to 55.

[0292] 57. A vector comprising the nucleic acid as described in Clause 56.

[0293] 58. An immunogenic composition comprising a recombinant attenuated CSFV according to any one of Clauses 50 to 55, an isolated nucleic acid encoding the recombinant attenuated CSFV according to Clause 56, or a vector according to Clause 57.

[0294] 59. The immunogenic composition according to Clause 58, used in a method of preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering the immunogenic composition according to Clause 58 to an animal in need of it.

[0295] 60. The immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related diseases in animals according to clause 58 or 59, wherein said animals are pigs.

[0296] 61. The immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related diseases in animals according to clause 58 or 59, wherein said animals are piglets.

[0297] 62. The immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related diseases in animals according to clause 58 or 59, wherein said animals are piglets aged 1 to 4 weeks.

[0298] 63. The immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related diseases in animals according to clause 58 or 59, wherein said animals are sows.

[0299] 64. The immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related diseases in animals according to clause 58 or 59, wherein said animals are pregnant sows.

[0300] 65. The immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related diseases in animals according to clause 58 or 59, wherein the immunogenic composition is administered only once.

[0301] 66. An immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related disease in animals according to clause 58 or 59, wherein the immunogenic composition is administered to the animal only once and effectively prevents and / or treats CSFV-related disease after the single administration of the immunogenic composition.

[0302] 67. The immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related diseases in animals according to clause 58 or 59, wherein the immunogenic composition is administered once or several times.

[0303] 68. The immunogenic composition according to clause 58 or 59, used in a method of preventing and / or treating CSFV-related diseases in animals according to clause 58 or 59, wherein the immunogenic composition is administered to the animals once or several times, and effectively prevents and / or treats CSFV-related diseases after the single or multiple administrations of the immunogenic composition.

[0304] 69. A method for preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering an immunogenic composition according to Clause 58 to an animal in need of such treatment.

[0305] 70. A method for preventing and / or treating CSFV-related diseases in animals, the method comprising the step of administering an immunogenic composition according to Clause 59 to an animal in need of such treatment.

[0306] 71. A method for preparing a recombinant attenuated CSFV vaccine, comprising introducing at least one mutation in the Erns protein and / or at least one mutation in the Npro protein into the CSFV; preferably, such mutation in the Erns protein is a deletion of amino acid at amino acid position 79 and / or a deletion of amino acid at amino acid position 171 of the Erns protein, and said mutation in the Npro protein is a deletion of the Npro protein except for the first four amino-terminal amino acids.

[0307] 72. The method according to Clause 71, wherein the recombinant attenuated CSFV is derived from strain C or wild-type strain QZ07 or GD18.

[0308] 73. The method according to Clause 72, wherein the recombinant attenuated CSFV is derived from QZ07, and wherein an amino acid at amino acid position 79 of the Erns protein is deleted.

[0309] 74. The method according to Clause 72, wherein the recombinant attenuated CSFV is derived from QZ07, and wherein amino acids at positions 79 and 171 of the Erns protein are deleted.

[0310] 75. The method according to Clause 72, wherein the recombinant CSFV is derived from wild-type strain GD18, and wherein the amino acid at amino acid position 79 of the Erns protein and the Npro protein are missing all amino acids except the first four amino-terminal amino acids.

[0311] 76. The method according to Clause 72, wherein the recombinant CSFV is derived from wild-type strain GD18, and wherein amino acids at positions 79 and 171 of the Erns protein are deleted.

[0312] Example

[0313] The following embodiments further illustrate the invention by way of example. It should be understood that the invention is not limited to any of the embodiments described below. Those skilled in the art will understand that the performance, results, and findings of these embodiments can be adapted and applied in a broader sense, taking into account the general description of the invention.

[0314] Example 1: Attenuating CSFV toxicity through deletions in Npro and / or Erns

[0315] Infectious clones were constructed using three field isolates of CSFV genotype 2.1: QZ07, GD18, and GD191, which were adapted to PK / WRL cell cultures and identified as representing low, intermediate, and high virulence strains, respectively. The complete genome sequences of field isolates QZ07 and GD18 are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0316] In short, firstly, a 2kb 5' end fragment of the 12kb whole genome was cloned into pACYC, and deletions were performed via this platform (deletion of the Npro gene from position 5 to 168 of the Npro protein, and deletion of the Erns protein amino acid (histidine) at position 79). Then, two DNA fragments covering another portion of the 12kb whole genome (at the 2kb position at the 3' end of the genome) were amplified from cDNA of each field isolate and inserted into the BAC plasmid pBeloBAC. Using the RED recombination method, the first 2kb of the CSFV genome mutation was inserted into pBeloBAC containing more than two fragments to assemble infectious CSFV clones. The resulting infectious clones were named GD18-ddNpro-ErnsH, GD191-ddNpro-ErnsH, QZ07-sdErnsH, and QZ07-ddNpro-ErnsH. QZ07-sdErnsH contains only a single histidine deletion at amino acid position 79 of the Erns protein. Live viruses with the deletion were rescued from infectious clones of three field isolates.

[0317] After 10 passages of the rescued live viruses, the structural sequences of four P10 viruses were amplified and sequenced. Specifically, viral RNA was extracted from the p10 virus strain using the QIAamp Virus Kit, and then the structural genes (1-4 kb) were amplified using the SuperScript III Platinum One Step RT-PCR Kit. The amplified DNA was then purified, sequenced, and compared with the parental virus sequence (wild type) after alignment. The sequencing results showed that the deletions were stable after 10 passages.

[0318] To determine the optimal titer of each passaged virus, growth curves were plotted by sampling every 24 hours after infection at an MOI of 0.01. Specifically, T25 flasks containing PK / WRL cells were infected with each P10 primary virus at an MOI of 0.001. The corresponding amount of virus was used for infection, diluted with 1 ml of MEM infection medium. After 1 hour of incubation, the infection medium was discarded, and 5 ml of fresh medium was added to the flasks. 200 μl samples were collected every 24 hours until 120 hours post-infection. The samples were then titrated to plot growth curves as shown below. Figure 1 The growth curves shown indicate that the highest valence meets the expected standard after 10 passages.

[0319] Highly toxic GD191 was excluded from further analysis solely for stringent safety considerations (avoiding reversion mutations), although it was a promising candidate. Furthermore, the deletion of Npro excluded QZ07. Additionally, the deletion of an additional amino acid (cysteine) at position 171 of the Erns protein was introduced into GD18 or QZ07 to improve safety properties, for example, for use in pregnant sows.

[0320] Finally, four candidates were identified as having mutations that facilitate attenuation: QZ07-sdErnsH, QZ07-ddErnsHC, GD18-ddNproErnsH, and GD18-ddErnsHC.

[0321] Table 1. Attenuated Drug Candidates

[0322]

[0323] sd, single deletion; dd, double deletion.

[0324] Example 2: Identification and introduction of DIVA sites

[0325] The core feature of the desired new vaccine is its ability to distinguish between vaccinated and infected animals (DIVA). The DIVA feature would be a substantial improvement over the conventional lapnified C strain and offers significant technological advantages. The strategy for introducing the DIVA feature involves altering one or more key epitopes on the surface of the immunodominant E2 protein and using ELISA to confirm the absence of antibodies recognizing wild-type epitopes as an indicator of vaccination (negative DIVA).

[0326] To achieve this strategy, the inventors selected strongly neutralizing mouse mAb 6B8. The hybridoma that produced monoclonal antibody 6B8 was obtained from Zhejiang University and deposited on June 13, 2018, at CCTCC (China Center for Type Culture Collection) (Wuhan University, Wuhan 430072, PRChina) with accession number CCTCC C2018120. Sequencing of monoclonal antibody 6B8 revealed that it possesses the following: a heavy chain variable region (V) with the amino acid sequence shown in SEQ ID NO:9. H ) and the light chain variable region (V) having the amino acid sequence shown in SEQ ID NO:10. L The CDR of this antibody can be readily determined by various methods known in the art, such as the Kabat method. For example, mAb 6B8 comprises VH CDR1 of the amino acid sequence shown in SEQ ID NO:25, VH CDR2 of the amino acid sequence shown in SEQ ID NO:26, VH CDR3 of the amino acid sequence shown in SEQ ID NO:27, VL CDR1 of the amino acid sequence shown in SEQ ID NO:28, VL CDR2 of the amino acid sequence shown in SEQ ID NO:29, and VL CDR3 of the amino acid sequence shown in SEQ ID NO:30.

[0327] Characterization of 1.6B8 mAb

[0328] To investigate whether mAb 6B8 can be used for most CSFVs, the inventors tested the binding of mAb 6B8 to various CSF viruses, such as those from group 1 (including the Shimen strain and C- strain) and group 2 (including QZ07 and GD18), with two BVDVs serving as controls. The results are shown in... Figure 2 Eight additional field CSFV isolates from genotype 2 also tested positive for 6B8 mAb (data not shown). These data indicate that 6B8 recognizes most conserved epitopes present on CSF viruses but does not react with BVDV viruses.

[0329] 2. Identification of key amino acids used for 6B8 binding

[0330] In the presence of mAb 6B8, C-strain virus, after successive passages in PK / WRL cell cultures, exhibited escape mutants that could grow in the presence of neutralizing concentrations of 6B8 antibody. Four clones of these escape mutants were obtained, all of which evaded 6B8 binding. Sequencing of their E2 genes revealed two nucleotide mutations in two codons (GGAGGT to AGAGAT). These changes translated into two amino acid mutations at consecutive positions 24 & 25 (Gly-Gly to Arg-Asp, or GG to RD).

[0331] Then, E2 sequence alignment was performed with BVDV and other plague viruses (QZ07, GD18, GD191, and C strains) to identify other potential key amino acids bound to 6B8. Figure 3 This method identified additional potential key amino acids, such as those at positions 14 and 22.

[0332] All these potential mutations (S14K, G22A, E24R / G25D) were individually introduced into E2 expression vectors to test their effect on 6B8 binding. The E2 gene was cloned into the pCI-neo-Tag vector (Promega, catalog number E1841) to generate expression vectors. After confirming correct expression of the E2 protein, all mutations were introduced into the E2 expression vectors. These vectors were then transfected into PK / WRL cells in 24-well plates using Lipofectamine 3000 (Invitrogen, catalog number L3000015). Twenty-four hours after transfection, cells were fixed with 4% formaldehyde and then treated with 0.1% Triton X-100. In the IFA (immunofluorescence assay), the cells were then tested with mAb 6B8 against CSFV or a rabbit polyclonal antibody (used as a positive control to detect CSFV with the modified 6B8 epitope) and the corresponding Alexa antibody. A second antibody conjugated with 488 (Invitrogen, catalog number 21206) was used to stain cells. As shown in 4A, microscopic examination revealed that the S14K, G22A, and E24R / G25D mutations were crucial for eliminating 6B8 binding. The inventors also tested the effects of other mutations at positions 14, 22, 24, and 25 on binding to the 6B8 antibody. Figure 4 As shown in B, mutations S14Q, S14R, and G22R completely eliminate 6B8 binding, while G22E and G22Q partially affect 6B8 binding, further indicating that positions 14 and 22 are critical for 6B8 binding. Figure 4As shown in C, the single mutation G24K (for strain C) completely eliminates 6B8 binding, which supports the fact that position 24 is crucial for 6B8 binding. G25S alone does not eliminate 6B8 binding. However, since the Gly-to-Asp mutation at position 25 occurs alongside the mutation at position 24, these two mutations can be considered as a single mutation (24 / 25 mutation).

[0333] The results showed that mutations at positions 14, 22, 24 and / or 24 / 25 could be used for DIVA. The results also indicated that mutations at the 6B8 epitope did not substantially alter the overall immunogenicity of the E2 protein, as the mutated E2 protein could still be recognized by anti-CSFV polyclonal antibodies.

[0334] These 6B8 epitope mutations were then introduced into the infectious clone GD18-ddNpro-ErnsH, resulting in three infectious clones (GD18-ddNpro-ErnsH-S14K, GD18-ddNpro-ErnsH-G22A, and GD18-ddNpro-ErnsH-EG24 / 25RD). Live virus was rescued from these three infectious clones, and IFA confirmed their binding properties to mAb 6B8 or polyclonal serum antibodies. Figure 5 The characterization of these viruses indicates that these mutations are stable beyond 10 generations, and the highest titer of each virus is similar to that of the parental GD18-ddNpro-ErnsH virus. Figure 6 Therefore, the mutations S14K, G22A, and E24R / G25D are suitable for DIVA development.

[0335] 3. Construct DIVA candidate viruses

[0336] To increase the chances of success, combinations of potential DIVA mutations were introduced into the four double- or single-deletion infectious clones of Example 1, resulting in four final DIVA infectious clones: QZ07-sdErnsH-KARD, QZ07-ddErnsHC-KARD, GD18-ddNproErnsH-KARD, and GD18-ddErnsHC-KARD (KARD stands for S14K, G22A, and E24R / G25D mutations). Live viruses were rescued from these four infectious clones, passaged, and characterized via IFA (Infectious Disease Analysis). Figure 7 The results indicated that the candidate containing the four-amino acid mutation KARD was infectious in vitro and did not react with 6B8 mAb. Other combinations of DIVA mutations, such as RD (E24R / G25D) and KRD (S14K and E24R / G25D), were also introduced into the four double- or single-deletion infectious clones of Example 1 and had similar results.

[0337] Example 3: Safety verification of four candidate recombinant viruses

[0338] The purpose of this embodiment is to evaluate the safety of four attenuated CSFV viruses with DIVA mutations, namely QZ07-sdErnsH-KARD, QZ07-ddErnsHC-KRD, GD18-ddNproErnsH-KRD, and GD18-ddErnsHC-KARD, in 3-week-old piglets.

[0339] A total of 29 piglets were divided into 5 groups. Five piglets served as negative controls (group 5), while the remaining 24 piglets were randomly divided into four groups (groups 1, 2, 3, and 4), with 6 piglets in each group. On day 0, animals in groups 1, 2, 3, and 4 were injected with 1 mL (5 log TCID50) into the left neck. 50 Piglets were vaccinated with QZ07-sdErnsH-KARD, QZ07-ddErnsHC-KRD, GD18-ddNproErnsH-KRD, and GD18-ddErnsHC-KARD ( / mL), as shown in Table 2. On day 0, all piglets were clinically healthy and free of CSFV and PRRSV antibodies and antigens, including BVDV and PRRV. All animals were healthy at the time of vaccination.

[0340] Table 2: Research Design

[0341] Group Animal numbers Vaccination Day 0 dosage Provide a means autopsy 1 6 GD18-ddNproErnsH-KRD <![CDATA[1mL 5Log TCID 50 / mL]]> IM In D21 2 6 QZ07-sdErnsH-KARD <![CDATA[1mL 5Log TCID 50 / mL]]> IM In D21 3 6 GD18-ddErnsHC-KARD <![CDATA[1mL 5Log TCID 50 / mL]]> IM In D21 4 6 QZ07-ddErnsHC-KRD <![CDATA[1mL 5Log TCID 50 / mL]]> IM In D21 5 5 N / A N / A IM In D21

[0342] Research process

[0343] body temperature

[0344] All animals were measured twice daily from D-4 to D21. Temperatures were recorded in degrees Celsius. For each piglet, the average temperature over the four days prior to D0 and before D0 vaccination (a total of nine measurement points) was defined as normal. The following temperature descriptions were considered normal: a) temperature rise within 0.5°C; b) temperature rise of 0.5–1°C over no more than four consecutive time points; c) temperature rise of 1–1.5°C in one animal over no more than two consecutive time points. Temperatures were measured on D0 before administration of IVP (Investigational Veterinary Products, i.e., a specific amount of the recombinant virus to be tested) and 4 hours after IVP administration. Temperatures on D21 were measured only once, prior to necropsy.

[0345] Clinical observation

[0346] Clinical observation was performed twice daily from D4 to D21 on all animals. Clinical observation consisted of assessments of activity level, appetite, and other abnormalities using a scoring system as shown in Table 3. A zero score indicated the absence of clinical signs, and increasing clinical scores indicated an increase in the severity of clinical signs. An individual animal was considered to have CSF-related clinical signs if it showed a clinical score higher than 1 at three consecutive observation points. Clinical observation on D0 was performed before and 4 hours after IVP administration. Clinical observation on D21 was performed only once, prior to necropsy.

[0347] Table 3: Explanation of Clinical Scoring

[0348]

[0349] Injection site reaction

[0350] Injection site reactions were assessed twice daily from D0 to D21 for all animals. Injection site reactions consisted of redness, swelling, heat, and pain, assessed using a scoring system as shown in Table 4. Zero indicated no injection site reaction, and increasing scores indicated an increased degree of reaction. An injection site reaction was considered vaccine-related if the total score for injection site reactions at three consecutive observation points was greater than 1. Injection site reactions at D0 were assessed before and 4 hours after IVP administration. Injection site reactions at D21 were assessed only once, prior to necropsy.

[0351] Table 4: Scoring system for injection site reaction

[0352]

[0353]

[0354] White blood cell count

[0355] Approximately 1 mL of blood was collected from each piglet at times D0, 3, 5, 7, 10, and 21. Samples were collected using a suitable needle and syringe and transferred to EDTA-coated tubes. White blood cells in the blood samples were immediately analyzed using an Exigo-61812 automated hematology analyzer. Each sample was tested twice.

[0356] autopsy

[0357] All surviving piglets were humanely euthanized and autopsied on day 21. CSF-related pathogenicity was examined in key target tissues / organs such as tonsils, kidneys, spleen, lymph nodes, ileum / rectum, etc. Clinically relevant CSF-related gross lesions were fixed in formalin for possible future evaluation (groups 1–4 only). Fresh tonsils were collected from each piglet for CSFV virus isolation.

[0358] Splenic infarction, intestinal mucosal ulcers in the rectum and ileum, subcutaneous petechiae and mucosal hemorrhage in the kidneys, lymph nodes, and bladder are gross pathological manifestations of CSFV infection. Pigs exhibiting three of the aforementioned manifestations are considered CSFV infected. The absence of the aforementioned manifestations is considered an absence of CSFV infection. If the isolated CSFV virus is positive, an animal exhibiting one or two of the aforementioned manifestations is considered positively infected with CSFV.

[0359] Virus isolation

[0360] Nasal swabs were collected from each piglet at times D0, 3, 5, 7, 10, and 21. A sterile swab was inserted into one nasal cavity and gently rotated to collect secretions; the sampling process was repeated for the other nasal cavity. After collection, the two nasal swabs were pooled into a sterile tube containing storage buffer (4 mL MEM containing 10% FBS and 1% antibiotics). Each nasal swab sample was aliquoted into three tubes, 600 μl / tube. All samples used for virus isolation were stored below -40°C for CSFV virus isolation.

[0361] For tonsil homogenization, tonsil tissue was cut into 0.4–0.5 g pieces and ground into a homogenous paste using a mortar and pestle in a small amount of cell culture medium. Alternatively, a suitable homogenizer or automated homogenizer was used, and a 10% (w / v) suspension was prepared by adding Hanks' Minimal Essential Medium (MEM), followed by three freeze-thaw cycles to lyse the cells. Finally, the sample was centrifuged at 9000 g for 15 minutes at 4 °C, and the clear homogenate was filtered through a 0.45 μm filter.

[0362] For nasal swab samples, remove the swab from the viral delivery culture (VTM). Frozen swab samples should be thawed first. Gently vortex or swirl the swab in the fluid and pick it up against the side of the tube. Transfer the suspension to a new centrifuge tube, centrifuge at 8,000 x g for 10 minutes at 4°C, and collect the supernatant for further inoculation. If the sample is contaminated, sterilely filter it using a syringe filter (0.45 μm and / or 0.22 μm).

[0363] 48-well flat-bottom microplates were seeded 24 hours prior to the scheduled assay. PK / WRL cells were cultured at a concentration of 0.7–1.0 × 10⁻⁶ cells / mL. 5Plant at a concentration of 500 μL / mL per well. After one day of incubation, discard the culture medium in the wells with a pipette, leaving only a small amount of residual MEM to prevent the cell monolayer from drying out. Immediately seed 200 μL of the test sample and positive control onto the PK / WRL monolayer in duplicate, allowing adsorption at 37°C for 1–2 hours. Discard the inoculum with a pipette and dispense 500 μL of fresh growth medium containing 50X Pen Strep (Life-tech, catalog number 15140-122) and 250X GENTAMICIN / AMPHOTERICIN (Invitrogen, catalog number R01510) into each well. Incubate the plates at 37°C in a 5% CO2 incubator for 3 days.

[0364] To improve sensitivity, virus isolation was performed after two passages as described below. The microplates were sealed with tape and frozen at -80°C for at least 1 hour, then thawed twice at room temperature to lyse the cells. Two aliquots of the prepared supernatant were seeded into 48-well cell culture plates. Cells were inoculated with Pen Strep and GENTAMICIN / AMPHOTERICIN as described above. The cultures were incubated in a CO2 incubator at 37°C for 3 days, and passaged again. The third-generation plates were analyzed by IFA.

[0365] Immunofluorescence (IFA) method

[0366] Aspirate the culture medium from the virus-infected and simulated wells. Wash the wells twice with 1×PBS for 5 minutes each time, then fix with 4% formaldehyde for 30 minutes. After fixation, wash the wells as described above and permeabilize with 0.1% Triton X-100 for 15 minutes. Then wash all wells and add an appropriately diluted first polyclonal antibody (rabbit serum against CSFV) to each well, followed by incubation at 37°C for 1 hour. After washing three times with 1×PBS, add a 200-fold diluted second anti-rabbit antibody (e.g., donkey anti-rabbit IgG Alexa) to each well. 488 conjugated (Invitrogen, catalog number 21203). After 1 hour of incubation, the wells were washed twice with 1×PBS, and finally, the IFA-positive wells were observed under a fluorescence microscope.

[0367] Research Results

[0368] body temperature

[0369] exist Figure 8At all measurement points shown, the mean body temperature for each group was between 37.5 and 39.5°C (physiological range). According to the definition of fever, no fever was detected in any group after administration of IVP (Investigational Veterinary Products).

[0370] Clinical observation

[0371] No treatment-related clinical signs were observed in any group after IVP administration.

[0372] Injection site reaction

[0373] No abnormal injection site reactions were observed in any of the vaccinated animals after IVP administration.

[0374] Gross pathology

[0375] All piglets were necropsyd at the end of the study. No gross lesions were observed in any of the animals after administration of IVP.

[0376] White blood cell count

[0377] Throughout the study, white blood cell counts remained stable compared to day 0, and no difference was found between the IVP-treated group and the control group.

[0378] CSFV separation in tonsils

[0379] All tonsil samples were negative for VI (virus isolation).

[0380] Rhinovirus shedding

[0381] All nasal swabs were negative for VI.

[0382] in conclusion:

[0383] The results of the safety study are summarized in Table 5.

[0384] Table 5. Summary of Safety Performance

[0385]

[0386] Safety studies showed no fever, clinical signs, leukopenia, or gross pathology in any of the vaccination groups. Furthermore, no virus was isolated from the tonsils of DPI 21, and no virus was shed into the environment. In conclusion, all four recombinant viruses were safe in 3-week-old piglets.

[0387] Example 4: Efficacy verification of four candidate recombinant viruses

[0388] The purpose of this embodiment is to evaluate the efficacy of four recombinant viruses, namely QZ07-sdErnsH-KARD, QZ07-ddErnsHC-KRD, GD18-ddNproErnsH-KRD and GD18-ddErnsHC-KARD, in 3-week-old piglets.

[0389] A total of 55 piglets were divided into 6 groups (groups 1, 2, 3, 4, 5, and 6). Ten piglets from each of groups 1, 2, 3, and 4 were used for recombinant virus testing, while the remaining 10 piglets from group 5 served as challenge controls. The remaining five piglets from group 6 served as negative controls. On day 0, animals in groups 1, 2, 3, and 4 were injected with 1 mL (3 log TCID3) into the left neck. 50 / mL) / piglets were inoculated with QZ07-sdErnsH-KARD, QZ07-ddErnsHC-KRD, GD18-ddNproErnsH-KRD, and GD18-ddErnsHC-KARD, as shown in Table 6. On day 0, 1 mL of PBS was injected into the left neck of group 5 as a challenge control. 14 days after vaccination, animals in groups 1, 2, 3, 4, and 5 were inoculated with CSFV Shimen strain at ≥10 5 The dose of MLD / mL was administered via the left neck. On day 0, all piglets were clinically healthy and free of CSFV and PRRSV antibodies and antigens, including BVDV and PRRSV. All animals were healthy at the time of immunization.

[0390] Table 6: Summary of Research Design

[0391]

[0392]

[0393] Body temperature and clinical scores were collected daily from D12 to D30. Whole blood samples were collected from all animals at days 0, 3, 5, 7, and 16 post-challenge (DPC) for white blood cell counts. All serum samples were collected at D0 for efficacy testing. At DPC 16, all surviving piglets were humanely euthanized and scored for gross pathological appearance.

[0394] The attack control group and the negative control group were CSFV antibody negative up to the day of attack (DPC0), and the negative control group remained CSFV antibody negative for the remainder of the study (DPC16). The morbidity and mortality rates in the attack control group were 100% and 90%, respectively, thus validating the study.

[0395] Research process

[0396] body temperature

[0397] From DPC-2 to DPC 16, the body temperature of all animals was measured once daily. Temperatures were recorded in degrees Celsius. The average body temperature over the three days prior to the attack (DPC-2 to DPC 0) was set as the normal body temperature for each piglet. An individual animal was considered to have a fever if it met the following criteria: 1°C < body temperature at 3 (≥) consecutive measurement points; or 1.5°C < body temperature at 2 (≥) consecutive measurement points.

[0398] Clinical observation

[0399] Clinical observation was performed on all animals once daily from DPC 0 to DPC 16. As shown in Table 6, clinical observation consisted of assessments of activity level, body tension (rigidity, cramps), body shape (body condition, thinning of muscle tissue), respiration, gait, skin and conjunctival appearance, appetite, and defecation. A zero score indicated the absence of clinical signs, and increasing clinical scores indicated an increase in the severity of clinical signs. An individual animal was considered to have CSF-related clinical signs if it showed a total clinical score higher than 2 across 3 consecutive observation points.

[0400] Table 7 Clinical Scoring Instructions

[0401]

[0402]

[0403] White blood cell count

[0404] Collect approximately 1 mL of blood from each piglet at DPCs 0, 3, 5, 7, and 16. Collect the samples using a suitable needle and syringe and transfer them to EDTA-coated tubes. Analyze the white blood cells in the blood samples immediately using an Exigo-61812 automated hematology analyzer. Test each sample twice.

[0405] autopsy

[0406] Researchers or designated personnel performed necropsies on any humanely euthanized / discovered dead animals. All surviving piglets were humanely euthanized and necropsed at DPC 16. CSF-related pathogenicity was examined in key target tissues / organs such as tonsils, kidneys, spleen, lymph nodes, ileum / rectum, etc. CSF-related gross lesions with clinical signs were fixed in formalin for possible future evaluation. Fresh tonsils were collected from each piglet for CSFV virus isolation.

[0407] Splenic infarction, intestinal mucosal ulcers in the rectum and ileum, subcutaneous petechiae and mucosal hemorrhage in the kidneys, lymph nodes, and bladder are gross pathological manifestations of CSFV infection. Pigs exhibiting three of the aforementioned manifestations are considered CSFV infected. The absence of the aforementioned manifestations is considered an absence of CSFV infection. If the isolated CSFV virus is positive, an animal exhibiting one or two of the aforementioned manifestations is considered positively infected with CSFV.

[0408] Morbidity and mortality

[0409] Morbidity: Individual animals are considered to be pathological if they meet the following criteria: A) CSF-related clinical signs within the onset of fever (one day before fever + one day after fever), and B) CSF-related gross lesions.

[0410] Mortality rate: Mortality rate associated with CSF infection.

[0411] Research Results

[0412] body temperature

[0413] An individual's normal temperature is the average temperature over the three days prior to attack (D12 to D14). Rectal temperature results are shown in... Figure 9 middle.

[0414] One animal in the QZ07-ddErnsHC-KRD group and two animals in the GD18-ddNpro-ErnsH-KRD group developed fever after the attack; however, all three piglets recovered quickly. No fever was observed in the other two treatment groups.

[0415] Clinical observation

[0416] Overall clinical results are shown in Figure 10 In the challenge control group, animals developed clinical signs associated with CSFV infection from DPC 2, which increased dramatically thereafter, reaching a score as high as 21 from DPC 4 to the end of the study. Typical CSFV signs included, for example, inability to stand, cramps, inability to walk and eat, conjunctivitis, and very dry feces on the floor. In the QZ07-ddErnsHC-KRD group, two animals showed signs. In the GD18-ddNpro-ErnsH-KRD group, three animals showed signs. No clinical signs were observed in the other two treatment groups.

[0417] White blood cell count

[0418] The white blood cell counts in the challenge group animals decreased significantly from DPC 0 to DPC 5 and remained low until the end of the study. Conversely, throughout the study, the white blood cell counts in all IVP groups decreased slightly from DPC 0 to DPC 5 and remained stable, consistently above 8*10^6 cells / day. 9 / L.

[0419] Gross pathology

[0420] All piglets underwent necropsy at death or at the end of the study. Gross pathological findings for each group are presented in Table 8. All animals in the attack control group showed at least three typical CSF lesions. Tonsillitis, splenic infarction, renal hemorrhage, subcutaneous hemorrhage, and lymph node hemorrhage were commonly observed in this group. No gross pathological changes were observed in any of the treatment groups.

[0421] Morbidity, mortality and other efficacy parameters

[0422] The efficacy evaluation results are summarized in Table 8.

[0423] Table 8. Summary of Efficacy and Performance

[0424]

[0425] All recombinant viruses provided significant protection compared to the challenge control group. All animals that did not receive any test vaccines or challenge wild-type CSFV material remained healthy.

[0426] in conclusion

[0427] Efficacy studies demonstrated protection for each candidate, with no mortality observed in any group. Only a small percentage of piglets exhibited transient fever and clinical signs following the attack; however, they recovered quickly.

[0428] Example 5: Development of a DIVA ELISA based on mAb 6B8 specific epitopes

[0429] The purpose of this embodiment is to develop a CSFV DIVA ELISA method that can distinguish infected animals from animals vaccinated with a candidate DIVA vaccine based on the mAb 6B8 epitope.

[0430] Materials and reagents for DIVA ELISA

[0431] 96-well ELISA plate: Corning; catalog number 42592.

[0432] 96-well cell culture plate: Corning; catalog number 3595.

[0433] Coating buffer (CBS): 0.05M Na2CO3, 0.05M NaHCO3; pH 9.6.

[0434] Substrate solution: TMB, Invitrogen; catalog number 002023.

[0435] Termination solution: 1N HCl.

[0436] Washing buffer: PBST with 0.1% Tween-20.

[0437] Blocking buffer: PBST containing 5% skim milk.

[0438] Dilution buffer: PBST containing 5% skim milk.

[0439] Coating antigen: CSFV E2 protein (derived from the full-length E2 of QZ07), named QZ07-spE2-delTM (4.22 mg / ml), prepared and purified by the inventors.

[0440] Competitive protein: The full-length CSFV E2 protein with the KARD mutation at the 6B8 epitope (named QZ07-spE2-delTM-6B8-KARD, 0.549 mg / ml) was prepared and purified by the inventors.

[0441] The porcine serum sample to be tested: serum from the safety and efficacy study of QZ07-sdErnsH-KARD.

[0442] Blocking antibody: Monoclonal antibody 6B8.

[0443] Second antibody: HRP-conjugated goat anti-mouse IgG: Santa Cruze; catalog number SC-2005.

[0444] Competitive ELISA (cELISA)

[0445] Dilute the coating antigen to a final concentration of 2.0 μg / ml using coating buffer, and add 100 μl of the diluted coating antigen to each well of a 96-well ELISA plate. Seal the plate and incubate overnight at 4°C. Wash the plate four times with 300 μl / well wash buffer, then block with 200 μl / well blocking buffer at 37°C for 1 hour. After blocking, wash the plate four times with 300 μl / well wash buffer. Add 50 μl of serum sample mixed with 50 μl dilution buffer to the ELISA plate at 37°C for 2 hours. Wash the plate four times with 300 μl / well wash buffer. Dilute the blocking antibody mAb 6B8 1:800 with dilution buffer, add 100 μl / well to the plate, and incubate at 37°C for 1 hour. Wash the ELISA plate four times with 300 μl / well wash buffer. Next, add 100 μl of the second antibody diluted 1:10000 in dilution buffer per well and incubate at 37°C for 1 hour. Wash the ELISA plate four times with 300 μl of wash buffer per well. Add 100 μl of substrate solution (TMB) to each well and incubate at room temperature for 10 minutes without exposing the plate to direct light. Add 100 μl of stop solution (1N HCl) to each well. Read the OD. 450 And calculate the blocking rate according to the following formula:

[0446] (Blocking rate (%) = (Mean negative control (OD450) - Mean sample (OD450) / Mean negative control (OD450) * 100)) Dual-competitive ELISA (dcELISA)

[0447] Dilute the coating antigen to a final concentration of 2.0 μg / ml using coating buffer, and add 100 μl of the diluted coating antigen to each well of a 96-well ELISA plate. Seal the plate and incubate overnight at 4°C.

[0448] Wash the ELISA plate four times with 300 μl / well wash buffer, then block it at 37°C for 1 hour with 200 μl / well blocking buffer. After blocking, wash the plate four times with 300 μl / well wash buffer.

[0449] Serum samples were pretreated with a competitive protein. Briefly, the competitive protein was diluted to 1 μg / 60 μl with dilution buffer, while 60 μl of dilution buffer was used as a control. 60 μl of the diluted competitive protein was mixed with 60 μl of serum sample and incubated in a 96-well cell culture plate at 37°C for 2 hours.

[0450] Transfer 100 μl of pretreated serum sample to a blocking ELISA plate at 37 °C for 2 hours. Wash the plate four times with 300 μl / well wash buffer. Dilute the blocking antibody mAb 6B8 1:800 with dilution buffer and add 100 μl / well to the ELISA plate, incubate at 37 °C for 1 hour. Wash the ELISA plate four times with 300 μl / well wash buffer. Then, add 100 μl / well of the second antibody diluted 1:10000 with dilution buffer and incubate at 37 °C for 1 hour. Wash the ELISA plate four times with 300 μl / well wash buffer. Add 100 μl of substrate solution (TMB) to each well and incubate at room temperature for 10 minutes without exposing the plate to direct light. Add 100 μl of stop solution (1N HCl) to each well. Read OD. 450 And calculate the blocking rate according to the following formula:

[0451] (Blocking rate (%) = (mean negative control (OD450) - mean sample (OD450) / mean negative control (OD450) * 100))

[0452] Different combinations of DIVA mutations in the 6B8 epitope are feasible for DIVA.

[0453] Using the above-described dcELISA, serum samples pretreated with different amounts of competitive proteins were used in overdose safety studies of candidates with RD (positions 24 and 25), KRD (positions 14, 24 and 25), or KARD (positions 14, 22, 24 and 25) mutations in the 6B8 epitope at different attenuated backgrounds (QZ07-sdErnsH or GD18-ddNpro-ErnsH).

[0454] The results are shown in Figure 11 In contrast, convalescent serum derived from RD, KRD, or KARD vaccine candidates showed low blocking rates (below 40%), while WT-derived serum maintained high blocking rates (above 50%). Therefore, each combination of 6B8 epitope mutations demonstrates the feasibility of generating DIVA candidates.

[0455] Comparison of cELISA and dcELISA for DIVA

[0456] Serum samples from previous safety evaluation studies (0, 7, 14, and 21 days post-vaccination) and previous efficacy evaluation studies (0, DPC0, and DPC16) derived from candidate QZ07-sdErnsH-KARD were used to compare the effects of cELISA and dcELISA on DIVA.

[0457] The results are shown in Figure 12 In the safety evaluation study, dcELISA results showed a lower blocking rate against 6B8 in serum samples from animals vaccinated with the QZ07-sdErnsH-KARD candidate vaccine. In the efficacy evaluation study, a higher blocking rate was observed after challenge with the Shimen wild-type strain, while a lower blocking rate was observed in serum before challenge (DPC0). Therefore, by dcELISA, animals infected with CSFV can be well distinguished from animals vaccinated with the QZ07-sdErnsH-KARD DIVA vaccine candidate.

[0458] However, high blocking rates were also observed in serum samples from a safety evaluation study conducted without challenge (21 days post-vaccination) using cELISA. Therefore, cELISA is not suitable for the DIVA of this candidate.

[0459] Example 6: Immunofluorescence assay (IFA) for determining the binding of 6B8 mAb to the mutated 6B8 epitope.

[0460] The binding of 6B8 mAb to the mutated 6B8 epitope (test sample) was determined by immunofluorescence assay (IFA) according to the following steps:

[0461] 1. In a 96-well microtiter plate, PK-15 cells were introduced at a concentration of approximately 1.1 × 10⁻⁶. 4Seed cells / well in duplicate and infected with the following CSFV at an MOI of 0.001 to 0.01:

[0462] (i) Test sample: CSFV containing E2 protein with modified 6B8 epitope;

[0463] (ii) Positive control: CSFV containing the E2 protein with the wild-type 6B8 epitope (such as attenuated wild-type strains QZ07-dErnsH or GD18-ddNrpo-ErnsH).

[0464] (iii) Negative control: CSFV containing an E2 protein with a KARD mutation in the 6B8 epitope as described herein (e.g., such as QZ07-sdErnsH-KARD).

[0465] CSFV-inoculated cells were kept in an incubator at 37°C and CO2 (4 to 6%) for 3 days without altering the fluid or adding culture medium.

[0466] 2. Discard the culture medium and wash the cells twice with 1×PBS (200 to 250 μL / well).

[0467] 3. To fix CSFV-infected cells, add 4% formaldehyde to the assay plate (50 μL / well).

[0468] 4. Incubate the plate at room temperature for 30-40 minutes. Gently remove the formaldehyde in a fume hood and wash the cells once with 1×PBS (200 to 250 μL / well).

[0469] 5. To facilitate permeabilization of the cell membranes of CSFV-infected cells, add 0.1% Triton X-100 to each well (50 μL / well). Incubate the assay plate at room temperature for 15–20 minutes. Wash the assay plate twice with 1×PBS (200–250 μL / well).

[0470] 6.6 B8-specific mAbs (such as antibodies produced from hybridomas deposited at CCTCC with accession number CCTCC C2018120) were diluted to 1:500 to 1:1000 with PBS containing 5% BSA, and then added to the assay plate at 50 μL / well. The plate was capped and incubated at 37°C for 1–2 hours.

[0471] 7. Rinse the test plate three times with 1×PBS (250μL / well).

[0472] 8. Dilute the second antibody, namely the Alexa antibody that specifically binds to the 6B8 antibody, 400-fold with PBS containing 5% BSA. 488-conjugated donkey anti-mouse antibody (ThermoFisher, Invitrogen, catalog number 21202) was added to the assay plate at 50 μL / well. The plate was capped and incubated at 37°C for 1–2 hours.

[0473] 9. Rinse the assay plate three times with 1×PBS (250 μL / well). Finally, add 1×PBS, 100 μL / well. Read the final fluorescence signal using an inverted fluorescence microscope.

[0474] The negative results (two replicates) of the test sample in this IFA indicate that one or more mutations in the 6B8 epitope of the E2 protein result in specific inhibition of the binding of the 6B8 monoclonal antibody to such mutated 6B8 epitopes.

[0475] Example 7: Safety study in pregnant sows

[0476] According to Table 10 below, sows of the same age and origin were vaccinated on day 55 of gestation, and necropsy was performed on day 100 of gestation.

[0477] Table 10.

[0478]

[0479] Prior to the study, all sows were negative for CSFV antibodies. All sows in the negative control group remained negative for both antibodies and antigens against CSFV until the end of the study.

[0480] No abnormalities related to vaccination were observed in the study: i) no injection site reaction was noted in any animal; ii) no animal showed a temperature above 38.8°C at any time point; iii) no clinical signs related to vaccination were observed in the four vaccination groups; iv) no viremia was detected in sows in the four vaccination groups, while viremia was detected in the positive control group between 7 and 14 dpi.

[0481] As shown in Table 11, vaccination has no effect on reproductive performance.

[0482] Table 11.

[0483]

[0484] Note: In group 6, a sow had a difficult birth, which resulted in the death of 9 piglets.

[0485] Based on the above preliminary results, vaccination with the four candidate vaccines is safe in pregnant sows. sequence list <110> Boehringer Ingelheim Animal Health (China) Co., Ltd. <120> Recombinant classical swine fever virus <130> P20193023 <160> 35 <170> PatentIn version 3.5 <210> 1 <211> 12296 <212> DNA <213> Artificial sequence <220> <223> QZ07-wt <400> 1 gtatacgagg ttagttcgtt ctcgtgtaca atattggaca aaacaaaatt ccgatttggc 60 ctagggcacc cctccagcga cggccgaact gggctagcca tgcccacagt aggactagca 120 aacggaggga ctagccgtag tggcgagctc cctgggtggt ctaagtcctg agtacaggac 180 agtcgtcagt agttcgacgt gagcaggagc ccacctcgag atgctatgtg gacgagggca 240 tgcccaagac acaccttaac cctggcgggg gtcgccaggg tgaaatcaca ccatgtgatg 300 ggggtacgac ctgatagggc gctgcagagg cccactaaca ggctagtata aaaatctctg 360 ctgtacatgg cacatggagt tgaatcattt tgaactattg tataaaacaa acaaacaaaa 420 accaatggga gtggaggaac cggtgtatga catcgcaggg agaccattat ttggggaccc 480 aagtgaggta cacccacaat caacactgaa gctaccacac gacaggggaa gaggtaatat 540 cagaactaca ctgaggacc tacctaggaa agcgactgc aggagtgga accacctagg 600 accagttagt gggatatacg taaagcctgg ccctgtctc tatcaggact acatgggccc 660 tgtctaccat agagccccat tagattttt tggtgaggcc caatttgtg aggtgaccaa 720 gaggataggt agggtgacgg gtagtgacgg aaagcttac cacatatatg tgtgcatcga 780 cggttgcata ctgttgaagt tagccaaag gggcgcgccc agatccctaa agtggactag 840 gaacttcacc gactgtccac tgtgggtcac tagttgttct gatgatggca caggtgacag 900 chaaaaaaaaaaaaaaaaaaaaaaaatta aagataagccc 960 tgagaaggac agtaagacca agccacctga tgctacaatt gtggtagagg gagtaaaata 1020 ccaagtaaaaaaaggca aagtcaagg gagaacact ccagatggcc tgtaccataa 1080 taagaaaaa ccaccagagt ccaggaaa actagaaaaa gccctattgg cctggggcagt 1140 gatagcaata gtgctgtacc agcctgtagc agccgagaat ataacccaat ggaacctgag 1200 tgacaacggc acagcggca tccagcaagc tatgtatctc agaggggtca ataggagctt 1260 gcatgggatc tggctgaaa aatatgcaa gggggtccct accatctgg ccactgacac 1320 ggaactgaca gagatacgcg ggatgatgga cgccagtgag aggacgaact acacgtgttg 1380 taggttgcag agacacgaat ggacaaca tggctgtgc aactgtaca acatagaccc 1440 ctggattcag ttaatgaca ggacccaagc aaatttgaca gaaggccctc cagataaga 1500 gtgtgccgtg acttgcaggt atgacaaaa taccgatgtt aacgtggtca cccaggccag 1560 gatagacct actactctga ctggctgcaa gaaagggaaaatttcat ttgcaggtac 1620 ggtcatagag ggcccatgca atttcaacgt atccgtggag gatacttat atggcgacca 1680 tgagtgtgc agcctgttcc aggacacggc tctgtaccta ttagatggaa tgaccacac 1740 tatagagaaa gccaggcagg gtgcggcaag agtcacatct tggctcggga gaactcag 1800 aaccacagggg agaagttgg agagaggaag caaacctgg ttcggtgcct atgccctgtc 1860 accttactgc aatgtaaca ggaaaatagg gtacatatgg tacacgaca attgcactcc 1920 ggcatgccctc ccaaaaaaaaaataat aggccagga aagtttgaca ccaatgcaga 1980 agacgggaag attcttcatg aaatgggggg ccacctatca gaattcttgt tgctttctct 2040 ggtagtcctg tctgacttcg ccccagaaac ggccagtaca ttatacctaa tcttacacta 2100 tgcaatccct cagtcccgtg acgaacccga ggtttgcgat acaaaccagc tcaacctaac 2160 agtgggactt aggagagaag atgtggtacc atcatcagtc tggaatattg gcaaatatgt 2220 gtgtgttaga ccagattggt ggccgtatga aactaaggtg gctctactgt ttgaagaggc 2280 gggacaggtc ataaagttag ctctacgggc actgagggat ttaactagag tctggaacag 2340 tgcatcaact actgcgttcc tcatctgctt gataaaaata ttaagaggac aggttgtgca 2400 aggtataata tggctgctgc tggtgactgg ggcacaaggg cggttgtcct gcaaggaaga 2460 ctacaggtat gcgatatcat caaccaatga gatagggccg ctaggggctg aaggtctcac 2520 caccacctgg aaaagaata accatggttt gcagctggat gacgggactg tcagggccat 2580 ttgcactgca gggtccttta aagttatagc acttaatgtg gtcagtagga ggtacctggc 2640 atcattacac aagagggctt tacccacttc agtaacattt gaactcctat ttgatgggac 2700 tagtccagca attgaggaga tgggagatga ctttggattt gggctgtgcc cttttgacac 2760 aacccccgtg gtcaaagga agtacaatac cactttatta aacggtagtg ctttctatct 2820 agtctgccca ataggatgga cgggtgtcat agagtgcacg gcagtaagcc ctacaacctt 2880 gagaacagaa gtggtgaaga ccttcaagag agaaagcct ttcccacaca gagtgggtttg 2940 cgtgaccact gttgtagaaa aagaagacct gttctactgc aagtgggggg gtaattggac 3000 atgtgtaaaa ggcaacccgg tgacctacat gggggggcaa gtaaaacaat gcagatggtg 3060 cggttttgac ttcaaggagc ccgatgggct cccacactac cccataggca agtgcatcct 3120 agcaaatgag acgggttaca gggtagtgga ttccacagac tgcaatagag atggcgtcgt 3180 tatcagcact gaaggtgaac acgagtgctt gattggcaac accaccgtca aggtgcacgc 3240 gttggatgga agactgggcc ctatgccgtg cagacccaaa gaaatcgtct ctagcgcagg 3300 acctgtaagg aaaacttcct gcaccttcaa ctacacaaag acactaagaa acaagtacta 3360 tgaacccagg gacagctatt tccagcaata tatgcttaag ggcgagtacc aatactggtt 3420 tgatctggac gtgaccgacc accacacaga ctactttgcc gaatttgttg tcttggtggt agtggcacta ttagggggga ggtacgtcct atggctaata gtgacctatg taattttaac agagcaactc gctgccggtt tacagctggg ccaaggcgag gtagtactga tagggaactt aattacccac acggacaatg aggtagtggt attacktctta ctgctctacc father agacgagcct father ggatactact gctgtttcat gccatgacca acaacccagt 3720. taagaccatg acagtagcat tgctgatgat cagtggggtc gccaagggtg ggaaaacaga tggtggttgg cagaggcagc cggagaccaa ttttgacatt caactcgcac tggcagttat agtagtcgtt gtgatgttac tggcaaagag agcccgact acttttcccc tggtgatcac 3900. agtggcaacc ttaagaacag ctaagataac caatggtttc agcacagatc tagctatagc cacagtgtcg gcagctttgc taacctggac ttatatcagt gactactaca aatataagac ttggctacag tacctcatca gcacggtgac tgggatcttc ctaataaggg tactgaaggg aataggcgag ctagacatgc acgccccac tttgccatct cacagacccc ttttctacat cctcgtgtac ctcatctcca ctgctgtggt gactagatgg aacctggacg tagccggact 4200 gctgctacag tgtgtcccaa cacttctaat ggtgttcacg atgtgggctg acattctcac 4260 cctaatcctc gtgttaccca cttatgaact ggcaaagttg tattacctta aggaagtgaa 4320 gatcggaacc gaaagggat ggctgtggaa aactaactat aagagggtaa atgacatcta 4380 tgaagtcgac caagctggcg aggggtcta cctcttccct tcgaaaa agactagtgc 4440 tataacaagc accatgttgc cattgatcaa agccatactc attagctgca tcagtaacaa 4500 gtggcaactc atatatttac tgtacctgat attcgaagtg tcctactacc ttcacaagaa 4560 agtcatagat gaaatagctg gtgggaccaa cttcgtttca aggctagtgg cagccttaat 4620 tgaagttaat tgggccttcg your acat agtaaagc ctaaagaagt tctttttgct 4680 gtccagtaga gttaaagaat tggtcatcaa acacaaagtg aggaatgaag tagtggcccg 4740 ctggttcgga gatgaagaga tctatgggat gcccaagttg atcggcttag tcaaggcagc 4800 aactctaagt aaaaaaaac actgtatctt gtgcaccgtc tgcgaggaca gagattggag 4860 aggagaaacc tgcccaaaat gtgggcgttt cggaccacca gtgatctgtg gtatgaccct 4920 agccgacttc gaggagaagc attataagag gatattcatc agggaggacc aatcagatgg 4980 accgctcagg gaggagcgtg cagggtactt acagtacaga gctaggggtc aactgtttct 5040 gaggaatctc ccagtgttgg cgacaaaagt caagatgctc ctggttggta acctcgggac 5100 ggaggttggg gatttggagc accttggctg ggtgcttaga gggcctgctg tctgcaagaa 5160 ggttactgaa catgaaaagt gtgctacgtc tataatggat aagttgactg cttcttcgg 5220 cgttatgcca agaggtacca cccccagagc ccccgtgaga tttcccacct ccctcctaaa 5280 gataagaaga gggctagaga cgggttgggc ttacacacat caaggtggca ttagctcagt 5340 tgaccatgtg acttgtggga aagacttgct ggtgtgtgac actatgggcc ggacaagggt 5400 cgtttgccaa tcaaataata agatgactga cgaatccgaa tacggggtca aaaccgactc 5460 agggtgccca gaaggggcca gatgttatgt gttcaaccct gaggcagtta acatatcagg 5520 cactaaaggg gccatggtcc acttacaaaa aactggtggg gagttcacct gcgtaacagc 5580 atcaggaacc ccggccttct ttgatctcaa gaacctcaag ggctggtcag ggctaccgat 5640 attcgaagca tcgagtggaa gggtagtcgg aagggtcaag gtcgggaaga acgatgactc 5700 taaaccaacc aaactcatga gtgggataca aacggtctct aaaagtgcca ctgacctgac 5760 ggagatggta aagaagataa caactatgaa caggggagag ttcagacaga taaccttggc 5820 cacaggtgct gggaaaacta cagagctccc caggtcagtc atagaagaga tagggagaca 5880 caaaagggtg ttggtattga tccccttgag ggccgcagca gaatcagtat accaatatat 5940 gaggcagaaa cacccaagta tagcattcaa cctgaggata ggggagatga aggaaggtca 6000 catggccacg gggataacct atgcctccta cggttacttt tgccagatgc cacaacctaa 6060 gctgagggcc gcaatggtag agtactccta catctttcta gatgagtacc attgtgccac 6120 cccagaacaa ctggctatca tggggaagat ccacagattc tcagagaacc tgcgggtggt 6180 agctatgaca gcgacaccag cagggacagt aacaactact gggcagaaac accctataga 6240 ggagttcata gccccggaag taatgaaagg agaagactta ggttcagagt acttagacat 6300 tgccggacta aagataccag tagaggagat gagacaac atgctttt ttgtaccac 6360 taggaatag gcggtagagg cggcaagaa actgaaagct aaggataca actcaggcta 6420 ttactacagt ggtgaggatc catctaacct gagggtagtc acatcgcagt cccatacgt 6480 ggttgtagcg accaacgcga tagaatcagg cgtcactctc ccggaccttg acgtggtcgt 6540 tgacacggga ctcaagtgtg agaaaagaat ccgattgtca cccagatgc ctttcatagt 6600 gactggccta aaagaatgg ctgttaccat tggggacaa gcccagagaa gaggggggt 6660 tggaagta aagcccggga gatacag gagccaagaa acccctgtcg gctctagga 6720 ctaccactac gatttattgc aagcccagag gtacggtata gagatggga taaatatcac 6780 caatccttc aggaatga actatgatg gagccctt gaggagata gcctgatgat 6840 aacacaattg gaatcctca acaatctact gatatcagag gagctgccgg tggcagtaaa 6900 aaatataatg gctaggactg accaccaga accaattcaa ctagcatata atagctacga 6960 gabacaagtg cctgtgttgt tcccaaaat aagaatgga gaggtgactg acacttacga 7020 tacttacacc ttcatcaatg caagaaaatt gggagatgat gtacctccct acgtgtatgc 7080 cacagaagat gaggacttgg cagtggaact gttgggccta gattggccgg accctgggaa 7140 ccaaggcact gtggaggccg gcagagcact aaaacaggtg gtcggtctat caacagccga 7200 gaatgccctg ttagtagcct tgtttgcta cgtagggtac caggccctct caaagaggca 7260 tatacctgtg gtcacagaca tatactcagt tgaagatcac aggctagagg acaccacaca 7320 cctacagtac gctccgaatg ccatcaagac ggaggggaag gagactgaat tgaaggagtt 7380 ggctcagggg gatgtgcaga gatgcgtgga agcgatgacc aattacgcga gagggggcat 7440 ccaatttatg aagtcacagg cactgcaggt gagaaacc cccacttata aagagacaat 7500 gaatactgta gcagactatg tgaaaaagtt tatcgaggca ctgtctgata gcaaggaaga 7560 catcttgaaa tatgggctgt ggggcgtaca tacggccttg tacaagagca ttggtgccag 7620 gcttggtcac gaaaccgcgt tcgcaaccct agccgtgaaa tggctggcat ttggggggga 7680 atcaatagca gatcatataa aacaagcggc tacagacttg gtcgtctact atatcatcaa 7740 cagacctcag ttcccaggag acacagagac acaacaggag gggagaaatt ttgtggccag 7800 cctactggtc tcagccctag caacttacac atataaaagc tggaactata ataacctgtc 7860 caagatagta gaaccggctt tggccaccct gccctatgcc gctaaagccc ttaaattatt 7920 tgcccctacc aggctagaga gcgtcgtcat attgagcacc gcaatctaca aaacatacct 7980 atcaatcagg cgaggcaaaa gcgatggatt gctaggtaca ggggttagtg cggctatgga 8040 gattatgtca caaaatccgg tatcagtggg catagcagtt atgctggggg ttggggctgt 8100 agcagcacac aacgcaattg aagccagtga gcagaagaga acactactta tgaaagtttt 8160 tgtaaagaac ttcttggacc aagcagccac agatgaacta gtcaaagaga gccctgagaa 8220 aataataatg gccttgtttg aagcagtgca aacagtaggc aatcctctta ggctagtgta 8280 ccacctttac ggggtttttt ataaagggtg ggaagcaaaa gagttggccc aaaggacagc 8340 cggcaggaat cttttcacct tgataatgtt tgaggccgtg gaactattgg gagtagatag 8400 cgaaggaaaa atccgccaac tatcgagtaa ttacatatta gagctcctgt ataagttccg 8460 tgacagtatc aaatctagtg tgagggagat agcaatcagc tggcccctg cccccttag 8520 ttgcgattgg acccacag atgacagaat agggcttccc cataacaatt acctccaaat 8580 ggagacaaga tgcccttgtg gctacaggat gaagcagta aaaacctgtg ctggggtt 8640 gagactctg gagagggag gttcattcct ctgcaggaat aaattcggta gaggtcacg 8700 gaactatagg gtgacaaat actatgatga caatttatca gaataaac cagtgataag 8760 aatggaagga catgtggaac tatatta gggggccact atcaactgg actttaacaa 8820 cagtaaaaca gtactggcaa ccgacaatg ggaggttgac cattccaccc tggtcaggc 8880 gctcaagagg cacacagggg ctgggtacca aggagcgtat atgggtgaga aacctaacca 8940 caacatctg atagagagag actgtgcaac gatcacaaa haaggtttt acttcatca 9000 gatgaagagg gggtgtgcgt tcacttatga cttgtccctc cacaacctca cccggttaat 9060 cgaattgta cacaaaacg acctggaaga tagagaatc cctgctgtta cggttacaac 9120 ctggctggcc tacacattg tgaatgaga catagggacc ataaaccag ttttgggga 9180 aaaagtaaca ccggaaaaac aggaggaggt agccttgcag cctgctgtgg tggtggacac 9240 aacagatgtg gccgtgaccg tggtggggga aacctctact atgactacag gggagacccc 9300 aacggcattc accagcttag gttcagactc taaagttcaa caagttctga agttaggggt 9360 ggatgagggt caataccccg ggcccagtca gcagagagca agcttgctcg acgctataca 9420 aggcgtggat gaaaggccct cggtattgat attgggatct gataaggcca cctccaatag 9480 ggtgaagacc gcaaagaatg tcaagatatt caggagcaga gaccccctgg aactgagaga 9540 aatgatgaga agagggaaga tcctggtcat agccctatgt aaggtcgaca ctgctctact 9600 gaaatttgtt gattacaaag gcaccttcct gaccagagaa accctagagg cattaagtttt 9660 gggtaagcct aagaaaaaaa acataaccaa gacagaggca caatggttgt tgtgcctcga 9720 aaaccaaata gaagagctgc ctgactggtt cgcagctgag gagcccgtat ttctggaagc 9780 caacatcaaa cgtgacaagt atcacctagt gggggatata gctactatca aagaaaaagc 9840 taaacaactg ggggcaacag actccacaaa gatatcaaaa gaggttggag ctaaagtata 9900 ttctatgaag ctgagtact gggtgataca agaagagaat aaacagggca gcttagcccc 9960 tttgtttgaa gagctcctgc aacagtgccc acctgggggc cagaataaaa ccacacatat 10020 ggtctcagcc taccactgg ctcaagggaa ctggatgcca gttggttgtc acgtgttcat 10080 ggggaccata cccgccagaa gaaccagac ccatccctat gaggcatacg tcaagctgag 10140 ggagttggta gatgaata agatgagac gctatgtggc ggttcaggcc taagtaagca 10200 caacgaatgg gtaattcgta agatcaagca tcaagggac ctgaggacca aacacatgtt 10260 gaaccccggg aaggttgcag agcaactgct tagagagga cacacaca atgtatatata 10320 taagactata ggctcagtga tgacagcac tggtatcagg ctggaaagt taccgtggt 10380 caggggcccaa acagacaaaaaaaaaagaaaaagaaagga 10440 agagaactta cagactccag gcttacaca gagttaatg gaagtctctca atgcattaaa 10500 aagacccgat cttgaggcct cttacgacgc tgtggagtgg gaggaattgg agaaggaat 10560 aaataggaag gtgctgcag gttctttga acacagaat ataggagg ttctggattc 10620 agaaaaaaac aaggttgaag agatcataga cagtttgaga aaaggtagga gtatcaggta 10680 ctatgaaact gcaatcccaa aaaacgagaa gagggacgtc aatgatgact ggactgccgg 10740 tgactttgta gacgagaaaa agcccagggt gatacaatac cctgaggcta aaaccaggtt 10800 ggccatcact aaagtaatgt acaagtgggt gaagcagaaa ccagtagtca tacccggcta 10860 tgaaggtaag acacctctgt tccaaatctt tgacaaagtg aagaaagaat gggaccaatt 10920 ccaaaatcca gtggctgtga gctttgacac caaagcgtgg gacacccagg tgactacagg 10980 agacctggaa ctaataaggg atatacagaa gttctacttc aagaagaagt ggcacaaatt 11040 cattgacacc ctaaccatgc acatgtcaga agtacccgta attagtgccg acggggaggt 11100 gtacataagg aaggggcaga gaggcagtgg acaacctgat acgagcgcag gcaacagcat 11160 gttgaatgta ttaacaatgg tttatgcctt ctgtgaggcc acgggagtgc cctataagag 11220 ttttgacaga gtggcaaaga tccacgtctg cggggatgat ggtttcttga tcactgaaag 11280 ggctcttggt gaaaaatttt cgagtaaagg agtccagatc ctatatgaag ctggtaagcc 11340 ccaaaaaatt acagaagggg ataagatgaa agtggcctac cagtttgatg acatcgagtt 11400 ctgctcccat acaccagtgc aagtaaggtg gtcagacaat acttccagtt atatgccggg 11460 gaggaacacg actacaatcc tggcaaaaat ggctacaagg ttagattcca gtggtgagag 11520 gggcactata gcatatgaga aggcggtggc gtttagcttc ttatgatgt actcctggaa 11580 cccactgatc agaaggatat gcttactggt gttgtcaact gaactgcaag tgagaccagg 11640 gaagtcaacc acctattact atgaagggga cccaatttct gcttacaagg aggtcatagg 11700 ccataatctc tttgacctta aaagaacaag ctttgagaaa ctagctaagt taaatcttag 11760 tatgtccaca ctcggggtat ggaccagaca caccagcaaa agattactac aagactgtgt 11820 caacgtcggc actaaagagg gcaactggct ggttaatgca gacagactgg tgagtagcaa 11880 gacaggaaat aggtatatac ctggagaggg tcatacccag caagggaaac attatgaaga 11940 actgatattg gcaaggaagc cgatcagcaa ttttgaaggg actgatagat acaatttggg 12000 cccaatagtc aacgtagtgt tgaggaggct gagagtcatg atgatggctc ttataggaag 12060 gggggtgtaa gcatggccgg cccttaaccg ggccctatca gtagaaccct gttgtaaata 12120 acactaactt attatttatt taaatactat tatttattta tttatttatt tattgaatga 12180 gcaaggattg gtacaaacta cctcatgtta ccacactaca ctcattttaa cagcacttta 12240 gctggaggga aaatcctgac gtccatagtt ggactaaggt aatttcctaa cggccc 12296 <210> 2 <211> 12299 <212> DNA <213> Artificial Sequence <220> <223> GD18-wt <220> <221> misc_feature <222> (12256)..(12256) <223> n is a, c, g, or t <400> 2 gtatacgagg ttagttcgtt ctcgtgtaca atattggaca agaccaaaat tccgatttgg 60 cctagggcac ccctccagcg acggccgaac tgggctagcc atgcccacag taggactagc 120 aaacggaggg actagccgta gtggcgagct ccctgggtgg tctaagtcct gagtacagga 180 cagtcgtcag tagttcgacg tgagcaggag cccacctcga gatgctatgt ggacgagggc 240 atgcccaaga cacaccttaa ccctggcggg ggtcgccagg gtgaaatcac accatgtgat 300 gggggtacga cctgataggg tgctgcagag gcccactaac aggctagtat aaaaaatctc 360 tgctgtacat ggcacatgga gttgaatcat tttgaactac tatacaaaac aaataaacaa 420 aaaccaatag gagtggagga accggtgtat gacatcgcag gaagaccatt ttcggggac 480 ccaagtgagg tacacccaca atcaacactg aagctgccac atgacagggg gagaggtaat 540 atcagaacta cactgaagaa cctacctagg aaaggcgact gtaggagtgg aaaccaccta 600 ggaccagtca gtgggatata tgtaaaaccc ggccctgtct tctatcagga ctacatgggc 660 cctgtctatc atagagctcc attggagttt ttgaagagg cccagctgtg tgaggtgact 720 aagagaatag gtagggtgac gggtagtgat gggaagcttt accacatata tgtgtgcatt 780 gacggttgca tactgctgaa gttagccaaa aggggcacgc ctagatccct aaagtggact 840 aggaacttca ccgactgtcc actatgggtc actagttgtt ctgatgatgg cgcaggtggc 900 agaaaaccaaaaaccaaaaaaaggc aagggtaat t'aaaatagc cccaaaagg 960 catgagaagg acagcaaaac caagccacct gatgccacga tcgtggtaga gggagtaaaa 1020 taccaagtga aaagaaagg caagtcaa gggaaca ctcagatgg cctataccat 1080 aaagaaca aaccaccaga gtccaggaag aaactagaaa aagccctact ggcttggggca 1140 gtgataacaa tcgtactgta ccagcctgta gcggccgaga atatactca gtggaacctg 1200 agtgacaatg gcacaagcgg tatccagcaa gccatgtatc ttagaggggt tataggagt 1260 ctacatggga tctggctga aaaaatatgc aaaggggtcc ctactcacct ggctactgat 1320 acggagctga cagagatacg agggatg gacgccagcg agaggacaa ctatacgtgt 1380 tgcaggttgc agagacacga atggaataa catggatggt gtaactggta cacatagac 1440 ccctggattc aattaatgaa caggaccca gcaatctga cagaggccc cccggattag 1500 gagtgcgccg tgacttgcag gtatgacaaaatgctgacg ttaacgtggt cacccaggcc 1560 aggaatagac caccactct gaccggctgc aagaaggaa aaacttttc atttgcaggt 1620 acgattatag agggcccatg caatttcaac gtctccgtgg aggacatcct atatggggac 1680 catgagtgtg gcagcctgtt ccaggacaca gctctgtacc tattagatgg aatgaccaac 1740 actatagaga aagccaggca gggtgcggca agagttacat cctggcttgg gaggcaactc 1800 agcaccacag ggaagaagtt ggagagagga agcaaaacct ggttcggcgc ctacgccctg 1860 tcaccttact gtaacgtaac aaggaaagtg gggtacatat ggtatacgaa caattgcact 1920 ccggcatgtc tcccaaaaaa cacgaaaata ataggtccag gaaaattcga taccaacgcg 1980 gaagatggga agatacttca tgaaatgggg ggccacctat cagaattttt gttgctttct 2040 ttagtaatcc tgtctgactt cgccccggag acggccagta cgctatacct aatcttacac 2100 tatgcaatcc ctcagtccca tgaagagcct gaaggttgcg atacgaacca gctcaatcta 2160 acagtgggac ttaggacaga agatgtggta ccatcatcag tttggaatat cggcaaatat 2220 gtgtgtgtca gaccagactg gtggccgtat gaaactaagg tggctttgct gtttgaggag 2280 gcaggacagg ttataaaact agctctacgg gcactgagag atttaactag agtctggaac 2340 agtgcatcaa ctactgcgtt cctcatctgc ttgataaaa tattaagagg acaggttgtg 2400 caagtataa tatggctgct gctggtact ggggcacaag ggcggttgac ctgtaggaa 2460 gactacaggt atgcgatatc atcaccaat gagatagggc cgcttggagc tgaggtctc 2520 actaccacct ggaaagaata caccatggt ttacagctgg atgacggc tgtcaggggcc 2580 acttgcactg cagggtcctt taaagttata gcacttaatg tggttag gaggtacctg 2640 gcatcattac acagaggggc ttgcccacc tcagtacat tgaacct atttgatggg 2700 accagcccag taattgagga gatgggagac gactttggat tgggctg cccttttgac 2760 acgatccctg tggtcaagg gaagtataac accaccttat taacggcag tgctttctat 2820 ctagtctgcc ctataggatg gacgggtgtt atagagtgca cggcagtaag ccccacaacc 2880 ttgagaacag aagtggtgaa gaccttcaag agagagaagc ctttccctca cagagtggac 2940 tgcgtgacca ctatagtaga aaagagac ctgttctatt gcaggctggg gggtaattgg 3000 acatgcgtga aaggtgaccc ggtgacctac acggggggcc aagtaaaaca atgcaggtgg 3060 tgcggtttca acttcaagga gcctgatggg ctcccacact accccatagg caagtgcatc 3120 ctagcaaatg agacgggata cagggtagtg gactccacag actgcaacag agacggcgtc 3180 gtcatcggca ctgaaggaga gcatgagtgc ttgatcggca acaccaccgt caaggtgcac 3240 gcgctggacg gaagactggc ccctatgcct tgcagaccca aagaaatcgt atctagtgcg 3300 ggacctgtaa ggaaaacttc ctgcacattt aactatacaa agactttgag gaacaagtac 3360 tatgagccca gggacagcta cttccagcaa tacatgctta agggcgagta tcaatactgg 3420 tttgatctgg acgtgacaga ccaccacaca gactacttcg ccgagtttgt tgtcttggtg 3480 gtagtggcac tattaggggg aaggtacgtc ctgtggctaa tagtgaccta tagatttcta 3540 acagagcaac tcgctgctgg tttacagcta ggccagggcg aggtggtgct gatagggaac 3600 ttaatcaccc acatggacaa cgaggtagtg gtatacttct tactgcttta cctaataata 3660 agagacgagc ccataaagaa atggatacta ctgctgttcc atgccatgac caacaaccca 3720 gttaagacca tgacagtagc attgctaatg ataagcgggg tagccaaggg tgggaaaata 3780 gatggtggtt ggcagaggca gccggagacc aatttgaca tccaattcgc actggcagtc 3840 ataatagtcg tcgtgatgtt gttggcaaag agagatccga ctacttttcc cctggtgatc 3900 actgtggcaa ccttgagaac ggctaagata accagtggtt tcagcacaga tctagccata 3960 gccacagtgt cggcaacttt gctaacctgg acttatatca gtgactacta caaatacaag 4020 acttggctac agtacctcat cagcacggtg actggaattt ttctgataag ggtactgaag 4080 ggggtcggcg agttggacct acacgccccg actctgccat cccacagacc cttttctac 4140 atccttgtgt acctcatctc cactgccgtg gtaacgagat ggaacttgga cgtagccgga 4200 atactgctac agtgcgcccc aacacttcta atggtattca cgatgtgggc tgacatcctc 4260 accctaattc tcatactgcc cacctatgag ttgacaaagt tatattacct taaggaagtg 4320 aagataggga ctgaaagagg atggctgtgg aaaactaatt acaagagggt aaatgacatc 4380 tatgaagtcg accaagctgg cgaaggggtt tacctcttcc cttcgaaaca aaagactgga 4440 gctataacga gcaccgtgtt gccgttgatc aaagccatac tcattagctg catcagtaac 4500 aagtggcaat tcatatattt actgtacttg atatttgagg tgtcctacta ccttcacaag 4560 aaaatcatag atgagatagc cggcgggacc aacttcgttt cgagactagt ggcggcttta 4620 attgaagtta attgggctct agacaatgaa gaagtcaaag gcctaaagaa gtttttcttg 4680 ttgtctagta gggtcaaaga gttggttatc aaacacaaag tgaggaatga agtaatggtc 4740 cgctggtttg aagatgaaga gatctacggg atgccaaagc tgatcggcct ggttaaggca 4800 gcaacactga gcaaaaacaa acactgtatt ttgtgcaccg tctgtgagga cagagattgg 4860 cggggagaaa cttgcccgaa atgcgggcgt tttggaccac cagtgatctg tggtatgacc 4920 ctagctgact tcgaggaaaa acactataag aggattttca tcagggagga ccaatcagac 4980 gggccgctca gggaggagca tgcagggtac ttgcagtaca aagctagggg tcaattgttt 5040 ctgaggaatc tcccagtgtt ggcaacaaaa gtcaagatgc ttctggttgg caacctaggg 5100 acagaggttg gggacctgga gcaccttggc tgggtgctca gagggcccgc tgtctgcaag 5160 aaggttactg aacatgaaaa gtgtgctacg tctataatgg ataagttgac tgccttcttt 5220 ggtgtcatgc caaggggtac cacccccaga gctcctgtaa gatttcccac ctcccttcta 5280 aagataagaa gagggctgga gacgggttgg gcttatacac accaaggcgg tatcagctca 5340 gttgaccatg ttacttgcgg gaaagacctg ctagtgtgtg acaccatggg tcggacaagg 5400 gttgtctgcc aatcgaataa caagatgact gacgagtctg aatacggagt caaaacccgac 5460 tcagggtgcc cagagggagc caggtgctac gtgttcaacc ctgaggcagt taatatca 5520 ggcactaaag gagccatggt ccacttacag aaaactggtg gagaattcac ctgtgtaaca 5580 gcatcaggga ccccagcttt cttcgatctc aagaacctca agggttggtc agggctaccg 5640 atatttgaag catcgagtgg aagggtagtc ggaagggtca aggtcgggaa gaacgaagac 5700 tctaaaccaa ccaaactcat gagtgggata caaacggtct ctaaaagtgc cactgatttg 5760 acggagatgg tgaagaagat aacaaccatg aacagggggg agttcagaca aataaccttg 5820 gccacaggtg ctggaaaaac tacagagcta cccaggtcag tcatagaaga gatagggaga 5880 cacaaaaggg tgctggtatt gatccccctt agggccgcag cagaatcagt ataccaatac 5940 acaccgag tagcattc aacctgagg tagggagat ggaggaagg 6000 tacatggcca cgggaataac ctatgcttct tatggttact tttgccagat gccacaaccc 6060 aagttgagag ccgcaatggt agagtattcc tacatctttc tagacgagta ccattgcgcc 6120 accccggaac aattggctat catggggaag atccacagat tctcagagaa cctgcgggtg 6180 gtcgctatga cagcgacgcc ggcaggcacg gtaacaacta ctgggcagaa acaccctata 6240 gaggagttca tagccccgga agtgatgaaa gagagact taggttcaga gtacttagac 6300 atcgccggac tAAagatacc agtagaggag atgagaac acatgctagt tttgtacca 6360 actaggaaca tggcagtgga ggcggcaag aaattgaag ccaaggata taactcaggc 6420 tattactaca gtggtgagga cccatccac ctgaggtag ttacatcgca gtcccatac 6480 gtggtggtag cgaccacgc atagaatca ggcgtcactc tcccagacct tgatgtggtc 6540 gttgacacag gactcaagtg tgagaaaga atccgactgt cacccagat gcctttcata 6600 gtgactggcc tgaaagaat ggccgtcact attgggac aagcccagag agagggagg 6660 gttggaagag taaagcccgg gagatactac aggagccaag aaactccagt cggctctaag 6720 gactaccact atgacttgct gcaagcccaa aggtacggta tagagatgg gataataatc 6780 accaaatcct tcagagagat gaactacgat tggacctttt atgaggaag tagcctgatg 6840 atacacaac tggaatcct siacaatctg ttgatatcag aggagctgcc ggtagcagta 6900 aaaaatataa tggctaggac tgaccaccca gaaccattc aactagcgta taatagctac 6960 gagacacagg taccagtgtt gttcccaag ataaggaatg gagaggtgac tgacacttac 7020 gandactaca ccttcctcaa tgcaagaaaa ttgggagatg atgtaccccc ctatgtgtat 7080 gccacagaag atgaggactt ggcagtggaa ctgttaggcc tagattggcc agaccctgga 7140 aaccaaggca ctgtggaggc tggcagagca ctaaaacagg tggtcggcct atcacagcc 7200 gagaatgccc tgctagtggc cttgttttggc tacgtaggt accaggccct ctcaaaaagg 7260 catatacctg tagtcacaga catatattca gttgagatc acaggttgga agatacaaca 7320 cacctacagt atgccccgaa cgccatcaag acggaggga aggagactga attgaggag 7380 ttggctcaag gggatgtgca gagatgtgtg gaagcagtgg ccaattatgc gagtgagggc 7440 atccaattta ttaagtcaca ggcactgaag gtgagagaga ccccgactta caaagagaca 7500 atgaatacag tggcagacta tgtgaaaaag ttcattgagg cactgtcaga tagcaaggaa 7560 gacatcttga aatatgggct gtggggtgta cacacggcct tgtataagag cattggtgcc 7620 agactaggtc acgaaactgc gttcgcaact ttagtcgtga aatggttggc atttgggggg 7680 gaatcagtaa cagatcacat aaagcaagca gccacagact tggttgttta ctatattatc 7740 aacagacctc aattcccagg ggacacggag acacaacaag aagggaggaa atttgtggcc 7800 agcttactgg tctcagccct agcaacctac acatacaaaa gctggaacta caacaatctg 7860 tccaagatag ttgaacctgc tttggccact ttgccctacg ccgccaaagc ccttaaatta 7920 ttcgccccta cccgactgga gagcgtcgtc atattgagca ccgcaatcta caaaacatat 7980 ctatcaatca ggcgaggcaa aagtgatgga ttgcttggta caggggttag tgcggctatg 8040 gagattatgt cacaaaatcc agtatcagtg ggcatagcag tcatgctggg ggttggggct 8100 gtagcagcccc atatgcaat tgaagccagt gagcagaga gacactact atgaaagtc 8160 ttgtgaaaa acttcttgga ccagcagcc acggatgaac tagtcaaga ggccctgag 8220 aaaataataa tggccctgtt tgagcagtg cagacggtag gcaccctct cagactggtg 8280 8340 gccggcagga acctctcac cttaataatg ttcgaggctg tggaactact gggagtagat 8400 agtgaaggga aaatccgcca gctctcaagt actacatat tagactcct gtacaagttc 8460 cgtgacgaca tcaatctag tgtgagggag atagcaatca gttgggcccc tgccccctc 8520 agctgcgact ggacaccac agatgacaga ataggacttc cccatgacaa ttatctccag 8580 atggagacaa gatgtccttg tggttacagg atgaagcag taaaaacctg tgccgggg 8640 ttgagactcc tggagggg gggttcattc ctctgcagga ataattcgg cagagggtca 8700 cggaattta gggtgacaaa attatgat xaacttat cagaataa accagtgata 8760 agaatggaag gandacgtgga actgtatcat aaaggggcca ctttcaact ggactttgac 8820 aacagtaaaa cagtactggc aacagataga tgggaagtcg accattccac cctgatcagg gtgctcaaga ggcacacagg ggctggattt caaggggcgt atctgggtga gaaacccaat 9000. 9000. 9000. 9000. 9000. 9000. 9000. 9000. 9000. 9000 aaaatgaaga gggggtgcgc gttcacctat gacttatcac tccacaacct tacccggcta atcgaattgg tacataagaa caacctggat gacagagaaa tccctgccgt tacggtcaca acctggctgg cctacacatt cgtgaatgaa gacataggg cctaaaacc agtcttcggg gaaaaagtaa caccggagaa gcaggaggag gtagccttgc agcctgcagt ggtggtggac 9240. acaacagatg tggccgtgac cgtggtgggg gaaacctcca ctatgaccac aggggagacc cccacaatat ttaccagctt aggttcggac tctaagtttc aacaagtcct gaaactgggg gtggatgagg gtcaatatcc cgggcccagg cagcagagag caagtttgct cgaagctgta caaggtgtag atgagaggcc ctcggtacta atattggggt ctgataaggc cacctccaat agggtgaaga ccgcaaaaga tgtgaaga ttcaggagca gagaccccct ggaactgaga gagatgatga gagaggga gatcctaatc atagccctgt gtaggtgga caccgctctg 9600 ctgaaatttg ttgattacaa aggtaccttc ctgaccagag agacctaga ggcattaagt 9660 ctgggcaaac ctaagaaaag agacatact aagacagagg cacgatggtt gttgtgccctc 9720 gaaggtcaat tagagagct gcctgactgg tttgcagcca aggagccat attcttagaa 9780 gccaacatca aacgtgacaa gtatcatctg gtgggagaca tagctacaat caaaaaaa 9840 gccaagcaac tgggggcaac agactccaca aagatatcaa aagaggttgg cgcgaaagtg 9900 tattctatga agttgagtaa ctgggtgata caggagaga ataacaggg cagcttaacc 9960 cccttgtttg aagagctccct gcacagtgc ccgcccgggg gccagaataa aaccacat 10020 atggcctcag cctaccaatt ggctcagggg aactggatgc cagttggttg ccacgtgttc 10080 atggggacca tacccgctag aagaaccaag actcatccct acgaggcata tgtcaagttg 10140 agggagttgg tggagaca tagatgaag acatcatgtg gcggttcagg cctatgtaag 10200 cacaacgaat gggtattcg windowcag catcaaggga acctgaggac cacacacatg 10260 ctgaaccccg gaagattgc tgagcaactg gagagaag ggcacagaca caatgtgtac 10320 aacaagacca taggctcagt aatgacagcg actggcatca ggctggaaaa gttacccgtg 10380 gttagagccc agacagatac aactaatttc caccaagcaa tagggaata atagacaag 10440 gagagaacc tacagacccc aggcttacac agaagttaa tggaggtatt caatgcatta 10500 aaagacctg agcttgaggc ctcttacgac gccgtggagt gggaggatt ggagagagga 10560 aaatagga agggtgctgc agggttctc gaacgcaaga ataggaga ggtcctagat 10620 tcagaaaaat aataggttga agagatcata gagagtttga agaaggtag gagtattaaa 10680 tattatgaaa ctgcaatccc aaagaacgaa aagagggatg tcaatgatga ctggactgcc 10740 ggagactttg tggatgaga aaaacccagg gtgatacaat atcctgaggc caaaaccagg 10800 ttagccatca ctaaagtgat gtataagtgg gtgaaacaga aaccagtagt catacccggc 10860 tatgaaggta agacaccctct gttccaaattt tttgacaag tgaaaaaga atggaaccaa 10920 ttccaaaatc cagtggcagt gagctttgac actaaagcat gggataccca ggtgactaca 10980 agagacctgg aactaataag ggatatacag aagttctatt tcaagaagaa gtggcacaaa 11040 ttcatcgaca ccctaaccat gcacatgtca gaagtacccg tgattagtgc cgacggggag 11100 gtgtatataa ggaaagggca gagaggcagt gggcaacctg atacgagcgc aggcaacagt 11160 atgctgaatg tgttaacaat ggtttatgcc ttctgtgagg ccacgggggt accctataaa 11220 agtttcgaca gagtggcaaa gatccacgtc tgtggggatg atggcttctt gattactgaa 11280 agggctcttg gtgaaaaatt tgcaagtaga ggagtccaga tcctatatga agccgggaag 11340 ccccaaaaaa tcactgaagg ggacaatatg aaagtggcct atcagtttga cgacatcgag 11400 ttctgctccc atacaccagt gcaggtaagg tggtcagaca acacctccag ttacatgccg 11460 gggaggaaca caaccacaat actggcaaaa atggctacaa ggttggattc cagtggtgag 11520 agaggcacta tagcatatga gaaggcagtg gcattcagtt tcttgttgat gtactcctgg 11580 aacccactga ttagaaggat atgcttattg gtgttatcaa ctgaaatgca agtgagacca 11640 gggaagtcaa ccacctatta ctatgaagga gacccaatat ctgcttacaa ggaggtcatc 11700 ggccataatc tctttgacct taaaagaaca agtttcgaga agctagctaa gctaaatctt 11760 agtatgtcca cactcggggt atggaccagg cataccagca aaagattact acaagactgt 11820 gtcaatgtcg gcaccaaaga gggcaactgg ctggttaacg cagacagact ggtgagtagt 11880 aagacaggga ataggtatat acctggagag ggtcataccc aacaaggaaa acattatgaa 11940 gagctggtat tggcaagaaa accgaccagt aattttgaag ggactgatag atataatttg 12000 ggcccaatag tcaacgtagt gttgaggagg ctgagagtca tgatgatggc tcttatagga 12060 aggggggtgt gagagcggcc ggctcttgac cgggccctat cagtataacc ctgttgtaaa 12120 taacactaac ttattattta tctagacact actatttatt tatttattta tttattgaat 12180 gagcaaggaa tggtacgaac tacctcatgt taccacacta cactcatttt aacagcactt 12240 tagctgagga aaaaantcct gacgtccata gttggactaa ggtaatttcc taacggccc 12299 <210> 3 <211> 12293 <212> DNA <213> Artificial Sequence <220> <223> QZ07-sdErnsH-KARD <400> 3 gtatacgagg ttagttcgtt ctcgtgtaca atattggaca aaacaaaatt ccgatttggc 60 ctagggcacc cctccagcga cggccgaact gggctagcca tgcccacagt aggactagca 120 aacggaggga ctagccgtag tggcgagctc cctgggtggt ctaagtcctg agtacaggac 180 agtcgtcagt agttcgacgt gagcaggagc ccacctcgag atgctatgtg gacgagggca 240 tgcccaagac acaccttaac cctggcgggg gtcgccaggg tgaaatcaca ccatgtgatg 300 ggggtacgac ctgatagggc gctgcagagg cccactaaca ggctagtata aaaatctctg 360 ctgtacatgg cacatggagt tgaatcattt tgaactattg tataaaacaa acaaacaaaa 420 accaatggga gtggaggaac cggtgtatga catcgcaggg agaccattat ttggggaccc 480 aagtgaggta cacccacaat caacactgaa gctaccacac gacaggggaa gaggtaatat 540 cagaactaca ctgaaggacc tacctaggaa aggcgactgc aggagtggaa accacctagg 600 accagttagt gggatatacg taaagcctgg ccctgtcttc tatcaggact acatgggccc 660 tgtctaccat agagccccat tagattttt tggtgaggcc caatttgtg aggtgaccaa 720 gaggataggt agggtgacgg gtagtgacgg aaagcttac cacatatatg tgtgcatcga 780 cggttgcata ctgttgaagt tagccaaag gggcgcgccc agatccctaa agtggactag 840 gaacttcacc gactgtccac tgtgggtcac tagttgttct gatgatggca caggtgacag 900 chaaaaaaaaaaaaaaaaaaaaaaaatta aagataagccc 960 tgagaaggac agtaagacca agccacctga tgctacaatt gtggtagagg gagtaaaata 1020 ccaagtaaaaaaaggca aagtcaagg gagaacact ccagatggcc tgtaccataa 1080 taagaaaaa ccaccagagt ccaggaaa actagaaaaa gccctattgg cctggggcagt 1140 gatagcaata gtgctgtacc agcctgtagc agccgagaat ataacccaat ggaacctgag 1200 tgacaacggc acagcggca tccagcaagc tatgtatctc agaggggtca ataggagctt 1260 gcatgggatc tggctgaaa aatatgcaa gggggtccct accatctgg ccactgacac 1320 ggaactgaca gagatacgcg ggatgatgga cgccagtgag aggacgaact acacgtgttg 1380 taggttgcag agacacgaat ggaacaaagg ctggtgcaac tggtacaaca tagacccctg 1440 gattcagtta atgaacagga cccaagcaaa tttgacagaa ggccctccag ataaagagtg 1500 tgccgtgact tgcaggtatg acaaaaatac cgatgttaac gtggtcaccc aggcaggaa 1560 tagacctact actctgactg gctgcaagaa agggaaaat ttttcatttg caggtacggt 1620 catagagggc ccatgcaatt tcaacgtatc cgtgaggac atcttatatg gcgaccatga 1680 gtgtggcagc ctgttccagg acacggctct gtacctatta gatggaatga ccaacactat 1740 agaaagcc aggcagggtg cggcaagagt cacatcttgg ctcgggacac aactcagaac 1800 1860 ttactgcaat gtaacaagga aaatagggta catatggtac acgaacaatt gcactccgg 1920 atgcctccca aaaaacacaa aataatagg cccaggaaag tttgacacca atgcagaaga 1980 cgggaagatt cttcatgaaa tggggggcca cctatcagaa ttcttgttgc tttctctggt 2040 agtcctgtct gacttcgccc cagaaacggc footcatta tacctaatct tacactatgc 2100 aatccctcag tcccgtgacg aacccgaggt ttgcgataca aaccagctca acctaacagt 2160 gggacttagg acagaagatg tggtaccatc atcagtctgg aatattggca aatatgtgtg 2220 tgttagacca gattggtggc cgtatgaaac taaggtggct ctactgtttg aagaggcggg 2280 acaggtcata aagttagctc tacgggcact gagggattta actagagtct ggaacagtgc 2340 atcaactact gcgttcctca tctgcttgat aaaaatatta agaggacagg ttgtgcaagg 2400 tataatatgg ctgctgctgg tgactggggc acaagggcgg ttgtcctgca aggaagacta 2460 caggtatgcg atatcaaaga ccaatgagat agggccgcta gcagctaggg acctcaccac 2520 cacctggaaa gaatataacc atggtttgca gctggatgac gggactgtca gggccatttg 2580 cactgcaggg tcctttaaag ttatagcact taatgtggtc agtaggaggt acctggcatc 2640 attacacaag agggctttac ccacttcagt aacatttgaa ctcctatttg atgggactag 2700 tccagcaatt gaggagatgg gagatgactt tggatttggg ctgtgccctt ttgacacaac 2760 ccccgtggtc aaagggaagt acaataccac tttattaaac ggtagtgctt tctatctagt 2820 ctgcccaata ggatggacgg gtgtcataga gtgcacggca gtaagcccta caaccttgag 2880 aacagaagtg gtgaagacct tcaagagaga gaagcctttc ccacacagag tgggttgcgt 2940 gaccactgtt gtagaaaaag aagacctgtt ctactgcaag tggggggta attggacatg 3000 tgtaaaaggc aacccggtga cctacatggg ggggcaagta aaacaatgca gatggtgcgg 3060 ttttgacttc aggagcccg atgggctccc acactacccc ataggcaagt gcatcctagc 3120 aaatgagacg ggttacaggg tagtggattc cacagactgc aatatagatg gcgtcgttat 3180 cagcactgaa ggtgaacacg agtgcttgat tggcaacacc accgtcaagg tgcacgcgtt 3240 ggatggaaga ctgggcccta tgccgtgcag acccaaagaa atcgtctcta gcgcaggacc 3300 tgtaaggaaa acttcctgca ccttcaacta cacaaagaca ctaagaaaca agtactatga 3360 acccagggac agctatttcc agcaatatat gcttaagggc gagtaccaat actggtttga 3420 tctggacgtg accgaccacc acacagacta ctttgccgaa tttgttgtct tggtggtagt 3480 ggcactatta gggggaggt acgtcctatg gctaatagtg acctatgtaa ttttaacaga 3540 gcaactcgct gccggtttac agctgggcca aggcgaggta gtactgatag ggaacttaat 3660. 3660. 3660. 3660. 3660. 3660. 3660. 3660. 3660. 3660 cgagcctata aagaatgga tactactgct gtttcatgcc atgaccaaca acccagttaa gaccatgaca gtagcattgc tgatgatcag tggggtcgcc aagggtggga aaacagatgg tggttggcag aggcagccgg agaccaattt tgacattcaa ctcgcactgg cagttatagt agtcgttgtg atgttactgg caaagagaga cccgactact tttcccctgg tgatcacagt 3900 ggcaacctta agaacagcta agataaccaa tggtttcagc acagatctag ctatagccac agtgtcggca gctttgctaa cctggactta tatcagtgac tactacaaat ataagacttg gctacagtac ctcatcagca cggtgactgg gatcttccta ataagggtac tgaagggaat 4140. aggcgagcta gacatgcacg ccccaacttt gccatctcac agaccccttt tctacatcct cgtgtacctc atctccactg ctgtggtgac taggac ctggacgtag ccggactgct 4200. gctacagtgt gtcccaacac ttctaatggt gttcacgatg tgggctgaca ttctcaccct 4260 aatcctcgtg tacccactt atgactggc aaagttgtat taccttaagg aagtgaat 4320 cggaaccgaa agaggatggc tgtggaaac taactataag agggtaaatg acatctatga 4380 agtcgaccaa gctggcgagg gggtctacct cttccctcg aaaaaaga ctagtgctat 4440 aacaagcacc atgttgccat tgatcaaagc catactcatt agctgcatca gtaacaagtg 4500 gcaactcata tatttactgt acctgatatt cgaagtgtcc tactaccttc acagaaagt 4560 catagatgaa atagctggtg ggaccact cgtttcagg ctagtggcag ccttaattga 4620 agttaatttgg gccttcgaca atgagaagt taaagccta aagaagttct tttgctgtc 4680 cagtagagtt aaagaatttgg tcatcaaaca caagtgagg aatgagtag tggcccgctg 4740 gttcggagat gaagagatct atgggatgcc caagttgatc gttcttagtca aggcagcac 4800 tctaagtaaaaaacact gtatcttgtg caccgtctgc gaggacagag attggagagg 4860 agaaacctgc ccaaaatgtg gggcgttcgg accaccagtg atctgtgta tgaccctagc 4920 cgacttcgag gagaagcatt atgaggat attcatcagg gaggaccaat cagatggacc 4980 gctcagggag gagcgtgcag ggtacttaca gtacagagct aggggtcaac tgtttctgag 5040 gaatctccca gtgttggcga caaaagtcaa gatgctcctg gttggtaacc tcgggacgga 5100 ggttggggat ttggagcacc ttggctgggt gcttagaggg cctgctgtct gcaagaaggt 5160 tactgaacat gaaaagtgtg ctacgtctat aatggataag ttgactgctt tcttcggcgt 5220 tatgccaaga ggtaccaccc ccagagcccc cgtgagattt cccacctccc tcctaaagat 5280 aagaagaggg ctagagacgg gttgggctta cacacatcaa ggtggcatta gctcagttga 5340 ccatgtgact tgtgggaaag acttgctggt gtgtgacact atgggccgga caagggtcgt 5400 ttgccaatca aataataaga tgactgacga atccgaatac ggggtcaaaa ccgactcagg 5460 gtgcccagaa ggggccagat gttatgtgtt caaccctgag gcagttaaca tatcaggcac 5520 taaaggggcc atggtccact tacaaaaaac tggtggggag ttcacctgcg taacagcatc 5580 aggaaccccg gccttctttg atctcaagaa cctcaagggc tggtcagggc taccgatatt 5640 cgaagcatcg agtggaaggg tagtcggaag ggtcaaggtc gggaagaacg atgactctaa 5700 accaaccaaa ctcatgagtg ggatacaaac ggtctctaa agtgccactg acctgacgga 5760 gatggtaag agaataaca ctgaacag gggagagttc agacagata ccttggccac 5820 aggtgctggg aaactacag agctccccag gtcagtcata gagagatag ggagacacaa 5880 aagggtgttg gtattgatcc ccttgagggc cgcagcagaa tcagtatacc atatatgag 5940 gcagaaacac ccaagtatag cattcaacct gaggataggg gagatgaagg aaggtcacac 6000 ggccacgggg atacctag cctcctacgg ttactttgc cagatgccac aacctaagct 6060 gaggggccgca atggtagagt actcctacat ctttctagat gagtaccatt gtgccacccc 6120 agaacaactg gctatcatgg ggagatcca cagattctca gagaacctgc gggtggtagc 6180 tatgacagcg acaccagcag ggacagtaac aactactggg cagaaacacc ctatagagga 6240 gttcatagcc ccggagta tgaaggaga agacttaggt tcagagtact tegcattgc 6300 cggactaag ataccagtag aggagatgaa gaacaacatg ctagttttg taccactag 6360 gatatggcg gtagaggcgg aagaaact gaagctaa ggatacaact caggctatta 6420 ctacagtggt gaggatccat ctaacctgag ggtagtcaca tcgcagtccc catacgtggt 6480 tgtagcgacc aacgcgatag aatcaggcgt cactctcccg gaccttgacg tggtcgttga 6540 cacggactc aagtgtgaga aaagaatccg attgtcaccc aagatgcctt tcatagtgac 6600 tggcctaaaa agaatggctg ttaccattgg ggaacaagcc cagaagaag ggagggttgg 6660 aagagtaaag cccgggagat actacaggaggag ccaagaaacc cctgtcggct ctaaggacta 6720 6780 atccttcaga gaatgaact atgattggag cctctatgag gaagatagcc tgatgataac 6840 acaattggaa atcctcaaca atctactgat atcagaggag ctgccggtgg cattaaaaa 6900 tataatggct aggactgacc acccagaacc aattcaacta gcatataata gctacgagac 6960 aaagtgcct gtgttgttcc caaaaataag aaatggagag gtgactgaca cttacgatac 7020 ttacaccttc atcaatgcaa gaaaattggg agatgatgta cctccctacg tgtatgccac 7080 agaagatgag gacttggcag tggaactgtt gggcctagat tggccggacc ctgggaacca 7140 aggcactgtg gaggccggca gagcactaaa acaggtggtc ggtctatcaa cagccgagaa 7200 tgccctgtta gtagccttgt ttggctacgt agggtaccag gccctctcaa agaggnot 7260 acctgtggtc acagadata actcagttga agatcacagg ctagaggaca ccacacacct 7320 acagtacgct ccgaatgcca tcaagacgga ggggaaggag actgaattga aggagttggc 7380 tcagggggat gtgcagagat gcgtggaagc gatgaccaat tacgcgagag ggggcatcca 7440 atttatgaag tcacaggcac tgcaggtgag agaaaccccc acttataaag agacaatgaa 7500 tactgtagca gactatgtga aaaagtttat cgaggcactg tctgatagca aggaagacat 7560 cttgaaatat gggctgtggg gcgtacatac ggccttgtac aagagcattg gtgccaggct 7620 tggtcacgaa accgcgttcg caaccctagc cgtgaaatgg ctggcatttg ggggggaatc 7680 aatagcagat catataaaac aagcggctac agacttggtc gtctactata tcatcaacag 7740 acctcagttc ccaggagaca cagagacaca acaggagggg agaaattttg tggccagcct 7800 actggtctca gccctagcaa cttacacata taaaagctgg aactataata acctgtccaa 7860 gatagtagaa ccggctttgg ccaccctgcc ctatgccgct aaagccctta aattatttgc 7920 ccctaccagg ctagagagcg tcgtcatatt gagcaccgca atctacaaaa catacctatc 7980 aatcaggcga ggcaaaagcg atggattgct aggtacaggg gttagtgcgg ctatggagat 8040 tatgtcacaa aatccggtat cagtgggcat agcagttatg ctgggggttg gggctgtagc 8100 agcacacaac gcaattgaag ccagtgagca gaagagaaca ctacttatga aagttttgtgt 8160 aaagaacttc ttggaccaag cagccacaga tgaactagtc aaagagagcc ctgagaaaat 8220 aataatggcc ttgtttgaag cagtgcaaac agtaggcaat cctcttaggc tagtgtacca 8280 cctttacggg gttttttata aagggtggga agcaaaagag ttggcccaaa ggacagccgg 8340 caggaatctt ttcaccttga taatgtttga ggccgtggaa ctattgggag tagatagcga 8400 aggaaaaatc cgccaactat cgagtaatta catattagag ctcctgtata agttccgtga 8460 cagtatcaaa tctagtgtga gggagatagc aatcagctgg gcccctgccc cctttagttg 8520 cgattggaca ccaacagatg acagaatagg gcttccccat aacaattacc tccaaatgga 8580 gandagatgc ccttgtggct acaggatgaa agcagtaaaa acctgtgctg gggagttgag 8640 acttctggaa gagggaggtt cattcctctg caggataaa ttcggtagag ggtcacggaa 8700 ctatagggtg acaaatact atgatgacaa tttatcagaa ataaaccag tgataagaat 8760 ggaactgacat gtggaactat atttaaggg ggccactc aaactggact ttsacacag 8820 taaaacagta ctggcaccg acaatggga ggttgaccat tccaccctgg tcaggcgct 8880 caaggcac acaggggctg ggtaccaagg agcgtatatg ggtgagaaac ctaaccacaa 8940 acatctgata gagagact gtgcacgat cacaaagac aaggtttact tcatcagat 9000 gaagaggggg tgtgcgttca cttatgactt gtccctccac aacctcaccc ggttaatcga 9060 attggtacac aaaaacgacc tggatag agaatccct gctgttacgg tcaacctg 9120 gctggcctac acatttgtga atgagacat agggaccata aaaccagtttt ttggggaaaa 9180 agtaacaccg gaaaaacagg aggaggtagc cttgcagcct gctgtggtgg tggacacac 9240 agatgtggcc gtgaccgtgg tgggggaac cttactatg actacagggg agaccccac 9300 ggcattcacc agcttaggtt cagactctaa agttcaacaa gttctgaagt taggggtgga 9360 tgagggtcaa taccccgggc ccagtcagca gagagcaagc ttgctcgacg ctatacaagg 9420 cgtggatgaa aggccctcgg tattgatatt gggatctgat aaggccacct ccaatagggt 9480 gaagaccgca aagaatgtca agatattcag gagcagagac cccctggaac tgagagaaat 9540 gatgagaaga gggaagatcc tggtcatagc cctatgtaag gtcgacactg ctctactgaa 9600 atttgttgat tacaaaggca ccttcctgac cagagaaacc ctagaggcat taagtttggg 9660 taagcctaag aaaaaaaaca taaccaagac agaggcacaa tggttgttgt gcctcgaaaa 9720 ccaaatagaa gagctgcctg actggttcgc agctgaggag cccgtatttc tggaagccaa 9780 catcaaacgt gacaagtatc acctagtggg ggatatagct actatcaaag aaaaagctaa 9840 acaactgggg gcaacagact ccacaaagat atcaaaagag gttggagcta aagtatattc 9900 tatgaagctg agtaactggg tgatacaaga agagaataaa cagggcagct tagccccttt 9960 gtttgaagag ctcctgcaac agtgcccacc tggggggccag aataaaacca cacatatggt 10020 ctcagcctac caactggctc aagggaactg gatgccagtt ggttgtcacg tgttcatggg 10080 gaccataccc gccagaagaa ccaagaccca tcctatgag gcatacgtca agctgaggga 10140 gttggtagat gattaaga tgaagacgct atgtggcggt tcaggcctaa gtaagcacaa 10200 cgaatgggta attcgtaaga tcaagcatca agggaacctg aggaccaac acatgttgaa 10260 ccccgggaag gttgcagagc aactgcttag agaaggacac agacacaatg tatatataa 10320 gactataggc tcagtgatga cagcaactgg tatcaggctg gaaagttac ccgtggtcag 10380 ggcccaaaca ghacaacca acttccacatca agcaatagg gataaaatag ahaggaa 10440 gaacttacag actccaggct tacacagaa gttaatggaa gtctcaatg cattaaaag 10500 acccgatctt gaggccctctt acgacgctgt ggagtgggag gattggaga aaggataaa 10560 taggaagggt gctgcaggtt tcttgaca cagaatata taggaggttc tggattcaga 10620 aaaaaacaag gttgagaga tcatagacag ttgagaaaa ggtaggagta tcaggtacta 10680 tgaaactgca atcccaaaaa acgagaagg ggacgtcaat gatgactgga ctgccggtga 10740 ctttgtagac gagaaaaagc ccagggtgat acaataccct gaggctaaaa ccaggttggc 10800 catcactaaa gtaatgtaca agtgggtgaa gcagaaacca gtagtcatac ccggctatga 10860 aggtaagaca cctctgttcc aaatctttga caaagtgaag aaagaatggg accaattcca 10920 aaatccagtg gctgtgagct ttgacaccaa agcgtgggac acccaggtga ctacaggaga 10980 cctggaacta ataagggata tacagaagtt ctacttcaag aagaagtggc acaaattcat 11040 tgacacccta accatgcaca tgtcagaagt acccgtaatt agtgccgacg gggaggtgta 11100 cataaggaag gggcagagag gcagtggaca acctgatacg agcgcaggca acagcatgtt 11160 gaatgtatta acaatggttt atgccttctg tgaggccacg ggagtgccct ataagagttt 11220 tgacagagtg gcaaagatcc acgtctgcgg ggatgatggt ttcttgatca ctgaaagggc 11280 tcttggtgaa aaattttcga gtaaaggagt ccagatccta tatgaagctg gtaagcccca 11340 aaaaattaca gaaggggata agatgaaagt ggcctaccag tttgatgaca tcgagttctg 11400 ctcccataca ccagtgcaag taaggtggtc agacaatact tccagttata tgccgggg 11460 gaacacgact acaatcctgg caaaaatggc tacaaggtta gattccagtg gtgagagggg 11520 cactatagca tatgagagg cggtggcgtt tagctctta ttgatgtact cctggaaccc 11580 actgatcaga aggatatgct tactggtgtt gtcaactgaa ctgcaagtga gaccagggaa 11640 gtcaccacc tattactg aaggggaccc aatttctgct tacaggagg tcataggcca 11700 taatctcttt gaccttaaaa gaacaagctt tgagaaacta gctaagttaa atcttagtat 11760 gtccacactc ggggtatgga ccagacacac cagcaaaga ttactacaag actgtgtcaa 11820 cgtcggcact aaagagggca actggctggt taatgcagac agactggtga gtagcagac 11880 aggaaatagg tatataccctg gagaggggtca tacccagcaa gggaaacatt atgagaact 11940 gatattggca aggaagccga tcagcaattt tgaagggact gatagataca atttggggccc 12000 atagtcaac gtagtgttga ggaggctgag agtcatgatg atggctctta taggagggg 12060 ggtgtaagca tggccggccc ttaaccgggc cttatcagta gaaccctgtt gtaataaca 12120 ctaacttatt atttatttaa atactattat ttatttattt atttatttat tgaatgagca 12180 aggattggta caaactacct catgttacca cactacactc attttaacag cactttagct 12240 ggagggaaaa tcctgacgtc catagttgga ctaaggtaat ttcctaacgg ccc 12293 <210> 4 <211> 12290 <212> DNA <213> Artificial sequence <220> <223> QZ07-ddErnsHC-KARD <400> 4 gtatacgagg ttagttcgtt ctcgtgtaca atattggaca aaacaaaatt ccgatttggc 60 ctagggcacc cctccagcga cggccgaact gggctagcca tgcccacagt aggactagca 120 aacggaggga ctagccgtag tggcgagctc cctgggtggt ctaagtcctg agtacaggac 180 agtcgtcagt agttcgacgt gagcaggagc ccacctcgag atgctatgtg gacgagggca 240 tgcccaagac acaccttaac cctggcgggg gtcgccaggg tgaaatcaca ccatgtgatg 300 ggggtacgac ctgatagggc gctgcagagg cccactaaca ggctagtata aaaatctctg 360 ctgtacatgg cacatggagt tgaatcattt tgaactattg tataaaacaa acaaacaaaa 420 accaatggga gtggaggaac cggtgtatga catcgcaggg agaccattat ttggggaccc 480 aagtgaggta butterflies storm gctaccacc gagggaa gaggtaat 540 cagaactaca ctgaggacc tacctaggaa agcgactgc aggagtgga accacctagg 600 accagttagt gggatatacg taaagcctgg ccctgtctc tatcaggact acatgggccc 660 tgtctaccat agagccccat tagattttt tggtgaggcc caatttgtg aggtgaccaa 720 gaggataggt agggtgacgg gtagtgacgg aaagcttac cacatatatg tgtgcatcga 780 cggttgcata ctgttgaagt tagccaaag gggcgcgccc agatccctaa agtggactag 840 gaacttcacc gactgtccac tgtgggtcac tagttgttct gatgatggca caggtgacag 900 chaaaaaaaaaaaaaaaaaaaaaaaatta aagataagccc 960 tgagaaggac agtaagacca agccacctga tgctacaatt gtggtagagg gagtaaaata 1020 ccaagtaaaaaaaggca aagtcaagg gagaacact ccagatggcc tgtaccataa 1080 taagaaaaa ccaccagagt ccaggaaa actagaaaaa gccctattgg cctggggcagt 1140 gatagcaata gtgctgtacc agcctgtagc agccgagaat ataacccaat ggaacctgag 1200 tgacaacggc acaagcggca tccagcaagc tatgtatctc agaggggtca ataggagctt 1260 gcatgggatc tggcctgaaa aaatatgcaa gggggtccct actcatctgg ccactgacac 1320 1380 taggttgcag agacacgaat ggaacaaagg ctggtgcaac tggtacaaca tagacccctg 1440 gattcagtta atgaacagga cccaagcaaa tttgacagaa ggccctccag ataaagagtg 1500 tgccgtgact tgcaggtatg acaaaaatac cgatgttaac gtggtcaccc aggcaggaa 1560 tagacctact actctgactg gctgcaagaa agggaaaat ttttcatttg caggtacggt 1620 catagagggc ccatgcaatt tcaacgtatc cgtgaggac atcttatatg gcgaccatga 1680 gggcagcctg ttccaggaca cggctctgta cctattagat ggaatgacca acactataga 1740 gaagccagg cagggtgcgg caagagtcac atcttggctc gggagacaac tcagaaccac 1800 agggaagaag ttggagagag gaagcaaaac ctggttcggt gcctatgccc tgtcacctta 1860 ctgcaatgta acaaggaaaa tagggtacat atggtacacg aacaattgca ctccggcatg 1920 cctcccaaaa aacacaaaaa taataggccc aggaaagttt gacaccaatg cagaagacgg 1980 gaagattctt catgaaatgg ggggccacct atcagaattc ttgttgcttt ctctggtagt 2040 cctgtctgac ttcgccccag aaacggccag tacattatac ctaatcttac actatgcaat 2100 ccctcagtcc cgtgacgaac ccgaggtttg cgatacaaac cagctcaacc taacagtggg 2160 acttaggaca gaagatgtgg taccatcatc agtctggaat attggcaaat atgtgtgtgt 2220 tagaccagat tggtggccgt atgaaactaa ggtggctcta ctgtttgaag aggcgggaca 2280 ggtcataaag ttagctctac gggcactgag ggatttaact agagtctgga acagtgcatc 2340 aactactgcg ttcctcatct gcttgataaa aatattaaga ggacaggttg tgcaaggtat 2400 aatatggctg ctgctggtga ctggggcaca agggcggttg tcctgcaagg aagactacag 2460 gtatgcgata tcaaagacca atgagatagg gccgctagca gctagggacc tcaccaccac 2520 ctggaaagaa tataaccatg gtttgcagct ggatgacggg actgtcaggg ccatttgcac 2580 tgcagggtcc tttaaagtta tagcacttaa tgtggtcagt aggaggtacc tggcatcatt acacaagagg gctttaccca cttcagtac atttgaactc ctattgatg ggactagtcc agcaattgag gagatgggag atgactttgg atttgggctg tgcccttttg acacaacccc 2820. cgtggtcaaa gggaagtaca ataccacttt attaacggt agtgctttct atctagtctg cccaatagga tggacgggtg tcataggtg cacggcagta agccctacaa ccttgagaac agaagtggtg aagaccttca agagagaga gccttttccca cacagagtgg gttgcgtgac cactgttgta gaaaaagaag acctgttcta ctgcaagtgg gggggtaatt ggacatgtgt 3060. aaaaggcaac ccggtgacct acatgggggg gcaagtaaaa caatgcagat ggtgcggttt tgacttcaag gagcccgatg ggctcccaca ctaccccata ggcaagtgca tcctagcaaa tgagacgggt tacagggtag tggattccac agactgcaat agagatggcg tcgttatcag 3180. cactgaaggt gaacacgagt gcttgattgg caacaccacc gtcaaggtgc acgcgttgga tggaagactg ggccctatgc cgtgcagacc caaagaaatc gtctctagcg caggacctgt aagaaaact tcctgcacct tcaactacac aaagacacta agaaacaagt actatgaacc 3360 cagggacagc tatttccagc aatatatgct taagggcgag taccaatact ggtttgatct 3420 ggacgtgacc gaccaccaca cagactactt tgccgaattt gttgtcttgg tggtagtggc 3480 actattaggg gggaggtacg tcctatggct aatagtgacc tatgtaattt taacagagca 3540 actcgctgcc ggtttacagc tgggccaagg cgaggtagta ctgataggga acttaattac 3600 ccacacggac aatgaggtag tggtatactt cttactgctc tacctaataa tagagagga 3660 gcctataaag aaatggatac tactgctgtt tcatgccatg accaacaacc cagttaagac 3720 catgacagta gcattgctga tgatcagtgg ggtcgccaag ggtgggaaaa cagatggtgg 3780 ttggcagagg cagccggaga ccaattttga cattcaactc gcactggcag ttatagtagt 3840 cgttgtgatg ttactggcaa agagagaccc gactactttt cccctggtga tcacagtggc 3900 aaccttaaga acagctaaga taaccaatgg tttcagcaca gatctagcta tagccacagt 3960 gtcggcagct ttgctaacct ggacttatat cagtgactac tacaatata agacttggct 4020 acagtacctc atcagcacgg tgactgggat cttcctaata agggtactga agggaatagg 4080 cgagctagac atgcacgccc caactttgcc atctcacaga ccccttttct acatcctcgt 4140 gtacctcatc tccactgctg tggtgactag atggaacctg gacgtagccg gactgctgct 4200 acagtgtgtc ccaacacttc taatggtgtt cacgatgtgg gctgacattc tcaccctaat 4260 cctcgtgtta cccacttatg aactggcaaa gttgtattac cttaaggaag tgaagatcgg 4320 aaccgaaaga ggatggctgt ggaaaactaa ctataagagg gtaaatgaca tctatgaagt 4380 cgaccaagct ggcgaggggg tctacctctt cccttcgaaa caaaagacta gtgctataac 4440 aagcaccatg ttgccattga tcaaagccat actcattagc tgcatcagta acaagtggca 4500 actcatatat ttactgtacc tgatattcga agtgtcctac taccttcaca agaaagtcat 4560 agatgaaata gctggtggga ccaacttcgt ttcaaggcta gtggcagcct taattgaagt 4620 taattgggcc ttcgacaatg aagaagttaa aggcctaaag aagttctttt tgctgtccag 4680 tagagttaaa gaattggtca tcaaacacaa agtgaggaat gaagtagtgg cccgctggtt 4740 cggagatgaa gagatctatg ggatgcccaa gttgatcggc ttagtcaagg cagcaactct 4800 aagtaaaat aaacactgta tcttgtgcac cgtctgcgag gacagagatt ggagaggaga 4860 aacctgccca aaatgtgggc gtttcggacc accagtgatc tgtggtatga ccctagccga 4920 cttcgaggag aagcattata agaggatatt catcagggag gaccaatcag atggaccgct 4980 cagggaggag cgtgcagggt acttacagta cagagctagg ggtcaactgt ttctgaggaa 5040 tctcccagtg ttggcgacaa aagtcaagat gctcctggtt ggtaacctcg ggacggaggt 5100 tggggatttg gagcaccttg gctgggtgct tagagggcct gctgtctgca agaaggttac 5160 tgaacatgaa aagtgtgcta cgtctataat ggataagttg actgctttct tcggcgttat 5220 gccaagaggt accaccccca gagccccccgt gagatttccc acctccctcc taaagataag 5280 aagagggcta gagacgggtt gggcttacac acatcaaggt ggcattagct cagttgacca 5340 tgtgacttgt gggaaagact tgctggtgtg tgacactatg ggccggacaa gggtcgtttg 5400 ccaatcaaat aataagatga ctgacgaatc cgaatacggg gtcaaaaccg actcagggtg 5460 cccagaaggg gccagatgtt atgtgttcaa ccctgaggca gttaacatat caggcactaa 5520 agggccatg gtccacttac aaaaaactgg tggggattc acctgcgtaa gtccacttac 5580 aaccccggcc ttctgatc tcagaacct caagggctgg tcaggctac cgatattcga 5640 agcatcgagt ggagggtag tcggaagggt caggtcggg aagaacgatg actctaacc 5700 aaccaaactc atgagtggga tacaacggt ctctaaagt gccactgacc tgacggagat 5760 ggtaagaag atacaacta tgaacagggg agagttcaga cagataacct tggccacagg 5820 tgctgggaaa actacagagc tccccaggtc agtcatagaa gagataggga accacaaag 5880 ggtgttgta ttgatcccct tgaggccgc agcagaatca gtataccaat atatgaggca 5940 gaaacacca agtatagcat tcaacctgag gatggggag atgaggaag gtcacatggc 6000 cacggggata acctagcct cctacggtta cttttgccag atgccacac ctaagctgag 6060 ggccgcaatg gtagagtact cctacatctt tctagatgag taccattgtg ccacccaga 6120 acaactggct atcatgggga agatccacag attctcag aacctgcggg tggtagctat 6180 cagcgaca ccagcaggga cagtacaac tactggggcag aaacacccta taggaggtt 6240 catagccccg gaagtaatga aaggagaa cttaggttca gagtacttag acatgccgg 6300 actaagata ccagtagagg agatgaga stormgcta gttttgtac storm 6360 tatggcggta gaggcggca agaactgaa agctaagga tacaactcag gctattacta 6420 cagtggtgag gatccatcta acctgaggggt agtcacatcg cagtccccat acgtggttgt 6480 agcgaccaac gcgatagaat caggcgtcac tctccggac cttgacgtgg tcgttgacac 6540 gggactcaag tgtgagaaaa gatccgatt gtcaccaag atgccttttca tagtgactgg 6600 cctaaaaga atggctgtta ccattgggga acaagcccag agagaggga gggttggaag 6660 agtaaagccc gggagatact acaggagcca agaacccct gtcggctcta aggactacca 6720 ctacgattta ttgcaagcccc agaggtacgg tatagaagat gggataaata tcaccaatc 6780 cttcagagaa atgaactatg attggagcct ctgaggaa gatagcctga tgataacaca 6840 attggaaatc ctcaacaatc tactgatatc agaggagctg ccggtggcag taaaaaatat 6900 aatggctagg actgaccacc cagaaccaat tcaactagca tataatagct acgagacaca 6960 agtgcctgtg ttgttccca aaataagaaa tggaggtg acgacactt acgactta 7020 caccttcatc atgcaagaa aattgggaga tgatgtacct ccctacgtgt atgccacaga 7080 agatgaggac tggcagtgg aactgttggg cctagattgg ccggaccctg ggaaccagg 7140 cactgtggag gccggcagag cactaaaaca ggtggtcggt ctatcacag ccgagaatgc 7200 cctgttagta gccttgtttg gctacgtagg gtaccaggcc ctccaaaga ggcatatacc 7260 tgtggtcaca gatatact cagttgaaga tcacaggcta gaggacacca cacacctaca 7320 gtacgctccg atgccatca agacggaggg gagagact gattgaagg agttggctca 7380 gggggatgtg cagagatgcg tggaagcgat gaccattac gcgagagggg gcatccaatt 7440 tatgaagtca caggcactgc aggtgagaga aacccccact tataaagaga caatgaatac 7500 tgtagcagac tatgtgaaaa agtttatcga ggcactgtct gatagcagg aagacatctt 7560 gaaatatggg ctgtggggcg tacatacggc cttgtacaag agcattggtg ccaggcttgg 7620 tcacgaaacc gcgttcgcaa ccctagccgt gaaatggctg gcatttgggg gggaatcaat 7680 agcagatcat ataaaacaag cggctacaga cttggtcgtc tactatatca tcaacagacc 7740 tcagttccca ggagacacag agacacaaca ggaggggaga aatttgtgg ccagcctact 7800 ggtctcagcc ctagcaactt acacatataa aagctggaac tataataacc tgtccaagat 7860 agtagaaccg gctttggcca ccctgcccta tgccgctaaa gcccttaaat tatttgcccc 7920 taccaggcta gagagcgtcg tcatattgag caccgcaatc tacaaaacat acctatcaat 7980 caggcgaggc aaaagcgatg gattgctagg tacaggggtt agtgcggcta tggagattat 8040 gtcacaaaat ccggtatcag tgggcatagc agttatgctg ggggttgggg ctgtagcagc 8100 acacaacgca attgaagcca gtgagcagaa gagaacacta cttatgaaag tttttgtaaa 8160 gaacttcttg gaccaagcag ccacagatga actagtcaaa gagagccctg agaaaataat 8220 aatggccttg tttgaagcag tgcaaacagt aggcaatcct cttaggctag tgtaccacct 8280 ttacggggtt tttataaag ggtgggaagc aaaagagttg gcccaaagga cagccggcag 8340 gatcttttc accttgataa tgttgaggc cgtggaacta tggggagtag atagcgaagg 8400 aaaaatccgc caactatcga gtaattacat atttagagctc ctgtataagt tccgtgacag 8460 tatcaatct agtgtgaggg agatagcaat cagctgggcc cctgccccct ttagttgcga 8520 ttggacacca acgatgaca gatagggct tcccataac aattacctcc aaatggagac 8580 aagatgccct tgtgctaca ggatgaaagc agtaaaaacc tgtgctgggg agttgagact 8640 tctggaagg ggaggttcat tcctctgcag gaataaatttc ggtagaggt cacggaacta 8700 taggtgaca aaatactatg atgacaattt atcagaata aaaccagtga tagaatgga 8760 aggacatgtg gaactatatt ataagggggc cacatcaa ctggacttta acaacagtaa 8820 aacagtactg gcaccgaca aatgggaggt tgaccattcc accctggtca gggcgctcaa 8880 gaggcacaca ggggctgggt accaggagc gtatatggtt gagaaaccta accacaaca 8940 tctgatagag agagactgtg caacgatcac aaagacaag gtttactca tcagatgaa 9000 gaggggtgt gcgttcactt atgacttgtc ctcacccggt taatcgaatt 9060 ggtacacaaa aacgacctgg aagatagaga aatccctgct gttacggtta caacctggct 9120 ggcctacaca tttgtgaatg aagacatagg gaccataaaa ccagtttttg gggaaaaagt 9180 aacaccggaa aaacaggagg aggtagcctt gcagcctgct gtggtggtgg acacaacaga 9240 tgtggccgtg accgtggtgg gggaaacctc tactatgact acaggggaga ccccaacggc 9300 attcaccagc ttaggttcag actctaaagt tcaacaagtt ctgaagttag gggtggatga 9360 gggtcaatac cccgggccca gtcagcagag agcaagcttg ctcgacgcta tacaaggcgt 9420 ggatgaaagg ccctcggtat tgatattggg atctgataag gccacctcca atagggtgaa 9480 gaccgcaaag aatgtcaaga tattcaggag cagagacccc ctggaactga gagaaatgat 9540 gagaaggg aagatcctgg tcatagccct atgtaaggtc gacactgctc tactgaaatt 9600 tgttgattac aaaggcacct tcctgaccag agaaacccta gaggcattaa gtttgggtaa 9660 gcctaagaaa aaaaacataa ccaagacaga ggcacaatgg ttgttgtgcc tcgaaaacca 9720 aatagaagag ctgcctgact ggttcgcagc tgaggagccc gtatttctgg aagccaacat 9780 haaacgtgac aagtacacc tagtggggga tatagctact atcaagaaaagctaaca 9840 actgggggca acagactcca caagatc aaagaggtt ggagctaaag tatattctat 9900 gaagctgagt aactgggtga tacaagaga gataacag ggcagcttag cccctttgtt 9960 tgaagagctc ctgcacagt gcccacctgg gggccagaat aaaaccacac atatggtctc 10020 agcctaccaa ctggctcaag ggaacgat gccagttggt tgtcacgtgt tcatggggac 10080 catacccgcc agaagaacca agacccatcc ctgaggca tacgtcaagc tgaggtt 10140 ggtagatgaa tatagatga agacgctatg tggcggttca ggcctaagta agcacaacga 10200 atgggtaatt cgtaagatca agcatcagg gaacctgagg accaaca tgttgaaccc 10260 cgggaaggtt gcagagcaac tgcttagaga aggacacaga cacaatgtat atataagac 10320 tataggctca gtgatgacag caacggtat caggctggaa aagttacccg tggtcaggc 10380 thunderstorm thunderstorm 10440 cttacagact ccaggcttac acagaagtt aatggaagtc ttcaatgcat taaaagacc 10500 cgatcttgag gcctcttacg acgctgtgga gtgggagaa ttggagaaag gaataaatag 10560 gaagggtgct gcaggtttct ttgaacacaa gaatatagga gaggttctgg attcagaaaa 10620 aaacaaggtt gaagagatca tagacagttt gagaaaaggt aggagtatca ggtactatga 10680 aactgcaatc ccaaaaaacg agaagaggga cgtcaatgat gactggactg ccggtgactt 10740 tgtagacgag aaaaagccca gggtgataca ataccctgag gctaaaacca ggttggccat 10800 10860 taagacacct ctgttccaaa tctttgacaa agtgaagaaa gaatgggacc aattccaaaa 10920 tccagtggct gtgagctttg acaccaaagc gtgggacacc caggtgacta caggagacct 10980 11040 caccctaacc atgcacatgt cagaagtacc cgtaattagt gccgacgggg aggtgtacat 11100 aaggaagggg cagagaggca gtggacaacc tgatacgagc gcaggcaaca gcatgttgaa 11160 tgtattaaca atggtttatg ccttctgtga ggccacggga gtgccctata agagttttga 11220 cagagtggca aagatccacg tctgcgggga tgatggtttc ttgatcactg aaagggctct 11280 tggtgaaaaa ttttcgagta aaggagtcca gatcctatat gaagctggta agccccaaaa 11340 aattacagaa ggggataaga tgaaagtggc ctaccagttt gatgacatcg agttctgctc 11400 ccatacacca gtgcaagtaa ggtggtcaga caatacttcc agttatatgc cggggaggaa 11460 cacgactaca atcctggcaa aaatggctac aaggttagat tccagtggtg agaggggcac 11520 tatagcatat gagaaggcgg tggcgtttag cttcttattg atgtactcct ggaacccact 11580 gatcagaagg atatgcttac tggtgttgtc aactgaactg caagtgagac cagggaagtc 11640 aaccacctat tactatgaag gggacccaat ttctgcttac aaggaggtca taggccataa 11700 tctctttgac cttaaaagaa caagctttga gaaactagct aagttaaatc ttagtatgtc 11760 cacactcggg gtatggacca gacacaccag caaaagatta ctacaagact gtgtcaacgt 11820 cggcactaaa gagggcaact ggctggttaa tgcagacaga ctggtgagta gcaagacagg 11880 aaataggtat atacctggag agggtcatac ccagcaaggg aaacattatg aagaactgat 11940 attggcaagg aagccgatca gcaattttga agggactgat agatacaatt tgggcccaat 12000 agtcaacgta gtgttgagga ggctgagagt catgatgatg gctcttatag gaaggggggt 12060 gtaagcatgg ccggccctta accgggccct atcagtagaa ccctgttgta aataacacta 12120 acttattatt tatttaaata ctattattta tttatttatt tatttattga atgagcaagg 12180 attggtacaa actacctcat gttaccacac tacactcatt ttaacagcac tttagctgga 12240 gggaaaatcc tgacgtccat agttggacta aggtaatttc ctaacggccc 12290 <210> 5 <211> 12293 <212> DNA <213> Artificial Sequence <220> <223> GD18-ddErnsHC-KARD <220> <221> misc_feature <222> (12250)..(12250) <223> n is a, c, g, or t <400> 5 gtatacgagg ttagttcgtt ctcgtgtaca atattggaca agaccaaaat tccgatttgg 60 cctagggcac ccctccagcg acggccgaac tgggctagcc atgcccacag taggactagc 120 aaacggaggg actagccgta gtggcgagct ccctgggtgg tctaagtcct gagtacagga 180 cagtcgtcag tagttcgacg tgagcaggag cccacctcga gatgctatgt ggacgagggc 240 atgcccaaga cacaccttaa ccctggcggg ggtcgccagg gtgaaatcac accatgtgat 300 gggggtacga cctgataggg tgctgcagag gcccactaac aggctagtat aaaaaatctc 360 tgctgtacat ggcacatgga gttgaatcat tttgaactac tatacaaaac aaataaacaa 420 aaaccaatag gagtggagga accggtgtat gacatcacag gaagaccatt ttcggggac 480 ccaagtgagg tacacccaca atcaacactg aagctgccac atgacagggg gagaggtaat 540 atcagaacta cactgaagaa cctacctagg aaaggcgact gtaggagtgg aaaccaccta 600 ggaccagtca gtgggatata tgtaaaaccc ggccctgtct tctatcagga ctacatgggc 660 cctgtctatc atagagctcc attggagttt ttgaagagg cccagctgtg tgaggtgact 720 aagagaatag gtagggtgac gggtagtgat gggaagcttt accacatata tgtgtgcatt 780 gacggttgca tactgctgaa gttagccaaa agggcacgc ctagatccct aaagtggact 840 aggaacttca ccgactgtcc actatgggtc actagttgtt ctgatgatgg cgcaggtggc 900 agaaaaccaaaaaccaaaaaaaggc aagggtaat t'aaaatagc cccaaaagg 960 catgagaagg acagcaaaac caagccacct gatgccacga tcgtggtaga gggagtaaaa 1020 taccaagtga aaagaaagg caagtcaa gggaaca ctcagatgg cctataccat 1080 aaagaaca aaccaccaga gtccaggaag aaactagaaa aagccctact ggcttggggca 1140 gtgataacaa tcgtactgta ccagcctgta gcggccgaga atatactca gtggaacctg 1200 agtgacaatg gcacaagcgg tatccagcaa gccatgtatc ttagaggggt tataggagt 1260 ctacatggga tctggctga aaaaatatgc aaaggggtcc ctactcacct ggctactgat 1320 acggagctga cagagatacg agggatg gacgccagcg agaggacaa ctatacgtgt 1380 tgcaggttgc agagacacga atggataaa ggatggtgta actggtacaa catagacccc 1440 tggattcaat taatgacag gacccaagca atctgacag aaggcccccc ggataggag 1500 tgcgccgtga cttgcaggta tgacaaaat gctgacgtta acgtggtcac ccaggccagg 1560 atagaccaa cccactgac cggctgcaag aaaggaaaa acttcatt tgcaggtacg 1620 attatagagg gcccatgcaa ttcaacgtc tccgtggagg acatcctata tggggaccat 1680 gagggcagcc tgttccagga cacagctctg tacctattag atggaatgac cacactata 1740 gagaaagcca ggcagggtgc ggcaagagtt acatcctggc tgggaggca actcagaacc 1800 acagggaaga agttggagag aggaagcaaa acctggttcg gcgcctacgc cctgtcacct 1860 tactgtaacg taacaggaa agtggggtac atatgtata cgaacaattg cactccggca 1920 tgtctcccaa aaaacacgaa ataataggt ccaggaaat tcgataccaa cgcggagat 1980 gggaagatac ttcatgaat ggggggccac ctatcagaat tttgttgct ttctttagta 2040 atcctgtctg acttcgcccc ggagacggcc agtacgctat acctaatctt acactatgca 2100 atccctcagt cccatgaggt tgcgatacga accagctcaa tctacagtg 2160 ggacttagga cagaagatgt ggtaccatca tcagtttgga atatcggcaa attgtgtgt 2220 gtcagaccag actggtggcc gtatgaact aaggtggctt tgctgtttga ggaggcagga 2280 caggttataa aactagctct acggggcactg agagatttaa ctagagtctg gaacagtgca 2340 tcaactactg cgttcctcat ctgcttgata aaatattaa gaggacaggt tgtgcaggt 2400 atatatggc tgctgctggt aactggggca caagggcggt tgacctgta ggaagactac 2460 aggtatgcga tatcaagac caatgagata gggccgcttg ccgctaggga cctcactacc 2520 acctggaaag atacaacca tggtttacag ctggatgacg ggactgtcag ggccacttgc 2580 actgcagggt cctttaaagt tatagcactt aatgtggtta gtaggaggta cctggcatca 2640 ttacacaaga gggctttgcc cacctacagta acatttgaac tcctatttga tgggaccagc 2700 ccagtaattg aggagatggg agacgacttt ggatttgggc tgtgccttt tgacacgatc 2760 cctgtgtca aagggaagta taacaccacc ttattaacg gcagtgcttt ctactagtc 2820 tgccctatag gatggacgggg tgttatagag tgcacggcag taagccccac aaccttgaga 2880 acagaagtgg tgagacctt cagagagag aagccttttcc ctcacagagt ggactgcgtg 2940 accactatag tagaaaaaga agacctgttc tattgcaggc tggggggtaa ttggacatgc 3000 gtgaaaggtg acccggtgac ctacacgggg ggccaagtaa aacaatgcag gtggtgcggt 3060 ttcaacttca aggagcctga tgggctccca cactacccca taggcaagtg catcctagca 3120 aatgagacgg gatacagggt agtggactcc acagactgca acagagacgg cgtcgtcatc 3180 ggcactgaag gagagcatga gtgcttgatc ggcaacacca ccgtcaaggt gcacgcgctg 3240 gacggaagac tggcccctat gccttgcaga cccaaagaaa tcgtatctag tgcgggacct 3300 gtaaggaaaa cttcctgcac atttaactat acaaagactt tgaggaacaa gtactatgag 3360 cccagggaca gctacttcca gcaatacatg cttaagggcg agtatcaata ctggtttgat 3420 ctggacgtga cagaccacca cacagactac ttcgccgagt ttgttgtctt ggtggtagtg 3480 gcactattag ggggaaggta cgtcctgtgg ctaatagtga cctatatagt tctaacagag 3540 caactcgctg ctggtttaca gctaggccag ggcgaggtgg tgctgatagg gaacttaatc 3600 acccacatgg acaacgaggt agtggtatac ttcttactgc tttacctaat aataagagac 3660 gagcccataa agaaatggat actactgctg ttccatgcca tgaccaacaa cccagttaag 3720 accatgacag tagcattgct aatgataagc ggggtagcca agggtgggaa aatagatggt 3780 ggttggcaga ggcagccgga gaccaatttt gacatccaat tcgcactggc agtcataata 3840 gtcgtcgtga tgttgttggc aaagagagat ccgactactt ttcccctggt gatcactgtg 3900 gcaaccttga gaacggctaa gataaccagt ggtttcagca cagatctagc catagccaca 3960 gtgtcggcaa ctttgctaac ctggacttat atcagtgact actacaaata caagacttgg 4020 ctacagtacc tcatcagcac ggtgactgga atttttctga taagggtact gaagggggtc 4080 ggcgagttgg acctacacgc cccgactctg ccatcccaca gacccctttt ctacatcctt 4140 gtgtacctca tctccactgc cgtggtaacg agatggaact tggacgtagc cggaatactg 4200 ctacagtgcg ccccaacact tctaatggta ttcacgatgt gggctgacat cctcacccta 4260 attctcatac tgcccaccta tgagttgaca aagttatatt accttaagga agtgaagata 4320 gggactgaaa gaggatggct gtggaaaact aattacaaga gggtaaatga catctatgaa 4380 gtcgaccaag ctggcgaagg ggtttacctc ttcccttcga aacaaaagac tggagctata 4440 acgagcaccg tgttgccgtt gatcaaagcc atactcatta gctgcatcag taacaagtgg 4500 caattcatat atttactgta cttgatattt gaggtgacct actaccttca caagaaaatc 4560 atagatgaga tagccggcgg gaccaacttc gtttcgagac tagtggcggc tttaattgaa 4620 gttaattggg ctctagacaa tgaagaagtc aaaggcctaa agaagttttt cttgttgtct 4680 agtagggtca aagagttggt tatcaaacac aaagtgagga atgaagtaat ggtccgctgg 4740 tttgaagatg aagagatcta cgggatgcca aagctgatcg gcctggttaa ggcagcaaca 4800 ctgagcaaaa acaaacactg tattttgtgc accgtctgtg aggacagaga ttggcgggga 4860 gaaacttgcc cgaaatgcgg gcgttttgga ccaccagtga tctgtggtat gaccctagct 4920 gacttcgagg aaaaacacta taagaggatt ttcatcaggg aggaccaatc agacgggccg 4980 ctcagggagg agcatgcagg gtacttgcag tacaaagcta ggggtcaatt gtttctgagg 5040 aatctcccag tgttggcaac aaaagtcaag atgcttctgg ttggcaacct agggacagag 5100 gttggggacc tggagcacct tggctgggtg ctcagagggc ccgctgtctg caagaaggtt 5160 actgaacatg aaaagtgtgc tacgtctata atggataagt tgactgcctt ctttggtgtc 5220 atgccaaggg gtaccacccc cagagctcct gtaagatttc ccacctccct tctaaagata 5280 agaagagggc tggagacggg ttgggcttat acacaccaag gcggtatcag ctcagttgac 5340 catgttactt gcgggaaaga cctgctagtg tgtgacacca tgggtcggac aagggttgtc 5400 tgccaatcga ataacaagat gactgacgag tctgaatacg gagtcaaaac cgactcaggg 5460 tgcccagagg gagccaggtg ctacgtgttc aaccctgagg cagttaatat atcaggcact 5520 aaaggagcca tggtccactt acagaaaact ggtggagaat tcacctgtgt aacagcatca 5580 gggaccccag ctttcttcga tctcaagaac ctcaagggtt ggtcagggct accgatattt 5640 gaagcatcga gtggaagggt agtcggaagg gtcaaggtcg ggaagaacga agactctaaa 5700 ccaaccaaac tcatgagtgg gatacaaacg gtctctaaaa gtgccactga tttgacggag 5760 atggtgaaga agataacaac catgaacagg ggggagttca gacaaataac cttggccaca 5820 ggtgctggaa aaactacaga gctacccagg tcagtcatag aagatagg gagacacaaa 5880 agggtgctgg tattgatccc ccttagggcc gcagcagaat cagtatacca atacatgagg 5940 cagaaacacc cgagtatagc attcaacctg aggatagggg agatggagga aggatacatg 6000 gccacgggaa taacctatgc ttcttatggt tactttgcc agatgccaca acccaagttg 6060 agagccgcaa tggtagagta ttcctacatc tttctagacg agtaccattg cgccaccccg 6120 gaacaatgg ctatcatggg gaagattccac agatctcag agaacctgcg ggtggtcgct 6180 atgacagcga cgccggcagg cacggtaca actactgggc agaacaccc tatagaggag 6240 ttcatagcccc cggaagtgat gaaggagaa gacttaggtt cagagtactt agacatcgcc 6300 ggactaaga taccagtaga ggagatgaag aacaacatgc tagttttgt accactagg 6360 aacatggcag tggaggcggc aagaaattg aaagccaaag gattaactc aggtattac 6420 tacagtggtg aggaccacatc CAcctgagg gtagttacat cgcagtcccc atacgtggtg 6480 gtagcgacca acgcaataga atcaggcgtc actctcccag accttgatgt ggtcgttgac 6540 acaggactca agtgtgagaa aagaatccga ctgtcaccca agatgcctttt catagtgact 6600 ggcctgaaa gatggccgt cactattggg gaacaagccc agagaggg gaggttgga 6660 agagtaagc ccgggagata ctacaggagc caqaaactc cagtcggctc taaggactac 6720 cactatgact tgctgcaagc ccaaggtac ggtatagaag atgggataaa tatcaccaaa 6780 tccttcagag agatgaacta cgattggagc ctttatgagg agatagcct gatgataca 6840 siactggaaa tcctcaacaa tctgttgata tcagaggagc tgccggtagc agtaaaaaat 6900 ataatggcta ggactgacca cccagaacca attcaactag cgtataatag ctacgagaca 6960 caggtaccag tgttgttccc aaagataagg aatggagagg tgactgacac tgacacac 7020 tacaccttcc tcaatgcaag aaaattggga gatgatgtac ccccctatgt gtagccaca 7080 gaagatgagg acttggcagt ggaactgtta ggcctagatt ggccagaccc tggaaaccaa 7140 ggcactgtgg aggctggcag agcactaaaa caggtggtcg gcctatcac agccgagaat 7200 gccctgctag tggccttgtt tggctacgta gggtaccagg ccctcaaa aaggcatata 7260 cctgtagtca cagacatata ttcagttgaa gatcacaggt tggatac aacacaccta 7320 cagtatgccc cgaacgccat caagcggag gggaaggaga ctgaattgaa ggagttggct 7380 caggggatg tgcagagatg tgtggaagca gtggccaatt atgcgagtga gggcatccaa 7440 tttattagt spider gaggtgaga gagaccccga cttachaga gagaatgaat 7500 acagtggcag actatgtgaa aaagttcatt gaggcactgt cagatagcaa ggagacatc 7560 ttgaaatatg ggctgtgggg tgtacacacg gccttgtata agagcattgg tgccagacta 7620 gtcacgaaa ctgcgttcgc aactttagtc gtgaaatggt tggcattgg gggggaatca 7680 gtaacagatc actaagca agcagccaca gacttggttg tttactatat tatchacaga 7740 cctcaatcc caggggacac ggagacaca caggaaggga ggaatttgt ggccagctta 7800 ctggtctcag ccctagcaac ctacacatac aaagctgga actacaacaa tctgtccaag 7860 atagttgaac ctgctttggc cacttgccc tacgccgcca aagcctta attattcgcc 7920 cctacccgac tggagcgt cgtcatattg agcaccgcaa tctacaaac atatctatca 7980 atcaggcgag gcaaaagtga tggattgctt ggtacagggg ttagtgcggc tatggagatt 8040 atgtcacaaa atccagtatc agtgggcata gcagtcatgc tgggggttgg ggctgtagca 8100 gcccataatg caattgaagc cagtgagcag aagagaacac tactaatgaa agtctttgtg 8160 aaaaactctct tggaccaagc agccacggat gaactagtca aagagagcc tgagaaaata 8220 ataatggccc tgtttgaagc agtgcagacg gtaggcaacc ctctcagact ggtgtaccac 8280 ctatatggag ttttttaataa agggtgggaa gcaaaagagt tggcccaaag gacagccggc 8340 aggaacctct tcaccttaat aatgttcgag gctgtggaac tactgggagt agatagtgaa 8400 gggaaaatcc gccagctctc aagtaactac atattagagc tcctgtacaa gttccgtgac 8460 gacatcaaat ctagtgtgag ggagatagca atcagttggg cccctgcccc cttcagctgc 8520 gactggacac caacagatga cagaatagga cttccccatg acaattatct ccagatggag 8580 acaagatgtc cttgtggtta caggatgaaa gcagtaaaaa cctgtgccgg ggagttgaga 8640 ctcctggaag aggggggttc attcctctgc aggaataaat tcggcagagg gtcacggaat 8700 tatagggtga caaaatatta tgatgacaac ttatcagaaa taaaaccagt gataagaatg 8760 gaaggacacg tggaactgta tcataaaggg gccactttca aactggactt tgacaacagt 8820 aaaacagtac tggcaagaga tagatgggaa gtcgaccatt ccaccctgat cagggtgctc 8880 aagaggcaca caggggctgg atttcaaggg gcgtatctgg gtgagaaacc caatcacaag 8940 cacctgatag agagagactg tgcaacgatc acaaaagaca aggtctgctt catcaaaatg 9000 aagagggggt gcgcgttcac ctatgactta tcactccaca accttacccg gctaatcgaa 9060 9120 ctggcctaca cattcgtgaa tgaagacata gggaccataa aaccagtctt cgggggaaaaa 9180 gtaacaccgg agaagcagga ggaggtagcc ttgcagcctg cagtggtggt ggacaacaa 9240 gatgtggccg tgaccgtggt gggggaaacc tccactatga ccacaggga gacccccaca 9300 atatttacca gcttaggttc ggactctaag tttcaacaag tcctgaaact gggggtggat 9360 gagggtcaat atcccgggcc caggcagcag agagcaagtt tgctcgaagc tgtacaaggt 9420 gtagatgaga ggccctcggt actaatattg gggtctgata aggccaccctc caatagggtg 9480 aagaccgca agaatgtgaa gatttcagg agcagagacc ccctggact gagagagatg 9540 atgagaagg ggagatcct aatcatagcc ctgtgtagg tggacaccgc tctgctgaaa 9600 tttgttgatt acaaggtac cttcctgacc agagagaccc tagaggcatt aagtctggggc 9660 aaacctaaga aagagacat aactaagaca gaggcacgat gttgttgtg cctcgaaggt 9720 cattagaag agctgcctga ctggtttgca gccaaggagc ccatattctt agaagccaac 9780 atcaaacgtg acagtatca tctggtggga gatagcta accaag aaagccaag 9840 caactgggggg siacagactc cacaagata tcaaagagg ttggcgcgaa agtgtattct 9900 atgaagttga gtaactgggt gatacaggaa gagaataac agggcagctt aacccccttg 9960 tttgaagagc tcctgcaca gtgcccgccc gggggccaga ataaaaccac acatggcc 10020 tcagcctacc aattggctca ggggaactgg atgccagttg gttgccacgt gttcatgggg 10080 accatacccg ctagagaac caactcat ccctacgagg catatgtca gttgagggag 10140 ttggtggaag aacatagat gagacatca tgtggcggtt caggcctatg taagcacaac 10200 gatgggtaa ttcgtaagat caagcatcaa gggaacctga ggaccagaca catgctgaac 10260 cccggaaaga ttgctgagca actggataga gaagggcaca vakacaatgt gtacacaag 10320 accataggct cagtaatgac agcgactggc atcaggctgg aaagttacc cgtggttaga 10380 gcccagacag atacaccaa tttccaccaa gcaatagggg aataaataga caggaagag 10440 aacctacaga ccccaggctt accagaag ttaatggagg tattcaatgc atttaaaaga 10500 cctgagcttg aggcctctta cgacgccgtg gagtgggagg aattggag aggaataat 10560 aggaagggtg ctgcaggtt ctcgaacgc agaatag gagaggtcct agattcagaa 10620 aaatagg ttgagagat catagacagt ttgagaag gtaggagtat aatattatt 10680 gaaactgcaa tcccaagaa cgaaaagagg gatgtcaatg atgactggac tgccggagac 10740 tttgtggatg agaaaaaacc cagggtgata caatcctg agccaaac caggttagcc 10800 atcactaaag tgatgtataa gtgggtgaaa cagaaaccag tagtcatacc cggctatgaa 10860 ggtaagacac ctctgttcca aatttttgac aaagtgaaaa aagaatggaa ccaattccaa 10920 aatccagtgg cagtgagctt tgacactaaa gcatgggata cccaggtgac tacaagagac 10980 ctggaactaa taagggatat acagaagttc tatttcaaga agaagtggca caaattcatc 11040 gacaccctaa ccatgcacat gtcagaagta cccgtgatta gtgccgacgg ggaggtgtat 11100 ataaggaaag ggcagagagg cagtgggcaa cctgatacga gcgcaggcaa cagtatgctg 11160 aatgtgttaa caatggttta tgccttctgt gaggccacgg gggtacccta taaaagtttc 11220 gacagagtgg caaagatcca cgtctgtggg gatgatggct tcttgattac tgaaagggct 11280 cttggtgaaa aatttgcaag tagaggagtc cagatcctat atgaagccgg gaagccccaa 11340 aaaatcactg aaggggacaa tatgaaagtg gcctatcagt ttgacgacat cgagttctgc 11400 tcccatacac cagtgcaggt aaggtggtca gacaacacct ccagttacat gccggggagg 11460 aacacaacca caatactggc aaaaatggct acaaggttgg attccagtgg tgagagaggc 11520 actatagcat atgagaaggc agtggcattc agttctttgt tgatgtactc ctggaaccca 11580 ctgattagaa ggatatgctt attggtgtta tcaactgaaa tgcaagtgag accagggaag 11640 tcaaccacct attactatga aggagaccca atatctgctt acaaggaggt catcggccat 11700 aatctctttg accttaaaag aacaagtttc gagaagctag ctaagctaaa tcttagtatg 11760 tccacactcg gggtatggac caggcatacc agcaaaagat tactacaaga ctgtgtcaat 11820 gtcggcacca aagagggcaa ctggctggtt aacgcagaca gactggtgag tagtaagaca 11880 gggaataggt atatacctgg agagggtcat acccaacaag gaaaacatta tgaagagctg 11940 gtattggcaa gaaaaccgac cagtaatttt gaagggactg atagatataa tttgggccca 12000 atagtcaacg tagtgttgag gaggctgaga gtcatgatga tggctcttat aggaaggggg 12060 gtgtgagagc ggccggctct tgaccgggcc ctatcagtat aaccctgttg taaataacgc 12120 taacttatta tttatctaga cactactatt tatttatta tttatttatt gaatgagcaa 12180 ggaatggtac gaactacctc atgttaccac actacactca ttttaacagc actttagctg 12240 aggaaaaaan tcctgacgtc catagttgga ctaaggtaat ttcctaacgg ccc <210> 6 <211> 11804 <212> DNA <213> The snowstorm <220> <223> GD18-ddNproErnsH-CARD <220> <221> misc_feature <222> (11761)..(11761) <223> n is a, c, g, or t <400> 6 gtatacgagg ttagttcgtt ctcgtgtaca atattggaca agaccaaaat tccgatttgg cctagggcac ccctccagcg acggccgac tgggctagcc atgcccacag tagctagc 120 aaacggaggg actagccgta gtggcgagct ccctgggtgg tctaagtcct gagtacagga 180 cagtcgtcag tagttcgacg tgagcaggag cccacctcga gatgctatgt ggacgagggc atgcccaaga cacaccttaa ccctggcggg ggtcgccagg gtgaatcac accatgtgat gggggtacga cctgataggg tgctgcagag gcccactac aggctagtat aaaaaatctc 360 tgctgtacat ggcacatgga gttgaattct gatgatggcg caggtggcag caaggataag aaaaccagaca ggatgaacha gggtaatta aaaatagcccc aaaaagagca tgagaggac 480 agcaaaacca agccacctga tgccacgatc gtggtagagg gagtaaaata ccaagtgaaa 540 aagaaaggca aagtcaagg gagacact aagtggcc tattaccata window600 ccaccagagt ccaggagaa actagaaaaa gcctactgg cttgggcagt gataacaatc 660 gtactgtacc agcctgtagc ggccgagaat atactcagt ggaacctgag tgacaatggc 720 acagcggta tccagcaagc catgtatctt agaggggtta ataggagtct acatgggatc 780 tggcctgaaa aaatatgcaa aggggtccct actcacctgg ctactgatac ggagctgaca 840 gagatacgag ggatgatgga cgccagcgag aggacaact atacgtgttg caggttgcag 900 agacacgaat ggaataaagg atggtgtaac tggtacaaca tagaccctg gattcaatta 960 atgaacagga cccaagcaaa tctgacagaa ggccccccgg ataaggagtg cgccgtgact 1020 tgcaggtag acaaaatgc tgacgttaac gtggtcaccc aggcaggaa taggaccacc 1080 actctgaccg gctgcagaa aggaaaaac tttcattg caggtacgat tatagaggc 1140 ccatgcaatt tcaacgtc cgtggaggac atcctatatg gggaccatga gtgtggcagc 1200 ctgttccagg accagctct gtacctatta gatgaatga ccacactat agagaagcc 1260 aggcagggtg cggcaaggt tacatcctgg cttgggaggc aactcagaac cacagggaag 1320 aagttggaga gaggaagcaaacctggttc ggcgcctacg ccctgtcacc ttactgtaac 1380 gtaacagga aagtggggta catatggtat acgaacaatt gcactccggc atgtctccca 1440 aaaaacacga aaatatagg tccaggaaa ttcgatacca acggcggaga tggaagata 1500 cttcatgaaa tggggggcca cctatcagaa tttgttgc tttcttgt aatcctgtct 1560 gacttcgccc cggagacggc cagtacgcta tacctaatct tacactgc aatccctcag 1620 tcccatgaag agcctgaagg ttgcgatacg aaccagctca atctaacagt gggacttagg 1680 acagaagatg tggtaccatc atcagttttgg atatcggca atatgtgtg tgtcagacca 1740 gactggtgc cgtatgaac taaggtggct tgctgttg aggaggcagg acaggttata 1800 aaactagctc tacgggcact gagagattta actagagctct ggaacagctcc atcactact 1860 gcgttcctca tctgcttgat aaaaatatta agaggacagg ttgtgcaagg tataatatgg 1920 ctgctgctgg taactggggc acaagggcgg ttgacctgta aggaagacta caggtatgcg 1980 atatcaaaga ccaatgagat agggccgctt gccgctaggg acctcactac cacctggaaa 2040 gaatacaacc atggtttaca gctggatgac gggactgtca gggccacttg cactgcaggg 2100 tcctttaaag ttatagcact taatgtggtt agtaggaggt acctggcatc attacacaag 2160 agggctttgc ccacctcagt aacatttgaa ctcctatttg atgggaccag cccagtaatt 2220 gaggagatgg gagacgactt tggatttggg ctgtgccctt ttgacacgat ccctgtggtc 2280 aaagggaagt ataacaccac ctttataaac ggcagtgctt tctatctagt ctgccctata 2340 ggatggacgg gtgttataga gtgcacggca gtaagcccca caaccttgag aacagaagtg 2400 gtgaagacct tcaagagaga gaagcctttc cctcacagag tggactgcgt gaccactata 2460 gtagaaaaag aagacctgtt ctattgcagg ctggggggta attggacatg cgtgaaaggt 2520 gacccggtga cctacacggg gggccaagta aaacaatgca ggtggtgcgg tttcaacttc 2580 aaggagcctg atgggctccc acactacccc ataggcaagt gcatcctagc aaatgagacg 2640 ggatacagggg tagtggactc cacagactgc aacagagacg gcgtcgtcat cggcactgaa 2700 ggagagcatg agtgcttgat cggcacacc accgtcagg tgcacgcgct ggacggaaga 2760 ctggccccta tgccttgcag acccaaagaa atcgtatcta gtgcgggacc tgtaggaaa 2820 acttcctgca catttaacta tachaagact tgaggaca agtactatga gcccagggac 2880 agctacttcc agcaatacat gcttaagggc gagtatcaat actggtttga tctggacgtg 2940 acagaccacc acacagacta cttcgccgag ttgttgtct tggtgtagt ggcactatta 3000 gggggaaggt acgtcctgtg gctaatagtg acctatatag ttctaacaga gcaactcgct 3060 gctggtttac agctaggcca gggcgaggtg gtgctgatag ggaacttaat caccacatg 3120 gandacgagg tagtggtata cttcttactg ctttacctaa taatagaga cgagcccata 3180 aagaaatgga tactactgct gttccatgcc atgaccaca acccagttaa gaccatgaca 3240 gtagcattgc taatgataag cggggtagcc aagggtggga aaatagatgg tggttggcag 3300 aggcagccgg agaccaattt tgacatccaa ttcgcactgg cagtcataat agtcgtcgtg 3360 atgttgttgg caagaga tcccctgg tgatcactgt gccaccttg 3420 agaacggcta agataccag tggttcagc acagatctag ccatagccac agtgtcggca 3480 actttgctaa cctggactta tatcagtgac tactacaaat acagacttg gctacagtac 3540 ctcatcagca cggtgactgg aatttctg ataagggtac tgaagggggt cggcgagttg 3600 gacctacacg cccgactct gccacccac agaccccttt tctacatcct tgtgtacctc 3660 atctccactg ccgtggtaac gagatggaac ttggacgtag ccggaatact gctacagtgc 3720 gccccacac ttctaatggt attcacgatg tggctgaca tccaccct aattctcata 3780 ctgcccacct atgagttgac aaagttatat taccttaagg aagtgagat agggactgaa 3840 agaggatggc tgtggaaac taattacaag agggtaaatg acatctatga agtcgaccaa 3900 gctggcgaag gggtttacct cttccctcg aaaaaaaga ctggagctat acgagcacc 3960 gtgttgccgt tgatcaagc catactcatt agctgcatca gtacaagtg gcaatcata 4020 tatttactgt acttgatatt tgaggtgtcc tactaccttc acaagaaaat catagatgag atagccggcg ggaccaactt cgtttcgaga ctagtggcgg ctttaattga agttaattgg gctctagaca atgaagaagt caaaggccta aagaagtttt tcttgttgtc tagtagggtc aaagagttgg ttatcaaaca caaagtgagg aatgaagtaa tggtccgctg gtttgaagat gaagagatct acgggatgcc aaagctgatc ggcctggtta aggcagcaac actgagcaaa 4380. aacaaacact gtattttgtg caccgtctgt gaggacagag attggcgggg agaaacttgc ccgaaatgcg ggcgttttgg accaccagtg atctgtggta tgaccctagc tgacttcgag 4440. gaaaaacact ataagaggat tttcatcagg gaggaccat cagacgggcc gctcagggag gagcatgcag ggtacttgca gtacaaagct aggggtcaat tgtttctgag gaatctccca gtgttggcaa caaaagtcaa gatgcttctg gttggcaacc tagggacaga ggttggggac ctggagcacc ttggctgggt gctcagaggg cccgctgtct gcaagaaggt tactgaacat 4680. gaaaagtgtg ctacgtctat aatggataag ttgactgcct tctttggtgt catgccaagg 4740 ggtaccacccc ccagagctcc tgtaagattt cccaccccc ttctaaagat aagagaggg 4800 ctggagacgg gttgggctta tacaccaa ggcggtatca gctcagttga ccatgttact 4860 tgcgggaaag acctgctagt gtgtgacacc atgggtcgga caagggttgt ctgccaatcg 4920 aaacaaga tgactgacga gtctgaatac ggagtcaaa ccgactcagg gtgcccagag 4980 ggagccaggt gctacgtgtt scacctgag gcagttaata tatcaggcac taaggagcc 5040 atggtccact tacagaaaac tggtggagaa ttcacctgtg taacaccatc agggacccca 5100 gctttcttcg atctcaagaa cctcaagggt tggtcaggc taccgatatt tgaagcatcg 5160 agtggaaggg tagtcggaag ggtcaggtc gggagaacg agactcta accaaccaaa 5220 ctcatgagtg ggatacaaac ggtctctaaa agtgccactg atttgacgga gatggtgaag 5280 aagataacaa ccatgaacag gggggagttc agacaaata ccttggccac aggtgctgga 5340 aaaactacag agctacccag gtcagtcata gagagatag ggagacaca aagggtgctg 5400 gtattgatcc cccttagggc cgcagcagaa tcagtatacc atacatgag gcagaacac 5460 ccgagtatag cattcaacct gaggataggg gagatggagg aaggatacat ggccacggga 5520 ataacctatg cttcttatgg ttacttttgc cagatgccac aacccaagtt gagagccgca atggtaggt attcctacat ctttctagac gagtaccatt gcgccacccc ggaacaattg gctatcatgg ggaagatcca cagattctca gagaacctgc gggtggtcgc tatgacagcg acgccggcag gcacggtac aactactggg cagaaacacc ctatagagga gttcatagcc ccggaagtga tgaaaggaga agacttaggt tcagagtact tagacatcgc cggactaaag attack ctagtttttg attack ctagtttg ctagtttg ctagtttg ctagtttg gtggaggcgg caaagaatt gaaagccaaa ggatataact caggctatta ctacagtggt gaggacccat ccaacctgag ggtagttaca tcgcagtccc catacgtggt ggtagcgacc aacgcaatag aatcaggcgt cactctccca gaccttgatg tggtcgttga cacaggactc aagtgtgaga aaagaatccg actgtcaccc aagatgcctt tcatagtgac tggcctgaaa agaatggccg tcactattgg ggaacaagcc cagagaagag ggagggttgg aagagtaaag cccgggagat actacaggag ccaagaaact ccagtcggct ctaaggacta ccactatgac 6240 ttgctgcaag cccaaaggta cggtatagaa gatgggataa atatcaccaa atccttcaga 6300 6360 atcctcaaca atctgttgat atcagaggag ctgccggtag cattaaaaa tataatggct 6420 aggactgacc acccagaacc aattcaacta gcgtataata gctacgagac acaggtacca 6480 gtgttgttcc caaagataag gaatggagag gtgactgaca cttacgacaa ctacaccttc 6540 ctcaatgcaa gaaaattggg agatgatgta cccccctatg tgtatgccac agaagatgag 6600 gacttggcag tggaactgtt aggcctagat tggccagacc ctggaaacca aggcactgtg 6660 gaggctggca gagcaaa acaggtggtc ggcctatcaa cagccgagaa tgccctgcta 6720 gtggccttgt ttggctacgt agggtaccag gccctctcaa aaaggcatat acctgtagtc 6780 6840 ccgaacgcca tcaagacgga gggaaggag actgaattga aggagttggc tcaaggggat 6900 gtgcagagat gtgtggaagc agtggccaat tatgcgagtg agggcatcca atttattaag 6960 tcacaggcac tgaaggtgag agagaccccg acttacaaag agacaatgaa tacagtggca 7020 gactatgtga aaaagttcat tgaggcactg tcagatagca aggaagacat cttgaaatat 7080 gggctgtggg gtgtacacac ggccttgtat aagagcattg gtgccagact aggtcacgaa 7140 actgcgttcg caactttagt cgtgaaatgg ttggcatttg ggggggaatc agtaacagat 7200 cacataaagc aagcagccac agacttggtt gttactata tttcaacag acctcaattc 7260 ccaggggaca cggagacaca acaagaaggg aggaaatttg tggccagctt actggtctca 7320 gcctagcaa cctacacata caaaagctgg aactacaaca atctgtccaa gatagttgaa 7380 cctgctttgg ccactttgcc ctacgccgcc aaagccctta aattattcgc cctacccga 7440 ctggagagcg tcgtcatatt gagcaccgca atctacaaaa catatctatc aatcaggcga 7500 ggcaaaagtg atggattgct tggtacaggg gttagtgcgg ctatggagat tatgtcacaa 7560 aatccagtat cagtgggcat agcagtcatg ctgggggttg gggctgtagc agcccataat 7620 gcaattgaag ccagtgagca gaagagaaca ctactaatga aagtctttgt gaaaaacttc 7680 ttggaccaag cagccacgga tgaactagtc aaagagagcc ctgagaaaat aataatggcc 7740 ctgtttgaag cagtgcagac ggtaggcaac cctctcagac tggtgtacca cctatatgga 7800 gttttttata aagggtggga agcaaaagag ttggcccaaa ggacagccgg caggaacctc 7860 ttcaccttaa taatgttcga ggctgtggaa ctactgggag tagatagtga agggaaaatc 7920 cgccagctct caagtaacta catattagag ctcctgtaca agttccgtga cgacatcaaa 7980 tctagtgtga gggagatagc aatcagttgg gcccctgccc ccttcagctg cgactggaca 8040 ccaacagatg acagaatagg acttccccat gacaattatc tccagatgga gacaagatgt 8100 ccttgtggtt acaggatgaa agcagtaaaa acctgtgccg gggagttgag actcctggaa 8160 gaggggggtt cattcctctg caggaataaa ttcggcagag ggtcacggaa ttatagggtg 8220 acaaaatatt atgatgacaa cttatcagaa ataaaaccag tgataagaat ggaaggacac 8280 gtggaactgt atcataaagg ggccactttc aaactggact ttgacaacag taaaacagta 8340 ctggcaacag atagatggga agtcgaccat tccaccctga tcagggtgct caagaggcac 8400 acaggggctg gatttcaagg ggcgtatctg ggtgagaaac ccaatcacaa gcacctgata 8460 gagagact gtgcaacgat cacaaaagac aaggtctgct tcatcaaaat gaagaggggg 8520 tgcgcgttca cctatgactt atcactccac aaccttaccc ggctaatcga attggtacat 8580 aagaacaacc tggatgacag agaaatccct gccgttacgg tcacaacctg gctggcctac 8640 acattcgtga atgaagacat agggaccata aaaccagtct tcggggaaaa agtaacaccg 8700 gagaagcagg aggaggtagc cttgcagcct gcagtggtgg tggacacaac agatgtggcc 8760 gtgaccgtgg tgggggaaac ctccactatg accacagggg agacccccac aatatttacc 8820 agcttaggtt cggactctaa gtttcaacaa gtcctgaaac tgggggtgga tgagggtcaa 8880 tatcccgggc ccaggcagca gagagcaagt ttgctcgaag ctgtacaagg tgtagatgag 8940 aggccctcgg tactaatatt ggggtctgat aaggccacct ccaatagggt gaagaccgca 9000 aagaatgtga agatattcag gagcagagac cccctggaac tgagagagat gatgagaaga 9060 gggaagatcc taatcatagc cctgtgtaag gtggacaccg ctctgctgaa atttgttgat 9120 tacaaggta ccttcctgac cagagagacc ctagaggcat taagtctggg caacctaag 9180 aaagagaca taactagac agaggcacga tggttgttgt gcctcgaagg tcattagaa 9240 gagctgcctg actggtttgc agccaggag cccatattct tagagccaa catchaacgt 9300 aghaagtatc atctggtggg agacatagct acatcaaag aaaagccaa gcaactgggg 9360 gcaacagact ccacaagat atcaaagg gttggcgcga aagtgtattc tatgaagttg 9420 agtaactggg tgatacagga agagaataa cagggcagct taaccccctt gtttgaagag 9480 ctcctgcaac agtgcccgcc cggggggccag ataaaacca cacatatggc ctcagcctac 9540 cavattggctc agggactg gatgccagtt ggttgccacg tgttcatggg gaccataccc 9600 gctagaagaa ccagactca tcctacgag gcatatgtca agttgaggga gttggtggaa 9660 gaacataga tgagacatc atgtggcggt tcaggcctat gtaagcacaa cgaatgggta 9720 attcgtaaga tcaagcatca agggaacctg agggaccagac acatgctgaa ccccggaaag 9780 attgctgagc aactggatag agaagggcac agacacaatg tgtacaaca gaccataggc 9840 tcagtaatga cagcgactgg catcaggctg gaaagttac ccgtggttag agcccagaca 9900 gataacta atttccacca agcaatagg gataaatag ahaahaga gaacctacag 9960 accccaggct tacacagaa gttaatggag gtattcaatg cattaaaag acctgagctt 10020 gaggccctt acgacgccgt ggagtgggag gattgaga gaggaataa taggaggggt 10080 gctgcagggt tcttcgaacg caagaata ggagaggtcc tegttcaga aaaataag 10140 gttgaagaga tcatagacag tttgagaaa ggtaggagta ttaatatta tgaaactgca 10200 atcccaaaga acgaaagag ggatgtcaat gatgactgga ctgccggaga ctttgtggat 10260 gagaaaaaac ccaggtgat acaatcct gaggccaaaa ccaggttagc catcactaaa 10320 gtgatgtata agtgggtgaa acagaaacca gtagtcatac ccggctatga aggtaagaca 10380 cctctgttcc aaatttttga aaagtgaa aaagaatgga accaattcca aaatccagtg 10440 gcagtgagct ttgacactaa agcatgggat acccaggtga ctacaagaga cctggaacta 10500 ataagggata tacagaagtt ctatttcaag aagaagtggc acaaattcat cgacacccta 10560 accatgcaca tgtcagaagt acccgtgatt agtgccgacg gggaggtgta tataaggaaa 10620 gggcagagag gcagtgggca acctgatacg agcgcaggca acagtagct gatgtgtta 10680 acaatggttt atgccttctg tgaggccacg ggggtaccct ataaaagttt cgacagagtg 10740 gcaaagatcc acgtctgtgg ggatgatggc ttcttgatta ctgaaagggc tcttggtgaa 10800 aaatttgcaa gtagaggagt ccagatccta tatgaagccg ggaagcccca aaaaatcact 10860 gaaggggaca atatgaaagt ggcctatcag tttgacgaca tcgagttctg ctcccataca 10920 ccagtgcagg taaggtgtc agacacacc tccagttaca tgccggggg gacacaacc 10980 acaatactgg caaaaatggc tacaagttg gattccagtg gtgagagagg cactatagca 11040 tatgagaagg cagtggcatt cagttcttg tgatgtact cctgaaccc actgattaga 11100 aggatatgct tattggtgtt atcaactgaa atgcaagtga gaccagggaa gtcaccacc 11160 tattactatg aaggagaccc aatatctgct tacaaggagg tcatcggcca taatctcttt 11220 gaccttaaaa gaacaagttt cgagaagcta gctaagctaa atcttagtat gtccacactc 11280 ggggtatgga ccaggcatac cagcaaaaga ttactacaag actgtgtcaa tgtcggcacc 11340 aaagagggca actggctggt taacgcagac agactggtga gtagtaagac agggaatagg 11400 tatatacctg gagagggtca tacccaacaa ggaaaacatt atgaagagct ggtattggca 11460 agaaaaccga ccagtaattt tgaagggact gatagatata atttgggccc aatagtcaac 11520 gtagtgttga ggaggctgag agtcatgatg atggctctta taggaagggg ggtgtgagag 11580 cggccggctc ttgaccgggc cctatcagta taaccctgtt gtaaataacg ctaacttatt 11640 atttatctag acactactat ttatttattt atttatttat tgaatgagca aggaatggta 11700 cgaactacct catgttacca cactacactc attttaacag cactttagct gaggaaaaaa 11760 ntcctgacgt ccatagttgg actaaggtaa tttcctaacg gccc 11804 <210> 7 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> QZ07-E2 <400> 7 Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn 180 185 190 Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val Ile Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 8 <211> 373 <212> PRT <213> Artificial Sequence <220> <223> GD18-E2 <400> 8 Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn 1 5 10 15 Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys Glu 20 25 30 Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr Cys 35 40 45 Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg 50 55 60 Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe 65 70 75 80 Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly Asp 85 90 95 Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val Lys 100 105 110 Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val 115 120 125 Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro 130 135 140 Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro 145 150 155 160 Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp 165 170 175 Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Asp 180 185 190 Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys Gly 195 200 205 Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys 210 215 220 Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp 225 230 235 240 Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu Cys 245 250 255 Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu 260 265 270 Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro 275 280 285 Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg Asn 290 295 300 Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys 305 310 315 320 Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His His Thr 325 330 335 Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala Leu Leu Gly 340 345 350 Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile Val Leu Thr Glu 355 360 365 Gln Leu Ala Ala Gly 370 <210> 9 <211> 135 <212> PRT <213> Artificial Sequence <220> <223> variable region of heavy chain of mAb 6B8 <400> 9 Met Asp Ser Arg Leu Asn Leu Val Phe Leu Val Leu Ile Leu Lys Gly 1 5 10 15 Val Gln Cys Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 20 25 30 Pro Gly Gly Ser Arg Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 35 40 45 Ser Ser Phe Gly Met His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu 50 55 60 Glu Trp Val Ala Tyr Ile Ser Ser Asp Ser Phe Thr Ile Tyr Tyr Ala 65 70 75 80 Asp Thr Met Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Pro Gln Asn 85 90 95 Thr Leu Phe Leu Gln Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met 100 105 110 Tyr Tyr Cys Ala Arg Gly Asp Leu Pro Phe Ala Tyr Trp Gly Gln Gly 115 120 125 Thr Leu Val Thr Val Ser Ala 130 135 <210> 10 <211> 131 <212> PRT <213> Artificial sequence <220> <223> variable region of light chain of mAb 6B8 <400> 10 Met Gly Ile Lys Met Glu Thr His Ser Gln Val Phe Val Tyr Met Leu 1 5 10 15 Leu Trp Leu Ser Gly Val Glu Gly Asp Ile Val Met Thr Gln Ser His 20 25 30 Lys Phe Met Ser Thr Ser Val Gly Asp Arg Val Ser Ile Thr Cys Lys 35 40 45 Ala Ser Gln Ala Val Gly Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro 50 55 60 Gly Gln Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg His Thr 65 70 75 80 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr 85 90 95 Leu Thr Ile Ser Asn Val Gln Ser Glu Asp Leu Ala Asp Tyr Phe Cys 100 105 110 His Gln Tyr Ser Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu 115 120 125 Glu Leu Lys 130 <210> 11 <211> 12 <212> PRT <213> Artificial sequence <220> <223> 6B8 epitope for GD18 or QZ07 or GD191 <400> 11 Ser Thr Asn Glu Ile Gly Pro Leu Gly Ala Glu Gly 1 5 10 <210> 12 <211> 12 <212> PRT <213> Artificial sequence <220> <223> 6B8 epitope for C strain <400> 12 Ser Thr Asp Glu Ile Gly Leu Leu Gly Ala Gly Gly 1 5 10 <210> 13 <211> 12 <212> PRT <213> Artificial sequence <220> <223> mutated 6B8 epitope with KRD for GD18 or QZ07 or GD191 <400> 13 Lys Thr Asn Glu Ile Gly Pro Leu Gly Ala Arg Asp 1 5 10 <210> 14 <211> 12 <212> PRT <213> Artificial sequence <220> <223> mutated 6B8 epitope with KARD for GD18 or QZ07 or GD191 <400> 14 Lys Thr Asn Glu Ile Gly Pro Leu Ala Ala Arg Asp 1 5 10 <210> 15 <211> 168 <212> PRT <213> Synthetic Sequence <220> <223> Npro of GD18 <400> 15 Met Glu Leu Asn His Phe Glu Leu Leu Tyr Lys Thr Asn Lys Gln Lys 1 5 10 15 Pro Ile Gly Val Glu Glu Pro Val Tyr Asp Ile Ala Gly Arg Pro Phe 20 25 30 Phe Gly Asp Pro Ser Glu Val His Pro Gln Ser Thr Leu Lys Leu Pro 35 40 45 His Asp Arg Gly Arg Gly Asn Ile Arg Thr Thr Leu Lys Asn Leu Pro 50 55 60 Arg Lys Gly Asp Cys Arg Ser Gly Asn His Leu Gly Pro Val Ser Gly 65 70 75 80 Ile Tyr Val Lys Pro Gly Pro Val Phe Tyr Gln Asp Tyr Met Gly Pro 85 90 95 Val Tyr His Arg Ala Pro Leu Glu Phe Phe Glu Glu Ala Gln Leu Cys 100 105 110 Glu Val Thr Lys Arg Ile Gly Arg Val Thr Gly Ser Asp Gly Lys Leu 115 120 125 Tyr His Ile Tyr Val Cys Ile Asp Gly Cys Ile Leu Leu Lys Leu Ala 130 135 140 Lys Arg Gly Thr Pro Arg Ser Leu Lys Trp Thr Arg Asn Phe Thr Asp 145 150 155 160 Cys Pro Leu Trp Val Thr Ser Cys 165 <210> 16 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Erns of GD18 <400> 16 Glu Asn Ile Thr Gln Trp Asn Leu Ser Asp Asn Gly Thr Ser Gly Ile 1 5 10 15 Gln Gln Ala Met Tyr Leu Arg Gly Val Asn Arg Ser Leu His Gly Ile 20 25 30 Trp Pro Glu Lys Ile Cys Lys Gly Val Pro Thr His Leu Ala Thr Asp 35 40 45 Thr Glu Leu Thr Glu Ile Arg Gly Met Met Asp Ala Ser Glu Arg Thr 50 55 60 Asn Tyr Thr Cys Cys Arg Leu Gln Arg His Glu Trp Asn Lys His Gly 65 70 75 80 Trp Cys Asn Trp Tyr Asn Ile Asp Pro Trp Ile Gln Leu Met Asn Arg 85 90 95 Thr Gln Ala Asn Leu Thr Glu Gly Pro Pro Asp Lys Glu Cys Ala Val 100 105 110 Thr Cys Arg Tyr Asp Lys Asn Ala Asp Val Asn Val Val Thr Gln Ala 115 120 125 Arg Asn Arg Pro Thr Thr Leu Thr Gly Cys Lys Lys Gly Lys Asn Phe 130 135 140 Ser Phe Ala Gly Thr Ile Ile Glu Gly Pro Cys Asn Phe Asn Val Ser 145 150 155 160 Val Glu Asp Ile Leu Tyr Gly Asp His Glu Cys Gly Ser Leu Phe Gln 165 170 175 Asp Thr Ala Leu Tyr Leu Leu Asp Gly Met Thr Asn Thr Ile Glu Lys 180 185 190 Ala Arg Gln Gly Ala Ala Arg Val Thr Ser Trp Leu Gly Arg Gln Leu 195 200 205 Ser Thr Thr Gly Lys Lys Leu Glu Arg Gly Ser Lys Thr Trp Phe Gly 210 215 220 Ala Tyr Ala 225 <210> 17 <211> 3898 <212> PRT <213> Artificial Sequence <220> <223> polyprotein of GD18 <400> 17 Met Glu Leu Asn His Phe Glu Leu Leu Tyr Lys Thr Asn Lys Gln Lys 1 5 10 15 Pro Ile Gly Val Glu Glu Pro Val Tyr Asp Ile Ala Gly Arg Pro Phe 20 25 30 Phe Gly Asp Pro Ser Glu Val His Pro Gln Ser Thr Leu Lys Leu Pro 35 40 45 His Asp Arg Gly Arg Gly Asn Ile Arg Thr Thr Leu Lys Asn Leu Pro 50 55 60 Arg Lys Gly Asp Cys Arg Ser Gly Asn His Leu Gly Pro Val Ser Gly 65 70 75 80 Ile Tyr Val Lys Pro Gly Pro Val Phe Tyr Gln Asp Tyr Met Gly Pro 85 90 95 Val Tyr His Arg Ala Pro Leu Glu Phe Phe Glu Glu Ala Gln Leu Cys 100 105 110 Glu Val Thr Lys Arg Ile Gly Arg Val Thr Gly Ser Asp Gly Lys Leu 115 120 125 Tyr His Ile Tyr Val Cys Ile Asp Gly Cys Ile Leu Leu Lys Leu Ala 130 135 140 Lys Arg Gly Thr Pro Arg Ser Leu Lys Trp Thr Arg Asn Phe Thr Asp 145 150 155 160 Cys Pro Leu Trp Val Thr Ser Cys Ser Asp Asp Gly Ala Gly Gly Ser 165 170 175 Lys Asp Lys Lys Pro Asp Arg Met Asn Lys Gly Lys Leu Lys Ile Ala 180 185 190 Pro Lys Glu His Glu Lys Asp Ser Lys Thr Lys Pro Pro Asp Ala Thr 195 200 205 Ile Val Val Glu Gly Val Lys Tyr Gln Val Lys Lys Lys Gly Lys Val 210 215 220 Lys Gly Lys Asn Thr Gln Asp Gly Leu Tyr His Asn Lys Asn Lys Pro 225 230 235 240 Pro Glu Ser Arg Lys Lys Leu Glu Lys Ala Leu Leu Ala Trp Ala Val 245 250 255 Ile Thr Ile Val Leu Tyr Gln Pro Val Ala Ala Glu Asn Ile Thr Gln 260 265 270 Trp Asn Leu Ser Asp Asn Gly Thr Ser Gly Ile Gln Gln Ala Met Tyr 275 280 285 Leu Arg Gly Val Asn Arg Ser Leu His Gly Ile Trp Pro Glu Lys Ile 290 295 300 Cys Lys Gly Val Pro Thr His Leu Ala Thr Asp Thr Glu Leu Thr Glu 305 310 315 320 Ile Arg Gly Met Met Asp Ala Ser Glu Arg Thr Asn Tyr Thr Cys Cys 325 330 335 Arg Leu Gln Arg His Glu Trp Asn Lys His Gly Trp Cys Asn Trp Tyr 340 345 350 Asn Ile Asp Pro Trp Ile Gln Leu Met Asn Arg Thr Gln Ala Asn Leu 355 360 365 Thr Glu Gly Pro Pro Asp Lys Glu Cys Ala Val Thr Cys Arg Tyr Asp 370 375 380 Lys Asn Ala Asp Val Asn Val Val Thr Gln Ala Arg Asn Arg Pro Thr 385 390 395 400 Thr Leu Thr Gly Cys Lys Lys Gly Lys Asn Phe Ser Phe Ala Gly Thr 405 410 415 Ile Ile Glu Gly Pro Cys Asn Phe Asn Val Ser Val Glu Asp Ile Leu 420 425 430 Tyr Gly Asp His Glu Cys Gly Ser Leu Phe Gln Asp Thr Ala Leu Tyr 435 440 445 Leu Leu Asp Gly Met Thr Asn Thr Ile Glu Lys Ala Arg Gln Gly Ala 450 455 460 Ala Arg Val Thr Ser Trp Leu Gly Arg Gln Leu Ser Thr Thr Gly Lys 465 470 475 480 Lys Leu Glu Arg Gly Ser Lys Thr Trp Phe Gly Ala Tyr Ala Leu Ser 485 490 495 Pro Tyr Cys Asn Val Thr Arg Lys Val Gly Tyr Ile Trp Tyr Thr Asn 500 505 510 Asn Cys Thr Pro Ala Cys Leu Pro Lys Asn Thr Lys Ile Ile Gly Pro 515 520 525 Gly Lys Phe Asp Thr Asn Ala Glu Asp Gly Lys Ile Leu His Glu Met 530 535 540 Gly Gly His Leu Ser Glu Phe Leu Leu Leu Ser Leu Val Ile Leu Ser 545 550 555 560 Asp Phe Ala Pro Glu Thr Ala Ser Thr Leu Tyr Leu Ile Leu His Tyr 565 570 575 Ala Ile Pro Gln Ser His Glu Glu Pro Glu Gly Cys Asp Thr Asn Gln 580 585 590 Leu Asn Leu Thr Val Gly Leu Arg Thr Glu Asp Val Val Pro Ser Ser 595 600 605 Val Trp Asn Ile Gly Lys Tyr Val Cys Val Arg Pro Asp Trp Trp Pro 610 615 620 Tyr Glu Thr Lys Val Ala Leu Leu Phe Glu Glu Ala Gly Gln Val Ile 625 630 635 640 Lys Leu Ala Leu Arg Ala Leu Arg Asp Leu Thr Arg Val Trp Asn Ser 645 650 655 Ala Ser Thr Thr Ala Phe Leu Ile Cys Leu Ile Lys Ile Leu Arg Gly 660 665 670 Gln Val Val Gln Gly Ile Ile Trp Leu Leu Leu Val Thr Gly Ala Gln 675 680 685 Gly Arg Leu Thr Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr 690 695 700 Asn Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys 705 710 715 720 Glu Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Thr 725 730 735 Cys Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg 740 745 750 Arg Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr 755 760 765 Phe Glu Leu Leu Phe Asp Gly Thr Ser Pro Val Ile Glu Glu Met Gly 770 775 780 Asp Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ile Pro Val Val 785 790 795 800 Lys Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu 805 810 815 Val Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser 820 825 830 Pro Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys 835 840 845 Pro Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu 850 855 860 Asp Leu Phe Tyr Cys Arg Leu Gly Gly Asn Trp Thr Cys Val Lys Gly 865 870 875 880 Asp Pro Val Thr Tyr Thr Gly Gly Gln Val Lys Gln Cys Arg Trp Cys 885 890 895 Gly Phe Asn Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly 900 905 910 Lys Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr 915 920 925 Asp Cys Asn Arg Asp Gly Val Val Ile Gly Thr Glu Gly Glu His Glu 930 935 940 Cys Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg 945 950 955 960 Leu Ala Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly 965 970 975 Pro Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg 980 985 990 Asn Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu 995 1000 1005 Lys Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His 1010 1015 1020 His Thr Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala 1025 1030 1035 Leu Leu Gly Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Ile 1040 1045 1050 Val Leu Thr Glu Gln Leu Ala Ala Gly Leu Gln Leu Gly Gln Gly 1055 1060 1065 Glu Val Val Leu Ile Gly Asn Leu Ile Thr His Met Asp Asn Glu 1070 1075 1080 Val Val Val Tyr Phe Leu Leu Leu Tyr Leu Ile Ile Arg Asp Glu 1085 1090 1095 Pro Ile Lys Lys Trp Ile Leu Leu Leu Phe His Ala Met Thr Asn 1100 1105 1110 Asn Pro Val Lys Thr Met Thr Val Ala Leu Leu Met Ile Ser Gly 1115 1120 1125 Val Ala Lys Gly Gly Lys Ile Asp Gly Gly Trp Gln Arg Gln Pro 1130 1135 1140 Glu Thr Asn Phe Asp Ile Gln Phe Ala Leu Ala Val Ile Ile Val 1145 1150 1155 Val Val Met Leu Leu Ala Lys Arg Asp Pro Thr Thr Phe Pro Leu 1160 1165 1170 Val Ile Thr Val Ala Thr Leu Arg Thr Ala Lys Ile Thr Ser Gly 1175 1180 1185 Phe Ser Thr Asp Leu Ala Ile Ala Thr Val Ser Ala Thr Leu Leu 1190 1195 1200 Thr Trp Thr Tyr Ile Ser Asp Tyr Tyr Lys Tyr Lys Thr Trp Leu 1205 1210 1215 Gln Tyr Leu Ile Ser Thr Val Thr Gly Ile Phe Leu Ile Arg Val 1220 1225 1230 Leu Lys Gly Val Gly Glu Leu Asp Leu His Ala Pro Thr Leu Pro 1235 1240 1245 Ser His Arg Pro Leu Phe Tyr Ile Leu Val Tyr Leu Ile Ser Thr 1250 1255 1260 Ala Val Val Thr Arg Trp Asn Leu Asp Val Ala Gly Ile Leu Leu 1265 1270 1275 Gln Cys Ala Pro Thr Leu Leu Met Val Phe Thr Met Trp Ala Asp 1280 1285 1290 Ile Leu Thr Leu Ile Leu Ile Leu Pro Thr Tyr Glu Leu Thr Lys 1295 1300 1305 Leu Tyr Tyr Leu Lys Glu Val Lys Ile Gly Thr Glu Arg Gly Trp 1310 1315 1320 Leu Trp Lys Thr Asn Tyr Lys Arg Val Asn Asp Ile Tyr Glu Val 1325 1330 1335 Asp Gln Ala Gly Glu Gly Val Tyr Leu Phe Pro Ser Lys Gln Lys 1340 1345 1350 Thr Gly Ala Ile Thr Ser Thr Val Leu Pro Leu Ile Lys Ala Ile 1355 1360 1365 Leu Ile Ser Cys Ile Ser Asn Lys Trp Gln Phe Ile Tyr Leu Leu 1370 1375 1380 Tyr Leu Ile Phe Glu Val Ser Tyr Tyr Leu His Lys Lys Ile Ile 1385 1390 1395 Asp Glu Ile Ala Gly Gly Thr Asn Phe Val Ser Arg Leu Val Ala 1400 1405 1410 Ala Leu Ile Glu Val Asn Trp Ala Leu Asp Asn Glu Glu Val Lys 1415 1420 1425 Gly Leu Lys Lys Phe Phe Leu Leu Ser Ser Arg Val Lys Glu Leu 1430 1435 1440 Val Ile Lys His Lys Val Arg Asn Glu Val Met Val Arg Trp Phe 1445 1450 1455 Glu Asp Glu Glu Ile Tyr Gly Met Pro Lys Leu Ile Gly Leu Val 1460 1465 1470 Lys Ala Ala Thr Leu Ser Lys Asn Lys His Cys Ile Leu Cys Thr 1475 1480 1485 Val Cys Glu Asp Arg Asp Trp Arg Gly Glu Thr Cys Pro Lys Cys 1490 1495 1500 Gly Arg Phe Gly Pro Pro Val Ile Cys Gly Met Thr Leu Ala Asp 1505 1510 1515 Phe Glu Glu Lys His Tyr Lys Arg Ile Phe Ile Arg Glu Asp Gln 1520 1525 1530 Ser Asp Gly Pro Leu Arg Glu Glu His Ala Gly Tyr Leu Gln Tyr 1535 1540 1545 Lys Ala Arg Gly Gln Leu Phe Leu Arg Asn Leu Pro Val Leu Ala 1550 1555 1560 Thr Lys Val Lys Met Leu Leu Val Gly Asn Leu Gly Thr Glu Val 1565 1570 1575 Gly Asp Leu Glu His Leu Gly Trp Val Leu Arg Gly Pro Ala Val 1580 1585 1590 Cys Lys Lys Val Thr Glu His Glu Lys Cys Ala Thr Ser Ile Met 1595 1600 1605 Asp Lys Leu Thr Ala Phe Phe Gly Val Met Pro Arg Gly Thr Thr 1610 1615 1620 Pro Arg Ala Pro Val Arg Phe Pro Thr Ser Leu Leu Lys Ile Arg 1625 1630 1635 Arg Gly Leu Glu Thr Gly Trp Ala Tyr Thr His Gln Gly Gly Ile 1640 1645 1650 Ser Ser Val Asp His Val Thr Cys Gly Lys Asp Leu Leu Val Cys 1655 1660 1665 Asp Thr Met Gly Arg Thr Arg Val Val Cys Gln Ser Asn Asn Lys 1670 1675 1680 Met Thr Asp Glu Ser Glu Tyr Gly Val Lys Thr Asp Ser Gly Cys 1685 1690 1695 Pro Glu Gly Ala Arg Cys Tyr Val Phe Asn Pro Glu Ala Val Asn 1700 1705 1710 Ile Ser Gly Thr Lys Gly Ala Met Val His Leu Gln Lys Thr Gly 1715 1720 1725 Gly Glu Phe Thr Cys Val Thr Ala Ser Gly Thr Pro Ala Phe Phe 1730 1735 1740 Asp Leu Lys Asn Leu Lys Gly Trp Ser Gly Leu Pro Ile Phe Glu 1745 1750 1755 Ala Ser Ser Gly Arg Val Val Gly Arg Val Lys Val Gly Lys Asn 1760 1765 1770 Glu Asp Ser Lys Pro Thr Lys Leu Met Ser Gly Ile Gln Thr Val 1775 1780 1785 Ser Lys Ser Ala Thr Asp Leu Thr Glu Met Val Lys Lys Ile Thr 1790 1795 1800 Thr Met Asn Arg Gly Glu Phe Arg Gln Ile Thr Leu Ala Thr Gly 1805 1810 1815 Ala Gly Lys Thr Thr Glu Leu Pro Arg Ser Val Ile Glu Glu Ile 1820 1825 1830 Gly Arg His Lys Arg Val Leu Val Leu Ile Pro Leu Arg Ala Ala 1835 1840 1845 Ala Glu Ser Val Tyr Gln Tyr Met Arg Gln Lys His Pro Ser Ile 1850 1855 1860 Ala Phe Asn Leu Arg Ile Gly Glu Met Glu Glu Gly Tyr Met Ala 1865 1870 1875 Thr Gly Ile Thr Tyr Ala Ser Tyr Gly Tyr Phe Cys Gln Met Pro 1880 1885 1890 Gln Pro Lys Leu Arg Ala Ala Met Val Glu Tyr Ser Tyr Ile Phe 1895 1900 1905 Leu Asp Glu Tyr His Cys Ala Thr Pro Glu Gln Leu Ala Ile Met 1910 1915 1920 Gly Lys Ile His Arg Phe Ser Glu Asn Leu Arg Val Val Ala Met 1925 1930 1935 Thr Ala Thr Pro Ala Gly Thr Val Thr Thr Thr Gly Gln Lys His 1940 1945 1950 Pro Ile Glu Glu Phe Ile Ala Pro Glu Val Met Lys Gly Glu Asp 1955 1960 1965 Leu Gly Ser Glu Tyr Leu Asp Ile Ala Gly Leu Lys Ile Pro Val 1970 1975 1980 Glu Glu Met Lys Asn Asn Met Leu Val Phe Val Pro Thr Arg Asn 1985 1990 1995 Met Ala Val Glu Ala Ala Lys Lys Leu Lys Ala Lys Gly Tyr Asn 2000 2005 2010 Ser Gly Tyr Tyr Tyr Ser Gly Glu Asp Pro Ser Asn Leu Arg Val 2015 2020 2025 Val Thr Ser Gln Ser Pro Tyr Val Val Val Ala Thr Asn Ala Ile 2030 2035 2040 Glu Ser Gly Val Thr Leu Pro Asp Leu Asp Val Val Val Asp Thr 2045 2050 2055 Gly Leu Lys Cys Glu Lys Arg Ile Arg Leu Ser Pro Lys Met Pro 2060 2065 2070 Phe Ile Val Thr Gly Leu Lys Arg Met Ala Val Thr Ile Gly Glu 2075 2080 2085 Gln Ala Gln Arg Arg Gly Arg Val Gly Arg Val Lys Pro Gly Arg 2090 2095 2100 Tyr Tyr Arg Ser Gln Glu Thr Pro Val Gly Ser Lys Asp Tyr His 2105 2110 2115 Tyr Asp Leu Leu Gln Ala Gln Arg Tyr Gly Ile Glu Asp Gly Ile 2120 2125 2130 Asn Ile Thr Lys Ser Phe Arg Glu Met Asn Tyr Asp Trp Ser Leu 2135 2140 2145 Tyr Glu Glu Asp Ser Leu Met Ile Thr Gln Leu Glu Ile Leu Asn 2150 2155 2160 Asn Leu Leu Ile Ser Glu Glu Leu Pro Val Ala Val Lys Asn Ile 2165 2170 2175 Met Ala Arg Thr Asp His Pro Glu Pro Ile Gln Leu Ala Tyr Asn 2180 2185 2190 Ser Tyr Glu Thr Gln Val Pro Val Leu Phe Pro Lys Ile Arg Asn 2195 2200 2205 Gly Glu Val Thr Asp Thr Tyr Asp Asn Tyr Thr Phe Leu Asn Ala 2210 2215 2220 Arg Lys Leu Gly Asp Asp Val Pro Pro Tyr Val Tyr Ala Thr Glu 2225 2230 2235 Asp Glu Asp Leu Ala Val Glu Leu Leu Gly Leu Asp Trp Pro Asp 2240 2245 2250 Pro Gly Asn Gln Gly Thr Val Glu Ala Gly Arg Ala Leu Lys Gln 2255 2260 2265 Val Val Gly Leu Ser Thr Ala Glu Asn Ala Leu Leu Val Ala Leu 2270 2275 2280 Phe Gly Tyr Val Gly Tyr Gln Ala Leu Ser Lys Arg His Ile Pro 2285 2290 2295 Val Val Thr Asp Ile Tyr Ser Val Glu Asp His Arg Leu Glu Asp 2300 2305 2310 Thr Thr His Leu Gln Tyr Ala Pro Asn Ala Ile Lys Thr Glu Gly 2315 2320 2325 Lys Glu Thr Glu Leu Lys Glu Leu Ala Gln Gly Asp Val Gln Arg 2330 2335 2340 Cys Val Glu Ala Val Ala Asn Tyr Ala Ser Glu Gly Ile Gln Phe 2345 2350 2355 Ile Lys Ser Gln Ala Leu Lys Val Arg Glu Thr Pro Thr Tyr Lys 2360 2365 2370 Glu Thr Met Asn Thr Val Ala Asp Tyr Val Lys Lys Phe Ile Glu 2375 2380 2385 Ala Leu Ser Asp Ser Lys Glu Asp Ile Leu Lys Tyr Gly Leu Trp 2390 2395 2400 Gly Val His Thr Ala Leu Tyr Lys Ser Ile Gly Ala Arg Leu Gly 2405 2410 2415 His Glu Thr Ala Phe Ala Thr Leu Val Val Lys Trp Leu Ala Phe 2420 2425 2430 Gly Gly Glu Ser Val Thr Asp His Ile Lys Gln Ala Ala Thr Asp 2435 2440 2445 Leu Val Val Tyr Tyr Ile Ile Asn Arg Pro Gln Phe Pro Gly Asp 2450 2455 2460 Thr Glu Thr Gln Gln Glu Gly Arg Lys Phe Val Ala Ser Leu Leu 2465 2470 2475 Val Ser Ala Leu Ala Thr Tyr Thr Tyr Lys Ser Trp Asn Tyr Asn 2480 2485 2490 Asn Leu Ser Lys Ile Val Glu Pro Ala Leu Ala Thr Leu Pro Tyr 2495 2500 2505 Ala Ala Lys Ala Leu Lys Leu Phe Ala Pro Thr Arg Leu Glu Ser 2510 2515 2520 Val Val Ile Leu Ser Thr Ala Ile Tyr Lys Thr Tyr Leu Ser Ile 2525 2530 2535 Arg Arg Gly Lys Ser Asp Gly Leu Leu Gly Thr Gly Val Ser Ala 2540 2545 2550 Ala Met Glu Ile Met Ser Gln Asn Pro Val Ser Val Gly Ile Ala 2555 2560 2565 Val Met Leu Gly Val Gly Ala Val Ala Ala His Asn Ala Ile Glu 2570 2575 2580 Ala Ser Glu Gln Lys Arg Thr Leu Leu Met Lys Val Phe Val Lys 2585 ​​2590 2595 Asn Phe Leu Asp Gln Ala Ala Thr Asp Glu Leu Val Lys Glu Ser 2600 2605 2610 Pro Glu Lys Ile Ile Met Ala Leu Phe Glu Ala Val Gln Thr Val 2615 2620 2625 Gly Asn Pro Leu Arg Leu Val Tyr His Leu Tyr Gly Val Phe Tyr 2630 2635 2640 Lys Gly Trp Glu Ala Lys Glu Leu Ala Gln Arg Thr Ala Gly Arg 2645 2650 2655 Asn Leu Phe Thr Leu Ile Met Phe Glu Ala Val Glu Leu Leu Gly 2660 2665 2670 Val Asp Ser Glu Gly Lys Ile Arg Gln Leu Ser Ser Asn Tyr Ile 2675 2680 2685 Leu Glu Leu Leu Tyr Lys Phe Arg Asp Asp Ile Lys Ser Ser Val 2690 2695 2700 Arg Glu Ile Ala Ile Ser Trp Ala Pro Ala Pro Phe Ser Cys Asp 2705 ​​2710 2715 Trp Thr Pro Thr Asp Asp Arg Ile Gly Leu Pro His Asp Asn Tyr 2720 ​​2725 2730 Leu Gln Met Glu Thr Arg Cys Pro Cys Gly Tyr Arg Met Lys Ala 2735 2740 2745 Val Lys Thr Cys Ala Gly Glu Leu Arg Leu Leu Glu Glu Gly Gly 2750 2755 2760 Ser Phe Leu Cys Arg Asn Lys Phe Gly Arg Gly Ser Arg Asn Tyr 2765 2770 2775 Arg Val Thr Lys Tyr Tyr Asp Asp Asn Leu Ser Glu Ile Lys Pro 2780 2785 2790 Val Ile Arg Met Glu Gly His Val Glu Leu Tyr His Lys Gly Ala 2795 2800 2805 Thr Phe Lys Leu Asp Phe Asp Asn Ser Lys Thr Val Leu Ala Thr 2810 2815 2820 Asp Arg Trp Glu Val Asp His Ser Thr Leu Ile Arg Val Leu Lys 2825 2830 2835 Arg His Thr Gly Ala Gly Phe Gln Gly Ala Tyr Leu Gly Glu Lys 2840 2845 2850 Pro Asn His Lys His Leu Ile Glu Arg Asp Cys Ala Thr Ile Thr 2855 2860 2865 Lys Asp Lys Val Cys Phe Ile Lys Met Lys Arg Gly Cys Ala Phe 2870 2875 2880 Thr Tyr Asp Leu Ser Leu His Asn Leu Thr Arg Leu Ile Glu Leu 2885 2890 2895 Val His Lys Asn Asn Leu Asp Asp Arg Glu Ile Pro Ala Val Thr 2900 2905 2910 Val Thr Thr Trp Leu Ala Tyr Thr Phe Val Asn Glu Asp Ile Gly 2915 2920 2925 Thr Ile Lys Pro Val Phe Gly Glu Lys Val Thr Pro Glu Lys Gln 2930 2935 2940 Glu Glu Val Ala Leu Gln Pro Ala Val Val Val Asp Thr Thr Asp 2945 2950 2955 Val Ala Val Thr Val Val Gly Glu Thr Ser Thr Met Thr Thr Gly 2960 2965 2970 Glu Thr Pro Thr Ile Phe Thr Ser Leu Gly Ser Asp Ser Lys Phe 2975 2980 2985 Gln Gln Val Leu Lys Leu Gly Val Asp Glu Gly Gln Tyr Pro Gly 2990 2995 3000 Pro Arg Gln Gln Arg Ala Ser Leu Leu Glu Ala Val Gln Gly Val 3005 3010 3015 Asp Glu Arg Pro Ser Val Leu Ile Leu Gly Ser Asp Lys Ala Thr 3020 3025 3030 Ser Asn Arg Val Lys Thr Ala Lys Asn Val Lys Ile Phe Arg Ser 3035 3040 3045 Arg Asp Pro Leu Glu Leu Arg Glu Met Met Arg Arg Gly Lys Ile 3050 3055 3060 Leu Ile Ile Ala Leu Cys Lys Val Asp Thr Ala Leu Leu Lys Phe 3065 3070 3075 Val Asp Tyr Lys Gly Thr Phe Leu Thr Arg Glu Thr Leu Glu Ala 3080 3085 3090 Leu Ser Leu Gly Lys Pro Lys Lys Arg Asp Ile Thr Lys Thr Glu 3095 3100 3105 Ala Arg Trp Leu Leu Cys Leu Glu Gly Gln Leu Glu Glu Leu Pro 3110 3115 3120 Asp Trp Phe Ala Ala Lys Glu Pro Ile Phe Leu Glu Ala Asn Ile 3125 3130 3135 Lys Arg Asp Lys Tyr His Leu Val Gly Asp Ile Ala Thr Ile Lys 3140 3145 3150 Glu Lys Ala Lys Gln Leu Gly Ala Thr Asp Ser Thr Lys Ile Ser 3155 3160 3165 Lys Glu Val Gly Ala Lys Val Tyr Ser Met Lys Leu Ser Asn Trp 3170 3175 3180 Val Ile Gln Glu Glu Asn Lys Gln Gly Ser Leu Thr Pro Leu Phe 3185 3190 3195 Glu Glu Leu Leu Gln Gln Cys Pro Pro Gly Gly Gln Asn Lys Thr 3200 3205 3210 Thr His Met Ala Ser Ala Tyr Gln Leu Ala Gln Gly Asn Trp Met 3215 3220 3225 Pro Val Gly Cys His Val Phe Met Gly Thr Ile Pro Ala Arg Arg 3230 3235 3240 Thr Lys Thr His Pro Tyr Glu Ala Tyr Val Lys Leu Arg Glu Leu 3245 3250 3255 Val Glu Glu His Lys Met Lys Thr Ser Cys Gly Gly Ser Gly Leu 3260 3265 3270 Cys Lys His Asn Glu Trp Val Ile Arg Lys Ile Lys His Gln Gly 3275 3280 3285 Asn Leu Arg Thr Arg His Met Leu Asn Pro Gly Lys Ile Ala Glu 3290 3295 3300 Gln Leu Asp Arg Glu Gly His Arg His Asn Val Tyr Asn Lys Thr 3305 3310 3315 Ile Gly Ser Val Met Thr Ala Thr Gly Ile Arg Leu Glu Lys Leu 3320 3325 3330 Pro Val Val Arg Ala Gln Thr Asp Thr Thr Asn Phe His Gln Ala 3335 3340 3345 Ile Arg Asp Lys Ile Asp Lys Glu Glu Asn Leu Gln Thr Pro Gly 3350 3355 3360 Leu His Lys Lys Leu Met Glu Val Phe Asn Ala Leu Lys Arg Pro 3365 3370 3375 Glu Leu Glu Ala Ser Tyr Asp Ala Val Glu Trp Glu Glu Leu Glu 3380 3385 3390 Arg Gly Ile Asn Arg Lys Gly Ala Ala Gly Phe Phe Glu Arg Lys 3395 3400 3405 Asn Ile Gly Glu Val Leu Asp Ser Glu Lys Tyr Lys Val Glu Glu 3410 3415 3420 Ile Ile Asp Ser Leu Lys Lys Gly Arg Ser Ile Lys Tyr Tyr Glu 3425 3430 3435 Thr Ala Ile Pro Lys Asn Glu Lys Arg Asp Val Asn Asp Asp Trp 3440 3445 3450 Thr Ala Gly Asp Phe Val Asp Glu Lys Lys Pro Arg Val Ile Gln 3455 3460 3465 Tyr Pro Glu Ala Lys Thr Arg Leu Ala Ile Thr Lys Val Met Tyr 3470 3475 3480 Lys Trp Val Lys Gln Lys Pro Val Val Ile Pro Gly Tyr Glu Gly 3485 3490 3495 Lys Thr Pro Leu Phe Gln Ile Phe Asp Lys Val Lys Lys Glu Trp 3500 3505 3510 Asn Gln Phe Gln Asn Pro Val Ala Val Ser Phe Asp Thr Lys Ala 3515 3520 3525 Trp Asp Thr Gln Val Thr Thr Arg Asp Leu Glu Leu Ile Arg Asp 3530 3535 3540 Ile Gln Lys Phe Tyr Phe Lys Lys Lys Trp His Lys Phe Ile Asp 3545 3550 3555 Thr Leu Thr Met His Met Ser Glu Val Pro Val Ile Ser Ala Asp 3560 3565 3570 Gly Glu Val Tyr Ile Arg Lys Gly Gln Arg Gly Ser Gly Gln Pro 3575 3580 3585 Asp Thr Ser Ala Gly Asn Ser Met Leu Asn Val Leu Thr Met Val 3590 3595 3600 Tyr Ala Phe Cys Glu Ala Thr Gly Val Pro Tyr Lys Ser Phe Asp 3605 3610 3615 Arg Val Ala Lys Ile His Val Cys Gly Asp Asp Gly Phe Leu Ile 3620 3625 3630 Thr Glu Arg Ala Leu Gly Glu Lys Phe Ala Ser Arg Gly Val Gln 3635 3640 3645 Ile Leu Tyr Glu Ala Gly Lys Pro Gln Lys Ile Thr Glu Gly Asp 3650 3655 3660 Asn Met Lys Val Ala Tyr Gln Phe Asp Asp Ile Glu Phe Cys Ser 3665 3670 3675 His Thr Pro Val Gln Val Arg Trp Ser Asp Asn Thr Ser Ser Tyr 3680 3685 3690 Met Pro Gly Arg Asn Thr Thr Thr Ile Leu Ala Lys Met Ala Thr 3695 3700 3705 Arg Leu Asp Ser Ser Gly Glu Arg Gly Thr Ile Ala Tyr Glu Lys 3710 3715 3720 Ala Val Ala Phe Ser Phe Leu Leu Met Tyr Ser Trp Asn Pro Leu 3725 3730 3735 Ile Arg Arg Ile Cys Leu Leu Val Leu Ser Thr Glu Met Gln Val 3740 3745 3750 Arg Pro Gly Lys Ser Thr Thr Tyr Tyr Tyr Glu Gly Asp Pro Ile 3755 3760 3765 Ser Ala Tyr Lys Glu Val Ile Gly His Asn Leu Phe Asp Leu Lys 3770 3775 3780 Arg Thr Ser Phe Glu Lys Leu Ala Lys Leu Asn Leu Ser Met Ser 3785 3790 3795 Thr Leu Gly Val Trp Thr Arg His Thr Ser Lys Arg Leu Leu Gln 3800 3805 3810 Asp Cys Val Asn Val Gly Thr Lys Glu Gly Asn Trp Leu Val Asn 3815 3820 3825 Ala Asp Arg Leu Val Ser Ser Lys Thr Gly Asn Arg Tyr Ile Pro 3830 3835 3840 Gly Glu Gly His Thr Gln Gln Gly Lys His Tyr Glu Glu Leu Val 3845 3850 3855 Leu Ala Arg Lys Pro Thr Ser Asn Phe Glu Gly Thr Asp Arg Tyr 3860 3865 3870 Asn Leu Gly Pro Ile Val Asn Val Val Leu Arg Arg Leu Arg Val 3875 3880 3885 Met Met Met Ala Leu Ile Gly Arg Gly Val 3890 3895 <210> 18 <211> 168 <212> PRT <213> Artificial Sequence <220> <223> Npro of QZ07 <400> 18 Met Glu Leu Asn His Phe Glu Leu Leu Tyr Lys Thr Asn Lys Gln Lys 1 5 10 15 Pro Met Gly Val Glu Glu Pro Val Tyr Asp Ile Ala Gly Arg Pro Leu 20 25 30 Phe Gly Asp Pro Ser Glu Val His Pro Gln Ser Thr Leu Lys Leu Pro 35 40 45 His Asp Arg Gly Arg Gly Asn Ile Arg Thr Thr Leu Lys Asp Leu Pro 50 55 60 Arg Lys Gly Asp Cys Arg Ser Gly Asn His Leu Gly Pro Val Ser Gly 65 70 75 80 Ile Tyr Val Lys Pro Gly Pro Val Phe Tyr Gln Asp Tyr Met Gly Pro 85 90 95 Val Tyr His Arg Ala Pro Leu Glu Phe Phe Gly Glu Ala Gln Phe Cys 100 105 110 Glu Val Thr Lys Arg Ile Gly Arg Val Thr Gly Ser Asp Gly Lys Leu 115 120 125 Tyr His Ile Tyr Val Cys Ile Asp Gly Cys Ile Leu Leu Lys Leu Ala 130 135 140 Lys Arg Gly Ala Pro Arg Ser Leu Lys Trp Thr Arg Asn Phe Thr Asp 145 150 155 160 Cys Pro Leu Trp Val Thr Ser Cys 165 <210> 19 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Erns of QZ07 <400> 19 Glu Asn Ile Thr Gln Trp Asn Leu Ser Asp Asn Gly Thr Ser Gly Ile 1 5 10 15 Gln Gln Ala Met Tyr Leu Arg Gly Val Asn Arg Ser Leu His Gly Ile 20 25 30 Trp Pro Glu Lys Ile Cys Lys Gly Val Pro Thr His Leu Ala Thr Asp 35 40 45 Thr Glu Leu Thr Glu Ile Arg Gly Met Met Asp Ala Ser Glu Arg Thr 50 55 60 Asn Tyr Thr Cys Cys Arg Leu Gln Arg His Glu Trp Asn Lys His Gly 65 70 75 80 Trp Cys Asn Trp Tyr Asn Ile Asp Pro Trp Ile Gln Leu Met Asn Arg 85 90 95 Thr Gln Ala Asn Leu Thr Glu Gly Pro Pro Asp Lys Glu Cys Ala Val 100 105 110 Thr Cys Arg Tyr Asp Lys Asn Thr Asp Val Asn Val Val Thr Gln Ala 115 120 125 Arg Asn Arg Pro Thr Thr Leu Thr Gly Cys Lys Lys Gly Lys Asn Phe 130 135 140 Ser Phe Ala Gly Thr Val Ile Glu Gly Pro Cys Asn Phe Asn Val Ser 145 150 155 160 Val Glu Asp Ile Leu Tyr Gly Asp His Glu Cys Gly Ser Leu Phe Gln 165 170 175 Asp Thr Ala Leu Tyr Leu Leu Asp Gly Met Thr Asn Thr Ile Glu Lys 180 185 190 Ala Arg Gln Gly Ala Ala Arg Val Thr Ser Trp Leu Gly Arg Gln Leu 195 200 205 Arg Thr Thr Gly Lys Lys Leu Glu Arg Gly Ser Lys Thr Trp Phe Gly 210 215 220 Ala Tyr Ala 225 <210> 20 <211> 3898 <212> PRT <213> Artificial sequence <220> <223> polyprotein of QZ07 <400> 20 Met Glu Leu Asn His Phe Glu Leu Leu Tyr Lys Thr Asn Lys Gln Lys 1 5 10 15 Pro Met Gly Val Glu Glu Pro Val Tyr Asp Ile Ala Gly Arg Pro Leu 20 25 30 Phe Gly Asp Pro Ser Glu Val His Pro Gln Ser Thr Leu Lys Leu Pro 35 40 45 His Asp Arg Gly Arg Gly Asn Ile Arg Thr Thr Leu Lys Asp Leu Pro 50 55 60 Arg Lys Gly Asp Cys Arg Ser Gly Asn His Leu Gly Pro Val Ser Gly 65 70 75 80 Ile Tyr Val Lys Pro Gly Pro Val Phe Tyr Gln Asp Tyr Met Gly Pro 85 90 95 Val Tyr His Arg Ala Pro Leu Glu Phe Phe Gly Glu Ala Gln Phe Cys 100 105 110 Glu Val Thr Lys Arg Ile Gly Arg Val Thr Gly Ser Asp Gly Lys Leu 115 120 125 Tyr His Ile Tyr Val Cys Ile Asp Gly Cys Ile Leu Leu Lys Leu Ala 130 135 140 Lys Arg Gly Ala Pro Arg Ser Leu Lys Trp Thr Arg Asn Phe Thr Asp 145 150 155 160 Cys Pro Leu Trp Val Thr Ser Cys Ser Asp Asp Gly Thr Gly Asp Ser 165 170 175 Lys Asp Lys Lys Pro Asp Arg Met Asn Lys Gly Lys Leu Lys Ile Ala 180 185 190 Pro Lys Glu His Glu Lys Asp Ser Lys Thr Lys Pro Pro Asp Ala Thr 195 200 205 Ile Val Val Glu Gly Val Lys Tyr Gln Val Lys Lys Lys Gly Lys Val 210 215 220 Lys Gly Lys Asn Thr Gln Asp Gly Leu Tyr His Asn Lys Asn Lys Pro 225 230 235 240 Pro Glu Ser Arg Lys Lys Leu Glu Lys Ala Leu Leu Ala Trp Ala Val 245 250 255 Ile Ala Ile Val Leu Tyr Gln Pro Val Ala Ala Glu Asn Ile Thr Gln 260 265 270 Trp Asn Leu Ser Asp Asn Gly Thr Ser Gly Ile Gln Gln Ala Met Tyr 275 280 285 Leu Arg Gly Val Asn Arg Ser Leu His Gly Ile Trp Pro Glu Lys Ile 290 295 300 Cys Lys Gly Val Pro Thr His Leu Ala Thr Asp Thr Glu Leu Thr Glu 305 310 315 320 Ile Arg Gly Met Met Asp Ala Ser Glu Arg Thr Asn Tyr Thr Cys Cys 325 330 335 Arg Leu Gln Arg His Glu Trp Asn Lys His Gly Trp Cys Asn Trp Tyr 340 345 350 Asn Ile Asp Pro Trp Ile Gln Leu Met Asn Arg Thr Gln Ala Asn Leu 355 360 365 Thr Glu Gly Pro Pro Asp Lys Glu Cys Ala Val Thr Cys Arg Tyr Asp 370 375 380 Lys Asn Thr Asp Val Asn Val Val Thr Gln Ala Arg Asn Arg Pro Thr 385 390 395 400 Thr Leu Thr Gly Cys Lys Lys Gly Lys Asn Phe Ser Phe Ala Gly Thr 405 410 415 Val Ile Glu Gly Pro Cys Asn Phe Asn Val Ser Val Glu Asp Ile Leu 420 425 430 Tyr Gly Asp His Glu Cys Gly Ser Leu Phe Gln Asp Thr Ala Leu Tyr 435 440 445 Leu Leu Asp Gly Met Thr Asn Thr Ile Glu Lys Ala Arg Gln Gly Ala 450 455 460 Ala Arg Val Thr Ser Trp Leu Gly Arg Gln Leu Arg Thr Thr Gly Lys 465 470 475 480 Lys Leu Glu Arg Gly Ser Lys Thr Trp Phe Gly Ala Tyr Ala Leu Ser 485 490 495 Pro Tyr Cys Asn Val Thr Arg Lys Ile Gly Tyr Ile Trp Tyr Thr Asn 500 505 510 Asn Cys Thr Pro Ala Cys Leu Pro Lys Asn Thr Lys Ile Ile Gly Pro 515 520 525 Gly Lys Phe Asp Thr Asn Ala Glu Asp Gly Lys Ile Leu His Glu Met 530 535 540 Gly Gly His Leu Ser Glu Phe Leu Leu Leu Ser Leu Val Val Leu Ser 545 550 555 560 Asp Phe Ala Pro Glu Thr Ala Ser Thr Leu Tyr Leu Ile Leu His Tyr 565 570 575 Ala Ile Pro Gln Ser Arg Asp Glu Pro Glu Val Cys Asp Thr Asn Gln 580 585 590 Leu Asn Leu Thr Val Gly Leu Arg Thr Glu Asp Val Val Pro Ser Ser 595 600 605 Val Trp Asn Ile Gly Lys Tyr Val Cys Val Arg Pro Asp Trp Trp Pro 610 615 620 Tyr Glu Thr Lys Val Ala Leu Leu Phe Glu Glu Ala Gly Gln Val Ile 625 630 635 640 Lys Leu Ala Leu Arg Ala Leu Arg Asp Leu Thr Arg Val Trp Asn Ser 645 650 655 Ala Ser Thr Thr Ala Phe Leu Ile Cys Leu Ile Lys Ile Leu Arg Gly 660 665 670 Gln Val Val Gln Gly Ile Ile Trp Leu Leu Leu Val Thr Gly Ala Gln 675 680 685 Gly Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr 690 695 700 Asn Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Lys 705 710 715 720 Glu Tyr Asn His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile 725 730 735 Cys Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg 740 745 750 Arg Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr 755 760 765 Phe Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly 770 775 780 Asp Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val 785 790 795 800 Lys Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu 805 810 815 Val Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser 820 825 830 Pro Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys 835 840 845 Pro Phe Pro His Arg Val Gly Cys Val Thr Thr Val Val Glu Lys Glu 850 855 860 Asp Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly 865 870 875 880 Asn Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Arg Trp Cys 885 890 895 Gly Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly 900 905 910 Lys Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr 915 920 925 Asp Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu 930 935 940 Cys Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg 945 950 955 960 Leu Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly 965 970 975 Pro Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Arg 980 985 990 Asn Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu 995 1000 1005 Lys Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp His 1010 1015 1020 His Thr Asp Tyr Phe Ala Glu Phe Val Val Leu Val Val Val Ala 1025 1030 1035 Leu Leu Gly Gly Arg Tyr Val Leu Trp Leu Ile Val Thr Tyr Val 1040 1045 1050 Ile Leu Thr Glu Gln Leu Ala Ala Gly Leu Gln Leu Gly Gln Gly 1055 1060 1065 Glu Val Val Leu Ile Gly Asn Leu Ile Thr His Thr Asp Asn Glu 1070 1075 1080 Val Val Val Tyr Phe Leu Leu Leu Tyr Leu Ile Ile Arg Asp Glu 1085 1090 1095 Pro Ile Lys Lys Trp Ile Leu Leu Leu Phe His Ala Met Thr Asn 1100 1105 1110 Asn Pro Val Lys Thr Met Thr Val Ala Leu Leu Met Ile Ser Gly 1115 1120 1125 Val Ala Lys Gly Gly Lys Thr Asp Gly Gly Trp Gln Arg Gln Pro 1130 1135 1140 Glu Thr Asn Phe Asp Ile Gln Leu Ala Leu Ala Val Ile Val Val 1145 1150 1155 Val Val Met Leu Leu Ala Lys Arg Asp Pro Thr Thr Phe P...

Claims

1. A recombinant classical swine fever virus, comprising at least one mutation in the 6B8 epitope of the E2 protein, wherein the unmodified 6B8 epitope is specifically recognized by the 6B8 monoclonal antibody, wherein the at least one mutation in the 6B8 epitope of the E2 protein causes the binding of the 6B8 monoclonal antibody to the mutated 6B8 epitope to be specifically inhibited; and wherein the unmodified 6B8 epitope is defined by the amino acid sequence STNEIGPLGAEG; and wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues S14, G22, E24 and / or E24 / G25 of the E2 protein, and the numbering of the amino acid residues refers to SEQ ID NO:7; or wherein the unmodified 6B8 epitope is defined by the amino acid sequence STDEIGLLGAGG, and the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues S14, G22, G24 and / or G24 / G25 of the E2 protein, and the numbering of the amino acid residues refers to the amino acid positions of SEQ ID NO:35; and it comprises a substitution at amino acid position 24 of the E2 protein and the amino acid at position 24 of the E2 protein is substituted with K, a substitution at amino acid positions 24 / 25 of the E2 protein and the amino acids at positions 24 and 25 of the E2 protein are substituted with R and D or K and D, respectively, a substitution at amino acid position 14 of the E2 protein and the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and / or a substitution at amino acid position 22 of the E2 protein and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E.

2. The recombinant classical swine fever virus according to claim 1, wherein the 6B8 monoclonal antibody is produced by a hybridoma deposited in CCTCC with the deposit number CCTCC C2018120, or comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 9 and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 10, or comprises a heavy chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 25, a heavy chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 26, a heavy chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 27, a light chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 28, a light chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 29, and a light chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:

30.

3. The recombinant classical swine fever virus according to claim 1, comprising a) a substitution at amino acid position 24 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with K; b) a substitution at amino acid position 14 of the E2 protein, wherein the amino acid at position 14 of the E2 protein is substituted with K, Q or R; or c) a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E.

4. The recombinant classical swine fever virus according to claim 1, comprising a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 25 of the E2 protein, wherein the amino acids at positions 24 and 25 of the E2 protein are substituted with R and D or K and D, respectively; a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 14 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 14 of the E2 protein is substituted with K, Q or R; a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 25 of the E2 protein and a substitution at amino acid position 14 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 14 of the E2 protein is substituted with K, Q or R. 4, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, and the amino acid at position 14 of the E2 protein is substituted with K, Q or R; a substitution at amino acid position 24 of the E2 protein and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E; a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 25 of the E2 protein and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E. The amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E; a substitution at amino acid position 14 of the E2 protein and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E; a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 14 of the E2 protein and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with The amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E; or a substitution at amino acid position 24 of the E2 protein, a substitution at amino acid position 25 of the E2 protein, a substitution at amino acid position 14 of the E2 protein, and a substitution at amino acid position 22 of the E2 protein, wherein the amino acid at position 24 of the E2 protein is substituted with R or K, the amino acid at position 25 of the E2 protein is substituted with D, the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E.

5. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the amino acid substitution within the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence as shown in any one of SEQ ID Nos: 13-14 and 31-34.

6. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus is attenuated.

7. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus has at least one mutation in the Erns protein and / or at least one mutation in the Npro protein.

8. The recombinant classical swine fever virus according to claim 7, wherein such mutation in the Erns protein is an amino acid deletion at amino acid position 79 of the Erns protein and / or an amino acid deletion at amino acid position 171 of the Erns protein, and the mutation in the Npro protein is a deletion of the Npro protein except the first four amino-terminal amino acids.

9. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus is from strain C.

10. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus is from the wild strain QZ07.

11. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus is from the wild strain GD18.

12. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus is from the wild strain QZ07 and (i) comprises an amino acid deletion at amino acid position 79 of the Erns protein; and (ii) comprises a substitution from E to K at amino acid position 24 of the E2 protein; or a substitution from E to R or K at amino acid position 24 and a substitution from G to D at amino acid position 25 of the E2 protein.

13. The recombinant classical swine fever virus according to claim 12, wherein the recombinant classical swine fever virus further comprises a substitution of S to K, Q or R at amino acid position 14 of the E2 protein, and / or a substitution of G to A, R, Q or E at amino acid position 22 of the E2 protein.

14. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus is from the wild strain QZ07 and (i) comprises an amino acid deletion at amino acid position 79 of the Erns protein, and an amino acid deletion at amino acid position 171 of the Erns protein; and (ii) comprises a substitution from E to K at amino acid position 24 of the E2 protein; or a substitution from E to R or K at amino acid position 24 and a substitution from G to D at amino acid position 25 of the E2 protein.

15. The recombinant classical swine fever virus according to claim 14, wherein the recombinant classical swine fever virus further comprises a substitution of S to K, Q or R at amino acid position 14 of the E2 protein, and / or a substitution of G to A, R, Q or E at amino acid position 22 of the E2 protein.

16. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus is from the wild strain GD18 and (i) comprises an amino acid deletion at amino acid position 79 of the Erns protein and a deletion of the Npro protein except the first four amino-terminal amino acids; and (ii) comprises a substitution of E to K at amino acid position 24 of the E2 protein; or a substitution of E to R or K at amino acid position 24 and a substitution of G to D at amino acid position 25 of the E2 protein.

17. The recombinant classical swine fever virus according to claim 16, wherein the recombinant classical swine fever virus further comprises a substitution of S to K, Q or R at amino acid position 14 of the E2 protein, and / or a substitution of G to A, R, Q or E at amino acid position 22 of the E2 protein.

18. The recombinant classical swine fever virus according to any one of claims 1 to 4, wherein the recombinant classical swine fever virus is from the wild strain GD18; and (i) comprises an amino acid deletion at amino acid position 79 of the Erns protein, and an amino acid deletion at amino acid position 171 of the Erns protein, and (ii) comprises a substitution of E to R or K at amino acid position 24 of the E2 protein; or a substitution of E to R or K at amino acid position 24 and a substitution of G to D at amino acid position 25 of the E2 protein.

19. The recombinant classical swine fever virus according to claim 18, wherein the recombinant classical swine fever virus further comprises a substitution of S to K, Q or R at amino acid position 14 of the E2 protein, and / or a substitution of G to A, R, Q or E at amino acid position 22 of the E2 protein.

20. An isolated nucleic acid encoding the recombinant classical swine fever virus according to any one of claims 1 to 19.

21. A vector comprising the isolated nucleic acid according to claim 20.

22. An immunogenic composition comprising the recombinant classical swine fever virus according to any one of claims 1 to 19, encoding the isolated nucleic acid according to claim 20, or the vector according to claim 21.

23. The immunogenic composition of claim 22, wherein the immunogenic composition is a marker vaccine or a vaccine that differentiates infected and vaccinated pigs.

24. Use of a recombinant classical swine fever virus according to any one of claims 1 to 19 or an immunogenic composition according to claim 22 or 23 in the manufacture of a medicament for preventing classical swine fever virus infection in pigs.

25. A method for preparing a classical swine fever virus vaccine, comprising introducing into a classical swine fever virus at least one mutation in the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody, wherein the at least one mutation in the 6B8 epitope of the E2 protein results in specific inhibition of the binding of the 6B8 monoclonal antibody to the mutated 6B8 epitope; wherein the unmodified 6B8 epitope is defined by the amino acid sequence STNEIGPLGAEG; and wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues S14, G22, E24 and / or E24 / G25 of the E2 protein, and the numbering of the amino acid residues is based on SEQ ID NO: NO:7; or wherein the unmodified 6B8 epitope is defined by the amino acid sequence STDEIGLLGAGG, and wherein the 6B8 epitope of the E2 protein specifically recognized by the 6B8 monoclonal antibody is defined by amino acid residues S14, G22, G24 and / or G24 / G25 of the E2 protein, and the numbering of the amino acid residues refers to the amino acid positions of SEQ ID NO:35; and it comprises a substitution at amino acid position 24 of the E2 protein and the amino acid at position 24 of the E2 protein is substituted with K, a substitution at amino acid positions 24 / 25 of the E2 protein and the amino acids at positions 24 and 25 of the E2 protein are substituted with R and D or K and D, respectively, a substitution at amino acid position 14 of the E2 protein and the amino acid at position 14 of the E2 protein is substituted with K, Q or R, and / or a substitution at amino acid position 22 of the E2 protein and the amino acid at position 22 of the E2 protein is substituted with A, R, Q or E.

26. The method according to claim 25, wherein the 6B8 monoclonal antibody is produced by a hybridoma deposited in CCTCC with the deposit number CCTCCC2018120, or comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 9 and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 10, or comprises a heavy chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 25, a heavy chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 26, a heavy chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 27, a light chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 28, a light chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 29, and a light chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:

30.

27. The method of claim 25, wherein the mutation within the 6B8 epitope of the E2 protein results in a mutated 6B8 epitope sequence as shown in any one of SEQ ID Nos: 13-14 and 31-34.

28. The method according to any one of claims 25 to 27, wherein the classical swine fever virus vaccine is an attenuated vaccine.

29. The method according to any one of claims 25 to 27, wherein the classical swine fever virus is from strain C or field strains QZ07 or GD18.

30. Use of a monoclonal antibody that specifically recognizes the 6B8 epitope of the E2 protein of classical swine fever virus, the recombinant classical swine fever virus according to any one of claims 1 to 19, and the wild-type E2 protein of the classical swine fever virus comprising the 6B8 epitope in the manufacture of a kit for distinguishing pigs infected with classical swine fever virus from pigs vaccinated with the immunogenic composition according to any one of claims 22 to 23, the method comprising obtaining a sample and testing the sample in an immunoassay.

31. The use according to claim 30, wherein the monoclonal antibody that specifically recognizes the 6B8 epitope i) is produced by a hybridoma deposited in CCTCC with the deposit number CCTCC C2018120, or comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 9 and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 10, or comprises a heavy chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 25, a heavy chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 26, a heavy chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 27, a light chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 28, a light chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 29, and a light chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:

30.

32. A monoclonal antibody, wherein the monoclonal antibody is produced by a hybridoma deposited in CCTCC with the deposit number CCTCC C2018120; or wherein the monoclonal antibody comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 9 and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 10; or wherein the monoclonal antibody comprises a heavy chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 25, a heavy chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 26, a heavy chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 27, a light chain variable region CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 28, a light chain variable region CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 29, and a light chain variable region CDR3 consisting of the amino acid sequence shown in SEQ ID NO:

30.

33. A kit for distinguishing pigs infected with classical swine fever virus from pigs vaccinated with the immunogenic composition according to any one of claims 22 to 23, comprising the monoclonal antibody according to claim 32, the recombinant classical swine fever virus according to any one of claims 1 to 19, and the wild-type E2 protein of the classical swine fever virus comprising the 6B8 epitope.

Images