Parthenogenetic genes

Abstract

The present invention provides the nucleotide and amino acid sequences of parthenogenesis genes in the genus Taraxacum and their (functional) homologues, fragments and variants thereof, which provide parthenogenesis as part of apomixis. Also provided are parthenogenetic plants and methods for preparing them, as well as molecular markers and methods for using them.

Description

Field of the Invention

[0001] The present invention relates to the field of biotechnology, in particular to plant biotechnology including plant breeding. The present invention particularly relates to the identification and use of genes relevant and useful, for example, for apomixis and haploid induction. The present invention particularly relates to genes associated with parthenogenesis, and the encoded proteins, and fragments thereof. The present invention also relates to methods for inhibiting and / or inducing parthenogenesis in plants and crops, the use of genes and / or proteins or fragments thereof for apomixis (particularly in combination with apomixis genes), or for the production of haploid plants in which chromosomes can be doubled to produce doubled haploids. Background Art

[0002] Apomixis (also known as agamospermy) is asexual plant reproduction through seeds. Apomixis has been reported in approximately 400 species of flowering plants (Bicknell and Koltunow, 2004). Apomixis in flowering plants occurs in two forms:

[0003] (1) Gametophytic apomixis, in which embryos are produced by parthenogenesis from unreduced, unfertilized egg cells;

[0004] (2) Sporophytic apomixis, in which the embryo is produced somatically from the sporophytic cells.

[0005] Examples of gametophytic apomixis are Taraxacum sp., Hieracium sp., Poa pratensis, and Tripsacum dactyloides. Examples of sporophytic apomixis are Citrus sp. and Garcinia mangostana. Gametophytic apomixis involves two developmental processes:

[0006] (1) avoidance of meiotic recombination and reduction (incomplete meiosis); and

[0007] (2) The egg cell develops into an embryo without fertilization (parthenogenesis).

[0008] Apomixis produces seeds that are genetically identical to the parent plants. Apomixis has long been recognized as being very useful in plant breeding (Asker, 1979; Hermsen, 1980; Asker and Jerling, 1990; Vielle-Calzada et al., 1995). The most obvious advantage of introducing apomixis into crops is the pure propagation of heterotic F1 hybrids (true breeding). In most crops, F1 hybrids are the best-performing varieties. However, in sexual crops, F1 hybrids must be produced again each generation by crossing inbred homozygous parents because self-fertilization of F1 hybrids leads to a loss of heterotic vigor through recombination in the genomes of F2 offspring plants. Producing sexual F1 seeds is an iterative, complex, and costly process. In contrast, apomictic F1 hybrids will continue to be pure. In other words, the genetic fixation of F1 hybrids and the production of consistent offspring plants through seeds become possible.

[0009] The F1 fixation (fixation) by apomixis is a special case of the general property of apomixis, i.e. any genotype, no matter how its genetic complexity, only needs one step to be passed down to the next generation. This means that apomixis can be used for the immediate fixation of polygenic quantitative traits. It should be noted that most yield traits are polygenic. Apomixis can be used for the stacking (or polymerization) of multiple traits (such as various resistances, several transgenics or multiple quantitative trait loci). In the absence of apomixis, in order to fix such a group of traits, each trait locus must be homozygous separately and then combined. When the locus number involved in the trait increases, it is time-consuming, logistically challenging and therefore costly to make these trait loci homozygous by hybridization. In addition, the specific epistatic interaction between the alleles is lost due to homozygosity. By apomixis, this type of non-additive genetic variation can be fixed. Apomixis (asexual reproduction through seeds) therefore has the potential to be a paradigm shift in plant breeding, commercial seed production, and agriculture (van Dijk et al. 2016, Van Dijk and Schauer 2016).

[0010] In addition to instantly fixing any genotype, regardless of complexity, apomixis has other important agricultural applications. Sexual interspecific hybrids and autopolyploids are often sterile due to meiotic problems. Because apomixis skips meiosis, its use could address these problems. Because apomixis prevents female hybridization, it has been proposed to be combined with male sterility to contain transgenes and prevent transgene introgression in wild relatives of transgenic crops (Daniell, 2002). In insect-pollinated crops (such as Brassicas), apomictic seed set is not limited by insufficient pollinator services. This is increasingly important given the growing health problems of pollinator bee colonies (Varroa mite infestations, African killer bees, etc.). In tuber-propagated crops (such as potatoes), apomixis would maintain superior genotypic clones while reducing or even eliminating the current risk of virus transmission and the associated costs of clean production, containment, and certification. Storage costs for apomictic seeds are also much lower than those for tubers or other asexually propagated plant parts. In ornamental plants, apomixis can replace labor-intensive and expensive tissue culture propagation and is generally considered to significantly reduce the costs of cultivar development and plant propagation.

[0011] Unfortunately, apomixis does not occur in any major crop. There have been many attempts to introduce apomixis in sexual crops. For example, the introgression of apomixis genes, the mutation of sexual model species, the de novo generation of apomixis by hybridization, and the cloning of candidate genes. So far, the introgression of apomixis genes from wild apomicts into crop species by extensive hybridization has not been successful (for example, apomixis from Dactylis serrata was infiltrated into corn - Savidan, Y., 2001; Morgan et al., 1998; WO97 / 10704). Regarding the sexual model species of mutation, WO2007 / 066214 describes the use of an incomplete meiotic mutant called Dyad in Arabidopsis. However, Dyad is a recessive mutation with very low penetrance. In crop species, this mutation has limited uses. Apomixis is produced from scratch by the hybridization between two kinds of sexual reproduction types and does not produce agriculturally interested apomicts (US2004 / 0168216A1 and US2005 / 0155111A1). In US2004 / 0148667, described the cloning of candidate apomixis genes in corn by transposon markers. The ortholog of elongate gene has been claimed to be induced apomixis. However, according to Barrell and Grossniklaus (2005), elongate gene skips meiosis II, therefore does not keep maternal genotype, and this makes its usefulness greatly reduced.

[0012] US2006 / 0179498 has described so-called reverse breeding as an alternative to apomixis. However, this is a technically complex in vitro laboratory procedure, while apomixis is an in vivo procedure performed by the plant itself. Furthermore, for reverse breeding, once the parental lines have been reconstructed (bigametic homozygotes), hybridization must still be performed.

[0013] Apomixis in natural apomicts usually has a genetic basis (reviewed by Ozias-Akins and Van Dijk, 2007). Therefore, another approach may be to separate apomictic genes from natural apomictic species. However, this is not an easy task, because natural apomicts usually have polyploid genomes, and positional cloning is very difficult in polyploids. Other complicating factors are that reorganization, repetitive sequences, and segregation aberrations in the apomict-specific chromosome regions are suppressed by hybridization. Summary of the Invention

[0014] As described herein, there is a need for methods for inducing apomixis in crops that do not have at least some of the limitations of the prior art. In particular, there is a need for methods for producing apomictic plants and apomictic seeds. There is also a need for genes and proteins involved in apomixis (particularly parthenogenesis) that are suitable for inducing apomixis in crops and that can substantially mimic the apomictic pathway.

[0015] The present inventors have now identified and isolated parthenogenesis locus and gene, the allele relevant to the parthenogenesis phenotype (expressed as parthenogenesis allele or Par allele in this article) and the allele relevant to the non-parthenogenesis phenotype (expressed as sexual or non-parthenogenesis allele or par allele in this article), its genetic sequence, i.e. promoter or 5'UTR sequence, coding sequence, 3'UTR sequence and encoded protein sequence.Parthenogenesis can be directly introduced into sexual plants, possibly by random or directed mutagenesis, by transformation or by somatic hybridization.The sexual allele of the parthenogenesis locus of sexual plants by genetic modification, for example, by mutagenesis, transgenic or by introducing double-strand break and homologous recombination at specific sites to insert, can introduce Par allele, and plant and / or its offspring can become and can make egg cell develop into embryo.

[0016] definition

[0017] As used herein, the term "locus" (plural: loci) refers to a specific location (or multiple locations) or site on a chromosome where, for example, a gene or genetic marker is found. For example, a "parthenogenesis locus" refers to the position at which a parthenogenesis gene is located in the genome, contributing to the alleles of a parthenogenesis phenotype, i.e., (parthenogenesis alleles or Par alleles) and / or its sexual counterpart, i.e., non-parthenogenesis genes (non-parthenogenesis alleles or par alleles). Genes, alleles, proteins or nucleic acids that are "functional in parthenogenesis" are understood herein to contribute to a parthenogenesis phenotype and / or to the ability of a plant or plant cell to be converted into an egg cell for development into an embryo.

[0018] As used herein, the term "allele" refers to any of one or more alternative forms of a gene at a specific locus. In diploid and / or polyploid cells of an organism, the alleles of a given gene are located at a specific location or locus on a chromosome, with one allele present on each chromosome in the set of homologous chromosomes. A diploid and / or polyploid or plant species can contain a large number of different alleles at a specific locus.

[0019] As used herein, the term "dominant allele" refers to the relationship between the alleles of a gene, wherein the influence on the phenotype of an allele (i.e., dominant allele) obscures the contribution of the second allele (i.e., recessive allele) at the same locus. For genes on autosomes (any chromosome except sex chromosomes), alleles and their associated traits are autosomal dominant or autosomal recessive. Dominance is a key concept in Mendelian inheritance and classical genetics. For example, dominant alleles can encode functional proteins, while recessive alleles do not encode. In one embodiment, the gene taught herein and its fragment or variant refer to the dominant allele of a parthenogenetic gene.

[0020] As used herein, the term "female ovary" (plural: "ovaries") refers to the enclosure in which spores are formed. It can be composed of a single cell or can be multicellular. All plants, fungi, and many other lineages form an ovary at some point in their life cycle. The ovary can produce spores by mitosis or meiosis. Typically, within each ovary, meiosis of the megaspore mother cell produces four haploid megaspores. In gymnosperms and angiosperms, only one of these four megaspores is functional at maturity, the other three degenerating. The resulting megaspore divides mitotically and develops into a female gametophyte, which ultimately produces an egg cell.

[0021] As used herein, the term "female gamete" refers to a cell that fuses with another ("male") cell during fertilization (conception) in a sexually reproducing organism under normal (sexual) conditions. In species that produce two morphologically different types of gametes and in which each individual produces only one type, a female is any individual that produces the larger type of gamete, called an ovule (egg) or egg cell. In plants, female ovules are produced by the ovary of a flower. When mature, haploid ovules produce female gametes and are then ready for fertilization. Male cells are (primarily haploid) pollen and are produced by anthers.

[0022] The term "genetic marker" or "polymorphic marker" refers to a region that can be used for a specific position on a "marker" chromosome on genomic DNA. If a genetic marker is tightly linked to a gene or is "on" a gene, it "marks" the DNA of the gene found thereon, and therefore can be used for (molecule) marker determination to select or antagonize the presence of the gene, such as in marker-assisted breeding / selection (MAS) methods. The example of a genetic marker is AFLP (amplified fragment length polymorphism, EP534858), microsatellite (microsatellite), RFLP (restriction fragment length polymorphism), STS (sequence tagged site), SNP (single nucleotide polymorphism), SFP (single feature polymorphism; See Borevitz et al., 2003), SCAR (sequence signature amplification region), CAPS marker (amplified polymorphic sequence of cutting) etc. The farther the marker is from the gene, the greater the possibility of recombination (crossing) between the marker and the gene, thus losing connection (and the co-separation of the marker and the gene). The distance between genetic loci is measured based on the recombination frequency and is given in cM (centimorgans; 1 cM is the meiotic recombination frequency (1%) between two markers. Because genome size varies greatly between species, the actual physical distance represented by 1 cM (i.e., kilobases, kb, between two markers) also varies greatly between species.

[0023] It will be understood that when reference is made herein to "linked" markers, this also includes markers "on" the gene itself.

[0024] "MAS" means "marker assisted selection", whereby plants are screened for the presence or absence of one or more genetic and / or phenotypic markers to accelerate the transfer of a DNA region comprising the marker (and optionally lacking flanking regions) into (elite) breeding lines.

[0025] "Molecular marker assay" (or test) refers to a (DNA-based) assay that indicates (directly or indirectly) the presence or absence of an allele, such as a Par or par allele, in a plant or plant part. Preferably, it allows determination of whether a particular allele is homozygous or heterozygous at the parthenogenesis locus of any individual plant. For example, in one embodiment, PCR primers are used to amplify nucleic acids connected to the parthenogenesis locus, enzymatically digest the amplified products, and based on the electrophoretic resolution pattern of the amplified products, it is possible to determine which allele(s) are present in any individual plant, as well as the zygosity of the alleles at the parthenogenesis locus (i.e., the genotype at each locus). Examples are SCAR markers (sequence signature amplified region), CAPS markers (cleaved amplified polymorphic sequences), and similar marker assays.

[0026] As used herein, the term "heterozygous" refers to a genetic condition that exists when two different alleles are located at a specific locus, but are located separately on corresponding sets of homologous chromosomes in a cell. In contrast, as used herein, the term "homozygous" refers to a genetic condition that exists when two (or more in the case of polyploidy) identical alleles are located at a specific locus, but are located separately on corresponding sets of homologous chromosomes in a cell.

[0027] As used herein, "variety" is in accordance with the UPOV convention and means a grouping of plants within a single botanical taxonomic unit of the lowest known rank, which grouping can be defined by the expression of characteristics and can be distinguished from any other grouping of plants by the expression of at least one of said characteristics and which is considered a unit in terms of its suitability for reproduction without variation (stability).

[0028] The terms "protein" and "polypeptide" are used interchangeably to refer to a molecule composed of a chain of amino acids, without reference to a specific mode of action, size, three-dimensional structure, or origin. Thus, a "fragment" or "portion" of a protein may still be referred to as a "protein." The term "isolated protein" is used to refer to a protein that is no longer in its native environment, for example, in vitro or in a recombinant bacterial or plant host cell.

[0029] The term "gene" refers to a DNA sequence comprising a region (transcribed region) that is transcribed into an RNA molecule (e.g., a pre-mRNA that is processed into mRNA) in a cell, operably linked to a suitable regulatory region (e.g., a promoter). Thus, a gene may comprise several operably linked sequences, such as a promoter, a 5' leader sequence comprising, for example, sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA), and a 3' untranslated sequence comprising, for example, a transcription termination site.

[0030] "Chimeric gene" (or recombinant gene) refers to any gene that is not normally found in a species in nature, particularly a gene in which one or more portions of a nucleotide sequence are present that are not related to each other in nature. For example, a promoter is not inherently associated with part or all of a transcriptional region or another regulatory region. The term "chimeric gene" should be understood to include expression constructs in which a promoter or transcriptional regulatory sequence is operably linked to one or more coding sequences or antisense (the reverse complement of the sense strand) or inverted repeat sequences (sense and antisense, whereby the RNA transcript forms double-stranded RNA when transcribed).

[0031] "3'UTR" or "3' untranslated sequence" (also often referred to as the 3' untranslated region or 3' end) refers to a nucleotide sequence found downstream of the coding sequence of a gene that contains, for example, a transcription termination site and (in most but not all eukaryotic mRNAs) a polyadenylation signal (such as, for example, AAUAAA or a variant thereof). After transcription is terminated, the mRNA transcript may be cleaved downstream of the polyadenylation signal and a poly(A) tail may be added, which participates in the transport of the mRNA to the cytoplasm (where translation occurs).

[0032] The "5'UTR" or "leader sequence" or "5' untranslated region" is the region of an mRNA transcript, and the corresponding DNA, located between the +1 position where transcription of the mRNA begins and the translation start codon of the coding region (usually AUG on mRNA or ATG on DNA). The 5'UTR typically contains sites important for translation, mRNA stability and / or turnover, and other regulatory elements.

[0033] "Gene expression" refers to a process in which a DNA region operably linked to an appropriate regulatory region (particularly a promoter) is transcribed into biologically active RNA, i.e., it can be translated into a biologically active protein or peptide (or active peptide fragment) or it itself is active (e.g., in post-transcriptional gene silencing or RNAi). In certain embodiments, an active protein refers to a constitutively active protein. The coding sequence is preferably in the sense direction and encodes the desired biologically active protein or peptide, or active peptide fragment. In gene silencing methods, the DNA sequence is preferably in the form of antisense DNA or inverted repeat DNA, including short sequences of the target gene in the antisense or sense and antisense directions.

[0034] "Transcriptional regulatory sequence" is defined herein as a nucleotide sequence that is capable of regulating the transcription rate of a (coding) sequence to which the transcriptional regulatory sequence is operably linked. Thus, a transcriptional regulatory sequence as defined herein will include all sequence elements necessary for transcription initiation (promoter elements), all sequence elements necessary for maintenance and regulation of transcription, including, for example, attenuators or enhancers. Although most relate to transcriptional regulatory sequences upstream (5') of a coding sequence, regulatory sequences found downstream (3') of a coding sequence are also included in this definition.

[0035] As used herein, the term "promoter" refers to a nucleic acid fragment that controls the transcription of one or more genes, which is located upstream of the transcription start site of the gene in the direction of transcription and is structurally identified by the presence of a binding site for a DNA-dependent RNA polymerase, a transcription start site, and any other DNA sequence (including but not limited to transcription factor binding sites, repressor protein and activator protein binding sites, and any other nucleotide sequence known to those skilled in the art that directly or indirectly regulates the amount of promoter transcription). Optionally, the term "promoter" also includes a 5'UTR region (e.g., a promoter may include one or more portions upstream (5') of the translation start codon of a gene in this article, because this region may play a role in regulating transcription and / or translation. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically (e.g., by external application of certain compounds) or developmentally regulated. A "tissue-specific" promoter is active only in a specific type of tissue or cell. A "promoter active in plants or plant cells" refers to the general ability of a promoter to drive transcription in a plant or plant cell. It does not have any effect on the spatiotemporal activity of the promoter.

[0036] As used herein, the term "operably linked" refers to a polynucleotide element connected in a functional relationship. When a nucleic acid is in a functional relationship with another nucleotide sequence, it is "operably linked". For example, if a promoter or transcriptional regulatory sequence affects the transcription of a coding sequence, it is operably linked to a coding sequence. Operably linked refers to that the DNA sequences being connected are usually continuous, and when it is necessary to connect two protein coding regions, they are continuous and in the reading frame so as to produce a "chimeric protein". A "chimeric protein" or "hybrid protein" is a protein composed of various protein "domains" (or motifs) that are not found in nature, but are connected to form functional proteins that show the functionality of the connected domains. A chimeric protein can also be a fusion protein of two or more naturally occurring proteins. As used herein, the term "domain" refers to any part or domain of a protein with a specific structure or function that can be transferred to another protein to provide a new hybrid protein with the functional properties of at least this domain.

[0037] The term "targeting peptide" refers to an amino acid sequence that targets a protein or protein fragment to an intracellular organelle such as a plastid, preferably a chloroplast, a mitochondria, or an extracellular space or apoplast (secretion signal peptide). The nucleotide sequence encoding the targeting peptide can be fused (in frame) to the nucleotide sequence of the amino terminal (N-terminal) of the encoded protein or protein fragment, or can be used to replace a natural targeting peptide.

[0038] " nucleic acid construct " or " vector " should be understood in this article to refer to the artificial nucleic acid molecule produced using recombinant DNA technology, which is used to deliver exogenous DNA into a host cell. The vector backbone can be, for example, a binary or super binary vector (see, for example, US 5591616, US 2002138879 and WO95 / 06722), a co-integration vector or a T-DNA vector, as known in the art and described elsewhere herein, a gene or a mosaic gene is integrated into, or if a suitable transcriptional regulatory sequence already exists, only required nucleotide sequence (for example, encoding sequence, antisense or inverted repeat sequence) is integrated into the downstream of the transcriptional regulatory sequence. Vectors typically comprise other genetic elements to promote their application in molecular cloning, such as, for example, selectable markers, multiple cloning sites, etc.

[0039] "Recombinant host cell" or "transformed cell" or "transgenic cell" refers to a new single cell (or organism) produced as a result of at least one nucleic acid molecule, particularly a gene or chimeric gene encoding a desired protein or nucleotide sequence, which upon transcription produces antisense RNA or inverted repeat RNA (or hairpin RNA) to silence the target gene / gene family that has been introduced into the cell. "Isolated nucleic acid" is used to refer to a nucleic acid that is no longer in its natural environment, for example, in vitro or in a recombinant bacterial or plant host cell.

[0040] "Host cell" is a primary cell that has been transformed with a transgenic gene to become a recombinant host cell. The host cell is preferably a plant cell or a bacterial cell. The recombinant host cell may contain a nucleic acid construct that is an extrachromosomal (episomal) replicating molecule, or more preferably, comprises a gene or chimeric gene that is integrated into the nuclear or plastid genome of the host cell.

[0041] A "recombinant plant" or "recombinant plant part" or "transgenic plant" is a plant or plant part (eg, seed or fruit or leaf) that comprises a recombinant gene or chimeric gene, even though the gene may not be expressed or not expressed in all cells.

[0042] An "elite event" is a recombinant plant that has been selected to contain a recombinant gene at a location in the genome that results in a plant having favorable phenotypic and / or agronomic characteristics. The DNA flanking the integration site can be sequenced to characterize the integration site and to distinguish the event from other transgenic plants containing the same recombinant gene at other locations in the genome.

[0043] The term "selectable marker" is a term that one of ordinary skill in the art is familiar with, and is used to describe any genetic entity in this article, and it can be used for selecting one or more cells containing selectable markers when expressing. Selectable marker gene product gives for example antibiotic resistance, or more preferably, herbicide resistance or another optional proterties such as phenotypic traits (for example the variation of pigmentation) or nutritional requirement.Term " reporter molecule (reporter) " is mainly used to refer to visible markers, such as green fluorescent protein (GFP), eGFP, luciferase, GUS etc.

[0044] The term "orthologue" of a gene or protein as used herein refers to a homologous gene or protein found in another species that has the same function as the gene or protein but (usually) diverged in sequence at a point in time when the species containing the gene diverged (i.e., evolved from a common ancestor by speciation). Thus, orthologues of Taxaracum parthenogenesis genes can be identified in other plant species based on sequence comparison (e.g., based on percent sequence identity across the entire sequence or to specific domains) and functional analysis.

[0045] The terms "homologous" and "heterologous" refer to the relationship between a nucleic acid or amino acid sequence and its host cell or organism, particularly in the context of transgenic organisms. Thus, a homologous sequence occurs naturally in the host species (e.g., a lettuce plant transformed with a lettuce gene), while a heterologous sequence does not occur naturally in the host cell (e.g., a lettuce plant transformed with a sequence from a potato plant). Depending on the context, the terms "homolog" or "homologous" may alternatively refer to sequences that are descendants of a common ancestral sequence (e.g., they may be orthologs).

[0046] "Stringent hybridization conditions" can be used to identify nucleotide sequences that are substantially identical to a given nucleotide sequence. Stringent conditions depend on the sequence and vary under different circumstances. Typically, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) of the specific sequence at a defined ionic strength and pH. Tm is the temperature (at a defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Typically, stringent conditions will be selected where the salt concentration is about 0.02 molar at pH 7 and the temperature is at least 60°C. Lowering the salt concentration and / or increasing the temperature can increase stringency. Stringent conditions for RNA-DNA hybridization (using, for example, Northern blots of 100 nt probes) are, for example, those that include at least one wash in 0.2X SSC at 63°C for 20 minutes, or equivalent conditions. Stringent conditions for DNA-DNA hybridization (using, for example, Southern blots of 100 nt probes) are, for example, those that include at least one wash (usually 2 times) in 0.2X SSC at a temperature of at least 50°C, typically about 55°C, for 20 minutes, or equivalent conditions. See also Sambrook et al. (1989) and Sambrook and Russell (2001).

[0047] "High stringency" conditions can be provided, for example, by hybridization at 65° C. in an aqueous solution containing 6× SSC (20× SSC containing 3.0 M NaCl, 0.3 M sodium citrate, pH 7.0), 5× Denhardt's (100× Denhardt's containing 2% Ficoll, 2% polyvinylpyrrolidone, 2% bovine serum albumin), 0.5% sodium dodecyl sulfate (SDS), and 20 μg / ml denatured carrier DNA (single-stranded fish sperm DNA, average length 120-3000 nucleotides) as a nonspecific competitor. After hybridization, high stringency washes can be performed in several steps, culminating in a wash in 0.2-0.1× SSC, 0.1% SDS at the hybridization temperature (approximately 30 minutes).

[0048] "Medium stringency" refers to conditions equivalent to hybridization in the above solutions but at about 60-62° C. In this case, the final wash is performed in 1×SSC, 0.1% SDS at the hybridization temperature.

[0049] "Low stringency" refers to conditions equivalent to hybridization at about 50-52°C in the above solution. In this case, the final wash is performed in 2×SSC, 0.1% SDS at the hybridization temperature. See also Sambrook et al. (1989) and Sambrook and Russell (2001).

[0050] "Sequence identity" and "sequence similarity" can be determined by using a global or local alignment algorithm for two peptides or two nucleotide sequences, depending on the length of the two sequences. Preferably, a global alignment algorithm (such as NeedlemanWunsch) is used to align sequences of similar length, which optimally align sequences over the entire length, while a local alignment algorithm (such as SmithWaterman) is preferably used to align sequences of substantially different lengths. When a sequence (when optimally aligned using default parameters by, for example, programs GAP or BESTFIT) shares at least a certain minimum percentage of sequence identity (as defined herein), the sequence can be referred to as "substantially identical" or "substantially similar." GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over its entire length (total length), maximizing the number of matches and minimizing the number of gaps. When two sequences have similar lengths, a global alignment is suitable for determining sequence identity. Typically, using GAP default parameters, gap creation penalty=50 (nucleotides) / 8 (proteins) and gap extension penalty=3 (nucleotides) / 2 (proteins). For nucleotides the default scoring matrix used is nwsgapdna, while for proteins the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and percentage sequence identity scores can be determined using a computer program such as the GCG Wisconsin Package, version 10.3, available from Accelrys Inc. (9685 Scranton Road, San Diego, CA 92121-3752 USA), or using open source software such as the program "needle" (using the global Needleman Wunsch algorithm) or "water" (using the local Smith Waterman algorithm) in EmbossWIN version 2.10.0, using the same parameters as GAP described above, or using the default settings (for both "needle" and "water" and for both protein and DNA alignments, the default gap opening penalty is 10.0 and the default gap extension penalty is 0.5; the default scoring matrices for proteins and DNA are Blossum62 and DNAFull). Local alignments, such as those using the Smith Waterman algorithm, are preferred when the sequences have substantially different total lengths.

[0051] Alternatively, the percent similarity or identity can be determined by searching public databases using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of the present invention can be further used as "query sequences" to search public databases, for example to identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12, to obtain nucleotide sequences homologous to the oxidoreductase nucleic acid molecules of the present invention. BLAST protein searches can be performed with the BLASTx program, score = 50, word length = 3, to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402. When using BLAST and Gapped BLAST programs, the default parameters of the respective programs (eg, BLASTx and BLASTn) can be used. See the National Center for Biotechnology Information homepage at http: / / www.ncbi.nlm.nih.gov / .

[0052] As used herein, the term "sexual plant reproduction" refers to a developmental pathway in which a somatic cell (e.g., diploid) called a "megaspore mother cell" undergoes meiosis to produce four reduced megaspores. One of these megaspores divides mitotically to form a female gametophyte (also called an embryo sac), which contains a reduced egg cell (i.e., a cell with a reduced number of chromosomes compared to the mother cell) and two reduced polar nuclei. Fertilization of the egg cell by one sperm cell of the pollen grain produces an embryo (e.g., a diploid), while fertilization of the two polar nuclei by a second sperm cell produces an endosperm (e.g., a triploid) (a process known as double fertilization).

[0053] As used herein, the term "megaspore mother cell" or "megasporocyte" refers to a cell that produces megaspores by division (usually meiosis) to produce four haploid megaspores that will develop into the female gametophyte. In angiosperms (also known as flowering plants), the megaspore mother cell produces megaspores, which develop into the female gametophyte through two different processes, including megasporogenesis (formation of megaspores in the nucellus or megasporangium) and megagametogenesis (development of the megaspores into the female gametophyte).

[0054] As used herein, the term "asexual plant reproduction" is the process of achieving plant reproduction without fertilization and without the fusion of gametes. Asexual reproduction produces new individuals that are genetically identical to the parent plants and to each other, except when mutations or somatic recombination occur. Plants have two main types of asexual reproduction, including vegetative reproduction (i.e., involving budding, tillering, etc., of the vegetative parts of the original plant) and apomixis.

[0055] As used herein, the term "apomixis" refers to the formation of seeds through an asexual process. A form of apomixis is characterized by: 1) incomplete meiosis, which refers to the formation of an unreduced embryo sac in the ovary, and 2) parthenogenesis, which refers to the development of unreduced egg cells into embryos. Hundreds of wild plant species have the characteristics of apomixis and asexual reproduction. Incomplete meiosis is the process that leads to the production of unreduced egg cells, which have the same chromosome number and the same or highly similar genotype as the somatic tissue of the parent plant. The unreduced egg cells can be from unreduced megaspores (diploid spore reproduction (diplospory)) or from somatic starting cells (apospory). In the case of diploid spore reproduction, megaspore generation is replaced by mitosis or modified meiosis. Modified meiosis is preferably the first division recovery type without recombination. Alternatively, the modified meiosis can be the second division reconstruction type. In a preferred embodiment, incomplete meiosis is the diploid spore type that affects the first meiotic division. Apomixis is known to occur in different forms, including at least two types of fusion, called gametophytic apomixis and sporophytic apomixis (also known as adventitious embryos). Examples of plants that undergo gametophytic apomixis include Taraxacum, Hieracium, Poa, and Dactylum spp. Examples of plants that undergo sporophytic apomixis include Citrus and Mangosteen.

[0056] As used herein, term " diplospory " refers to the situation that the unreduced embryo sac is directly derived from megaspore mother cell by mitosis or by the meiotic event of stopping.Three main types of diplospory have been reported, and with the plant names that they occur therein, it is Taraxacum, Ixeris and Antennaria type.In Taraxacum type, meiosis prophase has been started, but stops this process subsequently, produces two unreduced dyads, one of which produces embryo sac by mitosis.In Ixeris type, after meiosis prophase, equal division, then nucleus carries out two further mitosis to produce eight nuclear embryo sac.Taraxacum and Ixeris type are called meiotic diplospory, because they relate to the modification of meiosis. In contrast, in the genus Pleurotus, known as mitotic diploid spore reproduction, the megaspore mother cell does not initiate meiosis, but directly divides three times to produce an unreduced embryo sac. In the gametophyte apomixis by diploid spore reproduction, an unreduced gametophyte is produced from unreduced megaspores. This unreduced megaspore is produced by mitotic-like division (mitotic displory) or modified meiosis (meiotic displory). In both the gametophyte apomixis by apomixis and the gametophyte apomixis by diploid spore reproduction, the unreduced egg cell parthenogenesis develops into an embryo. The apomixis in the genus Taraxacum is a diploid spore type, which means that the first female meiosis (meiosis I) is skipped, producing two unreduced megaspores of the same genotype as the parent plant. One of these megaspores degenerates, while the other, unreduced megaspore survives and produces an unreduced female gametophyte (or embryo sac), which contains an unreduced egg cell. This unreduced egg cell, without fertilization, develops into an embryo with the same genotype as the parent plant. Seeds produced by the gametophytic apomixis process are called apomictic seeds.

[0057] The term "diploid sporogenesis capability" refers to the ability to induce diploid sporogenesis in a plant, preferably in the female ovary, preferably in the megaspore mother cell and / or the female gamete. Thus, a plant into which diploid sporogenesis capability has been introduced is capable of undergoing the diploid sporogenesis process, i.e., producing unreduced gametes by meiosis I recombination.

[0058] The term "diploid spores as part of gametophytic apomixis" refers to the diploid spore component of the apomixis process, i.e., the role of diploid spores in seed formation via an asexual process. In particular, in addition to the diploid spore function, the parthenogenetic function is also required for the establishment of apomixis. Thus, the combination of diploid spores and parthenogenetic functions can result in apomixis.

[0059] As used herein, the term "diploid sporophyte" refers to a plant that undergoes gametophytic apomixis via diploid sporulation or a plant that has been induced (e.g., by genetic modification) to undergo gametophytic apomixis via diploid sporulation. In both cases, when combined with parthenogenetic factors, the diploid sporophyte produces apomictic seeds.

[0060] As used herein, the term "apomixis seed" refers to seeds obtained from apomictic plant species or plants or crops induced to undergo apomixis, particularly gametophytic apomixis by diploid spore reproduction. Apomixis seeds are characterized in that they are clonal and genetically identical to the parent plant and the germinated plant, capable of pure propagation. In the present invention, "apomixis seed" also refers to "clonal apomictic seed."

[0061] As used herein, the term "apomixis plant" refers to a plant that reproduces asexually without fertilization. An apomictic plant can be a sexual plant that has been modified to become an apomict, such as a sexual plant that has been genetically modified, for example, with one or more parthenogenetic genes as taught herein, to produce an apomictic plant, or a plant that is the offspring of an apomictic plant. In this case, the offspring produced by apomixis are genetically identical to the parent plant.

[0062] "Clones" of cells, plants, plant parts or seeds are characterized in that they are genetically identical to their siblings and to the parent plant from which they were derived. The genomic DNA sequences of individual clones are nearly identical, however, mutations may cause slight differences.

[0063] As used herein, the term "monochromatic" or "monochromatic organism" (also known as a purebred organism) refers to an organism that consistently passes a phenotypic trait unchanged or nearly unchanged to its progeny. An organism is said to be monochromatic for each trait for which it is applicable, and the term "monochromatic" is also used to describe individual inherited traits.

[0064] As used herein, the term "F1 hybrid" (or F1 hybrid) refers to the first offspring generation of offspring with distinct parental types. The parental types may or may not be inbred lines. The F1 hybrid is used in genetics and selective breeding, where it may be represented as an F1 cross. Offspring of distinct parental types produce new, consistent phenotypes with a combination of characteristics from the parents. F1 hybrids are associated with unique advantages such as hybrid vigor and are therefore very popular in agricultural practice. In one embodiment of the invention, the methods, genes, proteins, variants or fragments taught herein can be used to fix the genotype of an F1 hybrid, regardless of its genetic complexity, and allow the production of organisms that can be passed down through generations in one step.

[0065] As used herein, the term "pollination" or "pollinated" refers to the process of transferring pollen from the anther (male part) of a plant to the stigma (female part) to enable fertilization and reproduction. It is unique to angiosperms (flowering plants). Each pollen grain is a male haploid gametophyte, adapted to be transported to the female gametophyte where fertilization is achieved by producing male gametes (or multiple gametes) in a double fertilization process. Successful angiosperm pollen grains (gametophytes) containing male gametes are transported to the stigma where they germinate and their pollen tubes grow downward along the style to the ovary. Its two gametes move downward along the tube to a position where the gametophyte containing the female gametes remains within the carpel. One nucleus fuses with the polar body to produce endosperm tissue, while the other nucleus fuses with the ovule to produce an embryo.

[0066] As used herein, the term "parthenogenesis" refers to a form of asexual reproduction in which the growth and development of embryos occurs without fertilization. The genes and proteins of the present invention can be combined with diplosporous factors (e.g., genes or chemical factors) to produce apomictic offspring.

[0067] As used herein, the term "polymerization or stacking genes" refers to the process of combining related or unrelated genes from different parental lines into a plant that forms the basis of desired or advantageous traits (e.g., disease resistance traits, color, drought resistance, insect resistance, etc.). Conventional breeding methods can be used to polymerize or stack genes, or the use of molecular markers can be accelerated to identify and retain plants containing the desired allele combination, and to discard plants that do not have the desired allele combination. In one embodiment of the invention, the parthenogenetic genes taught herein can be advantageously used in gene polymerization or stacking procedures to produce apomictic plants or to introduce apomictic reproduction in sexual crops.

[0068] In this document and its claims, the verb "to comprise" and its conjugations are used in its non-restrictive sense to mean that the items following the word are included, but items not specifically mentioned are not excluded. Furthermore, reference to an element with the indefinite article "a" or "an" does not exclude the possibility that more than one element is present, unless the context clearly requires the presence of one and only one element. Thus, the indefinite article "a" or "an" generally means "at least one". It will also be understood that when reference is made herein to a "sequence", this is generally referring to an actual physical molecule having a specific subunit sequence (e.g., amino acids).

[0069] As used herein, the term "plant" includes plant cells, plant tissues or organs, plant protoplasts, plant cell tissue cultures (from which plants can be regenerated), plant callus, plant cell clumps, and intact plant cells in plants or plant parts such as embryos, pollen, ovules, fruits, flowers, leaves (e.g., a harvested lettuce crop), seeds, roots, root tips, and the like. DETAILED DESCRIPTION

[0070] Nucleotide sequences according to the present invention

[0071] The present inventor has identified the gene, coding sequence, promoter, 3 ' UTR and protein responsible for parthenogenesis for the first time.Described genetic sequence, promoter sequence, coding sequence and 3 ' UTR sequence are located on the Par allele.The present inventor has also identified the sexual counterpart that is positioned at the Par allele, i.e. the genetic sequence, promoter sequence, coding sequence and 3 ' UTR sequence on the par allele.As the sexual counterpart of the dominant allele that causes parthenogenesis, these par alleles are also indicated as being relevant to parthenogenesis in this article, although their existence does not contribute to the parthenogenesis phenotype, because the existence of the par allele can indicate sexual phenotype, i.e. non-parthenogenesis phenotype.Because the Par allele can be a dominant allele, the confirmation of sexual phenotype may need all alleles of the Par locus to be assessed as par allele and / or need to assess the disappearance of the Par allele.In other words, "related to ... " should be understood as indicating parthenogenesis or non-parthenogenesis phenotype in this article, and optionally indicates that it is functional in parthenogenesis. Modification of the par allele, for example by modifying one or more expression control sequences of the par allele, such as a promoter sequence that results in altered expression of the encoded protein, can confer upon the par allele a Par allele capable of inducing a parthenogenetic phenotype.

[0072] Both Par and par alleles comprise a gene having a coding sequence that encodes a protein designated herein as "PAR protein" comprising a zinc finger C2H2-type domain (IPR13087), preferably a zinc finger K2-2-like domain having the following consensus sequence: C.{2}C.{7}[K / R]A.{2}GH.[R / N].H, which may also be annotated as: CXXCXXXXXXX[K / R]AXXGHX[R / N]XH (SEQ ID NO: 37), wherein X can be any naturally occurring amino acid, wherein [K / R] indicates that the amino acid at position 12 is lysine or arginine, and wherein [R / N] indicates that the amino acid at position 19 is arginine or asparagine (see Englbrecht et al., 2004). In addition to a zinc finger C2H2-type domain, preferably a zinc finger K2-2-like domain, as defined herein, the protein comprises an EAR motif having the consensus amino acid sequence DLNXXP (SEQ ID NO: 58) or DLNXP (SEQ ID NO: 59), wherein X can be any naturally occurring amino acid (see Kagale et al., 2010). Preferably, the protein is at most 400 amino acids, wherein the protein comprises one or two EAR motifs as described herein and a zinc finger K2-2-like domain as defined herein. Preferably, the protein is at most 400 amino acids, wherein the protein comprises only one or two EAR motifs as described herein and only one zinc finger K2-2-like domain as defined herein, i.e., no other EAR motifs as defined herein and no other zinc finger K2-2-like domains as defined herein. In addition to the features of a maximum size of 400 amino acids, only one or two EAR motifs as shown herein and a single zinc finger K2-2-like domain as defined, the PAR protein may comprise only one additional zinc finger domain having the zinc finger consensus sequence C.{2}C.{12}H.{3}H (which may also be annotated as: CXXCXXXXXXXXXXXXHXXXH (SEQ ID NO: 38), but more preferably does not comprise an additional zinc finger domain having the zinc finger consensus sequence C.{2}C.{12}H.{3}H (SEQ ID NO: 38).

[0073] Therefore, the present invention provides nucleic acids associated with plant parthenogenesis, wherein the nucleic acid comprises a nucleotide sequence encoding a PAR protein as defined herein. The present invention also provides a promoter sequence and a 3'UTR operably linked to the nucleotide sequence encoding the PAR protein. The medicinal dandelion (Taraxacum officinale) comprises a dominant Par allele capable of inducing parthenogenesis and two sexual counterparts, par allele-1 and par allele-2, encoding a PAR protein having an amino acid sequence of SEQ ID NO: 1, 6, or 11, respectively. The Par allele comprises a gene having a nucleotide sequence of SEQ ID NO: 5, par allele-1 comprises a par gene having a nucleotide sequence of SEQ ID NO: 10, and par allele-2 comprises a par gene having a nucleotide sequence of SEQ ID NO: 15. The Par gene comprises a promoter sequence having a nucleotide sequence of SEQ ID NO: 2, a coding sequence having a nucleotide sequence of SEQ ID NO: 3, and a 3'UTR having a nucleotide sequence of SEQ ID NO: 4. par gene-1 comprises a promoter sequence having SEQ ID NO: 7, a coding sequence having SEQ ID NO: 8, and a 3'UTR having SEQ ID NO: 9. par gene-2 ​​comprises a promoter sequence having SEQ ID NO: 12, a coding sequence having SEQ ID NO: 13, and a 3'UTR having SEQ ID NO: 14. Therefore, the present invention provides a nucleic acid related to plant parthenogenesis, wherein the nucleic acid comprises at least one of the following:

[0074] a) a gene encoding a protein having the amino acid sequence of SEQ ID NO: 1, 6 or 11;

[0075] b) a promoter having the nucleotide sequence of SEQ ID NO: 2, 7 or 12;

[0076] c) a coding sequence having the nucleotide sequence of SEQ ID NO: 3, 8 or 13;

[0077] d) a 3'UTR having the nucleotide sequence of SEQ ID NO: 4, 9 or 14;

[0078] e) a gene having the nucleotide sequence of SEQ ID NO: 5, 10 or 15;

[0079] f) a variant of any one of a)-e); and

[0080] g) A fragment of any one of a) to f).

[0081] Table 1 provides an overview of all SEQ ID NOs used herein.

[0082] Preferably, the nucleic acid is functional in parthenogenesis.

[0083] In one embodiment, the nucleic acid of the invention comprises or consists of at least one of the following:

[0084] a) a gene encoding a protein having the amino acid sequence of SEQ ID NO: 1;

[0085] b) a promoter having the nucleotide sequence of SEQ ID NO: 2;

[0086] c) a coding sequence having the nucleotide sequence of SEQ ID NO: 3;

[0087] d) a 3'UTR having the nucleotide sequence of SEQ ID NO: 4;

[0088] e) a gene having the nucleotide sequence of SEQ ID NO: 5;

[0089] f) a variant of any one of a)-e); and

[0090] g) A fragment of any one of a) to f).

[0091] Preferably, the nucleic acid of this embodiment and / or a product derived therefrom (such as an RNA transcript thereof or an encoded protein) indicates parthenogenesis, for example, a plant comprising said nucleic acid indicates that said plant exhibits parthenogenesis, meaning that it has the ability to develop an embryo from a reduced or unreduced egg cell. Preferably, said nucleic acid and / or a product derived therefrom, such as an RNA transcript thereof or an encoded protein, is functional in parthenogenesis, even more preferably induces or is capable of inducing parthenogenesis, preferably when present in a plant or plant cell.

[0092] In another embodiment, the nucleic acid of the invention comprises or consists of at least one of the following:

[0093] a) a gene encoding a protein having the amino acid sequence of SEQ ID NO: 6 or 11;

[0094] b) a promoter having the nucleotide sequence of SEQ ID NO: 7 or 12;

[0095] c) a coding sequence having the nucleotide sequence of SEQ ID NO: 8 or 13;

[0096] d) a 3'UTR having the nucleotide sequence of SEQ ID NO: 9 or 14;

[0097] e) a gene having the nucleotide sequence of SEQ ID NO: 10 or 15;

[0098] f) a variant of any one of a)-e); and

[0099] g) A fragment of any one of a) to f).

[0100] Preferably, the nucleic acid of this embodiment and / or products derived therefrom (such as RNA transcripts or encoded proteins thereof) do not induce or are unable to induce parthenogenesis, preferably when present in a homozygous state in a plant or plant cell. In other words, the presence of the nucleic acid of this embodiment can indicate a non-parthenogenetic phenotype or a sexual phenotype, for example, a plant comprising the nucleic acid indicates that the plant has a sexual phenotype, i.e., is unable to develop embryos from egg cells.

[0101] The Par allele can be a dominant allele. In the case where the Par allele is dominant, in order to confirm that the plant is a non-parthenogenetic phenotype, all alleles of the Par locus in the plant need to be evaluated as par alleles, and the presence of a single Par allele is sufficient to indicate that the plant is capable of parthenogenesis.

[0102] Nucleic acid of the present invention can be used for screening and / or genotyping.Optionally, the functionality of the parthenogenesis of the nucleic acid or gene and / or its derivative products of inference, or the ability of the nucleic acid and / or its derivative products of inference to induce parthenogenesis, can be assessed in the following manner: by reducing expression, by silencing or by knocking out the nucleic acid or gene in the plant of parthenogenesis, for example, by introducing early termination in the coding sequence of the gene. The loss of the parthenogenesis phenotype subsequently means that the nucleic acid and / or its derivative products of inference can induce parthenogenesis. The ability to induce parthenogenesis can also be assessed by making the apomictic plant of functional loss and the nucleic acid and / or its derivative products (mRNA or protein) of inference complementary. The apomictic plant of this functional loss can be a medicinal dandelion strain A68, which has been modified to lose the apomictic phenotype by reducing the expression (for example, by disappearance or knocking out) of functional Par alleles. Such a loss-of-function apomictic plant can be a medicinal dandelion isolate A68, comprising a Par allele, wherein SEQ ID NO: 23 as defined herein has been modified to any one of SEQ ID NOs: 24-27 (see Table 2). Such a loss-of-function apomictic plant of a medicinal dandelion isolate A68 can be obtained by targeted genome editing using a CRISPR-Cas9 / guide RNA complex, wherein the guide RNA (also referred to herein as gRNA) comprises a target-specific sequence of SEQ ID NO: 19 as exemplified herein. The deletion of the Par allele of the medicinal dandelion isolate A68 results in the loss of parthenogenesis, thereby resulting in the loss of apomixis. In the case where the putative nucleic acid or its derivative product has the ability to induce parthenogenesis, when the nucleic acid or derivative product is introduced into the isolate, for example, by transfecting the isolate with a vector comprising the nucleic acid and / or encoding the product, the apomictic phenotype will be restored (or rescued). Such a vector preferably comprises a sequence suitable for driving the expression of the encoded product in the isolate. For example, a putative nucleic acid that may encode a PAR protein of the present invention may be operably linked within the vector to the promoter defined herein by SEQ ID NO: 2 and, optionally, to the 3'UTR defined herein by SEQ ID NO: 4. For Taraxacum officinale isolate A68, high seed set in the absence of cross-pollination is a clear indicator of apomixis. As another explanation, selfing in this isolate can be ruled out because the fertility of sexually produced eggs and pollen grains would be very low due to the imbalance of triploid male and female meiosis.

[0103] Preferably, the variant nucleic acid defined herein is a homologue or orthologue of the gene, promoter, coding sequence and / or 3'UTR of Par or a par allele of the medicinal dandelion isolate A68 as defined herein. Preferably, the variant nucleic acid and / or products derived therefrom, such as RNA transcripts or encoded proteins thereof, are associated with parthenogenesis as defined herein and optionally induce or are capable of inducing parthenogenesis, preferably when present in a plant or plant cell. The variant preferably encodes a PAR protein as defined herein, or is operably linked to a sequence encoding a PAR protein as defined herein. Orthologues of the Par and par genes identified in the medicinal dandelion isolate A68 of other plant species can be identified based on the characteristics of the PAR protein as defined herein. Such genes may encode, but are not limited to, any one PAR protein selected from the group consisting of: a PAR protein of Ananas comosus (e.g., UniProtKB: A0A199URK4), a PAR protein of Apostasia shenzhenica (e.g., UniProtKB: A0A2I0AZW3), a PAR protein of Arabidopsis thaliana (e.g., UniProtKB: Q8GXP9, A0A178V2S4, O81793, A0A178V1Q3, A0MFC1, O81801), a PAR protein of Arabidopsis lyrata subsp. Lyrata (e.g., UniProtKB: D7MC52 or D7MCE8), a PAR protein of peanut (Arachis ipaensis) (e.g., SEQ ID NO: 45 or SEQ ID NO: 46). oleracea PAR protein (e.g., UniProtKB: A0A0D3A1Q6 or A0A0D3A1Q3), a PAR protein of Brassica campestris (e.g., UniProtKB: A0A398AHT1), a PAR protein of Brassica rapa (e.g., SEQ ID NO: 47), a PAR protein of Pekinensis subgenus (e.g., UniProtKB: M4D574 or M4D571), a PAR protein of Brassica oleracea (e.g., UniProtKB: A0A3P6ESB1 or A0A3P6F726),PAR protein of rapeseed (eg UniProtKB: A0A3P5ZMM3 or A0A3P5Z1M1), PAR protein of pigeon pea (Cajanus cajan) (eg SEQ ID NO: 46), PAR protein of mustard (Capsella rubella) (eg UniProtKB: R0H2J1 or R0H0C2), PAR protein of cephalotus follicularis (eg UniProtKB: A0A1Q3CSK1), PAR protein of chickpea (Cicera rietinum) (eg UniProtKB: A0A3Q7YBZ1, A0A1S2YZL9, A0A3Q7Y0Z6 or A0A1S2YZM6; or SEQ ID NO: 55, 56 or 57), PAR protein of chicory (Cichorium endivia) (eg SEQ ID NO: 39), PAR protein of cucumber (Cucumis sativus PAR protein (e.g., UniProtKB: A0A0A0KGW4 or A0A0A0L0X7), cantaloupe (Cucumis melo PAR protein (e.g., UniProtKB: A0A1S3BLF2 or A0A1S3B298), cucumber PAR protein (e.g., UniProtKB: A0A0A0KAW8), pumpkin (Cucurbita moschata PAR protein (e.g., SEQ ID NO: 43), Cuscuta campestris PAR protein (e.g., UniProtKB: A0A484MGR1), Dendrobium officinale PAR protein (e.g., UniProtKB: A0A484MGR2), catenatum (e.g., UniProtKB: A0A2I0V7N9, A0A2I0X2T2 or A0A2I0W0Q8), Dorcoceras hygrometricum (e.g., UniProtKB: A0A2Z7D3Y1), Eutrema salsugineum (e.g., UniProtKB: V4LSH0; or SEQ ID NO: 44), Fagus sylvatica (e.g., UniProtKB: A0A2N9E5Y5, A0A2N9HAB9 or A0A2N9H993), Genlisea aurea (e.g., UniProtKB: S8E1M6), Glycine max (e.g., SEQ ID NO: 51, 52, 53 or 54),PAR protein of upland cotton (Gossypium hirsutum) (eg, UniProtKB: A0A1U8LDU9), PAR protein of sunflower (Helianthus annuus) (eg, SEQ ID NO: 21), PAR protein of rubber tree (Hevea brasiliensis) (eg, SEQ ID NO: 42), PAR protein of Hieracium aurantiacum (eg, SEQ ID NO: 40), PAR protein of walnut (Juglans regia) (eg, UniProtKB: A0A2I4E6B1), PAR protein of lettuce (Lactuca sativa) (eg, UniProtKB: A0A2J6KZF7; or SEQ ID NO: 22), PAR protein of cucurbit (Lagenaria siceraria) (eg, SEQ ID NO: 48), PAR protein of Medicago truncatula (eg, SEQ ID NO: 50), PAR protein of citrus aurantium (eg, SEQ ID NO: 51), PAR protein of citrus aurantium (eg, SEQ ID NO: 53), PAR protein of citrus aurantium (eg, SEQ ID NO: 54), PAR protein of citrus aurantium (eg, SEQ ID NO: 55), PAR protein of citrus aurantium (eg, SEQ ID NO: 56), PAR protein of citrus aurantium (eg, SEQ ID NO: 57), PAR protein of citrus aurantium (eg, SEQ ID NO: 58), PAR protein of citrus aurantium (eg, SEQ ID NO: 59), PAR protein of citrus aurantium (eg, SEQ ID NO: 60), PAR protein of citrus aurantium (eg, SEQ ID NO: 61), PAR protein of citrus aurantium (eg, SEQ ID NO: 62), truncatula PAR protein (eg, UniProtKB: G7K024), Morus notabilis PAR protein (eg, UniProtKB: W9SMY3 or W9SMQ7), Mucunapruriens PAR protein (eg, UniProtKB: A0A371ELJ8), Nicotiana attenuata PAR protein (eg, UniProtKB: A0A1J6IQI6), Nicotiana sylvestris PAR protein (eg, UniProtKB: A0A1U7VXJ0), Nicotiana tabacum PAR protein (eg, UniProtKB: A0A1S4A651 or A0A1S3YHQ2), Oryza sativa L. PAR protein (eg, UniProtKB: A0A1S4A651 or A0A1S3YHQ2), sativa) subspecies Japonica (e.g., UniProtKB: B9FGH8), Oryza barthii (Oryza barthii) (e.g., UniProtKB: A0A0D3FWX3), Panicum miliaceum (Panicum miliaceum) (e.g., UniProtKB: A0A3L6Q010 or A0A3L6T1D6), Parasponia andersonii (e.g., UniProtKB: A0A2P5BMI5), Populus alba (Populus alba) (e.g., UniProtKB: A0A4U5PSY9),PAR protein of Populus trichocarpa (e.g., UniProtKB: B9H661), PAR protein of Punica granatum (e.g., UniProtKB: A0A2I0IBB9, A0A218XB85 or A0A218W102), PAR protein of Seneciocambrensis (e.g., SEQ ID NO: 41), PAR protein of Prunus persica (e.g., SEQ ID NO: 50), PAR protein of Trema orientale (e.g., UniProtKB: A0A2P5EB04), PAR protein of Trifolium pratense (e.g., UniProtKB: A0A2I0IBB9, A0A218XB85 or A0A218W102), PAR protein of Seneciocambrensis (e.g., SEQ ID NO: 41), PAR protein of Prunus persica (e.g., SEQ ID NO: 50), PAR protein of Trema orientale (e.g., UniProtKB: A0A2P5EB04), PAR protein of Trifolium pratense (e.g., UniProtKB: A0A2 pratense (e.g., UniProtKB: A0A2K3N851), Trifolium subterraneum (e.g., UniProtKB: A0A2Z6MYD3 or A0A2Z6MDR7), Trifolium pratense (e.g., UniProtKB: A0A2K3PR44), Vitis vinifera (e.g., UniProtKB: A0A438C778, A0A438ESC4 or A0A438DBR4), and Zea mays (e.g., UniProtKB: A0A1D6HF46, B6UAC5, A0A3L6F4S1, A0A3L6EMC6, A0A3L6EMC6, K7UHQ6 or A0A1D6KHZ4). Such a gene may also encode a PAR protein selected from the group consisting of: a PAR protein of kiwifruit (Actinidia chinensis) (UniProtKB: A0A2R6S2S9), a PAR protein of beet (Beta vulgaris) (UniProtKB: XP_010690656.1), a PAR protein of potato (Solanum tuberosum) (UniProtKB: XP_015159151.1), a PAR protein of tomato (Solanum lycopersicum) (UniProtKB: A0A3Q7GXB3), a PAR protein of Capsicum baccatum (UniProtKB: A0A2G2WJR7), a PAR protein of eggplant (Solanum melongena) (UniProtKB: AVC18974.1),PAR protein of wild soybean (Glycine soja) (GeneBank accession number: XP_028201014.1, XP_006596577.1 or UniprotKB: A0A445M3M6), PAR protein of peanut (Arachis hypogaea) (UniProtKB: A0A444WUX5), PAR protein of bean (Phaseolus vulgaris) (UniProtKB: V7CIF6), PAR protein of carrot (Daucus carota) (GeneBank accession number: XP_017245413.1), PAR protein of wheat (Triticum aestivum) PAR protein (UniProtKB: A0A3B6RP64), rice subspecies indica PAR protein (UniProtKB: A2YH63), rice subspecies japonica PAR protein (UniProtKB: Q5Z7P5) and cocoa (Theobroma cacao PAR protein (UniProtKB: A0A061DL63). The present invention covers these orthologous genes, their promoter sequences, coding sequences (including cDNA and mRNA sequences) and 3'UTR.

[0104] The nucleic acid of the present invention may be, but is not limited to, DNA (such as genomic DNA, cDNA) or RNA (such as mRNA). Preferably, the nucleic acid of the present invention is an isolated nucleic acid. Preferably, the variant nucleic acid as defined herein preferably comprises at least about 60%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or more nucleotide sequence identity to any of the sequences of SEQ ID NOs: 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14 and 15 and / or any of the sequences encoding SEQ ID NOs: 1, 6 and 11, or their complementary sequences, preferably when pairwise alignment is performed using, for example, the Needleman and Wunsch algorithm (global sequence alignment) with default parameters. For example, variants of the coding sequence of SEQ ID NO:3 preferably comprise at least 60%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or more nucleotide sequence identity to SEQ ID NO:3; variants of the coding sequence of SEQ ID NO:5 preferably comprise at least about 60%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or more nucleotide sequence identity to SEQ ID NO:5; and so on.

[0105] Preferably, the variant differs from any of SEQ ID NOs: 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14 and 15, and the sequences encoding SEQ ID NOs: 1, 6 and 11, or their complementary sequences, by one or more nucleotide deletions, insertions and / or substitutions, and includes natural and / or synthetic / artificial variants. A "natural variant" is a variant found in nature, for example in other Taraxacum species or other plants. Preferably, the variant is a nucleotide sequence (gene, promoter sequence or coding sequence) from a different plant species, for example from a Taraxacum species different from Taraxacum officinale sensu lato, such as a different cultivar, germplasm (accession) or breeding line. The variant may also be found in plants other than plants belonging to the genus Taraxacum and / or isolated from said plants.

[0106] As indicated herein, the nucleic acids of the invention also include fragments of a defined gene, promoter, or coding sequence of a Par or par allele as defined herein, or any variant thereof. A "fragment" comprises or consists of a contiguous nucleotide sequence of any one of SEQ ID NOs: 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, and 15, and / or a sequence encoding any one of SEQ ID NOs: 1, 6, and 11, or a variant thereof, such as at least about 10, 12, 15, 18, 20, 30, 50, 100, 150, 200, 250, 300, 500, 1000, 2000 or more contiguous nucleotides, or a complementary sequence thereof that is preferably capable of hybridizing to said sequence. In one embodiment, such a fragment may be functional in parthenogenesis (preferably capable of inducing parthenogenesis) as defined herein. In another embodiment, such a fragment may not be functional in parthenogenesis, but may be associated with parthenogenesis, for example because the fragment may hybridize to a sequence that is functional in parthenogenesis, thereby being indicative thereof. Such a fragment may be useful, for example, as a PCR primer or hybridization probe and thus as a genetic marker for mapping assays or molecular analyses and / or for identifying and / or isolating Par or par alleles from other plants.

[0107] Preferably, the nucleic acid of the invention comprises or consists of a regulatory sequence (preferably a promoter sequence) of a gene encoding a PAR protein as defined herein, wherein the regulatory sequence (preferably a promoter sequence) comprises a nucleic acid insert (preferably a double-stranded DNA insert), wherein the length of the insert is 50 to 2000 bp, 100 to 1900 bp, 200 to 1800 bp, 300 to 1700 bp, 400 to 1600 bp, 500 to 1500 bp, 600 to 1400 bp, 1000 to 1400, 1200 to 1400, or 1300 to 1400 bp. Even more preferably, the length of the insert is about 1300 bp. Preferably, the insert is associated with a parthenogenetic phenotype as defined herein, and optionally is functional in the parthenogenetic phenotype. Preferably, the insert is located within a promoter sequence that is located immediately upstream (3') of the sequence encoding the PAR protein, preferably such that the distance between the 3' end of the insert and the start codon of the sequence encoding the PAR protein is 50-200 bp, preferably about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 bp, most preferably about 102 bp. Preferably, the insert is positioned such that the 3' terminal nucleotide of the insert is located at a position homologous to the position of nucleotide 1798 of SEQ ID NO: 2 and / or nucleotide 1798 of SEQ ID NO: 5. Preferably, the insert has no open reading frame. Even more preferably, the insert is a miniature inverted repeat transposable element (MITE) or a MITE-like sequence, wherein the MITE or MITE-like sequence is a non-autonomous element characterized by containing an internal sequence lacking an open reading frame, flanked by terminal inverted repeats (TIRs), and the TIRs are flanked by small direct repeats (target site repeats). For further description of MITEs, TIRs and sequences, reference is made to Guo et al, Scientific Reports. 2017 Jun 1; 7(1): 2634, which is incorporated herein by reference. The insert, preferably the MITE or MITE-like sequence, may have at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more identity to SEQ ID NO: 60. Preferably, the insert is associated with a parthenogenetic phenotype as defined herein and is optionally functional in the parthenogenetic phenotype. In a further preferred embodiment, the nucleic acid of the invention comprises or consists of a regulatory sequence, preferably a promoter sequence, comprising the insert at a position as defined above.Preferably, the nucleic acid of the present invention comprises or consists of a sequence encoding a PAR protein as defined herein, which sequence is operably linked to said promoter sequence, wherein preferably said promoter sequence is located directly upstream of the sequence encoding the PAR protein. Optionally, said nucleic acid of the present invention may comprise one or more additional transcriptional regulatory sequences.

[0108] In one embodiment, nucleic acids of the invention can be derived from Taraxacum officinale (eg, Taraxacum officinale sensu lato) or other species.

[0109] In one embodiment, the nucleic acids of the invention are derived from a source other than Taraxacum officinale or Taraxacum officinale sensulato.

[0110] In one embodiment, the present invention encompasses homologous or orthologous Par alleles derived from plants that undergo parthenogenesis (such as wild or cultivated plants and / or from other plants). Such homologs or orthologs can be readily isolated by using the provided nucleotide sequences or portions thereof as primers or probes. For example, moderate or stringent nucleic acid hybridization methods can be used, for example using fragments of the nucleotide sequences defined herein or their complements. Variants can also be isolated from other wild or cultivated apomictic or non-apomictic plants (and / or from other plants) using known methods such as PCR, stringent hybridization methods, etc. Thus, variants of any one of SEQ ID NOs: 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, and 15 and / or variants of sequences encoding SEQ ID NOs: 1, 6, and 11 also include nucleic acids found naturally (or in nature) in other Taraxacum plants, strains, or cultivars and / or found naturally in other plants.

[0111] For optimal expression in a host or host cell, the coding sequences taught herein can be codon-optimized by adapting codon usage to that which is most preferred in plant genes, particularly native genes of the plant genus or species of interest, using available codon usage tables (e.g., more suitable for expression in the plant of interest), in particular (Bennetzen and Hall, 1982, J. Biol. Chem. 257, 3026-3031; Itakura et al., 1977 Science 198, 1056-1063). Codon usage tables for various plant species are disclosed by, for example, Ikemura (1993, In "Plant Molecular Biology Labfax", Croy, ed., Bios Scientific Publishers Ltd.) and Nakamura et al. (2000, Nucl. Acids Res. 28, 292.) as well as major DNA sequence databases (e.g., EMBL, Heidelberg, Germany). Thus, synthetic DNA sequences can be constructed such that identical or substantially identical proteins can be produced using the synthetic DNA sequences. Several techniques for modifying codon usage to that preferred by the host cell can be found in the patent and scientific literature.The exact method of codon usage modification is not critical to the present invention.

[0112] Minor modifications can be routinely made to any of SEQ ID NOs: 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, and 15 and / or sequences encoding SEQ ID NOs: 1, 6, and 11, or variants thereof, i.e., by random or targeted mutagenesis (e.g., by chemical mutagenesis or CRISPR-endonuclease-mediated mutagenesis). More profound modifications to the sequences as taught herein can be routinely made by de novo DNA synthesis of the desired sequence using available techniques.

[0113] In one embodiment, the nucleic acids of the invention can be modified by adding or deleting one or more amino acids at the N-terminus of the protein so that the N-terminus of the protein of the invention encoded by the nucleic acid has an optimal translation initiation context. It is generally preferred that the protein of the invention expressed in plant cells begins with a Met-Asp or Met-Ala dipeptide to achieve optimal translation initiation. Thus, an Asp or Ala codon can be inserted after the existing Met, or the second codon Val can be replaced by a codon for Asp (GAT or GAC) or Ala (GCT, GCC, GCA or GCG). The nucleotide sequence can also be modified to remove illegal splice sites.

[0114] In one embodiment, the nucleic acid of the invention may have a (genetically) dominant function, preferably provided by (over)expression of a functional protein having the amino acid sequence SEQ ID NO: 1 or a variant or functional fragment thereof, such as an ortholog found in another plant (i.e. other than dandelion or Taraxacum officinale sensu lato) or a fragment thereof.

[0115] Preferably, the nucleic acids of the present invention encode proteins or functional fragments thereof that, when produced in plants, are functional and induce and / or enhance parthenogenesis. For example, when a nucleic acid comprising SEQ ID NO: 3 or 5, or a variant or fragment thereof, is expressed (transcribed and translated) in suitable plant tissues and produces an appropriate amount of the protein of the present invention, parthenogenesis is significantly enhanced compared to plants that differ only in that they lack the nucleic acid. Functionality can also be readily tested by (over)expressing the nucleic acids of the present invention in suitable host plants (such as non-parthenogenic dandelion strains) and analyzing the transformants for parthenogenesis in bioassays (e.g., as described in Example 2). The functionality of the nucleic acids is preferably assessed by comparing test plants in which one or more of these nucleic acids are (over)expressed with control plants that differ from the test plants only in that the control plants lack (over)expression of the nucleic acid. Alternatively, silencing or disruption of the nucleic acids of the present invention associated with parthenogenesis can result in loss of function, i.e., reduced parthenogenesis.

[0116] Nucleic acid of the present invention can be used for producing carrier or plasmid, is used for expressing protein of the present invention in suitable host cell, or is used for silencing one or more endogenous parthenogenetic genes or gene families.Therefore, construct, carrier and / or the plasmid that comprise nucleic acid of the present invention and / or silence construct are also included in the present invention.

[0117] Amino acid sequences according to the present invention

[0118] The present invention provides a PAR protein as defined herein. The present invention also provides a protein associated with plant parthenogenesis, wherein the protein:

[0119] a) encoded by a nucleic acid of the present invention;

[0120] b) having an amino acid sequence of SEQ ID NO: 1, 6 or 11;

[0121] c) is a variant of a) and / or b); and / or

[0122] d) is a fragment of any one of a) to c),

[0123] Preferably, the protein is functional in parthenogenesis.

[0124] In one embodiment, the protein of the invention is:

[0125] a) encoded by a nucleic acid of any one of SEQ ID NOs: 3, 8 or 13;

[0126] b) having an amino acid sequence of SEQ ID NO: 1, 6 or 11;

[0127] c) is a variant of a) and / or b); and / or

[0128] d) is a fragment of any one of a) to c),

[0129] Among them, preferably, the protein of the present invention is suitable for inducing parthenogenesis.

[0130] In one embodiment, the protein of the invention is:

[0131] a) encoded by the nucleic acid of SEQ ID NO: 3 or 5;

[0132] b) having an amino acid sequence of SEQ ID NO: 1;

[0133] c) is a variant of a) and / or b); and / or

[0134] d) is a fragment of any one of a) to c),

[0135] Preferably, the protein of the present invention is suitable for inducing parthenogenesis. The variant is preferably a PAR protein as defined herein. Preferably, the protein or protein fragment is encoded by a nucleic acid of SEQ ID NO: 3 or 5 or a variant and / or fragment thereof, or such protein comprises SEQ ID NO: 1 or a variant and / or fragment thereof. Preferably, the variant comprises or consists of an amino acid sequence that is at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more identical to SEQ ID NO: 1, 6 or 11, respectively, preferably when aligned pairwise using, for example, the Needleman and Wunsch algorithm (global sequence alignment) with default parameters. Variants differ from the provided sequences by deletion, insertion and / or substitution of one or more amino acid residues and include natural and / or synthetic / artificial variants. Variants of proteins having amino acids encoded by the nucleic acids of the present invention, preferably variants of proteins encoded by any one of SEQ ID NOs: 3, 5, 8, 10, 13, 15, or variants of proteins having the amino acid sequence of any one of SEQ ID NOs: 1, 6 or 11, may be homologs or orthologs. Such orthologous proteins encompassed by the present invention may be, but are not limited to, any one of the following PAR proteins: PAR proteins of pineapple (e.g., UniProtKB: A0A199URK4), PAR proteins of Shenzhen orchid (e.g., UniProtKB: A0A2I0AZW3), PAR proteins of Arabidopsis thaliana (e.g., UniProtKB: Q8GXP9, A0A178V2S4, O81793, A0A178V1Q3, A0MFC1,oleracea PAR protein (e.g., UniProtKB: A0A0D3A1Q6 or A0A0D3A1Q3), a PAR protein of rapeseed (e.g., UniProtKB: A0A398AHT1), a PAR protein of turnip (e.g., SEQ ID NO: 40 or SEQ ID NO: 41), a PAR protein of Brachypodium distachyon (e.g., UniProtKB: I1J0D9), a PAR protein of Brassica oleracea var. oleracea (e.g., UniProtKB: A0A0D3A1Q6 or A0A0D3A1Q3), a PAR protein of rapeseed (e.g., UniProtKB: A0A398AHT1), a PAR protein of rapa (e.g., SEQ ID NO: 40 or SEQ ID NO: 41), a PAR protein of 5Z1M1); PAR protein of pigeon pea (e.g., SEQ ID NO: 46); PAR protein of mustard (e.g., UniProtKB: R0H2J1 or R0H0C2); PAR protein of ophiopogon var. melongena (e.g., UniProtKB: A0A1Q3CSK1); PAR protein of chickpea (e.g., UniProtKB: A0A3Q7YBZ1, A0A1S2YZL9, A0A3Q7Y0Z6 or A0A1S2YZM6); or SEQ ID NO: 47), PAR protein of Brassica rapa subgenus Pekinensis (e.g., UniProtKB: M4D574 or M4D571), PAR protein of Brassica oleracea (e.g., UniProtKB: A0A3P6ESB1 or A0A3P6F726), PAR protein of rapeseed (e.g., UniProtKB: A0A3P5ZMM3 or A0A3P5Z1M1); PAR protein of pigeon pea (e.g., SEQ ID NO: 46), PAR protein of Brassica juncea (e.g., UniProtKB: R0H2J1 or R0H0C2), PAR protein of ophiopogon var. melongena (e.g., UniProtKB: A0A1Q3CSK1); PAR protein of chickpea (e.g., UniProtKB: A0A3Q7YBZ1, A0A1S2YZL9, A0A3Q7Y0Z6 or A0A1S2YZM6); or SEQ ID NO: 48). NO: 55, 56 or 57), PAR protein of chicory (e.g., SEQ ID NO: 39), PAR protein of cucumber (e.g., UniProtKB: A0A0A0KGW4 or A0A0A0L0X7), PAR protein of melon (e.g., UniProtKB: A0A1S3BLF2 or A0A1S3B298), PAR protein of cucumber (e.g., UniProtKB: A0A0A0KAW8), PAR protein of pumpkin (e.g., SEQ ID NO: NO: 43), a PAR protein of Cuscuta australis (e.g., UniProtKB: A0A484MGR1), a PAR protein of Dendrobium officinale (e.g., UniProtKB: A0A2I0V7N9, A0A2I0X2T2 or A0A2I0W0Q8), a PAR protein of Heterocarpus fascicularis (e.g., UniProtKB: A0A2Z7D3Y1), a PAR protein of Halona salina (e.g., UniProtKB: V4LSH0; or SEQ ID NO: 44), a PAR protein of Fagus sylvatica (e.g., UniProtKB: A0A2N9E5Y5,A0A2N9HAB9 or A0A2N9H993), a PAR protein of Genlisea aurea (e.g., UniProtKB:S8E1M6), a PAR protein of soybean (e.g., SEQ ID NOs: 51, 52, 53, or 54), a PAR protein of cotton (e.g., UniProtKB:A0A1U8LDU9), a PAR protein of sunflower (e.g., SEQ ID NO: 21), a PAR protein of rubber tree (e.g., SEQ ID NO: 42), a PAR protein of yellow mountain chrysanthemum (e.g., SEQ ID NO: 40), a PAR protein of walnut (e.g., UniProtKB:A0A2I4E6B1), a PAR protein of lettuce (e.g., UniProtKB:A0A2J6KZF7; or SEQ ID NO: 22), a PAR protein of cucurbit (e.g., SEQ ID NO: NO: 48), PAR protein of Medicago truncatula (e.g., UniProtKB: G7K024), PAR protein of Morus alba (e.g., UniProtKB: W9SMY3 or W9SMQ7), PAR protein of Mucuna pruriens (e.g., UniProtKB: A0A371ELJ8), PAR protein of Nicotiana tabacum (e.g., UniProtKB: A0A1J6IQI6), PAR protein of Nicotiana tabacum (e.g., UniProtKB: A0A1U7VXJ0), PAR protein of Nicotiana tabacum (e.g., UniProtKB: A0A1S4A651 or A0A1S3YHQ2), PAR protein of Oryza sativa subsp. Japonica PAR protein (eg UniProtKB: B9FGH8), PAR protein of Oryza brevis (eg UniProtKB: A0A0D3FWX3), PAR protein of millet (eg UniProtKB: A0A3L6Q010 or A0A3L6T1D6), PAR protein of Codonopsis pilosula (eg UniProtKB: A0A2P5BMI5), PAR protein of Populus alba (eg UniProtKB: A0A4U5PSY9), PAR protein of Populus trichocarpa (eg UniProtKB: B9H661), PAR protein of Punica granatum (eg UniProtKB: A0A2I0IBB9,A0A218XB85 or A0A218W102), PAR protein of Senecio cambrensis (e.g., SEQ ID NO: 41), PAR protein of Prunus persica (e.g., SEQ ID NO: 50), Trema orientale PAR protein (e.g., UniProtKB: A0A2P5EB04), PAR protein of Trifolium repens (e.g., UniProtKB: A0A2K3N851), PAR protein of Trifolium repens (e.g., UniProtKB: A0A2Z6MYD3 or A0A2Z6MDR7), PAR protein of Trifolium repens (e.g., UniProtKB: A0A2K3PR44), PAR protein of Vitis vinifera (e.g., UniProtKB: A0A438C778, A0A438ESC4 or A0A438DBR4) and PAR protein of Zea mays (e.g., UniProtKB: A0A1D6HF46, B6UAC5, A0A3L6F4S1, A0A3L6EMC6, A0A3L6EMC6, K7UHQ6 or A0A1D6KHZ4). Such an orthologous protein may also be a PAR protein selected from the group consisting of: PAR protein of kiwi fruit (UniProtKB: A0A2R6S2S9), PAR protein of beet (UniProtKB: XP_010690656.1), PAR protein of potato (UniProtKB: XP_015159151.1), PAR protein of tomato (UniProtKB: A0A3Q7GXB3), PAR protein of Capsicum annuum (UniProtKB: A0A2G2WJR7), PAR protein of eggplant (UniProtKB: AVC18974.1), PAR protein of soybean (Glycine max PAR) (GeneBank accession number: XP_028201014.1, XP_ 006596577.1 or UniprotKB:A0A445M3M6), peanut PAR protein (UniProtKB:A0A444WUX5), bean PAR protein (UniProtKB:V7CIF6), carrot PAR protein (GeneBank accession number: XP_017245413.1), wheat PAR protein (UniProtKB:A0A3B6RP64), rice subspecies indica PAR protein (UniProtKB:A2YH63), rice subspecies japonica PAR protein (UniProtKB:Q5Z7P5) and cocoa PAR protein (UniProtKB:A0A061DL63).

[0136] Therefore, variants of the protein of SEQ ID NO: 1 encompassed by the present invention may be, but are not limited to, any of the orthologous PAR proteins defined herein.

[0137] When present in a plant or plant cell, the PAR proteins of the present invention and / or variants of the proteins having SEQ ID NOs: 1, 6, or 11 are capable of inducing parthenogenesis. The variants of the proteins may be endogenous or non-endogenous proteins of the plant or plant cell. Optionally, the PAR proteins of the present invention and / or variants of the proteins having SEQ ID NOs: 1, 6, or 11 are capable of inducing parthenogenesis when expression of the proteins is altered, preferably increased. Preferably, the altered expression, preferably increased expression, is in an egg cell. The altered or increased expression may be de novo expression of the protein in the plant or plant cell, or may be increased expression of an endogenous protein in the plant or plant cell. Methods for increasing protein expression are known to those skilled in the art. De novo expression of a protein in a plant or plant cell may be induced, for example, by transfecting the plant or plant cell with a construct or vector encoding the protein, introgressing a gene encoding the protein into progeny of the plant or plant cell, and / or by modifying an endogenous sequence resulting in a sequence encoding the protein, for example, by genetic modification. Optionally, this construct or vector comprises a sequence encoding a PAR protein operably linked to an egg cell promoter. Those skilled in the art are aware of egg cell promoters. Exemplary egg cell promoters capable of driving expression in the egg cells of plants include, but are not limited to, promoters of egg cell-specific genes EC1.1, EC1.2, EC1.3, EC1.4, or EC1.5 (see, for example, Sprunck et al. Science, 338: 1093-1097 (2012); AT2G21740; Steffen et al, Plant Journal 51: 281-292 (2007)), Arabidopsis thaliana DD45 promoter (Ohnishi et al. Plant Physiology 165: 1533-1543 (2014)).

[0138] Preferably, the construct or vector of the present invention comprises a sequence encoding a PAR protein operably linked to a regulatory sequence (preferably a promoter sequence) comprising a nucleic acid insert (preferably a double-stranded DNA insert), wherein the length of the insert is 50 to 2000 bp, 100 to 1900 bp, 200 to 1800 bp, 300 to 1700 bp, 400 to 1600 bp, 500 to 1500 bp, 600 to 1400 bp, 1000 to 1400, 1200 to 1400, or 1300 to 1400 bp. Even more preferably, the length of the insert is about 1300 bp. Preferably, the insert is associated with, and optionally functional in, a parthenogenetic phenotype as defined herein. Preferably, the insert is located within a promoter sequence that is located immediately upstream (3') of the sequence encoding the PAR protein, preferably such that the distance between the 3' end of the insert and the start codon of the sequence encoding the PAR protein is 50-200 bp, preferably about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 bp, most preferably about 102 bp. Preferably, the insert is positioned such that the 3' terminal nucleotide of the insert is located at a position homologous to the position of nucleotide 1798 of SEQ ID NO: 2 and / or nucleotide 1798 of SEQ ID NO: 5. Preferably, the insert has no open reading frame. Even more preferably, the insert is a miniature inverted repeat transposable element (MITE) or a MITE-like sequence, wherein the MITE or MITE-like sequence is a non-autonomous element characterized by containing an internal sequence lacking an open reading frame, flanked by terminal inverted repeats (TIRs), and the TIRs are flanked by small direct repeats (target site repeats). For further description of MITEs, TIRs and sequences, reference is made to Guo et al, Scientific Reports. 2017 Jun 1; 7(1): 2634, which is incorporated herein by reference. The insert, preferably the MITE or MITE-like sequence, may have at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more identity to SEQ ID NO: 60. Preferably, the insert is associated with a parthenogenetic phenotype as defined herein, and optionally is functional in the parthenogenetic phenotype. In a further preferred embodiment, the construct or vector of the invention comprises or consists of a regulatory sequence (preferably a promoter sequence) comprising the insert at a position as defined above.Preferably, the construct or vector comprises or consists of a sequence encoding a PAR protein as defined herein, which sequence is operably linked to said promoter sequence, wherein preferably said promoter sequence is located directly upstream of the sequence encoding the PAR protein. Optionally, said construct or vector of the present invention may comprise one or more additional transcriptional regulatory sequences.

[0139] Additionally or alternatively, such a construct or vector comprises a sequence encoding a PAR protein operably linked to the promoter of SEQ ID NO: 2. Altered or increased expression of an endogenous protein can be induced by modifying one or more regulatory sequences operably linked to the coding sequence. For example, a promoter sequence operably linked to a sequence encoding a protein can be modified, for example by genetic modification. In a preferred embodiment, an insert as defined above is introduced into the promoter sequence, preferably at a position as defined above. As described herein, this functionality capable of inducing parthenogenesis can be assessed by a suitable test for functionality in parthenogenesis using a nucleic acid encoding the variant. The protein of the invention may be an isolated protein.

[0140] "Natural variants" are those found in nature, for example, in cultivated or wild lettuce plants and / or other plants. Also included are fragments, i.e., less than full-length peptides of the proteins of the invention, preferably functional fragments, i.e., fragments that are capable of inducing parthenogenesis when expressed in a suitable host plant. Protein fragments as taught herein include peptides comprising or consisting of at least about 10, 20, 30, 40, 50, 100, 150, 200, 250 or more consecutive amino acids of a nucleic acid of the invention, in particular peptides comprising or consisting of at least about 10, 20, 30, 40, 50, 100, 150, 200, 250 or more consecutive amino acids of SEQ ID NO: 1, 6 or 11, or variants thereof (as defined herein). Sequences found in nature are also referred to herein as "wild-type."

[0141] The proteins of the invention can be isolated from natural sources, synthesized de novo by chemical synthesis (using, for example, a peptide synthesizer such as provided by Applied Biosystems), or produced by recombinant host cells by expressing a nucleotide sequence encoding a protein of the invention as taught herein. The proteins of the invention can also be produced by expression from a nucleic acid of the invention as defined herein.

[0142] Protein variants may comprise conservative amino acid substitutions within the basic (e.g., Arg, His, Lys), acidic (e.g., Asp, Glu), non-polar (e.g., Ala, Val, Trp, Leu, Ile, Pro, Met, Phe, Trp) or polar (e.g., Gly, Ser, Thr, Tyr, Cys, Asn, Gln) classes. In addition, non-conservative amino acid substitutions are also within the scope of the present invention.

[0143] Chimeric proteins, such as proteins composed of domains from different sources, such as the N-terminal domain of a protein of SEQ ID NO: 1, 6, or 11 (e.g., obtained from Taxaracum or plant species X) and the middle and / or C-terminal domain of a variant of SEQ ID NO: 1, 6, or 11 (e.g., obtained from Taxaracum or plant species Y or another plant species) are also included herein. Preferably, the chimeric protein is composed of domains from at least two orthologous proteins. Such chimeric proteins can have improved functionality, for example, when expressed in a plant host, they can confer parthenogenesis more efficiently than the native protein.

[0144] The present invention also includes all nucleotide sequences (RNA, cDNA, genomic DNA, etc.) encoding the protein, protein variant or protein fragment of the present invention. Due to the degeneracy of the genetic code, various nucleotide sequences may encode the same amino acid sequence.

[0145] Parthenogenetic plant and preparation method thereof

[0146] In another aspect, the present invention relates to plants (including, for example, plant cells, organs, seeds and plant parts), and methods for preparing plants, which show modified parthenogenesis, optionally transgenic plants having modified (preferably induced) parthenogenesis compared to natural or unmodified plants. Such plants can be prepared using different methods, for example as further described herein. Preferably, the plants of the present invention are obtained by technical means (preferably by the methods described herein). Such technical means are well known to those skilled in the art and include genetic modifications, such as, for example, at least one of random mutagenesis, targeted mutagenesis and nucleic acid insertion.

[0147] Preferably, the plants of the present invention are not obtained by essentially biological methods. Preferably, the plants of the present invention are not obtained solely by essentially biological methods. Preferably, the plants of the present invention are not obtained by any essentially biological method that induces parthenogenesis in a plant, preferably not directly. Preferably, the plants of the present invention are not obtained by any essentially biological method that induces parthenogenesis in a plant. Preferably, the plants of the present invention are not naturally occurring plants, i.e., plants that occur in nature.

[0148] In particular, the present invention provides a method for producing parthenogenetic plants, comprising the steps of:

[0149] a) introducing into one or more plant cells a nucleic acid according to the invention and / or a derivative thereof which is capable of inducing parthenogenesis and / or is functional in parthenogenesis;

[0150] b) optionally selecting a plant cell comprising the nucleic acid, wherein preferably the nucleic acid is integrated into the genome of the plant cell; and

[0151] c) regenerating a plant from said plant cell,

[0152] Preferably, the nucleic acid of the present invention encodes a PAR protein as defined herein (which is functional in parthenogenesis), or is operably linked to a sequence encoding a PAR protein as defined herein (which is functional in parthenogenesis), and / or is any one of SEQ ID NOs: 2-5, or encodes a protein of SEQ ID NO: 1, or a variant or fragment thereof.

[0153] The present invention further provides a method for producing apomictic plants, comprising the steps of:

[0154] a) introducing a nucleic acid according to the invention and / or a derivative thereof into one or more plant cells capable of undergoing incomplete meiosis, which is capable of inducing parthenogenesis;

[0155] b) optionally selecting a plant cell comprising the nucleic acid, wherein preferably the nucleic acid is integrated into the genome of the plant cell; and

[0156] c) regenerating a plant from said plant cell,

[0157] Preferably, the nucleic acid of the present invention encodes a PAR protein as defined herein (which is functional in parthenogenesis), or is operably linked to a sequence encoding a PAR protein as defined herein (which is functional in parthenogenesis), and / or is any one of SEQ ID NOs: 2-5, or encodes the protein of SEQ ID NO: 1, or a variant or fragment thereof. Plant cells capable of undergoing incomplete meiosis can be obtained by introducing a nucleic acid capable of conferring incomplete meiosis. Optionally, the nucleic acid is introduced into the plant cell before, simultaneously with, or after the introduction of the nucleic acid of the present invention.

[0158] The nucleic acid of the present invention can be introduced into one or more plant cells by transformation, gene introgression, somatic hybridization and / or protoplast fusion.This nucleic acid can be an exogenous nucleic acid, i.e. a nucleic acid that does not naturally exist in the plant cell.

[0159] The nucleic acid of the present invention can be introduced into one or more plant cells to obtain the nucleic acid of the present invention by modifying endogenous nucleic acid. The modification of endogenous gene is preferably included in the random or directed mutation of one or more nucleotides in the coding sequence and / or regulating and / or promoter sequence, or for example, the insertion or deletion of a short or larger sequence by homologous recombination, to change the expression of endogenous protein. This method preferably causes one or more endogenous par alleles to be modified into Par alleles as defined herein. Random mutagenesis can be, but is not limited to chemical mutagenesis and gamma radiation. Non-limiting examples of chemical mutagenesis include, but are not limited to EMS (ethyl methanesulfonate), MMS (methyl methanesulfonate), NaN3 (sodium azide), ENU (N-ethyl-N-nitrosourea), AzaC (azacytidine) and NQO (4-nitroquinoline 1-oxide). Optionally, a mutagenesis system such as TILLING (Targeting Induced Local Lesions IN Genomics McCallum et al., 2000, Nat Biotech 18:455, and McCallum et al. 2000, Plant Physiol. 123, 439-442, both of which are incorporated herein by reference) can be used to generate plant lines having modified genes as defined herein. TILLING uses traditional chemical mutagenesis (e.g., EMS mutagenesis) followed by high throughput screening of the mutations. Thus, TILLING can be used to obtain plants, seeds, and tissues comprising genes having one or more desired mutations. Targeted mutagenesis is mutagenesis that can be designed to change a specific nucleotide or nucleic acid sequence, such as, but not limited to, oligonucleotide-directed mutagenesis, RNA-guided endonucleases (e.g., CRISPR technology), TALENs, or zinc finger technology.

[0160] Preferably, the modification is a modification in the promoter sequence of a gene encoding a PAR protein as defined herein. Preferably, the modification introduces or increases the expression of a PAR protein as defined herein. Preferably, the modification introduces or increases the expression of a PAR protein as defined herein in an oocyte.

[0161] Therefore, the method of the present invention may comprise the following steps:

[0162] a) modifying a nucleic acid in one or more plant cells, the nucleic acid being a sequence encoding a protein associated with and / or functional in parthenogenesis, or being operably linked to a sequence encoding a protein associated with and / or functional in parthenogenesis, wherein preferably the nucleic acid is in the genome of the one or more plant cells;

[0163] b) optionally selecting a plant cell comprising the modified nucleic acid; and

[0164] c) regenerating a plant from said plant cell,

[0165] Preferably, the protein associated with and / or functional in parthenogenesis has an amino acid sequence according to the present invention as described above. Preferably, the nucleic acid to be modified in step a) is an endogenous nucleic acid, preferably comprising or consisting of a nucleotide sequence encoding a PAR protein as defined herein and / or a protein having an amino acid sequence of SEQ ID NO: 1, 6 or 11, or operably linked to a sequence encoding a PAR protein as defined herein and / or a protein having an amino acid sequence of SEQ ID NO: 1, 6 or 11, or a variant or fragment thereof.

[0166] In a particularly preferred embodiment, the nucleic acid is a gene encoding a protein related to parthenogenesis as defined herein (5'UTR) promoter sequence. Preferably, the modification is to introduce a nucleic acid inset, preferably a double-stranded DNA inset, wherein the length of the inset is 50 to 2000bp, 100 to 1900bp, 200 to 1800bp, 300 to 1700bp, 400 to 1600bp, 500 to 1500bp, 600 to 1400bp, 1000 to 1400, 1200 to 1400 or 1300 to 1400bp. Even more preferably, the length of the inset is about 1300bp. Preferably, the inset is relevant to the parthenogenesis phenotype as defined herein, and optionally is functional in the parthenogenesis phenotype. Preferably, the insert is introduced into a promoter sequence located immediately upstream (3') of the sequence encoding the PAR protein, preferably such that the distance between the 3' end of the insert and the start codon of the sequence encoding the PAR protein is 50-200 bp, preferably about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 bp, most preferably about 102 bp. Preferably, the insert is introduced such that the 3' terminal nucleotide of the insert is at a position homologous to the position of nucleotide 1798 of SEQ ID NO: 2 and / or nucleotide 1798 of SEQ ID NO: 5. Preferably, the insert has no open reading frame. Even more preferably, the insert is a miniature inverted repeat transposable element (MITE) or a MITE-like sequence, wherein the MITE or MITE-like sequence is a non-autonomous element characterized by containing an internal sequence lacking an open reading frame, flanked by terminal inverted repeats (TIRs), and the TIRs are flanked by small direct repeats (target site repeats). For further description of MITEs, TIRs and sequences, reference is made to Guo et al, Scientific Reports. 2017 Jun 1; 7(1): 2634, which is incorporated herein by reference. The insert, preferably the MITE or MITE-like sequence, may have at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more identity to SEQ ID NO: 60. Preferably, the insert is associated with a parthenogenetic phenotype as defined herein, and optionally is functional in the parthenogenetic phenotype.

[0167] Preferably, the modification of the nucleotide sequence results in the introduction or increased expression of the protein, preferably in an egg cell of a plant regenerated from the plant cell. Preferably, the modified promoter sequence comprises a sequence having at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2.

[0168] In addition, the method of the present invention may comprise the following steps:

[0169] a) modifying a nucleic acid in one or more plant cells capable of undergoing incomplete meiosis, the nucleic acid being a sequence encoding a protein associated with and / or functional in parthenogenesis or being operably linked to a sequence encoding a protein associated with and / or functional in parthenogenesis, wherein preferably, the nucleic acid is in the genome of the one or more plant cells;

[0170] b) optionally selecting a plant cell comprising the modified or altered nucleic acid; and

[0171] c) regenerating a plant from said plant cell,

[0172] Preferably, the protein associated with and / or functional in parthenogenesis has the amino acid sequence of the protein according to the present invention as described above. Preferably, the nucleic acid to be modified in step a) is an endogenous nucleic acid, preferably comprising or consisting of a nucleotide sequence encoding a PAR protein as defined herein and / or a protein having the amino acid sequence of SEQ ID NO: 1, 6 or 11, or operably linked to a sequence encoding a PAR protein as defined herein and / or a protein having the amino acid sequence of SEQ ID NO: 1, 6 or 11, or a variant or fragment thereof. Preferably, the nucleic acid to be modified in step a) is an endogenous nucleic acid.

[0173] In a particularly preferred embodiment, the nucleic acid is a promoter sequence of a gene encoding a protein associated with and / or functional in parthenogenesis as defined herein. Preferably, modification of the nucleotide sequence results in the introduction or increased expression of the protein, preferably in the egg cells of a plant regenerated from the plant cell. Preferably, the modified promoter sequence is a promoter sequence operably linked to a coding sequence for a PAR protein as defined herein. Preferably, the modified promoter sequence is modified to contain an insert as defined above, preferably at a position as defined above.

[0174] Preferably, the modified promoter sequence comprises a sequence having at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:2.

[0175] The present invention also provides a method for producing apomictic hybrid seeds, comprising the following steps:

[0176] a) crossing the sexually propagated first plant with pollen from a second plant to produce F1 hybrid seed; and

[0177] b) optionally selecting seeds comprising an apomictic phenotype from said F1 seeds;

[0178] wherein said first plant and / or second plant is capable of undergoing incomplete meiosis, and wherein said second plant comprises a nucleic acid according to the invention, and wherein said selection is preferably performed by genotyping. Preferably, said second plant comprises a nucleic acid according to the invention, said nucleic acid being any one of SEQ ID NOs: 2-5, or encoding a protein according to SEQ ID NO: 1, or a variant or fragment thereof.

[0179] Nucleic acid of the present invention can be included in a mosaic gene, a genetic construct or a nucleic acid vector. In one embodiment of the invention, nucleic acid of the present invention can be used to prepare a mosaic gene and / or a vector comprising the nucleic acid, for transferring the nucleic acid into a host cell and producing a functional (preferably capable of inducing parthenogenesis) protein encoded by the nucleic acid in the host cell. The vector used to produce this protein (or protein fragment or variant) in a plant cell is referred to as an "expression vector" in this article. The host cell is preferably a plant cell.

[0180] The construction of chimeric genes, constructs and / or vectors for optionally transiently but preferably stably introducing a nucleotide sequence encoding a protein into the genome of a host cell is well known in the art. In order to produce chimeric genes for inducing parthenogenesis and / or improving functionality in parthenogenesis, a nucleotide sequence encoding a protein of SEQ ID NO: 1, 6 or 11 or a functional variant and / or functional fragment thereof can be operably linked to a promoter sequence suitable for expression in a host cell using standard molecular biology techniques. The promoter sequence can already be present in the vector so that the nucleotide sequence encoding the protein can be simply inserted into the vector downstream of the promoter sequence. The vector can then be used to transform the host cell and the nucleic acid and / or chimeric gene of the present invention can be inserted into the nuclear genome or into the plastid, mitochondrial or chloroplast genome and can be expressed in the host cell using a suitable promoter (e.g., Mc Bride et al., 1995; US 5,693,507). In one embodiment, the nucleic acid and / or chimeric gene of the present invention can comprise a suitable promoter for expression in a plant cell or microbial cell (e.g., bacteria) operably linked to a nucleotide sequence encoding a protein of the present invention, optionally followed by a 3' non-translated nucleotide sequence. The coding sequence may optionally be preceded by a 5'UTR sequence. The promoter, 3'UTR, and / or 5'UTR may, for example, be derived from a natural parthenogenetic gene, or may be derived from other sources.

[0181] Nucleic acid (encoding protein that can induce parthenogenesis as taught herein) as taught herein can be stably inserted in the nuclear genome of single plant cell, and the plant cell transformed in this way can be used to produce the plant transformed, and the plant transformed has the phenotype of change owing to the presence of the protein in specific cells at a specific time. In non-limiting examples, the T-DNA vector in Agrobacterium tumefaciens (Agrobacterium tumefaciens) (it comprises the nucleic acid as taught herein, and this nucleic acid encoding is functional protein in parthenogenesis as taught herein) can be used to transform plant cell, then, can use for example EP 0116718, EP 0270822, PCT to publish WO84 / 02913 and the program described in the European patent application EP0242246 of announcement and Gould etc. (1991) from the plant cell regeneration transformed plant. The construction of the T-DNA vector for plant transformation mediated by Agrobacterium (Agrobacterium) is well known in the art. The T-DNA vector may be a binary vector as described in EP 0 120 561 and EP 0 120 515 or a co-integrative vector which can be integrated into the Agrobacterium Ti-plasmid by homologous recombination as described in EP 0 116 718. Lettuce transformation protocols have been described, for example, in Michelmore et al. (1987) and Chupeau et al. (1989).

[0182] Preferred T-DNA vectors contain a promoter operably linked to a nucleotide sequence encoding a protein of the present invention; for example, the promoter is operably linked to the nucleotide sequence of SEQ ID NO: 3, or a variant or functional fragment thereof, and is located between the T-DNA border sequences, or at least to the left of the right border sequence. Preferably, the promoter comprises a nucleic acid insert (preferably a double-stranded DNA insert), wherein the insert is 50 to 2000 bp, 100 to 1900 bp, 200 to 1800 bp, 300 to 1700 bp, 400 to 1600 bp, 500 to 1500 bp, 600 to 1400 bp, 1000 to 1400, 1200 to 1400, or 1300 to 1400 bp in length. Even more preferably, the insert is about 1300 bp in length. Preferably, the insert is associated with, and optionally functional in, a parthenogenetic phenotype as defined herein. Preferably, the insert is located within a promoter sequence that is located immediately upstream (3') of the sequence encoding the PAR protein, preferably such that the distance between the 3' end of the insert and the start codon of the sequence encoding the PAR protein is 50-200 bp, preferably about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 bp, most preferably about 102 bp. Preferably, the insert is positioned such that the 3' terminal nucleotide of the insert is located at a position homologous to the position of nucleotide 1798 of SEQ ID NO: 2 and / or nucleotide 1798 of SEQ ID NO: 5. Preferably, the insert has no open reading frame. Even more preferably, the insert is a miniature inverted repeat transposable element (MITE) or a MITE-like sequence, wherein the MITE or MITE-like sequence is a non-autonomous element characterized by containing an internal sequence lacking an open reading frame, flanked by terminal inverted repeats (TIRs), and the TIRs are flanked by small direct repeats (target site repeats). For further description of MITEs, TIRs and sequences, reference is made to Guo et al, Scientific Reports. 2017 Jun 1; 7(1): 2634, which is incorporated herein by reference. The insert, preferably the MITE or MITE-like sequence, may have at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more identity to SEQ ID NO: 60. Preferably, the insert is associated with a parthenogenetic phenotype as defined herein, and optionally is functional in the parthenogenetic phenotype. In a further preferred embodiment, the T-DNA vector comprises or consists of a regulatory sequence, preferably a promoter sequence, comprising the insert at a position as defined above.Preferably, the T-DNA vector comprises or consists of a sequence encoding a PAR protein as defined herein, which is operably linked to the promoter sequence, wherein preferably, the promoter sequence is located directly upstream of the sequence encoding the PAR protein. Optionally, the T-DNA vector may comprise one or more additional transcriptional regulatory sequences.

[0183] Border sequences are described by Gielen et al. (1984). Of course, other types of vectors can be used to transform plant cells using procedures such as direct gene transfer (as described in, for example, EP 0 223 247), pollen-mediated transformation (as described in, for example, EP 0 270 356 and WO 85 / 01856), protoplast transformation (as described in, for example, US 4,684,611), plant RNA virus-mediated transformation (as described in, for example, EP 0 067 553 and US 4,407,956), liposome-mediated transformation (as described in, for example, US 4,536,475), and other methods.

[0184] In another embodiment, the nucleic acid of the present invention can be introduced by somatic hybridization. Somatic hybridization can be performed by protoplast fusion (see, for example, Holmes, 2018).

[0185] The nucleic acids of the present invention can also be integrated into the genome, for example, by introducing double-strand breaks at appropriate sites in the genome using one or more specific nucleases (such as CRISPR-endonuclease / guide RNA complexes), and by integrating into the genome using donor constructs comprising the nucleic acids of the present invention. Those skilled in the art know how to design such CRISPR-endonuclease / guide RNA complexes to introduce double-strand breaks and donor constructs suitable for integration (for review, see Bortesi and Fischer, 2015).

[0186] Alternatively, plants can be transformed by altering the endogenous nucleotide sequence, thereby, for example, converting one or more par alleles contained in the plant into one or more Par alleles by random or directed mutagenesis. The mutagenesis may involve mutagenesis of the coding sequence, but may also include mutagenesis of regulatory sequences such as promoter sequences, 5'UTRs and / or 3'UTRs. The endogenous 5'UTR promoter nucleotide sequence of the par allele may be modified to include an insert as defined above, preferably at a position as defined above.

[0187] Likewise, selection and regeneration of transformed plants from transformed cells are well known in the art. Obviously, for different species, even for different varieties or cultivars of a single species, protocols are particularly suitable for high-frequency regeneration of transformants. The present invention also includes offspring of transformed plants that exhibit parthenogenesis and comprise nucleic acids and / or proteins of the present invention.

[0188] In addition to transformation of the nuclear genome, the present invention also includes transformation of the plastid genome (preferably the chloroplast genome). An advantage of plastid genome transformation is that the risk of transgene spread can be reduced. Plastid genome transformation can be performed as known in the art, see, for example, Sidorov et al. (1999) or Lutz et al. (2004).

[0189] The resulting transformed plants can be used in conventional plant breeding programs to produce more transformed plants containing the transgene. Single copy transformants can be analyzed using, for example, Southern blot analysis or PCR-based methods or Technology assay (Third Wave Technologies, Inc.) selection. By the presence of the nucleic acids or proteins and / or chimeric genes of the present invention, transformed cells and plants can be easily distinguished from untransformed cells and plants. The plant DNA sequences flanking the transgenic insertion site can also be sequenced, thereby allowing the development of "event-specific" detection methods for routine use. See, for example, WO0141558, which describes superior event detection kits (e.g., PCR detection kits) based on, for example, integration sequences and flanking (genomic) sequences.

[0190] The nucleic acid of the present invention can be inserted into the plant cell genome such that the inserted coding sequence is downstream (i.e., 3') of a promoter and under its control, said promoter being able to direct expression in the plant cell. This is preferably achieved by inserting a chimeric gene comprising these elements into the plant cell genome, particularly in the nuclear or plastid (e.g., chloroplast) genome.

[0191] The promoter (which is operably linked to SEQ ID NO: 3 or a variant or fragment thereof) can, for example, be a constitutively active promoter, such as: the strong constitutive 35S promoter or enhanced 35S promoter ("35S promoter") of cauliflower mosaic virus (CaMV) isolates CM1841 (Gardner et al., 1981), CabbB-S (Franck et al., 1980), and CabbB-JI (Hull and Howell, 1987); the 35S promoter described in Odell et al. (1985) or in US Pat. No. 5,164,316; a promoter from the ubiquitin family (e.g., the maize ubiquitin promoter, Christensen et al., 1992; EP 0 342 926; see also Cornejo et al., 1993); the gos2 promoter (de Pater et al., 1992), the emu promoter (Last et al., 1990), an Arabidopsis actin promoter such as that described by An et al. (1996), a rice actin promoter such as that described by Zhang et al. (1991) and that described in US 5,641,876 or the rice actin 2 promoter as described in WO070067; the promoter of Cassava vein mosaic virus (WO97 / 48819, Verdaguer et al., 1998), Subterranean Clover Stunt Virus (SUSV) Virus) pPLEX series promoters (WO96 / 06932, in particular the S7 promoter), alcohol dehydrogenase promoters, such as pAdh1S (GenBank accession numbers X04049, X00581), and TR1' promoter and TR2' promoter (respectively "TR1' promoter" and "TR2' promoter"), which drive the expression of 1' and 2' genes of T-DNA, respectively (Velten et al., 1984), the Figwort Mosaic Virus promoter described in US6051753 and EP426641, histone gene promoters such as the Arabidopsis thaliana Ph4a748 promoter (PMB 8: 179-191), and the like.

[0192] Alternatively, promoters can be used which are not constitutive but are specific for one or more tissues or organs of a plant (tissue-preferred / tissue-specific, including developmentally regulated promoters), such as egg cell-specific promoters, whereby the protein of the invention is expressed only or preferentially in cells of a specific tissue or organ and / or only during a specific developmental stage.

[0193] Since constitutive production of the protein of the present invention has high costs in terms of plant fitness, it is preferred in one embodiment to use a promoter whose activity is inducible. Examples of inducible promoters are wound-inducible promoters, such as the MPI promoter described by Cordera et al. (1994), which is induced by wounds (such as caused by insects or physical damage), or the COMPTII promoter (WO0056897) or the PR1 promoter described in US6031151. Alternatively, the promoter can be induced by chemicals, such as dexamethasone or tetracycline described in Aoyama and Chua (1997) and US6063985 (TOPFREE or TOP 10 promoters, see Gatz, 1997 and Love et al., 2000).

[0194] The term "inducible" does not necessarily require that the promoter be completely inactive in the absence of inducer stimulation. A low level of non-specific activity may be present, as long as this does not lead to significant yield or quality losses in the plant. Therefore, inducibility preferably refers to an increase in promoter activity, resulting in increased transcription of the downstream coding region encoding the protein of the present invention after contact with the inducer.

[0195] In one embodiment, the promoter of natural parthenogenesis gene is used.For example, the promoter of dandelion Par or par allele can be separated and operably connected with the coding region of encoding protein of the present invention.In one embodiment, described promoter (upstream transcriptional regulatory region, for example in about 2000bp upstream of translation start codon and / or transcription start codon) can use known method (such as TAIL-PCR (Liu etc., 1995; Liu etc., 2005), Linker-PCR or inverse PCR (IPCR)) from apomictic plant and / or other plant separation.

[0196] In one embodiment, a promoter of a natural parthenogenesis gene or a promoter derived therefrom is used. For example, a promoter derived from SEQ ID NO: 2 or a variant or fragment thereof can be used. Preferably, the promoter is a promoter comprising a nucleic acid insert (preferably a double-stranded DNA insert), wherein the length of the insert is 50 to 2000bp, 100 to 1900bp, 200 to 1800bp, 300 to 1700bp, 400 to 1600bp, 500 to 1500bp, 600 to 1400bp, 1000 to 1400, 1200 to 1400 or 1300 to 1400bp. Even more preferably, the length of the insert is about 1300bp. Preferably, the insert is associated with a parthenogenesis phenotype as defined herein, and is optionally functional in a parthenogenesis phenotype. Preferably, the insert is located within a promoter sequence that is located immediately upstream (3') of the sequence encoding the PAR protein, preferably such that the distance between the 3' end of the insert and the start codon of the sequence encoding the PAR protein is 50-200 bp, preferably about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 bp, most preferably about 102 bp. Preferably, the insert is positioned such that the 3' terminal nucleotide of the insert is located at a position homologous to the position of nucleotide 1798 of SEQ ID NO: 2 and / or nucleotide 1798 of SEQ ID NO: 5. Preferably, the insert has no open reading frame. Even more preferably, the insert is a miniature inverted repeat transposable element (MITE) or a MITE-like sequence, wherein the MITE or MITE-like sequence is a non-autonomous element characterized by containing an internal sequence lacking an open reading frame, flanked by terminal inverted repeats (TIRs), and the TIRs are flanked by small direct repeats (target site repeats). For further description of MITEs, TIRs and sequences, reference is made to Guo et al., Scientific Reports. 2017 Jun 1; 7(1): 2634, which is incorporated herein by reference. The insert, preferably the MITE or MITE-like sequence, may have at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more identity to SEQ ID NO: 60. Preferably, the insert is associated with a parthenogenetic phenotype as defined herein, and optionally is functional in the parthenogenetic phenotype. The promoter may have the nucleotide sequence of SEQ ID NO: 2. Longer sequences than those mentioned herein may also be used. The region up to about 2000 bp upstream of the translation start codon of the coding region may contain transcriptional regulatory elements (ie, promoter).Thus, in one embodiment, a nucleotide sequence 2000 bp, 1500 bp, 1000 bp, 800 bp, 500 bp, 300 bp or less upstream of the translation start codon of a sequence encoding a protein of the invention is isolated and tested for promoter activity, and if functional, the sequence can be operably linked to a sequence encoding a protein of the invention as taught herein. The promoter activity of the entire sequence and fragments thereof can be tested, for example, by deletion analysis, wherein the 5' and / or 3' portion is deleted, and promoter activity is tested using known methods (e.g., by operably linking the promoter or fragment to a reporter gene).

[0197] The coding sequences taught herein are preferably inserted into the plant genome such that the coding sequence is upstream (i.e., 5') of a suitable 3' untranslated region ("3' end" or 3' UTR). Suitable 3' ends include those of the CaMV 35S gene ("3'35S"), the nopaline synthase gene ("3'nos") (Depicker et al., 1982), the octopine synthase gene ("3'ocs") (Gielen et al., 1984), and the T-DNA gene 7 ("3' gene 7") (Velten and Schell, 1985), which serve as 3'-untranslated DNA sequences in transformed plant cells, among others. In one embodiment, a 3' UTR of a natural parthenogenetic gene or a 3' UTR derived therefrom is used. For example, any 3' UTR derived from SEQ ID NO: 4 or a variant or fragment thereof can be used. The 3' UTR may have the nucleotide sequence of SEQ ID NO: 4.

[0198] In one embodiment, a promoter having the nucleotide sequence of SEQ ID NO: 2, or a variant and / or fragment thereof, can be operably linked to a nucleic acid encoding a protein of the present invention. Preferably, the nucleotide sequence encoding the protein is capable of inducing parthenogenesis as taught herein, and more preferably has the amino acid sequence of SEQ ID NO: 1, or a variant and / or fragment thereof. Preferably, the promoter and coding sequence are further operably linked to the 3'UTR of SEQ ID NO: 4, or a variant and / or fragment thereof.

[0199] Introduction of the T-DNA vector into Agrobacterium can be performed using known methods such as electroporation or triparental mating.

[0200] The coding sequences as taught herein can optionally be inserted into the plant genome as a hybrid gene sequence whereby the coding sequence is linked in-frame to a gene encoding a selectable or scorable marker ( US 5,254,799 ; Vaeck et al., 1987 ), such as, for example, the neo (or nptII) gene encoding kanamycin resistance ( EP 0 242 236 ), so that the plant expresses an easily detectable fusion protein.

[0201] All or part of the sequence encoding the protein of the present invention can also be used to transform microorganisms, such as bacteria (e.g., Escherichia coli, Pseudomonas, Agrobacterium, Bacillus, etc.), fungi, algae, or insects, or to prepare recombinant viruses. This is particularly suitable for the production and subsequent purification of proteins (preferably isolated proteins). Transformation of bacteria (which have all or part of the coding sequence taught herein, incorporated into a suitable cloning vector) can be carried out in a conventional manner, preferably using conventional electroporation techniques described in Maillon et al. (1989) and WO 90 / 06999. For expression in prokaryotic host cells, the codon usage of the nucleotide sequence can be optimized accordingly (as described herein for plants). Intron sequences should be removed, and other adjustments for optimal expression can be made as known. Such prokaryotic host cells comprising the nucleic acids of the present invention and / or expressing the proteins of the present invention are included in the present invention. Such host cells can be used to produce the proteins and / or nucleic acids of the present invention.

[0202] The DNA sequence of the nucleic acids of the invention can be further altered in a translationally neutral manner to modify inhibitory DNA sequences that may be present in the gene part and / or by introducing changes in codon usage, for example, to adapt the codon usage to that which is most preferred by the plant, preferably by that of a particular relevant plant genus, for example a host plant as described herein.

[0203] According to one embodiment of the present invention, the protein of the present invention is targeted to intracellular organelles such as plastids, preferably chloroplasts, mitochondria, or secreted from the cell, potentially optimizing protein stability and / or expression. Similarly, the protein can be targeted to the vacuole. To this end, in one embodiment of the present invention, the chimeric gene of the present invention comprises a coding region encoding a signal or targeting peptide, which is connected to the region encoding the protein of the present invention. Particularly preferred peptides included in the protein of the present invention are transit peptides for chloroplast or other plastid targeting, especially repeat transit peptide regions from plant genes whose gene products are targeted to plastids, the optimized transit peptides of Capellades et al. (US 5,635,618), the transit peptide of spinach ferredoxin-NADP+ oxidoreductase (Oelmuller et al., 1993), the transit peptides described in Wong et al. (1992), and the targeting peptides in published PCT patent application WO 00 / 26371. Also preferred are peptides that signal the secretion of proteins to which such peptides are linked extracellularly, such as the secretion signal of potato proteinase inhibitor II (Keil et al., 1986), the secretion signal of the rice α-amylase 3 gene (Sutliff et al., 1991), and the secretion signal of tobacco PR1 protein (Cornelissen et al., 1986). Particularly useful signal peptides according to the present invention include chloroplast transit peptides (e.g., Van Den Broeck et al., 1985), or the optimized chloroplast transit peptides of US 5,510,471 and US 5,635,618 (which transport proteins to chloroplasts), secretory signal peptides, or peptides that target proteins to other plastids, mitochondria, ER, or another organelle. Signal sequences that target intracellular organelles or plant cell secretion or cell wall are present in proteins that are naturally targeted or secreted, preferably et al. (1989), and Weil (1991), Neuhaus & Rogers (1998), Bih et al. (1999), Morris et al. (1999), Hesse et al. (1989), Tavladoraki et al. (1998), Terashima et al. (1999), Park et al. (1997), Shcherban et al. (1995).

[0204] In one embodiment, a protein of the invention as taught herein is co-expressed with other proteins that control (preferably enhance or induce) parthenogenesis, incomplete meiosis, or apomixis in a single host, optionally under the control of different promoters. Such other genes may be genes that confer incomplete meiosis, such as, for example, diploid spore reproduction as described in WO 2017 / 039452 A1 (incorporated herein by reference).

[0205] In another embodiment, the protein of the invention is introgressed into germplasm, which preferably contains other genes of interest, such as genes that confer incomplete meiosis (e.g., genes for diploid spore reproduction). By hybridization and selection, hybrids are produced in which several genes of interest are stacked.

[0206] Co-expression host plants can be easily obtained by transforming plants that have expressed proteins of the present invention, or by hybridizing with plants transformed with different nucleic acids of the present invention. It should be understood that different proteins can be expressed in the same plant, or each can be expressed in a single plant and then combined in the same plant by hybridizing the single plants with each other. For example, in hybrid seed production, each parent plant can express each protein that needs to be co-expressed. After hybridizing the parent plants to produce hybrids, the two proteins are combined in the hybrid plant. The present invention includes such hybrids or their offspring comprising these two genes and / or expressing these two proteins.

[0207] Preferably, for selection purposes and weed control selection, the transgenic plants of the present invention are also bred with a gene encoding a gene that confers a herbicide such as a broad spectrum herbicide, for example a herbicide based on glufosinate ammonium as the active ingredient (e.g. or BASTA; resistance is conferred by the PAT or bar gene; see EP 0 242 236 and EP 0 242 246) or glyphosate (e.g. Resistance is conferred by the EPSPS gene, see for example EP 0 508 909 and EP 0 507 698). The use of a herbicide resistance gene (or other gene conferring a desired phenotype) as a selectable marker also has the advantage of avoiding the introduction of antibiotic resistance genes.

[0208] Alternatively or in addition, other selectable marker genes, such as antibiotic resistance genes, can be used. Because it is usually not accepted to retain antibiotic resistance genes in the host plant of conversion, these genes can be removed again after selecting transformant. There are different techniques for removing transgenic. A method of realizing removal is to add lox sites in the transgenic flank, and after selection, the transformed plant is hybridized with the plant expressing CRE recombinase (see, for example, EP506763B1). Site-specific recombination causes the excision of marker genes. Another site-specific recombination system is the FLP / FRT system described in EP686191 and US5527695. Site-specific recombination systems such as CRE / LOX and FLP / FRT can also be used for gene stacking purposes. In addition, a single component excision system has been described, see, for example, WO9737012 or WO9500555).

[0209] Preferably, the nucleic acids of the present invention are used to produce transgenic plant cells, plants, plant seeds, etc., and any derivatives / progeny thereof, having an enhanced parthenogenesis phenotype. Transgenic plants having enhanced parthenogenesis can be produced by transforming plant host cells with a nucleic acid of the present invention (preferably encoding a protein having the amino acid sequence of SEQ ID NO: 1, or variants and / or fragments thereof, under the control of a suitable promoter (as described herein)) and regenerating transgenic plants from said cells. Preferably, the transgenic plants of the present invention exhibit enhanced parthenogenesis compared to an untransformed or empty vector control. Thus, for example, transgenic lettuce plants exhibiting enhanced parthenogenesis are provided. Thus, a transformed plant expressing a protein of the present invention exhibits enhanced parthenogenesis if it exhibits a significant increase in parthenogenesis compared to an untransformed or empty vector-transformed control. The enhanced parthenogenesis phenotype can be fine-tuned by expressing an appropriate amount of a protein of the present invention capable of inducing parthenogenesis at an appropriate time and / or location. Such fine-tuning can be performed by determining the most suitable promoter and / or by selecting transgenic "events" that exhibit the desired expression level.

[0210] Transformants, hybrids or inbred lines expressing the desired level of a protein of the invention and / or comprising the desired or desired level of a nucleic acid of the invention are selected by, for example, analyzing copy number (Southern blot analysis), mRNA transcript levels (e.g., RT-PCR using primer pairs or flanking primers capable of amplifying the protein of the invention), or by analyzing the presence and levels of the parthenogenetic protein in various tissues (e.g., SDS-PAGE; ELISA assays, etc.). Single-copy transformants can be selected, for example, for regulatory reasons, and the sequences flanking the transgenic insertion site are analyzed, preferably sequenced, to characterize the "event." Transgenic events that result in high or moderate expression of a protein of the invention are selected for further development until high-performance, superior events with stable transgenes are obtained.

[0211] Transformants expressing protein of the present invention and / or comprising nucleic acid of the present invention can also comprise other transgenes, such as conferring disease resistance or conferring tolerance to other biological and / or abiotic stresses or conferring other genes of diploid spore reproduction. In order to obtain this plant with "stacked" transgene, other transgenes can be introduced into the transformant, or the transformant can be transformed with one or more other genes subsequently, or plant lines or variants can be transformed with several mosaic genes. For example, several transgenes can be present on a single vector, or can be present on different vectors of co-transformation.

[0212] In one embodiment, the following genes are combined with the nucleic acids of the invention: known disease resistance genes, in particular genes that confer enhanced resistance to necrotic pathogens, viral resistance genes, insect resistance genes, abiotic stress resistance genes (e.g., drought tolerance, salt tolerance, heat or cold tolerance, etc.), herbicide resistance genes, etc. Thus, the stacked transformants can have a wider range of biotic and / or abiotic stress tolerance to pathogen resistance, insect resistance, nematode resistance, salinity, cold stress, heat stress, water stress, etc. In addition, silencing methods can be combined with expression methods in a single plant, for example, silencing of a Par allele can be combined with expression of a par allele, or vice versa.

[0213] Optionally, nucleic acid of the present invention can be used to suppress parthenogenesis, for example, by silencing, striking down or reducing the expression of the parthenogenesis gene on one or more Par allelopathic genes in a plant or plant cell. This can be present in the Par allelopathic coding sequence or one or more regulatory sequences (for example promoter sequence) in the plant or plant cell by modifying, or by introducing the RNAi targeted transcript of the Par allelopathic genes. Therefore, the present invention also provides a method for reducing or eliminating parthenogenesis in a plant or plant cell, comprising the following steps:

[0214] a) reducing or eliminating the expression of a nucleic acid capable of inducing parthenogenesis and / or being functional in parthenogenesis in one or more plant cells;

[0215] b) selecting plant cells wherein said expression is reduced or eliminated; and

[0216] c) regenerating a plant from said plant cell.

[0217] The nucleic acid is preferably a nucleic acid comprising or consisting of any one of SEQ ID NOs: 2-5 and variants and / or fragments thereof, and / or a nucleic acid encoding the protein of SEQ ID NO: 1, and / or variants or fragments thereof.

[0218] Whole plants, plant parts (e.g., seeds, cells, tissues), and plant products (e.g., fruits) and progeny of any transformed plant described herein are included herein and can be identified by the presence of the transgene, for example, by PCR analysis using total genomic DNA as a template and using PCR primer pairs specific for the parthenogenetic gene and / or by using genomic variation analysis (such as, but not limited to, sequence-based genotyping (SBG) or SNPSelect analysis. "Event-specific" PCR diagnostic methods can also be developed, where the PCR primers are based on the plant DNA flanking the inserted transgene, see US6563026. Similarly, event-specific AFLP fingerprints or RFLP fingerprints can be developed that identify transgenic plants or any plants, seeds, tissues, or cells derived therefrom.

[0219] It will be appreciated that the transgenic plants according to the present invention preferably do not exhibit undesirable phenotypes, such as reduced yield, increased susceptibility to disease (particularly necrotrophs) or undesirable structural changes (dwarfing, deformation), etc., and that if such phenotypes are observed in primary transformants, they can be removed by conventional methods. Any transgenic plant described herein may be heterozygous, homozygous or hemizygous for the transgene.

[0220] The present invention further relates to plants, seeds, plant parts (e.g., plant cells) and plant products obtained or obtainable by the methods described in detail herein, preferably comprising a protein of the present invention, a nucleic acid of the present invention and / or a construct of the present invention. Preferably, the protein, nucleic acid and / or construct can induce parthenogenesis and / or are functional in parthenogenesis, as described in detail herein. The plant of the present invention is preferably a species listed as a suitable host plant herein. This method comprises infiltrating the nucleic acid of the present invention into offspring from a plant, and / or transforming a plant cell as a transgenic plant with the nucleic acid of the present invention, and subsequently regenerating a plant from the plant cell. Preferably, the plant, plant part and / or plant product is not a Taraxacumofficinale sensu lato species, which comprises a nucleic acid of the present invention, wherein the plant or plant cell is preferably a species listed as a suitable host plant herein, preferably from a family selected from the family Cruciferae, Cucurbitaceae, Leguminosae, Gramineae, Solanaceae and Asteraceae (Asteraceae) (Compositae).

[0221] Preferably, plant, plant part and / or plant product comprise nucleic acid of the present invention by genetic modification or by gene infiltration, wherein preferably, said nucleic acid is integrated in its genome.Preferably, said plant, plant part and / or plant product can parthenogenesis and / or is functional in parthenogenesis.Even more preferably, said plant, plant part and / or plant product further can carry out incomplete meiosis.The invention provides seed, plant part or plant product of plant of the present invention or vegetable cell.

[0222] The present invention also relates to plant parts and plant products derived from the plants of the present invention, wherein the plant parts and / or plant products comprise a protein of the present invention as defined herein, a nucleic acid of the present invention as defined herein and / or a construct of the present invention as defined herein, which may be a fragment as defined herein that allows assessment of the presence of such protein, nucleic acid or construct in the plant from which the plant part of the plant product is derived. Such parts and / or products may be seeds or fruits and / or products derived therefrom (e.g., sugars or proteins). Such parts, products and / or products derived therefrom may be non-breeding material.

[0223] Any plant can be a suitable host, but most preferably, the host plant species should be a plant species that will benefit from enhanced or reduced parthenogenesis. Suitable hosts include any plant species. In particular, cultivars or breeding lines with good agronomic properties are preferred. Those skilled in the art know how to test whether the nucleic acids and / or proteins taught herein, and / or their variants or fragments, can confer an increase or decrease in the parthenogenesis required for the host plant by producing transgenic plants and assessing parthenogenesis, as well as suitable control plants.

[0224] Suitable host plants include, for example, hosts belonging to the families Cruciferae, Cucurbitaceae, Leguminosae, Gramineae, Solanaceae, Compositae, Rosaceae, or Poaceae.

[0225] In a preferred embodiment, the host plant can be a plant species selected from the group consisting of Taraxacum, Lactuca, Pisum, Capsicum, Solanum, Cucumis, Zea, Gossypium, Glycine, Triticum, Oryza, and Sorghum.

[0226] In a preferred embodiment, the plant, plant part, plant cell or seed as taught herein is from a species selected from the group consisting of Taraxacum, Lactuca, Pisum, Capsicum, Solanum, Cucumber, Zea, Gossypium, Glycine max, Triticum, Oryza, Allium, Brassica, Helianthus annuus, Beta vulgaris, Cichorium, Chrysanthemum, Pennisetum, Secale, Hordeum, Medicago, Phaseolus, Rosa, Lilium, Coffea, Linum, Hemp, Cassava, Daucus, Cucurbita, Citrullus and Sorghum.

[0227] Suitable host plants include, for example, maize / corn (Zea mays species), wheat (Triticum species), barley (e.g., Hordeum vulgare), oats (e.g., Avena sativa), sorghum (Sorghum bicolor), rye (Secale cereale), soybean (Glycine max species, e.g., G. max), cotton (Gossypium species, e.g., G. hirsutum, G. barbadense), Brassica species (e.g., B. napus, B. juncea, B. oleracea, B. rapa, etc.), sunflower (Helianthus annus), safflower, yam, cassava, alfalfa (Medicago sativa), rice (Oryza sativa species, e.g., O. sativa L.), and rice (Oryza sativa L.). indica or japonica), forage grasses, pearl millet (Pennisetum species, such as P. glaucum), tree species (pine, poplar, fir, plantain, etc.), tea, coffee, oil palm, coconut, vegetable species such as peas, zucchini, beans (e.g., Phaseolus species), peppers, cucumbers, artichokes, asparagus, eggplant, broccoli, garlic, leeks, lettuce, onions, radishes, turnips, potatoes, Brussels sprouts, carrots, cauliflower, endive, celery , spinach, chicory, fennel, beets, fleshy fruit plants (grapes, peaches, plums, strawberries, mangoes, apples, plums, cherries, apricots, bananas, blackberries, blueberries, citrus, kiwi, figs, lemons, limes, nectarines, raspberries, watermelons, oranges, grapefruits, etc.), ornamental plants (e.g., roses, petunias, chrysanthemums, lilies, gerbera species), herbs (mint, parsley, basil, thyme, etc.), woody trees (e.g., species of Populus, Willow, Quercus, Eucalyptus), fiber species such as flax (Linum usitatissimum) and hemp (Cannabis sativa).

[0228] Marker-assisted selection and transfer of one or more Par alleles or a combination

[0229] The nucleic acids of the present invention can be used as genetic markers for marker-assisted selection of Par or par alleles in Taraxacum species and / or other plant species and for transferring and / or combining different or identical Par or par alleles into / in plants of interest and / or in plants that can be used to produce intraspecific or interspecific hybrids with plants in which the Par or par alleles (or variants) are found.

[0230] Many different markers can be developed based on these sequences to determine.The exploitation of marker determination generally relates to the identification of the polymorphism between Par and the par allele, so that polymorphism is the genetic marker of " mark " specific allele.Then polymorphism is used for marker determination.For example, the allelic sequence of Par as taught herein is relevant to the existence of parthenogenesis or enhancing.This is for example by screening the plant material of parthenogenesis and / or the plant material of non-parthenogenesis for the nucleotide sequence (part) of Par or par allele as taught herein so that specific allele is relevant to parthenogenesis or non-parthenogenesis to carry out.Therefore, PCR primers or probes can be produced, which detect this type of nucleotide sequence in the sample (for example RNA, cDNA or genomic DNA sample) obtained from the plant material of (non-) parthenogenesis.Comparative sequence or its part, and identify the polymorphic marker relevant to parthenogenesis.Then the polymorphic marker, for example the SNP mark connected with Par or par allele can be developed into rapid molecular assay, for the existence or not of parthenogenesis allele in screening plant material. Therefore, the presence or absence of these "genetic markers" indicates the presence of the Par or par allele to which they are linked, and detection of the genetic markers can be used in place of detection of the Par or par allele.

[0231] Preferably, an easy and rapid marker assay is used that allows for rapid detection of Par or par alleles or allele combinations in a sample (e.g., a DNA sample). Thus, in one embodiment, provided herein are uses of nucleic acids of the invention for determining the presence or absence of Par or par alleles in a sample, and / or for determining the homozygosity or heterozygosity of the alleles in a molecular assay.

[0232] Such an assay may, for example, comprise the following steps:

[0233] (a) providing parthenogenetic and non-parthenogenetic plant materials and / or nucleic acid samples thereof;

[0234] (b) determining the nucleotide sequence of all or part of the nucleic acid of the present invention in the material of (a).

[0235] In one aspect, PCR primers and / or probes, molecular markers, and kits for detecting nucleic acids of the invention or related or derived RNA sequences (such as transcripts) are provided. Degenerate or specific PCR primer pairs for amplifying nucleic acids of the invention from a sample can be synthesized based on the nucleotide sequences taught herein or variants thereof, as known in the art (see Dieffenbach and Dveksler, 1995; and McPherson et al., 2000). For example, any stretch of 9, 10, 11, 12, 13, 14, 15, 16, 18 or more consecutive nucleotides of the sequence (or complementary strand) can be used as a primer or probe.

[0236] In some embodiments, the present invention provides the Par or par allele sequence or its complementary sequence that comprises this paper instruction.The DNA fragmentation that comprises the Par or par allele sequence or its complementary sequence that comprises this paper instruction can be used as hybridization probe.Detection kit provided herein can comprise Par (allele-) specific primer and / or Par (allele-) specific probe, and uses the relevant scheme of nucleic acid of the present invention in primer or probe detection sample.This detection kit can for example be used to determine whether plant has been transformed with nucleic acid of the present invention, or for screening the existence of Par allele in Taraxacum germplasm and / or other plant species germplasm and optionally zygosity mensuration.

[0237] Therefore, in one embodiment, a method for detecting the presence or absence of a nucleotide sequence encoding a protein of the present invention in a plant tissue (e.g., dandelion tissue) or a nucleic acid sample thereof is provided. The method may comprise:

[0238] a) obtaining a plant tissue sample, or a nucleic acid sample thereof, from one or more plants,

[0239] b) analyzing the nucleic acid sample for the presence of one or more markers linked to the Par allele using a molecular marker assay, wherein the marker assay detects the presence of a nucleic acid of the invention associated with parthenogenesis, and optionally

[0240] c) selecting plants comprising one or more of said markers for further use.

[0241] Alternatively or additionally, the method may comprise:

[0242] a) obtaining a plant tissue sample, or a nucleic acid sample thereof, from one or more plants,

[0243] b) analyzing the nucleic acid sample for the presence of one or more markers linked to the par allele using a molecular marker assay, wherein the marker assay detects the presence of a nucleic acid of the invention associated with non-parthenogenesis, and optionally

[0244] c) selecting plants comprising one or more of said markers for further use.

[0245] Preferably, the plant or plants used in any of these methods are plants suitable as host plants as further defined herein.

[0246] Applications of parthenogenesis

[0247] The nucleic acids and / or proteins of the invention can be used for screening (e.g., for one or more parthenogenetic loci in plants or plant cells), genotyping, conferring parthenogenesis, conferring apomixis to increase ploidy and / or for producing doubled haploids. Preferably, the use is in plant biotechnology and / or breeding, i.e., in / on plants or plant cells.

[0248] Parthenogenesis is an essential factor of apomixis, and the gene of parthenogenesis can be used in combination with the gene of incomplete meiosis (for example diploid spore reproduction) to produce apomixis, and it is preferably used in the application listed in this paper.These genes can be introduced into sexual crops by transformation, gene infiltration or by modifying endogenous suitable gene thereby converting them into apomixis (or diploid spore reproduction).The understanding of the structure and function of apomixis gene can also be used to modify endogenous sexual reproduction gene, makes them become apomixis gene.Preferred purposes is that apomixis gene is placed under inducible promoter, makes when sexual reproduction produces new genotype, apomixis can be closed, and can be opened when needing apomixis reproduction good genotype.

[0249] Nucleic acid or its derivative can be used as a component of apomixis. Incomplete meiosis and parthenogenesis are both necessary for functional gametophyte apomixis. Incomplete meiosis can be achieved by a combination of mutations that affect meiosis (Crismani et al., 2013), resulting in the non-reduction of chromosomes in megaspores, i.e., mitosis rather than meiosis. Somatic cells that present gametophyte fate through epigenetic changes (Grimanelli, 2012) can also result in unreduced spore-like cells, which may produce unreduced gametes (egg cells). In another embodiment, incomplete meiosis is achieved by transgenic or non-transgenic expression of natural incomplete meiosis genes. Regardless of how unreduced egg cells are formed, the appropriate temporal and spatial expression of the nucleic acid of the present invention that can induce parthenogenesis can induce egg cells to behave as zygotes and split when not fertilized.

[0250] Parthenogenesis genes can be used in novel ways, for example, not directly as tools in apomixis. For example, although parthenogenesis and incomplete meiosis are combined in a single plant in apomixis, using incomplete meiosis in one generation and parthenogenesis in the next will link the sexual gene pools of crops at the diploid and polyploid levels, increasing ploidy levels through incomplete meiosis and reducing ploidy levels through parthenogenesis. This is very useful because polyploid populations are more suitable for mutation induction because they can tolerate more mutations. Polyploid plants can also be more vigorous. However, diploid populations are more suitable for selection, and diploid hybridization is more suitable for genetic mapping, BAC library construction, and other purposes. Parthenogenesis in polyploids can produce haploids, which can be hybridized with diploids. Diploid spore reproduction in diploids produces unreduced 2n egg cells, which can be fertilized by pollen from the polyploid to produce polyploid offspring. Thus, the alternation of incomplete meiosis and parthenogenesis in different breeding generations links the diploid and polyploid gene pools.

[0251] Another purpose of the nucleic acid derivative product (transcript or coded protein) without incomplete meiosis is to produce haploid offspring, which can be used to produce haploids and genome doubling (such as spontaneous genome doubling, colchicine, sodium azide or other chemicals) by double haploid (DH). Double haploid can be used as a parent to produce sexual F1 hybrids. Double haploid is the fastest method to make plants homozygous. Double haploid plants can be homozygous, and the second fastest method is self-pollination, which requires 5-7 generations to reach a sufficiently high level of homozygosity in diploid plants. There are several methods for producing double haploids. In some plant species, haploids can be produced by microspore culture. Other methods are to produce haploid embryos (gynecogenesis) by pollination with irradiated pollen (melon), or to pollinate with specific pollinator stock (corn, potato). These methods have their limitations, such as cost, genotype inadaptability, labor intensity, etc. In some crops, there is no method (such as tomato) for haploid production. Dominant alleles of parthenogenesis genes can significantly increase the frequency of gynogenetic development, thereby reducing the cost of haploid production.

[0252] The following non-limiting examples illustrate various embodiments of the present invention. Unless otherwise stated in the examples, all recombinant DNA techniques are based on the standard protocols described in Volumes 1 and 2 of Sambrook et al. (1989), Sambrook and Russell (2001); and Ausubel et al. (1994). Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by RDD Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK.

[0253] Table 1: Summary of SEQ ID NOs used herein

[0254]

[0255]

[0256]

[0257] Table 2: Effects of T-DNA constructs encoding Cas9 / gRNA-1 or Cas9 / gRNA-2 on seed phenotype, Par allele, and more specifically on the fragment of nucleotides 325-360 and the encoded amino acid fragment of the Par allele (SEQ ID NO: 23).

[0258]

[0259] BRIEF DESCRIPTION OF THE DRAWINGS

[0260] Figure 1 : Multiple sequence alignment of the coding sequence (nucleotides 325-360 of the Par allele coding sequence) and the encoded amino acids from amplicons of control plants (which show the wild-type sequence (SEQ ID NO: 23)) and transgenic plants containing a vector encoding the Cas9 / RNA-1 complex (which show modified sequences (SEQ ID NOs: 24-27)). The gene-specific portion of guide RNA-1 is boxed. Modifications are shown in bold and underlined. For alignment purposes, the wild-type sequence contains a spacer (-).

[0261] Figure 2 Germination experiment. Top row: A68 control, germinated, normal, viable black seeds. Middle row: Non-viable, light gray, non-germinating seeds of plant pKG10821-6, which has a 3 bp deletion in gene 164. Bottom row: All tetraploid, germinated, and viable progeny of plant pKG10821-6 pollinated with FCH72 haploid pollen. Seeds on each dish are from a single seed head.

[0262] Figure 3 : Transgenic lettuce lines emasculated 75 hours later, with the example of the transparent ovule (cleared ovule) of embryo, this line contains the medicinal dandelion Par allele driven by Arabidopsis thaliana EC1.1 promoter. Under the situation that this embryo is found, take this embryo in the sum of observation, as shown in Table 3.

[0263] Figure 4 : Example of polyembryony in transparent ovules 75 hours after emasculation of a transgenic lettuce line containing the Taraxacum officinale Par allele driven by the Arabidopsis thaliana EC1.1 promoter. Each asterisk represents an embryo.

[0264] Figure 5 : Analysis of Par gene expression in APO, PAR and SEX plants.

[0265] Example

[0266] Example 1

[0267] Materials and methods

[0268] Plant materials

[0269] Wild-type apomictic triploid Taraxacum officinale A68 and sexual diploid Taraxacum officinale FCH72.

[0270] DNA constructs

[0271] A binary vector encoding the following components in the T-DNA region was constructed; a parsley ubiquitin promoter (SEQ ID NO: 16) driving the Cas9 gene (SEQ ID NO: 17) with a 35S terminator, and a tomato U6 promoter (SEQ ID NO: 18, Nekrasov et al., 2013) driving guide RNA-1 (with a target-specific sequence of SEQ ID NO: 19) with a TTTTTT terminator sequence, and a glufosinate resistance gene for selection. A similar binary vector was constructed in which the sequence of guide RNA-1 was replaced with the sequence of guide RNA-2 (with a target-specific sequence of SEQ ID NO: 20). A suitable technique for generating such a binary vector is Golden Gate or Gibson (See, for example, Ma et al., 2015.) A vector encoding 35S-GUS in the T-DNA region was used as a control construct.

[0272] Plant transformation methods

[0273] Agrobacterium transformation was performed according to a modification of the protocol of Oscarsson (Oscarsson, Lotta. "Production of rubber from dandelion - a proof of concept for a new method of cultivation." 2015). The starting material for plant transformation was Taraxacum officinale A68 explants obtained from seed-derived plants propagated in vitro by subculture grown on half-strength MS20 medium containing 0.8% agar. 50 ml of an overnight culture in LB medium of Agrobacterium tumefaciens (Rhizobium radiobacter) such as strain C58C1 containing a binary vector was used for co-cultivation at a 10x dilution (resuspended and diluted in liquid MS20). The explants were cut into approximately 0.5 cm 2The explants were cultured in a 2-3 day culture medium (CIM) containing 20 g l-1 sucrose, 4.4 g l-1 micronutrients and MS, 8 g l-1 agar, 1 mg l-1 BAP, 0.2 mg l-1 IAA, 3 mg l-1 glufosinate for plant selection, 100 mg l-1 vancomycin and 100 mg l-1 cefotaxime, pH 5.8). The explants were transferred to fresh CIM weekly. When callus occurs, it is transferred to shoot induction medium (SIM; 20g l-1 sucrose, 4.4g l-1 has the MS of micro- and macronutrients, 8g l-1 agar, 2mg l-1 zeatin, 0.1mg l-1 IAA, 0.05mg l-1 GA3, 3mg l-1 glufosinate is used for plant selection, 100mg l-1 vancomycin and 100mg l-1 cefotaxime, pH 5.8).Finally, the shoots of several centimeters in diameter formed are rooted in rooting medium (RM; 20g l-1 sucrose, 2.2g l-1 has the MS of micro- and macronutrients, 8g l-1 agar, 100mg l-1 vancomycin and 100mg l-1 cefotaxime, pH 5.8).The buds that take root are transferred in potting soil in greenhouse.

[0274] result

[0275] The rooted plants obtained from Agrobacterium transformation were genotyped by PCR to determine the presence of the corresponding T-DNA encoding Cas9 and guide RNA-1 or guide RNA-2 in the plant genome. Plants that were positive for this test (represented herein as transgenic plants) were grown until fruiting. Individual transgenic plants derived from individual calli comprising any of these constructs had normal, vigorous, dark black-gray seeds, and some of these plants had abnormal light gray seeds (see Table 2). These light gray seeds were found to be empty, lacking embryos, and were found to be non-viable and not germinated. Control plants (T-DNA negative or transformed with 35S-GUS control constructs) never had similar abnormal light gray seeds, and control plants all had normal seed heads (with fertile black-gray seeds). Next, all transgenic plants were genotyped by amplicon sequencing of the guide RNA-1 targeted genomic DNA region on the Illumina MiSeqSystem. It was found that all transgenic plants with abnormal light gray seeds had small deletions or insertions in the parthenogenetic gene, more particularly in the fragment of the DNA targeted by gRNA-1. A68 is a triploid plant. The sequences of the other two alleles of this gene have been identified and are represented herein by SEQ ID NOs: 10 and 15. The sequences of these two alleles lack the PAM sequence required for Cas9 / guide RNA to induce DSBs.

[0276] The transgenic plants with normal black seeds had no changes in their gene sequences. Table 2 summarizes the small deletions or insertions observed and their effects on the translation of the coding sequence into protein sequence. Figure 1 Multiple sequence alignment of the amplicons is shown.

[0277] The observed seed set for transgenic plants with a small deletion in the gene of SEQ ID NO: 5 was interpreted as an indication of loss of the apomictic phenotype (referred to herein as loss of apomixis or LoA), and loss of the parthenogenetic phenotype (loss of parthenogenesis or LoP). Apomixis plants always carry the dominant Par allele.

[0278] The high fruit set of triploid Taraxacum plants in the absence of cross-pollination is a clear indicator of apomixis. As an alternative explanation, selfing can be ruled out, as the fertility of sexually produced eggs and pollen grains is very low due to the imbalance of meiosis between triploid males and females. Loss of the Par allele leads to LoP and, therefore, LoA. However, LoA can also be caused by disturbances in other developmental processes. Therefore, LoP plants are a subset of LoA plants, and further experiments are needed to identify the observed phenotype as a LoP loss phenotype.

[0279] To further investigate the nature of the observed light gray seed phenotype, crosses were performed. LoA in triploid transgenic A68 plants was detected by cross-pollinating them with haploid pollen from sexual FCH72 diploid plants. Seeds from these crosses were collected and sown, and the ploidy level of the progeny was measured using flow cytometry. All progeny were tetraploid, indicating that LoA plants possess the capacity for diploid spore reproduction and seed reproduction but lack parthenogenesis.

[0280] As a control, seeds of apomictic triploid A68 plants were sown and all were found to be triploid. In the same sowing, seeds were taken from various plants carrying T-DNA with guide RNA-1 that showed a light grey phenotype, but these seeds never germinated ( Figure 2 Plants carrying the T-DNA harboring guide RNA-2 and displaying the empty seed phenotype were expected to show similar germination test results when crossed with FHC72 (germination experiments were not performed). In summary, it can be concluded that Taraxacum officinale A86 carries a dominant Par allele, represented by SEQ ID NO: 5, which is required for parthenogenesis, and two recessive sexual alleles, represented by SEQ ID NOs: 10 and 15, respectively.

[0281] Example 2

[0282] Genes required for parthenogenesis can be used to transfer the parthenogenic trait to plants that are not apomictic or non-parthenogenetic. This can be achieved using a gene or a coding sequence of a gene or a homologous gene having SEQ ID NO: 5. A binary vector is prepared using T-DNA containing at least the gene or a homologous gene of SEQ ID NO: 5, driven by its native promoter or a female gamete-specific promoter. The gene construct is transformed into a plant that is not apomictic, such as lettuce or Arabidopsis, by Agrobacterium-mediated transformation. Plants that test positive for the presence of the transgene are evaluated for the occurrence of parthenogenesis. Since this trait is dominant, primary transformed plants (T0) are tested. In non-apomictic plants, parthenogenesis can be detected microscopically by Nomarski differential interference microscopy (DIC) of ovules cleared with methyl salicylate (Van Baarlen et al. 2002). In the absence of hybridization or self-fertilization, parthenogenetic egg cells develop into embryos. At least some of these embryos are found in plants containing the T-DNA described above.

[0283] Plant materials

[0284] For this experiment, wild-type lettuces were used: Iceberg type, Legacy, Takii Japan and Red Romaine type, Baker Creek Heirloom Seeds.

[0285] DNA constructs

[0286] A binary vector encoding the following components in the T-DNA region is constructed; the Arabidopsis thaliana EC1.1 promoter (as described in Sprunk et al. 2012) drives the expression of the Par allele CDS sequence of Taraxacum officinale (SEQ ID NO: 3), followed by the first 250 bases of the 3'UTR (the first 250 bases of SEQ ID NO: 4), followed by the 35S terminator and the neomycin phosphotransferase gene (nptII) for selection. A suitable technique for generating such a binary vector is Golden Gate or Gibson (See, for example, Ma et al., 2015.) The transgenic line carrying this T-DNA is designated pKG10824.

[0287] Plant transformation methods

[0288] Agrobacterium transformation is carried out by using Agrobacterium tumefaciens to transform lettuce independently of genotype. These methods are well known in the art and are taught, for example, by Curtis et al. Any other method suitable for genetic transformation of lettuce can be used to produce plants carrying the desired T-DNA, such as described in Michelmore et al. (1987) or Chupeau et al. (1989).

[0289] result

[0290] As described above in the "DNA Constructs" section, plants that tested positive for the presence of the transgene were evaluated for the occurrence of parthenogenesis. Because this trait is dominant, primary transformed plants (T0) were tested. In the absence of hybridization or self-fertilization, parthenogenetic egg cells develop into embryos. To prevent any fertilization of plants carrying the transgene, plants were grown in a greenhouse, and all flowers were manually emasculated before microscopic observation. Emasculation was performed by cutting off the involucral bracts before the corolla had developed. In non-apomictic plants, parthenogenesis can be detected microscopically using Nomarski differential interference microscopy (DIC) of transparent ovules. The chloral hydrate clearing method was employed here; a method commonly used for transparent plant ovules for microscopic imaging (e.g., Franks et al. 2016). 75 hours after emasculation, flower buds were harvested and ovules were cleared with chloral hydrate. In all seven transgenic lines evaluated, multiple embryos were observed in these clear ovules (see Table 3, which shows data for five of these lines). Figure 3 Examples of such observed embryos are shown. In some individual ovules, multiple embryos (polyembryony) were observed. Figure 4 Shown the example of observed polyembryonic.Yet, the frequency of observing polyembryonic is much lower than single embryo.In the transgenic strain that is not emasculated, before male gametophyte takes place and therefore before fertilization, can observe embryo.In these transgenic plants that are not emasculated, also observe polyembryonic under some rare circumstances.In the untransformed control plant of emasculation and imaging in the same manner, do not observe embryo at all.

[0291] Table 3: Effects of a T-DNA construct encoding the EC1.1 promoter driving the Par allele of the medicinal dandelion in transgenic lettuce lines. The numbers shown are from observations 75 hours after emasculation. In the untransformed control, no embryos were found 75 hours after emasculation. Approximately 25 ovules were present in a single flower bud. Ovules visible in a single microscopic plane were further analyzed.

[0292]

[0293]

[0294] These results demonstrate that the Par allele of Taraxacum officinale is sufficient by itself to induce embryo formation in lettuce. This is a clear example of using the Par allele of Taraxacum officinale to induce parthenogenesis in lettuce, where the egg cells develop into embryos in the absence of hybridization or self-fertilization. Similar results are expected when the lettuce homolog (SEQ ID NO: 22) is used for plant transformation in the same manner, for example, by transforming the lettuce plant with a vector containing a T-DNA region comprising the Arabidopsis thaliana EC1.1 promoter (as described in Sprunk et al. 2012) driving expression of the sequence encoding the lettuce homolog (SEQ ID NO: 22), with a 35S terminator and a neomycin phosphotransferase gene (nptII) for selection.

[0295] Example 3

[0296] The gene of SEQ ID NO: 5 has homologs in both parthenogenetic and non-parthenogenetic plant species. All of these sequences were compared using multiple sequence alignment and variant calling (including 5' and 3' regulatory sequences). This was done to determine which differences the parthenogenetic plant species versions of the gene of SEQ ID NO: 5 exhibited.

[0297] The present inventors identified a 1335 bp miniature inverted repeat transposable element (MITE) sequence or MITE-like sequence (defined herein by SEQ ID NO: 60) located 102 bp upstream (3') of the start codon (SEQ ID NO: 2) in the promoter sequence of the Par allele, which is absent from the sexual counterpart (SEQ ID NOs: 7 and 12). This MITE or MITE-like sequence is expected to be indicative of, and possibly causative of, a parthenogenetic phenotype, e.g., responsible for altered expression levels of the encoded protein.

[0298] These parthenogenetic allele-specific polymorphisms, insertions or deletions can be introduced into non-parthenogenetic plants by chemical mutagenesis or targeted gene editing of the sexual allele homologs of the parthenogenetic genes of the present invention. For example, the promoter sequence of the PAR gene can be replaced by the promoter of the dandelion Par allele (i.e., SEQ ID NO: 2), or the MITE sequence can be introduced into the PAR gene of a non-parthenogenetic plant at a position homologous to the MITE sequence in the above-mentioned dandelion Par allele. After introducing these parthenogenetic allele-specific polymorphisms, insertions or deletions, the plant will acquire the parthenogenetic trait. In non-parthenogenetic plants, parthenogenesis can be detected under a microscope by Nomarski differential interference microscopy (DIC) of ovules transparent with methyl salicylate (Van Baarlen et al. 2002). In the absence of hybridization or self-fertilization, the parthenogenetic egg cells develop into embryos. At least some such embryos are found in plants having the above-mentioned specific polymorphisms, insertions or deletions.

[0299] Example 4

[0300] Triploid and tetraploid dandelion apomicts were used as pollen donors for hybridization with diploid rubber grass (Taraxacum koksaghyz) plants. The pollen donors themselves were obtained by hybridizing sexual rubber grass with apomictic short-horned dandelion (Taraxacum brevicorniculatum) pollen donors. Therefore, apomictic genes are derived from short-horned dandelion (Kirschner et al. 2012). PCR markers were used to test the presence of Par alleles and diploid sporogenesis (Dip) alleles in triploid offspring plants (see WO2017 / 039452A1) and the production of apomictic seeds. Apomictic fruiting is defined as the production of viable seeds in triploid plants without cross-pollination.

[0301] Primers DIP_F (SEQ ID NO: 33) and DIP_R (SEQ ID NO: 34) were designed on the diploid sporulation gene VPS13 to specifically amplify the Dip allele. Using these primers, the presence of the Dip allele produced a PCR product of 829 bp, while the absence of the allele did not produce a PCR product.

[0302] Primers PAR_F (SEQ ID NO: 35) and PAR_R (SEQ ID NO: 36) were designed based on SEQ ID: 2 and SEQ ID: 4 to amplify any of the Par, par1, and par2 alleles. The presence of the Par allele can be distinguished by the length of the PCR product, as shown in Table 4.

[0303] Table 4: Amplicon lengths of PCR products amplifying the parthenogenetic (Par) allele and its sexual counterpart (par alleles 1 and 2) using primer pair PAR_F (SEQ ID NO: 35) and PAR_R (SEQ ID NO: 36).

[0304] Par allele par allele 1 par allele 2 Amplicon length (bp) 2400 1071 1111

[0305] 56 progeny plants were tested and a 100% correlation was observed between the presence of the Par allele and parthenogenesis as shown below in Table 5. No plants were observed that produced apomictic seeds and were negative for the DIP and PAR markers.

[0306] Table 5: Genotypic and phenotypic analyses of the offspring of hybrids between triploid and tetraploid dandelion apomicts and diploid rubber grass plants as pollen donors.

[0307]

[0308]

[0309] It can therefore be concluded that markers developed from the Par locus in Taraxacum officinale also identified the presence of parthenogenesis in a different species, Taraxacum officinale, which further demonstrates that the Par allele causes parthenogenesis.

[0310] Example 5

[0311] Construction of a γ-irradiation-deficient population of apomictic A68

[0312] Approximately 3 x 2,000 seeds from clone A68 were gamma-irradiated at three different doses: one-third with 250 Gy, one-third with 300 Gy, and one-third with 400 Gy. A total of 3,075 plants from the irradiated seeds were grown in pots in a greenhouse. After a two-month vernalization period at temperatures below 10°C, the plants were grown again in a heated greenhouse. More than 90% of the plants flowered and produced seeds. Plants were classified based on whether they displayed the loss of apomixis phenotype (LoA). Apomictic A68 plants spontaneously produce seeds and form large, white seed heads with dark brown centers, with seeds (achenes: single-seeded fruits) attached to the receptacle. In the case of the loss of apomixis phenotype, the center of the seed head is lighter and the diameter of the seed head is generally reduced. Finally, 102 plants were identified as having the loss of apomixis phenotype.

[0313] Using the method of Wu et al. (1992), single-dose dominant markers can be located in autopolyploid plants. In order to find AFLP markers associated with the Par locus (Vos et al. 1995), the Bulked Segregant Analysis method (Michelmore et al. 1991) was used. Two comparative DNA pools were constructed, pool A containing DNA from 10 triploid PAR plants and pool B containing DNA from 10 triploid non-Par plants, all progeny from the cross TJX3-20 (diploid sexual) × A68. The non-Par plants were carefully phenotyped using Nomarski DIC microscopy to confirm the absence of parthenogenesis (Van Baarlen et al. 2002). For the Par pool, apomictic plants were used. 147 AFLP primer combinations (Vos et al. 1995) were screened to determine the presence of fragments in pool A and the absence of fragments in pool B. The comparative fragments in the pools were verified on individuals from the pools. Based on the TJX3-20×A68 cross (76 plants), 17 AFLP markers were used to construct a genetic map of the chromosomal region of the Par locus. 14 of the 17 AFLP markers strictly co-segregated with the Par phenotype. This is an indication of suppression of recombination near the Par locus.

[0314] When one of the three homologous chromosomes is partially deleted, single-dose AFLP markers located on the deleted region will be lost. AFLP analysis of LoA plants showed that many LoA plants have lost one or more AFLP markers genetically linked to the Par locus. LoA plants lacking Par-linked AFLP markers produced tetraploid offspring after crossing with diploid pollen donors. This indicates that these LoA plants, despite having lost the apomictic phenotype, are still diploid spore reproductive and produce unreduced egg cells. These LoA plants can be graded based on the number of Par-linked AFLP markers they lack. The number of lost AFLP markers is an indication of the size of the deletion. The AFLP markers that are most frequently lost in LoA plants are considered to be closest to the Par locus. Plant i34 lacks the fewest PAR-linked AFLP markers and is therefore considered to have the smallest deletion.

[0315] Example 6

[0316] Genotype- and allele-specific expression of Par genes in female gametophytes of apomictic Taraxacum plants versus Par-deficient sexual plants

[0317] Cells and tissues from different developmental stages of gametophytes were isolated by laser-assisted microdissection (LAM) using the SLμCut instrument, which utilizes a solid-state UV-A laser (wavelength of approximately 350 nm) to cut tissue (2001, Medical Micro Instruments, Glattbrugg, Switzerland), as described in Wuest et al. (2010) and Florez-Rueda et al. (2020). Subsequently, transcriptome analysis was performed. TM RNA was extracted using an RNA isolation kit according to the manufacturer's instructions (ThermoFisher Scientific). To preserve native expression differences between samples, mRNA (after reverse transcription to DNA) was linearly amplified using the CEL-seq and CEL-seq2 protocols as described in Hashimshony et al. (2012) and Hashimshony et al. (2016).

[0318] Three plant lines were compared: 1. the triploid apomictic A68 (abbreviated as APO), originating from the Netherlands, 2. the tetraploid PAR-deficient progeny (abbreviated as DEL) produced by hybridization of the triploid deletion line i34 (PAR-deficient line, derived from A68, see Example 5 above) with the diploid pollen donor FCH72, and 3. the diploid sexual plant FCH72 (abbreviated as SEX), originating from France.

[0319] Each plant line, 5 different developmental stages / tissue types are sampled (Table 6). For very young stages, single samples are analyzed. From mature embryo sac, central cell and oocyte apparatus (oocyte apparatus) (ovum and synergid), three replicates are sampled. These together represent 9 samples (Table 6) of each plant line.

[0320] Table 6. Number of samples analyzed per type and stage

[0321]

[0322]

[0323] The linearly amplified DNA was sequenced on the Illumina Hiseq platform. Single reads were mapped to the sequence of the Par gene ( Figure 5). No Par gene expression was detected in any PAR-deficient or SEX plants (all stages and tissues). In the APO line, Par gene-specific reads were found in all samples of mature gametophytes, including in the egg organelle and central cell. Some transcript reads were also detected in a younger developmental stage of apomicts. Due to the 3' amplification bias of this method, most reads mapped to the 3' end of coding sequences and the 3'-UTR of genes.

[0324] Thus, the Par gene was expressed in seven samples of apomicts, but not in seven samples of deletion lines, nor in seven samples of sexual lines, which had comparable developmental states. This further emphasizes that ectopic expression of this gene in the central cell and egg organelle is responsible for the loss of egg cell arrest and, therefore, the parthenogenetic development of the embryo.

[0325] As also shown in Example 3, the expression of the Par gene in apomictic cells may not be repressed as it is in sexual reproduction, possibly due to the influence of the MITE sequence in the promoter region. Because the MITE is large, it may physically interfere with the binding of the transcription factor of the Par gene.

[0326] References

[0327] -An et al.(1996)Plant J.10,107

[0328] -Aoyama and Chua(1997)Plant Journal 11:605-612

[0329] -Asker,S.(1979)Progress in apomixis research.Hereditas 91(2):231–240.

[0330] -Asker, SE and Jerling, L. (1990) Apomixis in Plants. CRC Press, Boca Raton.

[0331] -Ausubel et al.(1994)Current Protocols in Molecular Biology,Volumes 1and 2,Current Protocols,USA

[0332] -Bae T.W.,Park R.H.,Kwak Y.S.,Lee H.Y.and Ryu S.B.(2005)Agrobacteriumtumefaciens-mediated transformation of a medicinal plant Taraxacumplatycarpum.Plant Cell,Tissue and Organ Culture 80:50-57.

[0333] -Baulcombe D.C.(1996)Plant Mol Biol.Oct;32(1-2):79-88.

[0334] -Barrell and Grossniklaus(2005)Confocal microscopy of whole ovulesfor analysis of reproductive development:the elongate1 mutant affects meiosisII.Plant Journal 34:309–320.

[0335] -Bennetzen J.L.and Hall B.D(1982)J.Biol.Chem.257:3026-3031.

[0336] -Bicknell and Koltunow 2004 Understanding apomixis:recent advancesand remaining conundrums.The Plant Cell 16:S228-S245.

[0337] -Bih et al.(1999)J.Biol.Chem.274,22884-22894.

[0338] -Borevitz,J.O.,Liang,D.,Plouffe,D.,Chang,H.-S.,Zhu,T.,Weigel,D.,Berry,C.C.,Winzeler,E.and Chory,J.(2003)Large-scale identification of single-feature polymorphisms in Arabidopsis.Genome Res.13:513-523.

[0339] -Bortesi,L.and Fischer,R.(2015)The CRISPR / Cas9 system for plantgenome editing and beyond.Biotechnology Advanced 33(1):41-52.

[0340] -Bruce M,Hess A,Bai J,Mauleon R,Diaz M G,Sugiyama N,Bordeos A,Wang G,Leung H,Leach,J.(2009)Detection of genomic deletions in rice usingoligonucleotide microarrays.BMC Genomics:10:129-140.

[0341] -Catanach AS,Erasmuson SK,Podivinsky E,Jordan BR,Bicknell R.(2006).Deletion mapping of genetic regions associated with apomixis inHieracium.Proc.Nat.Acad.Sci.103:18650-5.

[0342] -Christensen et al.(1992)Plant Mol.Biol.18:675-689.

[0343] -Chupeau et al.(1989)Transgenic plants of lettuce(Lactuca sativa)obtained through electroporation of protoplasts.Bio / Technology 7,503–508.

[0344] -Cordera et al.(1994)The Plant Journal 6,141.

[0345] -Cornejo et al.(1993)Plant Mol.Biol.23,567-581.

[0346] -Cornelissen et al.(1986)EMBO J.5,37-40.

[0347] -Crismani W.et al.(2013)J.Exp.Bot.64:55-65.

[0348] -Curtis IS et al.(1994)J.Exp.Bot.45.10:1441-1449.

[0349] -Daniell,H.(2002)Molecular strategies for gene containment intransgenic crops.Nature biotechnology 20:581-586.

[0350] -de Pater et al.(1992)Plant J.2,834-844

[0351] -Depicker A.and Van Montagu M.(1997)Post-transcriptional genesilencing in plants.Current Opinion in Cell Biology 9:373-382.

[0352] -Depicker et al.(1982)J.Mol.Appl.Genetics 1,561-573.

[0353] -Englbrecht et al.(2004)BMC Genomics,5(1):39

[0354] -Vielle-Calzada,J-Ph.,B.L.Burson,E.C Bashaw,and M.A.Hussey 1995.Earlyfertilization events in the sexual an aposporous egg apparatus of Pennisetumciliare(L.)Link,The Plant Journal 8(2):309-316.Dieffenbach and Dveksler(1995)PCR Primer:A Laboratory Manual,Cold Spring Harbor Laboratory Press.

[0355] -Florez-Rueda et al(2020),Laser-Assisted Microdissection of PlantEmbryos for Transcriptional Profiling,Methods Mol Biol,2122:127-139

[0356] -Foucu,F.(2006)Taraxacum officinale as an expression system forrecombinant proteins:Molecular cloning and functional analysis of the genesencoding the major latex proteins.Thesis Rheinisch- TechnischenHochschule Aachen.

[0357] -Franck et al.(1980)Cell 21,285-294.

[0358] -Franks RG(2016)Hum Press,New York,NY,1-7.

[0359] -Gardner et al.(1981)Nucleic Acids Research 9,2871-2887.

[0360] -Gatz,1997,Annu Rev Plant Physiol Plant Mol Biol.48:89-108

[0361] -Gielen et al.(1984)EMBO J 3,835-845.

[0362] -Guo et al,Scientific reports.2017 Jun 1;7(1):2634.

[0363] -Gould et al.(1991)Plant Physiol.95,426-434.

[0364] -Grimanelli D.(2012)Curr.Opin.Plant Biol.15:57-62.

[0365] -Hashimshony,T.,Senderovich,N.,Avital,G.et al.CEL-Seq2:sensitivehighly-multiplexed single-cell RNA-Seq.Genome Biol 17,77(2016).

[0366] -Hashimshony T,Wagner F,Sher N,Yanai I.CEL-Seq:single-cell RNA-Seq bymultiplexed linear amplification.Cell Rep.2012;2(3):666-673.

[0367] -Helliwell and Waterhouse(2003)Methods 30(4):289-95.

[0368] -Henikoff and Henikoff(1992)PNAS 89,915-919.

[0369] -Hermsen,J.G.Th.(1980)Breeding for apomixis in potato:Pursuing autopian scheme.Euphytica 29:595-607.

[0370] -Hesse et al.(1989)EMBO J.8,2453-2461.

[0371] -Holmes,M(2018)Historical Studies in the Natural Sciences,48(1).pp.1-23.ISSN 1939-1811

[0372] -Hull and Howell(1987)Virology 86,482-493.

[0373] -Ikemura(1993)In"Plant Molecular Biology Labfax",Croy,ed.,BiosScientific Publishers Ltd.

[0374] -Itakura et al.(1977)Science 198,1056-1063.

[0375] -Kagale et al.,(2010)Plant Physiology,152:1009-1134.

[0376] -Keil et al.(1986)Nucl.Acids Res.14,5641-5650.Kirschner J, J, T,De Heer,P,and PJ van Dijk 2012.Available ex-situ germplasm of thepotential rubber crop Taraxacum koksaghyz belongs to a poor rubber producer,T.brevicorniculatum(Compositae-Crepidinae).Genet.Resour.Crop Evol.DOI:10.1007 / s10722-012-9848-0

[0377] - and Weil(1991)Mol.Gen.Genet.225,297-304.

[0378] - et al.(1989)Mol.Gen.Genet.217,155-161.

[0379] -Last et al.(1990)Theor.Appl.Genet.81,581-588.

[0380] -Liu et al.(1995)Genomics 25(3):674-81.

[0381] -Liu et al.(2005)Methods Mol.Biol.286:341-8.

[0382] -Love et al.(2000)Plant J.21:579-88.

[0383] -Lutz KA et al.(2004)Plant J.37(6):906-13.

[0384] -Maillon et al.(1989)FEMS Microbiol.Letters 60,205-210.

[0385] -Ma,Xingliang,et al."A robust CRISPR / Cas9 system for convenient,high-efficiency multiplex genome editing in monocot and dicot plants."Molecularplant 8.8(2015):1274-1284.

[0386] -Mc Bride et al.(1995)Bio / Technology 13,362.

[0387] -McPherson at al.(2000)PCR-Basics:From Background to Bench,FirstEdition,Springer Verlag,Germany.

[0388] -Michelmore,R.W.,Marsh,E.,Seely,S.and Landry,B.(1987)Transformationof lettuce(Lactuca sativa)mediated by Agrobacterium tumefaciens.Plant CellRep.6:439-442.

[0389] -Michelmore,R.W.,Paran,I.and Kesseli,R.V.(1991)Identification ofmarkers linked to disease resistance genes by bulked segregant analysis:arapid method to detect markers in specific genomic regions using segregatingpopulations.Proc.Natl.Acad.Sci.88:9828-9832.

[0390] -Morgan,R.,Ozias-Akins,P.,and Hanna,W.W.(1998)Seed set in anapomictic BC3 pearl millet.Int.J.Plant Sci.159,89–97.

[0391] -Morris et al.(1999)Biochem.Biophys.Res.Commun.255,328-333.

[0392] -Müller,K.J.,He,X.,Fischer,R.,Prüfer,D.(2006)Constitutive knox1 geneexpression in dandelion(Taraxacum officinale,Web.)changes leaf morphologyfrom simple to compound.Planta 224:1023–1027.

[0393] -Nakamura et al.(2000)Nucl.Acids Res.28,292.

[0394] -Nekrasov,Vladimir,et al."Targeted mutagenesis in the model plantNicotiana benthamiana using Cas9 RNA-guided endonuclease."Naturebiotechnology 31.8(2013):691.

[0395] -Neuhaus&Rogers(1998)Plant Mol.Biol.38,127-144.

[0396] -Odell et al.(1985)Nature 313,810-812.

[0397] -Oelmuller et al.(1993)Mol.Gen.Genet.237,261-272.

[0398] -Oscarsson,L."Production of rubber from dandelion-a proof of conceptfor a new method of cultivation."2015

[0399] -Ozias-Akins,P.and P.J.van Dijk.(2007)Mendelian genetics of apomixisin plants.Annu.Rev.Genet.41:509-537.

[0400] -Park et al.(1997)J.Biol.Chem.272,6876-6881.

[0401] -Plant Molecular Biology Labfax(1993)by R.D.D.Croy,jointly publishedby BIOS Scientific Publications Ltd(UK)and Blackwell Scientific Publications,UK.

[0402] -Ríos G,Naranjo M A,Iglesias D J,Ruiz-Rivero O,Geraud,M,Usach,A andTalón M.(2008)Characterization of hemizygous deletions in Citrus using array-Comparative Genomic Hybridization and microsynteny comparisons with thepoplar genome.BMC Genomics 9:381-395.

[0403] -Ross,M.,LaBrie,T.,McPherson,S.,and Stanton,V.P.(1999).Screeninglarge-insert libraries by hybridization.In Current Protocols.in HumanGenetics,A.Boyl,ed(New York:Wiley),pp 5.6.1–5.6.32.

[0404] -Sambrook and Russell(2001)Molecular Cloning:A Laboratory Manual,Third Edition,Cold Spring Harbor Laboratory Press,NY.

[0405] -Sambrook et al.(1989)Molecular Cloning:A Laboratory Manual,SecondEdition,Cold Spring Harbor Laboratory Press.

[0406] -Savidan Y.(2001)Transfer of apomixis through wide crosses.In:SavidanY,Carman J,Dresselhaus T,editors.The flowering of apomixis:From mechanisms togenetic engineering.Mexico:CIMMYT,IRD;pp.153–167.

[0407] -Shcherban et al.(1995)Proc.Natl.Acad.Sci USA 92,9245-9249.

[0408] -Sidorov VA et al.(1999)Plant J.19:209-216.

[0409] -Smith TF,Waterman MS(1981)J.Mol.Biol 147(1);195-7.

[0410] -Sprunck et al.(2012)Science 338.6110 1093-1097

[0411] -Stam,M.,Mol,J.N.and Kooter,J.M.(1997)The silencing of genes intransgenic plants.Annals of Botany 79:3-12.

[0412] -Sutliff et al.(1991)Plant Molec.Biol.16,579-591.

[0413] -Tas,ICQand Van Dijk,PJ(1999)Crosses between sexual and apomictic dandelions(Taraxacum)I.The inheritance of apomixis.Heredity 83:707-714.

[0414] -Tavladoraki et al.(1998)FEBS Lett.426,62-66.

[0415] -Terashima et al.(1999)Appl.Microbiol.Biotechnol.52,516-523.

[0416] -Vaeck et al.(1987)Nature 328,33-37.

[0417] -Van Baarlen,De Jong,JH,and Van Dijk,PJ(2002)Comparative cyto-embryological investigations of sexual and apomictic dandelions(Taraxacum)and their apomictic hybrids.Sex Plant Reprod 15:31-38.

[0418] -Van Den Broeck et al.(1985)Nature 313,358.

[0419] -Van Dijk,PJand Bakx-Schotman,JMT(2004)Formation of unreducedmegaspores(diplospory)in apomictic dandelions(Taraxacum)is controlled by asex-specific dominant gene.Genetics 166,483-492.

[0420] -Van Dijk,PJand Schauer,SE

[0421] https: / / www.keygene.com / wp-content / uploads / 2018 / 07 / apomixis-game-changer-in-breeding.pdf 2016Velten and Schell(1985)Nucleic Acids Research 13,6981-6998.

[0422] -Van Dijk,P.J.,Rigola,D.and Schauer,S.E."Plant breeding:surprisingly,less sex is better."Current Biology 26.3(2016):R122-R124.

[0423] -Van Dijk,P.J.,Tas,I.C.Q.,Falque,M,and Bakx-Schotman J.M.T.(1999)Crosses between sexual and apomictic dandelions(Taraxacum).II.The breakdownof apomixis.Heredity 83:715-721.

[0424] -Van Dijk,P.J.,Van Baarlen,P.,and de Jong,J.H.(2003)The occurrence ofphenotypically complementary apomixis-recombinants in crosses between sexualand apomictic dandelions(Taraxacum officinale).Sex.Plant Repr.16:71-76.

[0425] -Velten et al.(1984)EMBO J 3,2723-2730.

[0426] -Verdaguer et al.(1998)Plant Mol.Biol.37,1055-1067.

[0427] -Vielle-Calzada,J-Ph.,BLBurson,EC Bashaw,and MAHussey 1995.Earlyfertilization events in the sexual and aposporous egg apparatus of Pennisetumciliare(L.)Link,The Plant Journal 8(2):309-316.

[0428] -Vielle-Calzada,JP,Crane,CFand Stelly,DM(1996a)Apomixis:Theasexual revolution.Science 274:1322-1323.

[0429] -Vijverberg,K.van der Hulst,R.Lindhout,P.and Van Dijk PJ(2004)Agenetic linkage map of the diplosporous chromosomal region in Taraxacum(common dandelion;Asteraceae).Theor.Appl.Genet.108:725-732.

[0430] -Vos,P.,Hogers,R.,Bleeker,M.,Reijans,M.,Lee,Th.van der,Hornes,M.,Frijters,A.,Pot,J.,Peleman,J.,Kuiper,M.and Zabeau,M.(1995).AFLP:a newtechnique for DNA fingerprinting. Res.23:4407-4414.

[0431] -Wesley et al.(2003)Methods Mol Biol.236:273-86.

[0432] -Wesley et al.(2004)Methods Mol Biol.265:117-30.

[0433] -Wong et al.(1992)Plant Molec.Biol.20,81-93.

[0434] -Wu KK1,Burnquist W,Sorrells ME,Tew TL,Moore PH,Tanksley SD(1992)The detection and estimation of linkage in polyploids using single-doserestriction fragments.Theor.Appl.Genet.83:294-300.

[0435] -Wuest SE, Vijverberg K, Schmidt A, et al. Arabidopsis female gametophytegene expression map reveals similarities between plant and animalgametes. Curr Biol. 2010; 20(6):506-512.

[0436] -Zhang et al.(1991)The Plant Cell 3,1155-1165. Sequence Listing <110> Master Gene Co., Ltd. <120> Parthenogenetic genes <130> P6069700pct <150> EP 19177252.4 <151> 2019-05-29 <150> EP 19200872.0 <151> 2019-10-01 <150> EP 20170243.8 <151> 2020-04-17 <160> 60 <170> PatentIn version 3.5 <210> 1 <211> 170 <212> PRT <213> Taraxacum officinale <400> 1 Met Ala Asp Asn Gly Asn Thr Gly Arg Gln Lys Asp Asp Asp Gly Gly 1 5 10 15 His Asp Gly Pro Arg Gln Asn Pro Thr Thr Pro Pro Ser Pro Ser Arg 20 25 30 Thr Pro Arg Arg Pro Arg Arg Asn Thr Ser Pro Pro Lys His Ser Pro 35 40 45 Gly Ala Ser Ser Ser Thr Met Pro Ala Pro Pro Thr Pro Pro Ala Pro 50 55 60 Thr Gly Ile Thr Gly Ala Ser Ser Ser Ser Val Gly Thr Asn Ile Ile 65 70 75 80 Ser Phe Ile Pro Pro Lys Thr Lys Arg Thr Lys Ser Val Ile Cys Pro 85 90 95 Ile Cys Asn Lys Asp Met Cys His Glu Lys Ala Leu Cys Gly His Ile 100 105 110 Arg Trp His Thr Gln Glu Glu Arg Leu Ala Ala Ser Ile Ala Ile Ala 115 120 125 Arg Ala Leu Ser Ser Asn Val Val Val Ser Gly Asn Gly Asp Glu Asp 130 135 140 Glu Gly Pro Ser Lys Lys Tyr Lys Leu Pro Asp Leu Asn Lys Ser Pro 145 150 155 160 Pro Pro Glu Glu Glu Asp Glu Asp Ala Ala 165 170 <210> 2 <211> 1900 <212> DNA <213> Taraxacum officinale <400> 2 taaggccata acaaggttat ttgaacattc gcctaaaccc taaaccaact atatctattc 60 ggatttgtta cgagttttag agttctaga aaatcagtta tatatcgatt aggcttggtt 120 ctaggttata agaaaaaatg attctctatc cggtatgaca tagagacaaa ccggtctact 180 tttataagaa aatcatattt gaaacaatgt ctagttaata attaattaat atgtgcatgt 240 ttaaatttag aatatcctga atttatattt agtgcgcaac cctatgtaag atcgaactaa 300 ttttaaaccg taaccagaca tgcatgtttg atcagtaata aaaaggctat tatcgtcgaa 360 aatattaaaa caaaatataa tatcttattt ggcgccattt catgtcaacg gttgaaagca 420 agttaccaac gcctccaacc gatcatttct ccggtaacaa ccaactgcta ccagggccgg 480 ccagaaggct gtgcggcttg ggctgtggca caggggcagc agatttagtc catttattat 540 ggtctgctat ttatttgggt ccaataagat cagggcacta aaactcaaat acatcaattc 600 aagtcggcgg caaaagaata aaaagcgcca atttttagaa gacaaggaga cagcacaata 660 atcatgcttt tccaatggcc attaatttt agcctttgtg aggtataaat atgaatcact 720 ttttctccaa atatcattat tgtaaactag taaagagcgt aaattgtttt atcgctaatc 780 ttcttcttt tcaaatataa ttgtttgatt ctttgtagta ggtacgttaa gttttatatc 840 attcgtcctg gaaacctttt cttatgcccc ttcaatttat gaatttgtgt tttgtattgt 900 cttgctatta atccaatgca aactaattct gccgcatcga tctcacagag ttggagcagc 960 ttaaaaggag ttttggggca acttaaaatg agggtagctt ttttgttgtt gttggtctac 1020 tatttacttt ggtccttatc gttttagttt tgtgttcatt gaggatttga atgactttga 1080 acacaagttt ataaaactaa gttttgtga ttctaaattt ttgatgtgtg caaccgacta 1140 aatgaatata aaattctgat ttgtgtattt ctgatttctg attaccggt tattcattat 1200 gttttctgg atctcatatg aatttagtat ataaaaatct caggttcttc ttactcagtc 1260 tagtatattt tggcattggg gatcagggtt aaaatcatca ttttctaag cactaacaag 1320 ctttaaaacc atcaattaaa agttagttct catacctgg aattgttat tgctttagta 1380 ttcatttcat agtgtcaata ccttacaact gttattgtt ttcaaatgtt tactgttttg 1440 cactttagtt gtttttagca tgtttcaact ttcaaagtta attgacgata gtgtcatata 1500 cgaaatatca tcactcatac aaaattaaac tggatagaat ttttccgat gaaatctatt 1560 tttaaatagt tacgaatata ataggagact tatatgttt gtttcaaaat tacacaaaaa 1620 caccatggaa atgggcatta gtttgtataa gcatcctttt aaatataaag ctttgttaca 1680 ttgatgcctt ctaaatatat aatattgtaa tgatttgtag taaacaccat ggaaatgggc 1740 attattaaga tgttcgccc agggcatgaa aaactatcgg accggccctg actgctacta 1800 ataaccgcca ccgcaaaaac ctataaatac aacttccatc acaattctgt cccctactcc 1860 catttcaatc caaaaaaagg ctacacagac atatacagcg 1900 <210> 3 <211> 513 <212> DNA <213> Taraxacum officinale <400> 3 atggcagata atggcaacac cggccgtcaa aaggatgacg acggtggcca tgatggacca 60 cgccaaaacc caactactcc accctcccct tccgcaccc ctcgaagacc aaggcggaac 120 acatcaccgc ccaaacattc tccgggggcg tcttcaagca ccatgccagc gccgcctact 180 cccctgcgc cgacgggaat caccggtgct tctagttctt ctgtgggtac tatataatt 240 tcatttattc cacccaaaac caaaagaacg aagtcggtga tctgcccgat ctgcaacaaa 300 gatatgtgcc atgagaaggc gctgtgtggc cacatccggt ggcatacaca ggaggaaaga 360 ttggcggcca gcatcgctat agcaagagcg ctatcttcta acgttgttgt ttctggcaat 420 ggcgatgaag atgaaggtcc atctaaaaag tataaactcc cggacctgaa caaatctcca 480 ccgccggagg aggaggacga ggacgctgcc is 513 <210> 4 <211> 5356 <212> DNA <213> Taraxacum officinale <400> 4 ttttcttgcg ggagaggcat gcatgtatgt gtggcctttt tgcaataata ctatgcatgg 60 gagatgcata aagtttatct ttattttt tagtttaata atgtgtggca aactttatat 120 catttatgat ttcggccatg tactgctaca tcgttctagg atggttattc cctagaattt 180 gctttatgta tttgttttct ttgttaattc ttctcttcct taaacgttat ttcatgtgaa 240 ttgcgatgtc atgatattgc aggaatgtaa cttagaactc aacgataaaa agtgtgttga 300 gatcgtggaa gttgatcatt tatcttgaat tcataagata agcaacatga gataggataa 360 ttaattactg tggggattc tttttatatt catattattc gttgtaatgc aaatttttaa 420 gtagaataac gaatgtgtct tattatttac ggttaaatgc aaaagatcat taacatatct 480 cattgattt gttactgat gtattctcat gtgttctgtt gctaaattct atttgaaaa 540 gtatattcaa ttaaagcaat gcattttaga tataaagcaa ctccataact tataattgtg 600 tagattttta ccaattcaat gtcttaaaag aaaaataaaa attgaaagtt taattaattg 660 ccatagtgat cccgttcccg tcaattatgt gatcaatttt taccagagca aaaccccaca 720 tttcttgtag tgaacaatct gtggatgata accgatcgaa gactttgtg gggatttcac 780 taaccaacta tttggctctc attaattact attagttata taaggccatc ccaagtattt 840 tggcaatatt caaaacgagt aaactataaa attacacttt tggttcttgt atttctaact 900 tttagaatta tgtatttggt tcttatagtt ttttatttgt atgaattaca ttacttttgg 960 tccacaatat tttttttt ctataattcc atttttagtc attgtagttt taatttgcaa 1020 taaaaaatta atttatattt ttaatccata tatatagttg gcaatattct atattttagg 1080 ttcagattgt atcttttata aaaaagagtc ttaaaagact aaaccttttg gatccttata 1140 gttttcacaa tcacttgtga tttttttaat gaacatatca tatttcttaa attacatcag 1200 taatctacgt ataacattta atataatttt atttaatcag aaatatagga ttcgtataat 1260 aactttgctg aacttaggct tcatttttaa caaaggataa tgcatcatgc atgacataaa 1320 aatttgtaat atttctaatg tgcatgcact acaagaacct gacccttcat atacattaat 1380 gaatgattct cttttcttat ttaatcttag caagcggttt ggataattgt ctgcacaata 1440 ttaagaattg cactagctag ctaggggagt ccatgacgta ataagcaaat taactagagg 1500 acttgtagga ggcttgatca cttcattgta tatctaatgg cactatcgat atatgattgg 1560 cttgtgtgta tctatggaat ttaacactat taaaaaatat atctttaatg acaatcaaca 1620 acacacagta atttatgact tacaaaatca tgtgtgatta aaaaaaaatgt catgtttttt 1680 aaaattatag aggatttacg acttacataa ttatgtgtca taattatatg tcatcttgtg 1740 taatattat gacttacaaa aatgtatgtc atgttttatc atcataaaat ctataaaaaa 1800 aaatagaaac acgaggatac tttcagtgta tgttatctgt aaaaaaaaat aaaaactcgg 1860 aggacactaa aagtgtagaa acttgacagc ataaacgaat ttattacct tcatcaaaac 1920 ttattttact tcaatctctg aaccagctcc cttcattaat ctcttcgaga tgtaggttga 1980 ttttaatgct aaatgaactt ttcaaatgta taaataaaac ttttctgtgc cagatttgac 2040 attgatggag atgaagatac acaagtgaat tcacctttca atgatcatac tgacatacca 2100 agtactccta tcccctctcc acctccacaa aacgaacctc aatttcaaaa acgtaactat 2160 catttaaata tttaatcatt tttcaattgg attcatgcgg taatagaagt tactggactt 2220 taaactttt gtagctgatg agattcatga gcaacagtcc atggacattt tccaaatcaa 2280 caagttttctg atgaggacaa cgtaaaaaaa gttttcaat tattaaacat atgatttgg 2340 tttttaaaag atattaatt atggaaatc ttcagaaag tctcaatact ttggtttat 2400 taatgaaaaa gtctcaaaa aaaatttgaa taaaaaagtc cataaaattg gataaattat 2460 tcgatttagc ccaatttgcc aagtaaatct ggtaaatta ggctaaatcg aaatttag 2520 ccagttttggt gggcctttt gcgcaaaac attattgg gacttaatcg ttaatttcc 2580 ccaaatttca gtttatttac agtcttggag taaaaccgaa cctagtgcgc taattttggc 2640 ttttggtgtt tggaatttatt gggctcggtt tctgaacgag ttgattttt 2700 ggttcttga ttcaattttt tggttttggg gttgaaccca tggatttcg atttggtttc 2760 ggctttgata atatttttgt gcaatcgttc aaatatccg agttagatg ggtttaaatg 2820 ttatcaaac cgaaccgag ggtagaaccc haaaactgaa cccaatcgaa aatccatagg 2880 ttgaacccca gaaccgaacc cataaactc taaaaacca aaagccaaaat taaccgataa 2940 aaaacttaaa atacatgttt gttaaatcta gtaggtgtt tttgacactt tatgtaaatt 3000 atagaaaaaa atggattaac tgtttgctta ttaagataaa aacgacgtaa aaatagaatt 3060 ggattagaaa tgaaccattt ttttacatcg tttactttat ttactaggtt ataacccgtg 3120 tattacacgg gttgacgata aaaaattgta taaaaaaaca acatataatg gtaagtttgt 3180 aatcgtacat gggttgcttc aattttaatt taaaaattgt aattccaaat gaaatatatg 3240 taggatgata taacatactt gtaaatgtaa atgagagttt gttggcattt catacattta 3300 gcccatcaaa tcaaacgcaa aaaatctttt taatcctata atacatgtgg caacaatata 3360 cgattagcat ttcgctgaga gagaggcttt aagtgaggat gtgaaaaaga aggaacatag 3420 caacttggaa tttaaaagatc aaaaaacctt gaaggcttt tggaatgtaa aaatatagaa 3480 atgaataaat gtggcttctt gtatgtatca agagtaggac ctgtattaga aacataaaaa 3540 atttgtgtct aataaaaatc aacaaaaaca gaacgtaaac gaaagaagtt attggtaaaa 3600 aaagatttca aaaatagttt ttttttgaac cggttcaaaa atagttatt tacttatta 3660 tccatttaat ccaaactttt ttttgtcaaa tatctcatgg aattagttgg ctgcgtcact 3720 cttgtcactg ggcgttataa cttttgcctt gtggtttgca acaccacctt aaataacata 3780 gacaaataac attaaatatc atgataatac ataataactc acaaaagatg cattctatag 3840 aacggtataa ttgattagaa caaaataatc taaatagttt atgaggatta ccttgataat 3900 tcccttggag tgaatactat ccacgatgtc atcttccaaa ggtattcaat ggcttttatt 3960 agaacccaat ttcagaatta cattgatgcc acagttacat tcactaaata tcttcctctt 4020 aggcttttag tttgactata ttttaaccat tttcacatca cactttaacc accccctttg 4080 gttattaatg tcaaaaggaa caaaactcac aaatcaaatg cgtggtgttt atactattgg 4140 tacaatgttt ataaatttct taaaaatgag cacaatttca aaaaacttaa acaaatgtca 4200 atggtcacca tgtggtatta atattataaa gttctaaaaa taccattcca ccccaacatg 4260 gtactaacca gttagaaaat caagaaacag aaacatactc tttaatctaa aacaatataa 4320 tatagggatg tgttatgagt ttagtttcat ctaaccatga attcatatag gattgtacgt 4380 ttctcctcga aattgcaaag aattttgttc gactaagcaa tctacatatt aatggatttg 4440 tatggtttct cggtttgtag gtaagttaag agctaccagg aaagagaaaa tttgcaccat 4500 aggtactaaa cacattctac aatggtggct ttaacgtgag agagaataga gaggtcgaaa 4560 catatttccg ttaaataagc aaacataagt ttctatttgg gatcaataag tttcttccta 4620 tagtggtaaa tggatctgta cttgttaagc tcttaaacat atttgttgtc actgttcact 4680 tcctattttg cagtgctctt ctattactta cattcttctt atgacattct tttaataagg 4740 aaaaataacc acttattcta gtattctatt gttttgttag agtcaatatc agataagaac 4800 ctaaaaaggt gggacaaatt gataacttaa tcaatatatc aaactgtcat atgtctcaag 4860 tctcaaccca aattgatatg tttaagaaaa attcagaaaa gatatgtcca tgggacatgt 4920 gcatgtatat gtataagtgt acattcctaa aaaaagtagg ctcatatgac atgagcatgt 4980 atgtgcttat tgtataaag attacaaatt ttcttaaaaa tgaacacaat ttcaaaatac 5040 ctataccaaa gcccatgatc aacatagcat ctgatattaa tattataaag ctctaaacaa 5100 atctaccccg acatcaagtg gtacttacaa gttggaaaat caagatacaa aaacatagct 5160 tttaatctaa gtaaaaacac aataatatag ggatatgacc tatatgcatg tttaaaatct 5220 taagtctgta aagattgata ggattggaaa actcttctat tcaacacaag aaaagaatta 5280 cagtaggagg agggactctc acactcaact actacaaaaa aaccaaccct cacttactaa 5340 cactctcaca ctagtg 5356 <210> 5 <211> 7769 <212> DNA <213> Taraxacum officinale <400> 5 taaggccata acaaggttat ttgaacattc gcctaaaccc taaaccaact atatctattc 60 ggatttgtta cgagttttag agtttctaga aaatcagtta tatatcgatt aggcttggtt 120 ctaggttata agaaaaaatg attctctatc cggtatgaca tagagacaaa ccggtctact 180 tttataagaa aatcatattt gaaacaatgt ctagttaata attaattaat atgtgcatgt 240 ttaaatttag aatatcctga atttatattt agtgcgcaac cctatgtaag atcgaactaa 300 ttttaaaccg taaccagaca tgcatgtttg atcagtaata aaaaggctat tatcgtcgaa 360 aatattaaaa caaaatataa tatcttattt ggcgccattt catgtcaacg gttgaaagca 420 agttaccaac gcctccaacc gatcatttct ccggtaacaa ccaactgcta ccagggccgg 480 ccagaaggct gtgcggcttg ggctgtggca caggggcagc agatttagtc catttattat 540 ggtctgctat ttatttgggt ccaataagat cagggcacta aaactcaaat acatcaattc 600 aagtcggcgg caaaagaata aaaagcgcca atttttagaa gacaaggaga cagcacaata 660 atcatgcttt tccaatggcc attaatttt agcctttgtg aggtataaat atgaatcact 720 ttttctccaa atatcattat tgtaaactag taaagagcgt aaattgtttt atcgctaatc 780 ttcttcttt tcaaatataa ttgtttgatt ctttgtagta ggtacgttaa gttttatatc 840 attcgtcctg gaaacctttt cttatgcccc ttcaatttat gaatttgtgt tttgtattgt 900 cttgctatta atccaatgca aactaattct gccgcatcga tctcacagag ttggagcagc 960 ttaaaaggag ttttggggca acttaaaatg agggtagctt ttttgttgtt gttggtctac 1020 tatttacttt ggtccttatc gttttagttt tgtgttcatt gaggatttga atgactttga 1080 acacaagttt ataaaactaa gttttgtga ttctaaattt ttgatgtgtg caaccgacta 1140 aatgaatata aaattctgat ttgtgtattt ctgatttctg attaccggt tattcattat 1200 gttttctgg atctcatatg aatttagtat ataaaaatct caggttcttc ttactcagtc 1260 tagtatattt tggcattggg gatcagggtt aaaatcatca ttttctaag cactaacaag 1320 ctttaaaacc atcaattaaa agttagttct catacctgg aattgttat tgctttagta 1380 ttcatttcat agtgtcaata ccttacaact gttattgtt ttcaaatgtt tactgttttg 1440 cactttagtt gtttttagca tgtttcaact ttcaaagtta attgacgata gtgtcatata 1500 cgaaatatca tcactcatac aaaattaaac tggatagaat ttttccgat gaaatctatt 1560 tttaaatagt tacgaatata ataggagact tatatgttt gtttcaaaat tacacaaaaa 1620 caccatggaa atgggcatta gtttgtataa gcatcctttt aaatataaag ctttgttaca 1680 ttgatgcctt ctaaatatat aatattgtaa tgatttgtag taaacaccat ggaaatgggc 1740 attattaaga tgttcgccc agggcatgaa aaactatcgg accggccctg actgctacta 1800 ataaccgcca ccgcaaaaac ctataaatac aacttccatc acaattctgt cccctactcc 1860 catttcaatc caaaaaaagg ctacacagac fathercagcg atggcagata atggcaacac cggccgtcaa aaggatgacg acggtggcca tgatggacca cgccaaaacc caactactcc accctcccct tcccgcaccc ctcgaagacc aaggcggac acatcaccgc ccaaacattc tccggggggcg tcttcaagca ccatgccagc gccgcctact ccccctgcgc cgacgggaat caccggtgct tctagttctt ctgtgggtac father tcatttattc cacccaaaac caaaagaacg aagtcggtga tctgcccgat ctgcaacaaa gatatgtgcc atgagaaggc gctgtgtggc cacatccggt ggcatacaca ggaggaaga ttggcggcca gcatcgctat agcaagagcg ctatcttcta acgttgttgt ttctggcaat ggcgatgaag atgaaggtcc atctaaaaag tataactcc cggacctga caaatctcca ccgccggagg aggaggacga ggacgctgcc tgattttctt gcgggagagg catgcatgta tgtgtggcct ttttgcaata 2460 atactatgca tgggagatgc ataaagttta tctttatttt ttttagttta ataaatgtgtg gcaaacttta tatcatttat gatttcggcc atgtactgct acatcgttct aggatggtta 2580 ttccctagaa ttgctttat gtatttgttt tctttgttaa ttcttctctt ccttaaacgt 2640 tatttcatgt gaattgcgat gtcatgatat tgcaggaatg taacttagaa ctcaacgata 2700 aaaagtgtgt tgagatcgtg gaagttgatc attatcttg aattcataag ataagcaaca 2760 tgagatagga taattaatta ctgtggggat ttctttttat attcatatta ttcgttgtaa 2820 tgcaaatttt tagtagaat aacgaatgtg tcttattatt tacggttaaa tgcaaaagat 2880 cattaacata tctccattga tttgtttact gatgtattct catgtgttct gttgctaaat 2940 tctattttga aaagtatatt caattaaagc aatgcatttt agatataaag caactccata 3000 acttataatt gtgtagattt ttaccaattc aatgtcttaa aagaaaaata aaaattgaaa 3060 gttaattaa ttgccatagt gatcccgttc ccgtcaatta tgtgatcaat ttttaccaga 3120 gcaaaacccc acatttcttg tagtgaacaa tctgtggatg ataaccgatc gaagacttttt 3180 gtggggattt cactaaccaa ctatttggct ctcattaatt actattagtt atataaggcc 3240 atcccaagta ttttggcaat attcaaaacg agtaaactat aaaattacac ttttggttct 3300 tgtatttcta acttttagaa ttatgtattt ggttcttata gtttttatt tgtatgaatt 3360 acattacttt tggtccacaa tattttttat tttctataat tccatttta gtcattgtag 3420 ttttaatttg cataaaaaa ttaattta ttttaatcc atatatatag ttggcaat 3480 tctatatttt agttcagat tgtatcttt aaaaaaga gtcttaaaag actaacctt 3540 ttggatcctt atagttttca caatcacttg tgatttttt atgaacata tcatatttct 3600 taaattacat cagtaatcta cgtataacat tattatataat tttattaat cagaaata 3660 ggattcgtat ataactttg ctgaacttag gcttcatttt taacaagga taatgcatca 3720 tgcatgacat aaaaatttgt atatttcta atgtgcatgc actacaagaa cctgaccctt 3780 catatacatt aatgaatgat tctctttctt tattaatct tagcaagcgg tttggataat 3840 tgtctgcaca atattagaa ttgcactagc tagctagggg agtccatgac gtaataagca 3900 attack aggacttgta ggaggcttga gtatatcta tggcactc 3960 gatatatgat tggcttgtgt gtatctatgg atttacac tattaaaaaa tatatcttta 4020 atgacaatca acaacacaca gtaatttatg acttacaaaa tcatgtgtga ttaaaaaaaa 4080 tgtcatgttt tttaaaatta tagaggattt acgacttaca taattatgtg tcataattat 4140 atgtcatctt gtgtaatatt tatgacttac aaaaatgtat gtcatgtttt atcatcataa 4200 aatctataaa aaaaataga aacacgagga tactttcagt gtatgttatc tgtaaaaaaa 4260 aataaaaact cggaggacac taaaagtgta gaaacttgac agcataaacg aatttattta 4320 ccttcatcaa aacttatttt acttcaatct ctgaaccagc tcccttcatt aatctcttcg 4380 agatgtagt tgattttaat gctaaatgaa cttttcaaat gtataaataa aacttttctg 4440 tgccagattt gacattgatg gagatgaaga tacacaagtg aattcacctt tcaatgatca 4500 tactgacata ccaagtactc ctatcccctc tccacctcca caaaacgaac ctcaatttca 4560 aaaacgtaac tatcatttaa atatttaatc atttttcaat tggattcatg cggtaataga 4620 agttactgga ctttaaactt tttgtagctg atgagattca tgagcaacag tccatggaca 4680 ttttccaaat caacaagttt ctgatgagga caacgtaaaa aaagttttc aattattaaa 4740 catatgattt tggtttta aagatatta attggaaa atcttcagaa aagtctcaat 4800 actttgggtt tattaatgaa aaagtctca aaaaaaattt gataaaaa gtccataaaa 4860 ttggataaat tattcgattt agcccaattt gccaagtaaa tctggtaaaa ttaggctaaa 4920 tcgaataatt tagccagttt ggtgggcctt ttgcgcaaa aacattattt tgggacttaa 4980 tcgttaattt tccccaatt tcagtttatt tacagcttg gagtaaacc gaacctagtg 5040 cgctatttt gttttttttgtt atttggtttt atttgggctcg gtttctgaac 5100 gagtttgatt ttggtttt tgatcatt ttggtttt ggggttgac ccatggattt 5160 tcgatttggt ttcggctttg atatattt tgtgcaatcg ttcaaatat ccgagttaga 5220 ttgggtttaa atgttatca aaccgaaacc gagggtagaa cccaaact gaacccaatc 5280 gaaaatccat aggttgaacc ccagaaccga acccaataa ctctaaaaac caaagccaa 5340 aattaccga taaaaaactt aaatacatg ttgttaaat ctagtaggt gttttgaca 5400 ctttatgtaa attatagaaa aaatggatt aactgtttgc ttattagat aaaacgacg 5460 taaaaataga attggattag aaatgaacca ttttttaca tcgtttactt tatttactag 5520 gttataaccc gttattaca cgggttgacg ataaaaaaatt gtataaaaaa acaacatata 5580 atggtaagtt tgtaatcgta catgggttgc ttcaatttta atttaaaat tgtaattcca 5640 aatgaaatat atgtaggatg atataacata cttgtaaatg taaatgagag tttgttggca 5700 5760 tggcacaaat atacgattag catttcgctg agagagaggc tttaagtgag gatgtgaaaa 5820 agaaggaaca tagcaacttg gaatttaaag atcaaaaaac cttgaaaggc ttttggaatg 5880 taaaaatata gaaatgaata aatgtggctt cttgtatgta tcaagagtag gacctgtatt 5940 agaaacataa aaaatttgtg tctaataaaa atcaacaaaa acagaacgta aacgaaagaa 6000 gttatggta aaaaaagatt tcaaaaatag tttttttttg aaccggttca aaaatagtta 6060 ttttacttat ttatccattt aatccaaact tttttttgtc aaatatctca tggaattagt 6120 tggctgcgtc actcttgtca ctgggcgtta taacttttgc cttgtggttt gcaacaccac 6180 cttaaataac atagacaaat aacattaaat atcatgataa tacatataataa ctcacaaaag 6240 atgcattcta tagaacggta taattgatta gaacaaata atctaaatag tttatgagga 6300 ttaccttgat aattcccttg gagtgaatac tatccacgat gtcatcttcc aaaggtattc 6360 aatggcttt attagaaccc aatttcagaa ttacattgat gccacagtta cattcactaa 6420 atatcttcct cttaggcttt tagtttgact atattttaac cattttcaca tcacacttta 6480 accaccccct ttggtatta atgtcaaaag gaacaaaact cacaaatcaa atgcgtggtg 6540 tttatactat tggtacaatg tttaaaatt tcttaaaaat gagcacaatt tcaaaaaact 6600 taaacaaatg tcaatggtca ccatgtggta ttaatattat aaagttctaa aaataccatt 6660 ccaccccaac atggtactaa ccagttagaa aatcaagaaa cagaaacata ctctttaatc 6720 taaaacaata taatataggg atgtgttatg agtttagttt catctaacca tgaattcata 6780 taggattgta cgtttctcct cgaaattgca aagaattttg ttcgactaag caatctacat 6840 attaatggat ttgtatggtt tctcggtttg taggtaagtt aagagctacc aggaaagaga 6900 aaatttgcac cataggtact aaacacattc tacaatggtg gctttaacgt gagagagaat 6960 agagaggtcg aacatattt ccgttaaata agcaacata agttcttt tgggatcaat 7020 aagtttctc ctatagtggt aaatggatct gtacttgtta agctcttaaa catatttgtt 7080 gtcactgttc acttcctatt ttgcagtgct cttctattac ttacattctt cttatgacat 7140 tcttttaata aggaaaaata accacttatt ctagtattct attgttttgt tagagtcaat 7200 atcagataag aacctaaaaa ggtgggacaa attgatact taatcaat atcaactgt 7260 catatgtctc aagtctcaac ccaattgat atgtttaaga aaattcaga aagatatgt 7320 ccatgggaca tgtgcatgta tatgtataag tgtacattcc taaaaaaagt aggctcatat 7380 gatatgagca tgtatgtgct tattgttata aagattacaa atttcttta aaatgaacac 7440 aatttcaaa tacctatacc aaagcccatg atcacatag catctgatat taatattata 7500 aagctctaaa caatctacc ccgacatcaa gtgtactta caagttggaa atcaagata 7560 caaaaacata gctttaatc taagtaaaa cacaatata taggatatg acctatatgc 7620 atgtttaaaa tcttaagtct gtaaagattg ataggattgg aaaactcttc tattcaacac 7680 aagaaaagaa ttacagtagg aggagggact ctcacactca actactacaa aaaaaccaac 7740 cctcacttac taacactctc acactagtg 7769 <210> 6 <211> 227 <212> PRT <213> Taraxacum officinale <400> 6 Met Ser Thr Val Lys Ser Lys Leu Ser Thr Pro Pro Thr Asp His Phe 1 5 10 15 Ser Gly Asn His Gln Leu Leu Leu Ile Thr Ala Thr Ala Lys Thr Tyr 20 25 30 Ile Tyr Asn Phe His His Asn Ser Val Pro Tyr Ser His Phe Asn Pro 35 40 45 Lys Lys Ala Thr Gln Thr Tyr Thr Ala Met Ala Asp Asn Gly Asn Thr 50 55 60 Gly Arg Gln Lys Asp Asp Asp Gly Gly His Asp Gly Gly Arg Pro Asn 65 70 75 80 Pro Thr Thr Pro Pro Ser Pro Ser Arg Thr Pro Arg Arg Pro Arg Arg 85 90 95 Thr Thr Ser Pro Pro Lys His Ser Pro Gly Ala Ser Ser Ser Thr Met 100 105 110 Pro Ala Pro Pro Thr Pro Pro Ala Pro Thr Gly Ile Thr Gly Ala Ser 115 120 125 Ser Ser Ser Val Gly Thr Asn Ile Ile Ser Phe Thr Pro Pro Lys Thr 130 135 140 Lys Arg Thr Lys Ser Val Ile Cys Pro Ile Cys Lys Lys Asp Met Cys 145 150 155 160 His Glu Lys Ala Leu Cys Gly His Ile Arg Trp His Thr Gln Glu Glu 165 170 175 Arg Leu Ala Ala Ser Ile Ala Ile Ala Arg Ala Leu Ser Ser Asn Val 180 185 190 Val Val Ser Gly Asn Gly Asp Glu Asp Glu Gly Pro Ser Lys Lys Tyr 195 200 205 Lys Leu Pro Asp Leu Asn Lys Ser Pro Pro Pro Glu Glu Glu Asp Glu 210 215 220 Asp Ala Ala 225 <210> 7 <211> 14519 <212> DNA <213> Taraxacum officinale <400> 7 ctgacttggc caacattttt tgttcttccg atcccttcgt aacaatcagt ttaagcacaa 60 ttgaattata tggagataaa taggtgaaat ttggaagacg aggatggggag agtgcgaaga gccaaagaag agaaatgtgg gatagcggcc ggccggttgt taatagaagt gcttagatct tggagacctt ctaatgctta tggaggacc agatgcttca atttgtaaat ctgcgctgcc 300 sq. ft. 300 sq. ft. 300 sq. ft. 300 sq. ft tttcccactt gtataattct cttattcatt ttcaaatctt tatctaatt aaggatatcg gcaaaaatat aatcctaatt gtttttcaaa atgataagga ttaaggta acttaattct tgttttattc attattatt attattgttt tttatcaatg ttttaaaacc cgggttttga gtcaacccgg tcttgtgaaa aatcccgggt cagccggtca gctgatctac cggttcaata 540 tatttaaata aaatataaat tttcatatag aatttgagtt ttaggctaag aaaatcgggt tttgggctaa ggaaaatcgg gtttaagttt tgggctaatg gattttcggg tcaataacgt ttttttccgt tttttagatc ggttcgaccg cgttttgtgt gaaacccggc cggggttgatc 720 cgagtcaata attggcaaca acccggtata tgttgacccg ctcttgtccc cgggtcccgg ttcaaccggt tggatcggcc gggttgaccc tggttttaaa acactgtttt ttatacaata 840 tatttgtttt tgtttttagt tttgtttg ttttgattt tgtagatata ttttaattt 900 tatttttatt ttgtataaat atagtcatta caaccgatta tttgtaagtt gagtcggtca 960 aaacgaactt tctgaaatt cttatacatt ttcggcgaa acatgaatat tttgatcaac 1020 caatatgctt tttctaggt ttttaaata aaccgcacgt tcaattgcat attcgcaaac 1080 aatagaactc gaaaacccta atcgagcttg tttatagaa atctgggttg agtgcataca 1140 tataattaa taactgtgaa aaagttgtt ttaacatgct aaacctatcg atagtcggtt 1200 ataataatta tatgtaaaca aaatcagaaa caataatgat atatgtcacc caaaaaaata 1260 gttactaaat atatacaaaa tcaaaaacaa cagtaatttc ttttacaaaa aaaagagaac 1320 aatagtgact aactttagaa agaaaaaaa agaactaaat tactcttata aatcattatc 1380 ttttatataa attggtaaat tggtcatgta atctagaatg tgaattgcgg aatgctttag 1440 tcacatttg aacaaactgg taattattaa ttcgataaa agttcttcaa gaatagtttg 1500 gtcacatttt ggacgacaat ggtgtgtttt ccatagtaag caatacgtaa tgagttcgct 1560 tataggaaa atagatctaa agcttaatga aatcatatgt atagtaca tattattttc 1620 acacgttaca ttgttgtaa cgtcctcaat tttttaata tatataacta ggtacactct 1680 aaggtcgtgc taagcacgac ccacgaatgg taatttaggt aattttcat ccttgactaa 1740 atacattat gctaataca aagattaag atacaatgc atacattat aagtaata 1800 aagtacatga tattctcac atttagtctt tatacataga aaacttacac tggccattg 1860 CAaaaaaca ttaaatctcc ctaaaagta gagtttaca atgaaagct tgttttatta 1920 gcaacaata atcaatgt gaagctatag tatagtacc tactcattc aacttttagg 1980 cagtgcagta attacttact catgttaatg gtgaaatgca ttaagataa cttcattcaa 2040 cggattaaat ctgggttcat tataaatgta ctcttagtta ctcctccatg taactgcatt 2100 tagcgaaca aaagctct aaaataat atgaacaca tgctaattta taaatgacat 2160 catgggtata gatgctgtaa catcctaaac ttttaaata ataataat catatttggg 2220 Atttaagta atattttaag aatattgata aattagagaa tgaataca agaggcattt 2280 tattttagc ctttgattta taaaaaagaaaaaccttga attggatgt attttgaat 2340 gggtaagtat ttaaagat gtgtaagtta aggggataa atggaatta aggagataag 2400 catttgacca aagtcaaat agaaggaaca ataagtcggt cgatgtttt cctgtgtgca 2460 tcttcggacg spy agaaaagac gagcgaga spy spy spy 2520 gagattatcg aggagagagac agcgaagtcg gaggagggag accgagaacg accgagacag 2580 gaggaaaacc gagagacaag gggaggacga ggcagcagca gcctaggctg ctgcgttttt 2640 ggcgacagaa aaccaccgcc agcggcggtg gtggtgagcg acggtggtgg tggagccgag 2700 aaggggttgt ggtggtgtta gaagtgatgg ttcatctca tttctgata atttgcctt 2760 ttggacaat aaattgaagg taactttcaa agctttagat gattatctct tgaagtaga 2820 aagcaagggt aatttagtct tcaatgt tatggagag ggtaataca cccaaatgct 2880 aacaaaatca tatagatta tgtgatttga agttatatag ttcatgaatg tgaaggttga 2940 ctttctgcaa tggtcaaaca tggacatgga catgattata gcatattagc aatgtaatag 3000 gaatggaatc accaattcca ttgttgaaaa tagaaaattt gatgtgtgca gaattttgta 3060 aaatttccca aaacaccaac tttaaggctg cataagtcat gcatgaagaa tgcaaatcag 3120 tccattcttt cgcctaacat caagtccttg caacatagat tacacaggaa aaagaaacag 3180 ccaaatccga gttcgtatga ggattgtatg actgttcaac gtttgtcaaa agttgctgtc 3240 atgctgtcaa accagaattt ttctaagtct gggaaatatg cagaaaatgg gtttgaccag 3300 tttttggagc ttcataactt gatttataca tatccaaatc agttgattct tgagcctaaa 3360 ctgtagagaa agatgaggag aaggcatagg aaaaagaatc aacacatttg gatatcgtat 3420 acaacctgtg caaagggttg aagtaggctc aaaacccatt tttgacataa ttgtcaatta 3480 tatgaattgt gggtaacttt tgccgtaatg aaatgttttg acatataagt gtttatattg 3540 acttataaac atgttaagac tataaacttg ataaagtaac atgtcaaaac ccgaaaatgc 3600 ctatttaggc aaagtatgat gcttaattga gaaatcggtc aaatagcata aaaactaaaa 3660 gtgttctaaa tggtccaaga agactttata cataacttac acatcattag cacatgatgt 3720 gtagtacatg tgaggtttga acacttttat acttggaaaa ttgtcaagta gtcaaaaatg 3780 ggacaaaagg gtaaaattgt ccaaaatgag tatatggcta attaaagcaa gttgagctac 3840 3900 agttttgaag gtaatgtcaa tttaaagtaa gttaaccaaa agaaagtaag ttgctaattt 3960 tgggatatat gacccaaatg agttatgcat tggtttttag gttgtgtaat acctataatg 4020 agatatgaat tgattatgag acatgtattg atgataatac aaatgatgta atgaaatagg 4080 ttcgttgcct atcgtggagc aggagcatg cggattagtg tagctagtct tacctagcta 4140 ctaaggtgag tacgtgtgga ttgtttttcc attttcgggt acatggaaaa samaaatttt 4200 tataatgaag tgcctaatgt tttgaaagaa agaatgaatg aaaatacttg atgcttttga 4260 aagaatgttt taaaagaaag taatgttttg aagaaaaag gtttgatgct ttacgtttga 4320 aaatgaatat gtcttgatat taatgaatgg aatgggtaaa gcatgaatga tataatatgt 4380 aataataaga tgctaaggat ggttatgttt atgatgttca cgtgaatata agaatgttgc 4440 tcgatctaag atgtcccggg tagggattca gaggagccta tcggggtggt acctcccctt 4500 cgcgagatag gttacctaat gtaaatgatg tcaatgtaat ctgatttgtt cttttgcat 4560 tggtacagac ttggggtata tcagacccaa gtataatatg atatggccat atgataagat 4620 gattaaaaga gtatgtgaaa tgttaaaggt tatgtaaaat gttatatgaa attattcaaa 4680 gagatcttta tggttattat gtctatgaaa aggaagcata taatgtata gatattttat 4740 gtctaaaccc acgtagctca ccagactagt tgtctgacgt attattttt atgccatgta 4800 tttcaggtta tacacgagga tagactgatg atcgatagaa gctagatgtt acgacggata 4860 gacggagtgg agctttcaag ttctattgta atgatcttac cgtaaattct tatttgcttt 4920 gctatggttg ctgtttgata tataattggt aacacccgag aattgtttta tatatattca 4980 aaaagtttt atttgggacg gttttgtaa acatgaccaa gtgtcatgaa atatttttaa 5040 aaccatagcg ttttaaaac gataaaatga ggggtgttac agatgcgata atatatctta 5100 ggattatgtc aaatatttat gccaattata catgagagag caagtttata agagttttag 5160 ttattctatc attggatca tatagatacg tattatagt agacagagat gcatgaat 5220 tatagcagag aacttttgc aaaacctaac ctcactgcat gttgcattca tcaccccac 5280 ttgtagttgt aacaccatga atatgccaat taagaatat catgaggtat attgtactgg 5340 aaatgacaaa agtactaat ttacaataga acgcagtcaa acttggttat ttgtaaattt 5400 ttagaagca atttachaaaaaaaacat aaaaaaaacacag taaatcacag 5460 acattgctca tggagagtg actgatcaaa ctgaccgtttt attttctgt ttcttgtaca 5520 actaccaaac gttcctgtat aaccaccaaa tagtcccaga ctttagaaaa tagacagaa 5580 aaccacagat atacatacat acagccatac attataattt ttaattgaaa aaaatgcata 5640 gaaaaccagt ctcaataa gaaccaaata aagagatac aaatgaaacc tggttatcga 5700 aaaagagt tagataat gatttcagca ttgcactca tgtaaacgat atgccattgg 5760 gatccgttgg aaagggtatc gtgaagtgat taggagaag cggggtgtta gggtttttt 5820 tgcagtttat tgaacaggtt gatcaaattt tgcgccggta gggttaattc cttttcgaac 5880 gggtttctat ctgggtcttt catcaaaatc actcatgttt gtgtctctaa cctttagttg 5940 cagatggata tcagatcaac ggtttcaggc taaatgggg aacaaataac aagaagaaag 6000 cggtgacatc tgtgttcgta ttcgtatggt ggaaggggaa gagtggcgta tgaattggtc 6060 aatgtaaaac atctggaaac aacttctccc aacatgtaaa aggatccgga aaatatgaaa 6120 atgacgatta gagatttcgt tcggatattg ggaatatggt cgcgtctgat tgccctacgg 6180 tgcccaccgt ttgggtttct tgatttgtcg tttagataga tgtcggaggt ctaaattcac 6240 aatcctgttc ttccgcggta attgaaattg ggtaaggcta attgtttaga tcaaatggca 6300 gaggacgatg tgaagttgcg ttgccctata attggctctc gtgaaattga attgcaaatt 6360 tcacaacgat gttagcaaca ataatcgtcg ctctcgcatc ccataccgtc gcaacgtatg 6420 atggtgatcg agattgagag atttagggct agatgtggcg ttggcggaca taggttgtgg 6480 ttgacggaat gaggaagaaga cgtgagcgtc gattgaggta gcaacaggcg gagggttaac 6540 ggtgtcatca tggtgaaagg tcgcgcgtcg ttttatggtc gatagatcat ggacgttgtg 6600 agtgaatgcc ggcgcaaca cggtggagga aagtctatgc tttagttgac ggggcggttt 6660 tctctcggag acggaagag gacgtcgaaa gaaggccgg ttggagaaa tatattaac 6720 gcgccgacac acgctatcag agaagaccgg tttcttata taataatgac taggtacgtg 6780 caagggtcgt gctaagcacg acccatggag gcttcttgag aaaattgtaa acacatatca 6840 tataatagcg acgaacttta ctgttattga tatataagt gattaagcat ggttggccct 6900 aagttaaaac tcaactact gtaagtagt aatgtaata atttacctt ttcagctatc 6960 gatcttagat tgctctgtag tgttgtgtct tagtgctttt cacggttctt ttatatgcat 7020 atagtcacat aaaatcagac acacatag ataacccac agacaatcac aaaaatca 7080 gtctgatgag gttaattt aagcaatag gattgattt caagcaatta gaggaata 7140 atatattaat ttcacgtact cctattgtag ttattgtgac aaaacccaac tgtttaattg 7200 tgccattgca aaagtccac ctgtttaatt tctttatcaa catgtcgttg catcctttta 7260 catgcaata tttcagaaca tcttcctata atgacccttg agatgaactt tttagaaata 7320 ttgttgctgg ttacattatc agaaaaaaca gagcttatga aaaagacca aacatagtaa 7380 ctcgtacttc atgtctggta gttctttga atatttccgt ctttgttcg aaacaatttg 7440 gttgaactgt agtagatctt tcaactgta tacaacttca caatgtttt tgtaagttca 7500 ttacttctag atccttcaa agagaggt siactcaa atttgcataa accagattta 7560 ttgaaggcta attagattag tgttgtagggg ctttttggat aataataaa atgaaacata 7620 ggtgctgcaa caggtgcgaa agaatttggt tggacagtag taggtctttc aactgtata 7680 caactttaca attgttttg taagttcatt atttctagat ccttcaaa aaaaggaggt 7740 siaactaaa aaatttctaa accagattta ttgaggctg attagatta cattgcagggg 7800 ctttttggga aataata atgaagata ggtccaacag aaacgaagga ggtgtgaatt 7860 atgcacaaa tggaacaca cattatcgt agtacacatg tattacag ggatcaattt 7920 ccatttattg ttccatcaat tgccaattt aaagataac aaatgcatcc ttttgaatg 7980 gaaaagtag atacataaa ccagagagag gtatacattt agtccagaaa cggtggaaat 8040 tactttacct agagttgcgt gatcaatg gaaatcaga ggagagacc ctaaatcgca 8100 atccatcttc tattcctat agaatcaat ggaaatttct tactccgac cttttcatt 8160 tccacaagtt tgtaatcgat aagatcataa aagaaaccg atttacatta gcaaatcttt 8220 aaggcacttg tttgtagttc tcaagtatgc gttacgtag aaattctaga cagaaaaggg 8280 acgacaggga aaataatggt ggaataata aacaatcaag atchaaaga taataatccct 8340 taaaactaac aaaaatttcta tcaataagcc ctacaatga gaaatgac ggtggagact 8400 cacctgattg cagtggcgga agcttggg ggctttggta ggccatggcc ccctgttttt 8460 tggaaaattt tcaaaaaaa aaaaattata tatatat cattgataa gtctagactc 8520 aggaaactat gaagattag aaatagatca agttatctaa atcaatctc gaaaatatg 8580 gaaggaatca aaacacaata tttatctcat tgtgaatca aaaaccctat aaaaaacaca 8640 aatctaacct acaatttaaa tcaaaaacac cataaaaatc aacctaccgt cggattcagc 8700 cgtcgtcgtc ttcttcaccg gaccaccatc caccgccatt gcttcaatcg tgctttctcg 8760 tcaatagctt agtggcttgt tcagctttct tgctctacca atgattttta tacactttcc 8820 agcaccaccg atttgttgaa cggtaatatt atgctccttt atatttttga aatctttgaa 8880 agttcatctg gttttctgtc tctgtaaact gtaaagaaac tttatgttt tgttaagaaa 8940 ataggagat agagaagaaa gagtattgac gtgcttttcc catatgtctc gaatgccaca 9000 ttaggaaaag acaaaaagaa aacaattagt acattacgct agtgtgatag tactgtatga 9060 ctattagtat gatttacagc tttaataggg attcatagaa aagaacaaaa taaactactt 9120 ataaattaaa aatcgagctt tattttaat tagtttaaat aaatatttag ctataacata 9180 atatattata tgttttgtat ttataatcaa atataattat ttgtattaca gattagtttg 9240 tataatcaaa tataatgatt catgtttcga aaagattgtt taaatatttt tatatgccat 9300 gttttttaac tgaattatat ttttttgtat gattttcttt acaatttagt ttttctttac 9360 aatttagttt tggcccccct tgtttttttg tttgtgttcc gcccctgcct gattgatgcg 9420 agaaaaggaa agccgccgac atttgtgctt cttcccgcgt taagaaaaat cgcagatgac 9480 attacgattc tttttctaca ggagatagg ggggttgcga ctttgcgtga tttgttgtta 9540 atgagtgatg cgtcgtccgt tttgatcggt agcccgtgga gactgattta tttgacagat 9600 agatgtcgtt ctcgttgatg atgcaggtgt aattggcggc gttggtgaag cgaagatggc 9660 ataggaatg gctttgcaga ggagaaaagg agtttcacaa atatggatta ttgaatcgtc 9720 gtttcagagt cgcgatggtt agtaatcgat ggatttgggt ttgcacctgt tcaaggggtg 9780 gtgacgtgtc ttactgtaag aaagagtcgc gatggttagt aatcgacgat ggatttgggt 9840 ttgcaacatc gttgacggaa acgacgcggc gatggagaga ggcggtagag ggaatgaaac 9900 gggagattta ccttcaaccg caaacatgtc ttcgttcctc gaaaatcata tgcgcccttt 9960 atgaaaattc cttcacgcgc cgtacacgcg ctcagaaaaa acatagggtt ttcttatata 10020 ataatgacta ggaacgttta tgcgccgtga taatcacggc ccatgagtgg tacaaatgtt 10080 gtaaaactta gaaaatggga aagttgaatg tacaatgtta tgatttattt tattcttcat 10140 agcacaatac tttgcttta gtgaaagcag ttaaaaagtg gatgtgtcgt tagcaactat 10200 aaacttttaa caaaatatta catacagaac atagaata gataaacact aaaaaaatac 10260 aaatagccg tgttcacac ggcccacaga atgcaatttg gatatttcta aggaggtgta 10320 aaaaatattg ctattatggg agctattct aggtatattt tgttactcac atgacatgaa 10380 tattgagtaa tttgtaaaa ttggtaattt agcttagatt ttcccacaaa gatgagtgtt 10440 aaactatca aggagat atggtacttc ctcacaaag atgattttga atatctata 10500 ttttaaatgt agaactact atcacatgag acaatattg atattactgg ttaggattac 10560 aacattgata tgtaaaatat ttggtaatg taaatttctct aaaaagctt ggaagtagaa 10620 tgcaacaca atatatgcta gtattacatg ttgggtgat ttatgaatgt acttacgtgt 10680 tgatccttat taccgtact tgaataattt tatctgatca atgctttacc tatatggcta 10740 tatctagcaa tgtgcattat tcacaatta tggagtgtaa attcatatag acgtatatga 10800 cagtggaatga aaggaaaac aagtaatttg attgaatcac tgagaaaaaa gcaaagata 10860 catgcatata aatgttaca tcaaataca gagaataat gaagaaga taataatgtg 10920 gagcattca aaagtaag aatgtaagtc cttgatagct cgaaatttctt ttaagtcttc 10980 cgtgatagcc taatgtttat atagagag acattcaaa tgaatagaa ttatatcacc 11040 taacagtatt taatcctact ctacttggcc attgagcata ttgctattgt taaaaattat 11100 gtccaaatcg catttaactg ttagatgcaa ttccattgc cgattacact tatatgtatg 11160 tagtaaatta taattactc ttgtcctgg tcatttgatg tgtcatggat gtttgtagg 11220 acaataat agattacaat aacttaata taaaattgag ttaatattcc agaattcaca 11280 aaatgtgtaa taacacttat ttataatttc cacgtaatta atgattact acttagaatc 11340 ctacaagtttt ttgttatca ccttcatat gatcgtataa atgcaacac ccttaatgca 11400 tttatagttg ttggtctgcc acgaacacct ttttctgttg attatttgtc attattatgt 11460 taaaaaatgt tgaaaaatg ttaatggga tttgttg gcaagagat gaacttctcc 11520 aatattgtag ttgcataaat attgccagtt ccatcataca gaataacc tcttatattg ggcaatagaa ttatagaaac aatagggtt aaccgactta catgtattga tctctgattc ttctttacac actggacaaa ttagtctatc atgtcttgca caaccctgtt aaagaaaaca gtgaaaattg accacgaagg tgtatcctct agtaccaaca ttacatctat cattttaaaa gggaaatgta tacttatcat atatatctaa tggacgttgc ctttcctcca attgtcactc ttacatctaa tggaaattat gatcacaatt tacttttaac agcatagata cattcatttg ttggtaagac acttttggcg gattcattgt attaatcttt catgtaaaaa ttctcattca agatattagg tttttgttag aacccttgtt atttgaacat gcaacctgaa ttctgattgt 12060. 12060. 12060. 12060. ttcaggcct tgtgttcatt attack ctattcggtt tagttctttt atgagtccta tatttacatc cttaaccatt ttaacaagtc catcatattg ggaattttaa tataatacc caatgttatt catttttgtc gcttcagtag atattgacca tactaaagat gagtatttaa tactcataca acatgaaaga aaaaatgaa aaactaacag tcacttagt agcccaatc tccatacaa 12300 tagcgcttta agaataaacc aatttcaggt gaattgtag aaggacata aatctgtaca 12360 tgaaaaaaca ttacagtta cacaataattt atttgcacag agataaaag cacaatgt 12420 gatgagaga ttaaagta ggaagtgaa caaaatac catcaaatc caatgttagt 12480 aaaagaaa atgtacgagc gattcataac attcatccaa aacccatatg cgatgttgaa 12540 tgcatatctg gataaaagaa tttaataac ataagcgcc tgtaaaatca ataacaaaa 12600 tcataaaaa tagacctaaa atgcaaccg acttattgtt tctatacacc ataaatgat 12660 tttcacgaat tttatccaa gaaagataaa aagtcataaa attgaacggg cttaccgatt 12720 tgaatcgtgg tctgtatctg ccacgcagat cagataca tcataatcta catcaagat 12780 ttcagaaaaa tatgaaactt ccgccattac taatttgata tgaatttctc agagcctaaa 12840 aaaacctaa attackaaaa atcaacaca gttttttgac gtttaccttg atttgtgaaa 12900 ataggcattt gggtttttc gtaggatttt ctatgaaaga agccatcaag tttatgacat 12960 tgtaattta agcaagtat gatatatga aggattagga aaagagatcgg attgtgatga 13020 tccggagaga aaatacaca aaccagagag aagcgatgtt gtgattgtgg tgtattaatc 13080 tgttttaaa cctctaacca cttcttgtaa gtccgtaatc agacgaatg cgcttgaata 13140 ataagtcttt cacgccagtg tcgaggatta atgccgtcaa gggtggtggg gaggtattta 13200 taggaagaaa tgcggtggag gtgaatggag gcgtcgatca aacccaagg gaaacggttt 13260 gtcgaaatag atgcgttggt cattcgccat aagtttgtga aacggtgagt gtatccttgg 13320 cgtcgtttga aagtttgtga aacggtggcg atgctccgtt aaggaccgg caacggatcg 13380 agcgatatgt aaatgggagg gcagaaatat tgcatacgcg ccggacacgc gcttatggaa 13440 gtgagtat ggagtgata ggattttctt atataataat gatataactt attttaat 13500 aacatcgtac tatacgtttc aaaataattt agagttttaa taaaattacg gatgatta 13560 accaattaca aaaaata agtgtcggtg ataaaatt tgtaacaacg aaaaacattc 13620 aaaaaatctg atgcggaaa tccatacat gagaatacga ttcgtttgca gtcacgccgg 13680 tttctcacc ttctgaggtt cctgaaaaag gttaataaac aatgggtaag ctaaagttta 13740 gtgatcatac acattacttg tctattatat gagttagata cattcacata tcacatacat 13800 acaagcatac acatattaca aaaaatccctc acacatattg ttggtaccaa ctactatta 13860 gtggaccagg ttattcttgg gggtcaatg tggttaacca taaatgtttg gagtttaggt 13920 tccccttggg ggccgaccat aacacccat atcatatctc tgtctaggtt ctctttgggg 13980 actgactata gatacttg ctcagattct ccttggagga taaccactcct cgacgagatt 14040 aacaacggac caccactgtt ttcagcttgt aacctgcac atcatagtt gcgatctcg 14100 gcgacaatga tgaaccaca tcacaac agtagtgccg gtagttagt cgttggataa 14160 taggaggcatc atctgaccct tttagcggtg acttttgttg cctatgaagg tcttatcagt 14220 tatatatcga ttaggcttgg ttctaggtta taagaaaaaa tgatctcta tccggtatga 14280 catagagaca aaccggtcta ctttataag aaaatcatat ttgaacaat gtcgtgttaa 14340 taattatat gtgtagttt aaatttagaa tatcctgaac tattattag ttcgcaaccc 14400 tatgtaagat cgaactaatt ttaaccgta accagacgtg catgttttgat cagtataaa 14460 aaggctatca tcgtcgaaaa tattaaaca aaatataata tcttatttgg cgccatttc 14519 <210> 8 <211> 684 <212> DNA <213> Tarrhacum officina <400> 8 atgtcaacgg ttaaaagcaa gttatcaacg cctcaaccg atcattctc cggtaccac 60 caactgctac taataccgc caccgcaaa acctatatat acaacttcca tcacaattct 120 gtcccctact cccattca tccaaaaag gctacacaga catatacagc gatggcagat 180 aatggcaca ccggccgtca aaaggatgac gacggtggcc atgatggggg acgcccaat 240 ccgaccacccc caccctcccc ttcccccc ccgcgagac ccaggcggac cacaccgccg 300 cctaaacatt ctccggggc gtctcaagc accatgccag cgccgcctac tcccctgcg 360 ccgacggggaa tcaccggtgc gtctagttct tctgtgggta ctaatataat ttcatttact 420 ccacccaaaa ccaaaagaac gaagtcggtg atttgtccga tctgtaagaa agatatgtgc 480 catgagaagg cgctgtgtgg ccacatccgg tggcatactc aggaagaaag attggcggcc 540 agcattgcta tagcaagagc gctatcttct aacgttgttg tttctggcaa tggcgatgaa 600 gatgaaggtc catctaaaaa gtataaactc ccggacctga acaagtcacc accgccggag 660 gaggaggacg aggacgctgc ctga 684 <210> 9 <211> 4521 <212> DNA <213> Taraxacum officinale <400> 9 ttttcttgcg ggagaggcat gtatgtgtgg cctttttgca ataatactat gcatgggaga 60 tgcataaagt ttatcttat tttgttttag tttaataatg tgtggcaaac tttatatcat 120 ttatgattc ggccatgtac tgctacatcg ttctaggatg gttattccct agaatttgct 180 tttatatt ttttttcttc gttaattctt cctctccttt aacgttattt catgtgaatt 240 tgcgatatca tgatattgca ggaacgtaac ttagaactca acgataaaaa gtgtgttgag 300 atcgtggaag ttgatcgttt atcttgaatt cacaagataa gcaacatgag atagaataat 360 taattactgc ggagatttct ttttagattc atcttattcg ttgtaaattg caatgcaaat 420 ttttaagtag aataacgaaa gcgtgttgtt attacggtt aaatgcaaaa aatcattaac 480 atatctccat aattgatttg tttagtatgc attctcatgt gttctattgc aaaattctat 540 tttgaaattc aattaaagca atgcatttta gatataaagc aattccatca cttaattata 600 ttgggtagat ttttaccaaa tcactgtcct aaaagaaaaa taaaaaatga aagttcaatg 660 ccatagtgat cccgtcaatt atgtgatcaa ttttaccag agcaaaaccc caaaagttaa 720 agagtataat tgcagaacga caacaatctg aggatgatac taactccggt ataaaccgaa 780 tgctttgtg gggatttcac taatcaacta tttggctctc atcacaaggc cgtgttaatg 840 gattactatt agttataagg ccatcccaag ttgtttggct atattattac cttttaaaaa 900 ccaaaatgtg taaactgtaa attacactt ttggttcttg tattttctaa tttttagaat 960 tatgtatttg gttcttgtag ttttttttatt tgtatgaatc atattagttt tggtccacga 1020 taacttttat tttctataat tacactttg gtcattgtag ttttaattg caaaaaaa 1080 ataatctatc ttttagtcc atatatatag tttgcaat tctatatttt aggttcaggt 1140 tatatatcttt ttacaaaat actacttatg atttttat gatatatca tatttcgtaa 1200 attackacataa cattttatat attttattt attacagaact attaggattcg catgataact 1260 ttgctgaact taattgggct tcatttta haaggataa tgcatcatgc atgacataaa 1320 aatttgtaat gtttctaatg tgcatgcact acagaacct gacctcat atacattaat 1380 gatgattct cttttcttat tatatcttag siaacggtttt ggataagagt ctgaacaata 1440 ttagaattg cactagctag ctagtccatg cagcaagcaa atttattaga ggacttttta 1500 1560 gtatgtatgg atttaatat tactaaaaaa tattaatgac aacaatac acactaattt 1620 ataacttaca aaagcgtgtg tcattaaaga aaatgtcatg tttcttaaaa tatggaat 1680 ttactactta catattatg tgtcataat ttactcatc tgtgtgata ttatgactt 1740 acaaaaatgt atgttatgtt tatcgtcata aaatctgtaa aaaaaaatag aaacatggag 1800 gatactttca aggtgtagaa acttgacagc ataaacgggt ttattacctt catcaaaact 1860 tatcttactt caatctcttg gagatgcagg ttgattttaa tgctaaatga acttttcaaa 1920 tgtataaata tatatctttt gacggatttg acattgatgg agatgaagat acaccagtga 1980 attcaccttt caatgatcat actgacatac caagtactct tatcccctct ccacctccac 2040 agaacgaacc tcaatttcaa aaacgtaact gccgctgttc taaaaacaga aaattttcaa 2100 aaacgtaact atcatttaaa tatttaatca tttttcaatt ggattcatgc tgtaatagaa 2160 gttactggac tttaaacttc ttgtagctga tgagattcat gaacaacagt ccaaggagat 2220 tttccaaatc aacaagtttc tgatgagaac aaggtaaaaa aaataagttt ttcatttaaa 2280 catatgattt tggtttcaa aagataatta attataggaa ctcttctgaa aagtcccaaa 2340 gtttacccgt aaaattgatt ttggtttttt tttaaattga ataaaaaagt ccataaaatt 2400 ggataaatta ttcgatttag cccaatttac ctagtatatc tggtaaaat tggttaaatc 2460 gaataattta ggcagtttgt tgggcttttt tgcgcaaaaa cattattttg ggacttaatc 2520 gttaattttc cccaagtttc agtttattta ftaatttgga ataaaaccga acctagtgcg 2580 ctaattttgt cttttggtgt ttagaattat ttgggtttat tggtctcggt ttctaaacga 2640 gttcggtttt tggtttcttg attcgatttt tggcttttgg gttcaaccca tggattttcg 2700 atttggtttt ggttttgata atattttttg tgcaatcgtt caaaaaatcc gagttagatt 2760 gggtttaaat gttatcaaaa ccaaaaccga tggtagaacc ccaaaactga acccaatcga 2820 aaatccatgg gttgaacctc aaaaacgaac ccaataaatt ctaaaaacca aaatccaaaa 2880 ttagcggata aaaattttaa aatacatatc tactggtaag gtgtttttga caatttatgt 2940 aaattataga aaaaaatgta ttaagtgttt gctatttaag ataaaaatgg cgttaaaaat 3000 agaattggtt agaaatgaac cattttttta tattttttac ttcatttatt aagtaaaatag 3060 tagaggtgaa ttagagatga tctaagatat tttttttctt tcaaaaagag cttcgaaaac 3120 acttttccga cagaaacaag acacaaacct ttttactcgt agaccgacga tttttttaaa 3180 gatcaagac ctaagagagat ttgtctccca tcttcttaaa acatagtga gatagacact 3240 tctagcctct tctatgctaa aaaaagagc tcgcctttag ttggttaat tgagacaat 3300 ggtctccaca aaaacatagg tagttaggta ctcacgcgcc aagttacta tctcaatca 3360 aacataactg tatgatcgtc aacacatttt acagttaac aaagagcat tgctttagac 3420 ttaaaattg ctttgagaaa aaaaaacac ctaagaattt ctaaaagcga tgatttcaac 3480 tctctttaaa atgtatatat atgttacatt ttggtcttta aacttttca gaagtaca 3540 ttcaactcct atttcaaaa tgttcttaca tgagcgatat gattttaccg tttaaaatgt 3600 aaaccatgat aactatttct aaattccaat tttgttcg ttgatcaatc tcattatcat 3660 tcaatgcata caaacaca tacaatctgt ttgtcatct tctcaagc cgaaagacaa 3720 ctaaacat gagactgaa gaggacaatc tagcaactc aaacttcact ataatttgc 3780 aattgctatt ggtagccatg aagtaacatt tttgaggagg ttaacaaat ttacagta 3840 aattcaataa tccatcacca cgatatgtaa tcatctacac aaacacagat gatgatagtc 3900 atatatgttc gtaatcacac aagcaagaaa tcgcaatgta ctttacaccg tcttctctga 3960 cttgaacacg ggaattggtt gtctaagaag tagattgttt cccacggatt taccaagtac 4020 atttaaatcc ttcacccttt gtatctctct tcctgttttt tgttttgcaa tcaacaaaaa 4080 aaaaagtaaa aatcccatct taaattcacg caaaaaaaaca cattgaatca accatcacta 4140 tagtagtttc aagaaaaatc tgcacttcca taatttcttt ctattacacc attatactag 4200 gaaaacttca tagcaatatt atctaaatac aaagcaattt ttactagtaa tattcgtaga 4260 tttgtcaata tatagtgtcc taataaagaa aaataacgg aactataatg ctctaatagg 4320 tagatttttt ttagtataat gtcctaataa gagaaaaaac aaatgtacaa ttatgtaata 4380 ataagaaaag aaagtaatat gcttaataga caaataaatg aaaccatgtt gctatttctt 4440 gcatctagtc cttattgaa taatatgtag catattaact acttatgaat tttatatata 4500 aatgataaaa aattccgtga g 4521 <210> 10 <211> 19724 <212> DNA <213> Taraxacum officinale <400> 10 ctgacttggc caacattttt tgttcttccg atcccttcgt aacaatcagt ttaagcacaa ttgaattata tggagataaa taggtgaaat ttggaagacg aggatggggag agtgcgaaga gccaaagaag agaaatgtgg gatagcggcc ggccggttgt taatagaagt gcttagatct tggagacctt ctaatgctta tggaggacc agatgcttca atttgtaaat ctgcgctgcc 300 sq. ft. 300 sq. ft. 300 sq. ft. 300 sq. ft tttcccactt gtataattct cttattcatt ttcaaatctt tatctaatt aaggatatcg gcaaaaatat aatcctaatt gtttttcaaa atgataagga ttaaggta acttaattct tgttttattc attattatt attattgttt tttatcaatg ttttaaaacc cgggttttga gtcaacccgg tcttgtgaaa aatcccgggt cagccggtca gctgatctac cggttcaata 540 tatttaaata aaatataaat tttcatatag aatttgagtt ttaggctaag aaaatcgggt tttgggctaa ggaaaatcgg gtttaagttt tgggctaatg gattttcggg tcaataacgt ttttttccgt tttttagatc ggttcgaccg cgttttgtgt gaaacccggc cggggttgatc 720 cgagtcaata attggcaaca acccggtata tgttgacccg ctcttgtccc cgggtcccgg 780 ttcaaccggt tggatcggcc gggttgaccc tggttttaaa acactgtttt ttatacaata 840 tatttgtttt tgtttttagt tttgtttttg tttttgattt tgtagatata tttttaattt 900 tatttttatt ttgtataaat atagtcatta caaccgatta tttgtaagtt gagtcggtca 960 aaacgaactt tctgataatt cttatacatt tttcggcgaa acatgaatat tttgatcaac 1020 caatatgctt ttttctaggt tttttaaata aaccgcacgt tcaattgcat attcgcaaac 1080 aatagaactc gaaaacccta atcgagcttg ttttatagaa atctgggttg agtgcataca 1140 taataattaa taactgtgaa aaagtttgtt ttaacatgct aaacctatcg atagtcggtt 1200 1260 gttactaaat atatacaaaa tcaaaaacaa cagtaattc ttttacaaaa aaaagagaac 1320 1380 ttttatataa attggtaaat tggtcatgta atctagaatg tgaattgcgg aatgctttag 1440 tcacatttg aaaaactgg taattaa ttcgataaa agttctca gatagtttg 1500 gtcacatttt ggacgacaat ggtgtgtttt ccatagtaag caatacgtaa tgagttcgct 1560 tataggaaa atagatctaa agcttaatga aatcatatgt atagtaca tattattttc 1620 acacgttaca ttgttgtaa cgtcctcaat tttttaata tatataacta ggtacactct 1680 aaggtcgtgc taagcacgac ccacgaatgg taatttaggt aattttcat ccttgactaa 1740 atacattat gctaataca aagattaag atacaatgc atacattat aagtaata 1800 aagtacatga tattctcac atttagtctt tatacataga aaacttacac tggccattg 1860 CAaaaaaca ttaaatctcc ctaaaagta gagtttaca atgaaagct tgttttatta 1920 gcaacaata atcaatgt gaagctatag tatagtacc tactcattc aacttttagg 1980 cagtgcagta attacttact catgttaatg gtgaaatgca ttaagataa cttcattcaa 2040 cggattaaat ctgggttcat tataaatgta ctcttagtta ctcctccatg taactgcatt 2100 tagcgaaca aaagctct aaaataat atgaacaca tgctaattta taaatgacat 2160 catgggtata gatgctgtaa catcctaaac ttttaaata ataataat catatttggg 2220 Atttaagta atattttaag aatattgata aattagagaa tgaataca agaggcattt 2280 tattttagc ctttgattta taaaaaagaaaaaccttga attggatgt attttgaat 2340 gggtaagtat ttaaagat gtgtaagtta aggggataa atggaatta aggagataag 2400 catttgacca aagtcaaat agaaggaaca ataagtcggt cgatgtttt cctgtgtgca 2460 tcttcggacg spy agaaaagac gagcgaga spy spy spy 2520 gagattatcg aggagagagac agcgaagtcg gaggagggag accgagaacg accgagacag 2580 gaggaaaacc gagagacaag gggaggacga ggcagcagca gcctaggctg ctgcgttttt 2640 ggcgacagaa aaccaccgcc agcggcggtg gtggtgagcg acggtggtgg tggagccgag 2700 aaggggttgt ggtggtgtta gaagtgatgg ttcatctca tttctgata atttgcctt 2760 ttggacaat aaattgaagg taactttcaa agctttagat gattatctct tgaagtaga 2820 aagcaagggt aatttagtct tcaatgt tatggagag ggtaataca cccaaatgct 2880 aacaaaatca tatagattaa tgtgatttga agtttatagat ttcatgaatg tgaaggttga 2940 ctttctgcaa tggtcaaaca tggacatgga catgattata gcatattagc aatgtataag 3000 gaatggaatc accaattcca ttgttgaaaa tagaaattt gatgtgtgca gaattttgta 3060 aaatttccca aaacaccaac tttaaggctg cataagtcat gcatgaagaa tgcaaatcag 3120 tccattcttt cgcctaacat caagtccttg caacatagat tacacaggaa aaagaaacag 3180 ccaaatccga gttcgtatga ggattgtatg actgttcaac gtttgtcaaa agttgctgtc 3240 atgctgtcaa accagaattt ttctaagtct gggaaatatg cagaaaatgg gtttgaccag 3300 tttttggagc ttcataactt gatttataca tatccaaatc agttgattct tgagcctaaa 3360 ctgtagagaa agatgaggag aaggcatagg aaaaagaatc aacacatttg gatatcgtat 3420 acaacctgtg caaagggttg aagtaggctc aaaaccatt tttgacataa ttgtcaatta 3480 tatgaattgt gggtaacttt tgccgtaatg aaatgttttg acatataagt gtttatattg 3540 acttataaac atgttaagac tataaacttg ataaagtaac atgtcaaaac ccgaaaatgc 3600 ctatttaggc aaagtatgat gcttaattga gaaatcggtc aaatagcata aaaactaaaa 3660 gtgttctaaa tggtccaaga agactttata cataacttac acatcattag cacatgatgt 3720 gtagtacatg tgaggtttga acacttttat acttggaaaa ttgtcaagta gtcaaaaatg 3780 ggacaaaagg gtaaaattgt ccaaaatgag tatatggcta attaaagcaa gttgagctac 3840 3900 agttttgaag gtaatgtcaa tttaaagtaa gttaaccaaa agaaagtaag ttgctaattt 3960 tgggatatat gacccaaatg agttatgcat tggtttttag gttgtgtaat acctataatg 4020 agatatgaat tgattatgag acatgtattg atgataatac aaatgatgta atgaaatagg 4080 ttcgttgcct atcgtggagc aggagcatg cggattagtg tagctagtct tacctagcta 4140 ctaaggtgag tacgtgtgga ttgtttttcc attttcgggt acatggaaaa samaaatttt 4200 tataatgaag tgcctaatgt tttgaaagaa agaatgaatg aaaatacttg atgcttttga 4260 aagaatgttt taaaagaaag taatgttttg aagaaaaag gtttgatgct ttacgtttga 4320 aaatgaatat gtcttgatat taatgaatgg aatgggtaaa gcatgaatga tataatgtgt 4380 aataataaga tgctaaggat ggttatgttt atgatgttca cgtgaatata agaatgttgc 4440 tcgatctaag atgtcccggg tagggattca gaggagccta tcggggtggt acctcccctt 4500 cgcgagatag gttacctaat gtaaatgatg tcaatgtaat ctgatttgtt cttttgcat 4560 tggtacagac ttggggtata tcagacccaa gtataatatg atatggccat atgataagat 4620 gattaaaaga gtatgtgaaa tgttaaaggt tatgtaaaat gttatatgaa attattcaaa 4680 gagatcttta tggttattat gtctatgaaa aggaagcata taatgtata gatattttat 4740 gtctaaaccc acgtagctca ccagactagt tgtctgacgt attattttt atgccatgta 4800 tttcaggtta tacacgagga tagactgatg atcgatagaa gctagatgtt acgacggata 4860 gacggagtgg agctttcaag ttctattgta atgatcttac cgtaaattct tatttgcttt 4920 gctatggttg ctgtttgata tataattggt aacacccgag aattgtttta tatatattca 4980 aaaagtttt atttgggacg gttttgtaa acatgaccaa gtgtcatgaa atatttttaa 5040 aaccatagcg ttttaaaac gataaaatga ggggtgttac agatgcgata atatatctta 5100 ggattatgtc aaatatttat gccaattata catgagagag caagtttata agagttttag 5160 ttattctatc attggatca tatagatacg tattatagt agacagagat gcatgaat 5220 tatagcagag aacttttgc aaaacctaac ctcactgcat gttgcattca tcaccccac 5280 ttgtagttgt aacaccatga atatgccaat taagaatat catgaggtat attgtactgg 5340 aaatgacaaa agtactaat ttacaataga acgcagtcaa acttggttat ttgtaaattt 5400 ttagaagca atttachaaaaaaaacat aaaaaaaacacag taaatcacag 5460 acattgctca tggagagtg actgatcaaa ctgaccgtttt attttctgt ttcttgtaca 5520 actaccaaac gttcctgtat aaccaccaaa tagtcccaga ctttagaaaa tagacagaa 5580 aaccacagat atacatacat acagccatac attataattt ttaattgaaa aaaatgcata 5640 gaaaaccagt ctcaataa gaaccaaata aagagatac aaatgaaacc tggttatcga 5700 aaaagagt tagataat gatttcagca ttgcactca tgtaaacgat atgccattgg 5760 gatccgttgg aaagggtatc gtgaagtgat taaggagaag cggggtgtta gggtttttt 5820 tgcagttat tgaacaggtt gatcaaattt tgcgccggta gggttaattc cttttcgaac 5880 gggttctct ctgggtcttt catcaaaatc actcatgttt gtgtctctaa cctttagttg 5940 cagatggata tcagatcaac ggtttcaggc taaatggggg aaaataac aagaagaaag 6000 cggtgacatc tgtgttcgta ttcgtatggt ggaaggggaa gagtggcgta tgaattggtc 6060 aatgtaaaac atctggaaac aacttctccc aacatgtaaa aggatccgga aaatatgaaa 6120 atgacgatta gagattcgt tcggatattg ggaatatggt cgcgtctgat tgccctacgg 6180 tgcccaccgt ttgggtttct tgatttgtcg tttagaga tgtcggaggt ctaaattcac 6240 aatcctgttc ttccgcggta attgaaattg ggtaaggcta attgtttaga tcaaatggca 6300 gaggacgatg tgaagttgcg ttgccctata attggctctc gtgaaattga attgcaaatt 6360 tcacaacgat gttagcaaca ataatcgtcg ctctcgcatc cataccgtc gcaacgtatg 6420 atggtgatcg agattgagag atttagggct agatgtggcg ttggcggaca taggttgtgg 6480 ttgacggaat gaggagaga cgtgagcgtc gattgaggta gcacaggcg gaggttaac 6540 ggtgtcatca tggtgaaagg tcgcgcgtcg ttttatggtc gatagatcat ggacgttgtg 6600 agtgaatgcc ggcgcaaca cggtggagga aagtctatgc tttagttgac ggggcggttt 6660 tctctcggag acggaagag gacgtcgaaa gaaggccgg ttggagaaa tatattaac 6720 gcgccgacac acgctatcag agaagaccgg tttcttata taataatgac taggtacgtg 6780 caagggtcgt gctaagcacg acccatggag gcttcttgag aaaattgtaa acacatatca 6840 tataatagcg acgaacttta ctgttattga tatataagt gattaagcat ggttggccct 6900 aagttaaaac tcaactact gtaagtagt aatgtaata atttacctt ttcagctatc 6960 gatcttagat tgctctgtag tgttgtgtct tagtgctttt cacggttctt ttatatgcat 7020 atagtcacat aaaatcagac acacatag ataacccac agacaatcac aaaaatca 7080 gtctgatgag gttaattt aagcaatag gattgattt caagcaatta gaggaata 7140 atatattaat ttcacgtact cctattgtag ttattgtgac aaaacccaac tgtttaattg 7200 tgccattgca aaagtccac ctgtttaatt tctttatcaa catgtcgttg catcctttta 7260 catgcaata tttcagaaca tcttcctata atgacccttg agatgaactt tttagaaata 7320 ttgttgctgg ttacattatc agaaaaaaca gagcttatga aaaagacca aacatagtaa 7380 ctcgtacttc atgtctggta gttctttga atatttccgt ctttgttcg aaacaatttg 7440 gttgaactgt agtagatctt tcaactgta tacaacttca caatgtttt tgtaagttca 7500 ttacttctag atccttcaa agagaggt siactcaa atttgcataa accagattta 7560 ttgaaggcta attagattag tgttgtagggg ctttttggat aataataaa atgaaacata 7620 ggtgctgcaa caggtgcgaa agaatttggt tggacagtag taggtctttc aactgtata 7680 caactttaca attgttttg taagttcatt atttctagat ccttcaaa aaaaggaggt 7740 siaactaaa aaatttctaa accagattta ttgaggctg attagatta cattgcagggg 7800 ctttttggga aataata atgaagata ggtccaacag aaacgaagga ggtgtgaatt 7860 atgcacaaa tggaacaca cattatcgt agtacacatg tattacag ggatcaattt 7920 ccatttattg ttccatcaat tgccaattt aaagataac aaatgcatcc ttttgaatg 7980 gaaaagtag atacataaa ccagagagag gtatacattt agtccagaaa cggtggaaat 8040 tactttacct agagttgcgt gatcaatg gaaatcaga ggagagacc ctaaatcgca 8100 atccatcttc tattcctat agaatcaat ggaaatttct tactccgac cttttcatt 8160 tccacaagtt tgtaatcgat aagatcataa aagaaaccg atttacatta gcaaatcttt 8220 aaggcacttg tttgtagttc tcaagtatgc gttacgtag aaattctaga cagaaaaggg 8280 acgacaggga aaataatggt ggaataata aacaatcaag atchaaaga taataatccct 8340 taaaactaac aaaaatttcta tcaataagcc ctacaatga gaaatgac ggtggagact 8400 cacctgattg cagtggcgga agcttggg ggctttggta ggccatggcc ccctgttttt 8460 tggaaaattt tcaaaaaaa aaaaattata tatatat cattgataa gtctagactc 8520 aggaaactat gaagattag aaatagatca agttatctaa atcaatctc gaaaatatg 8580 gaaggaatca aaacacaata tttatctcat tgtgaatca aaaaccctat aaaaaacaca 8640 aatctaacct acaatttaaa tcaaaaacc cataaaaatc aacctaccgt cggattcagc 8700 cgtcgtcgtc ttcttcaccg gaccaccatc caccgccatt gcttcaatcg tgctttctcg 8760 tcaatagctt agtggcttgt tcagctttct tgctctacca atgattttta tacactttcc 8820 agcaccaccg atttgttgaa cggtaatatt atgctccttt atatttttga aatctttgaa 8880 agttcatctg gttttctgtc tctgtaaact gtaaagaaac tttatgttt tgttaagaaa 8940 atagagagat agagaagaaa gagtattgac gtgcttttcc catatgtctc gaatgccaca 9000 ttaggaaaag acaaaaagaa aacaattagt acattacgct agtgtgatag tactgtatga 9060 ctattagtat gatttacagc tttaataggg attcatagaa aagaacaaaa taaactactt 9120 ataattaaa aatcgagctt tatttttaat tagtttaaat aaatatttag ctataacata 9180 atatattata tgttttgtat ttataatcaa atataattat ttgtattaca gattagtttg 9240 tataatcaaa tataatgatt catgtttcga aaagattgtt taaattttt tatatgccat 9300 gttttttaac tgaattatat ttttttgtat gattttcttt acaatttagt ttttctttac 9360 <h2 style=";text-align:left;direction:ltr">aatttagttt tggcccccct tgttttttttg tttgtgttcc gcccctgcct gattgatgcg 9420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agaaaaggaa agccgccgac atttgtgctt cttcccgcgt taagaaaaat cgcagatgac 9480<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> attacgattc tttttctaca gaggaatagg ggggttgcga ctttgcgtga tttgttgtta 9540<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atgagtgatg cgtcgtccgt tttgatcggt agcccgtgga gactgattta tttgacagat 9600<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agatgtcgtt ctcgttgatg atgcaggtgt aattggcggc gttggtgaag cgaagatggc 9660<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atagggaatg gctttgcaga ggagaaaagg agtttcacaa atatggatta ttgaatcgtc 9720<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtttcagagt cgcgatggtt agtaatcgat ggatttgggt ttgcacctgt tcaaggggtg 9780<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtgacgtgtc ttactgtaag aaagagtcgc gatggttagt aatcgacgat ggatttgggt 9840<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttgcaacatc gttgacggaa acgacgcggc gatggagaga ggcggtagag ggaatgaaac 9900<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gggagattta ccttcaaccg caaacatgtc ttcgttcctc gaaaatcata tgcgcccttt 9960<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atgaaaattc cttcacgcgc cgtacacgcg ctcagaaaaa acatagggtt ttcttatata 10020<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ataatgacta ggaacgttta tgcgccgtga taatcacggc ccatgagtgg tacaaatgtt 10080<h2 style=";text-align:left;direction:ltr"> gtaaaactta gaaaatggga aagttgaatg tacaatgtta tgatttattt tattcttcat agcacaatac ttttgcttta gtgaaagcag ttaaaaagtg gatgtgtcgt tagcaactat aaacttttaa caaaatatta catacagaac atagaaata throwingacact aaaaaataac aaaatagccg tgttcaacac ggcccacaga atgcaatttg gatattcta aggaggtgta aaaaatattg ctattatggg agctaattct aggtatattt tgttactcac atgacatgaa 10440. ttttgagtaa ttttgtaaaa ttggtaattt agcttagtt ttcccacaaa gatgagtgtt aaaactatca aggaggatat atggtacttc ctcaacaaag atgattttga aatatctata ttttaaatgt aagaactact atcacatgag acaaatattg attack ttaggattac aacattgata tgtaaaatat tttggtaatg taattttct aaaaaagctt ggaagtagaa tgcaacaaca atatatgcta gtattacatg ttgggtgatt ttatgaatgt acttacgtgt tgatccttat ttaccgtact tgaatattt tatctgatca atgctttacc tatatggcta tatctagcaa tgtgcattat tcacaaatta tggagtgtaa attcatatag acgtatatga cagtggaatga aaggaaaac aagtaatttg attgaatcac tgagaaaaaa gcaaagata 10860 catgcatata aatgttaca tcaaataca gagaataat gaagaaga taataatgtg 10920 gagcattca aaagtaag aatgtaagtc cttgatagct cgaaatttctt ttaagtcttc 10980 cgtgatagcc taatgtttat atagagag acattcaaa tgaatagaa ttatatcacc 11040 taacagtatt taatcctact ctacttggcc attgagcata ttgctattgt taaaaattat 11100 gtccaaatcg catttaactg ttagatgcaa ttccattgc cgattacact tatatgtatg 11160 tagtaaatta taattactc ttgtcctgg tcatttgatg tgtcatggat gtttgtagg 11220 acaataat agattacaat aacttaata taaaattgag ttaatattcc agaattcaca 11280 aaatgtgtaa taacacttat ttataatttc cacgtaatta atgattact acttagaatc 11340 ctacaagtttt ttgttatca ccttcatat gatcgtataa atgcaacac ccttaatgca 11400 tttatagttg ttggtctgcc acgaacacct ttttctgttg attatttgtc attattatgt 11460 taaaaaatgt tgaaaaatg ttaatggga tttgttg gcaagagat gaacttctcc 11520 atattgtag ttgcataaat attgccagtt ccatcataca gatataaccc tcttatattg 11580 ggcaatagaa ttatagaac aaagggtt aaccgactta catgtattga tctctgattc 11640 ttctttacac actggacaaa ttagtctatc atgtcttgca caaccctgtt aaagaaaaaca 11700 gtgaaaattg accacgaagg tgtatcctct agtaccaca ttacatctat cattttaaaa 11760 gggaaatgta tacttatcat atatatctaa tggacgttgc ctttcctcca attgtcactc 11820 ttacatctaa tggaattat gatcacaatt tactttaac agcatagata cattcattg 11880 ttggtaagac acttttggcg gattcattgt attaatcttt catgtaaaa ttctcattca 11940 agatattagg ttttgttag aacccttgtt atttgaacat gcaacctgaa ttctgattgt 12000 tcccacacc aacattaata attackctc cactagacca tcattccacc ttcaggccct 12060 tgtgttcatt attataagca ctattcggtt tagttctttt atgagtccta tattacatc 12120 cttaaccatt ttaacaagtc catcatattg ggaattttaa tataaatacc caatgttatt 12180 cattttgtc gcttcagtag atattgacca tactaagat gagtatttaa tactcataca 12240 acatgaaaga aaaaatgaa aaactaacag tcacttagt agcccaatc tccatacaa 12300 tagcgcttta agaataaacc aatttcaggt gaattgtag aaggacata aatctgtaca 12360 tgaaaaaaca ttacagtta cacaataattt atttgcacag agataaaag cacaatgt 12420 gatgagaga ttaaagta ggaagtgaa caaaatac catcaaatc caatgttagt 12480 aaaagaaa atgtacgagc gattcataac attcatccaa aacccatatg cgatgttgaa 12540 tgcatatctg gataaaagaa tttaataac ataagcgcc tgtaaaatca ataacaaaa 12600 tcataaaaa tagacctaaa atgcaaccg acttattgtt tctatacacc ataaatgat 12660 tttcacgaat tttatccaa gaaagataaa aagtcataaa attgaacggg cttaccgatt 12720 tgaatcgtgg tctgtatctg ccacgcagat cagataca tcataatcta catcaagat 12780 ttcagaaaaa tatgaaactt ccgccattac taatttgata tgaatttctc agagcctaaa 12840 aaaacctaa attackaaaa atcaacaca gttttttgac gtttaccttg atttgtgaaa 12900 ataggcattt gggtttttc gtaggatttt ctatgaaaga agccatcaag tttatgacat 12960 tgtaattta agcaagtat gatatatga aggattagga aaagagatcgg attgtgatga 13020 tccggagaga aaatacaca aaccagagag aagcgatgtt gtgattgtgg tgtattaatc 13080 tgttttaaa cctctaacca cttcttgtaa gtccgtaatc agacgaatg cgcttgaata 13140 ataagtcttt cacgccagtg tcgaggatta atgccgtcaa gggtggtggg gaggtattta 13200 taggaagaaa tgcggtggag gtgaatggag gcgtcgatca aacccaagg gaaacggttt 13260 gtcgaaatag atgcgttggt cattcgccat aagtttgtga aacggtgagt gtatccttgg 13320 cgtcgtttga aagtttgtga aacggtggcg atgctccgtt aaggaccgg caacggatcg 13380 agcgatatgt aaatgggagg gcagaaatat tgcatacgcg ccggacacgc gcttatggaa 13440 gtgagtat ggagtgata ggattttctt atataataat gatataactt attttaat 13500 aacatcgtac tatacgtttc aaaataattt agagttttaa taaaattacg gatgatta 13560 accaattaca aaaaata agtgtcggtg ataaaatt tgtaacaacg aaaaacattc 13620 aaaaaatctg atgcggaaa tccatacat gagaatacga ttcgtttgca gtcacgccgg 13680 tttctcacc ttctgaggtt cctgaaaaag gttaataaac aatgggtaag ctaaagttta 13740 gtgatcatac acattacttg tctattatat gagttagata cattcacata tcacatacat 13800 acaagcatac acatattaca aaaaatccctc acacatattg ttggtaccaa ctactatta 13860 gtggaccagg ttattcttgg gggtcaatg tggttaacca taaatgtttg gagtttaggt 13920 tccccttggg ggccgaccat aacacccat atcatatctc tgtctaggtt ctctttgggg 13980 actgactata gatacttg ctcagattct ccttggagga taaccactcct cgacgagatt 14040 aacaacggac caccactgtt ttcagcttgt aacctgcac atcatagtt gcgatctcg 14100 gcgacaatga tgaaccaca tcacaac agtagtgccg gtagttagt cgttggataa 14160 taggaggcatc atctgaccct tttagcggtg acttttgttg cctatgaagg tcttatcagt 14220 tatatatcga ttaggcttgg ttctaggtta taagaaaaaa tgatctcta tccggtatga 14280 catagagaca aaccggtcta ctttataag aaaatcatat ttgaacaat gtcgtgttaa 14340 taattatat gtgtagttt aaatttagaa tatcctgaac tattattag ttcgcaaccc 14400 tatgtaagat cgaactaatt ttaaccgta accagacgtg catgttttgat cagtataaa 14460 aaggctatca tcgtcgaaaa tattaaaca aatataata tcttatttgg cgccattca 14520 tgtcaacggt taaaagcaag ttcaaccc ctcaaccga tcattctcc ggtaccacc 14580 aactgctact ataaccgcc accgcaaaa cctatatata caactccat cacaatctg 14640 tccctactc ccattcaat ccaaaaaagg ctacacagac atacagcg atggcagata 14700 atggcacac cggccgtca aaggatgacg acggtggcca tgatggggga cgcccaaatc 14760 cgaccacccc accctcccct tcccccccc cgcgagacc cggcggacc acatcgccgc 14820 ctaaacattc tccggggcg tctcaagca ccatgccagc gccgcctact cccctgcgc 14880 cgacgggaat caccggtgcg tctagttctt ctgtgggtac taataatt tcatttactc 14940 cacccaaaac caaaagaacg aagtcggtga tttgtccgat ctgtaagaaa gatatgtgcc 15000 atgagaaggc gctgtgtggc cacatccggt ggcatactca ggaagaaaga ttggcggcca 15060 gcattgctat agcaagagcg ctatcttcta acgttgttgt ttctggcaat ggcgatgaag 15120 atgaaggtcc atctaaaaag tataaactcc cggacctgaa caagtcacca ccgccggagg 15180 aggaggacga ggacgctgcc tgatttctt gcgggagagg catgtatgtg tggcctttt 15240 gcaataatac tatgcatggg agatgcataa agtttatctt tattttgttt tagtttaata 15300 atgtgtggca aactttatat catttatgat ttcggccatg tactgctaca tcgttctagg 15360 atggttattc cctagaattt gctttatat atttttttc ttcgttaatt cttctcttcc 15420 tttaacgtta tttcatgtga atttgcgata tcatgatatt gcaggaacgt aacttagaac 15480 tcaacgataa aaagtgtgtt gagatcgtgg aagttgatcg tttatcttga attcacaaga 15540 tagcaacat gagatagaat attaattac tgcggagatt tctttttaga ttcatcttat 15600 tcgttgtaaa ttgcaatgca aatttttaag tagaataacg aaagcgtgtt gttatttacg 15660 gttaaatgca aaaaatcatt aacatatctc cataattgat ttgtttagta tgcattctca 15720 tgtgttctat tgcaaaattc tattttgaaa ttcaattaaa gcaatgcatt ttagatataa 15780 agcaattcca tcacttaatt atattgggta gatttttacc aaatcactgt cctaaaagaa 15840 aaataaaaaa tgaaagttca atgccatagt gatcccgtca attatgtgat caatttttac 15900 cagagcaaaa ccccaaaagt taaagagtat aattgcagaa cgacaacaat ctgaggatga 15960 tactaactcc ggtataaacc gatgctttt gtggggattt cactaatcaa ctatttggct 16020 ctcatcacaa ggccgtgtta atggattact attagttata aggccatccc aagttgtttg 16080 gctatattat taccttttaa aaaccaaaat gtgtaaactg taaaattaca cttttggttc 16140 ttgtattttc taatttttag aattatgtat ttggttcttg tagttttttt atttgtatga 16200 atcatattag ttttggtcca cgataacttt tattttctat aattacactt ttggtcattg 16260 tagttttaaat ttgcaagaaa aaaataatct atctttttag tccatatata tagtttgcaa 16320 tattctatat tttaggttca ggttatatat cttttacaaa atactactt atgatttttt 16380 aatgaatata tcatatttcg taaattacat aacatttta tataattta tttagtcaga 16440 actataggat tcgcatgata actttgctga acttaatttgg gctcatttt taacaagga 16500 taatgcatca tgcatgacat aaaaatttgt aatgtttcta atgtgcatgc actacaagaa 16560 cctgaccctt catatacatt aatgaatgat tctctttct tattatatct tagcaaacgg 16620 tttggataag agtctgaaca atattagaa ttgcactagc tagcttacc atgcagcaag 16680 caattaatt agaggacttt ttagaggct tgatcactc attgtatatc taatggcact 16740 gtggatatat gattggattg tgtgtagta tggaatttaa tattactaa aaatattaat 16800 gaaacaat aacacacta tttataactt aaaagcgt gtgtcattaa agaaaatgtc 16860 atgtttctta aatatggag atttactac ttacatatt atgtgtcata atttatgtc 16920 atcttgtgtg atatttatga cttacaaaaa tgtatgttat gtttatcgtc ataaaatctg 16980 taaaaaaaaa tagaaacatg gaggatactt tcaaggtgta gaaacttgac agcataaacg 17040 ggttattac cttcatcaaa acttatctta cttcaatctc ttggagatgc aggttgattt 17100 taatgctaaa tgaacttttc aaatgtataa atatatatct tttgacggat ttgacattga 17160 tggagatgaa gatacaccag tgaattcacc tttcaatgat catactgaca taccaagtac 17220 tcttatcccc tctccacctc cacagaacga acctcaattt caaaaacgta actgccgctg 17280 ttctaaaaac agaaaatttt caaaaacgta actatcattt aaatatttaa tcatttttca 17340 attggattca tgctgtaata gaagttactg gactttaaac ttcttgtagc tgatgagatt 17400 catgaacaac agtccaagga gattttccaa atcaacaagt ttctgatgag aacaaggtaa 17460 aaaaaataag tttttcattt aaacatatga ttttggttt caaaagataa ttaattatag 17520 gaactcttct gaaaagtccc aaagtttacc cgtaaaattg attttggttt ttttttaaat 17580 tgaataaaaa agtccataaa attggataaa ttattcgatt tagcccaatt tacctagtat 17640 atctggtaaa aattggttaa atcgaataat ttaggcagtt tgttgggctt ttttgcgcaa 17700 aaacattatt ttgggactt atcgttaattt ttcccagt ttcagtttat tcagtatt 17760 ggataaaac cgaacctagt gcgctaattt tgtctttgg tgtttagaat tattttggtt 17820 tattggtctc gtttctaaa cgagttcggt ttttggttc tgattcgat ttttggttt 17880 tgggttcaac ccatggattt tcgatttggt ttggttttg ataatatttt ttgtgcaatc 17940 gttcaaaaaa tccgagttag attgggttta atgttatca aaaccaaaac cgatggtaga 18000 acccaaaac tgaaccaat cgaaaatcca tggttgaac ctcaaaacg aacccaataa 18060 attctaaaaa ccaaaatcca aattagcgg aaaaattt taaaatacat atctactggt 18120 aaggtgtttt tgacaattta tgtaattat agaaaaaat gtattaagtg tttgctattt 18180 aagataaaaa tggcgttaaaatagaatttg gttagaatg aaccatttt ttatatttt 18240 tacttcattt attagtaa tagtagaggt tacttagaga tgatctaaga tatttttttt 18300 ctttcaaaa gagcttcgaa aacactttc cgacagaaac aagacacaaa cctttttact 18360 cgtagaccga cgattttttt aaagatcaaa gacctaagaa gatttgtctc ccatcttctt 18420 aaaaacatatg tgagatagac acttttagcc tcttctatgc taaaaaaaag agctcgcctt 18480 tagtttggtt aatttgagac aatggtctcc acaaaaacat aggtagttag gtactcacgc 18540 gccaagttac taatctcaaa tcaaacataa ctgtatgatc gtcaacacat tttacaagtt 18600 aacaaaagag cattgcttta gacttaaaaa ttgctttgag aaaaaacaaa cacctaagaa 18660 tttctaaaag cgatgatttc aactctcttt aaaatgtata tatatgttac attttggtct 18720 ttaaactttt caagaaagta caattcaact cctattttca aaatgttctt acatgagcga 18780 tatgatttta ccgtttaaaa tgtaaaccat gataactatt tctaaattcc aatttttgtt 18840 tcgttgatca atctcattat cattcaatgc atacaaaaca caatacaatc tgttttgtca 18900 tcttcttcaa ggccgaaaga caactaaaca tatgaagact gaagaggaca atctagcaaa 18960 ctcaaacttc actataaatt tgcaattgct attggtagcc atgaagtaac atttttgagg 19020 aggttaacaa aattttaaca gtaaattcaa taatccatca ccacgatatg taatcatcta 19080 tornado gatgatgata gtcatatatg ttcgtaatca tornado aaatcgcaat 19140 gtactttaca ccgtcttctc tgactgaac acgggaattg gttgtctaag aagtagattg 19200 ttcccacgg atttaccaag tacatttaaa tccttcaccc ttgtatctc tcttcctgtt 19260 ttttgttttg caatcaaca aaaaaaagt aaaaatccca tcttaaattc acgcaaaaaa 19320 acacattgaa tcaccatca ctatagtagt ttcaagaaaa atctgcactt ccataatttc 19380 tttctattac accattatac taggaaact tcatagcaat atttactaa taxaagcaa 19440 tttttactag taatattcgt agatttgtca atatatagtg tcctataaa gaaaaaataa 19500 cggaactata atgctctaat aggtagattt tttttagtat aatgtcctaa taagagaaaa 19560 aaaaatgta helpattaaataaaaagtaatgctat agaaaata 19620 atgaaaccat gttgctattt ctgcatcta gtccttattt gaataatatg tagcatatta 19680 actacttatg aattttatat aataatgata aaaattccg tgag 19724 <210> 11 <211> 227 <212> PRT <213> Taraxacum officinale <400> 11 Met Ser Thr Val Lys Ser Lys Leu Ser Thr Pro Pro Thr Asp His Phe 1 5 10 15 Ser Gly Asn His Gln Leu Leu Leu Ile Thr Ala Thr Ala Lys Thr Tyr 20 25 30 Ile Tyr Asn Phe His His Asn Ser Val Pro Tyr Ser His Phe Asn Pro 35 40 45 Lys Lys Ala Thr Gln Thr Tyr Thr Ala Met Ala Asp Asn Gly Asn Thr 50 55 60 Gly Arg Gln Lys Asp Asp Asp Gly Gly His Asp Gly Gly Arg Pro Asn 65 70 75 80 Pro Thr Thr Pro Pro Ser Pro Ser Arg Thr Pro Arg Arg Pro Arg Arg 85 90 95 Thr Thr Ser Pro Pro Lys His Ser Pro Gly Ala Ser Ser Ser Thr Met 100 105 110 Pro Ala Pro Pro Thr Pro Pro Ala Pro Thr Gly Ile Thr Gly Ala Ser 115 120 125 Ser Ser Ser Leu Gly Thr Asn Ile Ile Ser Phe Thr Pro Pro Lys Thr 130 135 140 Lys Arg Thr Lys Ser Val Ile Cys Pro Ile Cys Lys Lys Asp Met Cys 145 150 155 160 His Glu Lys Ala Leu Cys Gly His Ile Arg Trp His Thr Gln Glu Glu 165 170 175 Arg Leu Ala Ala Ser Ile Ala Ile Ala Arg Ala Leu Ser Ser Asn Val 180 185 190 Val Val Ser Gly Asn Gly Asp Glu Asp Glu Gly Pro Ser Lys Lys Tyr 195 200 205 Lys Leu Pro Asp Leu Asn Lys Ser Pro Pro Pro Glu Glu Glu Asp Glu 210 215 220 Asp No No 225 <210> 12 <211> 3217 <212> DNA <213> Taraxacum officinale <400> 12 gttgaaagga aggatcggca gagaacaaga ttgagagagt tttatcgaag agaagagatg 60 gttgtgttga ttgacggcag agttcagcaa tggcagatat gcgtgtttaa agcgcagttt 120 gtggacagtt tgtccaaagg ccttcaagtg ggagattgtt gagatgaaga cccttttgac 180 caagtactta aatgtgattg gttgcatggg aaagagcttt acacttcatt ggttgaaaat 240 gaagcatgtt atttaatagt acgtctccac ttgttcttta tgaaggatga agacagccac 300 caagtcttta tgaatgtttc your area caatgattag atgctgcctg ctcccttact 360 tcttcactat aaataggtgc ttaaggcacc tctcttctta caccaaacaa cacaagtc 420 acagattaca aagattgaga gagttttcat tttctctcta gagtttgttt tgtcaaaagt 480 tttgtgtgca gattaattag ttgagagaca ctcctaatta atataaccac ttacacttgt 540 cattgattag cattctagtg tcagagagtt ctgagtgatt gtaacctttg tgtgatttat 600 atataaatct ctctcttgtt cgccagtgga cgtagctgat tatcctgatc agtgaaccac 660 ttaaaatatc gtgttgatat tatttatctg cagattattt taccagatag ttttattccg 720 caccgcaaag cataccgtcc attatttgtc agacgtacct actctcagct catcccagca 780 ggagttagac ctgcaggcag ccagccgtat ttcacaacag tgaattatgc aacaaatgga 840 aacacaat tatcgtagta cacatgtaat taacagggat caatttccat ttatgttcc 900 atcaattgcc aaatttaaa gataacaaat gcatcctttt tgaatggaaa agtatgatac 960 ataaaaccag agagaggtat acatttagtc cagaaacggt ggaaattact ttacctagag 1020 ttgcgtgaat caaatggaaa atcagaggaa gagaccctaa atcgcaatcc atctcttatt 1080 ccctatagaa tcaaatggaa atttcttact tccgaccttt ttcatttcca caagtttgta 1140 atcgataaga tcataaaga aaaccgattt acattagcaa atctttaagg cagtttgtag 1200 ttctcaagta tgcgttacgt atgaaattct agacagaaaa gggacgacag ggaaataat 1260 ggtggaataa ataaacaatc aagaatcaaa agataataat ccttaaaact aacaaaaatt 1320 ctatcaataa gccctacaaa tgagaaatat gacggtggag actcacctga ttgatgcgag 1380 aaaaggaaag ccgccgacat ttgtgcttct tcccgcgtta agaaaaatcg cagatgacat 1440 tacgattctt tttctacaga ggaatagggg ggttgcgact ttgcgtgatt tgttgttaat 1500 gagtgatgcg tcgtccgttt tgatcggtag cccatggaga ctgatttatt tgacagatag 1560 atgtcgttct cgttgatgat gcaggtgtaa ttggcggcgt tggtgaagcg aagatggcat 1620 agggaatgga tttgcagagg agaaaaggag tttcacaaat atggattatt gaattgtcgt 1680 ttcagagtcg cgatggttag taatcgatgg atttgggttt gcacctgttc aaggggtggt 1740 gacgtgtctt actgtaagaa agagtcgcga tggttagtaa tcgacgatgg atttgggttt 1800 gcaacatcgt tgacggaaac gacgcggcga tggagagagg cggtagaggg aatgaaacgg 1860 gagatttacc ttcaaccgca aacatgtctt cgttcctcga aaatcatatg cgccctttat 1920 gaaaattcct tcacgcgccg tacacgcgct cagaaaaagc ataggggtttt cttatataat 1980 aatgatataa cttaatttta aataacatcg tactatacgt ttcaaaataa attagagttt 2040 tataaaatt acggaatgat taaacctatt acaaacaaat ataagtgtcg gtaatataaa 2100 atttgtaaca acgaaaacat ttcaaaaaat ctgaatgcgg aaatccataa catgagaata 2160 cgattcgttt gcagtcacgc cggttctttc accttctgag ggtcctgaaa aaggttaata 2220 aacaatgggt aagctaaagt ttagggatca tacacattac ttgtctatta tatgagttag 2280 atacattcac atatcacata catacaagca tacacatatt acaaaaaatc ctaacacata 2340 tggttggtac caactactat ttagtggacc aggttattct tgggggtcaa ttgtggttaa 2400 cataaacacc catatcatat 2460 ctctgtctag gttctctttg gggactgact atagacact tgctcagat tctccttgga 2520 ggataaccat cctcgacgag attackacacg gaccaccact gtttcagct tgtaacctgc 2580 aacatcaata gttgcgatct tcggcgacaa tgatgaacca acatcacac aacagtagtg 2640 ccggtatgtt agtcgttgga taatagaggc atcatctgac ccttttagcg gtgactttg 2700 ttgcctatga aggtcttatc agttatatat cgattaggct tggttctagg ttataagaaa 2760 aaatgattct ctatccggta tgacatagag aaaccggt ctacttat aagaaaatca 2820 tactcgtatt tgaaacgaaa atcatatttg aaacaatgtc gtgttaataa ttaatatgtg 2880 tatgtttaaa tttagaatat cctgaactta tatttagttc gcaaccctat gtaagatcga 2940 actaatttta aaccgtaacc agacatgcat gtttgatcag taataaaag gctatcatcg 3000 tcgaaaatat taaaaaaaaa tataatttct tattttggcgc cattcatgt caacggttaa 3060 aagcaagtta tcaacgccctc aaccgatca ttctccggt aaccaccac tgctactaat 3120 aaccgccacc gcaaaaacct atatacaa cttccatcac aattctgtcc cctactccca 3180 tttcaatcca aaaaaggcta cacagacata tacagcg 3217 <210> 13 <211> 684 <212> DNA <213> Taraxacum officinale <400> 13 atgtcaacgg ttaaaagcaa gttatcaacg cctccaaccg atcatttctc cggtaaccac 60 caactgctac tataaccgc caccgcaaaa acctatatat acaacttcca tcacaattct 120 gtcccctact cccatttcaa tccaaaaaag gctacacaga catatacagc gatggcagat 180 aatggcaaca ccggccgtca aaaggatgac gacggtggcc atgatggggg acgcccaaat 240 ccgaccaccc caccctcccc ttcccgcacc ccgcgaagac ccaggcggac cacatcgccg 300 cctaaacatt ctccggggc gtcttcaagc accatgccag cgccgcctac tcccctgcg 360 ccgacggggaa tcaccggtgc gtctagttct tctctgggta ctaatataat ttcatttact 420 ccacccaaaa ccaaaagaac gaagtcggtg atttgtccga tctgtaagaa agatatgtgc 480 catgagaagg cgctgtgtgg ccacatccgg tggcatactc aggaagaaag attggcggcc 540 agcattgcta tagcaagagc gctatcttct aacgttgttg tttctggcaa tggcgatgaa 600 gatgaaggtc catctaaaaa gtataaactc ccggacctga acaagtcacc accgccggag 660 gaggaggacg aggacgctgc ctga 684 <210> 14 <211> 3925 <212> DNA <213> Taraxacum officinale <400> 14 ttttcttgcg ggagaggcat gtatgtgtgg cctttttgca ataatactat gcatgggaga 60 tgcataaagt ttatcttat tttgttttag tttaataatg tgtggcaaac tttatatcat 120 ttatgattc ggccatgtac tgctacatcg ttctaggatg gttattccct agaatttgct 180 tttatatt ttttttcttc gttaattctt cctctccttt aacgttattt catgtgaatt 240 tgcgatatca tgatattgca ggaacgtaac ttagaactca acgataaaaa gtgtgttgag 300 atcgtggaag ttgatcgttt atcttgaatt cacaagataa gcaacatgag atagaataat 360 taattactgc ggagatttct ttttagattc atcttattcg ttgtaaattg caatgcaaat 420 ttttaagtag aataacgaaa gcgtgttgtt attacggtt aaatgcaaaa aatcaataac 480 atatctccat aattgatttg tttagtatgc attctcatgt gttctattgc aaaattctat 540 tttgaaattc aattaagca atgcatttta gattaaagc atttccatca cttaattata 600 ttgggtagat ttttaccaaa tcactgtcct aaaagaaaaa taaaaaatga aagttcaatg 660 ccatagtgat cccgtcaatt atgtgatcaa ttttaccag agcaaaccc caaagttaa 720 aggatataat tgxaaccgaactg aggatac aactccggt aaccgaa 780 tgctttgtg gggatttcac taatcaacta ttggctc atcacaggc cgtgttaatg 840 gattactatt agttatagg ccatcccaag ttgttttggct atattac cttttaaaaa 900 ccaaaatgtg taaactgtaa aattacactt ttggttctg tattttcta ttttagaat 960 tatgtatttg gttcttgtag ttttttt tgtatgaatc atattagttt tggtccacga 1020 taacttttat tttctataat tacactttg gtcattgtag ttttaattg caaaaaaa 1080 ataatctatc ttttagtcc atatatatag tttgcaat tctatatttt aggttcaggt 1140 tatatatcttt ttacaaaat actacttatg atttttat gatatatca tatttcgtaa 1200 attacataaa cattttatat aattttattt agtcagaact ataggattcg catgataact 1260 ttgctgaact taattgggct tcatttttaa caaaggataa tgcatcatgc atgacataaa 1320 aatttgtaat gtttctaatg tgcatgcact acaagaacct gacccttcat atacattaat 1380 gaatgattct cttttcttat tatatcttag caaacggttt ggataagagt ctgaacaata 1440 ttaagaattg cactagctag ctaggggagt ccatgcagca agcaaattaa ttagaggact 1500 ttttaagagg cttgatcact tcattgtata tctaatggca ctgtggatat atgattggat 1560 tgtgtgtatg tatggaattt aatattacta aaaatatac atttaatgac aaacaataac 1620 acactaattt ataacttaca aaagcgtgta tcattaaaga aaatttcatg tttcttaaaa 1680 tatggagaat ttactactta cataattatg tgtcataaat tttgtcatc ttgtgtgata 1740 tttatgactt acaaaaatgt atgtgatatt tatgacttac aaaaatgtat gttatgttta 1800 tcgtcataaa atctgtaaaa aaaatagaa acatggagga tactttcaat gtgtagaaac 1860 ttgacagcat aaacaggttt attaccttca tcaaaactta tcttacttca atctcttgga 1920 gatgcaggtt gattttaatg ctaaatgaac ttttcaaatg father father father tatcttttga cggatttgac attgatggag atgaagatac accagtgaat tcacctttca atgatcatac tgacatacca agtactctta tcccctctcc acctccacag aacgaacctc aatttcaaaa acgtaactgc cgctgttcta aaaacagaaa attttcaaaa acgtaactat catttaaata tttaatcatt tttcaattgg attcatgctg taatagaagt tactggactt taaacttctt gtagctgatg agattcatga acaacagtcc aaggagattt tccaaatcaa caagtttctg atgagaacaa ggtaaaaaaa ataagttttt catttaaca tatgattttg gttttcaaaa 2400. 2400. cttctgaaaa gtcccaaagt ttacccgtaa aattgatttt ggtttttttt ttttaaattg aataaaaag tccataaaat tggataatt attcgattta gcccaattta cctagtatat ctggtaaaaa tgggttaaat cgaataattt aggcagtttg ttgggctttt ttgcgcaaaa acattatttt gggacttaat cgttaatttt ccccaagttt cagtttattt acagtattgg aataaaaccg aacctagtgc gctaattttg tctttttggtg tttagaatta ttgggttta ttggtctcgg tttctaaacg agttcggtttt ttggttctt 2700 gattcgattt ttggctttg ggttcaaccc atggattttc gatttggttt tggttttgat 2760 aatatttttt gtgcaatcgt tcaaaaaatc cgagttagat tgggtttaaa tgttatcaaa 2820 accaaaaccg atggtagaac cccaaaactg aacccaatcg aaaatccatg ggttgaacct 2880 caaaaacgaa cccaataaat tctaaaaacc aaaatccaaa attagcggat aaaaatttta 2940 aaatacatat ctactggtaa ggtgtttttg acaatttatg taaattatag aaaaaaatgt 3000 attaagtgtt tgctatttaa gataaaaatg gcgttaaaaa tacaattggt tagaaatgaa 3060 ccattttttt gttgtaaatg agtggtgcat caacgatggt ggatgccatc ttttccttcc 3120 accatataca tctttgtcaa acaccataca cacaaattct catatgtcaa agatattaat 3180 tatcatgtcc actgagtttg tatataaat agatgatcaa ttacaacgag aatatacac 3240 tgaattctca tttctaaatt gaagaatctc tctctctctc tctcatctct cagttttcaa 3300 agttttataa gttactagtt tatagtgttt ctaattactt catatttata acacgttatc 3360 agcacgagag ctctaagca gattgcaat tacttaata agtttataa aaaaaaaaa 3420 tcatataaaacatagat aaaattaattaccat ggacatgatg gactaac 3480 attttatttc ttatactaac atttattt gttaactaac atttatt gtttctaca 3540 tttatttatg catactaca tttatttg ttactaca tttattg tttctacat 3600 ttatttatgc attackacat ttatttgt tactacttt tatttgta tactaatgtt 3660 tatttatca attatttta catttactat ttttgatta tatttttta tagccgata 3720 gatttattt tctatttatt aaacttattt daddy daddy daddy 3780 ataacgtta tatatatac ggctatatat ataacgtcta tatatata acggctatat 3840 ttttacacta taaaayaca catcattctc cattttatta ccacacaaa taatttctct 3900 catcttccaa atcatch gaaa 3925 <210> 15 <211> 7826 <212> DNA <213> Tarrhacum officina <400> 15 gttgaaagga aggatcggca gagaacaga ttgagagagt tttacgaag agaagagatg 60 gttgtgttga ttgacggcag agttcagcaa tggcagatat gcgtgtttaa agcgcagttt 120 gtggacagtt tgtccaaagg ccttcaagtg ggagattgtt gagatgaga cccttttgac 180 240 gaagcatgtt atttaatagt acgtctccac ttgttcttta tgaaggatga agacagccac 300 caagtcttta tgaatgtttc your area caatgattag atgctgcctg ctcccttact 360 tcttcactat aaataggtgc ttaaggcacc tctcttctta caccaaacaa cacaagtc 420 acagattaca aagattgaga gagttttcat tttctctcta gagtttgttt tgtcaaaagt 480 tttgtgtgca gattaattag ttgagagaca ctcctaatta atataaccac ttacacttgt 540 cattgattag cattctagtg tcagagagtt ctgagtgatt gtaacctttg tgtgatttat 600 atataaatct ctctcttgtt cgccagtgga cgtagctgat tatcctgatc agtgaaccac 660 ttaaaatatc gtgttgatat tatttatctg cagattattt taccagatag ttttattccg 720 caccgcaaag cataccgtcc attatttgtc agacgtacct actctcagct catcccagca 780 ggagttagac ctgcaggcag ccagccgtat ttcacaacag tgaattatgc aacaaatgga 840 aacacacaat tatcgtagta cacatgtaat taacagggat caatttccat ttatgttcc 900 atcaattgcc aaatttaaaa gataacaaat gcatcctttt tgaatggaaa agtatgatac 960 ataaaaccag agagaggtat acatttagtc cagaaacggt ggaaattact ttacctagag 1020 ttgcgtgaat caaatggaaa atcagaggaa gagaccctaa atcgcaatcc atctcttatt 1080 ccctatagaa tcaaatggaa atttcttact tccgaccttt ttcatttcca caagtttgta 1140 atcgataaga tcataaaga aaaccgattt acattagcaa atctttaagg cagtttgtag 1200 ttctcaagta tgcgttacgt atgaaattct agacagaaaa gggacgacag ggaaataat 1260 ggtggaataa ataaacaatc aagaatcaaa agataataat ccttaaaact aacaaaaatt 1320 ctatcaataa gccctacaaa tgagaaatat gacggtggag actcacctga ttgatgcgag 1380 aaaaggaaag ccgccgacat ttgtgcttct tcccgcgtta agaaaaatcg cagatgacat 1440 tacgattctt tttctacaga ggaatagggg ggttgcgact ttgcgtgatt tgttgttaat 1500 gagtgatgcg tcgtccgttt tgatcggtag cccatggaga ctgatttatt tgacagatag 1560 atgtcgttct cgttgatgat gcaggtgtaa ttggcggcgt tggtgaagcg aagatggcat 1620 agggaatgga tttgcagagg agaaaaggag tttcacaaat atggattatt gaattgtcgt 1680 ttcagagtcg cgatggttag taatcgatgg atttgggttt gcacctgttc aaggggtggt 1740 gacgtgtctt actgtaagaa agagtcgcga tggttagtaa tcgacgatgg atttgggttt 1800 gcaacatcgt tgacggaaac gacgcggcga tggagagagg cggtagaggg aatgaaacgg 1860 gagatttacc ttcaaccgca aacatgtctt cgttcctcga aaatcatatg cgccctttat 1920 gaaaattcct tcacgcgccg tacacgcgct cagaaaaagc ataggggtttt cttatataat 1980 aatgatataa cttaatttta aataacatcg tactatacgt ttcaaaataa attagagttt 2040 tataaaatt acggaatgat taaacctatt acaaacaaat ataagtgtcg gtaatataaa 2100 atttgtaaca acgaaaacat ttcaaaaaat ctgaatgcgg aaatccataa catgagaata 2160 cgattcgttt gcagtcacgc cggttctttc accttctgag ggtcctgaaa aaggttaata 2220 aacaatgggt aagctaaagt ttagggatca tacacattac ttgtctatta tatgagttag 2280 atacattcac atatcacata catacaagca tacacatatt acaaaaaatc ctaacacata 2340 tggttggtac caactactat ttagtggacc aggttattct tgggggtcaa ttgtggttaa 2400 ccataaatgt ttggagttta ggttctcttt gggggccgac cataaacacc catatcatat 2460 ctctgtctag gttctctttg gggactgact atagacaact ttgctcagat tctccttgga 2520 ggataaccat cctcgacgag attaacaacg gaccaccact gttttcagct tgtaacctgc 2580 aacatcaata gttgcgatct tcggcgacaa tgatgaacca acatcaacac aacagtagtg 2640 ccggtatgtt agtcgttgga tatagaggc atcatctgac ccttttagcg gtgacttttg 2700 ttgcctatga aggtcttatc agttatatat cgattaggct tggttctagg ttataagaaa 2760 aaatgattct ctatccggta tgacatagag acaaaccggt ctacttttat aagaaaatca 2820 tactcgtatt tgaaacgaaa atcatatttg aaacaatgtc gtgttaataa ttaatatgtg 2880 tatgtttaaa tttagaatat cctgaactta tatttagttc gcaaccctat gtaagatcga 2940 actaatttta aaccgtaacc agacatgcat gtttgatcag taataaaag gctatcatcg 3000 tcgaaaatat taaaaaaaaa tataatttct tattttggcgc cattcatgt caacggttaa 3060 aagcaagtta tcaacgccctc aaccgatca ttctccggt aaccaccac tgctactaat 3120 aaccgccacc gcaaaaacct atatatacaa cttccatcac aattctgtcc cctactccca 3180 tttcaatcca aaaaaggcta cacagacata tacagcgatg tcaacggtta aaagcaagtt 3240 atcaacgcct ccaaccgatc atttctccgg taaccaccaa ctgctactaa taaccgccac 3300 cgcaaaaacc tatatataca acttccatca caatctgtc ccctactccc atttcaatcc 3360 aaaaaaggct accacacat atacagcgat ggcagataat ggcacaccg gccgtcaaaa 3420 ggatgacgac ggtggccatg atgggggacg cccaaatccg accacccac cctccccttc 3480 ccgcaccccg cgaagaccca ggcggaccac atcgccgcct aacattctc cgggggcgtc 3540 ttcaagcacc atgccagcgc cgcctactcc cccctgcgccg acgggaatca ccggtgcgtc 3600 tagttctctct ctgggtacta atataatttc atttactcca cccaaaacca aaagaacgaa 3660 gtcggtgatt tgtccgatct gtaagaaaga tatgtgccat gagaaggcgc tgtgtggcca 3720 catccggtgg catactcagg aagaaagatt ggcggccagc attgctatag caagagcgct 3780 atcttctaac gttgttgttt ctggcaatgg cgatgaagat gaaggtccat ctaaaaagta 3840 taaactcccg gacctgaaca agtcaccacc gccggaggag gaggacgagg acgctgcctg 3900 atttcttgc gggagaggca tgtatgtgtg gcctttttgc aataatacta tgcatgggag 3960 atgcataaag tttatcttta tttgtttta gtttaataat gtgtggcaaa ctttatatca 4020 tttatgattt cggccatgta ctgctacatc gttctaggat ggttattccc tagaatttgc 4080 ttttatatat ttttttctt cgttaattct tctcttcctt taacgttatt tcatgtgaat 4140 ttgcgatatc atgatattgc aggaacgtaa cttagaactc aacgataaaa agtgtgttga 4200 gatcgtggaa gttgatcgtt tatcttgaat tcacaagata agcaacatga gatagaataa 4260 ttaattactg cggagatttc tttttagatt catcttattc gttgtaaatt gcaatgcaaa 4320 ttttaagta gaataacgaa agcgtgttgt tatttacggt taaatgcaaa aaatcaataa 4380 catatctcca taattgattt gtttagtatg cattctcatg tgttctattg caaaattcta 4440 ttttgaaatt caattaaagc aatgcatttt agatataaag caattccatc acttaattat 4500 attgggtaga tttttaccaa atcactgtcc taaaagaaaa ataaaaaatg aaagttcaat 4560 gccatagtga tcccgtcaat tatgtgatca atttttacca gagcaaaacc ccaaaagtta 4620 aagagtataa ttgcagaacg acaacaatct gaggatgata ctaactccgg tataaaccga 4680 atgctttgt ggggatttca ctaatcaact atttggctct catcacaagg ccgtgttaat 4740 ggattactat tagttataag gccatcccaa gttgtttggc tatattatta ccttttaaaa 4800 accaaaatgt gtaaactgta aaattacact tttggttctt gtattttcta atttttagaa 4860 ttatgtattt ggttcttgta gtttttttat ttgtatgaat catattagtt ttggtccacg 4920 ataactttta ttttctataa ttacacttt ggtcattgta gttttaattt gcaagaaaaa 4980 aataatctat ctttttagtc catatatata gtttgcaata ttctatatttt taggttcagg 5040 ttatatct tttacaaaaa tactacttat gattttttaa tgaatatatc atatttcgta 5100 aattacataa acattttata taattttat tagtcagaac tataggattc gcatgataac 5160 tttgctgaac ttaattgggc ttcattttta acaaaggata atgcatcatg catgacataa 5220 aaatttgtaa tgtttctaat gtgcatgcac tacaagaacc tgacccttca tatacattaa 5280 tgaatgattc tcttttctta ttatatctta gcaaacggtt tggataagag tctgaacaat 5340 attaagaatt gcactagcta gctaggggag tccatgcagc aagcaaatta attagaggac 5400 tttttaagag gcttgatcac ttcattgtat atctaatggc actgtggata tatgattgga 5460 ttgtgtgtat gtatggaatt taatattact aaaaaatata catttaatga caaacaataa 5520 cacactaatt tataacttac aaaagcgtgt atcattaaag aaaatttcat gtttcttaaa 5580 atatggagaa tttactactt acataattat gtgtcataaa tttatgtcat cttgtgtgat 5640 atttatgact tacaaaaatg tatgtgatat ttatgactta caaaaatgta tgttatgttt 5700 atcgtcataa aatctgtaaa aaaaaataga aacatggagg atactttcaa tgtgtagaaa 5760 cttgacagca taaacaggtt tattaccttt atcaaaactt atcttacttc aatctcttgg 5820 agatgcaggt tgattttaat gctaaatgaa cttttcaaat gtataaatat atatcttttg 5880 5940 ctgacatacc aagtactctt atcccctctc cacctccaca gaacgaacct caatttcaaa 6000 aacgtaactg ccgctgttct aaaaacagaa aattttcaaa aacgtaacta tcatttaaat 6060 atttaatcat ttttcaattg gattcatgct gtaataagaag ttactggact ttaaacttct 6120 tgtagctgat gagattcatg aacaacagtc caaggagatt ttccaaatca acaagtttct 6180 gatgaagaa aggtaaaaa aataagttt tcatttaaac atatgatttt ggttttcaaa 6240 agaattaa ttataggaac tcttctgaaa agtcccaaag tttacccgta aaattgattt 6300 tggtttttt tttttaaatt gaataaaaaa gtccataaaa ttggataaat tattcgattt 6360 agcccaattt acctagtata tctggtaaaa atgggttaaa tcgaataatt taggcagttt 6420 gttgggcttt tttgcgcaaa aacattattt tgggacttaa tcgttaattt tccccaagtt 6480 tcagtttatt tacagtattg gaataaaacc gaacctagtg cgctaatttt gtcttttggt 6540 gtttagaattt atttgttctcg gtttctaaac gagttcggtt ttggttttct 6600 tgattcgatt ttggcttt gggttcacc catggattt cgatttggtt ttggttttga 6660 taatatttt tgtgcaatcg ttcaaaaat ccgagttaga ttggtttta atgttatca 6720 aaccaaaacc gatggtagaa ccccaaaact gaacccaatc gaaaatccat gggttgaacc 6780 tcaaaaacga accaataa ttctaaaaac caaaatccaa attagcgga taaaatttt 6840 aaatacata tctactggta aggtgttttt gatattta gtaaattata gaaaaaaatg 6900 tattaagtgt ttgctattta agataaaaat ggcgttaaa atacaatgg ttagaatga 6960 accattttt tgttgtaat gagtggtgca tcaacgatgg tggatgccat cttttccttc 7020 caccatatac atctttgtca aacaccatac acacaattc tcatatgtca agatattaa 7080 ttatcatgtc cactgagttt gtaatataaa tagagatca attacaacga gaaataca 7140 ctgaattctc atttctaat tgagaatct ctctctct ctctcatctc tcagttttca 7200 aagttttata agttactagt tctaattact tcatattat aacacgttat 7260 cagcacgaga gctctaagca agatatgcaa ttacttaata aagtttata aaataaacaa attack attack attack tggacatgat ggactacta cattttttt cttatactaa cattttttt tgttaactaa cattttttt tgtttctaac atttatttat gcatactaac atttatttat gttaactaac atttatttat gtttctaaca 7560. tttatttatg catactaaca tttatttatg ttactaactt ttatttatgt attackgt ttatttatca aatttattta acatttacta ttttttgatt atatttttta attagccgat agaatttatt tatttaatta ttctatttat taaacttatt tttataata tatatata fatherccgtt father cggctatata fatheracgtct father aacggctata tttttacact father acatcattct ccattttat accacaaca fatherttctc tcatcttcca aatcatcaag agaaaa <210> 16 <211> 972 <212> DNA <213> Artificial Sequence <220> <223> parsley ubiquitin promote sequence <400> 16 aaaaattacg gatatgaata taggcatatc cgtatccgaa ttatccgttt gacagctagc 60 aacgattgta caattgcttc tttaaaaaag gaagaaagaa agaaagaaaa gaatcaacat 120 cagcgttaac aaacggcccc gttacggccc aaacggtcat atagagtaac ggcgttaagc 180 gttgaaagac tcctatcgaa atacgtaacc gcaaacgtgt catagtcaga tcccctcttc 240 cttcaccgcc tcaaacacaa aaataatctt ctacagccta tatatacaac ccccccttct 300 atctctcctt tctcacaatt catcatcttt ctttctctac ccccaatttt aagaaatcct 360 ctcttctcct cttcattttc aaggtaaatc tctctctctc tctctctctc tgttattcct 420 tgttttaatt aggtatgtat tattgctagt ttgttaatct gcttatctta tgtatgcctt 480 atgtgaatat ctttatcttg ttcatctcat ccgtttagaa gctataaatt tgttgatttg 540 actgtgtatc tacacgtggt tatgtttata tctaatcaga tatgaatttc ttcatattgt 600 tgcgtttgtg tgtaccaatc cgaaatcgtt gatttttttc atttaatcgt gtagctaatt 660 gtacgtatac atatggatct acgtatcaat tgttcatctg tttgtgtttg tatgtataca 720 gatctgaaaa catcacttct ctcatctgat tgtgttgtta catacataga tatagatctg 780 ttatatcatt ttttttatta attgtgtata tatatatgtg catagatctg gattacatga 840 ttgtgattat ttacatgatt ttgttattta cgtatgtata tatgtagatc tggactttt 900 ggagttgttg acttgattgt atttgtgtgt gtatatgtgt gttctgatct tgatatgtta 960 tgtatgtgca gc 972 <210> 17 <211> 4140 <212> DNA <213> Artificial Sequence <220> <223> Cas9 <400> 17 atggataaga agtactctat cggactcgat atcggacta actctgtggg atgggctgtg 60 atcaccgatg agtacaaggt gccatctaag aagttcaagg ttctcggaaa caccgatagg 120 cactctatca agaaaaacct tatcggtgct ctcctcttcg attctggtga aactgctgag 180 gctaccagac tcaagagaac cgctagaaga aggtacacca gaagaaagaa caggatctgc 240 tacctccaag agatcttctc taacgagatg gctaaagtgg atgattcatt cttccacagg 300 ctcgaagagt cattcctcgt ggaagaagat aagaagcacg agaggcaccc tatcttcgga 360 aacatcgttg atgaggtggc ataccacgag aagtacccta ctatctacca cctcagaaag 420 aagctcgttg attctactga taaggctgat ctcaggctca tctacctcgc tctcgctcac 480 atgatcaagt tcagaggaca cttcctcatc gagggtgatc tcaaccctga taactctgat 540 gtggataagt tgttcatcca gctcgtgcag acctacaacc agcttttcga agagaaccct 600 atcaacgctt caggtgtgga tgctaaggct atcctctctg ctaggctctc taagtcaaga 660 aggcttgaga acctcattgc tcagctccct ggtgagaaga agaacggact tttcggaaac 720 ttgatcgctc tctctctcgg actcacccct aacttcaagt ctaacttcga tctcgctgag 780 gatgcaaagc tccagctctc aaaggatacc tacgatgatg atctcgataa cctcctcgct 840 cagatcggag atcagtacgc tgatttgttc ctcgctgcta agaacctctc tgatgctatc 900 ctcctcagtg atatcctcag agtgaacacc gagatcacca aggctccact ctcagcttct 960 atgatcaaga gatacgatga gcaccaccag gatctcacac ttctcaaggc tcttgttaga 1020 cagcagctcc cagagaagta caaagagatt ttcttcgatc agtctaagaa cggatacgct 1080 ggttacatcg atggtggtgc atctcaagaa gagttctaca agttcatcaa gcctatcctc 1140 gagaagatgg atgaaccga ggaactcctc gtgaagctca atagagagga tcttctcaga 1200 aagcagagga ccttcgataa cggatctatc cctcatcaga tccacctcgg agagttgcac 1260 gctatcctta gaaggcaaga ggatttctac ccattcctca aggataacag ggaaaagatt 1320 gagaagattc tcaccttcag aatcccttac tacgtgggac ctctcgctag aggaaactca 1380 agattcgctt ggatgaccag aaagtctgag gaaaccatca ccccttggaa cttcgaagag 1440 gtggtggata agggtgctag tgctcagtct ttcatcgaga ggatgaccaa cttcgataag 1500 aaccttccaa acgagaaggt gctccctaag cactctttgc tctacgagta cttcaccgtg 1560 tacaacgagt tgaccaaggt taagtacgtg accgagggaa tgaggaagcc tgcttttttg 1620 tcaggtgagc aaaagaaggc tatcgttgat ctcttgttca agaccaacag aaaggtgacc 1680 gtgaagcagc tcaaagagga ttacttcaag aaaatcgagt gcttcgattc agttgagatt 1740 tctggtgttg aggataggtt caacgcatct ctcggaacct accacgatct cctcaagatc 1800 attaaggata agatttctt ggataacgag gaaaacgagg atatcttgga ggatatcgtt 1860 cttaccctca ccctctttga agatagagag atgattgaag aaaggctcaa gacctacgct 1920 catctcttcg atgataaggt gatgaagcag ttgaagagaa gaagatacac tggttgggga 1980 aggctctcaa gaaagctcat taacggaatc aggataagc agtctggaaa gacaatcctt 2040 gatttcctca agtctgatgg attcgctaac agaaacttca tgcagctcat ccacgatgat 2100 tctctcacct ttaaagagga tatccagaag gctcaggttt caggacaggg tgatagtctc 2160 catgagcata tcgctaacct cgctggatct cctgcaatca agaagggaat cctccagact 2220 gtgaaggttg tggatgagtt ggtgaaggtg atgggaaggc ataagcctga gaacatcgtg 2280 atcgaaatgg ctagagagaa ccagaccact cagaagggac agaagaactc tagggaaagg 2340 atgaagagga tcgaggaagg tatcaaagag cttggatctc agatcctcaa agagcaccct 2400 gttgagaaca ctcagctcca gaatgagaag ctctacctct actacctcca gaacggaagg 2460 gatatgtatg tggatcaaga gttggatatc aacaggctct ctgattacga tgttgatcat 2520 atcgtgccac agtcattctt gaaggatgat tctatcgata acaaggtgct caccaggtct 2580 gataagaaca ggggtaagag tgataacgtg ccaagtgaag aggttgtgaa gaaaatgaag 2640 aactattgga ggcagctcct caacgctaag ctcatcactc agagaaagtt cgataacttg 2700 actaaggctg agaggggagg actctctgaa ttggataagg caggattcat caagaggcag 2760 cttgtggaaa ccaggcagat cactaagcac gttgcacaga tcctcgattc taggatgaac 2820 accaagtacg atgagaacga taagttgatc agggaagtga aggttatcac cctcaagtca 2880 aagctcgtgt ctgatttcag aaaggatttc caattctaca aggtgaggga aatcaacaac 2940 taccaccacg ctcacgatgc ttaccttaac gctgttgttg gaaccgctct catcaagaag 3000 tatcctaagc tcgagtcaga gttcgtgtac ggtgattaca aggtgtacga tgtgaggaag 3060 atgatcgcta agtctgagca agagatcgga aaggctaccg ctaagtattt cttctactct 3120 aacatcatga atttcttcaa gaccgagatt accctcgcta acggtgagat cagaaagagg 3180 ccactcatcg agacaaacgg tgaaacaggt gagatcgtgt gggataaggg aagggatttc 3240 gctaccgtta gaaaggtgct ctctatgcca caggtgaaca tcgttaagaa aaccgaggtg 3300 cagaccggtg gattctctaa agagtctatc ctccctaaga ggaactctga taagctcatt 3360 gctaggaaga aggattggga ccctaagaaa tacggtggtt tcgattctcc taccgtggct 3420 tactctgttc tcgttgtggc taaggttgag aagggaaaga gtaagaagct caagtctgtt 3480 aaggaacttc tcggaatcac tatcatggaa aggtcatctt tcgagaagaa cccaatcgat 3540 ttcctcgagg ctaagggata caaagaggtt aagaaggatc tcatcatcaa gctcccaaag 3600 tactcactct tcgaactcga gaacggtaga aagaggatgc tcgcttctgc tggtgagctt 3660 caaaagggaa acgagcttgc tctcccatct aagtacgtta actttcttta cctcgcttct 3720 cactacgaga agttgaaggg atctccagaa gataacgagc agaagcaact ttcgttgag 3780 cagcacaagc actacttgga tgagatcatc gagcagatct ctgagttctc taaaagggtg 3840 atcctcgctg atgcaaacct cgataaggtg ttgtctgctt acaacaagca cagagataag 3900 cctatcaggg aacaggcaga gaacatcatc catctcttca cccttaccaa cctcggtgct 3960 cctgctgctt tcaagtactt cgatacaacc atcgatagga agagatacac ctctaccaaa 4020 gaagtgctcg atgctaccct catccatcag tctatcactg gactctacga gactaggatc 4080 gatctctcac agctcggtgg tgattcaagg gctgatccta agaagaagag gaaggtttga 4140 <210> 18 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> tomato U6 promoter <400> 18 ggagtgatca aaagtcccac atcgatcagg tgatatatag cagcttagtt tatataatga 60 tagagtcgac atagcgattg 80 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> target specific sequence of RNA-1 <400> 19 catccggtgg catacacagg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> target specific sequence of RNA-2 <400> 20 ggagtagttg ggttttggcg 20 <210> 21 <211> 89 <212> PRT <213> Helianthus annuus <400> 21 Met Ser Ser Pro Ser Lys Asn Lys Ser Lys Ser Ser Ile Cys Pro Val 1 5 10 15 Cys Lys Arg Asp Leu Cys His Glu Lys Ala Leu Asn Gly His Ile Arg 20 25 30 Trp His Thr Gln Gln Glu Arg Glu Ala Ala Gly Ile Gly Asn Ala Lys 35 40 45 Ala Val Ala Ser Ala Ser Val Val Ile Arg Asp Ala Asn Val Arg Arg 50 55 60 Pro Glu Thr Ser Lys Pro Val Lys Leu Pro Asp Leu Asn Lys Ser Pro 65 70 75 80 Pro Arg Glu Glu Asp Lys Asp Ala Ala 85 <210> 22 <211> 157 <212> PRT <213> Lactuca sativa <400> 22 Met Ala Asp Asp Gly Asn Thr Ala Arg Gln Gln Ala Asp Ala Gly Gly 1 5 10 15 His Gly Asn Ala Arg Pro Asn Ser Ser Thr Pro Pro Ser Ser Pro Ser 20 25 30 Gln Pro Pro Arg Arg Pro Arg Arg Ala Gly Ala Thr Thr Pro Ser Lys 35 40 45 Leu Ser Gln Ala Ala Ser Ser Ser Thr Asn Leu Pro Pro Pro Pro Thr 50 55 60 Pro Thr Pro Thr Pro Pro Thr Pro Ser Ala Asp Gly Ile Leu Leu Gly 65 70 75 80 Thr Ala Arg Arg Pro Val Ile Cys Pro Ile Cys Lys Lys Asp Met Tyr 85 90 95 His Glu Lys Ala Leu Cys Gly His Ile Arg Trp His Thr Gln Glu Glu 100 105 110 Arg Leu Ala Ala Ser Arg Asp Ile Ala Arg Ala Leu Ser Ala Asn Val 115 120 125 Val Ser Gly Gln Arg Gly Asp Gly Glu Gln Gly Pro Ser Lys Arg Phe 130 135 140 Lys Leu Pro Asp Leu Asn Glu Pro Pro Pro Ser Glu Asp 145 150 155 <210> 23 <211> 36 <212> DNA <213> Taraxacum officinale <400> 23 tgtggccaca tccggtggca tacacaggag gaaaga 36 <210> 24 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> pKG10821-1 <400> 24 tgtggccaca tccggtggca tacaccagga ggaaaga 37 <210> 25 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> pKG10821-4 <400> 25 tgtggccaca tccggtggca tacacagga ggaaaga 37 <210> 26 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pKG10821-5 <400> 26 tgtggccaca tccggtggca 35 <210> 27 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> pKG10821-6 <400> 27 tgtggccaca tccggtggca taaggaggaa aga 33 <210> 28 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> pKG10821-1 <400> 28 Cys Gly His Ile Arg Trp His Thr Pro Gly Gly Lys 1 5 10 <210> 29 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> pKG108121-4 <400> 29 Cys Gly His Ile Arg Trp His Thr Gln Gly Gly Lys 1 5 10 <210> 30 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> pKG10821-5 <400> 30 Cys Gly His Ile Arg Trp His Thr Arg Arg Lys 1 5 10 <210> 31 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> pKG10821-6 <400> 31 Cys Gly His Ile Arg Trp His Lys Glu Glu Arg 1 5 10 <210> 32 <211> 12 <212> PRT <213> Taraxacum officinale <400> 32 Cys Gly His Ile Arg Trp His Thr Gln Glu Glu Arg 1 5 10 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 33 gaaaccgaag caaactctac ca 22 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reversed primer <400> 34 gcgctttcta caatcttaca 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 35 gatcgaacta attttaaacc 20 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reversed primer <400> 36 gatcaacttc cacgatctca ac 22 <210> 37 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> K2-2 like zinc finger domain <220> <221> misc_feature <222> (2)..(3) <223> Xaa can be any naturally occurring amino acid <220> <221> misc_feature <222> (5)..(11) <223> Xaa can be any naturally occurring amino acid <220> <221> MISC_FEATURE <222> (12)..(12) <223> Xaa can be K or R <220> <221> misc_feature <222> (14)..(15) <223> Xaa can be any naturally occurring amino acid <220> <221> misc_feature <222> (18)..(18) <223> Xaa can be any naturally occurring amino acid <220> <221> MISC_FEATURE <222> (19)..(19) <223> Xaa can be R or N <220> <221> misc_feature <222> (20)..(20) <223> It can be any naturally occurring amino acid. <400> 37 Cys No. Cys No. No. No. No. No. No. No. No. Gly 1 5 10 15 His More More His 20 <210> 38 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> consensus zinc finger domain. <220> <221> misc_feature <222> (2)…(3) <223> It can be any naturally occurring amino acid. <220> <221> misc_feature <222> (5)..(16) <223> It can be any naturally occurring amino acid. <220> <221> misc_feature <222> (18)..(20) <223> It can be any naturally occurring amino acid. <400> 38 Cys Happy Happy Cys Happy Happy Happy Happy Happy Happy Hour 1 5 10 15 His More More His 20 <210> 39 <211> 163 <212> PRT <213> cichorium endivia <400> 39 Met Val Asp Asp Gly Thr Thr Ala Arg Gln Gln Val Asp Asp Gly Gly 1 5 10 15 His Gly Asn Pro Arg Pro Asn Pro Thr Thr Pro Pro Pro Ser Pro Ser 20 25 30 Arg Thr Pro Arg Arg Thr Arg Arg Ala Gly Ala Thr Thr Pro Ser Lys 35 40 45 Leu Ser Pro Ala Val Ser Ser Thr Thr Leu Pro Pro Pro Pro Thr Pro 50 55 60 Pro Thr Pro Pro Ala Asp Arg Leu Val Thr Gly Thr Ser Ser Ser Leu 65 70 75 80 Gly Thr Gln Arg Val Arg Arg Ser Lys Ser Val Ile Cys Pro Ile Cys 85 90 95 Lys Lys Asp Met Cys His Glu Lys Ala Leu Cys Gly His Ile Arg Trp 100 105 110 His Thr His Glu Glu Arg Gln Ala Ala Ser Ser Asp Ile Ala Arg Ala 115 120 125 Leu Ser Ser Asn Phe Ser Ser Gly His Gly Gly Glu Glu Gln Gly Pro 130 135 140 Ser Lys Arg Phe Lys Val Pro Asp Leu Asn Lys Pro Pro Pro Pro Glu 145 150 155 160 Glu Asp Asp <210> 40 <211> 161 <212> PRT <213> Hieracium aurantiacum <400> 40 Met Val Asp Asp Gly Thr Ala Ala Arg Gln Gln Val Asp Asp Gly Gly 1 5 10 15 His Gly Glu Arg Arg Pro Thr Pro Thr Thr Pro Pro Pro Ser Pro Ser 20 25 30 Arg Thr Pro Arg Arg Ser His Arg Pro Gly Thr Thr Pro Pro Ser Lys 35 40 45 Leu Ser Pro Ala Ala Ser Ser Thr Ala Leu Pro Pro Pro Pro Thr Pro 50 55 60 Pro Thr Pro Thr Val Val Ala Gly Ser Ser Ser Ser Leu Thr Thr Pro 65 70 75 80 Arg Ile Lys Arg Ser Lys Ser Val Ile Cys Pro Ile Cys Lys Lys Asp 85 90 95 Met Cys His Glu Lys Ala Leu Cys Gly His Ile Arg Trp His Thr Gln 100 105 110 Glu Glu Arg Leu Ala Ala Ser Gly Asp Ile Ala Arg Ala Leu Ser Ala 115 120 125 Asn Phe Val Ser Gly Gly Asn Gly Asp Glu Glu Gln Gly Ser Ser Lys 130 135 140 Arg Phe Lys Val Pro Asp Leu Asn Lys Pro Pro Pro Pro Glu Glu Asp 145 150 155 160 Asp <210> 41 <211> 166 <212> PRT <213> Senecio cambrensis <400> 41 Met Val Asn Ser Gly Asp Ala Ser Arg Ser Asp Asp Asn Pro Asn Thr 1 5 10 15 Pro Asn Arg Arg Ala Gly Lys Ala His Ala Ala Pro Ser Thr Ser Pro 20 25 30 Ser Ser Pro Pro Pro Pro Ile Gly Arg Leu Ser Ala Thr Thr Pro Leu 35 40 45 Ser Gly Ser Lys Arg Pro His Ser Pro Thr Lys Lys Ser Asn Phe Ile 50 55 60 Cys Pro Ile Cys Gly Lys Asp Leu Tyr His Ser Lys Ala Leu Asn Gly 65 70 75 80 His Ile Arg Trp His Ser Gln Met Glu Arg Glu Leu Lys Lys Lys Ala 85 90 95 Leu Arg Asp Ile Arg Glu Arg Asp Val Ala Val Val Ala Ala Ala Asp 100 105 110 Ala Val Gln Val Ala Pro Val Pro Ala Thr Val Pro Val Pro Val Pro 115 120 125 Thr Ile Val Arg Thr Arg Leu Phe His Glu Gln Pro Gln Pro Gln Pro 130 135 140 Gln Glu Glu Val Pro Tyr Asn Tyr Ala Tyr Leu Leu Pro Asp Leu Asn 145 150 155 160 Ala Ser Ala Asp Glu Glu 165 <210> 42 <211> 203 <212> PRT <213> Hevea brasiliensis <400> 42 Met Val Asn Ser Ser Pro Ser Ser Ser Ser Ser Ser Ser Ser Pro Thr 1 5 10 15 Pro Pro Pro Glu Val Gln Val Gly Pro Gly Gly Ser Ser Val Gly Gly 20 25 30 Glu Ser Glu Glu Gly Cys Ser Ser Arg Lys Lys Lys Ala Gly Ser Asn 35 40 45 Asp Gln Gln Gly Asp Glu Glu Gly Val Gln Lys Arg Leu Lys Arg Gly 50 55 60 Glu Met Asp Ser Pro Ile Ser Glu Pro Val Cys Cys Ile Cys Asn Lys 65 70 75 80 Lys Phe Gly Ser Trp Lys Gly Val Phe Gly His Met Arg Ala His Pro 85 90 95 Glu Arg Glu Trp Arg Gly Ala Phe Pro Pro Pro Lys Glu Lys Ala Gly 100 105 110 Ala Ile Asn Ile Asn His Gln Gln Ile Leu Gln Gln Gln Leu Ala Pro 115 120 125 Thr Leu Leu Ser Leu Gly Arg Glu Ala Leu Ala Arg Met Thr Asn His 130 135 140 His Gly Ser Gly Ala Ala Asn Ala Ala Ala Pro Ser Arg Arg Ala Gly 145 150 155 160 Asp Thr Glu Leu Asn Arg Glu Gln Gln Glu Leu Ala Gly Pro Ser Thr 165 170 175 Ile Ile His Pro Ser Leu Arg Gly Phe Asp Leu Asn Leu Pro Pro Pro 180 185 190 Pro Glu Glu Ala Asn Glu Asp Asp Arg Asn Asn 195 200 <210> 43 <211> 230 <212> PRT <213> Cucurbita moschata <400>...

Claims

1. A nucleic acid associated with plant parthenogenesis, wherein the nucleic acid comprises at least one of the following: a) a gene encoding a protein having an amino acid sequence consisting of SEQ ID NO: 1, operably linked to an egg cell-specific promoter; b) the coding sequence of the gene of a) having the nucleotide sequence of SEQ ID NO: 3 operably linked to an egg cell-specific promoter; c) The gene according to a) having the nucleotide sequence of SEQ ID NO:

5.

2. The nucleic acid of claim 1, wherein the egg cell-specific promoter comprises a promoter sequence of an egg cell-specific gene EC1.1, EC1.2, EC1.3, EC1.4 or EC1.

5.

3. The nucleic acid of claim 1 or 2, wherein the nucleic acid is functional in parthenogenesis.

4. The nucleic acid of claim 1, wherein the nucleic acid is contained in a chimeric gene, a genetic construct or a nucleic acid vector.

5. A protein related to plant parthenogenesis, wherein the protein consists of the following amino acid sequence: a) encoded by the nucleic acid of claim 1; and / or b) SEQ ID NO:

1.

6. The protein of claim 5, wherein the protein is functional in parthenogenesis.

7. A method for producing parthenogenetic plants, comprising the steps of: i) introducing a nucleic acid into one or more plant cells to obtain a parthenogenetic gene, wherein the one or more plant cells belong to a species of the family Asteraceae (Compositae), wherein the nucleic acid comprises at least one of: a) a gene encoding a protein consisting of the amino acid sequence of SEQ ID NO: 1, operably linked to an egg cell-specific promoter; b) a coding sequence having the nucleotide sequence of SEQ ID NO: 3 operably linked to an egg cell-specific promoter; c) the gene of a) having the nucleotide sequence of SEQ ID NO: 5; ii) selecting plant cells comprising the nucleic acid; and iii) regenerating a plant from the plant cell, wherein the regenerated plant is a parthenogenetic plant.

8. The method of claim 7, wherein the egg cell-specific promoter comprises a promoter sequence of an egg cell-specific gene EC1.1, EC1.2, EC1.3, EC1.4 or EC1.

5.

9. The method of claim 7 or 8, wherein in step ii) the nucleic acid is integrated into the genome of the selected plant cell.

10. The method of claim 7, wherein the nucleic acid is contained in a chimeric gene, a genetic construct, or a nucleic acid vector.

11. The method of claim 7, wherein the plant cell in step i) is not of the species Taraxacum officinale sensulato.

12. The method of claim 7, wherein the nucleic acid in step i) is introduced by genetic modification or introgression.

13. The method of claim 12, wherein the nucleic acid is integrated into its genome.

14. A method for producing an apomictic plant, comprising steps i) to iii) of claim 7, wherein the one or more plant cells of step i) are capable of undergoing incomplete meiosis.

15. A method for producing apomictic F1 hybrid seeds, comprising the steps of: a) crossbreeding a sexually propagating first plant with pollen from a second plant to produce F1 hybrid seeds, wherein the second plant comprises a nucleic acid as defined in claim 7, and wherein the first plant and / or the second plant is capable of undergoing incomplete meiosis.

16. The method of claim 15, wherein the method further comprises the steps of: b) selecting from said F1 hybrid seeds those comprising an apomictic phenotype.

17. The method of claim 16, wherein the seeds comprising the apomictic phenotype are selected by genotyping.

18. A method for producing an apomictic hybrid plant comprising the steps of claim 15 or 16, and further comprising the following steps: c) growing at least one F1 plant from said F1 hybrid seed.

19. Use of a nucleic acid as defined in claim 7 or a protein as defined in claim 5 for screening a parthenogenesis gene in a plant or a plant cell, for genotyping a plant or a plant cell for parthenogenesis and / or for conferring parthenogenesis on a plant or a plant cell.

Images