Catalase-binding nucleic acid aptamers and their applications

By using nucleic acid aptamers with specific sequences to replace sodium azide as a catalase inhibitor and combining them with nucleic acid aptamers of calcium dobesilate, the safety and accuracy issues in creatinine detection were solved, and efficient and safe creatinine detection was achieved.

CN113817742BActive Publication Date: 2025-09-26HUBEI QINGKE BIOTECHNOLOGY CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202110969990.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-08-23
Publication Date
2025-09-26
Estimated Expiration
2041-08-23

AI Technical Summary

Technical Problem

In existing creatinine detection methods, the use of sodium azide as a catalase inhibitor poses safety issues. At the same time, interfering substances such as calcium dobesilate have a significant impact on the test results, resulting in insufficient detection accuracy and safety.

Method used

A sequence-specific aptamer was used to replace sodium azide as a catalase inhibitor, and a calcium dobesilate-bound aptamer was used to reduce the influence of interfering substances for the detection of creatinine by the sarcosine oxidase method.

Benefits of technology

It improves the accuracy and safety of creatinine testing, reduces the impact of interfering substances such as calcium p-hydroxybenzenesulfonate, and ensures the reliability and non-toxicity of test results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003225313930000091
    Figure BDA0003225313930000091
  • Figure BDA0003225313930000101
    Figure BDA0003225313930000101
  • Figure BDA0003225313930000111
    Figure BDA0003225313930000111
Patent Text Reader

Abstract

The present invention discloses a catalase-binding nucleic acid aptamer, selected from any one or more of the nucleic acid aptamers represented by SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3. The present invention also discloses a creatinine detection kit comprising the catalase-binding nucleic acid aptamer. The present invention also discloses a method for detecting creatinine for non-diagnostic purposes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of clinical testing, and in particular to a nucleic acid aptamer combined with catalase and its application. Background Art

[0002] Aptamer is a structured oligonucleotide sequence (DNA or RNA) obtained by in vitro screening technology - systematic evolution of ligands by exponential enrichment (SELEX). It has specific recognition ability and high affinity for the corresponding target molecules (proteins, viruses, bacteria, cells, drugs, etc.).

[0003] Creatinine, with the chemical formula C4H7N3O, is the end product of creatine metabolism in the human body and is primarily excreted through glomerular filtration. Serum creatinine is an effective indicator for evaluating glomerular filtration function and is commonly used clinically to monitor renal function and indicate dialysis treatment for patients with renal failure. The main clinical methods for creatinine detection are the picric acid method and the sarcosine oxidase method. The picric acid method has been gradually eliminated due to its toxicity, poor anti-interference ability, and instability. The sarcosine oxidase method, however, has gradually become dominant in clinical testing due to its excellent accuracy, linearity, and stability.

[0004] The sarcosine oxidase method for creatinine determination is currently the most widely used clinical creatinine detection method. Its principle is as follows: ① In the first step, sarcosine oxidase and creatine hydroxylase convert endogenous creatine into a substance that is resistant to creatinase catalysis. The generated H2O2 is decomposed by catalase, thereby eliminating the interference of endogenous creatinine. ② In the second step, creatinase converts creatinine in the sample into creatine. Creatinine is catalyzed by sarcosine oxidase and creatine hydroxylase to produce H2O2. Simultaneously, a catalase inhibitor (usually 0.1% sodium azide) is added to the reagent in this second step. This prevents the generated H2O2 from being decomposed, allowing it to be quantified using the Trinder's reaction, thereby indirectly determining the creatinine concentration in the sample. However, sodium azide is highly toxic and poses safety concerns, which makes the test inconvenient. Summary of the Invention

[0005] Based on this, it is necessary to provide a nucleic acid aptamer that binds to catalase and its application to address the problem of selecting a catalase inhibitor when determining creatinine by the sarcosine oxidase method.

[0006] A nucleic acid aptamer that binds to catalase is selected from any one or more nucleic acid aptamers with sequences shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6.

[0007] A creatinine detection kit comprises the nucleic acid aptamer combined with catalase.

[0008] In one embodiment, the kit includes an R1 reagent for converting endogenous creatine, wherein the R1 reagent includes catalase.

[0009] In one embodiment, the kit further comprises an R2 reagent for converting creatinine, wherein the R2 reagent comprises the catalase-binding nucleic acid aptamer according to claim 1; preferably, the concentration of the catalase-binding nucleic acid aptamer in the R2 reagent is 1 nmol / L to 100 nmol / L, preferably 5 nmol / L to 20 nmol / L.

[0010] In one embodiment, the kit further includes an anti-calcium dobesilate interference reagent. Preferably, the anti-calcium dobesilate interference reagent is selected from any one or more of the nucleic acid aptamers binding to calcium dobesilate with sequences shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3; more preferably, the anti-calcium dobesilate interference reagent is present alone in the R1 reagent or the R2 reagent, or is present in both the R1 reagent and the R2 reagent.

[0011] In one embodiment, the concentration of the nucleic acid aptamer binding to calcium dobesilate in the R1 reagent or the R2 reagent is 1 nmol / L to 100 nmol / L, preferably 5 nmol / L to 20 nmol / L.

[0012] In one embodiment, the kit includes R1 reagent and R2 reagent, wherein the R1 reagent includes sarcosine oxidase, creatine succinyl hydrolase, a nucleic acid aptamer binding to calcium dobesilate selected from the sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the catalase, and the R2 reagent includes creatininase, 4-AA, peroxidase and the nucleic acid aptamer binding to catalase as described in claim 1.

[0013] In one embodiment, the kit includes R1 reagent and R2 reagent, the R1 reagent includes sarcosine oxidase, creatine succinyl hydrolase and the catalase, and the R2 reagent includes creatinine, 4-AA, peroxidase and the catalase-binding nucleic acid aptamer according to claim 1 and a nucleic acid aptamer binding to calcium dobesilate selected from the sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0014] In one embodiment, the kit includes R1 reagent and R2 reagent, the R1 reagent includes sarcosine oxidase, creatine succinyl hydrolase, a nucleic acid aptamer binding to calcium dobesilate selected from the sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the catalase and the catalase, and the R2 reagent includes creatininase, 4-AA, peroxidase and the nucleic acid aptamer binding to catalase as claimed in claim 1 and a nucleic acid aptamer binding to calcium dobesilate selected from the sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0015] In one embodiment, each component of the R1 and R2 reagents can be present in the form of separate packages or in the form of a mixed reagent.

[0016] In one embodiment, the kit further comprises any one or more of a preservative, a surfactant, a nuclease inhibitor, and ascorbate oxidase.

[0017] A method for detecting creatinine for non-diagnostic purposes, comprising the following steps:

[0018] a. reacting a reagent containing sarcosine oxidase, creatine succinyl hydrolase, and catalase with a test sample to convert endogenous creatine in the test sample into a substance that cannot be catalyzed by creatinase, and decomposing the generated H2O2;

[0019] b. reacting a reagent containing creatinase and a catalase inhibitor with the test sample mixture obtained in step a, wherein the catalase inhibitor is selected from any one or more catalase-binding nucleic acid aptamers having a sequence as shown in SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6;

[0020] c. Quantitatively detect the H2O2 obtained in step b.

[0021] In one embodiment, the method further comprises: adding one or more nucleic acid aptamers binding to calcium dobesilate selected from the sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 to the reactants in step a and / or step b.

[0022] The inventors screened out three RNA sequences with excellent affinity for catalase: GGUCAAACCACACUUUGCCCCGCCCGCCGAUAC (SEQ ID NO. 4); GUGUGUCCCAAGGGGGGGGGACCCCAACACACU (SEQ ID NO. 5); and GUUUAUAUCGCGCGACAAAGACCCG (SEQ ID NO. 6).

[0023] The inventors also discovered that any one, any two, or three of the three sequences mentioned above can be used for the sarcosine oxidase method to detect creatinine. The catalase-binding aptamer was used in the detection reagent. The test results showed that the aptamer exhibited a strong inhibitory effect on catalase activity and could perfectly replace sodium azide, thereby improving the accuracy and safety of creatinine detection. DETAILED DESCRIPTION

[0024] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0026] Except as shown in the operating examples or otherwise indicated, all numbers used in the specification and claims to express the amounts of ingredients, physicochemical properties, etc. are understood to be adjusted by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters listed in the above specification and the appended claims are approximate values, and those skilled in the art can appropriately change these approximate values ​​by utilizing the teachings disclosed herein to seek to obtain the desired properties. The use of numerical ranges expressed as endpoints includes all numbers within the range and any range within the range, for example, 1 to 5 includes 1, 1.1, 1.3, 1.5, 2, 2.75, 3, 3.80, 4 and 5, etc.

[0027] An embodiment of the present invention provides a nucleic acid aptamer that binds to catalase, which is selected from any one or more nucleic acid aptamers with sequences shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6.

[0028] The inventors screened out three RNA sequences with excellent affinity for catalase: GGUCAAACCACACUUUGCCCCGCCCGCCGAUAC (SEQ ID NO. 4); GUGUGUCCCAAGGGGGGGGGACCCCAACACACU (SEQ ID NO. 5); and GUUUAUAUCGCGCGACAAAGACCCG (SEQ ID NO. 6).

[0029] The inventors also discovered that any one, any two, or three of the three sequences mentioned above can be used for the sarcosine oxidase method to detect creatinine. The catalase-binding aptamer was used in the detection reagent. The test results showed that the aptamer exhibited a strong inhibitory effect on catalase activity and could perfectly replace sodium azide, thereby improving the accuracy and safety of creatinine detection.

[0030] An embodiment of the present invention further provides a creatinine detection kit, comprising any one or more catalase-binding nucleic acid aptamers selected from the sequences shown in SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6.

[0031] In some embodiments, the kit includes sarcosine oxidase, creatine succinyl hydrolase, catalase, and creatinase.

[0032] Calcium dobesilate is a microvascular protective agent widely used in the treatment of diabetic retinopathy. It exists unchanged in the human body and is excreted through the kidneys and intestines. The in vivo concentration and variability of calcium dobesilate tablets are as follows: In healthy men, after oral administration of 500 mg of the drug, peak plasma concentrations reach approximately 13 μg / mL approximately 4 hours later. It is widely distributed in tissues, with a plasma protein binding rate of 20-25%, but it cannot cross the blood-brain barrier. Calcium dobesilate tablets are primarily excreted unchanged in the urine, with approximately 50% excreted in the urine within 24 hours after oral administration, of which only 10% is metabolites. Peak plasma concentrations reach 65 μg / mL 5 minutes after intravenous administration of 500 mg of the drug. Approximately 75% is excreted in the urine within 24 hours after intravenous injection. Its pharmacokinetic profile conforms to a two-compartment model, with a β-phase elimination half-life of 4.1 hours. In recent years, a growing number of clinical studies have found that calcium dobesilate significantly interferes with creatinine detection using sarcosine oxidase-based creatinine assays. While some researchers have investigated the mechanism by which calcium dobesilate interferes with creatinine detection using sarcosine oxidase-based creatinine assays, the precise mechanism of this interference remains unclear due to its complexity.

[0033] In some embodiments, the kit further comprises any one or more nucleic acid aptamers that bind to calcium dobesilate and have sequences shown in SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.3.

[0034] The inventors screened out three RNA sequences with excellent affinity for calcium p-dobesilate: AGCUUUUUGACCCAGAGAGUGAAAACC (SEQ ID NO. 1), UUGCAAAAACCUGUGUGUGUGUUUUCC (SEQ ID NO. 2), and UUUUGGUGUGUACACACCCCCAAACUGUGUGU (SEQ ID NO. 3).

[0035] The inventors also discovered that any one, any two, or three of the three sequences described above can be used for the sarcosine oxidase method to detect creatinine. The use of the calcium dobesilate-binding nucleic acid aptamer in a detection reagent demonstrated unexpectedly good resistance to calcium dobesilate interference, including excellent resistance to calcium dobesilate concentrations of up to 70 μg / ml in the test sample, thereby improving the accuracy of creatinine detection.

[0036] The nucleic acid aptamer binding to calcium dobesilate can be used not only in the sarcosine oxidase method creatinine detection kit, but also in other kits in which calcium dobesilate significantly interferes with detection, such as NEFA, UA, etc., which are also within the scope of protection of the present invention.

[0037] In some embodiments, the kit also includes a hydrogen peroxide detection reagent. Hydrogen peroxide detection can be performed using the Trinder reaction, also known as a "coupled endpoint colorimetric method." The principle is that hydrogen peroxide (H2O2) produced by the analyte through enzymatic action generates a red quinoneimine compound in the presence of 4-aminoantipyrine (4-AA) and peroxidase (POD). The hydrogen peroxide detection reagent can include 4-AA and peroxidase (POD).

[0038] In some embodiments, the kit further comprises a nuclease inhibitor. The nuclease inhibitor is used to degrade the aptamer. The nuclease inhibitor can be selected from DECP.

[0039] In some embodiments, the kit further comprises ascorbic acid oxidase to avoid the influence of ascorbic acid on hydrogen peroxide detection.

[0040] In some embodiments, the kit further comprises a preservative, which may be neomycin sulfate and / or polymyxin B.

[0041] Each reagent in the kit can be packaged separately or divided into at least two parts and mixed and packaged according to the detection principle of creatinine.

[0042] An embodiment of the present invention further provides a creatinine detection kit using the sarcosine oxidase method, wherein the kit comprises an R1 reagent for converting endogenous creatine, and the R1 reagent comprises catalase.

[0043] In some embodiments, the kit further comprises an R2 reagent for converting creatinine, wherein the R2 reagent comprises the nucleic acid aptamer that binds to catalase.

[0044] In some embodiments, the kit includes an anti-calcium dobesilate interference reagent. Preferably, the anti-calcium dobesilate interference reagent is selected from any one or more of the nucleic acid aptamers binding to calcium dobesilate of the sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the anti-calcium dobesilate interference reagent is present alone in the R1 reagent or the R2 reagent, or is present in both the R1 reagent and the R2 reagent.

[0045] In some embodiments, the concentration of the calcium dobesilate-binding nucleic acid aptamer in the R1 reagent or the R2 reagent is 1 nmol / L to 100 nmol / L, specifically 1 nmol / L, 5 nmol / L, 10 nmol / L, 20 nmol / L, 30 nmol / L, 40 nmol / L, 50 nmol / L, 60 nmol / L, 70 nmol / L, 80 nmol / L, 90 nmol / L, or 100 nmol / L, preferably 5 nmol / L to 20 nmol / L.

[0046] In a specific embodiment, the kit includes R1 reagent and R2 reagent, the R1 reagent includes sarcosine oxidase, creatine succinyl hydrolase, a nucleic acid aptamer binding to calcium dobesilate selected from the sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the catalase, and the R2 reagent includes creatinine, 4-AA, peroxidase and any one or more nucleic acid aptamers binding to catalase selected from the sequence shown in SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6.

[0047] In a specific embodiment, the kit includes R1 reagent and R2 reagent, the R1 reagent includes sarcosine oxidase, creatine succinyl hydrolase and the catalase, and the R2 reagent includes creatinine, 4-AA, peroxidase and a nucleic acid aptamer binding to catalase selected from any one or more of the sequences shown in SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6 and a nucleic acid aptamer binding to calcium dobesilate selected from any one of the sequences shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0048] In a specific embodiment, the kit includes R1 reagent and R2 reagent, the R1 reagent includes sarcosine oxidase, creatine succinyl hydrolase, a nucleic acid aptamer binding to calcium dobesilate selected from the sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the catalase and the catalase, and the R2 reagent includes creatininase, 4-AA, peroxidase and any one or more nucleic acid aptamers binding to catalase selected from the sequence shown in SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6 and a nucleic acid aptamer binding to calcium dobesilate selected from the sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0049] In some embodiments, the kit further comprises any one or more of a preservative, a surfactant, a nuclease inhibitor, and ascorbate oxidase, which are present in the R1 reagent or the R2 reagent alone, or in both the R1 reagent and the R2 reagent.

[0050] In some embodiments, the concentration of sarcosine oxidase in the R1 reagent is 5 KU / L to 400 KU / L. Specifically, the concentration of sarcosine oxidase in the R1 reagent is 5 KU / L, 10 KU / L, 50 KU / L, 100 KU / L, 150 KU / L, 200 KU / L, 250 KU / L, 300 KU / L, 350 KU / L, or 400 KU / L. Preferably, the concentration of sarcosine oxidase in the R1 reagent is 10 KU / L to 30 KU / L, specifically 10 KU / L, 15 KU / L, 20 KU / L, 25 KU / L, or 30 KU / L.

[0051] In some embodiments, the concentration of the creatine succinyl hydrolase in the R1 reagent is 5 KU / L to 400 KU / L. Specifically, the concentration of the creatine succinyl hydrolase in the R1 reagent is 5 KU / L, 10 KU / L, 50 KU / L, 100 KU / L, 150 KU / L, 200 KU / L, 250 KU / L, 300 KU / L, 350 KU / L, or 400 KU / L. Preferably, the concentration of the creatine succinyl hydrolase in the R1 reagent is 10 KU / L to 30 KU / L, specifically 10 KU / L, 15 KU / L, 20 KU / L, 25 KU / L, or 30 KU / L.

[0052] In some embodiments, the concentration of catalase in the R1 reagent is 100 KU / L to 800 KU / L.

[0053] In some embodiments, the R1 reagent includes HPEPS buffer, and its concentration can be 10 mmol / L to 500 mmol / L, for example, 10 mmol / L, 50 mmol / L, 100 mmol / L, 150 mmol / L, 200 mmol / L, 250 mmol / L, 300 mmol / L, 350 mmol / L, 400 mmol / L, 450 mmol / L, 500 mmol / L, preferably 50 mmol / L to 100 mmol / L.

[0054] In some embodiments, the R1 reagent includes Trinder's reagent, which can be specifically selected from TOOS. Its concentration in the R1 reagent can be 0.1 mmol / L to 20 mmol / L, preferably 1 mmol / L to 5 mmol / L.

[0055] In some embodiments, the R1 reagent includes a surfactant. The concentration of the surfactant in the R1 reagent can be 0.01 g / L to 10 g / L, preferably 0.1 g / L to 2 g / L. The surfactant can be a bile salt, preferably sodium cholate.

[0056] In some embodiments, the concentration of the catalase-binding aptamer in the R2 reagent is 1 nmol / L to 100 nmol / L, specifically 1 nmol / L, 5 nmol / L, 10 nmol / L, 20 nmol / L, 30 nmol / L, 40 nmol / L, 50 nmol / L, 60 nmol / L, 70 nmol / L, 80 nmol / L, 90 nmol / L, or 100 nmol / L, preferably 5 nmol / L to 20 nmol / L.

[0057] In some embodiments, the concentration of the creatininase in the R2 reagent is 10 KU / L to 900 KU / L.

[0058] In some embodiments, the R2 reagent includes a hydrogen peroxide detection reagent. The hydrogen peroxide detection reagent may include 4-AA and peroxidase (POD). The concentration of 4-AA in the R2 reagent may be 0.1 mmol / L to 20 mmol / L, preferably 1 mmol / L to 5 mmol / L. The concentration of peroxidase in the R2 reagent may be 1 KU / L to 200 KU / L, preferably 5 KU / L to 20 KU / L.

[0059] The present invention also provides a method for detecting creatinine for non-diagnostic purposes, comprising the following steps:

[0060] a. reacting sarcosine oxidase, creatine succinyl hydrolase and catalase with the test sample to convert endogenous creatine in the test sample into a substance that cannot be catalyzed by creatinase, and decomposing the generated H2O2;

[0061] b. reacting the test sample mixture obtained in step a with creatininase and a catalase inhibitor, wherein the catalase inhibitor is selected from any one or more catalase-binding nucleic acid aptamers having sequences as shown in SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6;

[0062] c. quantitatively detecting the H2O2 obtained in step b;

[0063] In some embodiments, the method further comprises adding one or more nucleic acid aptamers binding to calcium dobesilate selected from the sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 to the reactants in step a and / or step b.

[0064] The non-diagnostic creatinine detection method can directly adopt the creatinine detection kit using the sarcosine oxidase method of any of the above embodiments.

[0065] The following are specific examples.

[0066] 1. Kit formulation design in different embodiments

[0067] The reagents of each example were prepared using the formula shown in Table 1 (where √ indicates that the example contains the corresponding component and × indicates that it does not).

[0068] AGCUUUUUGACCCAGAGAGUGAAAACC(SEQ ID NO.1);

[0069] UUGCAAAAACCUGUGUGUGUGUUUUCC(SEQ ID NO.2);

[0070] UUUUGGUGUGUACACACCCCCAAACUGUGUGU(SEQ ID NO.3);

[0071] GGUCAAACCACACUUUGCCCCGCCCGCCGAUAC(SEQ ID NO.4);

[0072] GUGUGUCCCAAGGGGGGGGGACCCCAACACACU (SEQ ID NO. 5);

[0073] GUUUAUAUCGCGCGACAAAGACCCG (SEQ ID NO. 6).

[0074] Table 1 Reagent formulas for different examples

[0075]

[0076]

[0077] 2. Interference of nucleic acid aptamers on detection

[0078] Serum samples from 40 normal subjects were collected to ensure that the samples had no obvious hemolysis, turbidity, or icterus.

[0079] On a Hitachi 7180, 12 test channels were set up according to the parameters in Table 2. The first channel contained a commercially available reagent, and the remaining channels contained the reagents described in Examples 1-11. After the reagents were placed, all 12 channels were calibrated using the Landox composite calibrator. After calibration, testing was performed using the Landox composite quality control product. Subsequent operations were performed only when the creatinine test results were within control.

[0080] Table 2 Kit analysis method and test parameters

[0081]

[0082] The 40 samples collected were detected simultaneously using the above 12 channels, and the results (in μmol / L) are shown in Table 3.

[0083] R in Table 3 2 , a, and b are the fitting curve parameters of the test results of the embodiment and the test results of the commercial reagent, R 2is the square of the correlation coefficient, and the fitting equation can be written as y=aX+b. Obviously, compared with the commercial reagent, the detection reagent of Example 1 does not add any nucleic acid aptamer that binds to catalase, and the catalase remains active during the entire detection process, resulting in a seriously low detection result. However, the R2 detection reagent of Example 2-11 has an improvement in the detection result relative to that of Example 1 by adding any nucleic acid aptamer that binds to catalase, indicating that the nucleic acid aptamer selected by the present invention has a good inhibitory effect on catalase. Moreover, compared with the detection results of the commercial reagent, Example 2-11 has a good correlation with the commercial detection reagent and a small relative deviation, indicating that adding the nucleic acid aptamer that binds to catalase of the present invention to the detection reagent will not have a negative effect on the original detection of the detection reagent.

[0084] Table 3 Test results of 40 samples by different embodiment kits

[0085]

[0086] 3. Repeatability verification of the kit

[0087] The repeatability of Examples 1-11 was assessed using samples No. 22 and No. 30. The results are shown in Table 4. The unit of each result data in the table is μmol / L.

[0088] Table 4 Kit repeatability verification results

[0089]

[0090] 4. Prepare the samples to be tested with different interfering substances

[0091] After the above experiment is completed, mix samples 3, 5, 22, 25, 27, and 38, shake and mix thoroughly, and label them as Mixed Sample 1. Mix samples 1, 6, 11, 19, 30, and 39, shake and mix thoroughly, and label them as Mixed Sample 2. Separately, prepare a 1000 mg / dL vitamin C solution, a 400 mg / dL bilirubin solution, a 4 g / dL hemoglobin solution, a 60 g / L chyle solution, and a 140 μg / mL calcium dobesilate solution. Prepare 12 clean 1.5 mL EP tubes and prepare the samples according to the following table:

[0092] Table 5 Preparation of mixed sample 1 and interferents

[0093] Interference Normal saline Vitamin C Bilirubin Hemoglobin Chylous calcium dobesilate Amount of interfering substances added 20 μL 20 μL 20 μL 20 μL 20 μL 20 μL Mixed sample 1 volume 380μL 380μL 380μL 380μL 380μL 380μL Sample number G1 G2 G3 G4 G5 G6 Final concentration of interfering substance / 50 mg / dL 20 mg / dL 200 mg / dL 3000 mg / dL 70 μg / ml

[0094] Table 6 Preparation of mixed sample 2 and interferents

[0095] Interference Normal saline Vitamin C Bilirubin Hemoglobin Chylous calcium dobesilate Amount of interfering substances added 20 μL 20 μL 20 μL 20 μL 20 μL 20 μL Mixed sample 2 volumes 380μL 380μL 380μL 380μL 380μL 380μL Sample number G7 G8 G9 G10 G11 G12 Final concentration of interfering substance / 50 mg / dL 20 mg / dL 200 mg / dL 3000 mg / dL 70 μg / ml

[0096] 5. Detection of samples containing interfering substances

[0097] The above samples G1-G12 were tested simultaneously using the reagents of Examples 2-11 (since the reagent of Example 1 could not inhibit the activity of catalase in the second step reaction and had obvious defects, this example was not tested when performing the anti-interference test). The test results (μmol / L) are shown in Table 7:

[0098] Table 7 Detection results of different embodiment kits for test samples containing interfering substances

[0099]

[0100]

[0101] As shown in Table 7, compared to the physiological saline interfering substance reference groups G1 and G7, the relative deviations of the creatinine concentration test results for samples G2-G6 and G8-G11 after the addition of the interfering substances vitamin C, bilirubin, hemoglobin, and chyle, respectively, were all controlled within ±10%, falling within a reasonable error range, indicating that these interfering substances had little effect on the detection of creatinine concentration. When calcium dobesilate was added as an interfering substance, the results of Example 2 showed that the detection of creatinine concentration was significantly affected when no calcium dobesilate-binding aptamer was added. The results of Examples 3-11 demonstrated that adding any calcium dobesilate-binding aptamer to the detection reagent achieved the desired anti-calcium dobesilate interference effect. Furthermore, the calcium dobesilate-binding aptamer achieved the same anti-calcium dobesilate interference effect regardless of whether it was added to the R1 or R2 reagents. When nucleic acid aptamers binding to calcium dobesilate were added, the relative deviation of the test results compared with the normal saline reference group was small, indicating that the addition of nucleic acid aptamers had no significant effect on other properties of the reagent.

[0102] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0103] The above-described embodiments merely illustrate several implementation methods of the present invention, and are intended to facilitate a specific and detailed understanding of the technical solutions of the present invention. However, they should not be construed as limiting the scope of the invention patent. It should be noted that a person skilled in the art could make several modifications and improvements without departing from the scope of the present invention, and these modifications and improvements fall within the scope of the present invention. Therefore, the scope of the present invention patent shall be determined by the appended claims, and the specification may be used to interpret the claims. Sequence Listing <110> Hubei Qingke Biotechnology Co., Ltd. Beijing Qingke Biotechnology Co., Ltd. <120> Catalase-binding nucleic acid aptamers and their applications <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 27 <212> RNA <213> Artificial Sequence <400> 1 agcuuuuuga cccagagagu gaaaacc 27 <210> 2 <211> 27 <212> RNA <213> Artificial Sequence <400> 2 uugcaaaaac cugugugugu guuuucc 27 <210> 3 <211> 32 <212> RNA <213> Artificial Sequence <400> 3 uuuuggugug uacacacccc caaacugugu 32 <210> 4 <211> 33 <212> RNA <213> Artificial Sequence <400> 4 ggucaaacca cacuuugccc cgcccgccga uac 33 <210> 5 <211> 33 <212> RNA <213> Artificial Sequence <400> 5 guguguccca agggggggggg acccaacac acu 33 <210> 6 <211> 25 <212> RNA <213> Artificial Sequence <400> 6 guuuauaucg cgcgacaaag acccg 25

Claims

1. A creatinine detection kit, characterized in that, The kit includes a nucleic acid aptamer that binds to catalase; the nucleic acid aptamer that binds to catalase is selected from any one or more nucleic acid aptamers with sequences shown in SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6; The kit further comprises an anti-calcium dobesilate interference reagent, which is selected from any one or more of the calcium dobesilate-binding nucleic acid aptamers having sequences shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.

3.

2. The creatinine detection kit according to claim 1, wherein The kit comprises an R2 reagent for converting creatinine, and the concentration of the nucleic acid aptamer combined with catalase in the R2 reagent is 1 nmol / L to 100 nmol / L.

3. The creatinine detection kit according to claim 1, wherein The kit includes an R1 reagent for converting endogenous creatine, wherein the R1 reagent includes catalase.

4. The creatinine detection kit according to claim 2, wherein The concentration of the catalase-binding nucleic acid aptamer in the R2 reagent is 5 nmol / L to 20 nmol / L.

5. The creatinine detection kit according to claim 2 or 3, characterized in that The anti-calcium dobesilate interference reagent exists in the R1 reagent or the R2 reagent alone, or exists in both the R1 reagent and the R2 reagent.

6. The creatinine detection kit according to claim 5, characterized in that The concentration of the nucleic acid aptamer binding to calcium dobesilate in the R1 reagent or the R2 reagent is 1 nmol / L to 100 nmol / L.

7. The creatinine detection kit according to claim 6, characterized in that The concentration of the nucleic acid aptamer binding to calcium dobesilate in the R1 reagent or the R2 reagent is 5 nmol / L to 20 nmol / L.

8. The creatinine detection kit according to claim 5, characterized in that The R1 reagent includes sarcosine oxidase, creatine succinyl hydrolase, a nucleic acid aptamer binding to calcium dobesilate selected from any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the catalase; the R2 reagent includes creatinine, 4-AA, peroxidase, and the nucleic acid aptamer binding to catalase; Alternatively, the R1 reagent comprises sarcosine oxidase, creatine acyl hydrolase and the catalase, and the R2 reagent comprises creatinine, 4-AA, peroxidase and the catalase-binding nucleic acid aptamer and a nucleic acid aptamer binding to calcium dobesilate selected from the sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3; Alternatively, the R1 reagent includes sarcosine oxidase, creatine succinyl hydrolase, a nucleic acid aptamer that binds to calcium dobesilate and has a sequence selected from any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the catalase; the R2 reagent includes creatininase, 4-AA, peroxidase, the nucleic acid aptamer that binds to catalase, and a nucleic acid aptamer that binds to calcium dobesilate and has a sequence selected from any one of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.

3.

9. The creatinine detection kit according to any one of claims 1 to 4, 6 to 8, characterized in that The kit further comprises any one or more of a preservative, a surfactant, a nuclease inhibitor and ascorbic acid oxidase.

10. A method for detecting creatinine for non-diagnostic purposes, characterized in that: The following steps are involved: a. reacting a reagent containing sarcosine oxidase, creatine succinyl hydrolase, and catalase with a test sample to convert endogenous creatine in the test sample into a substance that cannot be catalyzed by creatinase, and decomposing the generated H2O2; b. reacting a reagent containing creatinase and a catalase inhibitor with the test sample mixture obtained in step a, wherein the catalase inhibitor is selected from any one or more catalase-binding nucleic acid aptamers having a sequence as shown in SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6; c. quantitatively detecting the H2O2 obtained in step b by Tinder reaction; The method further comprises: adding one or more nucleic acid aptamers binding to calcium dobesilate selected from the sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 to the reactants in step a and / or step b.

Citation Information

Patent Citations

  • Two-step enzyme measuring method and measuring reagent for creatinine in blood serum

    CN102721684A

  • Composition for eliminating interference of calcium dobesilate medicine on creatininase-method detection

    CN108627654A