Novel cell lines comprising a selection marker and their use for protein production
By inactivating the DHODH gene in cell lines and using an exogenous DHODH expression vector, the toxicity problem of selectable marker inhibitors in existing technologies has been solved, improving the efficiency and safety of recombinant protein production.
Patent Information
- Application Number
- CN202080035132.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-03-19
- Filing Date
- 2020-03-19
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2040-03-20
AI Technical Summary
In existing recombinant protein production processes, the selection marker inhibitors used, such as teriflunomide and methotrexate, are toxic, difficult to handle, and affect cell viability and safety.
By partially or completely inactivating the endogenous DHODH gene in cell lines, using uridine-free culture medium, and introducing an expression vector encoding exogenous DHODH, cells that produce the target protein are selected without the use of inhibitors as selection pressure.
It improves the viability of producing cells, reduces the risk of toxicity, and enhances the production efficiency and safety of recombinant proteins.
Smart Images

Figure BDA0003347973060000081 
Figure BDA0003347973060000191 
Figure BDA0003347973060000201
Abstract
Description
Technical Field
[0001] This invention relates to cell lines and selection markers for protein production. Background Technology
[0002] Industrial-scale production of recombinant proteins requires the isolation of clones capable of producing large quantities of the recombinant protein. Introducing a xenogeneic gene into animal host cells and screening for expression of the added gene is a lengthy and complex process. This process includes transfection and selection of clones with long-term stable expression, as well as screening for clones with high expression rates of the corresponding recombinant protein.
[0003] When generating clones that express recombinant proteins from expression vectors, host cells are typically transfected using a DNA vector encoding both the target protein and a selection marker on the same vector. This expression vector therefore contains a selection marker that allows selection of clones in which the expression vector is present. This selection marker can also lead to co-amplification of the transfected DNA, thereby allowing for the isolation of high-yield clones.
[0004] Most selectable markers are proteins that confer resistance to antibiotics or other toxic substances or are essential for cell survival. Several such selectable markers are known in the art, including, for example, G418, hygromycin, puromycin, bleomycin, dihydrofolate reductase (DHFR), glutamine synthase (GS), and hypoxanthine-guanine phosphoribosyltransferase (HPRT). In particular, GS is widely used as a selectable marker in the industrial production of recombinant proteins in eukaryotic cells. The GS gene allows the synthesis of glutamine, which is essential for cell growth, and is inhibited by MSX (L-methionine sulfoxide imine). In the presence of MSX, only cells expressing higher levels of GS can survive. After appropriate selection, cells that produce exogenous proteins can be selected.
[0005] In a previous application, WO 2016 / 062837, the inventors developed an expression system based on the use of dihydroorotate dehydrogenase (DHODH) as a selectable marker. DHODH is an enzyme required for pyrimidine synthesis. Therefore, compounds that inhibit DHODH inhibit DNA synthesis, thereby inhibiting cell proliferation. This selectable marker thus constitutes an expression vector encoding DHODH, which is used in combination with DHODH inhibitors such as leflunomide and teriflunomide.
[0006] However, most inhibitors used with the aforementioned selectable markers are toxic. In the case of DHODH selectable markers, teriflunomide is, for example, a potent immunosuppressant, and its management, especially on a large scale, can be challenging for safety reasons. In the case of GS selectable markers, MSX is a convulsant at high doses and may therefore also cause management problems. In the case of DHFR selectable markers, methotrexate is known to exhibit hematopoietic and gastrointestinal toxicity, and therefore also causes management problems.
[0007] Therefore, there is a need for an expression system in which the selection of clones that produce the target protein can be made without the addition of difficult-to-process compounds.
[0008] This invention fulfills this need. Summary of the Invention
[0009] This invention arises from the inventors' design of cell lines in which the DHODH gene is partially or completely inactivated, allowing selection of cells producing the target protein in a uridine-free culture medium. Typically, such cell lines with the DHODH gene partially or completely inactivated are grown in a uridine-supplemented medium. However, when transfected with an expression vector containing a nucleotide sequence encoding mammalian DHODH, particularly a mutant mammalian DHODH, and an expression cassette for expressing the target protein, the culture medium is typically changed to a uridine-free medium to select the cells producing the target protein.
[0010] This expression system is particularly advantageous because it increases the viability of producing cells by avoiding the use of inhibitors as selective pressure. The inventors have also demonstrated that this reduction in toxicity is associated with high productivity.
[0011] Therefore, the present invention relates to a cell line containing a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene.
[0012] In a particular embodiment, the cell line is the Chinese hamster ovary (CHO) cell line.
[0013] In a more specific implementation, the cell line is generated in the following manner:
[0014] a) Inactivate the endogenous DHODH gene in cells, especially through gene editing methods, such as CRISPR-Cas9, and
[0015] b) The cells are cultured in a medium containing uridine under conditions suitable for producing cell lines in which the endogenous DHODH gene is partially or completely inactivated.
[0016] In a particular embodiment, all alleles of the endogenous DHODH gene in the cell line are partially or completely inactivated.
[0017] In other embodiments, the cell line further comprises an expression vector containing a nucleotide sequence encoding exogenous mammalian DHODH and at least one expression cassette for expressing the recombinant protein, wherein the exogenous DHODH contains at least 60% identical sequences to either sequence SEQ ID NO:2 or sequence SEQ ID NO:4.
[0018] In a particular embodiment, the nucleotide sequence comprises the sequence of SEQ ID NO:1 or the sequence of SEQ ID NO:3.
[0019] In another specific embodiment, the recombinant protein is a monoclonal antibody.
[0020] In yet another specific embodiment, the vector comprises a first expression cassette suitable for cloning the light chain of an antibody and a second expression cassette suitable for cloning the heavy chain of an antibody.
[0021] Another object of the present invention is an expression system comprising:
[0022] (i) cell lines containing partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) genes as defined above, and
[0023] (ii) An expression vector comprising a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing a recombinant protein, wherein the exogenous DHODH comprises at least 60% identical to the sequence SEQ ID NO:2 or the sequence SEQ ID NO:4.
[0024] In a particular embodiment, the nucleotide sequence comprises the sequence of SEQ ID NO:1 or the sequence of SEQ ID NO:3.
[0025] In another specific implementation, the recombinant protein is a monoclonal antibody.
[0026] In a particular embodiment, the vector comprises a first expression cassette suitable for cloning the light chain of an antibody and a second expression cassette suitable for cloning the heavy chain of an antibody.
[0027] The present invention also relates to (i) cell lines or expression systems as defined above and (ii) uridine-free culture media.
[0028] Another object of the present invention relates to an in vitro method for producing recombinant proteins, said in vitro method comprising the following steps:
[0029] A)a1) Provides a cell line as defined above, which further comprises an expression vector containing a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing a recombinant protein, wherein the exogenous DHODH contains at least 60% identical to the sequence SEQ ID NO:2 or the sequence SEQ ID NO:4.
[0030] or
[0031] a2) Provide the cell lines as defined above and
[0032] a2') Introduce the expression vector as defined above into the cell line provided in step a2);
[0033] or
[0034] a3) Provide cell lines containing the endogenous DHODH gene.
[0035] a3') to partially or completely inactivate the endogenous DHODH gene in the cell line provided in step a3) and
[0036] a3”) Introduce the expression vector as defined above into a cell line containing the partially or completely inactivated endogenous DHODH gene obtained in step a3’).
[0037] B) Culture the cell line under conditions suitable for producing the recombinant protein; and
[0038] C) Isolate and / or purify the recombinant protein.
[0039] In a particular embodiment, step B) of the method is carried out in a uridine-free culture medium.
[0040] In another specific embodiment, the method further includes step D of formulating the recombinant protein into a pharmaceutical composition.
[0041] The present invention also relates to the use of cell lines, expression systems, or kits as defined above for the production of recombinant proteins.
[0042] In a particular embodiment, the cell line, the expression system, or the kit is used in combination with a uridine-free culture medium. Attached Figure Description
[0043] Figure 1 shows the genomic structure of the human DHODH gene, cited as Gene ID: 100756632, which was available on Genbank NCBI on December 21, 2018.
[0044] Figure 2 shows the alignment of exon 2 of sequence n°1DHODH. PAM: Pre-interstitial sequence adjacent motif (TGG).
[0045] Figure 3 shows the screening of different KO (knockout) DHODH clones for antibody production in the presence of different concentrations of teriflunomide as a selector.
[0046] Figure 4 shows the protein quantities in mg / mL produced using different DHODH variants as selection markers.
[0047] Figure 5 shows the lipase production on day 14 using human DHODH G202A or human GS selection markers and DHODH KO or wild-type CHO cells.
[0048] Figure 6 shows the day 14 monoclonal antibody mAb-B yield obtained using human DHODH G202A or human GS selection markers and DHODH KO or wild-type CHO cells.
[0049] Figure 7 shows the day 14 yield of bispecific antibodies obtained using human DHODH G202A and / or human GS selection markers and DHODH KO or wild-type CHO cells.
[0050] Figure 8 shows the yield of trispecific antibodies on day 14 using human DHODH G202A and human GS selection markers and DHODH KO or wild-type CHO cells. Detailed Implementation
[0051] Dihydroorotate dehydrogenase
[0052] As used herein, the term "dihydroorotate dehydrogenase" or "DHODH" refers to a polypeptide capable of catalyzing the conversion of dihydroorotate (4,5-dihydroorotate or 2,6-dioxo-1,3-diazinon-4-carboxylic acid) to orotate (orotate or 1,2,3,6-tetrahydro-2,6-dioxo-4-pyrimidinecarboxylic acid), as shown in the following reaction:
[0053]
[0054] This polypeptide is classified under Enzyme Committee (EC) number 1.3.3.1. The polypeptide capable of catalyzing the above reaction exhibits "DHODH activity".
[0055] The above reaction is the fourth step in the de novo synthesis of uridine monophosphate (rUMP), which is required for the synthesis of DNA and RNA. Therefore, inhibition or inactivation of DHODH has the effect of inhibiting DNA and RNA synthesis, thereby inhibiting cell proliferation.
[0056] cell lines
[0057] This invention relates to a cell line containing a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene.
[0058] The cell line is a eukaryotic cell line, such as a mammalian cell line, such as the Chinese hamster ovary (CHO) cell line, a monkey cell line, or a human cell line.
[0059] In a particular embodiment, the cell line is a CHO cell line.
[0060] CHO cell lines are commonly used for industrial protein production, and many CHO cell lines are known to those skilled in the art. Examples of such CHO cell lines include those publicly available from the U.S. Type Culture Collection (ATCC), such as the CHO-K1 cell line (ATCC number: CCL-61), the CHO-S cell line (e.g., sold by Invitrogen and Gibco), the CHO DP-12 cell line (ATCC numbers CRL-12444 and 12445), and the CHO 1-15 cell line (ATCC number CRL-9606). Another cell line suitable for industrial protein production is the CHO 9E4 cell line. The 9E4 cell line was established from a clone of the CHO-K1 cell line through a single-cell cloning process. The establishment of the 9E4 cell line is presented in more detail in Example 1. The CHO-K1 cell line was obtained by Puck in 1957 and is deposited at the ATCC with the number CCL-61.
[0061] Human cells (such as HEK293 (ATCC number CRL-1573), HKB11 (ATCC number CRL-12568), PER-C6 (Crucell), HT1080 (ATCC number CRL-121), Jurkat, Daudi, Raji, and CAP (ATCC number CRL-1098) cells) can also be used for protein production to obtain the natural glycosylation pattern of recombinant human proteins.
[0062] In one embodiment, the cell line is capable of growing in serum-free medium (e.g., a medium with a defined chemical composition) and / or suspension. Those skilled in the art can obtain such a cell line by acclimating the parental cell line to serum-free medium and / or suspension (e.g., by single-cell cloning, by gradual acclimation, and / or by a “starvation and preservation” process).
[0063] The cell line of the present invention is a cell line containing a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene.
[0064] In this article, "endogenous DHODH gene" refers to the DHODH gene that is normally present in the specific cells under specific environmental conditions and at a specific developmental stage.
[0065] The difference between “endogenous DHODH gene” and “exogenous DHODH” as defined below is that the exogenous DHODH is provided by an expression vector as defined below. If the expression vector has been introduced into the cell line of the present invention, then the expression vector may be present in the cell line of the present invention.
[0066] As understood by those skilled in the art, the endogenous DHODH gene will depend on the cell line. For example, in the CHO cell line, the endogenous DHODH gene is the Chinese hamster DHODH gene; in the human cell line, the endogenous DHODH gene is the human DHODH gene.
[0067] Typically, wild-type Chinese hamster DHODH refers to a variant containing SEQ ID NO:2 or a sequence thereof, along with said sequence exhibiting DHODH activity. Such variants may, for example, correspond to variants naturally occurring in the hamster species (such as allelic variants or splice variants).
[0068] Generally, wild-type human DHODH refers to a variant containing SEQ ID NO:4 or a sequence thereof, along with said sequence exhibiting DHODH activity. Such variants may, for example, correspond to variants naturally occurring in the human species (such as allelic variants or splice variants).
[0069] As used herein, “gene” includes the DNA region encoding the gene product as well as all DNA regions that regulate the production of the gene product, regardless of whether such regulatory sequences are adjacent to coding and / or transcriptional sequences. Therefore, a gene includes promoter sequences, terminators, translation regulatory sequences (such as ribosome binding sites and internal ribosome entry sites), enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions.
[0070] Gene “inactivation” refers to any reduction in gene expression compared to the corresponding wild-type cells. Gene inactivation can be complete (complete inactivation or knockout) or partial (e.g., where the gene exhibits a suballelic expression level below normal, or a mutant gene product showing a partially reduced activity of its effect).
[0071] In a particular implementation, all alleles of the endogenous DHODH gene are partially or completely inactivated.
[0072] In a particular implementation, the endogenous DHODH gene is completely inactivated.
[0073] In a more specific implementation, all alleles of the endogenous DHODH gene are completely inactivated.
[0074] In a particular implementation, the endogenous DHODH gene is inactivated using a CRISPR-Cas9 method as described in Aga et al. (2015) BMC Proceedings 9 (Supplement 9): P2.
[0075] As is well known to those skilled in the art, the CRISPR-Cas9 system is a prokaryotic adaptive immune response system that uses non-coding RNA to guide site-specific DNA cleavage by the Cas9 nuclease. This DNA damage is repaired via the non-homologous end joining (NHEJ) DNA repair pathway or the homologous directed repair (HDR) pathway through cellular DNA repair mechanisms. To produce gene damage, a single guide RNA (gRNA) consisting of a crRNA sequence specific to the DNA target and a tracrRNA sequence that interacts with the Cas9 protein binds to a recombinant form of the Cas9 protein with DNA endonuclease activity. The resulting complex leads to target-specific double-stranded DNA cleavage. The cleavage site is repaired via the non-homologous end joining (NHEJ) DNA repair pathway, an error-prone process that can lead to insertions / deletions (INDELs) that can disrupt gene function.
[0076] In a particular embodiment, at least one exon of the DHODH gene is targeted for inactivation, particularly via gene editing methods such as CRISPR-Cas9. In a more specific embodiment, a portion of the N-terminal portion of the DHODH gene encoding the DHODH protein is targeted for inactivation, particularly via gene editing methods such as CRISPR-Cas9. In yet another embodiment, the second exon of the DHODH gene is targeted for inactivation, particularly via gene editing methods such as CRISPR-Cas9.
[0077] In one embodiment, a 20-nucleotide sequence of CAAGGATGATGGCTGCATCC (SEQ ID NO:23) or GGATGCAGCCATCATCCTTG (SEQ ID NO:5), or any sequence compatible with knocking out the DHODH gene without impairing CHO survival, is used as a corresponding DNA fragment for generating gRNA that targets the second exon of the DHODH gene. This gRNA is typically obtained using oligonucleotides with the sequences CACCGCACCGGGATGCAGCCATCATCCTTG (SEQ ID NO:6) and AAAACCAAGGATGATGGCTGCATCC (SEQ ID NO:7) or oligonucleotides with the sequences GGATGCAGCCATCATCCTTGGTTTT (SEQ ID NO:24) and CAAGGATGATGGCTGCATCCCGGTG (SEQ ID NO:25). These oligonucleotides are typically cloned at a unique restriction site on the plasmid, such as the BaeI site in the pCM3561 plasmid (commercially available from Invitrogen), such that the cloned DNA sequence is under the control of the U6 promoter and, upon introduction of the plasmid into the cell, is transcribed into a single transcriptional unit containing a crRNA fused with the tracrRNA. This crRNA portion is specific for the second exon of the DHODH gene and is recognized by the Cas9 enzyme.
[0078] To identify cell lines inactivated for the DHODH gene, single cells are typically isolated by limiting dilution in well plates, and after achieving adequate confluence (e.g., 90% confluence), the cells are aliquoted into at least two conditions, such as one in uridine-supplemented medium and another in uridine-free medium. The target clone is usually a clone sensitive to the lack of uridine.
[0079] After isolation, these target cells can be cultured in a medium containing pyrimidine bases, especially a medium containing uridine.
[0080] In this text, "pyrimidine base" refers to pyrimidine itself and various pyrimidine derivatives with a pyrimidine nucleus as their backbone. Examples of such pyrimidine bases include uracil-related nucleic acid substances, such as uracil, uridine, uridine phosphate (especially uridine monophosphate (UMP), uridine diphosphate (UDP), and uridine triphosphate (UTP)), deoxyuridine, and deoxyuridine phosphate (especially deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), and deoxyuridine triphosphate (dUTP)); and cytosine-related nucleic acid substances, such as cytosine, cytidine, and cytidine phosphate (especially cytidine monophosphate (CMP), cytidine diphosphate (CDP), and cytidine triphosphate). glycosides (CTP), deoxycytidine, 2'-deoxycytidine, phosphate deoxycytidine (especially dCMP, dCDP and dCTP); thymidine, thymidine, phosphate thymidine (especially tMP, dDP and dTP), deoxycytidine, phosphate deoxycytidine (especially dTMP, dTDP and dTTP)); thymidine, thymidine, phosphate deoxycytidine (especially dTMP, dTDP and dTTP)).
[0081] In a particular embodiment, the pyrimidine base is uridine.
[0082] In this article, "uridine" refers to the nucleoside of the following formula.
[0083]
[0084] "Uridine-free culture medium" means any basal culture medium suitable for the growth of a particular cell line, wherein the culture medium contains less than 1 mM of uridine, and in particular, the culture medium does not contain any uridine.
[0085] "A medium containing uridine" means any basal medium suitable for the growth of a particular cell line, wherein the medium also contains 1 mM to 25 mM uridine, particularly 5 mM to 10 mM uridine.
[0086] “Basal medium” in this document means a medium suitable for exposure to cells, such as unsupplemented medium for exposure to CHO cells. Those skilled in the art will understand that the basal medium to be used will depend on the cell type used. Examples of basal media include CDCHO medium, OPTICHO medium, etc. TM Culture medium, Fecto CHO TM Culture medium, FortiCHO TM Culture medium, ExpiCHO TM Culture medium, Ex-Cell TM Culture medium, ActiPRO TM Culture medium, MAM PF77 TMCulture medium and PowerCHO TM Culture medium.
[0087] In a particular embodiment, the basal culture medium is also supplemented with glutamine, typically 4 mM to 6 mM glutamine.
[0088] Therefore, in a particular embodiment, the cell line of the present invention is generated in the following manner:
[0089] a) Inactivate the endogenous DHODH gene in cells, especially through gene editing methods such as CRISPR-Cas9, and
[0090] b) The cells are cultured in a medium containing uridine under conditions suitable for producing cell lines in which the endogenous DHODH gene is partially or completely inactivated.
[0091] The generation of CHO cell lines containing endogenous DHODH genes that are completely or partially inactivated by the CRISPR-Cas9 method is further illustrated in Examples 2 and 3.
[0092] Cell lines containing fully or partially inactivated endogenous DHODH genes (such as CHO cell lines) can be generated using a variety of other molecular biology techniques known in the art. For example, other gene-editing techniques that can be used to generate cell lines with fully or partially inactivated endogenous DHODH genes include the use of zinc finger nucleases (ZFNs) or transcription factor-like effector nucleases (TALENs). The Cre / Lox method can also be used to knock out one or more or all alleles of the DHODH gene.
[0093] In a particular embodiment, the cell line of the present invention further comprises an expression vector as defined in the "Expression Vector" section below.
[0094] The expression vector can be introduced into cell lines using any suitable technique known to the technician (such as transfection, particularly by electroporation or chemical transfection or transduction).
[0095] In certain embodiments, the cell lines of the present invention may also include additional expression vectors containing selection markers, different from the expression vectors of the present invention, typically additional expression vectors containing sequences encoding glutamine synthase.
[0096] Exogenous DHODH
[0097] The DHODH (also referred to as "exogenous DHODH") encoded by the expression vector used in this invention may comprise at least 60%, 62%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% identical sequences or sequences composed thereof with respect to SEQ ID NO:2 or SEQ ID NO:4. It may also comprise or consist of fragments of at least 100, 150, 200, 250, 300, or 350 consecutive amino acids of SEQ ID NO:2 or SEQ ID NO:4, provided that the protein retains DHODH activity.
[0098] In some embodiments, the exogenous DHODH according to the invention comprises or consists of at least 60%, 62%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% identical sequences to or composed of the sequences of SEQ ID NO:2 and SEQ ID NO:4.
[0099] In some embodiments, the exogenous DHODH according to the invention is human DHODH, i.e., human-origin DHODH.
[0100] As used herein, the term "human DHODH" refers to a protein having a sequence comprising or consisting of SEQ ID NO:4 and a variant of said protein exhibiting DHODH activity. Such variants may, for example, correspond to variants naturally occurring in the human species (such as allelic variants or splice variants). Alternatively, such variants may correspond to variants obtained through genetic engineering. In one embodiment, such variants differ from the sequence of SEQ ID NO:4 only in that they contain at most 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid variation (such variation includes substitution, insertion, and deletion) compared to SEQ ID NO:4.
[0101] In a particular embodiment, the human DHODH is a variant containing the G202A mutation compared to the wild-type sequence, and is typically a protein containing the amino acid sequence SEQ ID NO:26 or composed thereof.
[0102] In some implementations, the exogenous DHODH is hamster DHODH, i.e., DHODH of hamster origin. The hamster DHODH can be, for example, Chinese hamster (gray hamster (Cetulus griseus)) DHODH.
[0103] As used herein, the term "Chinese hamster DHODH" refers to a variant containing or consisting of the sequence SEQ ID NO:2 and exhibiting DHODH activity. Such variants may, for example, correspond to variants naturally occurring in the hamster species (such as allelic variants or splice variants). Alternatively, such variants may correspond to variants obtained through genetic engineering. In one embodiment, such variants differ from the sequence SEQ ID NO:2 only in that they contain at most 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid variation (such variation includes substitution, insertion, and deletion).
[0104] In another embodiment, the variant DHODH will have DHODH activity, optionally having the same activity level as the wild-type protein, or 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140% or higher of the wild-type protein.
[0105] A polypeptide having an amino acid sequence that is at least, for example, 95% "identical" to the query amino acid sequence of the present invention means that the amino acid sequence of the subject polypeptide is identical to the query sequence, but the subject polypeptide sequence may contain up to five amino acid changes per 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence that is at least 95% identical to the query amino acid sequence, up to 5% (5 out of 100) of the amino acid residues in the subject sequence may be inserted, deleted, or substituted with another amino acid.
[0106] Sequence identity can be identified over the full length of the variant sequence, the full length of the reference sequence, or both. For example, a global alignment can be used to calculate the percentage of identity (i.e., comparing the two sequences over their entire length). Methods for comparing the identity and homology of two or more sequences are well known in the art. The “needle” procedure can be used, for example, when performing a global alignment, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453) to find the best alignment (including gaps) of the two sequences considering their entire length. The needle procedure is available, for example, on the World Wide Web website at ebi.ac.uk. The percentage of identity according to the invention is preferably calculated using the EMBOSS::need|e (global) procedure, wherein the “Gap Open” parameter is equal to 10.0, the “Gap Extend” parameter is equal to 0.5, and a Blosum62 matrix is used.
[0107] Variants of the reference sequence, compared to the reference sequence, may contain mutations such as deletions, insertions, and / or substitutions. In the case of substitution, the substitution preferably corresponds to the conservative substitutions shown in the table below.
[0108] Conservative replacement amino acid types Ala, Val, Leu, Ile, Met, Pro, Phe, Trp Amino acids with aliphatic hydrophobic side chains Ser, Tyr, Asn, Gln, Cys Amino acids with uncharged but polar side chains Asp, Glu Amino acids with acidic side chains Lys, Arg, His Amino acids with basic side chains Gly Neutral side chain
[0109] expression carrier
[0110] The expression vectors used in the context of this invention are suitable for producing recombinant proteins and contain a sequence encoding dihydroorotate dehydrogenase (DHODH).
[0111] The expression vector is preferably a DNA vector.
[0112] The expression vector used in the context of this invention contains a sequence encoding exogenous DHODH as defined in the “Exogenous DHODH” section above.
[0113] In a specific implementation, the cell line into which the expression vector is introduced is the CHO cell line, and the exogenous DHODH is of xenogeneic origin (i.e., the exogenous DHODH is not hamster DHODH).
[0114] The sequence encoding this exogenous DHODH can be a naturally occurring nucleotide sequence. Alternatively, the triplet of the sequence encoding this DHODH can be biased for expression in CHO cells. Software and algorithms for biasing sequences to obtain optimal expression are known in the art and include, for example, the algorithm described in Raab et al. (2010) Syst Synth Biol. 4:215-225. This algorithm not only provides the best available codons for expression but also takes into account GC content and the absence of unwanted DNA motifs.
[0115] For example, the sequence encoding exogenous DHODH may comprise or consist of at least 60%, 62%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical sequences to or composed of the sequence of SEQ ID NO:3 (i.e., the sequence encoding human DHODH of SEQ ID NO:4, which has been designed for optimal expression in CHO cells) and / or the sequence of SEQ ID NO:1 (i.e., the sequence encoding hamster DHODH of SEQ ID NO:2, which has been designed for optimal expression in CHO cells).
[0116] In one implementation, the sequence encoding exogenous DHODH comprises or consists of the sequence of SEQ ID NO:1 or SEQ ID NO:3.
[0117] In the context of this invention, the expression vector encoding the exogenous DHODH as defined above can be placed under the control of any promoter known to those skilled in the art.
[0118] For example, the sequence encoding the exogenous DHODH as defined above can be placed under the control of a promoter suitable for driving DHODH expression, such as the simian vacuolar virus 40 (SV40) promoter (e.g., a late or early SV40 promoter), the CMV promoter, the elongation factor 1 promoter, the GAPDH promoter, the RPL37 promoter, or the actin promoter. For example, the early SV40 promoter is described in Benoist and Chambon (1981) Nature 290:304-310 and Moreau et al. (1981) Nucleic Acids Res. 9:6047-6068. Specifically, the SV40 promoter is a full-length promoter. The SV40 promoter may also have an origin of replication containing a 72 bp repeat sequence.
[0119] In some embodiments, the SV40 promoter is not the SV40 promoter in which positions 128 to 270 have been removed, that is, the SV40 promoter is not the SV40 promoter described in Korean Patent No. 10-0267720, but is a gene bank deposited on December 17, 1997, with accession number KCTC 8860P at the KIST Institute of Bioengineering.
[0120] In other implementations, the sequence encoding the exogenous DHODH as defined above is not placed under the control of the SV40 promoter.
[0121] Expression vectors suitable for producing recombinant proteins are known to those skilled in the art. Such vectors typically correspond to expression vectors containing an origin of replication and at least one expression cassette that allows cloning and expression of the desired recombinant protein. The expression cassette typically contains a 5' untranslated region (containing or consisting of a promoter and optional enhancer sequences), one or more restriction sites that allow cloning of the sequence encoding the recombinant protein, a 3' untranslated region (e.g., a poly-A signal), and optional one or more introns. The promoter sequence can correspond to any strong promoter well known in the art, such as the human CMV promoter. Optionally, the expression vector used in the context of this invention contains a prokaryotic origin of replication (e.g., a prokaryotic replicon, such as ColE1 in *E. coli*) and at least one prokaryotic selectable marker gene (also called a prokaryotic selectable marker) such that the vector allows replication in prokaryotic cells. Cells replicating the vector also express the prokaryotic selectable marker gene and can therefore be identified and selected. Prokaryotic selectable marker genes are well known to those skilled in the art. Examples of selective marker genes in prokaryotes are, for example, nucleic acid sequences that encode proteins that confer resistance to antibiotics (e.g., sequences that encode proteins that confer resistance to ampicillin, chloramphenicol, cyprodinil, or kanamycin).
[0122] The recombinant protein may correspond to any protein of interest to those skilled in the art.
[0123] As used herein, the term “protein” is intended to include peptides (i.e., amino acid chains of fewer than 50 amino acids), polypeptides (i.e., amino acid chains of at least 50 amino acids), monomeric proteins (i.e., proteins composed of a single amino acid chain), and multimeric proteins (i.e., proteins composed of two or more amino acid chains, such as monoclonal antibodies).
[0124] The expression vectors used in the context of this invention typically contain a number of expression cassettes, the number of which is the same as the number of different amino acid chains constituting the protein (e.g., one expression cassette in the case of a monomeric protein or a homodimeric protein, two expression cassettes in the case of a heterodimeric protein or a monoclonal antibody, etc.).
[0125] Alternatively, the expression vector used in the context of this invention may contain only one expression cassette, even when it is necessary to produce heterodimeric proteins or monoclonal antibodies. In this case, one or more sequences of one or more other amino acid chains encoding the protein are present on a separate expression vector, which is co-transfected with the expression vector according to the invention into a host cell line, particularly a CHO cell line.
[0126] In this case, the supplemental separate expression vector may contain selection markers different from the DHODH selection markers described herein, such as DHFR, GS, or HPRT.
[0127] In one embodiment, the expression vector used in the context of this invention may not contain an expression cassette. In this case, the expression cassette suitable for expressing the recombinant protein is present on a separate vector, which is co-transfected with the expression vector according to the invention into a host cell line, particularly a DHODH-inactivated cell line of the invention, and more particularly a DHODH-inactivated CHO cell line of the invention.
[0128] Therefore, in some embodiments, the expression vector used in the context of this invention comprises:
[0129] - The sequence of exogenous DHODH codes, as defined above, is placed under the control of the early SV40 promoter;
[0130] - First expression cassette, wherein the sequence encoding the light chain of the antibody is under the control of the CMV promoter;
[0131] - A second expression cassette, wherein the sequence encoding the heavy chain of the antibody is placed under the control of a CMV promoter;
[0132] -The origin of prokaryotic replication; and
[0133] - Selectable markers for use in prokaryotic cells, placed under the control of their natural promoters, that is, sequences encoding proteins that confer resistance to ampicillin.
[0134] Throughout this specification, the term "recombinant protein" refers to any recombinant protein that needs to be produced. It may, for example, correspond to therapeutic and / or preventative proteins, i.e., proteins intended for use as pharmaceuticals (including vaccines). In one specific embodiment, the recombinant protein to be produced is not DHODH. In another specific embodiment, the recombinant protein to be produced is an antibody, such as a monoclonal antibody. In yet another specific embodiment, the recombinant protein to be produced is an antigenic protein.
[0135] The term "antibody" is used in its broadest sense herein and specifically encompasses any isotype (such as IgG, IgM, IgA, IgGD, and IgE) of monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (including bispecific and trispecific antibodies), antibody fragments (such as Fv, scFv, ds, Fab, Fab', or F(ab')2 fragments), single-domain antibodies and their fragments, and fusion proteins containing antibody fragments. Antibodies that react with specific antigens can be produced by recombinant methods (such as selecting a library of recombinant antibodies from phages or similar vectors) or by immunizing animals with antigens or antigen-encoded nucleic acids.
[0136] As used herein, a “monoclonal antibody” is an antibody obtained from a population of substantially homogeneous antibodies, meaning that the antibodies forming the population are substantially identical, but may contain small amounts of naturally occurring mutations. These antibodies target a single epitope (or, in the case of multispecific monoclonal antibodies, a group of epitopes), and are therefore highly specific.
[0137] A typical monoclonal antibody consists of two identical heavy chains and two identical light chains linked by disulfide bonds. Each heavy and light chain contains constant and variable regions. Each variable region contains three segments called “complementarity-determining regions” (“CDRs”) or “hypervariates”, which are primarily responsible for binding epitopes of the antigen. These are commonly referred to as CDR1, CDR2, and CDR3, numbered sequentially from the N-terminus (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., National Institute of Health, Bethesda, MD, 1991). The more highly conserved portion of the variable region is called the “framework region”.
[0138] The monoclonal antibody may be, for example, a mouse antibody, a chimeric antibody, a humanized antibody, or a fully human antibody.
[0139] The monoclonal antibody can be a monospecific, bispecific, or trispecific antibody.
[0140] When the recombinant protein to be produced is a monoclonal antibody, the expression vector according to the present invention may contain a first expression cassette suitable for cloning the antibody light chain and a second expression cassette suitable for cloning the antibody heavy chain.
[0141] In a specific implementation, each of the first and second expression boxes contains a cytomegalovirus (CMV) promoter, such as a CMV promoter derived from human or mouse CMV. More specifically, the first and second expression boxes may contain:
[0142] -CMV immediate early enhancer promoters (e.g., those with a sequence described in Teschendorf et al. (2002) Anticancer Res. 22:3325-3330); or
[0143] - An IE2 promoter / enhancer from mouse CMV (e.g., one with a sequence described in Chatlerard et al. (2007) Biotechnol Bioeng. 96:106-117); or
[0144] -hCMV-MIE control element (e.g., one with the sequence described in WO 89 / 01036).
[0145] The term "antigenic protein" is used herein in its broadest sense and covers any protein, alone or in combination with adjuvants, capable of generating an immune response. It may be intended for use in prophylactic or therapeutic vaccines. In a specific embodiment, the antigenic protein is a vaccine protein, i.e., a protein intended for use in a prophylactic vaccine.
[0146] The expression vector may contain at least one sequence encoding the target recombinant protein (e.g., a sequence encoding a monomeric protein, a sequence encoding an antibody chain, or two sequences encoding an antibody light chain and an antibody heavy chain, respectively), or it may be empty (i.e., it does not contain such a sequence encoding the target recombinant protein).
[0147] Expression systems, kits, methods, and applications
[0148] This invention provides an expression system, the expression system comprising:
[0149] (i) A cell line as defined in the “Cell Lines” section above, which contains partially or completely inactivated endogenous DHODH genes as defined in the “Cell Lines” section above, and
[0150] (ii) Expressive vehicles as defined in the “Expressive Vehicles” section above.
[0151] The expression system of the present invention may further include supplementary separate expression vectors, each of which contains a nucleotide sequence encoding a selection marker different from DHODH (such as DHFR, GS, or HPRT) and at least one expression cassette for expressing the recombinant protein.
[0152] Alternatively, the expression system of the present invention may also include supplementary expression carriers as defined in the "Expression Carrier" section above.
[0153] The present invention provides a kit comprising (i) a cell line according to the invention or an expression system according to the invention containing an expression vector as defined in the “Expression Vector” section above, and (ii) a uridine-free culture medium as defined above.
[0154] The kit may contain an expression vector encoding exogenous DHODH (in the expression system) as described above. In such a kit, the vector is preferably empty, as this allows for the cloning of the target protein for those skilled in the art. Additionally, the expression vector is preferably isolated from the cell line in this kit.
[0155] The kit also includes a uridine-free culture medium as defined in the “Cell Lines” section above.
[0156] The kit may also include a culture medium suitable for culturing the cell line, a culture medium suitable for transfecting the vector into the cell line, packaging materials, and / or instructions for using the expression system.
[0157] In a particular implementation, the kit does not contain a DHODH inhibitor.
[0158] Examples of DHODH inhibitors include dioctinacic acid, buquina (6-fluoro-2-(2'-fluoro-1,1'-biphenyl-4-yl)-3-methyl-4-quinoline carboxylic acid), naphthoquinone derivatives (such as dichloroallyl succinate), isoxazole derivatives (such as leflunomide (5-methyl-N-[4-(trifluoromethyl)phenyl]-isoxazole-4-carboxamide) and its active metabolite teriflunomide ((2Z)-2-cyano-3-hydroxy-N-[4-(trifluoromethyl)phenyl]but-2-amide), quinolone carboxylic acid, naphthoquinone, isoxazole, phenoxyquinoline, redoxal and its derivatives, succinate, lapacol, atovaquinone, and (8-chloro-4-(2-chloro-4-fluoro-phenoxy)quinoline). Inhibitors of DHODH may be able to inhibit DHODH activity by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%.
[0159] In a particular implementation, the kit does not contain teriflunomide.
[0160] The present invention also provides the use of cell lines according to the invention, expression systems according to the invention, or kits according to the invention comprising expression vectors as defined in the "Expression Vectors" section above for the in vitro production of recombinant proteins.
[0161] In a particular implementation, the cell line, expression system, or kit is used in combination with a uridine-free culture medium as defined above, and more particularly in the absence of DHODH inhibitors.
[0162] The present invention also provides the use of the expression system according to the invention, the cell line according to the invention comprising the expression vector as defined in the "Expression Vector" section above, or the kit according to the invention for isolating clonal cells ("high-yield clones") that produce high levels of recombinant protein in vitro, particularly in the absence of DHODH inhibitors.
[0163] In the context of this invention, the term "high level of recombinant protein" is intended to mean a concentration of recombinant protein in the culture medium of at least 0.05 g / L, preferably at least 0.1 g / L, still preferably at least 0.2 g / L, and more preferably between 0.3 g / L and 1 g / L. The concentration of the recombinant protein can be determined by methods well known to those skilled in the art, particularly including enzyme-linked immunosorbent assay (ELISA), Western blotting, caliper techniques, and the concentration range of purified protein corresponding to said recombinant protein.
[0164] The present invention also provides an in vitro method for producing recombinant proteins, the in vitro method comprising the following steps:
[0165] A)a1) Provide a cell line according to the invention comprising an expression vector as defined in the “Expression Vector” section above;
[0166] or
[0167] a2) Provide the cell line according to the invention and
[0168] a2') Introduce the expression vector as defined in the "Expression Vectors" section above into the cell line provided in step a2);
[0169] or
[0170] a3) Provide cell lines containing the endogenous DHODH gene.
[0171] a3') to partially or completely inactivate the endogenous DHODH gene in the cell line provided in step a3) and
[0172] a3”) Introduce the expression vector as defined in “Expression Vectors” above into a cell line containing a partially or completely inactivated endogenous DHODH gene obtained in step a3’).
[0173] B) Culture the cell line under conditions suitable for producing the recombinant protein; and
[0174] C) Isolate and / or purify the recombinant protein.
[0175] In a particular embodiment, step B) of the above method is carried out in a culture medium that is free of uridine, and more particularly free of DHODH inhibitors, and specifically includes the following sub-step: selecting transfected cells that still grow despite the absence of uridine, and especially in the absence of DHODH inhibitors.
[0176] The present invention also provides an in vitro method for isolating clonal cells that produce high levels of recombinant proteins, the method comprising or consisting of the following steps:
[0177] A)a1) Provide a cell line according to the invention comprising an expression vector as defined in the “Expression Vector” section above;
[0178] or
[0179] a2) Provide the cell line according to the invention and
[0180] a2') Introduce the expression vector as defined in the "Expression Vectors" section above into the cell line provided in step a2);
[0181] or
[0182] a3) Provide cell lines containing the endogenous DHODH gene.
[0183] a3') to partially or completely inactivate the endogenous DHODH gene in the cell line provided in step a3) and
[0184] a3”) introduces the expression vector as defined in “Expression Vectors” above into a cell line containing a partially or completely inactivated endogenous DHODH gene obtained in step a3’).
[0185] B) Culture the cell line under conditions suitable for producing the recombinant protein; and
[0186] C) Isolate clones that produce high levels of recombinant proteins.
[0187] In a particular embodiment, step B) of the above method is carried out in a culture medium that is free of uridine, and more particularly free of DHODH inhibitors, and specifically includes the following sub-step: selecting transfected cells that still grow despite the absence of uridine, and especially in the absence of DHODH inhibitors.
[0188] In step a2') or a3"), the expression vector may be introduced into the cell line using any technique known to those skilled in the art, such as transfection, particularly by electroporation or chemical transfection or transduction.
[0189] The conditions suitable for producing recombinant proteins are well known to those skilled in the art. For example, the methods described in the examples can be used.
[0190] In a specific implementation, the culture medium used in step B) contains a gradually decreasing concentration of uridine. This allows selection of clones in which the vector-derived exogenous DHODH gene (and thus the sequence encoding the recombinant protein) has been amplified.
[0191] The above method may further include the step of formulating the recombinant protein into a pharmaceutical composition.
[0192] Throughout this specification, terms such as “comprises,” “comprised,” and “comprising” have the meaning that applies to them in most patent jurisdictions, preferably in the jurisdictions discussed; for example, they may mean “includes,” “included,” “including,” etc. Terms such as “consisting essentially of,” “consists essentially of,” and “consisting of” have the meaning that applies to them in most patent jurisdictions, preferably in the jurisdictions discussed; for example, they mean excluding all, most, or all but negligible amounts of other elements, and they allow for elements not expressly listed but exclude elements found in the prior art or that affect the essential or novel features of the invention.
[0193] Numerous references are cited throughout the text of this specification. Each reference cited herein (including any journal article or abstract, published or unpublished patent application, granted patent, manufacturer's specification, description, etc.) is incorporated herein by reference. However, it is not acknowledged that any reference cited herein is actually prior art relating to the present invention.
[0194] The present invention will be further described with reference to the following figures and embodiments, which are for illustrative purposes only and are not intended to limit the invention.
[0195] This invention is defined by the claims, which should be interpreted with the aid of the description and drawings.
[0196] Brief description of the sequence
[0197]
[0198]
[0199] Example
[0200] Example 1 : Obtain CHO 9E4 cell line
[0201] This example describes the acquisition of the CHO9E4 cell line from the CHO-K1 cell line, which is commercially available from ATCC under the designation ATCC CCL-61.
[0202] 1. CHO-K1 cell line
[0203] A vial of CHO-K1 cells (ATCCCCL-61) frozen in 1969 in the presence of fetal bovine serum was obtained from ATCC.
[0204] 2. In Ex-Cell TM Thaw vials in 302 medium and prepare CHO-LG-APF library
[0205] The CHO-K1 vial was directly added to Ex-Cell supplements containing 4mM glutamine. TM Thaw in 302 medium (SAFC) and amplify on static supports, then amplify in a spinner. The resulting CHO-LG-APF library was then processed in Ex-Cell. TM Frozen after 12 passages and 17.3 generations in 302 medium.
[0206] 3. Transfer Ex-Cell TM The CHO-LG-APF library in 302 medium was thawed and the ABC-024P22 library was prepared.
[0207] Place the CHO-LG-APF vial in Ex-Cell TM Thaw and amplify in 302 medium. Thaw the resulting ABC-024P22 library after 18.5 generations.
[0208] 4. Adapt the CMV07-024 library to CDCHO fusion medium and prepare the ABC-003 library.
[0209] Thaw CMV07-024 and directly adapt it to Ex-cell supplemented with 4mM glutamine. TMCDCHO fusion medium (SAFC) was used, and the cells were adapted for 12.5 generations in a shaker until they reached the ex-cell level. TM The ABC-003 library in the CDCHO fusion medium was frozen.
[0210] 5. Thaw the ABC-003 library in CDCHO fusion medium and prepare the ABC-053 library in CDCHO fusion medium.
[0211] The ABC-003 vials were thawed in CDCHO fusion medium, and the ABC-53 library was frozen after 4.2 generations after dilution.
[0212] 6. Thaw the ABC-053 library in CDCHO fusion medium, and select, clone, and prepare the P15A11 library in CDCHO fusion medium.
[0213] ABC-053 was added to Ex-cell supplemented with 4mM glutamine. TM Thaw in CDCHO fusion medium (SAFC). After amplification of the culture, clones were formed in plates by limiting dilutions, followed by amplification in CDCHO fusion medium. A library of clone P15A11 generated from this clone was frozen. This cloning and amplification corresponded to approximately 94 generations.
[0214] 7. Thaw the P15A11 library in CDCHO fusion medium, adapt the library by direct passage in CDCHO, and prepare the CHOSP10-002 library in CDCHO medium.
[0215] The P15A11 library was added to Ex-cells supplemented with 4 mM glutamine. TM Cells were thawed in CDCHO fusion medium (SAFC) and diluted in CDCHO medium after two passages in CDCHO fusion medium. After three passages in CDCHO medium, the CHOSP10-002 library was frozen after a total of 15.9 generations.
[0216] 8. Thaw and amplify the CHOSP10-002 library in CDCHO medium, eliminate clumps by centrifugation, and select by subculturing in 96-well plates without clumps. Amplify in 6-well plates and on a shaker to prepare the CHOSP10-012 library in CDCHO medium.
[0217] The CHOSP10-002 library was thawed in CDCHO medium (Invitrogen) supplemented with 6 mM glutamine and then expanded. The culture was centrifuged to remove cell clumps and cultured further by separating cells only from the supernatant. At this stage, 11.3 generations were generated from thawing.
[0218] The culture was aliquoted into 96-well plates at 10 cells per well. Wells with cells proliferating individually in suspension were expanded in 6-well plates and then in a shaker. 23.2 additional generations were produced until the CHOSP10-012 library was frozen.
[0219] 9. Thaw the CHOSP10-012 library, amplify it, and prepare the CHOSP11-008 library (9E4 library).
[0220] The CHOSP10-012 library was thawed in CDCHO medium (Invitrogen) supplemented with 6 mM glutamine and then expanded from the Erlenmeyer flask stage to a 17L bioreactor.
[0221] The 9E4 library was frozen after a total of 10 generations.
[0222] Example 2 : To generate CHO cell lines in which the DHODH gene is ineffective
[0223] A- Design and construction of CRISPR-CAS9 guide RNA (gRNA)
[0224] To disable the DHDOH gene in CHO cells, the inventors first restored the hamster DHODH gene sequence and used publicly available TeFor software to design different guide RNAs (gRNAs) for CRISPR-Cas9 transfection into the CHO genome. The complete CHO DHODH sequence with introns and exons is shown in Figure 1.
[0225] The software identified eight sequences that can target the DHODH gene:
[0226] Sequence 1
[0227] CACCGGGATGCAGCCATCATCCTTG(SEQ ID NO:6)
[0228] AAAACCAAGGATGATGGCTGCATCC(SEQ ID NO:7)
[0229] Sequence 2
[0230] CACCGGATGCAGCCATCATCCTTGG(SEQ ID NO:8)
[0231] AAAACCCAAGGATGATGGCTGCATC(SEQ ID NO:9)
[0232] Sequence 3
[0233] CACCGGCAGCCATCATCCTTGGGGG(SEQ ID NO:10)
[0234] AAAACCCCCCAAGGATGATGGCTGC(SEQ ID NO:11)
[0235] Sequence 4
[0236] CACCGGCCATCATCCTTGGGGGAGG(SEQ ID NO:12)
[0237] AAAACCCTCCCCCAAGGATGATGGC(SEQ ID NO:13)
[0238] Sequence 5
[0239] CACCGGCTATTCGCTTCACGTCCCT(SEQ ID NO:14)
[0240] AAAACAGGGACGTGAAGCGAATAGC(SEQ ID NO:15)
[0241] Sequence 6
[0242] CACCGGCCTCTACAAACTGGGCTTT(SEQ ID NO:16)
[0243] AAAACAAAGCCCAGTTTGTAGAGGC(SEQ ID NO:17)
[0244] Sequence 7
[0245] CACCGGGCTTTGGGTTTGTCGAGGT(SEQ ID NO:18)
[0246] AAAACACCTCGACAAACCCAAAGCC(SEQ ID NO:19)
[0247] Sequence 8
[0248] CACCGGCTGGTCTGAGGAGCCTACA(SEQ ID NO:20)
[0249] AAAACTGTAGGCTCCTCAGACCAGC(SEQ ID NO:21)
[0250] Although eight sequences were tested and cloned, only four clones were transfected and only one successfully knocked out the DHODH gene. The following 20-nucleotide sequence, GGATGCAGCCATCATCCTTG (SEQ ID NO:5), was used as the corresponding DNA fragment to generate the gRNA shown in Figure 2. It targets the second exon of the DHODH gene. To obtain the transcription of the appropriate gRNA, two oligonucleotides, CACCGGGATGCAGCCATCATCCTTG (oligo1, SEQ ID NO:6) and AAAACCAAGGATGATGGCTGCATCC (oligo2, SEQ ID NO:7), were synthesized, annealed, and cloned at the unique BaeI site of pCM3561 (commercially available from Invitrogen).
[0251] The cloned DNA sequence is thus under the control of the U6 promoter, and after the DNA is transfected into CHO cells, it is transcribed into a single transcription unit containing crRNA fused with tracrRNA. The crRNA portion is specific to the second exon of the DHODH gene, while the tracrRNA is recognized by the Cas9 enzyme itself.
[0252] B- Preparation of materials for CRISPR-Cas9 gene editing
[0253] As disclosed in Example 1, CHO9E4 cells were isolated from CHO K-1 cells purchased from ATCC and selected, and were grown and maintained in suspension culture in a serum-free CDCHO medium supplemented with 6 mM L-glutamine, optimized for the growth of Chinese hamster ovary (CHO) cells, at 37°C in an incubator with 8% CO2 and 80% humidity.
[0254] 10 μg of sgRNA expression vector (pCM3561) was digested with 1 μL BaeI enzyme at 25°C for 1 hour with a supplement of 5 units / μl containing 20 μM S-adenosylmethionine (SAM). The digested plasmid was then separated by electrophoresis using a 1% agarose gel. The resulting sgRNA cloning vector was then recovered using a gel extraction kit (Qiagen Kit).
[0255] The sgRNA cloning vector and the annealed guide oligonucleotide were ligated using T4 DNA ligase (Biolabs) and incubated at room temperature for 10 min.
[0256] 5 μL of the ligation product was added to 50 μL of E. coli DH5α competent cells (Invitrogen).
[0257] Cells and DNA were incubated on ice for 30 min, followed by heat shock at 42 °C for 45 s. After adding 500 mL of SOC medium, the cells were incubated at 37 °C (800 rpm) for 1 h to allow the bacteria time to produce antibiotic resistance proteins encoded on the plasmid backbone. After incubation, each tube was spread onto an LB dish supplemented with 100 μg / mL ampicillin. The culture dishes were incubated overnight at 37 °C. A negative control (using water instead of the inserted DNA) was used to evaluate the success of transformation.
[0258] For the amplification step, two colonies were selected for each construction and inoculated into 2 mL LB medium supplemented with 100 μg / mL ampicillin in a tube, and incubated overnight (37°C, 700 rpm). The overnight culture was harvested by centrifugation. The QIAprep Miniprep Kit was used. TM The amplified DNA was recovered by QIAGEN (eluted in EB buffer). The sequence of the target guide oligonucleotide was then examined by Sanger sequencing (sense and antisense sequencing, GATC Company). After alignment verification on Vector NTI software (Thermofisher Scientific), the corresponding colonies were inoculated into 200 mL LB medium supplemented with 100 μg / mL ampicillin. After incubation for 24 hours, bacteria were harvested by centrifugation at 6000g for 15 min at 4°C. The EndoFree Plasmid Maxi Kit was used. TM (QIAGEN) MaxiPrep was prepared. DNA was precipitated by adding room temperature isopropanol. After centrifugation for 1 h (4 °C, 8000 rpm), the DNA precipitate was washed with endotoxin-free room temperature 70% ethanol. After a brief fresh centrifugation, the precipitate was air-dried for 1 h and redissolved in an appropriate volume of endotoxin-free sterile water to achieve a DNA concentration of 5 mg / mL. The DNA concentration was measured using a nanodrop device.
[0259] Four different plasmids were prepared: pBH6840 (KO DHODH SEQ1), pBH6841 (KO DHODH SEQ4), pBH6842 (KO DHODH SEQ5), and pBH6843 (KO DHODH SEQ7). The targets of these plasmids in the CHO DHODH gene are shown in sequence SEQ ID NO:22.
[0260] DNA sequencing was performed by GATC subcontractor (Eurofins Genomics Company).
[0261] C-CRISPR-Cas9 gene editing
[0262] Transfection was performed via electroporation using MaxCyte STX and its CHO-defined protocols. These were performed in an OC-100 processing unit (20 million cells per transfection).
[0263] The day before transfection, the cells were loaded with 1.5 × 10⁻⁶ cells. 6 10 cells / mL were seeded in CDCHO medium supplemented with 6 mM L-glutamine.
[0264] On the day of transfection, the cells were numbered using a ViCell device (Beckman & Coulter). The required number of cells were centrifuged at 250g for 10 minutes, and the supernatant was discarded.
[0265] For each transfection condition, 20×10 6 Centrifuge the cells at 250g for 10 min. Resuspend the pellet in 70 μL Maxcyte buffer. Add 30 μg DNA and transfer the mixture (cells, buffer, and DNA) to a 100 μL Maxcyte electroporation cartridge. The processing unit used is the OC-100, which is specific to the 100 μL cartridge, and the optimized program for CHO is selected.
[0266] Perform the following transfection.
[0267] T1 pBH6840 KO DHODH SEQ1 T2 pBH6841 KO DHODH SEQ4 T3 pBH6842 KO DHODH SEQ5 T4 pBH6843 KO DHODH SEQ7 T5 W / O ADN H2O
[0268] After electroporation, the cells were transferred to 25 mL working conical flasks. They were placed in a static incubator at 37°C and 5% CO2 for 45 min. Then, 25 mL of CDCHO medium supplemented with 6 mM L-glutamine was added to resuspend the cells, and the conical flasks were placed in a shaker at 37°C, 5% CO2, 70% humidity, and 110 rpm.
[0269] The day after electroporation, single cells were seeded from each well of the CHO9E4 transfection pool using limiting dilution. After approximately 20 days, once the cells reached about 90% confluence and appeared healthy under a microscope, the cells were aliquoted into two new 96-well plates, one with and one without uridine.
[0270] Several clones were selected based on their sensitivity to uridine deficiency. These clones were adapted for growth in CDCHO medium supplemented with 6 mM glutamine and 5 mM uridine.
[0271] To confirm the success of the gene editing, the Qiagen DNeasy kit was used. TM(Qiagen) extracted genomic DNA from CRISPR-Cas9 cloned cells. The target locus was amplified by PCR using appropriate primers for the DHODH locus region targeted by CRISPR-Cas9, and the PCR products were sequenced by NGS using PCR fragments covering the potentially deleted regions.
[0272] Example 3 : Can alternatively generate CHO cell lines in which the DHODH gene is nullified
[0273] A- Design and construction of CRISPR CAS9 guide RNA (gRNA)
[0274] To disable the DHDOH gene in CHO cells, the inventors first started by restoring the hamster DHODH gene sequence and then used publicly available Tefor software to design different guide RNAs (gRNAs) for transfection into the CHO genome using CRISPR-Cas9.
[0275] The software identified eight sequences that can target the DHODH gene:
[0276] Sequence 1'
[0277] GGATGCAGCCATCATCCTTGGTTTT(SEQ ID NO:24)
[0278] CAAGGATGATGGCTGCATCCCGGTG(SEQ ID NO:25)
[0279] Sequence 2'
[0280] GATGCAGCCATCATCCTTGGGTTTT(SEQ ID NO:27)
[0281] CCAAGGATGATGGCTGCATCCGGTG(SEQ ID NO:28)
[0282] Sequence 3'
[0283] GCAGCCATCATCCTTGGGGGGTTTT(SEQ ID NO:29)
[0284] CCCCCAAGGATGATGGCTGCCGGTG(SEQ ID NO:30)
[0285] Sequence 4'
[0286] GCCATCATCCTTGGGGGAGGGTTTT(SEQ ID NO:31)
[0287] CCTCCCCCAAGGATGATGGCCGGTG (SEQ ID NO:32)
[0288] Sequence 5'
[0289] GCTATTCGCTTCACGTCCCTGTTTT(SEQ ID NO:33)
[0290] AGGGACGTGAAGCGAATAGCCGGTG (SEQ ID NO:34)
[0291] Sequence 6'
[0292] GCCTCTACAAACTGGGCTTTGTTTT(SEQ ID NO:35)
[0293] AAAGCCCAGTTTGTAGAGGCCGGTG (SEQ ID NO:36)
[0294] Sequence 7'
[0295] GGCTTTGGGTTTGTCGAGGTGTTTT(SEQ ID NO:37)
[0296] ACCTCGACAAACCCAAAGCCCGGTG(SEQ ID NO:38)
[0297] Sequence 8'
[0298] GCTGGTCTGAGGAGCCTACAGTTTT(SEQ ID NO:39)
[0299] TGTAGGCTCCTCAGACCAGCCGGTG(SEQ ID NO:40)
[0300] Although eight sequences were tested and cloned, only four clones were transfected and only one successfully knocked out the DHODH gene. The following 20-nucleotide sequence, GGATGCAGCCATCATCCTTG (SEQ ID NO:5), was used as the corresponding DNA fragment for gRNA production. It targets the second exon of the DHODH gene. To obtain the transcription of the appropriate gRNA, two oligonucleotides, GGATGCAGCCATCATCCTTGGTTTT (oligo1', SEQ ID NO:24) and CAAGGATGATGGCTGCATCCCGGTG (oligo2', SEQ ID NO:25), were synthesized, annealed, and cloned at the unique BaeI site of pCM3561 (commercially available from Invitrogen).
[0301] The cloned DNA sequence is thus under the control of the U6 promoter, and after the DNA is transfected into CHO cells, it is transcribed into a single transcription unit containing crRNA fused with tracrRNA. The crRNA portion is specific to the second exon of the DHODH gene, while the tracrRNA is recognized by the Cas9 enzyme itself.
[0302] B- Preparation of materials for CRISPR-Cas9 gene editing
[0303] As disclosed in Example 1, CHO9E4 cells were isolated from CHO K-1 cells purchased from ATCC and selected, and were grown and maintained in suspension culture in a serum-free CDCHO medium supplemented with 6 mM L-glutamine, optimized for the growth of Chinese hamster ovary (CHO) cells, at 37°C in an incubator with 8% CO2 and 80% humidity.
[0304] 10 μg of sgRNA expression vector (pCM3561) was digested with 1 μL BaeI enzyme at 25°C for 1 hour with a supplement of 5 units / μl containing 20 μM S-adenosylmethionine (SAM). The digested plasmid was then separated by electrophoresis using a 1% agarose gel. The resulting sgRNA cloning vector was then recovered using a gel extraction kit (Qiagen Kit).
[0305] The sgRNA cloning vector and the annealed guide oligonucleotide were ligated using T4 DNA ligase (Biolabs) and incubated at room temperature for 10 min.
[0306] 5 μL of the ligation product was added to 50 μL of E. coli DH5α competent cells (Invitrogen).
[0307] Cells and DNA were incubated on ice for 30 min, followed by heat shock at 42 °C for 45 s. After adding 500 mL of SOC medium, the cells were incubated at 37 °C (800 rpm) for 1 h to allow the bacteria time to produce antibiotic resistance proteins encoded on the plasmid backbone. After incubation, each tube was spread onto an LB dish supplemented with 100 μg / mL ampicillin. The culture dishes were incubated overnight at 37 °C. A negative control (using water instead of the inserted DNA) was used to evaluate the success of transformation.
[0308] For the amplification step, two colonies were selected for each construction and inoculated into 2 mL LB medium supplemented with 100 μg / mL ampicillin in a tube, and incubated overnight (37°C, 700 rpm). The overnight culture was harvested by centrifugation. The QIAprep Miniprep Kit was used.TM The amplified DNA was recovered by QIAGEN (eluted in EB buffer). The sequence of the target guide oligonucleotide was then examined by Sanger sequencing (sense and antisense sequencing, GATC Company). After alignment verification on Vector NTI software (Thermofisher Scientific), the corresponding colonies were inoculated into 200 mL LB medium supplemented with 100 μg / mL ampicillin. After incubation for 24 hours, bacteria were harvested by centrifugation at 6000g for 15 min at 4°C. The EndoFree Plasmid Maxi Kit was used. TM (QIAGEN) MaxiPrep was prepared. DNA was precipitated by adding room temperature isopropanol. After centrifugation for 1 h (4 °C, 8000 rpm), the DNA precipitate was washed with endotoxin-free room temperature 70% ethanol. After a brief fresh centrifugation, the precipitate was air-dried for 1 h and redissolved in an appropriate volume of endotoxin-free sterile water to achieve a DNA concentration of 5 mg / mL. The DNA concentration was measured using a nanodrop device.
[0309] Four different plasmids were prepared: pBH6840 plasmid (KO DHODH SEQ1), pBH6841 plasmid (KO DHODH SEQ4), pBH6842 plasmid (KO DHODH SEQ5), and pBH6843 plasmid (KO DHODH SEQ7).
[0310] DNA sequencing was performed by GATC subcontractor (Eurofins Genomics Company).
[0311] C-CRISPR-Cas9 gene editing
[0312] Transfection was performed via electroporation using MaxCyte STX and its CHO-defined protocols. These were performed in an OC-100 processing unit (20 million cells per transfection).
[0313] The day before transfection, the cells were loaded with 1.5 × 10⁻⁶ cells. 6 10 cells / mL were seeded in CDCHO medium supplemented with 6 mM L-glutamine.
[0314] On the day of transfection, the cells were numbered using a ViCell device (Beckman & Coulter). The required number of cells were centrifuged at 250g for 10 minutes, and the supernatant was discarded.
[0315] For each transfection condition, 20×10 6Centrifuge the cells at 250g for 10 min. Resuspend the pellet in 70 μL Maxcyte buffer. Add 30 μg DNA and transfer the mixture (cells, buffer, and DNA) to a 100 μL Maxcyte electroporation cartridge. The processing unit used is the OC-100, which is specific to the 100 μL cartridge, and the optimized program for CHO is selected.
[0316] Perform the following transfection.
[0317] T1 pBH6840 KO DHODH SEQ1 T2 pBH6841 KO DHODH SEQ4 T3 pBH6842 KO DHODH SEQ5 T4 pBH6843 KO DHODH SEQ7 T5 W / O ADN H2O
[0318] After electroporation, the cells were transferred to 25 mL working conical flasks. They were placed in a static incubator at 37°C and 5% CO2 for 45 min. Then, 25 mL of CDCHO medium supplemented with 6 mM L-glutamine was added to resuspend the cells, and the conical flasks were placed in a shaker at 37°C, 5% CO2, 70% humidity, and 110 rpm.
[0319] The day after electroporation, single cells were seeded from each well of the CHO9E4 transfection pool using limiting dilution. After approximately 20 days, once the cells reached about 90% confluence and appeared healthy under a microscope, the cells were aliquoted into two new 96-well plates, one with and one without uridine.
[0320] Several clones were selected based on their sensitivity to uridine deficiency. These clones were adapted for growth in CDCHO medium supplemented with 6 mM glutamine and 5 mM uridine.
[0321] To confirm the success of the gene editing, the Qiagen DNeasy kit was used. TM (Qiagen) extracted genomic DNA from CRISPR-Cas9 cloned cells. The target locus was amplified by PCR using appropriate primers for the DHODH locus region targeted by CRISPR-Cas9, and the PCR products were sequenced by NGS using PCR fragments covering the potentially deleted regions.
[0322] Example 4 Recombinant proteins were produced using DHODH-deficient CHO cell lines.
[0323] Antibody production was tested on empirically validated DHODH-deficient CHO clones obtained in Example 2 or 3 to verify whether these clones could express antibodies in the absence of teriflunomide.
[0324] Designed vectors at a concentration of 5 mg / mL were generated and prepared. Except for plasmid pBH6209, which encodes a transposase, all of them possess an ITR, which allows the plasmid to be integrated into the genome of the production cell using a transposon system.
[0325] The cell lines used were wild-type CHO 9E4_SP11 and KO2 and KO19 with DHODH knocked out.
[0326] CHO 9E4_SP11 was cultured in CDCHO medium supplemented with 6 mM L-glutamine.
[0327] KO2 and KO19 were cultured in CDCHO medium supplemented with 6 mM L-glutamine and 5 mM uridine.
[0328] They were initially cultured in 25 mL working conical flasks and expanded until the desired number of live cells was reached.
[0329] Different proteins were produced using an efficient electroporation protocol developed by Maxcyte on the Maxcyte STX device.
[0330] The cells were loaded with 1.5 × 10⁻⁶ cells per day before transfection. 6 Repackaging.
[0331] On the day of transfection, cells were co-transfected with two vectors: a DNA plasmid expression vector containing a human anti-CD38 heavy chain (HC) and light chain (LC) expression cassette and a DHODH selection marker (as described in WO 2016 / 062837), flanked by a PiggyBac recognition site (inverted terminal repeat, ITR); and a transposase vector from Transposagen that catalyzes the migration of transposons to the TTAA site in the CHO genome.
[0332] For each transfection condition, 80×10 6 Centrifuge the cells at 250g for 10 min. Resuspend the pellet in 250 μL Maxcyte buffer. Add 120 μg DNA and transfer the mixture (cells, buffer, and DNA) to a 400 μL Maxcyte electroporation cartridge. The processing unit used is the OC-400, which is specific to the 400 μL cartridge, and the optimized program for CHO is selected.
[0333] For the recovery period, transfected cells were immediately transferred to 125 mL flasks at 37°C for 40 min without stirring. 25 mL of preheated CDCHO medium supplemented with 6 mM glutamine (+5 mM uridine for KO cells) was added, and the transfected culture was maintained at 37°C in an incubator with 8% CO2 and 80% humidity. On day 1 post-transfection, cells were centrifuged and divided into 1×10⁻⁶ cells. 6Cells / mL were resuspended in CD OPTiCHO supplemented with 6 mM glutamine, 30% FeedB (Gibco), and varying amounts of teriflunomide (0, 5, 15, and 25 μM). TM Selective medium (Gibco)
[0334] On day 14 post-transfection, cells were centrifuged at 200g for 10 min at 25°C. The supernatant was filtered through a 0.22 μm PES filter, and antibody titers were measured using an Octet apparatus.
[0335] As shown in Figure 3, the two clones (KO2 and KO19) exhibited good yields in the absence of teriflunomide, and genomic NGS showed that both clones contained knockout mutations at two alleles of the DHODH locus.
[0336] Notably, all KO clones produced antibodies even in the absence of teriflunomide as a selector. Two clones, KO2 and KO19, were selected for further investigation. Furthermore, these cited clones are the only ones demonstrating homozygous knockout of the DHODH gene.
[0337] Therefore, this embodiment demonstrates that the present invention provides a set of cell lines and vectors that allow for the generation of antibodies without the use of any selection pressure.
[0338] Example 5 Evaluation of three human DHODH variants
[0339] To verify whether using the impaired form of human DHODH enhanced the copy number integrated into the CHO genome, thus allowing for better productivity, DHODH KO2, KO19, and WT CHO 9E4 cell lines were transfected with three human DHODH cDNA variants described in patients with Miller syndrome (R135C, G202A, and R346W, see Fang et al. (2012) Biosci. 32:631-639). As a control vector, plasmids carrying cDNA encoding human WT DHODH were transfected.
[0340] 50 ng of the plasmid vector (pBH6204) encoding the human anti-CD38 monoclonal antibody mAb-A, digested with SalI-BglII restriction enzyme, was mixed with 37.5 ng of SalI-BglII-purified DNA fragments corresponding to each variant (R135C, G202A, and R346W). After adding 1 μL of T4-DNA ligase (BioLabs) and concentrated ligation buffer, the ligation reaction (final volume 10 μL) was carried out at room temperature for 10 min.
[0341] Then, the aliquots from this DNA pool were used to transform *E. coli* competent cells (Stellar). TM (Takala).
[0342] As recommended by the manufacturer, use the commercially available Qiagen Plasmid Mini-Preparation Kit (Qiagen) for small-scale plasmid preparation.
[0343] DNA sequencing using 603 sense (sequence GTTGGCCTTCCAATGGCTT, SEQ ID NO:41) and 503 antisense (sequence GTTCCTTCACAAAGAT, SEQ ID NO:42) oligonucleotides was performed by a GATC subcontractor (Eurofins Genomics Company).
[0344] DHODH variant transfection was performed via electroporation using MaxCyte STX. As mentioned above, this was done in the OC-100 processing unit.
[0345] One day after transfection, the cells were centrifuged and discharged at 1×10⁻⁶. 6 9E4 CHO cells were resuspended at 1 / mL in CD CHO selective medium supplemented with 6 mM glutamine and 25 μM teriflunomide for 9E4 CHO cells, but not for KO2 and KO19 clones.
[0346] After two generations, at 0.3 × 10 6 mAb-A production began in CD OPTiCHO medium containing 30% FeedB, 6mM glutamine, and 25μM teriflunomide for 9E4 CHO cells and no teriflunomide for KO2 and KO19 clones.
[0347] On day 14 post-transfection, cells were centrifuged at 200g for 10 min at 25°C. The supernatant was filtered through a 0.22 μm PES filter, and antibody titers were measured using an Octet apparatus.
[0348] As shown in Figure 4, no significant effects were observed between the R138C and R346W DHODH mutations on the WT CHO 9E4 and DHODH KO clones. On the other hand, the G202A mutation allowed for gram-scale antibody production using the WT CHO 9E4 line and improved the productivity of the DHODH KO2 and KO19 clones.
[0349] Example 6 Proteins are produced using the expression system of the present invention.
[0350] Using the expression system of the present invention, particularly using human DHODH cDNA (which contains the G202A mutation disclosed above on the empirically validated clones CHO 9E4 KO2 and KO19 disclosed in Example 3 above) to produce different types of proteins, it was demonstrated that the final productivity was at least in the same range as that of prior art expression systems using human glutamine synthase (GS) as a selectable marker.
[0351] The following proteins were produced:
[0352] - Lipase :
[0353] Using monocistronic cDNA PLBL2-His and
[0354] ο Use either the hDHODH G202A or hGS plasmid as optional markers.
[0355] - Monoclonal antibody (mAb-B) :
[0356] Using bicistronic cDNA encoding the VH and VL chains of the antibody and
[0357] ο Use either the hDHODH G202A plasmid or the hGS plasmid as optional markers;
[0358] - Bispecific antibodies :
[0359] ο Using (i) a bicistronic cDNA encoding the VH and VL chains of the antibody or (ii) two monocistronic cDNAs encoding the VH and VL chains of the antibody, respectively, and
[0360] ο Use optional markers (i) hDHODH G202A plasmid (for bicistronic cDNA) or (ii) two hDHODH G202A plasmids or hDHODH G202A plasmid and hGS plasmid (for monocistronic cDNA).
[0361] - Trispecific antibodies :
[0362] Using two bicistronic cDNAs and
[0363] ο Use optional markers hDHODH G202A plasmid and hGS plasmid.
[0364] exist One day before transfection, cells were placed in CD CHO medium supplemented with 6 mM glutamine and 5 mM uridine at a concentration of 1.5 × 10⁻⁶. 6 Cells / mL dilution
[0365] On the day of transfection, the cell suspension was placed in CD CHO supplemented with 6 mM L-glutamine and 5 mM uridine at a concentration of 1.1 × 10⁻⁶. 6 Cells / ml dilution. Vortex the reagent for 5 seconds and then slow down the rotation, adding 25 μL / tube to a 50 mL empty tube. In a second 50 mL tube, dilute 12.5 μg of cDNA in CD CHO medium, then pour the diluted DNA into the purified medium all at once. In the reagent. Immediately homogenize the solution and incubate for 10 minutes. The DNA transfection mixture was poured onto the cells, and the culture was incubated at 37°C, 190 rpm, and 8% CO2.
[0366] Using Invitrogen TM Countess TM The device was used to count cells 24 hours after transfection. The entire cell culture was centrifuged at 200g for 10 min. The pellet was resuspended in 2.5 mL of preheated production medium under the conditions disclosed below.
[0367] In the case of complex proteins containing 3 or more subunits, a second transfection is performed using the transfection protocol described above.
[0368] -For lipase monocistronic vectors (proteins with a His tag)
[0369]
[0370]
[0371] MSX: L-methionine sulfoxide imine; Gln: glutamine; Uri: uridine; TNF: teriflunomide
[0372] -For monoclonal antibody mAb-B bicistronic VH and VL vectors:
[0373]
[0374] MSX: L-methionine sulfoxide imine; Gln: glutamine; Uri: uridine; TNF: teriflunomide; FeedB: commercial feed
[0375] -For bispecific antibodies with bicistronic or two monocistronic VH and VL vectors:
[0376]
[0377]
[0378] MSX: L-methionine sulfoxide imine; Gln: glutamine; Uri: uridine; TNF: teriflunomide; FeedB: commercial feed
[0379] -For trispecific antibody bicistronic VH and VL vectors:
[0380]
[0381] MSX: L-methionine sulfoxide imine; Gln: glutamine; Uri: uridine; TNF: teriflunomide; FeedB: commercial feed
[0382] 72 hours after transfection, use Invitrogen TM Countess TM The device counts cells and increases protein production by changing to a different culture medium. Furthermore, cell viability is measured at 3 and 7 days post-transfection.
[0383] On day 14 post-transfection, cells were centrifuged at 200g for 10 min at 25°C. The supernatant was filtered through a 0.22 μm PES filter, and protein titers were measured using an Octet apparatus.
[0384] The following results were obtained.
[0385] a) Lipase
[0386]
[0387] The lipase production on day 14 is shown in Figure 5.
[0388] These results indicate that both KO DHODH cell lines have the ability to produce lipase in the absence of teriflunomide selective pressure, which reduces toxicity to producing cells.
[0389] Furthermore, the KO DHODH cell line is able to produce the same range of lipases as the existing GS system (in wild-type 9E4CHO cells), namely 1 g / L on a 25 ml scale.
[0390] b) Monoclonal antibody mAb-B
[0391]
[0392]
[0393] Figure 6 shows the yield of monoclonal antibody mAb-B on day 14.
[0394] These results indicate that the KO DHODH cell lines exhibit different characteristics in the production of this specific antibody. In fact, even though both clones have better productivity than existing teriflunomide production techniques, the KO19 clone shows significantly higher productivity than the KO2 clone.
[0395] In the optimal KO cell line (KO19), antibody yield was in the same range as that of the existing GS system (in wild-type 9E4 CHO cells), at a scale of approximately 0.67 g / L on a 25 ml scale.
[0396] In addition, increased viability was observed using the KO cell line.
[0397] c) Bispecific antibodies
[0398]
[0399] Figure 7 shows the bispecific antibody yield on day 14.
[0400] In all tested scenarios, the production efficiency of bispecific antibodies was lower than that of monospecific antibodies. However, despite the difficulties in producing such bispecific antibodies, the productivity of the optimal KO cell line was in the same range as that of the existing GS system (in wild-type 9E4CHO cells), at approximately 0.145 g / L on a 25 ml scale.
[0401] In addition, increased viability was observed using the KO cell line.
[0402] d) Trispecific antibodies
[0403]
[0404] The trispecific antibody yield on day 14 is shown in Figure 8.
[0405] Under all conditions, both KO cell lines yielded results in the same range as those of the prior art selection system, namely a significant 0.5 g / L.
[0406] Therefore, this embodiment demonstrates that the KO DHODH CHO clone is suitable for expressing various protein forms (proteins, monoclonal antibodies, bispecific antibodies, trispecific antibodies). These clones can even be used for double transfection to produce complex proteins. sequence list <110> Sanofi <120> Novel cell lines containing selection markers and their use in protein production <130> BET 18P4548 <150> EP19305331.1 <151> 2019-03-19 <160> 45 <170> PatentIn 3.5 version <210> 1 <211> 1188 <212> DNA <213> Syrian hamster (Cricetus cricetus) <400> 1 atggcttggc ggcagatgcg gaagagagcc ctggacgccg ctatcatcct gggaggcgga 60 ggcctgctgt tcacctctta cctgacagcc accggcgacg accacttcta cgccgagtac 120 ctgatgcctg ccctgcagag actgctggac cctgagtctg cccaccggct ggccatcaga 180 ttcacctccc tgggcctgct gcccagagcc accttccagg actccgacat gctggaagtg 240 cgggtgctgg gccacaagtt cagaaacccc gtgggaatcg ccgctggctt cgacaagcac 300 ggcgaggctg tggacggcct gtacaagctg ggcttcggct tcgtggaagt gggctccgtg 360 acaccccagc cccaggaagg caaccccaga cctagagtgt tccggctgcc tgaggaccag 420 gccgtgatca acagatacgg cttcaactcc cacggcctgt ccgtggtgga acaccggctg 480 agagccagac agcagaagca gaacaagctg accgccgacg gcctgcccct gggcatcaat 540 ctgggcaaga acaagacctc cgaggacgct gccgccgact acgtggaagg cgtgcgagtg 600 ctgggacctc tggccgatta cctggtcgtg aacgtgtcct cccccaacac cgctggcctg 660 agaagcctgc agggaaaggc cgagctgaga aggctgctgg ccaaggtgct gcaggaacgg 720 gacgctctga agggcgccca gaaacctgcc gtgctcgtga agatcgcccc tgacctgacc 780 gcccaggaca aagaggatat cgcctccgtg gccagagagc tgggcatcga cggactgatc 840 gtgaccaaca ccaccgtgtc tcggcctacc ggactgcagg gcgctctgag atctgagatg 900 ggcggcctgt ctggcaagcc tctgagggac ctgtccaccc agaccatcag agagatgtac 960 accctgaccc agggccggat ccccatcatt ggagtgggcg gagtgtcctc tggccaggac 1020 gccctggaaa agatccaggc tggcgcctct ctggtgcagc tgtataccgc cctgaccttt 1080 ctgggccctc ccgtggtggt gcgagtgaag agagaactgg aagccctgct gaaagagcgg 1140 ggcttcaaca ccgtgaccga ggccatcggc gctgaccaca gaagatga 1188 <210> 2 <211> 395 <212> PRT <213> Syrian Hamster (Cricetus cricetus) <400> 2 Met Ala Trp Arg Gln Met Arg Lys Arg Ala Leu Asp Ala Ala Ile Ile 1 5 10 15 Leu Gly Gly Gly Gly Leu Leu Phe Thr Ser Tyr Leu Thr Ala Thr Gly 20 25 30 Asp Asp His Phe Tyr Ala Glu Tyr Leu Met Pro Ala Leu Gln Arg Leu 35 40 45 Leu Asp Pro Glu Ser Ala His Arg Leu Ala Ile Arg Phe Thr Ser Leu 50 55 60 Gly Leu Leu Pro Arg Ala Thr Phe Gln Asp Ser Asp Met Leu Glu Val 65 70 75 80 Arg Val Leu Gly His Lys Phe Arg Asn Pro Val Gly Ile Ala Ala Gly 85 90 95 Phe Asp Lys His Gly Glu Ala Val Asp Gly Leu Tyr Lys Leu Gly Phe 100 105 110 Gly Phe Val Glu Val Gly Ser Val Thr Pro Gln Pro Gln Glu Gly Asn 115 120 125 Pro Arg Pro Arg Val Phe Arg Leu Pro Glu Asp Gln Ala Val Ile Asn 130 135 140 Arg Tyr Gly Phe Asn Ser His Gly Leu Ser Val Val Glu His Arg Leu 145 150 155 160 Arg Ala Arg Gln Gln Lys Gln Asn Lys Leu Thr Ala Asp Gly Leu Pro 165 170 175 Leu Gly Ile Asn Leu Gly Lys Asn Lys Thr Ser Glu Asp Ala Ala Ala 180 185 190 Asp Tyr Val Glu Gly Val Arg Val Leu Gly Pro Leu Ala Asp Tyr Leu 195 200 205 Val Val Asn Val Ser Ser Pro Asn Thr Ala Gly Leu Arg Ser Leu Gln 210 215 220 Gly Lys Ala Glu Leu Arg Arg Leu Leu Ala Lys Val Leu Gln Glu Arg 225 230 235 240 Asp Ala Leu Lys Gly Ala Gln Lys Pro Ala Val Leu Val Lys Ile Ala 245 250 255 Pro Asp Leu Thr Ala Gln Asp Lys Glu Asp Ile Ala Ser Val Ala Arg 260 265 270 Glu Leu Gly Ile Asp Gly Leu Ile Val Thr Asn Thr Thr Val Ser Arg 275 280 285 Pro Thr Gly Leu Gln Gly Ala Leu Arg Ser Glu Met Gly Gly Leu Ser 290 295 300 Gly Lys Pro Leu Arg Asp Leu Ser Thr Gln Thr Ile Arg Glu Met Tyr 305 310 315 320 Thr Leu Thr Gln Gly Arg Ile Pro Ile Ile Gly Val Gly Gly Val Ser 325 330 335 Ser Gly Gln Asp Ala Leu Glu Lys Ile Gln Ala Gly Ala Ser Leu Val 340 345 350 Gln Leu Tyr Thr Ala Leu Thr Phe Leu Gly Pro Pro Val Val Val Arg 355 360 365 Val Lys Arg Glu Leu Glu Ala Leu Leu Lys Glu Arg Gly Phe Asn Thr 370 375 380 Val Thr Glu Ala Ile Gly Ala Asp His Arg Arg 385 390 395 <210> 3 <211> 1188 <212> DNA <213> Homo sapiens <400> 3 atggcttggc ggcacctgaa gaagagggcc caggacgccg tgatcatcct gggaggcgga 60 ggcctgctgt tcgcctctta cctgatggct accggcgacg agcggttcta cgccgagcat 120 ctgatgccca cactgcaggg cctgctggac cctgagtctg cccatagact ggccgtgcgg 180 ttcacctccc tgggactgct gcctagagcc cggttccagg actccgacat gctggaagtg 240 cgggtgctgg gccacaagtt cagaaacccc gtgggaatcg ccgctggctt cgacaagcac 300 ggcgaggctg tggacggcct gtacaagatg ggcttcggct tcgtggaaat cggctccgtg 360 acccccaagc cccaggaagg caaccccaga cctcgggtgt tcagactgcc tgaggaccag 420 gctgtgatca acagatacgg cttcaactcc cacggcctgt ccgtggtgga acaccggctg 480 agagccagac aggaagca ggccaagctg accgaggatg gcctgcctct gggagtgaac 540 ctgggcaaga acaagacctc cgtggacgcc gccgaggatt acgctgaagg cgtgcgagtg 600 ctgggacccc tggctgatta cctggtcgtg aacgtgtcct cccccaacac cgctggcctg 660 agatctctgc agggcaaggc cgagctgcgg agactgctga caaaggtgct gcaggaacgc 720 gacggcctgc ggagagtgca tagacctgcc gtgctcgtga agatcgcccc cgacctgacc 780 agccaggaca aagaggatat cgcctccgtc gtgaaagagc tgggcatcga cggactgatc 840 gtgaccaaca ccaccgtgtc taggcctgcc ggactgcagg gggctctgag atctgaaacc 900 ggcggactgt ccggcaagcc tctgagggat ctgtccaccc agaccatcag agagatgtac 960 gcctgaccc agggccggggt gccaatcatt gggtgggcg gagtgtcctc cggccaggat 1020 gccctggaaa agatcagagc cggcgcttcc ctggtgcagc tgtacaccgc tctgaccttt 1080 tggggccctc ccgtcgtggg gaagtgaag agagagctgg aagccctgct gaagagcag 1140 ggatttggcg gcgtgaccga tgccatcggc gctgaccaca gaagatga 1188 <210> 4 <211> 395 <212> PRT <213> Homo sapiens <400> 4 Met Ala Trp Arg His Leu Lys Lys Arg Ala Gln Asp Ala Val Ile Ile 1 5 10 15 Leu Gly Gly Gly Gly Leu Leu Phe On Tyr Leu Met Thr Gly 20 25 30 Asp Glu Arg Phe Tyr Ala Glu His Met Pro Thr Leu Gln Gly Leu 35 40 45 Leu Asp Pro Glu Ser Ala His Arg Leu Ala Val Arg Phe Thr Ser Leu 50 55 60 Gly Leu Leu Pro Arg Ala Arg Phe Gln Asp Ser Asp Met Leu Glu Val 65 70 75 80 Arg Val Leu Gly His Lys Phe Arg Asn Pro Val Gly Ile Ala Ala Gly 85 90 95 Phe Asp Lys His Gly Glu Ala Val Asp Gly Leu Tyr Lys Met Gly Phe 100 105 110 Gly Phe Val Glu Ile Gly Ser Val Thr Pro Lys Pro Gln Glu Gly Asn 115 120 125 Pro Arg Pro Arg Val Phe Arg Leu Pro Glu Asp Gln Ala Val Ile Asn 130 135 140 Arg Tyr Gly Phe Asn Ser His Gly Leu Ser Val Val Glu His Arg Leu 145 150 155 160 Arg Ala Arg Gln Gln Lys Gln Ala Lys Leu Thr Glu Asp Gly Leu Pro 165 170 175 Leu Gly Val Asn Leu Gly Lys Asn Lys Thr Ser Val Asp Ala Ala Glu 180 185 190 Asp Tyr Ala Glu Gly Val Arg Val Leu Gly Pro Leu Ala Asp Tyr Leu 195 200 205 Val Val Asn Val Ser Ser Pro Asn Thr Ala Gly Leu Arg Ser Leu Gln 210 215 220 Gly Lys Ala Glu Leu Arg Arg Leu Leu Thr Lys Val Leu Gln Glu Arg 225 230 235 240 Asp Gly Leu Arg Arg Val His Arg Pro Ala Val Leu Val Lys Ile Ala 245 250 255 Pro Asp Leu Thr Ser Gln Asp Lys Glu Asp Ile Ala Ser Val Val Lys 260 265 270 Glu Leu Gly Ile Asp Gly Leu Ile Val Thr Asn Thr Thr Val Ser Arg 275 280 285 Pro Ala Gly Leu Gln Gly Ala Leu Arg Ser Glu Thr Gly Gly Leu Ser 290 295 300 Gly Lys Pro Leu Arg Asp Leu Ser Thr Gln Thr Ile Arg Glu Met Tyr 305 310 315 320 Ala Leu Thr Gln Gly Arg Val Pro Ile Ile Gly Val Gly Gly Val Ser 325 330 335 Ser Gly Gln Asp Ala Leu Glu Lys Ile Arg Ala Gly Ala Ser Leu Val 340 345 350 Gln Leu Tyr Thr Ala Leu Thr Phe Trp Gly Pro Pro Val Val Gly Lys 355 360 365 Val Lys Arg Glu Leu Glu Ala Leu Leu Lys Glu Gln Gly Phe Gly Gly 370 375 380 Val Thr Asp Ala Ile Gly Ala Asp His Arg Arg 385 390 395 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> The corresponding DNA fragment used to generate gRNA <400> 5 ggatgcagcc atcatccttg 20 <210> 6 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 1) <400> 6 caccgggatg cagccatcat ccttg 25 <210> 7 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 1) <400> 7 aaaaccaagg atgatggctg catcc 25 <210> 8 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 2) <400> 8 caccggatgc agccatcatc cttgg 25 <210> 9 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 2) <400> 9 aaaacccaag gatgatggct gcatc 25 <210> 10 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 3) <400> 10 caccggcagc catcatcctt ggggg 25 <210> 11 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 3) <400> 11 aaaacccccc aaggatgatg gctgc 25 <210> 12 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 4) <400> 12 caccggccat catccttggg ggagg 25 <210> 13 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 4) <400> 13 aaaaccctcc cccaaggatg atggc 25 <210> 14 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 5) <400> 14 caccggctat tcgcttcacg tccct 25 <210> 15 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 5) <400> 15 aaaacaggga cgtgaagcga atagc 25 <210> 16 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 6) <400> 16 caccggcctc tacaaactgg gcttt 25 <210> 17 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 6) <400> 17 aaaacaaagc ccagtttgta gaggc 25 <210> 18 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 7) <400> 18 caccgggctt tgggtttgtc gaggt 25 <210> 19 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 7) <400> 19 aaaacacctc gacaaaccca aagcc 25 <210> 20 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 8) <400> 20 caccggctgg tctgaggagc ctaca 25 <210> twenty one <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used to obtain gRNA (Sequence 8) <400> twenty one aaaactgtag gctcctcaga ccagc 25 <210> twenty two <211> 14437 <212> DNA <213> Gray hamster (Cricetulus griseus) <220> <221> Unclassified features <222> (1992) (2015) <223> plasmids pBH6840 KO DHODH SEQ1 and pBH6841 KO DHODH Target of SEQ4 <220> <221> Unclassified features <222> (2129)...(2147) <223> The target of plasmid pBH6842 KO DHODH SEQ5 <220> <221> Unclassified features <222> (4015)...(4047) <223> Target of plasmid pBH6843 KO DHODH SEQ7 <400> 22 ccgagcccac attctccaat ggagtggagg cagaggcggg cccagtggca gaaggagcat 60 ggcgtggaga cagatgagag tgagtctgtt gcgggtgctt acgcttgttc ggaaaacagg 120 ttgggagtgg acgaggctgg gagattgaaa ggctggggcc cttgcagtgt gggctgcatg 180 tgtgctcagc taggggcatg caaaaagcaa gcgtgctggg cagaggctga gttgattgtg 240 agagatcgcg ggcttttttt tttttttttt tcttaaactg agctagtatc gggcccctgt 300 gagcacatgg tggctagcat tatggaaagg atccagggcg gaatgaaata agacacgcag 36" ccacccttcc agataaagtg tggttagaat gggagtcccg tgcgaagagt ccgtagattg 420 tgtccctggc ttgggaaaga gtgcgcagat attgtttctt gacacgtgag aatttctccc 480 tccagaggag ggagaatgaa tacttggttt gctgtacagg caaatctgat cacatcctct 540 acttccttat ttagtggaca aatcccatta aaaatataat cactgattgt ggtgaggggt 600 tgtgctgtga catgggagct ggaaccgaac tctgcactta accactgaac catctccagc 660 ccccaaatct gtattttggc tgacaccccc acatttctcc taccttactt taagaaatgc 720 tttcctttta gttccaaaca gacctgtctt cctctacccc attctctggc ccttctcatt 780 ggcttcagcc acctagagat tccttctcca gctgcttcct cctctttagc ttttgtgtct 840 ccttggaaag tcaaccttag cctggagagga gcctcaagat ccttccatta cttatctctt 900 cgtgtcagtt ttcttgggtt tgtgtttaca tggccattaa tttctctctt cattagatag 960 attacacact tctgaaggac agggacctgg tgtggtttgc ttgcctttgg tgaaggattg 1020 aatgaatgca ttagccactt ggcatctggc agtgataatt atcaaaaagc attgtgagcc 1080 tcctttgaac tagggtagtg attctctacc cagagtgtga agctatgttt gtattacaac 1140 cacttttata ttatacacat aggacatttc aggccagtaa cttttctagg tataatttta 1200 aaatatagac accatgtcct aactacagta taaaggagaa atgaaaacat gtatttcagt 1260 1320 gaaggtgtgc gttggtatac aaacagcact gtataccctt tctggtgggg ttttaggaac 1380 agtgaccaag tcttagtaat gttttgtgca aactgtacaa ttgtccttaa attacaagt 1440 atctttattt ctgtaaagt caccctgtac atgtaaacca tgtggttgtg tggtgaacta 1500 tagcttgctt cttgccctc cttattacct cagatatag gaagttttcc tcacataaat 1560 agcaatagca agttcaaca tcatacagta catagggaaa ctagtgtgtt agctttaatt 1620 aaagaagaat attgacagga ctgatttctc cacaccaaat gtattagcat cattccctca 1680 ttaactagta aaatttcc catgtgaccc ctaggggca gtactgcctg tcttgaaat 1740 tccctgcctg gtccttagga aaatattcag ggctagaacc catgtaagca gtgtaggtac 1800 tgcatctacc ttgtagatg tgtaagtggg caggatatga aggggacag tgtgagcagg 1860 gaaggactgt cacttgtgt agttgttg tcctctggggc aggtgtgaag ggtcaggaag 1920 ggtactgcag gctggtctga tggggttccc catggggcct tttctcccc ccactagaag 1980 cgggccctgg atgcagccat catccttggg ggaggaggac ttcttcac ctcttacctg 2040 acagccacgg gcgatgacca tttctgct gatatctga tgccggccct gcagaggctg 2100 ctagacccag aatcagccca ccggctagct attcgcttca cgtccctggg gctccttcct 2160 cgagctacat ttcaggactc tgacatgctg gtaggtcccc cggtcaccct gtgttacatt 2220 tgtgtttgta ggggaggtca catccttcag cacttcggta ttcctctgct gccactgggc 2280 ttttgaaaac cagagctgca ggttcacaag cagctgggac ctggagccca gcccgaggaa 2340 gggacttttc ttctgtgtta caccctgtac ttacagaaca gcactcagca tatagccggt 2400 gcttacagct ttaatcctca cagataccct ttgagggagg tcctatctca tctccatcta 2460 caaatcagga aactgaggta cagactaagt aagtgacttg cccaaggtca cacagctggg 2520 aggtggcagg accaggattc aaacctatag agtttgactc cagtgtccaa ccttggtcac 2580 tggcctgcct tgctgagatc cctctgctga acaggaacat cttctggagt cattaagcag 2640 ctactggatg caggggacag ggtcagcagg gaagggctgt cacttgtaga tactgtgtcc 2700 tctgtctgga taggtgtgaa gtctcagagt gggtgctgca gcctggcctg atgggtccgt 2760 cctttccccc catcagaagc agaccctggc tgtagtcatc accctgaggg gtggaggact 2820 taagtcctag gcaacctcct gccccagcca cattcagcca caactcactc ctgtggccca 2880 cctggcacca tttataacag agccagtgtg gcccttctac tgtctctctg aatgctcccc 2940 ttttgagatg ggcctaggtt gtccaggttg gtctcaaact tggggtccca aatgatttca 3000 gaatctcagc ttcctgagta agtgggatca cacagtatgc accactgtgc gcagtggtcc 3060 ctgttccccg atagccaggc cggttgatac tcttagcccg attcaccttt ctcggttttc 3120 taagtcttca gttttctatc atgacgagac tctcctgggg gagggggatg gctgggtgct 3180 tctggaatgc ttggctgacc cggtctcctg attgaccggt tttaccataa tctcaaagaa 3240 gcctgacatc aacaccccag gctctgtcac acagccaggg atgagaactg gcttgagggt 3300 agcctcaagg aaggcctgtt ctagctgaac ttctcgcctc atggttatga agtgctgcgt 3360 gcacattttt accttccttg tgctcattct cgtctcctgt ggattttgag agcatgtagc 3420 tttccccttg gggactggcc tctaagagct cactggcagc accattgcct gccagtgtcc 3480 acccttcagc tctccatggt gcccatgggc tggcttcttg acagttatgg aggaagggcc 3540 agctagggct tgtatgctag gctggctaca ggctacctca aggctggtga caccaaggac 3600 tccttctcct gcccaggttg agtagatagg aagatacaca gtaattgtgc aagacagcac 3660 ctgtctcctc ttcacttgtg gtgggacact atctttctct ccccactgcc ttgagacccc 3720 ctggtgacag actccagcag acatcagaag cacctgcaga atgctgatgc agatagatac 3780 cccagggtgt ccttcctccc aaagatccct attttctggg cccagtgatg cttagcaagc 3840 tccaggggaa ttcttataca gtatgctggg atccctgctg tgagaaccac ttggtatagc 3900 tgcttatacc tctgacctgt ctccttccca ggaagtgaga gtcctgggcc ataaattccg 3960 aaatccggta gggattgctg cgggatttga caagcacggg gaagctgtag atggcctcta 4020 caaactgggc tttgggtttg tcgaggtagg aagtgtgact ccccagcctc aggaaggaaa 4080 ccccagaccc agagtgttcc gcctcccgga ggaccaagct gtcattaaca ggtaggtggt 4140 ggctcaatgt catagggaca tctcctcccc tgctgggatc tctgagatgg aacctgtttt 4200 gtgcttttct catatgatca gtggacagtc tgtcctttgg gatagtcagg agcacctttg 4260 aacacctgtt gtgtactagg cagctctcgc cccaaccttg ggaaacagct gttaggattt 4320 taccaggtat tcccactgag gctctgagag ctggtgctgg ttgcaaagaa cagcttggga 4380 aggcttgggc tgttgggctt cagtgtgagc ttttttacat tgttgctcta ttgccttttgt 4440 ccaatgttgg ctaacaggaa tataatgatc tcacatgtaa tttgaaatat tctaatgatg 4500 cattaaaaac tagtgaactt gataatacat ttataattat tatatttta attattatga 4560 tttaattata aacagtgtgt tctaaagtca ttttaacctg cagtcaatgt aaaaatcatt 4620 ggttaactat cgtcctcttt ttattggttt ccggtccccc aatgccttta cttctggttc 4680 ctctcacttg gccagggctg gtggccacaa gcttcagcag cgttggtact gtacaggtga 4740 cccttgcttt caatgaacag ggacatggta ttcaaatgta cagctgctct taggaggaga 4800 atccttcgac tgtatgaagc cttgcggttt gttgttctgt atagttagta taactgcaaa 4860 gggaagacct tcgtactttt tgctaggaga ttttggaga acctccttgt ggggattttg 4920 gcaggcctgt ggcagtgctt cctactgctt gtttcaggaa actgatttac aagtcataga 4980 tctttctgtt acattacagg caggactga tgtctttagg actggccaga caaaatactt gtgtttctga tttggctgtt acaagtgact tcgggtctta ggatgatggt acttgggaca gggagtggtg agggacaggc acctgtgctc ttgggcatgt gcgaacttag ccttcttgct 5160 catatacaca gtgtgtgttc to grow tgctaacgga tgggtattta cacctgcaga 5220 cccacatgcc acaatccatg cagtgttgct ctggctgcaa gcaacaaagt gatgtaacca gatctcattt gttatcattc ttgtcactag cacaaaataa ctgacagcag gcagcttaag gaatggggtc aggtattttg gctcacagtt tgaggggaca cgccctcccg gtggcaggag 5400 cctgaggcag agggtcactc tgtacctaca gtgaggagc agcaaggga ggatgctggt gcttgggtct ctttctccgt cttgctcagc tggggtgtga atccatggtg ctgcccatgt5520 ttgcggtggg tcttccctgc tccattcaac cttcccagaa acagtcttcc agacacacaa caggtgtgtt tccatggtga ctctaagtca catctagttg acaatgaagc ataaccagtg gtgagagcat ggaaatggtc tcaggtacgt tttccaaact gccacctttt aattccaccc cttacctgtg ggtttatgtg ctccaggtac ggattcaaca gccacgggct ctcagtggtg 5760 gaacacaggc tacgggccag acagcagaag cagaacaagc tcactgcagg taaactcagg 5820 tgttgtggga gggacttact aactctatta caaagaaaca tggggagggc atgggattca 5880 gcaataagaa acaaatgagc aaacaattaa aaccccacag aacaactcag gggattgtcc 5940 agcttctacc acagcctcaa aggtctcaac cagatggcat aattcagcaa aaccttgctg 6000 gtctctggca tccatggaac ctgaattgtg tcttaactta ggggcttgaa gatcagcaga 6060 gagcatgtgt ggagctaaga tgcgccccga gttcatcttc ccacatcccg ccctgctgct 6120 gtccttctgt tcactgtgta aatagtgtgt attagttctg gaagagctac agaagagaat 6180 agagttgtca cactcctgtc cttccactca ggggaccagc tgtcctcaaa tctcacttcg 6240 gaaacaacct ttgcttttgg tggattctca tggagacgct ccagtttgtc ctctgtggtc 6300 tgcatggctc tctgaagtgc attttggggt caaagccctg ggtggtggcc cccctcccca 6360 tgtctccctg tgtggcttct gcagtccatg gagatttttc tcctttgcct ctggaatgtc 6420 tttcaggagg tcttagtctc atttgatgtc cccatagtgt gacaattaag ccaaggactt 6480 ctgcatttat ttgaggagct aggagagaga gggctgaagc atttgacgag tttagagggt 6540 gggaacagga aatgacaatg tttaaaaaaa cccctggttt tgacggaacc gggtctgcca 6600 gccctgtaga accttgaaca caatgtttgt ggtttgtggc gttctcctgc ctcctgcctt 6660 ccgtttcttc gtttaatgc cttctgtggg ctaggtttat tgccattgtc ctgtgtccac 6720 ccttcatcct cattctgtgc cctcacagtc actggagtga ggccaagttc tgtgtctttg 6780 ccctgcctac atgtgtctgc tgacagctag cagcctcata gaaacttttc atcagcacca 6840 tgcctaggaa ccctagtgga tagaagagac tgtgctttgt gtaaagtgta gttcagcctt 6900 cctgactcca gaactgtgac tgtgggcagg tgaccactaa tgaaaggctc agttgcctct 6960 tggaagccat actctcaatc cagtttactt gtgctaaagc ttacagtgat cctggcttgc 7020 tgggtgctag acttgaagct ttgagacctt gttctgtata tagtctaatc cctggctcca 7080 cccagcccac ttaggaaatt agttacacaa atcttacttt taagttgatg acccagaaga 7140 tgacgggttg tgagagatgg actgtgagaa gggggctagc aatacagtgg gggatgttgc 7200 ccgtgtcctc cctggcctgg tatgggtgag ctgacttggt gttctaggtc tggctggatt 7260 ggcagatgga cagcagcctg ggccactgac atactaggag ttgtaagaaa gttgagttgt 7320 aataaagatg aatccaggaa actcctttct gccaaagaga acatgagtct gaaagagcat 7380 ttttctagag gcttggcctt ttgagagtga cagggggcag gtgtgagtaa ttacacccag 7440 gccccaggag tgtcttgagg ctacagagat gtatcatcac cctaattata agttcttttc 7500 tcagagaaca agaaagattt attacacact tccatctact ttttaggcat gatagttgaa 7560 aacatttcct agtgttttcc tgtgtagctc aggctggcct cagacttaca gcaatcctcc 7620 tgcagactaa atttccatgt gtggcctcca gtgttttata cttttgtttt taatcatttc 7680 acatacagtc ccttgaccaa ggctcatgag attcaggttg ttcttgctga catgcccatc 7740 aatacctgcc tactctctct tttgttatct ctcaaaccac tgatctgtga atatagcaag 7800 tgtcattggg agtcatttta ttgctacata cttcaagaag agcagtagta tttgtttttt 7860 tccccatgtc cctgatttgt ctggactcag atccttggcc acccatgcag tcagtgttgg 7920 ggatgggttc catctcatgg attgggcctt aaatacaatc agattctggt tggttactcc 7980 cgcagctttg tgctactgtt tcactagtgc atccagggca ggtcatcatt gtagatcaaa 8040 agatgtgtag cggggttggt gtttaccttt ctcctttggt aacatgcaga atacctccca 8100 gtaccatgga caccaccaga gggatgaagg ctgtaggtag gcaccagctc gacttctccc 8160 tatttaataa cttgtgtagg tgttgtcttt agcaatagag ccttgtcagt tttcagagag 8220 caaccaatat ccttgacaat agcctgggtt gtttgggtat tctcatgggg cccctttggc 8280 caacaacttc tttgaaagtc tggtcaaatt cttcactaaa accatctggc actgggcatt 8340 ttttggttgg gaggctttta tgactgcttc tattttacta ggggttataa gtttgtttac 8400 attgcttatc cgatcttgat ttaactttag tagatggtat gtatcaagaa aattattcat 8460 ttattttcaa ttttccattt aggtagagta taggttttta aaacacatcc ctatgattct 8520 ttggatttcc ttggtgtctg ttgttatgtc actcttttca tctctaattt tgttaatttg 8580 gatctttcct ctttgccttt taattaattt ggctaagggt ttgtcaatct tactggtttt 8640 ctcaaagaac caactcttcg tttcattgat tctttgcatt atttttgtct gtttctattt 8700 cattgatttc agccctgagt ttgattattt cctgccatct actcctcctg ggtgtgactt 8760 cttgttgttc tagagctttc aggtgtgcta gtatgaaatc tctctaattt atgtaggcac 8820 ttagtgctac ataaagtttt gggttttgt tttgttttga cctatttttc attcagtagt 8880 gagttgttca gtttcagttg ttcagtttcc atgagtttgt aagctttctg ttgtttttgt 8940 aggtgttgat attcagcttt aatctgtggt ggtatgatag ggtattattt cagttttctt 9000 gtatcttttg agacttgctt tatggcctag tatatggtca gttttggaga aagttccatg 9060 aggtgctgag aagaaacgtt ttgtgtttgg gtgaaatgtt ctataaatta ggtccatttg 9120 gttaacaca tcatttagct ccatcatttc tttgttcagt ttttgtctgg atgacctgtc 9180 tattgtcgag agttggggag tatcaaagta tcccactatg tgtgtgtgtg tgcggagggg 9240 tcaatatgtg atttaagcta tagtagtt tcttttatga acttggatgc cttgtgctt 9300 ggtgcataga tgtttagaat ttcaatatcc tcttggtggg tttttccttt gatgagtatg 9360 tagtttcctt ccctatctat ctcttgatta gatttgattt gaaatctatt ctgtcatata 9420 ttaaaatggc ttcacccatt tgctttcttg tccatttgct tggaatatct ttttccatcc 9480 ttttactctg aggtgatatc tatccttgat gttaaagtat gtttcttgga ttcagttaaa 9540 gaatgaatcc tatttttgaa cccaattttt tagtctgtgt cttatttatt gggaaattga 9600 ggccactgat atcagtgttt gttgattcct gttatattat tgttatggcg taggcccctt 9660 cccttttgat ttgctggtct gagattattt attcaggctg aagttttcct tgtagtacct 9720 tctatcaagc tggatttgta gacagaaacc acttaagttt cattttattg tagattgtca 9780 ttctttcttc atctctgtga ttaaatgttt tgctggctat agtagtctgg gctggcatct 9840 gtggtagaat gtctgcccag gacctttgac ttttagagtc tcgattgaag tcaggggtta 9900 ttctaatagg tttgtctgcc gttatatgtt atctggtctt tctctattgt ggcttttggt 9960 attctttctt tgttctgtac attctgtttt ttgattatta tgtgttgtgg ggaatttatt 10020 tttggcccag tccgtttggt gttctatttg tttcttatac catgataggc acttccttct 10080 ttaggttagg taacttttca tctgtgattt tgttgaaaat attttctgtg cctttgacct 10140 gggtttcttc tccttttgct atccctgtta cttatagatt tttggtgttt tcatagtatc 10200 ctagatttcc tggatgtttt gtgcctggat tttgttttct ttcttttttt gtagatttaa 10260 cattttcttt gactgcagta tccttgtctc ctatcttgtc ctcagtgctt gagactctgt 10320 cttccatttc ttgtatgatt ttggtgaggc ttgcttctaa gatttctgtt ctagttccta 10380 aatttttcat ttccagcttt acctcaattt gggttttctt tagcaattcc atttcctctt 10440 tcatgtgttg aacaattttc ttcatttcat tgcactgttt gtgttttcat taatgggttt 10500 attcatatct tctttaggga ccttgaacat attcataata gctattctga gagccttgtc 10560 ttatgcttcc ctgtattgca tttctcggag cctgctgtgg tagggttgct gggctctagt 10620 ggagacatgt cgttctggct gttactgggt ttttacactg gtgtctaggc gactgggttt 10680 gagaagattg taattctagg tgctgatatc tggtcttgtt tttgttgggg tgatgttcag 10740 ttccttggtt tctgttgccc ccccccctca gggggggtgt ggtaactgga ttggttgcct 10800 ggtagggaat gcttctgaga tcctgccaga accctgccac tggcagtctt gggtagaaag 10860 tgtttctagg tgttgggagc tgacactaat gattgaggat gggttagaag cagtggtggc 10920 gggagagtcc acaggaggag gagagctggg tgtgccacca gggtctgcac agaggcctgg 10980 gaatgagaac agagatgaag gtgaggcctc agcaggtagt ctgctacaag gttgggataa 11040 ggctgggaga ttggaacttg gggacaggag ggagagtgaa gatcgcagac ccatcccctg 11100 gccaggtggg ggaagcctgg aggagaagat ctgtgtgatc tgctggaaat gggtccctta 11160 gtaacttctt gaagtttctt tgattttgag gctgctgttg ggggtcccct gtatgccaag 11220 catgtggtat atcactgaga tagaatctcc atagccctgc ttcttttttg agactgggtc 11280 tcatatcggc caggttggcc ttgaactagc tatgttgacc ttgaactttt ccttacctat 11340 acctgagaac tgggattaca agtgcccatc acacccagct tcctattgtt tttgcttttt 11400 tcctagtatt taagcttctg gcttccccat taaaatttaa aagatgaaag gcttagtaca 11460 cgggaagcat ccttgaaggt gcacacactt gccatataga gaggatgaag tggttctaag 11520 tcatcaggca gcagccccag gatcagacag ttcacattct ccatcatctg gttcagggga 11580 gccccacctg tactctgaat gttgcctggg aaactgtggg gacacactct tgatatttac 11640 agatgggctg cctctgggaa taaacctggg gaagaataag acttcggagg atgctgctgc 11700 agactatgta gagggtgttc gtgtcctggg ccccttggct gactacctgg tggtgaatgt 11760 gtccagtccc aacactgctg gtctgaggag cctacaggga aaggctgagc tgcgccgcct 11820 gctggccaag gtgtgtcatt acaccatcac atgcctgttg tccttactcc ttttcattct 11880 tcaggtgaag attcaggaca actgaggaga aactgttctt cacagctggc ctaggagccc 11940 tcatcacaca ttttccaagt accctctcat gtctcacagc cccggtcata cacaatagac 12000 agttcactgc tttaaaacca caggcaagca gagcagagca ggcggggctc ccatgtatca 12060 ctctgtcccc agaactgtga atgctcagca cttgtgacac acctccttgt ttgttttcag 12120 gaacaaaatc aaaacccttg agcagttatc tcggcgggg gtgcgggggt gggggaattg 12180 ctggtgcttt agttgacctt aggtgaaaat gctggcctgc actgcggggc tatgggctgg 12240 gtccccatct ctggcttgtc aacctaggtg ctgcaggaga gggacgcttt gaagggagcg 12300 cagaagccag cagtgctggt gaagatcgcc cccgacctca cggcccagga caaggagcac 12360 attgccagtg tggcgagaga ggtttgagtt ggggtggtcc agggcagggt gggggtagcc 12420 ttcatcgtcc actgctgctg ggataacaca gaagggcatg attggtgact tcctctgtgt 12480 gaagtggaca gctgggttgat tgtctgtcat tgtatagttc atctggtagc aaacagtgag 12540 tttgaaaatg tgtttggtga gtcttttct tgcttctgat ctgtcttcat ccagaaagtc 12600 tgaggcctgt gctagtctct gccagtctca cctgggactt agaatggtgt ctgtcccttt 12660 ccagcttgtg taaaccag gcttctctgg ctaaaaaaggt agtaggaaca cagtctgctg 12720 12780 taagggtcaa actctgtgta ggcactgtga tgggttcagc aggagatgct gctgtgtctt 12840 cagcattgag aggctaattc tgatggcttc tccaatcaag atgtaggtga ggcctgtgag 12900 ggtcttgctc tgcagagctg gcccctggcc tggtggctgc ttcaatcctc aaaagacagt 12960 ttccttgagt acttcagatc catggcttaa ggctcttttt ctgtcttgtg ctgcagctgg 13020 gcattgatgg attaattgtc acaaacacca cagtgagtcg cccgactggc ctccaaggtg 13080 ctctgcgttc tgagatggga ggactgagcg ggaagccact ccgagatctg tcgacccaga 13140 ccatccggga gatgtacacc ctcactcaag gtaaggcttt tttgtttgtt tgtttgaggc 13200 aggatttctc tgtttaacac ctctggctgt cctggaactc acttggtaga ccaggctggc 13260 ctggaactca cagcttccct agtgctggga ttaaaggcat gtgccaccat tgcctggcta 13320 aggcaagact tctttggaca aatgtgaggt cctggatctt ccctcattca ctgtgtttgc 13380 tgagaactct ggttctgccc tcatcggctg tgtttgctgg gactgaggcc tgatggagcc 13440 ctgggtcttt agccctccct tcccggcctt gctatgtgct tctctccagg caggattccc 13500 attatcgggg ttggtggtgt gagcagtggg caagatgcgc tggagaagat ccaggcaggg 13560 gcctccctgg tgcagctgta cacggccctc accttcctgg ggccacccgt cgtggtcagg 13620 gtcaagcgtg agctggaggc acttctaaag tgagtagggt tcgatgcagc tgagacgtag 13680 aaagtgacac ttgtcatcag tctattgtgt actcccagag ggccggaggg aacactgagg 13740 gcatggtggg acgatttctc tgctgcagct ttggccaagg acaaacagtg ccagaggaat 13800 tcagaatgct tctgaggcag ggctcattac aaggcaggac ttgccacttg cccaggggct 13860 gggcatggag gatgaagtag taatttacat tgactcagtg tctggaagct gcaggttata 13920 aagtcacttc ccttcctgca cagaaggcct ggctgtacat atgtgcaggg gcctgggtga 13980 gggcagagta gcagtggttg taaggtgtgt tgggtgggac ggtgtggtaa gcggtgtgct 14040 catggtgagt gtgggcttcc ttaggacagg ctatttgttt tctgtccaga gagcggggtt 14100 ttaacacagt cacagaagcc attggagcag atcatcggag gtgacggttc ctgccagatg 14160 ccccatccag aacgtgccca ccaactcaag caagccttgt ggctgcatca taagaggaag 14220 atctgtctca agctatgtcc cttgactgtg tgacctggct ggactgcata agccagtcac 14280 ggttatcact agacagtaaa ggctttctct aatgagacca tgaactctac agtcactttc 14340 tggatctaag tcctggggatc cctcagtatt ataaggacat tggctctttg ggaggaaaaa 14400 tcatggagaa aataaagcca tttcaatctg ttttcaa 14437 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <220> <223> The corresponding DNA fragment used to generate gRNA <400> twenty three caaggatgat ggctgcatcc 20 <210> twenty four <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 1') used to obtain gRNA <400> twenty four ggatgcagcc atcatccttg gtttt 25 <210> 25 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 1') used to obtain gRNA <400> 25 caaggatgat ggctgcatcc cggtg 25 <210> 26 <211> 395 <212> PRT <213> Artificial sequence <220> <223> Amino acid sequence of human DHODH G202A <400> 26 Met Ala Trp Arg His Leu Lys Lys Arg Ala Gln Asp Ala Val Ile Ile 1 5 10 15 Leu Gly Gly Gly Gly Leu Leu Phe Ala Ser Tyr Leu Met Ala Thr Gly 20 25 30 Asp Glu Arg Phe Tyr Ala Glu His Leu Met Pro Thr Leu Gln Gly Leu 35 40 45 Leu Asp Pro Glu Ser Ala His Arg Leu Ala Val Arg Phe Thr Ser Leu 50 55 60 Gly Leu Leu Pro Arg Ala Arg Phe Gln Asp Ser Asp Met Leu Glu Val 65 70 75 80 Arg Val Leu Gly His Lys Phe Arg Asn Pro Val Gly Ile Ala Ala Gly 85 90 95 Phe Asp Lys His Gly Glu Ala Val Asp Gly Leu Tyr Lys Met Gly Phe 100 105 110 Gly Phe Val Glu Ile Gly Ser Val Thr Pro Lys Pro Gln Glu Gly Asn 115 120 125 Pro Arg Pro Arg Val Phe Arg Leu Pro Glu Asp Gln Ala Val Ile Asn 130 135 140 Arg Tyr Gly Phe Asn Ser His Gly Leu Ser Val Val Glu His Arg Leu 145 150 155 160 Arg Ala Arg Gln Gln Lys Gln Ala Lys Leu Thr Glu Asp Gly Leu Pro 165 170 175 Leu Gly Val Asn Leu Gly Lys Asn Lys Thr Ser Val Asp Ala Ala Glu 180 185 190 Asp Tyr Ala Glu Gly Val Arg Val Leu Ala Pro Leu Ala Asp Tyr Leu 195 200 205 Val Val Asn Val Ser Ser Pro Asn Thr Ala Gly Leu Arg Ser Leu Gln 210 215 220 Gly Lys Ala Glu Leu Arg Arg Leu Leu Thr Lys Val Leu Gln Glu Arg 225 230 235 240 Asp Gly Leu Arg Arg Val His Arg Pro Ala Val Leu Val Lys Ile Ala 245 250 255 Pro Asp Leu Thr Ser Gln Asp Lys Glu Asp Ile Ala Ser Val Val Lys 260 265 270 Glu Leu Gly Ile Asp Gly Leu Ile Val Thr Asn Thr Thr Val Ser Arg 275 280 285 Pro Ala Gly Leu Gln Gly Ala Leu Arg Ser Glu Thr Gly Gly Leu Ser 290 295 300 Gly Lys Pro Leu Arg Asp Leu Ser Thr Gln Thr Ile Arg Glu Met Tyr 305 310 315 320 Ala Leu Thr Gln Gly Arg Val Pro Ile Ile Gly Val Gly Gly Val Ser 325 330 335 Ser Gly Gln Asp Ala Leu Glu Lys Ile Arg Ala Gly Ala Ser Leu Val 340 345 350 Gln Leu Tyr Thr Ala Leu Thr Phe Trp Gly Pro Pro Val Val Gly Lys 355 360 365 Val Lys Arg Glu Leu Glu Ala Leu Leu Lys Glu Gln Gly Phe Gly Gly 370 375 380 Val Thr Asp Ala Ile Gly Ala Asp His Arg Arg 385 390 395 <210> 27 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 2') used to obtain gRNA <400> 27 gatgcagcca tcatccttgg gtttt 25 <210> 28 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 2') used to obtain gRNA <400> 28 ccaaggatga tggctgcatc cggtg 25 <210> 29 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 3') used to obtain gRNA <400> 29 gcagccatca tccttggggg gtttt 25 <210> 30 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 3') used to obtain gRNA <400> 30 cccccaagga tgatggctgc cggtg 25 <210> 31 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 4') used to obtain gRNA <400> 31 gccatcatcc ttgggggagg gtttt 25 <210> 32 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 4') used to obtain gRNA <400> 32 cctcccccaa ggatgatggc cggtg 25 <210> 33 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 5') used to obtain gRNA <400> 33 gctattcgct tcacgtccct gtttt 25 <210> 34 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 5') used to obtain gRNA <400> 34 agggacgtga agcgaatagc cggtg 25 <210> 35 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 6') used to obtain gRNA <400> 35 gcctctacaa actgggcttt gtttt 25 <210> 36 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 6') used to obtain gRNA <400> 36 aaagcccagtttgtagaggc cggtg 25 <210> 37 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 7') used to obtain gRNA <400> 37 ggctttgggt ttgtcgaggt gtttt 25 <210> 38 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 7') used to obtain gRNA <400> 38 acctcgacaa acccaaagcc cggtg 25 <210> 39 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 8') used to obtain gRNA <400> 39 gctggtctga ggagcctaca gtttt 25 <210> 40 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides (sequence 8') used to obtain gRNA <400> 40 tgtaggctcc tcagaccagc cggtg 25 <210> 41 <211> 19 <212> DNA <213> Artificial sequence <220> <223> 603 semantic oligonucleotides <400> 41 gttggccttc caatggctt 19 <210> 42 <211> 16 <212> DNA <213> Artificial sequence <220> <223> 503 antisense oligonucleotides <400> 42 gttccttcac aaagat 16 <210> 43 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Including target sequences and PAM sequences <400> 43 ggatgcagcc atcatccttg g 21 <210> 44 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Includes the meaningful DHODH exon 2 sequence region of CrispR sequence n°1. <400> 44 gacgaaacac cgggatgcag ccatcatcct tggttttaga 40 <210> 45 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Including the antisense DHODH exon 2 sequence region of CrispR sequence n°1 <400> 45 tctaaaacca aggatgatgg ctgcatcccg gtgtttcgtc 40
Claims
1. A Chinese hamster ovary (CHO) cell line comprising a completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene and an expression vector adapted to produce recombinant proteins, wherein the expression vector contains a sequence encoding exogenous mammalian DHODH.
2. The cell line according to claim 1, wherein the cell line is generated by: a) Inactivates the endogenous DHODH gene in cells and b) The cells are cultured in a medium containing uridine under conditions suitable for producing a cell line in which the endogenous DHODH gene is completely inactivated.
3. The cell line according to claim 2, wherein the endogenous DHODH gene is inactivated by gene editing.
4. The cell line of claim 3, wherein the endogenous DHODH gene is inactivated by a CRISPR-Cas9 method.
5. The cell line according to any one of claims 1 to 4, wherein one or more or all alleles of the endogenous DHODH gene are completely inactivated.
6. The cell line of claim 1, wherein the expression vector containing the nucleotide sequence encoding exogenous mammalian DHODH comprises at least one expression cassette for expressing the recombinant protein, wherein the exogenous DHODH comprises at least 95% identical to the sequence SEQ ID NO:2 or the sequence SEQ ID NO:4, and wherein the exogenous DHODH retains DHODH activity.
7. An expression system, the expression system comprising: (i) Chinese hamster ovary (CHO) cell lines containing a completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene and (ii) An expression vector comprising a nucleotide sequence encoding mammalian DHODH and at least one expression cassette for expressing a recombinant protein, wherein the DHODH comprises at least 95% identical to the sequence SEQ ID NO:2 or the sequence SEQ ID NO:4, and the exogenous DHODH retains DHODH activity.
8. The cell line of claim 6 or the expression system of claim 7, wherein the nucleotide sequence comprises the sequence of SEQ ID NO:1 or the sequence of SEQ ID NO:
3.
9. The cell line of claim 1 or the expression system of claim 7, wherein the recombinant protein is a monoclonal antibody.
10. The cell line of claim 1 or the expression system of any one of claims 7, wherein the vector comprises a first expression cassette suitable for cloning the light chain of an antibody and a second expression cassette suitable for cloning the heavy chain of an antibody.
11. A kit comprising (i) the cell line of claim 1 or the expression system of claim 7 and (ii) a uridine-free culture medium.
12. The kit according to claim 11, wherein the uridine-free culture medium is further free of DHODH inhibitors.
13. An in vitro method for producing a recombinant protein, the in vitro method comprising the following steps: A)a1) Provide a cell line according to any one of claims 1-6 and 8-10; or a2) Provide a Chinese hamster ovary (CHO) cell line containing a completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene and a2') Introduce the expression vector as defined in any one of claims 8 to 10 into the cell line provided in step a2); or a3) Provide a Chinese hamster ovary (CHO) cell line containing the endogenous DHODH gene, a3') Completely inactivate the endogenous DHODH gene in the cell line provided in step a3) and a3”) introduces the expression vector as defined in any one of claims 8 to 10 into a cell line containing a completely inactivated endogenous DHODH gene obtained in step a3’); B) Culture the cell line under conditions suitable for producing the recombinant protein; and C) Isolate and / or purify the recombinant protein.
14. The method of claim 13, wherein step B) is carried out in a uridine-free culture medium.
15. The method of claim 14, wherein step B) is carried out in a culture medium free of uridine and DHODH inhibitors.
16. The method according to any one of claims 13-15, the method further comprising step D) formulating the recombinant protein into a pharmaceutical composition.
17. Use of the cell line of claim 1, the expression system of claim 8, or the kit of claim 11 or 12 for the production of recombinant proteins.
18. The use according to claim 17, wherein the cell line, the expression system, or the kit is used in combination with a uridine-free culture medium.
19. The use according to claim 18, wherein the cell line, the expression system, or the kit is used in combination with a culture medium that is free of uridine and DHODH inhibitors.
Citation Information
Patent Citations
Expression vector containing human glutamine synthase gene and process for prepairing erythropoietin from animal cell line efficiently
KR100267720B1
Recombinant DNA expression vectors
WO1989001036A1
Novel selection marker for cell transfection and protein production
WO2016062837A1
Novel selection marker for cell transfection and protein production
CN107109435A
Compounds and methods useful for treating or preventing hematological cancers
CN108472280A