Human antibodies conjugated to RET and methods of use thereof

Abstract

The present invention provides fully human antibodies that bind to the RET receptor tyrosine kinase, compositions comprising the antibodies, and methods of use. The antibodies of the present invention are useful for treating diseases, disorders, or conditions associated with the expression, activation, or signaling of the RET receptor tyrosine kinase gene or rearranged forms thereof, including cancerous conditions and cancer-related pain, or for alleviating pain associated with other conditions that are at least partially attributable to the expression, activation, or signaling of RET. The antibodies specific for RET may be useful for retarding tumor cell growth or tumor cell proliferation and may also be useful for alleviating pain associated with the cancer and other conditions. The antibodies may also be useful for diagnosing diseases, disorders, or conditions associated with RET activation or signaling.

Description

Field of the Invention

[0001] The present invention relates to human antibodies and antigen-binding fragments of human antibodies that specifically bind to RET (rearranged during transfection) receptor tyrosine kinase, as well as compositions comprising these antibodies and therapeutic methods using these antibodies.

[0002] Sequence Listing

[0003] An official copy of the sequence listing is submitted electronically with this specification via EFS-Web as an ASCII formatted sequence listing, with the file name 10582WO01_SeqList_ST25.TXT, creation date April 9, 2020, and size of approximately 168 kilobytes. The sequence listing contained in this ASCII formatted file is part of this specification and is incorporated herein by reference in its entirety. Background Art

[0004] RET (REarranged during Transfection) receptor tyrosine kinase is expressed during development in various tissues, including the peripheral and central nervous systems and kidney (Arighi, E et al., (2005), Cytokine Growth Factor Rev 16:441-467; Borrello, MG et al., (2013), Expert Opin. Ther. Targets, 17(4):403-419; Golden, JP et al. (1998), J. Comp. Neurol. 398:139-150; Golden, JP et al. (1999), Exp. Neurol. 158:504-528). It is also expressed in neural crest-derived cells and regulates cell proliferation, migration and survival (Coulpier, M et al. (2002), J Biol Chem, 277: 1991-1999; Golden, JP et al. (1998), J Comp Neurol 398: 139-150; Golden, JP et al. (1999), Exp Neurol 158: 504-528). RET knockout mice exhibit renal dysgenesis and lack of enteric neurons in the digestive tract. A very similar phenotype was observed in mice in which both GFRα1 and GDNF genes were knocked out, confirming the major role of GDNF / GFRα1 in RET signaling activation during development.

[0005] RET is a signaling receptor for glial-derived neurotrophic factor (GDNF) family ligands, which include GDNF, artemin, neurturin, and persephin. GDNF family ligands interact with and activate RET only in the presence of one of four GPI-linked co-receptors called GDNF family receptors GFR (1 to 4) (Baloh, RH et al. (2000), Curr Opin Neurobiol 10: 103-110; Borrello, MG et al. (2013), Expert Opinion on Therapeutic Targets, 17 (4): 403-419). The primary ligands of the co-receptors GFRα1, GFRα2, GFRα3, and GFRα4 are GDNF, neurturin (NRTN), artemin (ARTN), and persephin (PSPN), respectively, although cross-talk between ligands and co-receptors has been observed in vitro.

[0006] The role of RET as a driver of tumorigenesis has been established by activating mutations frequently observed in multiple endocrine neoplasia syndromes MEN2A and MEN2B and in familial medullary thyroid carcinoma (Mulligan, LM et al. (1994), Nat. Genet. 6:70-74). In addition, a high percentage of sporadic medullary thyroid carcinomas contain somatic activating mutations in RET (Fusco, A et al. (1987), Nature 328:170-172; Grieco, M et al. (1990), Cell 60:557-563). These mutations can occur in the kinase domain or in the extracellular domain, where the mutations render unpaired cysteines thought to promote ligand-independent RET dimerization and activation. Therefore, the tumorigenic potential of RET in humans has been clearly established by genetic studies.

[0007] In addition to its role in endocrine cancers, recent studies have identified RET as a potential therapeutic target for breast cancer. RET and GFRα1 are expressed in breast cancer cell lines and in primary human breast cancer samples. It is worth noting that the expression of RET and GFRα1 can be induced in vitro by estrogen. Consistent with this observation, RET and GFRα1 are preferably expressed in the estrogen receptor-positive subpopulation of breast cancer. In addition, GDNF-induced RET signaling promotes the anchorage-independent growth of estrogen receptor-positive breast cancer cells and enhances the effects of estrogen on the growth and survival of these cells, thereby indicating functional collaboration between these two pathways. Therefore, RET signaling appears to be an important driver of the oncogenic phenotype in breast cancer cells (Wang, C. et al. (2012), Breast Cancer Res Treat 133 (2): 487-500; Stine, ZE et al. (2011), Human Molecular Genetics 20 (19): 3746-3756).

[0008] Activation of RET begins with the binding of GDNF to GFRα1. The GDNF / GFRα1 complex then binds to RET, causing receptor dimerization and activation. There are several small molecules that can inhibit RET, including agents that show activity in patients with medullary thyroid cancer (vandetanib) (see Wells, SA et al. (2012), Journal of Clinical Oncology (J Clin Oncol) 30: 134-141; Leboulleux, S. et al. (2012), Lancet Oncol 13: 897-905). Other small molecules that bind to and inhibit RET signaling have been identified (Borrello, MG et al. (2013), Expert Opinion on Therapeutic Targets, 17 (4): 403-419). Unfortunately, due to their lack of specificity, some of these compounds have shown adverse events in clinical trials, hindering further development.

[0009] To date, there are no reports of therapeutic anti-RET monoclonal antibodies being used in a clinical setting to treat tumors expressing RET. The studies reported herein describe the generation of a fully human monoclonal antibody that binds to RET and prevents the interaction of RET with one or more GDNF family members in complex with their corresponding co-receptors.

[0010] The domain structure of the RET extracellular region is shown in Figure 1In the RET signaling complex, it consists of four cadherin-like domains followed by a cysteine-rich domain (see Borrello, MG et al. (2013), Expert Opinion on Therapeutic Targets, 17(4): 403-419). Although the structure of the active RET signaling complex has not yet been resolved, it appears that the GDNF / GFRα1 complex contacts the RET extracellular domain at multiple sites, including the fourth cadherin-like domain and the cysteine-rich domain. Therefore, antibodies against multiple domains of RET can potentially inhibit signaling. Antibodies against RET have been described and can be found in US6861509 and US2009 / 0136502.

[0011] However, given the role that RET plays in tumor cell growth and proliferation, and given the fact that there are only a few approved drugs targeting this molecule, there remains a need for RET inhibitors, such as human antibodies that specifically bind to RET, are highly potent and do not produce adverse effects that would prevent approval for clinical use. Summary of the invention

[0012] The present invention provides fully human monoclonal antibodies (mAbs) or antigen-binding fragments thereof that specifically bind to RET and inhibit the binding or interaction of RET with one or more GDNF family member ligands (GDNF, neurturin, artemin, and persephin), which are complexed with their corresponding co-receptors (GFRα1, GFRα2, GFRα3, and GFRα4, respectively). In one embodiment, the human anti-RET antibodies described herein prevent the interaction of RET with the GDNF / GFRα1 complex. In a related embodiment, the human anti-RET antibodies described herein prevent the interaction of RET with the artemin / GFRα3 complex. In a related embodiment, the human anti-RET antibodies described herein prevent the interaction of RET with the neurturin / GFRα2 complex or the persephin / GFRα4 complex.

[0013] The studies described herein show that these antibodies are able to modulate ligand-dependent RET signaling.In certain embodiments, antibodies have been identified that antagonize ligand-dependent RET signaling.

[0014] In view of the role of RET in the development of various endocrine tumor syndromes and other cancers, antibodies of the present invention that antagonize / inhibit the signaling activity of RET can be used to treat these tumor syndromes and cancers to inhibit the growth / proliferation of tumor cells. Examples of cancerous conditions that can be treated using the RET antagonist antibodies of the present invention include, but are not limited to, thyroid tumors, lung tumors, pancreatic tumors, skin cancer, breast cancer, and leukemia. Thyroid tumors that can be treated using the antagonist anti-RET antibodies of the present invention may include papillary thyroid carcinoma (PTC) or medullary thyroid carcinoma (MTC). Medullary thyroid carcinoma that can be treated using the antagonist anti-RET antibodies of the present invention may include hereditary MTC, which is selected from the group consisting of MEN2A, MEN2B, and familial medullary thyroid carcinoma (FMTC) syndromes, or medullary thyroid carcinoma may be sporadic MTC. The antibodies of the invention may also be used to treat pain associated with these cancerous conditions, as well as pain associated with other diseases, disorders or conditions in which RET activity or signaling may play a role.

[0015] The antibody can be used as a stand-alone therapy, or can be used in combination with a second agent suitable for treating a disease or condition associated with RET expression. In certain embodiments, the antibody can be therapeutically combined with a second agent to treat a disease or condition or to improve at least one symptom associated with a disease or condition. If the antibody inhibits RET activity or signaling and is being considered for the treatment of, for example, a cancerous condition, the second agent may be a chemotherapeutic agent or a bone marrow repair agent, or may be radiation therapy for the treatment of a tumor. If the antibody inhibits RET activity or signaling and is being considered for the treatment of pain associated with a condition, and if the treatment warrants the use of a second analgesic, the second agent may be any agent that is also suitable for alleviating pain associated with the condition, such as: aspirin or another NSAID, morphine, steroids (e.g., prednisone), nerve growth factor (NGF) inhibitors (e.g., small molecule NGF antagonists or anti-NGF antibodies), anti-Na v 1.7 Antibody or Na v 1.7 small molecule inhibitors, Na v 1.8 Antagonists (e.g., anti-Na v 1.8 Antibody or Na v 1.8 small molecule inhibitors), Na v 1.9 Antagonists (e.g., anti-Na v 1.9 Antibody or Na v1.9), cytokine inhibitors (e.g., interleukin-1 (IL-1) inhibitors (e.g., rilonacept ("IL-1 trap")) or anakinra , small molecule IL-1 antagonists or anti-IL-1 antibodies; IL-18 inhibitors (such as small molecule IL-18 antagonists or anti-IL-18 antibodies); IL-6 or IL-6R inhibitors (such as small molecule IL-6 antagonists, anti-IL-6 antibodies or anti-IL-6 receptor antibodies), caspase-1 inhibitors, p38 inhibitors, IKK1 / 2 inhibitors, CTLA-4Ig inhibitors or opioids.

[0016] The antibodies of the invention may be full length (e.g., IgG1 or IgG4 antibodies) or may comprise only the antigen binding portion (e.g., Fab, F(ab') 2 or scFv fragments), and can be modified to affect functionality, such as eliminating residual effector function (Reddy et al., (2000), J. Immunol. 164: 1925-1933).

[0017] Thus, in a first aspect, the present invention provides an isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET (rearranged during transfection) receptor tyrosine kinase, wherein the antibody has one or more of the following characteristics:

[0018] (a) is a fully human antibody;

[0019] (b) As measured by surface plasmon resonance, the range is between about 1.0×10 -7 M is about 1.0×10 -12 M of K D ;

[0020] (c) inhibiting or blocking the binding or interaction of RET with one or more GDNF family member ligands (GDNF, neurturin, artemin, and persephin) in complex with their corresponding co-receptors (GFRα1, GFRα2, GFRα3, and GFRα4, respectively);

[0021] (d) inhibiting RET signaling mediated by one or more GDNF family member ligands selected from the group consisting of GDNF, neurturin, artemin and persephin;

[0022] (e) enhancing RET internalization / degradation after said antibody binds to said RET receptor;

[0023] (f) comprises a heavy chain variable region (HCVR) having an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, and 290; or

[0024] (g) comprises a light chain variable region (LCVR) having an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282 and 298.

[0025] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET blocks the binding of human RET to the GDNF:GFRa1 co-complex, and its IC 50 Values ​​range from about 100 pM to about 7.0 nM.

[0026] In a related embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET blocks the binding of human RET to the GDNF:GFRα1 co-complex, and its IC 50 Values ​​ranged from about 250 pM to about 5.2 nM.

[0027] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET blocks the binding of human RET to the GDNF:GFRα1 co-complex by about 40% to about 100%.

[0028] In a related embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET blocks the binding of human RET to the GDNF:GFRα1 co-complex by about 57% to about 97%.

[0029] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET inhibits GDNF-mediated RET signaling, and its IC 50 Values ​​range from about 50 pM to greater than 100 nM.

[0030] In a related embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET inhibits GDNF-mediated RET signaling, and its IC 50 Values ​​ranged from approximately 143 pM to greater than 100 nM.

[0031] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET inhibits GDNF-mediated RET signaling by about 40% to about 100%.

[0032] In a related embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET inhibits GDNF-mediated RET signaling by about 60% to about 100%.

[0033] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET inhibits artemin-mediated RET signaling, and its IC 50 Values ​​range from about 100 pM to about 500 nM.

[0034] In a related embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET inhibits artemin-mediated RET signaling, and its IC 50 Values ​​ranged from about 250 pM to about 341 nM.

[0035] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET inhibits artemin-mediated RET signaling by about 57% to about 100%.

[0036] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET comprises a heavy chain variable region (HCVR) having an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, and 290.

[0037] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET comprises a light chain variable region (LCVR) having an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282, and 298.

[0038] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET comprises: a heavy chain variable region (HCVR) having an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, and 290; and a light chain variable region (LCVR) having an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282, and 298.

[0039] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET comprises a HCVR / LCVR amino acid sequence pair selected from the group consisting of SEQ ID NO: 2 / 10, 18 / 26, 34 / 42, 50 / 58, 66 / 74, 82 / 90, 98 / 106, 114 / 122, 130 / 138, 146 / 154, 162 / 170, 178 / 186, 194 / 202, 210 / 218, 226 / 234, 242 / 250, 258 / 266, 274 / 282, and 290 / 298.

[0040] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET comprises: a HCVR comprising three heavy chain CDRs (HCDR1, HCDR2, and HCDR3), wherein the three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) are contained within a HCVR amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, and 290; and a LCVR comprising three light chain CDRs (LCDR1, LCDR2, and LCDR3), wherein the three light chain CDRs (LCDR1, LCDR2, and LCDR3) are contained within a LCVR amino acid sequence selected from the group consisting of SEQ ID NOs: NO: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282 and 298.

[0041] Methods and techniques for identifying CDRs within HCVR and LCVR amino acid sequences are well known in the art and can be used to identify CDRs within a given HCVR and / or LCVR amino acid sequence disclosed herein. Exemplary conventions that can be used to identify CDR boundaries include, for example, the Kabat definition, the Chothia definition, and the AbM definition. In general, the Kabat definition is based on sequence variability, the Chothia definition is based on the position of the structural loop regions, and the AbM definition is a compromise between the Kabat and Chothia approaches. See, e.g., Kabat, "Sequences of Proteins of Immunological Interest", National Institutes of Health, Bethesda, Md. (1991); Al-Lazikani et al., (1997), J. Mol. Biol. 273:927-948; and Martin et al., (1989), Proc. Natl. Acad. Sci. USA 86:9268-9272. Public databases can also be used to identify CDR sequences within antibodies.

[0042] In one embodiment, the isolated human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET comprises:

[0043] (a) a HCDR1 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 4, 20, 36, 52, 68, 84, 100, 116, 132, 148, 164, 180, 196, 212, 228, 244, 260, 276 and 292;

[0044] (b) a HCDR2 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 6, 22, 38, 54, 70, 86, 102, 118, 134, 150, 166, 182, 198, 214, 230, 246, 262, 278 and 294;

[0045] (c) a HCDR3 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 8, 24, 40, 56, 72, 88, 104, 120, 136, 152, 168, 184, 200, 216, 232, 248, 264, 280 and 296;

[0046] (d) a LCDR1 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 12, 28, 44, 60, 76, 92, 108, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284, and 300;

[0047] (e) a LCDR2 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 14, 30, 46, 62, 78, 94, 110, 126, 142, 158, 174, 190, 206, 222, 238, 254, 270, 286, and 302; and

[0048] (f) a LCDR3 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 16, 32, 48, 64, 80, 96, 112, 128, 144, 160, 176, 192, 208, 224, 240, 256, 272, 288 and 304.

[0049] In one embodiment, the present invention provides an isolated antibody or antigen-binding fragment thereof that specifically binds to RET, which competes for specific binding to RET with an antibody or antigen-binding fragment comprising a heavy chain and a light chain sequence pair selected from the group consisting of SEQ ID NO: 2 / 10, 18 / 26, 34 / 42, 50 / 58, 66 / 74, 82 / 90, 98 / 106, 114 / 122, 130 / 138, 146 / 154, 162 / 170, 178 / 186, 194 / 202, 210 / 218, 226 / 234, 242 / 250, 258 / 266, 274 / 282, and 290 / 298.

[0050] In one embodiment, the present invention provides an isolated antibody or antigen-binding fragment thereof that specifically binds to RET, which binds to the same epitope on RET recognized by the antibody, wherein the antibody comprises a heavy chain and a light chain sequence pair selected from the group consisting of SEQ ID NO: 2 / 10, 18 / 26, 34 / 42, 50 / 58, 66 / 74, 82 / 90, 98 / 106, 114 / 122, 130 / 138, 146 / 154, 162 / 170, 178 / 186, 194 / 202, 210 / 218, 226 / 234, 242 / 250, 258 / 266, 274 / 282 and 290 / 298.

[0051] In one embodiment, the present invention provides a fully human monoclonal antibody or antigen-binding fragment thereof that specifically binds to RET, wherein the antibody or fragment thereof exhibits one or more of the following features: (i) comprising a HCVR having an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274 and 290, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; (ii) comprising a LCVR having an amino acid sequence selected from the group consisting of SEQ ID NO: NO: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282 and 298, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; (iii) comprising a HCDR3 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 8, 24, 40, 56, 72, 88, 104, 122, 136, 152, 168, 184, 200, 216, 232, 248, 264, 280 and 296, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and a LCDR3 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 8, 24, 40, 56, 72, 88, 104, 120, 136, 152, 168, 184, 200, 216, 232, 248 NO:16, 32, 48, 64, 80, 96, 112, 128, 144, 160, 176, 192, 208, 224, 240, 256, 272, 288 and 304, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; (iv) comprising a HCDR1 domain having an amino acid sequence selected from the group consisting of SEQ ID NO:4, 20, 36, 52, 68, 84, 100, 116, 132, 148, 164, 180, 196, 212, 228, 244, 260, 276 and 292, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; (v) a HCDR2 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: NO: 6, 22, 38, 54, 70, 86, 102, 118, 134, 150, 166, 182, 198, 214, 230, 246, 262, 278 and 294, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity;(vi) a LCDR1 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: 12, 28, 44, 60, 76, 92, 108, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284 and 300, or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto; (vii) and a LCDR2 domain having an amino acid sequence selected from the group consisting of SEQ ID NO: NO:14, 30, 46, 62, 78, 94, 110, 126, 142, 158, 174, 190, 206, 222, 238, 254, 270, 286 and 302, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; (viii) exhibit a range of about 1×10; -7 M is about 1×10 -12 M of K D (ix) It can block the binding of human RET to the GDNF:GFRα1 complex, with an IC 50 value is less than about 5.2 nM; or (x) exhibits the ability to inhibit ligand-dependent RET signaling by about 60% to 100%, with an IC 50 Values ​​ranged from approximately 143 pM to greater than 100 nM.

[0052] In a second aspect, the present invention provides nucleic acid molecules encoding antibodies or fragments thereof that specifically bind to RET. Recombinant expression vectors carrying the nucleic acids of the present invention and host cells into which these vectors have been introduced are also encompassed by the present invention, as are methods of producing antibodies by culturing host cells under conditions that allow the production of antibodies, and methods of recovering the produced antibodies.

[0053] In one embodiment, the invention provides an antibody or fragment thereof comprising a HCVR encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, 17, 33, 49, 65, 81, 97, 113, 129, 145, 161, 177, 193, 209, 225, 241, 257, 273 and 289, or a substantially identical sequence having at least 90%, at least 95%, at least 98% or at least 99% homology thereto.

[0054] In one embodiment, the antibody or fragment thereof further comprises a LCVR encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 9, 25, 41, 57, 73, 89, 105, 121, 137, 153, 169, 185, 201, 217, 233, 249, 265, 281 and 297, or a substantially identical sequence having at least 90%, at least 95%, at least 98% or at least 99% homology thereto.

[0055] In one embodiment, the present invention also provides an antibody or an antigen-binding fragment of an antibody, comprising: a HCDR3 domain encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, 23, 39, 55, 71, 87, 103, 119, 135, 151, 167, 183, 199, 215, 231, 247, 263, 279, 287 and 295, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and a LCDR3 domain encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: NO: 15, 31, 47, 63, 79, 95, 111, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287 and 303, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0056] In one embodiment, the present invention provides an antibody or fragment thereof, which further comprises a HCDR1 domain encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, 19, 35, 51, 67, 83, 99, 115, 131, 147, 163, 179, 195, 211, 227, 243, 259, 275 and 291, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; a HCDR2 domain encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: NO:5, 21, 37, 53, 69, 85, 101, 117, 133, 149, 165, 181, 197, 213, 229, 245, 261, 277 and 293, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; a LCDR1 domain encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO:11, 27, 43, 59, 75, 91, 107, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267, 283 and 299, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and a LCDR2 domain encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO:11, 27, 43, 59, 75, 91, 107, 123, 139, NO: 13, 29, 45, 61, 77, 93, 109, 125, 141, 157, 173, 189, 205, 221, 237, 253, 269, 285 and 301, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0057] In a third aspect, the invention features a human antibody or antigen-binding fragment specific for RET comprising a polypeptide derived from V H , D H and J H The HCVR is encoded by the nucleotide sequence segment of the germline sequence, and the HCVR is derived from the V K and J K The nucleotide sequence segment of the germline sequence encodes the LCVR.

[0058] The present invention encompasses antibodies with modified glycosylation patterns. In some applications, modifications to remove undesirable glycosylation sites may be useful, or, for example, to remove fucose moieties to increase antibody-dependent cellular cytotoxicity (ADCC) function (see Shield et al., (2002) JBC 277:26733). In other applications, modifications to galactosylation may be performed to modulate complement-dependent cytotoxicity (CDC).

[0059] In a fourth aspect, the present invention provides a pharmaceutical composition comprising at least one isolated fully human monoclonal antibody or antigen-binding fragment thereof that binds to RET, and a pharmaceutically acceptable carrier or diluent. In one embodiment, the present invention provides a pharmaceutical composition comprising two fully human monoclonal antibodies or antigen-binding fragments thereof that bind to the same epitope on RET or to two different epitopes, and a pharmaceutically acceptable carrier or diluent. It should be understood that any combination of antibodies as described herein can be used in a pharmaceutical composition to achieve the desired results in a patient population in need of such therapy. For example, two antibodies that recognize and / or bind to RET can be used in a composition.

[0060] In one embodiment, the composition comprises an antibody that binds RET and has a HCVR / LCVR amino acid sequence pair selected from the group consisting of SEQ ID NO: 2 / 10, 18 / 26, 34 / 42, 50 / 58, 66 / 74, 82 / 90, 98 / 106, 114 / 122, 130 / 138, 146 / 154, 162 / 170, 178 / 186, 194 / 202, 210 / 218, 226 / 234, 242 / 250, 258 / 266, 274 / 282, and 290 / 298.

[0061] In one embodiment, the pharmaceutical composition comprises at least one antibody that binds to RET, wherein the antibody comprises: three heavy chain complementarity determining regions (HCDR1, HCDR2, and HCDR3) contained within any one of the heavy chain variable region (HCVR) amino acid sequences selected from the group consisting of SEQ ID NOs: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, and 290; and three light chain complementarity determining regions (LCDR1, LCDR2, and LCDR3) contained within any one of the light chain variable region (LCVR) amino acid sequences selected from the group consisting of SEQ ID NOs: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282, and 298.

[0062] In one embodiment, an antibody of the invention or a composition containing one or more antibodies of the invention can be used to inhibit at least one activity or function associated with RET expressed on a cell. In one embodiment, the cell can be a tumor cell. In one embodiment, the activity can be cell signaling.

[0063] In one embodiment, the invention features a composition that is a combination of an antibody or antigen-binding fragment of an antibody of the invention and a second therapeutic agent.

[0064] The second therapeutic agent can be a small molecule drug, a protein / peptide, an antibody, a nucleic acid molecule, such as an antisense molecule or siRNA. The second therapeutic agent can be synthetic or naturally derived.

[0065] The second therapeutic agent can be any agent that is advantageously combined with the antibody of the present invention or its fragment, for example, if the anti-RET antibody is a RET inhibitor to be used to treat a cancerous condition, then the second agent can be selected from a chemotherapeutic agent, a radionuclide, a siRNA specific for RET, a second antibody specific for RET, a small molecule RET inhibitor, and a bone marrow repair agent (e.g., G-CSF, GM-CSF, or M-CSF), or a biological agent with colony stimulation or bone marrow repair activity. In certain embodiments, if any possible side effects associated with the antibody or antigen-binding fragment of the antibody of the present invention may occur, then the second therapeutic agent may be an agent that helps to offset or alleviate these side effects. In certain embodiments, the second therapeutic agent may be an agent suitable for alleviating pain associated with certain conditions characterized by pain and / or inflammation. Such a second agent may include a nerve growth factor (NGF) inhibitor (e.g., a small molecule NGF antagonist or an anti-NGF antibody), aspirin or another NSAID, morphine, a steroid (e.g., prednisone), an anti-Na v 1.7 Antibody or Na v 1.7 small molecule inhibitors, Na v 1.8 Antagonists (e.g., anti-Na v 1.8 Antibody or Na v 1.8 small molecule inhibitors), Na v 1.9 Antagonists (e.g., anti-Na v 1.9 Antibody or Na v 1.9), cytokine inhibitors (e.g., interleukin-1 (IL-1) inhibitors (e.g., rilanacept ("IL-1 trap"); Regeneron) or anakinra ( , Amgen), small molecule IL-1 antagonists or anti-IL-1 antibodies; IL-18 inhibitors (e.g., small molecule IL-18 antagonists or anti-IL-18 antibodies); IL-6 or IL-6R inhibitors (e.g., small molecule IL-6 antagonists, anti-IL-6 antibodies or anti-IL-6 receptor antibodies), caspase-1 inhibitors, p38 inhibitors, IKK1 / 2 inhibitors, CTLA-4Ig inhibitors or opioids.

[0066] It should also be understood that the antibodies and pharmaceutically acceptable compositions of the present invention can be used in combination therapy, that is, antibodies and pharmaceutically acceptable compositions can be used simultaneously with one or more other desired therapeutic agents or medical procedures, before or after them. The specific therapy combination (therapeutic agent or procedure) used in the combination regimen will take into account the compatibility of the desired therapeutic agent and / or procedure, and the desired therapeutic effect to be achieved. It should also be understood that the therapy used can achieve the desired effect on the same disease (for example, the antibody can be used simultaneously with another agent for treating the same disease), or the therapy can achieve different effects (for example, controlling any adverse effects). As used herein, the additional therapeutic agent usually used to treat or prevent a specific disease or condition is suitable for the disease or condition being treated.

[0067] If a small molecule RET inhibitor is considered to be combined with the antibody of the present invention, the small molecule RET inhibitor can be selected from the following group: vandetanib, sorafenib, sunitinib, cabozantinib, motesanib, RPI-1, PP-1 and NVP-AST478, cediranib, (AZD2171), gefitinib, erlotinib, SU14813, vatalanib (vatalanib), (BAY43-9006), XL-647, XL-999, AG-013736, BIBF1120, TSU68, GW786034, AEE788, CP-547632, KRN951, CHIR258, CEP-7055, OSI-930, ABT-869, E7080, ZK-304709, BAY57-9352, L-21649, BMS582664, XL-880, XL-184, XL-820, RPI-1, PP-1, and NVP-AST478.

[0068] As recognized in the relevant art, when multiple therapeutic agents are co-administered, the dosage may be adjusted accordingly.

[0069] The fifth aspect of the present invention provides a method for treating a disorder or condition associated with the expression, activation or signaling of the RET receptor tyrosine kinase gene or its rearranged form, or pain associated with the disorder or condition, the method comprising administering to a patient in need thereof any antibody or antigen-binding fragment of the anti-RET antibodies described herein and a pharmaceutically acceptable carrier or diluent.

[0070] In one embodiment, the disorder or condition is a cancer selected from the group consisting of thyroid cancer, lung cancer, pancreatic cancer, skin cancer, breast cancer, and hematogenous cancer. In one embodiment, the disorder or condition associated with expression, activation, or signaling of the RET receptor tyrosine kinase gene or its rearranged form is selected from the group consisting of acute pain, chronic pain, neuropathic pain, inflammatory pain, arthritis, osteoarthritis, migraine, cluster headache, trigeminal neuralgia, herpetic neuralgia, general neuralgia, neurodegenerative disorders, neuroendocrine disorders, visceral pain, acute gout, post-herpetic neuralgia, diabetic neuropathy, sciatica, back pain, head or neck pain, severe or intractable pain, breakthrough pain, postoperative pain, toothache, rhinitis, cancer pain, or bladder disorders.

[0071] In a related aspect, the invention provides a method for inhibiting tumor growth or tumor cell proliferation, wherein the tumor or tumor cell expresses RET or a rearranged form thereof, the method comprising administering an antibody or antigen-binding fragment thereof of the invention to a patient in need thereof.

[0072] In one embodiment, the tumor is a solid tumor or a hematogenous tumor.

[0073] In one embodiment, the solid tumor is selected from the group consisting of a thyroid tumor, a lung tumor, a pancreatic tumor, a skin tumor, and a breast tumor.

[0074] In one embodiment, the thyroid tumor is papillary thyroid carcinoma (PTC) or medullary thyroid carcinoma (MTC).

[0075] In one embodiment, the medullary thyroid cancer is hereditary MTC selected from the group consisting of MEN2A, MEN2B, and familial medullary thyroid carcinoma (FMTC) syndrome, or wherein the medullary thyroid cancer is sporadic MTC.

[0076] In one embodiment, the lung tumor is lung adenocarcinoma.

[0077] In one embodiment, the lung tumor is non-small cell lung cancer (NSCLC).

[0078] In one embodiment, the skin tumor is melanoma.

[0079] In one embodiment, the blood-borne tumor is a leukemia.

[0080] In one embodiment, the leukemia is chronic myelomonocytic leukemia.

[0081] In a related aspect, the invention provides a method of downregulating RET expression and / or function, the method comprising administering an antibody or antigen-binding fragment thereof of the invention.

[0082] In one embodiment, downregulation of RET expression and / or function causes downregulation of a downstream signaling pathway selected from the group consisting of a RAS / RAF / ERK pathway and a PI3K pathway. In certain embodiments, downregulation of RET expression and / or function causes downregulation of a signaling pathway selected from the group consisting of a PKC pathway, a SRC pathway, and a STAT3 pathway.

[0083] In one embodiment, the anti-RET antibodies of the present invention can interfere with or prevent the interaction between RET and one or more GDNF family member ligands (GDNF, neurturin, artemin and persephin), which are complexed with their corresponding co-receptors (GFRα1, GFRα2, GFRα3 and GFRα4, respectively). In one embodiment, the human anti-RET antibodies described herein can interfere with or prevent the interaction of RET with the GDNF / GFRα1 complex. In a related embodiment, the human anti-RET antibodies described herein can interfere with or prevent the interaction of RET with the artemin / GFRα3 complex. In other related embodiments, the human anti-RET antibodies described herein can interfere with or prevent the interaction of RET with the neurturin / GFRα2 complex or the persephin / GFRα4 complex.

[0084] Once activated, RET recruits various signaling molecules that regulate biological responses. RET can activate various signaling pathways, such as RAS / RAF / ERK (extracellular signal-regulated kinase), phosphatidylinositol 3-kinase (PI3K) / AKT, PKC, and SRC. These signaling pathways are activated by the binding of adaptor proteins to intracellular tyrosine residues of RET that are phosphorylated by their own kinase activity.

[0085] Therefore, in certain aspects of the present invention, the anti-RET antibodies of the present invention can block biological reactions that are at least partially attributed to RET activation of other signal transduction pathways. In certain embodiments, the anti-RET antibodies of the present invention can interfere with signal transduction by pathways comprising RET and RAS. In certain embodiments, anti-RET antibodies can interfere with cell proliferation, migration or invasion, or phosphorylation of ERK1 / 2 (extracellular signal-regulated kinase 1 / 2). In certain embodiments, anti-RET antibodies can interfere with signal transduction by pathways comprising RET and PI3K (phosphatidylinositol-3-kinase). In certain embodiments, anti-RET antibodies can interfere with cell proliferation, migration or invasion, or phosphorylation of Akt (protein kinase B).

[0086] The antibody or antigen-binding fragment may be administered to the patient in combination with a second therapeutic agent suitable for treating a disease, disorder, or condition. If the disease or condition to be treated by the anti-RET antibody is a cancerous condition, the second therapeutic agent may be selected from the group consisting of a chemotherapeutic agent, a radionuclide (alone or as part of a drug targeting regimen), an antibody-drug conjugate, a small molecule RET inhibitor, an anti-tumor agent, an siRNA specific for RET, and a second antibody specific for RET. If it is envisioned that the anti-RET antibody is used to treat pain associated with a cancerous condition, or for treating pain associated with other conditions that can be at least partially attributed to RET activation or signaling, the second agent may be selected from any one or more of the following: a nerve growth factor (NGF) inhibitor (e.g., a small molecule NGF antagonist or an anti-NGF antibody), aspirin or another NSAID, morphine, a steroid (e.g., prednisone), an anti-Na v 1.7 Antibody or Na v 1.7 small molecule inhibitors, Na v 1.8 Antagonists (e.g., anti-Na v 1.8 Antibody or Na v 1.8 small molecule inhibitors), Na v 1.9 Antagonists (e.g., anti-Na v 1.9 Antibody or Na v 1.9), cytokine inhibitors (e.g., interleukin-1 (IL-1) inhibitors (e.g., rilanacept ("IL-1 trap"); Rezenex) or anakinra ( Amgen), small molecule IL-1 antagonists or anti-IL-1 antibodies; IL-18 inhibitors (e.g., small molecule IL-18 antagonists or anti-IL-18 antibodies); IL-6 or IL-6R inhibitors (e.g., small molecule IL-6 antagonists, anti-IL-6 antibodies or anti-IL-6 receptor antibodies), caspase-1 inhibitors, p38 inhibitors, IKK1 / 2 inhibitors, CTLA-4Ig inhibitors or opioids.

[0087] Other embodiments will be apparent by review of the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0088] Figure 1 . Schematic representation of the human RET receptor. DETAILED DESCRIPTION

[0089] Before describing the inventive method, it should be understood that the present invention is not limited to the specific method and described experimental conditions, and thus the method and conditions may vary. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be restrictive, because the scope of the present invention will only be limited by the appended claims.

[0090] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. As used herein, the term "about" when used to refer to a specific recited value means that the value may differ from the recited value by no more than 1%. For example, as used herein, the expression "about 100" includes 99 and 101 and all values ​​therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0091] Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.All publications mentioned herein are incorporated by reference in their entirety.

[0092] definition

[0093] "Rearranged during transfection" (also known as "RET") is a receptor tyrosine kinase expressed during development of various tissues, including the peripheral and central nervous systems and kidneys. The RET oncogene was identified in 1985 by Takahashi et al., who reported a novel gene rearrangement with transforming activity in NIH / 3T3 cells transfected with human lymphoma DNA (see Takahashi, M. et al., (1985) Cell, 42:581-588). RET was subsequently confirmed as an oncogene that undergoes somatic rearrangement in the DNA of patients with papillary thyroid carcinoma (PTC), and was subsequently denoted RET / PTC. (Fusco, A. et al. (1987), Nature, 328:170-172; Grieco, M. et al. (1990), Cell, 60:557-63). The RET protein consists of three domains: an extracellular ligand-binding domain, a hydrophobic transmembrane domain, and a cytoplasmic portion with a tyrosine kinase domain split by the insertion of 27 amino acids (see Figure 1). There are two major isoforms of RET produced by alternative splicing. The short RET isoform and the long RET isoform are called RET9 and RET51, respectively, and differ by 9 and 51 unrelated C-terminal amino acids. It is highly conserved in a wide range of species (Carter, MT et al. (2001), Cytogenet Cell Genet, 95: 169-76). Both isoforms show transforming activity by focus formation assay (Rossel, M. et al. (1997), Oncogene, 14: 265-75).

[0094] The cDNA sequence and amino acid sequence of isoform A of RET (also known as RET51) are provided in GenBank as Accession Nos. NM_020975.4 and NP_066124.1, respectively, and are provided herein as SEQ ID NOs: 309 and 310, respectively.

[0095] The cDNA sequence and amino acid sequence of isoform C of RET (also known as RET9) are provided in GenBank as accession numbers NM_020630.4 and NP_065681.1, respectively, and are provided herein as SEQ ID NOs: 311 and 312, respectively. RET or an immunogenic fragment thereof can be used to prepare human monoclonal antibodies specific for RET. RET protein or fragments thereof can be recombinantly produced using standard methods known in the art. Exemplary fusion proteins containing the ecto-domain of RET are shown in SEQ ID NOs: 305, 306, 307, and 309. These fusion proteins can be used as immunogens, or they can be used to target therapeutic agents to cells or tissues expressing RET.

[0096] RET is a signaling receptor for ligands of the "glial-derived neurotrophic factor (GDNF) family," which includes GDNF (see GenBank Accession No. NP_000505.1), artemin (see GenBank Accession No. Q5T4W7), neurturin (see GenBank Accession No. NM_004558), and persephin (see GenBank Accession No. AF040962). GDNF family ligands interact with and activate RET only in the presence or complex with one of four GPI-linked "co-receptors", referred to as the GDNF family receptors GFRα1 (see GenBank Accession No. NP_005255.1), GFRα2 (see GenBank Accession No. NM_001495.4), GFRα3 (see GenBank Accession No. NP_001487.2), GFRα4 (see GenBank Accession No. NM_022139 for GFRα4a and GenBank Accession No. NM_145762.2 for GFRα4b) (Baloh, RH et al. (2000), Current Opinion in Neurobiology, 10:103-110; Borrello, MG et al. (2013), Expert Opinion on Therapeutic Targets, 17(4):403-419). The primary ligands of the co-receptors GFRα1, GFRα2, GFRα3 and GFRα4 are GDNF, neurturin (NRTN), artemin (ARTN) and persephin (PSPN), respectively.

[0097] The term "IC 50 ” refers to “half maximal inhibitory concentration,” which measures the effectiveness of a compound (e.g., an anti-RET antibody) in inhibiting a biological or biochemical effect. This quantitative measure indicates the amount of a particular inhibitor required to inhibit a given biological process by half.

[0098] As used herein, the terms "treat", "treatment", or "treating" refer to delaying the progression of a disease, disorder, or condition that is due in part to or associated with RET expression in cells or tissues of a subject, such as slowing the rate of tumor cell proliferation in a patient bearing a tumor expressing RET, or reducing pain associated with a cancerous condition or pain associated with any other disease or condition caused at least in part by RET expression when an antagonist / inhibitory antibody of the invention is administered.

[0099] As used herein, the terms "prevent", "preventing" and "prevention" refer to inhibiting the progression or onset of a disease, disorder or condition (e.g., certain cancers) that is due in part to or associated with RET expression in cells or tissues of a subject, or inhibiting tissue damage that occurs in a patient following an injury, or inhibiting or alleviating pain associated with a disease or condition that is due in part to RET expression.

[0100] As used herein, the term "antibody" refers to an immunoglobulin molecule comprising four polypeptide chains (two heavy (H) chains and two light (L) chains interconnected by disulfide bonds) (i.e., a "complete antibody molecule"), as well as multimers thereof (e.g., IgM) or antigen-binding fragments thereof. Each heavy chain includes a heavy chain variable region ("HCVR" or "V H ”) and the heavy chain constant region (comprising domain C H 1. C H 2 and C H 3). Each light chain includes a light chain variable region ("LCVR" or "V L ”) and the light chain constant region (C L ). H and V L The V region can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). H and V L It includes three CDRs and four FRs arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In certain embodiments of the present invention, the FRs of the antibody (or its antigen-binding fragment) may be identical to the human germline sequence, or may be modified naturally or artificially. The amino acid consensus sequence may be defined based on a side-by-side analysis of two or more CDRs.

[0101] It is also possible to replace one or more CDR residues or omit one or more CDRs. Antibodies have been described in the scientific literature, in which one or two CDRs can be assigned for binding. Padlan et al. (1995 FASEB J. 9: 133-139) analyzed the contact area between an antibody and its antigen based on a disclosed crystal structure, and concluded that only about one-fifth to one-third of the CDR residues actually contact the antigen. Padlan also found many antibodies in which one or two CDRs do not have amino acids that contact the antigen (see also Vajdos et al. 2002 Journal of Molecular Biology 320: 415-428).

[0102] CDR residues that do not contact the antigen can be identified from the Kabat CDR region outside the Chothia CDR by molecular modeling and / or empirically based on previous studies (e.g., residues H60-H65 in CDRH2 are generally not required). If a CDR or a residue thereof is omitted, it is generally substituted with an amino acid that occupies the corresponding position in another human antibody sequence or a consensus sequence of these sequences. The position of substitution within the CDR and the amino acid used for substitution can also be selected empirically. Empirical substitutions can be conservative or non-conservative substitutions.

[0103] Compared to the corresponding germline sequence, the fully human monoclonal antibodies disclosed herein may include one or more amino acid substitutions, insertions and / or deletions in the framework and / or CDR regions of the heavy and light chain variable domains. These mutations can be easily determined by comparing the amino acid sequences disclosed herein with germline sequences obtained from, for example, public antibody sequence databases. The present invention includes antibodies and antigen-binding fragments derived from any of the amino acid sequences disclosed herein, wherein one or more amino acids in one or more framework regions and / or CDR regions are mutated into corresponding residues of the germline sequence from which the antibody is derived, or mutated into corresponding residues of another human germline sequence, or mutated into conservative amino acid substitutions of corresponding germline residues (such sequence changes are collectively referred to herein as "germline mutations"). Starting from the heavy and light chain variable region sequences disclosed herein, a person of ordinary skill in the art can easily produce a variety of antibodies and antigen-binding fragments comprising one or more individual germline mutations or combinations thereof. In certain embodiments, V H and / or V LAll framework and / or CDR residues in the domain are mutated back to the residues found in the original germline sequence of the derived antibody. In other embodiments, only some residues are mutated back to the original germline sequence, for example, only the mutated residues found in the first 8 amino acids of FR1 or in the last 8 amino acids of FR4, or only the mutated residues found in CDR1, CDR2 or CDR3. In other embodiments, one or more mutations in framework and / or CDR residues become the corresponding residues of different germline sequences (that is, germline sequences different from the germline sequences of the initially derived antibody). In addition, the antibody of the present invention may contain any combination of two or more germline mutations in the framework and / or CDR regions, for example, wherein some individual residues are mutated into the corresponding residues of a specific germline sequence, and some other residues different from the original germline sequence can be maintained or mutated into the corresponding residues of different germline sequences. Once obtained, antibodies and antigen-binding fragments containing one or more germline mutations can be readily tested for one or more desired properties, e.g., improved binding specificity, increased binding affinity, improved or enhanced antagonistic or agonistic biological properties (as the case may be), reduced immunogenicity, etc. Antibodies and antigen-binding fragments obtained in this general manner are encompassed by the present invention.

[0104] The invention also includes fully monoclonal antibodies comprising variants of any of the HCVR, LCVR, and / or CDR amino acid sequences disclosed herein having one or more conservative substitutions. For example, the invention includes antibodies having HCVR, LCVR, and / or CDR amino acid sequences having, e.g., 10 or fewer, 8 or fewer, 6 or fewer, 4 or fewer, etc., conservative amino acid substitutions relative to any of the HCVR, LCVR, and / or CDR amino acid sequences disclosed herein.

[0105] As used herein, the term "human antibody" is intended to include antibodies with variable regions and constant regions derived from human germline immunoglobulin sequences. The human mAb of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or somatic mutations in vivo), such as in CDR, especially in CDR3. However, as used herein, the term "human antibody" is not intended to include mAbs that are transplanted to human FR sequences from CDR sequences derived from another mammalian species (e.g., mouse) germline.

[0106] The term "specific binding" or "specifically binds to" and the like means that the antibody or antigen-binding fragment thereof forms a relatively stable complex with the antigen under physiological conditions. Specific binding can be characterized by at least about 1×10 -6 M or lower equilibrium dissociation constant (e.g., smaller K DIndicates tighter binding). Methods for determining whether two molecules specifically bind are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, etc. As described herein, surface plasmon resonance, such as BIACORE TM Antibodies that specifically bind to RET are identified. In addition, as used herein, multispecific antibodies that bind to a RET protein and one or more additional antigens, or bispecific antibodies that bind to two different regions of RET are still considered "specifically binding" antibodies.

[0107] The term "high affinity" antibody refers to those mAbs that have a binding affinity for RET expressed as at least 10 -7 M. At least 10 -8 M; preferably 10 -9 M; more preferably 10 -10 M, more preferably 10 -11 M, more preferably 10 -12 M of K D , such as by surface plasmon resonance, e.g. BIACORE TM or solution affinity ELISA.

[0108] The term "slow off rate", "Koff" or "kd" refers to the rate constant for antibody dissociation from RET of 1×10 -3 s -1 or lower, preferably 1×10 -4 s -1 or lower, such as by surface plasmon resonance, e.g. BIACORE TM Measured.

[0109] As used herein, the terms "antigen-binding portion" of an antibody, "antigen-binding fragment" of an antibody, etc. include any naturally occurring, enzymatically obtainable, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. As used herein, the term "antigen-binding portion" or "antibody fragment" of an antibody refers to one or more fragments of an antibody that retain the ability to bind to RET.

[0110] Certain embodiments of the invention, antibodies or antibody fragments may be conjugated to a therapeutic moiety (an "immunoconjugate" or "antibody-drug conjugate"), such as a small molecule RET inhibitor, an anti-tumor agent, a radionuclide, a growth factor, a bone marrow repair agent or a colony stimulating factor, or any other therapeutic moiety useful for treating a disease, disorder or condition associated with RET expression (e.g., cancer or damaged tissue).

[0111] As used herein, "isolated antibody" means an antibody that is substantially free of other antibodies (Abs) having different antigenic specificities (eg, an isolated antibody that specifically binds RET or a fragment thereof is substantially free of Abs that specifically bind antigens other than RET).

[0112] As used herein, "blocking antibody" or "neutralizing antibody" (or "antibody that neutralizes RET activity") means an antibody that binds to RET so as to inhibit at least one biological activity of RET (e.g., cell signaling). For example, the antibodies of the present invention may help block the binding of RET to one of its ligands or GFRα co-receptors, or prevent or treat a disease associated with RET expression. In addition, the antibodies of the present invention may show the ability to improve at least one symptom of a disease or condition associated with RET expression. The inhibition of the biological activity of RET can be assessed by measuring one or more indicators of RET biological activity by one or more of several standard in vitro assays (e.g., any of the assays described herein) or in vivo assays known in the art (e.g., animal models for viewing in vivo tumor cell growth inhibition) after administration of one or more antibodies described herein.

[0113] As used herein, the term "surface plasmon resonance" refers to an optical phenomenon that allows the analysis of real-time biomolecular interactions by detecting changes in protein concentration within a biosensor matrix, for example using BIACORE TM Systems (Uppsala, Sweden and PharmaciaBiosensor AB, Piscataway, NJ).

[0114] As used herein, the term “K D ” refers to the equilibrium dissociation constant for a specific antibody-antigen interaction.

[0115] The term "epitope" refers to an antigenic determinant that interacts with a specific antigen binding site, which is called a paratope in the variable region of an antibody molecule. A single antigen may have more than one epitope. Therefore, different antibodies may bind to different regions on an antigen and may have different biological effects. The term "epitope" also refers to the site on an antigen where B cells and / or T cells react. It also refers to the region of the antigen to which an antibody binds. An epitope may be defined as structural or functional. A functional epitope is generally a subset of a structural epitope and has those residues that directly contribute to the affinity of the interaction. An epitope may also be conformational, i.e., composed of nonlinear amino acids. In certain embodiments, an epitope may include a determinant as a chemically active surface group (e.g., amino acid, sugar side chain, phosphoryl or sulfonyl) of a molecule, and in certain embodiments, may have specific three-dimensional structural features and / or specific charge features.

[0116] The term "substantial identity" or "substantially identical" when referring to a nucleic acid or a fragment thereof indicates that when appropriate nucleotide insertions or deletions are optimally aligned with another nucleic acid (or its complementary strand), as discussed below, there is nucleotide sequence identity in at least about 90%, more preferably at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases as measured by any well-known sequence identity algorithm (e.g., FASTA, BLAST or GAP). In some cases, a nucleic acid molecule having substantial identity to a reference nucleic acid molecule can encode a polypeptide having an amino acid sequence that is identical or substantially similar to a polypeptide encoded by the reference nucleic acid molecule.

[0117] When applied to polypeptides, the term "substantially identical" or "substantially similar" means that when optimally aligned, for example, by using the program GAP or BESTFIT with the default gap weight, two peptide sequences share at least 90% sequence identity, even more preferably at least 95%, 98% or 99% sequence identity. Preferably, different residue positions differ by conservative amino acid substitutions. "Conservative amino acid substitutions" are substitutions of one amino acid residue by another amino acid residue having a similar side chain (R group) with chemical properties (e.g., charge or hydrophobicity). In general, conservative amino acid substitutions will not substantially change the functional properties of proteins. In the case where two or more amino acid sequences differ from each other by conservative substitutions, the percentage or degree of similarity may be raised to correct the conservative nature of the substitution. The means for making such adjustments are well known to those skilled in the art. See, for example, Pearson (1994) Methods Mol. Biol. 24: 307-331, incorporated herein by reference. Examples of amino acid groups with chemically similar side chains include 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic-hydroxy side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine ​​and methionine. Preferred conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamic acid-aspartic acid, and asparagine-glutamine. Furthermore, a conservative substitution is any change that has a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Science 256: 1443 45, incorporated herein by reference. A "moderately conservative" substitution is any change that has a non-negative value in the PAM250 log-likelihood matrix.

[0118] Sequence analysis software is usually used to measure the sequence similarity of polypeptides. Protein analysis software uses similarity metrics assigned to various substitutions, deletions and other modifications including conservative amino acid substitutions to match similar sequences. For example, GCG software contains such as GAP and BESTFIT programs, which can be used under default parameters to determine the sequence homology or sequence identity between closely related polypeptides (such as between homologous polypeptides from different organism species or between wild-type proteins and their mutant proteins). See, for example, GCG version 6.1. FASTA can also be used to compare polypeptide sequences under default or recommended parameters; the program in GCG version 6.1 FASTA (e.g., FASTA2 and FASTA3) provides the comparison and sequence identity percentage of the best overlapping region between the query sequence and the search sequence (Pearson (2000) see above). When the sequence of the present invention is compared with a database containing a large number of sequences from different organisms, another preferred algorithm is a computer program BLAST using default parameters, especially BLASTP or TBLASTN. See, e.g., Altschul et al. (1990) J. Mol. Biol. 215:403-410 and (1997) Nucleic Acids Res. 25:3389-3402, each of which is incorporated herein by reference.

[0119] In certain embodiments, the antibodies or antibody fragments used in the methods of the present invention may be monospecific, bispecific, or multispecific. Multispecific antibodies may be specific for different epitopes of a target polypeptide, or may contain antigen binding domains that are specific for epitopes of more than one target polypeptide. Exemplary bispecific antibody formats that can be used in the context of the present invention involve the use of a first immunoglobulin (Ig) C H 3 domain and the second Ig C H 3 domains, of which the first and second Ig C H The three domains differ from each other by at least one amino acid, and wherein the at least one amino acid difference reduces binding of the bispecific antibody to protein A compared to a bispecific antibody lacking the amino acid difference. H The 3 domains bind protein A and the second Ig C H The 3 domain contains a mutation that reduces or eliminates protein A binding, such as the H95R modification (by IMGT exon numbering; H435R by EU numbering). H 3 may further comprise a Y96F modification (by IMGT; Y436F by EU). HOther modifications found within 3 include: D16E, L18M, N44S, K52N, V57M and V82I in the case of IgG1 mAb (by IMGT; D356E, L358M, N384S, K392N, V397M and V422I by EU); N44S, K52N and V82I in the case of IgG2 mAb (IMGT; N384S, K392N and V422I by EU); and Q15R, N44S, K52N, V57M, R69K, E79Q and V82I in the case of IgG4 mAb (by IMGT; Q355R, N384S, K392N, V397M, R409K, E419Q and V422I by EU). Variations of the bispecific antibody formats described above are encompassed within the scope of the present invention.

[0120] The phrase "therapeutically effective amount" means an amount that produces the effect for which it is administered. The exact amount will depend on the purpose of the treatment and can be determined by one skilled in the art using known techniques (see, e.g., Lloyd (1999) The Art, Science and Technology of Pharmaceutical Compounding).

[0121] General Description

[0122] "Rearranged during transfection" (also known as "RET") is a receptor tyrosine kinase expressed during development in various tissues, including the peripheral and central nervous systems and kidneys (Arighi, E. et al. (2005), Cytokine Growth Factor Reviews 16:441-67; Borrello, MG et al. (2013) Expert Opinion on Therapeutic Targets, 17(4):403-419). The RET oncogene was identified in 1985 by Takahashi et al., who reported a novel gene rearrangement with transforming activity in NIH / 3T3 cells transfected with human lymphoma DNA (see Takahashi, M. et al., (1985) Cell, 42:581-588). RET was subsequently confirmed as an oncogene that undergoes somatic rearrangement in the DNA of patients with papillary thyroid carcinoma (PTC), and was subsequently denoted as RET / PTC. (Fusco, A. et al. (1987), Nature, 328:170-172; Grieco, M. et al. (1990), Cell, 60:557-63). The RET protein consists of three domains: an extracellular ligand-binding domain, a hydrophobic transmembrane domain, and a cytoplasmic portion with a tyrosine kinase domain split by the insertion of 27 amino acids (see Figure 1). There are two major isoforms of RET produced by alternative splicing. The short RET isoform and the long RET isoform are called RET9 and RET51, respectively, and differ by 9 and 51 unrelated C-terminal amino acids. It is highly conserved in a wide range of species (Carter, MT et al. (2001), Cytogenesis and Cytogenetics, 95: 169-76). Both isoforms show transforming activity by focus formation assays (Rossel, M. et al. (1997), Oncogenes, 14: 265-75).

[0123] Genetic alterations of RET have been shown to be involved in the etiology of thyroid cancer, and more recent data suggest that RET is also involved in lung adenocarcinoma (Viglietto, G. et al. (1995), Oncogene, 11: 1207-10; Fischer, AH et al. (1998), Am J Pathol. 153: 1443-50). Other studies suggest that RET may be involved in other tumors, including breast tumors, pancreatic tumors, leukemias, and melanomas (Ballerini, P. et al. (2012), Leukemia, 26: 2384-9; Sawai, H. et al. (2005), 65(24): 11536-44; Narita, N. et al. (2009), Oncogene, 28: 3058-68).

[0124] Vandetanib (ZD6474, AstraZeneca) is an orally available aminoquinazoline compound that was initially developed as a VEGFR2 inhibitor, but was subsequently found to be active against RET, VEGFR3, EGFR, and PDGFR. Vandetanib is currently approved by the FDA and EMA for advanced and metastatic medullary thyroid carcinoma (MTC) (Wells, SA et al., (2012), Journal of Clinical Oncology (J. Clin. Oncol.) 30: 134-41).

[0125] Sorafenib (BAY43-9006, Bayer Pharmaceuticals) is a bisarylurea compound that was initially developed to target the serine / threonine kinase BRAF, but was subsequently found to be a potent agent for Flt-3, VEGFR1-3, PDGFR, c-kit, and RET (Wilhelm, S. et al., (2006), Nat Rev Drug Discov, 5:835-44). Sorafenib is FDA-approved for advanced liver and kidney cancer.

[0126] Sunitinib (SU11248, Sunitinib (Pfizer) is an indole ketone compound that mainly targets VEGFR2, PDGFR, c-kit, FLT3 and RET kinases (Chow, LQ et al., (2007), Journal of Clinical Oncology 25:884-96). Sunitinib is approved by the FDA for patients with GIST resistant to imatinib, as well as for advanced pancreatic neuroendocrine tumors and renal cell carcinoma.

[0127] Cabozantinib (Cometriq, formerly known as XL-184, Exelixis) is a small molecule multikinase inhibitor targeting MET, VEGFR2 and RET. It is currently in clinical trials for a large number of tumor types, including medullary thyroid cancer, prostate cancer, ovarian cancer, non-small cell lung cancer (NSCLC), hepatocellular carcinoma, renal cell carcinoma and breast cancer, as well as melanoma and glioblastoma (Zhang, Y. et al., (2010), Idrugs 13:112-21).

[0128] Another RET-targeting agent in clinical development is motesanib (AMG-706, Amgen), a multi-kinase inhibitor targeting VEGFR1-3, Flt3, Kit, PDGFR, and RET.

[0129] Other RET inhibitors in preclinical development are RPI-1, an indoline compound; PP-1, a pyrazolopyrimidine compound active against RET and Src; and NVP-AST478, a biphenyl-urea compound with potent anti-RET kinase activity in vitro and in vivo (Cuccuru, G. et al. (2004), J Natl Cancer Inst 96: 1006-14).

[0130] However, a problematic aspect of the above-mentioned RET inhibitors is that they are not specific for RET, that is, they appear to act through multiple mechanisms and, therefore, may potentially produce other adverse effects in vivo. For example, some of the inhibitors mentioned above induce adverse events such as hypertension and QTc prolongation. Therefore, the non-selective nature of these agents may limit the therapeutic window. It is necessary to identify agents, such as anti-RET antibodies that selectively bind to RET, which can produce excellent clinical efficacy and more favorable safety characteristics.

[0131] Therefore, there remains a need for effective therapies for RET-driven tumors, and further, there is a need to identify agents that are specific for RET for use in preventing and treating other diseases, disorders or conditions associated with RET expression without producing the adverse side effects associated with the agents described above. Such specificity and efficacy can be achieved by using anti-RET antibodies, such as those described herein.

[0132] In certain embodiments, the antibodies of the invention are obtained from mice immunized with a primary immunogen (e.g., a fully human RET protein), or with a recombinant form of the protein or a fragment thereof, or with a fusion protein containing the extracellular / extracellular domain of human RET (see GenBank Accession No. NP_066124.1 (SEQ ID NO: 310) or GenBank Accession No. NP_065681.1 (SEQ ID NO: 312)), or a recombinantly produced RET fusion protein (see SEQ ID NOs: 305, 306, 307, and 313), followed by immunization with a secondary immunogen (purified human RET protein), or with an immunogenic active fragment of a RET protein (e.g., the extracellular domain of RET).

[0133] The immunogen may be a DNA encoding human RET protein (see GenBank Accession No. NM_020975.4 and SEQ ID NO: 309 for isoform A; or GenBank Accession No. NM_020630.4 and SEQ ID NO: 311 for isoform C) or an active fragment thereof.

[0134] The immunogen may be derived from the extracellular domain of the RET protein, which spans amino acid residues 1-635 of any one of SEQ ID NOs: 305, 307, 310, 312 and 313 (including the signal sequence); derived from amino acid residues 1-636 of SEQ ID NO: 306 (including the signal sequence). The immunogen may be derived from a fragment of any of the above regions of the RET protein.

[0135] The full-length amino acid sequence of RET51 is shown in SEQ ID NO: 310, and is also shown in GenBank Accession No. NP_066124.1. The full-length amino acid sequence of RET9 is shown in SEQ ID NO: 312, and is also shown in GenBank Accession No. NP_065681.1. An exemplary immunogen may be a recombinant construct shown in SEQ ID NO: 307 or 313.

[0136] In certain embodiments, fragments of the above regions can be used to prepare antibodies that specifically bind to RET, or peptides that extend from the N-terminus or C-terminus or both of the regions described herein beyond the specified region by about 5 to about 20 amino acid residues can be used. In certain embodiments, any combination of the above regions or fragments thereof can be used to prepare RET-specific antibodies. In certain embodiments, any one or more of the above RET regions, or fragments thereof, can be used to prepare monospecific, bispecific or multispecific antibodies.

[0137] Antigen-binding fragment of an antibody

[0138] Unless otherwise specifically indicated, as used herein, the term "antibody" should be understood to cover antibody molecules comprising two immunoglobulin heavy chains and two immunoglobulin light chains (i.e., "complete antibody molecules") and antigen-binding fragments thereof. As used herein, the terms "antigen-binding portion" of an antibody, "antigen-binding fragment" of an antibody, etc. include any naturally occurring, enzymatically obtainable, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. As used herein, the term "antigen-binding portion" or "antibody fragment" of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to RET. Antibody fragments may include Fab fragments, F(ab') 2 The antigen-binding fragment of antibody can be derived from, for example, a complete antibody molecule using any suitable standard technique, such as proteolytic digestion or recombinant genetic engineering techniques involving manipulation and expression of DNA encoding antibody variable domains and (optional) constant domains. Such DNA is known and / or can be easily obtained from, for example, commercial sources, DNA libraries (including, for example, phage-antibody libraries), or can be synthesized. DNA can be sequenced and manipulated chemically or by using molecular biology techniques, such as by arranging one or more variable and / or constant domains into a suitable configuration, or introducing codons, producing cysteine ​​residues, modifying, adding or deleting amino acids, etc.

[0139] Non-limiting examples of antigen-binding fragments include: (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv (scFv) molecules; (vi) dAb fragments; and (vii) the smallest recognition unit consisting of amino acid residues that mimic the hypervariable region of an antibody (e.g., an isolated complementary determining region (CDR), such as a CDR3 peptide) or a restricted FR3-CDR3-FR4 peptide. Other engineered molecules, such as domain-specific antibodies, single domain antibodies, domain-deleted antibodies, chimeric antibodies, CDR-grafted antibodies, bifunctional antibodies, trifunctional antibodies, tetrafunctional antibodies, minibodies, nanobodies (e.g., monovalent nanobodies, bivalent nanobodies, etc.), small modular immunopharmaceuticals (SMIPs) and shark variable IgNAR domains are also encompassed within the expression "antigen-binding fragment" as used herein.

[0140] The antigen-binding fragment of an antibody will generally contain at least one variable domain. The variable domain can be of any size or any amino acid composition and generally contains at least one CDR that is adjacent to or in frame with one or more framework sequences. L Domain-related V H In the antigen-binding fragment of the structural domain, V H and V L The domains can be positioned relative to each other in any suitable arrangement. For example, the variable region can be a dimer and contain V H -V H 、V H -V L or V L -V L In addition, the antigen-binding fragment of an antibody may contain a monomer V H or V L Structural domain.

[0141] In certain embodiments, an antigen-binding fragment of an antibody may contain at least one variable domain covalently linked to at least one constant domain. Non-limiting, exemplary configurations of variable and constant domains that may be found within an antigen-binding fragment of an antibody of the invention include: (i) V H -C H 1; (ii) V H -C H 2; (iii) V H -C H 3; (iv) V H -C H 1-C H 2; (v) V H -CH 1-C H 2-C H 3(vi)V H -C H 2-C H 3; (vii) V H -C L ; (viii) V L -C H 1; (ix) V L -C H 2; (x) V L -C H 3; (xi) V L -C H 1-C H 2; (xii) V L -C H 1-C H 2-C H 3; (xiii) V L -C H 2-C H 3; and (xiv) V L -C L . In any configuration of variable domains and constant domains (including any of the exemplary configurations listed above), the variable domains and constant domains may be directly connected to each other or may be connected by a complete or partial hinge region or linker region. The hinge region may be composed of at least 2 (e.g., 5, 10, 15, 20, 40, 60 or more) amino acids, which results in a flexible or semi-flexible connection between adjacent variable domains and / or constant domains in a single polypeptide molecule. In addition, the antigen-binding fragments of the antibodies of the present invention may comprise non-covalent associations with each other and / or with one or more monomeric V H or V L Homodimers or heterodimers (or other multimers) of any of the variable and constant domain configurations listed above in which the domains are non-covalently associated (e.g., via disulfide bonds).

[0142] As with complete antibody molecules, antigen-binding fragments can be monospecific or multispecific (e.g., bispecific). Multispecific antigen-binding fragments of antibodies typically contain at least two different variable domains, each of which is capable of specifically binding to a separate antigen or a different epitope on the same antigen. Any multispecific antibody format (including the exemplary bispecific antibody formats disclosed herein) can be adapted for use in the context of antigen-binding fragments of the antibodies of the present invention using conventional techniques available in the art.

[0143] Preparation of human antibodies

[0144] Methods for producing human antibodies in transgenic mice are known in the art.Any such known methods can be used in the context of the present invention to make human antibodies that specifically bind to RET.

[0145] use Technology (see, e.g., US 6,596,541, Regeneron Pharmaceutical, ) or any other known method for producing monoclonal antibodies, a high affinity chimeric antibody to RET having a human variable region and a mouse constant region is initially isolated. The technology relates to the production of transgenic mice having a genome comprising human heavy and light chain variable regions operably linked to endogenous mouse constant region loci, so that the mice produce antibodies comprising human variable regions and mouse constant regions in response to antigenic stimulation. DNA encoding the heavy and light chain variable regions of antibodies is isolated and operably linked to DNA encoding human heavy and light chain constant regions. The DNA is then expressed in cells capable of expressing fully human antibodies.

[0146] Generally, challenge with relevant antigens Mice, lymphocytes (e.g., B cells) are recovered from the mice expressing the antibodies. Lymphocytes can be fused with myeloma cell lines to prepare immortalized hybridoma cell lines, and such hybridoma cell lines are screened and selected to identify hybridoma cell lines that produce antibodies specific to the relevant antigens. DNA encoding the heavy and light chain variable regions can be isolated and connected to the desired isotype of heavy and light chain constant regions. Such antibody proteins can be produced in cells, such as CHO cells. In addition, DNA encoding antigen-specific chimeric antibodies or light and heavy chain variable domains can be isolated directly from antigen-specific lymphocytes.

[0147] First, a high-affinity chimeric antibody having a human variable region and a mouse constant region is isolated. As described in the experimental section below, antibodies are characterized and selected for desired characteristics, including affinity, selectivity, epitopes, etc. The mouse constant region is replaced with the desired human constant region to produce a fully human antibody of the present invention, such as a wild-type or modified IgG1 or IgG4. Although the selected constant region may vary depending on the specific use, the high-affinity antigen binding and target specificity characteristics are present in the variable region.

[0148] In certain embodiments, the antibodies of the invention have a relative affinity of about 1.0×10 -7 M is about 1.0×10 -12 The affinity (K D). The mouse constant region is replaced with the desired human constant region to generate the fully human antibodies of the present invention. Although the constant region selected can vary depending on the specific use, the high affinity antigen binding and targeting specificity characteristics are present in the variable region.

[0149] Bioequivalence

[0150] The anti-RET antibodies and antibody fragments of the present invention encompass such proteins, which have amino acid sequences that are different from those of the described antibodies but retain the ability to bind to RET proteins. These variant antibodies and antibody fragments contain one or more amino acid additions, deletions or substitutions compared to the parent sequence, but exhibit biological activities that are substantially equivalent to the biological activities of the described antibodies. Similarly, the DNA sequences encoding antibodies of the present invention encompass sequences that contain one or more nucleotide additions, deletions or substitutions compared to the disclosed sequences, but the sequences encode antibodies or antibody fragments that are substantially biologically equivalent to the antibodies or antibody fragments of the present invention.

[0151] If, for example, two antigen binding proteins or antibodies are pharmaceutical equivalents or pharmaceutical substitutes that do not show significant differences in the rate and extent of absorption when administered at the same molar dose under similar experimental conditions (single dose or multiple doses), they are considered bioequivalent. If some antibodies are equivalent in extent of absorption but not in rate of absorption, they are considered equivalents or pharmaceutical substitutes, but because this difference in absorption rate is intentional and reflected in the labeling, it is not necessary to achieve effective in vivo drug concentrations, for example in long-term use, and it is considered to have no medical significance for the specific drug product under study, it may still be considered bioequivalent.

[0152] In one embodiment, two antigen binding proteins are bioequivalent if there are no clinically meaningful differences in their safety, purity, and potency.

[0153] In one embodiment, two antigen binding proteins are bioequivalent if a patient can switch one or more times between the reference product and the biological product without an increased risk of expected adverse effects (including clinically significant changes in immunogenicity, or reduced effectiveness) compared to continued treatment without such a switch.

[0154] In one embodiment, two antigen binding proteins are bioequivalent if they both act under one or more conditions of use by one or more common mechanisms of action (to the extent such mechanisms are known).

[0155] Bioequivalence can be demonstrated by in vivo and / or in vitro methods. Bioequivalence measurements include, for example: (a) in vivo tests in humans or other mammals, where the concentration of the antibody or its metabolites is measured over time in blood, plasma, serum or other biological fluids; (b) in vitro tests that are correlated with and reasonably predictive of human in vivo bioavailability data; (c) in vivo tests in humans or other mammals, where appropriate acute pharmacological effects of the antibody (or its target) are measured over time; and (d) in well-controlled clinical trials, establishing the safety, efficacy or bioavailability or bioequivalence of the antibody.

[0156] Bioequivalent variants of the antibodies of the present invention can be constructed by, for example, making various substitutions to residues or sequences, or by deleting terminal or internal residues or sequences that are not required for biological activity. For example, cysteine ​​residues are not essential for biological activity and can be deleted or replaced with other amino acids to prevent the formation of unnecessary or incorrect intramolecular disulfide bridges during renaturation. In other cases, bioequivalent antibodies can include antibody variants comprising amino acid changes that modify the glycosylation characteristics of the antibody, such as mutations that eliminate or remove glycosylation.

[0157] Anti-RET antibodies containing Fc variants

[0158] According to certain embodiments of the present invention, there is provided an anti-RET antibody comprising an Fc domain, wherein the Fc domain comprises one or more mutations, wherein the mutations enhance or attenuate the binding of the antibody to the FcRn receptor, for example, at an acidic pH compared to a neutral pH. For example, the present invention comprises an anti-RET antibody comprising a C in the Fc domain. H Zone 2 or C HMutations in the 3 regions, wherein one or more mutations increase the affinity of the Fc domain for FcRn in an acidic environment (e.g., in an endosome with a pH range of about 5.5 to about 6.0). When administered to an animal, these mutations can increase the serum half-life of the antibody. Non-limiting examples of these Fc modifications include, for example, position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L / Y / F / W or T), 254 (e.g., S or T) and 256 (e.g., S / R / Q / E / D or T); or position 428 and / or 433 (e.g., H / L / R / S / P / Q or K) and / or 434 (e.g., H / F or Y); or position 250 and / or 428; or position 307 or 308 (e.g., 308F, V308F) and 434. In one embodiment, modifications include 428L (e.g., M428L) and 434S (e.g., N434S) modifications; 428L, 259I (e.g., V259I) and 308F (e.g., V308F) modifications; 433K (e.g., H433K) and 434 (e.g., 434Y) modifications; 252, 254 and 256 (e.g., 252Y, 254T and 256E) modifications; 250Q and 428L modifications (e.g., T250Q and M428L); and 307 and / or 308 modifications (e.g., 308F or 308P).

[0159] For example, the present invention includes an anti-RET antibody comprising an Fc domain comprising one or more pairs or groups of mutations selected from the group consisting of 250Q and 248L (e.g., T250Q and M248L); 252Y, 254T and 256E (e.g., M252Y, S254T and T256E); 428L and 434S (e.g., M428L and N434S); and 433K and 434F (e.g., H433K and N434F). All possible combinations of the aforementioned Fc domain mutations and other mutations within the antibody variable domain disclosed herein are within the scope of the present invention.

[0160] Biocharacterization of antibodies

[0161] In general, the antibodies of the invention may act by binding to RET, and when so acting, block or prevent RET activation and / or signaling. The antibodies of the invention may also act by binding to RET, and when so acting, interfere with or prevent the interaction or binding of RET with one or more GDNF family members, which are complexed with their corresponding co-receptors, such as GDNF / GFRα1, neurturin / GFRα2, artemin / GFRα3, or persephin / GFRα4. Based on the fact that the tumorigenic potential of RET has been established in humans, antagonistic antibodies that specifically bind to RET may prove to have a beneficial effect in inhibiting tumor cell growth in patients with cancerous conditions.

[0162] In certain embodiments, the antibodies of the invention may act by blocking or inhibiting RET activity by binding to any region or fragment of the full-length protein, the amino acid sequence of which is shown in SEQ ID NO: 310 (RET51), also as shown in GenBank Accession No. NP_066124.1, and in SEQ ID NO: 312 (RET9), also as shown in GenBank Accession No. NP_065681.1. The antibodies may also bind to any region found in SEQ ID NO: 310 or 312, or to a fragment found in SEQ ID NO: 310 or 312.

[0163] In one embodiment, the present invention provides a fully human monoclonal antibody or an antigen-binding fragment thereof that binds to a RET protein, wherein the antibody or fragment thereof exhibits one or more of the following characteristics:

[0164] (a) is a fully human antibody;

[0165] (b) As measured by surface plasmon resonance, it exhibits a range between about 1.0×10 -7 M is about 1.0×10 -12 M of K D ;

[0166] (c) inhibiting or blocking the binding or interaction of RET with one or more GDNF family member ligands (GDNF, neurturin, artemin, and persephin) in complex with their corresponding co-receptors (GFRα1, GFRα2, GFRα3, and GFRα4, respectively);

[0167] (d) inhibiting RET signaling mediated by one or more GDNF family member ligands selected from the group consisting of GDNF, neurturin, artemin and persephin;

[0168] (e) enhancing RET internalization / degradation after said antibody binds to said RET receptor;

[0169] (f) comprises a heavy chain variable region (HCVR) having an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, and 290; or

[0170] (g) comprises a light chain variable region (LCVR) having an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282 and 298.

[0171] Certain anti-RET antibodies of the present invention are capable of binding to RET proteins and inhibiting activation and / or signaling associated with RET. When doing so, the antibodies can be used to inhibit tumor growth that depends on the activation of RET signaling for growth. These antagonistic anti-RET antibodies can be used alone to treat cancerous conditions, or can be used as an adjuvant therapy with any other anticancer agent (e.g., a chemotherapeutic small molecule) or radiotherapy or bone marrow repair agents.

[0172] In certain embodiments, anti-RET antibodies may be able to inhibit multiple signaling pathways, including the RAS / RAF pathway, which leads to the activation of mitogen activated protein kinases (MAPKs) ERK1 and ERK2 (Trupp, M. et al., (1999), Journal of Biol. Chem. 274:20885-94; Santoro, M. et al., (1994), Mol. Cell Biol. 14:663-75; van Weering, DHJ et al. (1995), 11:2207-14; Worby, CA et al., (1996) Journal of Biol. Chem. 271:23619-22), phosphatidylinositol 3-kinase (PI3K), leading to the activation of serine / threonine kinase Akt (Trupp, M. et al., (1999), Journal of Biol. Chem. 274:20885-94; van Weering, DHJ et al., (1995), 11:2207-14; Worby, CA et al., (1996) Journal of Biol. Chem. 271:23619-22), Weering, DHJ, (1997), Journal of Biological Chemistry 272:249-54; Segouffin-Cariou, C. et al., (2000), 275:3568-76; Maeda, K. et al., (2004), 323:345-54).

[0173] In Example 4 and Example 5, non-limiting, exemplary in vitro assays for measuring the ability of the anti-RET antibodies of the present invention to block the binding of RET to the GFRα1 / GDNF co-complex, and in vitro assays for measuring the effects of antibodies on RET signaling, activation or internalization are described, respectively. In Example 3, the binding affinity and kinetic constants of human anti-RET antibodies were determined by surface plasmon resonance, which was measured on a Biacore 4000 or T200 instrument. In Example 4, a competitive sandwich ELISA assay was used to test the ability of antibodies to block the binding of RET to the GFRα1 / GDNF co-complex. Example 5 demonstrates the ability of the antibodies of the present invention to inhibit ligand-dependent RET signaling in a serum response factor (SRE) luciferase reporter assay. More specifically, the data presented in Example 5 show that the anti-RET antibodies of the present invention exhibit a range of inhibitory activity on RET signaling in the presence of glial family ligands, GDNF and artemin.

[0174] Epitope mapping and related technologies

[0175] Various techniques known to those of ordinary skill in the art can be used to determine whether an antibody "interacts with one or more amino acids" within a polypeptide or protein. Exemplary techniques include, for example, conventional cross-blocking analysis, such as can be performed "anti Antibodies》, Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harb., NY). Other methods include alanine scanning mutation analysis, peptide blot analysis (Reineke (2004) Methods in Molecular Biology 248: 443-63), peptide cleavage analysis crystallization studies and NMR analysis. In addition, methods such as epitope excision, epitope extraction and chemical modification of antigens can be used (Tomer (2000), Protein Science 9: 487-496). Another method that can be used to identify amino acids in polypeptides that interact with antibodies is hydrogen / deuterium exchange detected by mass spectrometry. In general, hydrogen / deuterium exchange methods involve deuterium labeling of the relevant protein, followed by binding of the antibody to the deuterium-labeled protein. Next, the protein / antibody complex is transferred to water, and the exchangeable protons in the amino acids protected by the antibody complex undergo deuterium-hydrogen reverse exchange, and the exchange rate is lower than the exchangeable protons in the amino acids in the non-interface portion. Thus, amino acids that form part of the protein / antibody interface can retain deuterium and therefore exhibit a relatively high mass compared to amino acids not included in the interface. After antibody dissociation, the target protein is subjected to protease cleavage and mass spectrometry analysis to reveal deuterium-labeled residues corresponding to specific amino acids that interact with the antibody. See, for example, Ehring (1999) Analytical Biochemistry 267 (2): 252-259; Engen and Smith (2001) Anal. Chem. 73: 256A-265A.

[0176] The term "epitope" refers to a site on an antigen to which B cells and / or T cells respond. B cell epitopes can be formed by continuous amino acids, or by non-continuous amino acids juxtaposed by tertiary folding of proteins. Epitopes formed by continuous amino acids are usually retained when exposed to denaturing solvents, while epitopes formed by tertiary folding are usually lost when treated with denaturing solvents. An epitope usually includes at least 3 amino acids, more usually at least 5 or 8-10 amino acids, in a unique spatial conformation.

[0177] Modification-Assisted Profiling (MAP) (also known as Antigen Structure-based Antibody Profiling (ASAP)) is a method for classifying a large number of monoclonal antibodies (mAbs) against the same antigen according to the similarity of the binding properties of each antibody to a chemically or enzymatically modified antigen surface (US 2004 / 0101920, specifically incorporated herein by reference in its entirety). Each class can reflect a unique epitope that is significantly different from or partially overlaps with the epitope represented by another class. This technology allows rapid filtering of genetically identical antibodies, thereby allowing characterization to be focused on genetically different antibodies. When applied to hybridoma screening, MAP can help identify rare hybridoma clones that produce mAbs with desired characteristics. MAP can be used to classify the antibodies of the present invention into groups of antibodies that bind to different epitopes.

[0178] The present invention includes anti-RET antibodies that bind to the same epitope as any of the specific exemplary antibodies described herein in Table 1. Likewise, the present invention also includes anti-RET antibodies that compete with any of the specific exemplary antibodies described herein in Table 1 for binding to RET or a fragment thereof.

[0179] By using conventional methods known in the art, one can easily determine whether an antibody binds to the same epitope as a reference anti-RET antibody, or whether it competes with it for binding. For example, in order to determine whether a test antibody binds to the same epitope as a reference RET antibody of the present invention, the reference antibody is bound to a RET protein or peptide under saturation conditions. Next, the ability of the test antibody to bind to the RET molecule is assessed. After saturation binding of the reference anti-RET antibody, if the test antibody is able to bind to RET, it can be inferred that the test antibody binds to an epitope different from the reference antibody. On the other hand, after saturation binding of the reference anti-RET antibody, if the test antibody cannot bind to the RET molecule, the test antibody may bind to the same epitope as the epitope bound by the reference anti-RET antibody of the present invention.

[0180] To determine whether an antibody competes for binding with a reference anti-RET antibody, the binding method described above is performed in two directions: in the first direction, the test antibody is allowed to bind to the RET molecule under saturating conditions, and the binding of the test antibody to the RET molecule is subsequently assessed. In the second direction, the test antibody is allowed to bind to the RET molecule under saturating conditions, and the binding of the reference antibody to the RET molecule is subsequently assessed. If only the first (saturated) antibody is able to bind to the RET molecule in both directions, it is inferred that the test antibody and the reference antibody compete for binding to RET. As will be appreciated by those of ordinary skill in the art, an antibody that competes for binding with a reference antibody may not necessarily bind to the same epitope as the reference antibody, but may sterically block the binding of the reference antibody by binding to overlapping or adjacent epitopes.

[0181] If two antibodies each competitively inhibit (block) the binding of another antibody to an antigen, then the two antibodies are bound to the same or overlapping epitopes. That is, 1 times, 5 times, 10 times, 20 times or 100 times of an excess of one antibody inhibits the binding of another antibody by at least 50%, but preferably 75%, 90% or even 99%, as measured in a competitive binding assay (see, e.g., Junghans et al., Cancer Res. 1990 50: 1495-1502). In addition, if substantially all amino acid mutations that reduce or eliminate the binding of an antibody in an antigen are also reduced or eliminated in conjunction with another antibody, then the two antibodies have the same epitope. If some amino acid mutations that reduce or eliminate the binding of an antibody reduce or eliminate the binding of another antibody, then the two antibodies have overlapping epitopes.

[0182] Additional routine experiments (e.g., peptide mutations and binding analysis) may then be performed to confirm whether the observed lack of binding of the test antibody is actually due to binding to the same epitope as the reference antibody, or whether steric blocking (or another phenomenon) causes the observed lack of binding. This type of experiment can be performed using ELISA, RIA, surface plasmon resonance, flow cytometry, or any other quantitative or qualitative antibody binding assay available in the art.

[0183] Immunoconjugates

[0184] The present invention encompasses human RET monoclonal antibodies coupled to a therapeutic moiety ("immunoconjugate"), such as an agent capable of inhibiting tumor cell proliferation or alleviating at least one symptom associated with a RET-related condition (e.g., a cancerous condition). This agent may be a second different antibody or anti-tumor chemotherapeutic agent for RET, or may be a radionuclide used to kill tumor cells when targeting tumor cells expressing RET. The type of therapeutic moiety that can be coupled to the anti-RET antibody will take into account the condition to be treated and the desired therapeutic effect to be achieved. In addition, if the desired therapeutic effect is to treat sequelae or symptoms associated with certain tissues expressing RET or any other condition caused by RET expression, such as but not limited to cancer, it may be advantageous to combine an agent suitable for treating the sequelae or symptoms of the condition or alleviating any side effects of the antibodies of the present invention. Examples of suitable agents for forming immunoconjugates are known in the art, see, for example, WO 05 / 103081.

[0185] Multispecific Antibodies

[0186] The antibodies of the present invention may be monospecific, bispecific or multispecific. A multispecific antibody may be specific for different epitopes of a target polypeptide, or may contain an antigen binding domain that is specific for more than one target polypeptide. See, for example, Tutt et al., 1991, Journal of Immunology 147:60-69; Kufer et al., 2004, Trends Biotechnol. 22:238-244. The antibodies of the present invention may be connected to another functional molecule, such as another peptide or protein, or co-expressed with it. For example, an antibody or a fragment thereof may be functionally connected (e.g., by chemical coupling, genetic fusion, non-covalent association or otherwise) to one or more other molecular entities (e.g., another antibody or antibody fragment) to produce a bispecific or multispecific antibody with a second binding specificity.

[0187] An exemplary bispecific antibody format that can be used in the context of the present invention involves the use of a first immunoglobulin (Ig) C H3 domain and second Ig C H3 domains, wherein the first and second Ig C H3 The domains differ from each other by at least one amino acid, and wherein the at least one amino acid difference reduces binding of the bispecific antibody to protein A compared to a bispecific antibody lacking the amino acid difference. H3 The domain binds protein A and the second Ig C H3 The domain contains a mutation that reduces or eliminates Protein A binding, such as the H95R modification (by IMGT exon numbering; H435R by EU numbering). H3It may further comprise a Y96F modification (by IMGT; Y436F by EU). H3 Other modifications found within include: D16E, L18M, N44S, K52N, V57M and V82I in the case of IgG1 antibodies (by IMGT; D356E, L358M, N384S, K392N, V397M and V422I by EU); N44S, K52N and V82I in the case of IgG2 antibodies (IMGT; N384S, K392N and V422I by EU); and Q15R, N44S, K52N, V57M, R69K, E79Q and V82I in the case of IgG4 antibodies (by IMGT; Q355R, N384S, K392N, V397M, R409K, E419Q and V422I by EU). Variations of the bispecific antibody formats described above are encompassed within the scope of the invention.

[0188] Therapeutic administration and formulations

[0189] The present invention provides therapeutic compositions comprising anti-RET antibodies or antigen-binding fragments thereof of the present invention. The therapeutic compositions according to the present invention will be administered with suitable carriers, excipients and other agents, which are incorporated into the formulations to provide improved transfer, delivery, tolerance, etc. Numerous suitable formulations can be found in the formulary known to all pharmaceutical chemists: Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA. These formulations include, for example, powders, pastes, ointments, gels, waxes, oils, lipids, containing vesicles (e.g., LIPOFECTIN TM ), lipids (cationic or anionic), DN conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsion carbowax (polyethylene glycol of various molecular weights), semisolid gels, and semisolid mixtures containing carbowax. See also Powell et al., Compendium of excipients for parenteral formulations PDA (1998) J PharmSci Technol 52: 238-311.

[0190] The dosage of each of the antibodies of the present invention may vary according to the age and stature of the subject to be administered, the target disease, the condition, the route of administration, etc. When the antibodies of the present invention are used to treat a patient's RET-related disease or condition, or to treat one or more symptoms associated with a condition that relies on RET activation or signaling, such as certain tumors expressing RET in patients, or to reduce the severity of the disease, it is generally advantageous to administer each of the antibodies of the present invention intravenously or subcutaneously at a single dose of about 0.01 to about 30 mg / kg body weight, more preferably about 0.1 to about 20 mg / kg body weight, or about 0.1 to about 15 mg / kg body weight, or about 0.02 to about 7 mg / kg body weight, about 0.03 to about 5 mg / kg body weight, or about 0.05 to about 3 mg / kg body weight, or about 1 mg / kg body weight, or about 3.0 mg / kg body weight, or about 10 mg / kg body weight, or about 20 mg / kg body weight. Multiple doses may be administered as needed. Depending on the severity of the condition, the frequency and duration of treatment may be adjusted. In certain embodiments, the antibodies or antigen-binding fragments thereof of the invention may be administered in an initial dose of at least about 0.1 mg to about 800 mg, about 1 to about 600 mg, about 5 to about 300 mg, or about 10 to about 150 mg, about 100 mg, or about 50 mg. In certain embodiments, the initial dose may be followed by a second or more subsequent doses of the antibody or antigen-binding fragment thereof in an amount approximately equal to or less than the initial dose, wherein the subsequent doses are separated by at least 1 to 3 days; at least one week; at least 2 weeks; at least 3 weeks; at least 4 weeks; at least 5 weeks; at least 6 weeks; at least 7 weeks; at least 8 weeks; at least 9 weeks; at least 10 weeks; at least 12 weeks; or at least 14 weeks.

[0191] Various delivery systems are known and can be used to administer the pharmaceutical composition of the present invention, such as encapsulation in liposomes, micron particles, microcapsules, recombinant cells capable of expressing mutant viruses, receptor-mediated endocytosis (see, for example, Wu et al. (1987) Journal of Biological Chemistry 262: 4429-4432). Introduction methods include, but are not limited to, intradermal, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The composition can be administered by any suitable route, such as by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, nasal mucosa, rectal and intestinal mucosa, etc.), and can be administered together with other bioactive agents. It can be administered systemically or topically. It can be delivered in the form of an atomized formulation (see US2011 / 0311515 and US2012 / 0128669). Delivery of agents suitable for treating respiratory diseases by inhalation is becoming more and more widely accepted (see AJ Bitonti and JA Dumont, (2006), Adv. Drug Deliv. Rev, 58: 1106-1118). In addition to being effective in treating local lung diseases, this delivery mechanism may also be applicable to systemic delivery of antibodies (see Maillet et al. (2008), Pharmaceutical Research, 25(6), 2008).

[0192] The pharmaceutical compositions can also be delivered in vesicles, particularly liposomes (see, e.g., Langer (1990) Science 249: 1527-1533).

[0193] In some cases, the pharmaceutical composition can be delivered in a controlled release system. In one embodiment, a pump can be used. In another embodiment, a polymeric material can be used. In yet another embodiment, a controlled release system can be placed near the target of the composition, so only a portion of the systemic dose is required.

[0194] Injectable preparations can include dosage forms for intravenous, subcutaneous, intradermal and intramuscular injections, drip infusions, etc. These injectable preparations can be prepared by well-known methods. For example, the above-described antibody or its salt can be dissolved, suspended or emulsified in a conventional sterile aqueous medium or oily medium for injection to prepare an injectable preparation. As an aqueous medium for injection, there are, for example, physiological saline, isotonic solutions containing glucose and other adjuvants, etc., which can be used in combination with suitable solubilizers, such as alcohol (e.g., ethanol), polyols (e.g., propylene glycol, polyethylene glycol), nonionic surfactants [e.g., polysorbate 80, HCO-50 (adduct of polyethylene oxide (50 mol) and hydrogenated castor oil)], etc. As an oily medium, sesame oil, soybean oil, etc., are used, which can be used in combination with solubilizers, such as benzyl benzoate, benzyl alcohol, etc. The injection thus prepared is preferably filled in a suitable ampoule.

[0195] The pharmaceutical composition of the present invention can be delivered subcutaneously or intravenously using a standard needle and syringe. In addition, with respect to subcutaneous delivery, pen delivery devices are readily applicable to delivering the pharmaceutical composition of the present invention. Such pen delivery devices can be reusable or disposable. Reusable pen delivery devices typically utilize a replaceable cartridge containing the pharmaceutical composition. Once the entire pharmaceutical composition in the cartridge has been administered and the cartridge is empty, the empty cartridge can be easily discarded and replaced with a new cartridge containing the pharmaceutical composition. The pen delivery device can then be reused. In a disposable pen delivery device, there is no replaceable cartridge. In fact, the disposable pen delivery device is preloaded with the pharmaceutical composition held in a reservoir within the device. Once the pharmaceutical composition in the reservoir is emptied, the entire device is discarded.

[0196] A variety of reusable pen delivery devices and auto-injector delivery devices are used for subcutaneous delivery of the pharmaceutical compositions of the present invention. Examples include, but are not limited to, AUTOPEN TM (Owen Mumford, Inc., Woodstock, UK), DISETRONIC TM pen (Disetronic Medical Systems, Burghdorf, Switzerland), HUMALOG MIX 75 / 25 TM Pen, HUMALOG TM Pen, HUMALIN 70 / 30 TM PEN (Eli Lilly and Co., Indianapolis, IN), NOVOPEN TMI, II and III (NovoNordisk, Copenhagen, Denmark), NOVOPEN JUNIOR TM (Novo Nordisk, Copenhagen, Denmark), BD TM Pen (Becton Dickinson, Franklin Lakes, NJ), OPTIPEN TM 、OPTIPEN PRO TM 、OPTIPEN STARLET TM and OPTICLIK TM (sanofi-aventis, Frankfurt, Germany), etc. Examples of disposable pen delivery devices for use in subcutaneous delivery of the pharmaceutical compositions of the present invention include, but are not limited to, SOLOSTAR TM Pen (sanofi-aventis), FLEXPEN TM (Novo Nordisk) and KWIKPEN TM (Eli Lilly), SURECLICK TM Autoinjector (Amgen, Thousand Oaks, CA), PENLET TM (Haselmeier, Stuttgart, Germany), EPIPEN (Dey, LP) and HUMIRA TM pen (Abbott Labs, Abbott Park IL), etc., to name a few.

[0197] Advantageously, the pharmaceutical composition for oral or parenteral use described above is prepared into a dosage form suitable for a unit dose that meets the dosage of the active ingredient. Such unit dose dosage forms include, for example, tablets, pills, capsules, injections (ampoules), suppositories, etc. The amount of the aforementioned antibody contained is generally about 5 to about 500 mg per dosage form in a unit dose; especially in the form of an injection, preferably about 5 to about 100 mg and about 10 to about 250 mg for other dosage forms.

[0198] Administration regimen

[0199] According to certain embodiments of the present invention, multiple doses of antibodies against RET may be administered to a subject within a defined time course. The method according to this aspect of the present invention includes sequentially administering multiple doses of antibodies against RET to a subject. As used herein, "sequential administration" means administering each dose of antibodies against RET to a subject at different time points, such as on different days at predetermined intervals (e.g., hours, days, weeks, or months). The present invention includes the following method, which includes sequentially administering a single initial dose of an antibody against RET to a patient, followed by one or more second doses of an antibody against RET, and optionally subsequently administering one or more third doses of an antibody against RET.

[0200] The terms "initial dose", "second dose" and "third dose" refer to the time sequence of administering antibodies against RET. Therefore, the "initial dose" is the dose administered at the beginning of the treatment regimen (also called the "baseline dose"); the "second dose" is the dose administered after the initial dose; the "third dose" is the dose administered after the second dose. The initial dose, the second dose, and the third dose may all contain the same amount of antibodies against RET, but may generally differ from each other in terms of the frequency of administration. However, in certain embodiments, the amount of antibodies against RET contained in the initial dose, the second dose, and / or the third dose differs from each other during the course of treatment (e.g., up or down, as appropriate). In certain embodiments, two or more (e.g., 2, 3, 4, or 5) doses are administered as "loading doses" at the beginning of the treatment regimen, followed by subsequent doses (e.g., "maintenance doses") at a lower frequency.

[0201] In an exemplary embodiment of the invention, each second and / or third dose is administered 1 to 26 (e.g., 1, 1 1 / 2, 2, 2 1 / 2, 3, 3 1 / 2, 4, 4 1 / 2, 5, 5 1 / 2, 6, 6 1 / 2, 7, 7 1 / 2, 8, 8 1 / 2, 9, 9 1 / 2, 10, 10 1 / 2, 11, 11 1 / 2, 12, 12 1 / 2, 13, 13 1 / 2, 14, 14 1 / 2, 15, 15 1 / 2, 16, 16 1 / 2, 17, 17 1 / 2, 18, 18 1 / 2, 19, 19 1 / 2, 20, 20 1 / 2, 21, 21 1 / 2, 22, 22 1 / 2, 23, 23 1 / 2, 24, 24 1 / 2, 25, 25 1 / 2, 26, 26 1 / 2 or more) weeks after the previous dose. As used herein, the phrase "previous dose" means the dose of an antibody against RET administered to a patient prior to the sequential administration of the next dose in a series of multiple administrations with no intervening doses.

[0202] The method according to this aspect of the invention may include administering any number of second doses and / or third doses of an antibody against RET to a patient. For example, in certain embodiments, only a single second dose is administered to a patient. In other embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8 or more) second doses are administered to a patient. Similarly, in certain embodiments, only a single third dose is administered to a patient. In other embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8 or more) third doses are administered to a patient.

[0203] In embodiments involving multiple second doses, each second dose can be administered at the same frequency as other second doses. For example, each second dose can be administered to the patient 1 to 2 weeks after the previous dose. Similarly, in embodiments involving multiple tertiary doses, each tertiary dose can be administered at the same frequency as other tertiary doses. For example, each tertiary dose can be administered to the patient 2 to 4 weeks after the previous dose. In addition, the frequency of administering the second dose and / or the tertiary dose to the patient can change during the course of the treatment regimen. During the course of treatment, the physician can adjust the frequency of administration according to the needs of individual patients after clinical examination.

[0204] Therapeutic uses of antibodies

[0205] Due to its binding / interaction with RET proteins expressed on certain cells and tissues, the antibodies of the present invention are suitable for preventing the interaction of RET proteins with one or more ligand / co-receptor complexes, such as GDNF / GFRα1, artemin / GFRα3, neurturin / GFRα2 or persephin / GFRα4. In view of the ability of the anti-RET antibodies of the present invention to prevent or inhibit such interactions, the antagonist antibodies of the present invention may prove to be suitable for inhibiting tumor cell growth when tumor cells rely on RET signaling for growth, or it may prove to be suitable for inhibiting pain associated with cancerous conditions and pain associated with other diseases or disorders in which RET activation or signaling plays a role. When administered alone or in combination with another anti-tumor agent or treatment regimen or with one or more agents for further improving pain associated with the condition, the antibodies of the present invention can be used to slow the growth and / or metastasis of tumors in subjects with tumors expressing RET, or for treating pain associated with cancerous conditions. In addition, the antibodies of the present invention may be suitable for improving at least one symptom associated with a cancerous condition.

[0206] It is contemplated that the antibodies of the present invention may be used alone or in combination with a second or third agent for the treatment of a RET-related disease or condition, or for the alleviation of at least one symptom or complication associated with a RET-related disease or condition. "RET-related disease or condition" is any disease or condition in which RET is known to be expressed in cells or tissues affected by the disease or condition, and is advantageously responsive to treatment with a small molecule therapeutic agent known to inhibit RET activation and / or signaling, or is advantageously responsive to treatment with an anti-RET antibody of the present invention. The second or third agent may be delivered simultaneously with the antibody of the present invention, or it may be administered separately before or after the antibody of the present invention. The second or third agent may be a small organic molecule, or a biological agent, such as a protein or polypeptide. The second or third agent may be synthetic or naturally derived. The second or third agent can be an anti-tumor agent, such as a chemotherapeutic drug or radiation therapy; or a bone marrow repair agent; or other agent that reduces fever or pain; another second but different antibody that specifically binds to RET; an agent (e.g., an antibody) that binds to a RET ligand (e.g., GDNF, neurturin, artemin, or persephin), or to a RET co-receptor (e.g., GFRα1, GFRα2, GFRα3, or GFRα4), or an siRNA specific for the RET molecule.

[0207] In yet another embodiment of the invention, the antibodies of the invention are used to prepare a pharmaceutical composition for treating a patient with a RET-related disease or condition. In yet another embodiment of the invention, the antibodies of the invention are used to prepare a pharmaceutical composition for reducing tumor cell proliferation or reducing the tumor burden of a patient with a tumor that depends on RET signaling for growth. In another embodiment of the invention, the antibodies of the invention are used as adjuvant therapy together with any other agent suitable for treating a RET-related disease or condition, including chemotherapeutic agents, radiation therapy, bone marrow repair agents, a second RET antibody, or any other antibody specific for a RET antigen, or an antibody specific for GDNF or GFRα1, or any other palliative therapy known to those skilled in the art.

[0208] The antibodies of the present invention are suitable for treating, preventing and / or ameliorating any disease, disorder or condition associated with RET activity, or for ameliorating at least one symptom associated with a disease, disorder or condition, or for alleviating pain associated with such a disease, disorder or condition. Exemplary conditions, diseases and / or conditions that can be treated with the anti-RET antibodies of the present invention, and / or pain associated with such conditions, diseases or conditions include acute or chronic pain, including but not limited to neuropathic pain, inflammatory pain, arthritis, migraine, cluster headache, trigeminal neuralgia, herpetic neuralgia, general neuralgia, irritable bowel syndrome, inflammatory bowel syndrome, visceral pain including abdominal pain, osteoarthritis pain, gout, post-herpetic neuralgia, diabetic neuropathy, radiculopathy, sciatica, back pain, head or neck pain, breakthrough pain, postoperative pain, bone pain, cancer pain. Other conditions that can be treated by the antibodies and treatment methods of the invention include thyroid cancer, familial medullary thyroid carcinoma (FMTC) syndrome, sporadic medullary carcinoma (MTC), multiple endocrine neoplasia syndromes MEN2A and MEN2B, prostate cancer, breast cancer, cervical cancer, colon cancer or bladder cancer and pain associated with these conditions. The cancer that can be treated by the antibodies of the invention can be a solid tumor or it can be a blood-borne tumor, such as a leukemia.The antibodies or antigen-binding fragments thereof of the present invention can also be used to treat the following conditions: non-malignant acute, chronic or fracture pain; rheumatoid arthritis, spinal cord stenosis; neuropathic low back pain; myofascial pain syndrome; fibromyalgia; temporomandibular joint pain; pancreatic pain; chronic headache; tension headache; HIV-related neuropathy; Charcot-Marie Tooth neuropathy; hereditary sensory neuropathy; peripheral nerve injury; painful neuroma; ectopic proximal and distal discharges; radiculopathy; chemotherapy-induced neuropathic pain; radiation therapy-induced neuropathic pain; post-mastectomy pain; central pain; spinal cord injury pain; post-stroke pain; thalamic pain; complex regional pain syndrome; phantom pain; refractory pain; musculoskeletal pain; joint pain; acute gout pain; mechanical low back pain; neck pain; tendinitis; injury / exercise pain pain; pyelonephritis; appendicitis; cholecystitis; intestinal obstruction; hernia; chest pain, including cardiac pain; pelvic pain; renal colic; acute obstetric pain, including labor pain; cesarean section pain; burn and trauma pain; endometriosis; herpes zoster pain; sickle cell anemia; acute pancreatitis; orofacial pain, including sinusitis pain, toothache; multiple sclerosis pain; leprosy pain; Behcet's disease pain; obesity pain; phlebitis pain; Guillain-Barre pain; painful legs and moving toes; Haglund syndrome; Fabry's disease pain; bladder and genitourinary disorders; overactive bladder; painful bladder syndrome; interstitial cystitis; or prostatitis.

[0209] Combination therapy

[0210] As described above, according to certain embodiments, the methods of the present invention include administering to a subject a combination of one or more additional therapeutic agents and an antibody against RET. As used herein, the expression "in combination with" means that the additional therapeutic agent is administered before, after, or simultaneously with the pharmaceutical composition comprising the anti-RET antibody. The term "in combination with" also includes the continuous or simultaneous administration of an anti-RET antibody and a second therapeutic agent.

[0211] For example, when administered "before" a pharmaceutical composition comprising an anti-RET antibody, the additional therapeutic agent may be administered about 72 hours, about 60 hours, about 48 hours, about 36 hours, about 24 hours, about 12 hours, about 10 hours, about 8 hours, about 6 hours, about 4 hours, about 2 hours, about 1 hour, about 30 minutes, about 15 minutes, or about 10 minutes before administration of the pharmaceutical composition comprising an anti-RET antibody. When administered "after" a pharmaceutical composition comprising an anti-RET antibody, the additional therapeutic agent may be administered about 10 minutes, about 15 minutes, about 30 minutes, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours after administration of the pharmaceutical composition comprising an anti-RET antibody. Administration “concurrently with” a pharmaceutical composition comprising an anti-RET antibody means that the additional therapeutic agent is administered to the subject in a separate dosage form within less than 5 minutes (before, after, or simultaneously with) administration of the pharmaceutical composition comprising the anti-RET antibody, or is administered to the subject in a single combined dose formulation comprising both the additional therapeutic agent and the anti-RET antibody.

[0212] Combination therapy may include an anti-RET antibody of the invention and any additional therapeutic agent that may be advantageously combined with an antibody of the invention or with a biologically active fragment of an antibody of the invention. For example, a second or third therapeutic agent may be used to help reduce the patient's tumor burden, such as a chemotherapeutic agent or a radiotherapy suitable for inhibiting tumor cell proliferation in a subject. In addition, the antibody may be used as an adjuvant therapy after surgical removal of the tumor and may be used alone, or in combination with a chemotherapeutic agent, radiotherapy, or bone marrow repair agent. As mentioned above, the antibody may also be used in combination with other therapies, including a second antibody specific for RET or an antibody specific for a RET ligand, or an antibody or fusion molecule that binds to GFRα1 (see SEQ ID NO: 308).

[0213] Diagnostic Uses of Antibodies

[0214] The anti-RET antibodies of the invention can also be used to detect and / or measure RET in a sample, for example for diagnostic purposes. It is envisioned that a disease or condition believed to be associated with RET can be confirmed by measuring the presence of RET in, for example, a biopsy sample from a tumor (i.e., tumor cells) that grows dependent on RET signaling. An exemplary diagnostic assay for RET may include, for example, contacting a sample obtained from a patient with an anti-RET antibody of the invention, wherein the anti-RET antibody is labeled with a detectable marker or reporter molecule or used as a capture ligand to selectively separate cells expressing RET protein from a patient sample. In addition, an unlabeled anti-RET antibody can be combined with a secondary antibody that is itself detectably labeled for diagnostic applications. The detectable marker or reporter molecule may be a radioactive isotope, such as 3 H.14 C. 32 P. 35 S or 125 I; a fluorescent or chemiluminescent moiety, such as fluorescein isothiocyanate or rhodamine; or an enzyme, such as alkaline phosphatase, β-galactosidase, horseradish peroxidase, or luciferase. Specific exemplary assays that can be used to detect or measure RET containing F protein in a sample include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).

[0215] Samples that can be used in diagnostic assays according to the present invention include any tissue or fluid sample obtained from a patient under normal or pathological conditions containing a detectable amount of RET protein or fragments thereof. In general, the level of RET in a specific sample obtained from a healthy patient (e.g., a patient who does not suffer from a disease or condition associated with the presence of RET) is measured to preliminarily establish a baseline or standard level of RET protein. The baseline level of RET can then be compared to the level of RET measured in a sample obtained from an individual suspected of having a disease or condition associated with RET or symptoms associated with such a condition.

[0216] Example

[0217] The following examples are set forth to provide a person of ordinary skill in the art with a complete disclosure and description of how to make and use the methods and compositions of the present invention, and the examples are not intended to limit the scope of what the inventors consider to be their invention. Every effort has been made to ensure accuracy with respect to the numbers used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise indicated, parts are parts by weight, molecular weights are average molecular weights, temperatures are degrees Celsius, and pressures are at or near atmospheric pressure.

[0218] Example 1. Generation of human antibodies against RET protein

[0219] Antibodies to RET may be generated using an immunogen comprising any of the following. In certain embodiments, antibodies of the invention, such as full-length RET protein (see, e.g., isoforms of human RET51, SEQ ID NO: 310, also found in ATCC Accession No. NP_066124.1; and isoforms of human RET9, SEQ ID NO: 312, also found in ATCC Accession No. NP_065681.1, both with signal sequences of residue numbers 1-28) are obtained from mice immunized with a primary immunogen. One or more booster injections containing the same molecule may be given to the mouse, or the mouse may be boosted with an immunogenic fragment thereof, such as a human RET extracellular domain (the human RET extracellular domain is within the range of amino acids 1-635 of SEQ ID NO: 313, also found in ATCC Accession No. NP_066124.1, with a signal sequence within the range of amino acid residues 1-28). In certain embodiments, mice are injected with full-length RET protein, followed by a boost with any of the constructs set forth in SEQ ID NOs: 305, 306, 307, and 313, or with a recombinantly prepared molecule.

[0220] In certain embodiments, antibodies of the invention are obtained from mice immunized with a primary immunogen (e.g., a biologically active RET molecule), or an immunogenic fragment of a RET protein, or a DNA encoding a full-length protein or an active fragment thereof. The immunogen can be delivered to the animal by any route including, but not limited to, intramuscular, subcutaneous, intravenous, or intranasal.

[0221] In certain embodiments, full-length RET protein or fragments thereof can be used to prepare monospecific, bispecific, or multispecific antibodies.

[0222] As mentioned above, the full-length protein or fragments thereof used as immunogens are administered directly to a culture medium containing DNA encoding the variable regions of human immunoglobulin heavy chains and kappa light chains together with an adjuvant that stimulates the immune response. Mice. The antibody immune response is monitored by RET immunoassay. When the desired immune response is achieved, spleen cells are harvested and fused with mouse myeloma cells to maintain their viability and form hybridoma cell lines. Hybridoma cell lines are screened and selected to identify cell lines that produce RET-specific antibodies. Using this technology and the various immunogens described above, several chimeric antibodies (i.e., antibodies with human variable domains and mouse constant domains) were obtained; certain exemplary antibodies produced in this manner are represented, for example, as H2M7086N.

[0223] Anti-RET antibodies have also been isolated directly from antigen-positive B cells without fusion with myeloma cells, as described in US 2007 / 0280945 A1, which is specifically incorporated herein by reference in its entirety. Using this approach, several fully human anti-RET antibodies (i.e., antibodies having human variable domains and human constant domains) were obtained; exemplary antibodies generated in this manner are represented as follows: H4H8044P, H4H8045P, H4H8046P, H4H8048P, H4H8056P, H4H8058P, H4H8060P, H4H8062P, H4H8066P, H4H8067P, H4H8071P, H4H8076P, H4H8079P, H4H8080P, H4H8083P, H4H8084P, H4H8085P, and H4H8087P.

[0224] The biological properties of exemplary antibodies produced according to the methods of this example are described in detail in the examples set forth below.

[0225] Example 2. Heavy and light chain variable region amino acid sequences

[0226] Table 1 sets forth the heavy chain and light chain variable region amino acid sequence pairs of selected antibodies specific for RET proteins and their corresponding antibody identifiers. Antibodies are generally named herein according to the following nomenclature: an Fc prefix (e.g., "H4H," "H1M," "H2M"), followed by a numerical identifier (e.g., "7086" as shown in Table 1), followed by a "P" or "N" suffix. Thus, according to this nomenclature, an antibody may be referred to as, for example, "H2M7086N." The H4H, H1M, and H2M prefixes in the antibody names used herein indicate a specific Fc region of the antibody. For example, the "H2M" antibody has a mouse IgG2 Fc, while the "H4H" antibody has a human IgG4 Fc. As will be appreciated by those of ordinary skill in the art, an H1M or H2M antibody may be converted to an H4H antibody, and vice versa, but in any case, the variable domains (including CDRs) indicated by the numerical identifiers shown in Table 1 will remain the same. Antibodies with the same numerical antibody names but differing by the letter suffixes N, B or P refer to antibodies having heavy and light chains that have identical CDR sequences but have sequence variations in regions that do not fall within the CDR sequences (i.e., in the framework regions). Thus, the N, B and P variants of a particular antibody have identical CDR sequences within their heavy and light chain variable regions but differ from each other within their framework regions.

[0227] Table 1

[0228]

[0229] Example 3. Binding affinity and kinetic constants of human monoclonal anti-RET antibodies obtained by surface plasmon resonance

[0230] The binding affinity and kinetic constants of human anti-RET antibodies were determined by surface plasmon resonance (Biacore T200) at 25°C and 37°C (Tables 2-3). Antibodies represented as human IgG4 Fc (i.e., "H4H" designation) were captured on an anti-human Fc sensor surface (mAb-capture format), and soluble monomeric (hRET.mmh; SEQ ID NO: 305, cynomolgus monkey (macacafascicularis; mf) RET.mmh; SEQ ID NO: 306) or dimeric (hRET.mFc; SEQ ID NO: 307) RET proteins were injected on the sensor surface. The binding equilibrium dissociation constant (K) was calculated from the kinetic rate constants. D ) and dissociation half-life (t 1 / 2 ): K D [M] = k d / k a ; and t 1 / 2 (min)=(ln2 / (60×k d ). Calculations were performed using Biacore T200 Evaluation Software v1.0.

[0231] Several antibodies of the present invention showed subnanomolar affinities for human and monkey RET proteins (Tables 2-3).

[0232] Table 2: Biacore binding affinity of human Fc mAbs at 25°C

[0233]

[0234]

[0235] NB: No binding was observed under the conditions used

[0236] Table 3: Biacore binding affinity of human Fc mAbs at 37°C

[0237]

[0238]

[0239] NB: No binding was observed under the conditions used

[0240] Example 4. Anti-RET antibodies strongly block the binding of human RET to the GFRα1 / GDNF co-complex

[0241] A competitive sandwich ELISA was used to assess the ability of anti-RET antibodies to block binding of human RET to pre-complexed plate-bound GDNF:GFRα1. Most RET antibodies potently blocked binding of RET to plate-bound GDNF / GFRα1 co-complexes (Table 4). 50 Values ​​ranged from 5.2 nM to below the theoretical floor of the assay (250 pM), with maximal blockade ranging from 72% to 96%.

[0242] Detailed Methods

[0243] Recombinant human dimeric GDNF (R&D systems) and human GFRα1.mFc (SEQ ID: 308) were mixed in PBS at a 1:1 molar ratio to obtain a final co-complex concentration of about 2.0 μg / ml. The GDNF-GFRα1 co-complex was incubated at room temperature (RT) for 1 hour and then coated on a 96-well microtiter plate at 4°C overnight. Nonspecific binding sites were blocked with BSA.

[0244] Separately, 1 nM of biotinylated monomeric RET protein (biot-hRET.mmh; SEQ ID: 305) was titrated with varying amounts of serially diluted antibody ranging from 0-120 nM. The antibody RET mixture was incubated for 1 hour at RT and then transferred to a microtiter plate previously coated with hGDNF / hGFRα1 co-complex. Binding was allowed to continue for 1 hour at RT followed by extensive washing. Plate-bound biot-hRET.mmh was detected with HRP-conjugated streptavidin and developed with TMB. The plate was read at 450 nm using Prism TM The sigmoidal dose-response model in the software was used for data analysis.

[0245] IC 50 The value, calculated as the antibody concentration required to block 50% of hRET binding to hGDNF / hGFRα1, is used as an indicator of blocking potency. The maximum blocking value represents the ability of the anti-RET antibody to block hRET binding relative to the baseline. The baseline value is calculated according to the absorbance measured at a constant amount of hRET on the dose curve (0% blocking) and the absorbance measured without the addition of hRET (100% blocking). The absorbance value of the well containing the highest concentration of each antibody is used to determine the percentage of blocking at the maximum concentration of the antibody tested. Table 4 shows the IC 50 and a summary of the maximum blocking percentage.

[0246] Table 4: IC of pre-complexed GDNF / GFRα1 coated on anti-RET antibody blocking plate 50 value

[0247]

[0248] #Below the theoretical bottom value of analysis <2.5E-10M; IC-uncertain

[0249] Example 5. Anti-RET antibodies inhibit ligand-dependent RET signaling and show strong internalization in the SRE-luciferase reporter assay

[0250] In this example, MCF7 and hRET engineered reporter cell lines were used to examine the effects of anti-RET antibodies on RET signaling and internalization.

[0251] The glial family ligands GDNF and Artemin trigger RET activation by forming high-affinity co-complexes with GFRα1 or GFRα3, respectively, thereby binding two RET molecules together and initiating phosphorylation of specific tyrosine residues. RET transphosphorylation activates several downstream intracellular cascades, and upregulation of RET signaling has been implicated in several disease lesions, including cancer (Borrello, MG et al., (2013), Expert Opinion on Therapeutic Targets 17(4): 403-419).

[0252] To test the ability of RET antibodies to block GDNF-mediated signaling, the human breast cancer cell line MCF7 expressing RET and GFRα1 was transduced with a serum response factor (SRE)-regulated luciferase reporter gene to generate the MCF7 / SRE-Luc line. The antibodies of the invention showed potent inhibition of GDNF-stimulated RET signaling with an IC of 50 Values ​​ranged from 143 pM to >100 nM (Table 5). Percent inhibition ranged from 60%-100%. Several non-blocking antibodies were also identified; H4H8085P stimulated luciferase activity to 50% of the levels observed with GDNF, while H4H8044P, H4H8076P, and H4H8046P were weaker activators of the luciferase reaction (2%-5% activation).

[0253] To determine whether blocking antibodies for GDNF-mediated RET signaling would also be effective against artemin-triggered activity, an engineered HEK293 / hGFRa3 / hRET SRELuc cell line was constructed. Most GDNF-dependent blockers of RET signaling were also blockers of artemin-dependent signaling activity in this cell line (Table 5; columns 5-6). Notably, H4H8048P was identified as a more potent blocker of artemin-dependent signaling compared to GDNF-dependent signaling, which may reflect different epitopes bound by the GDNF-GFRα1 and artemin-GFRα3 co-complexes on the RET receptor.

[0254] Finally, to understand whether the observed blocking activity could also be due to degradation of the RET receptor upon antibody binding, several antibodies were tested in an internalization assay (Table 6). Of the seven antibodies tested, H4H8087P was identified as the strongest internalizer, with H4H8079P and H4H7086P also showing potent internalization.

[0255] Finally, this example demonstrates that the anti-RET antibodies of the invention display a range of activating and inhibitory activities on RET signaling in the presence of glial family ligands (GDNF and artemin).

[0256] Table 5: IC of anti-RET antibodies in the SRE-luciferase ligand-dependent RET signaling assay 50 Value and EC 50 value

[0257]

[0258] Table 6: Internalization percentage of anti-RET antibodies relative to H4H8087P at 37°C

[0259] PID Internalization (%H4H8087P) H4H7086N 59.03 H4H8058P 42.02 H4H8062P 44.94 H4H8067P 58.20 H4H8079P 62.78 H4H8048P 35.37 H4H8087P 100.00

[0260] Detailed Methods

[0261] Generation of MCF7 / SRE luciferase stable cell lines

[0262] MCF7 cells naturally express RET and GFRα1. MCF7 was transduced using the Cignal Lenti SRE reporter kit (SABioscience) to generate stably introduced SRE-luciferase, and two weeks of puromycin selection were performed to generate MCF7 / SRELuc cells. The lentivirus expresses the firefly luciferase gene under the control of a minimal CMV promoter and tandem repeats of the serum response element (SRE).

[0263] Generation of HEK293 / hGFRa1(or 3) / hRET / SRE luciferase stable cell lines

[0264] Human GFRα (1 or 3) and hRET were stably introduced into HEK293 cells by consecutive rounds of Lipofectamine2000-mediated transfection and selected for at least two weeks in 500 μg / ml G418 (hGFRa1 or 3) and 100 μg / ml hygromycin B (hRET). As described above, the Cignal Lenti SRE reporter kit was then used to transduce the HEK293 dual stable lines expressing hGFRa1 / hRET or hGFRa3 / hRET to generate the HEK293 / hGFRa1 / hRET / SRE-Luc cell line and the artemin-responsive HEK293 / GFRa3 / hRET / SRE-Luc cell line.

[0265] Inhibition of GDNF-stimulated luciferase activity in MCF7 / SRE luciferase engineered cell lines

[0266] Twenty thousand MCF7-SRE-luc cells were seeded in Optimem + 0.5% FBS in a PDL-coated 96-well plate and incubated at 37°C with 5% CO. 2 For inhibition curves, cells were incubated for 1 hour with serial dilutions of anti-hRET mAb ranging from 1.6 pM to 1 μM. A constant dose of human GDNF (4-10 pM) was then added and cells were incubated for an additional 6 hours.

[0267] To assess the activation properties of anti-RET mAbs, MCF7-SRE-Luc cells were incubated with serial dilutions of anti-hRET mAbs ranging from 1.6 pM to 1 μM in the absence of ligand for 6 h.

[0268] GDNF dose response curves were measured using serial dilutions of GDNF ranging from 0.05 pM to 10 nM, added to wells without antibody and incubated at 37°C for 6 hours. TM Luciferase activity was measured using the luciferase ELISA kit (Promega) and relative light units (RLU) were measured on a Victor luminometer (Perkin Elmer).

[0269] Inhibition of Artemin-stimulated luciferase activity in HEK293 / hGFRa3 / hRET engineered cell line

[0270] By the method described for MCF7 / SRE-Luc cells, anti-RET antibodies were used to assess the inhibition of luciferase activity stimulated by Artemin in the HEK293 / hGFRa3 / hRET / SRE-Luc cell line. In order to generate an inhibition curve, cells were incubated with serially diluted anti-hRET antibodies ranging from 1.6pM to 1μM for 1 hour. The cells were then stimulated with a constant dose of hArtemin (100pM) for 6 hours. Artemin dose-response curves were generated by adding serially diluted hArtemin (0.17pM to 10nM) to cells for 6 hours at 37°C without the addition of antibodies. Luciferase activity measurements and curve fitting were performed as described for luciferase activity stimulated by GDNF.

[0271] Calculation of EC 50 / IC 50 value

[0272] EC was determined according to a four-parameter logistic equation on a 12-point response curve using GraphPad Prism. 50 / IC 50 Percent blocking is reported for the highest antibody dose and data are reported as mean ± standard deviation (SD).

[0273] Quantitative analysis of the internalization properties of anti-RET antibodies

[0274] To test the internalization of anti-hRET mAb, HEK293 / hGFRa1 / hRET / SRE-Luc cells were incubated with antibodies (10 μg / ml) on ice for 30 minutes, followed by one wash. The cells were then incubated with an anti-hFc Fab secondary antibody conjugated with alexa488 for 30 minutes, followed by a second wash. The antibodies were allowed to internalize for 4 hours at 37°C or kept at 4°C to prevent internalization. Cells were fixed with 4% formaldehyde and cell surface alexa488 was quenched by incubation with anti-alexa488 quenching antibody at 4°C for 1 hour. Nuclei were stained with Hoechst staining and images were acquired on ImageXpress micro XL (Molecular Device).

[0275] Total alexa488 intensity in intracellular vesicles in quenched samples at 37° C. was quantified by Columbus image analysis software (PerkinElmer). Total internalized mAb intensity was expressed as a percentage of the most strongly internalized mAb.

[0276] Example 6. Generation of bispecific antibodies

[0277] A variety of bispecific antibodies are produced for practicing the methods of the present invention. For example, RET-specific antibodies are produced in a bispecific format ("bispecific"), in which variable regions that bind to different domains of the RET protein are linked together to confer dual domain specificity within a single binding molecule. Appropriately designed bispecific antibodies can enhance overall RET neutralization efficacy by increasing specificity and binding affinity. The variable regions specific for individual domains are paired in a structural framework that allows each region to bind to a separate epitope at the same time, or to bind to different regions within a domain at the same time. In one embodiment of a bispecific antibody, the heavy chain variable region (V) from a binder specific for one domain is linked to the RET protein. H ) and a light chain variable region (V L ) to identify the original V H pairing without destroying the V H The original specific non-homologous V L partner. In this way, a single V L Fragment (e.g., V L 1) Can be used with two different V H Domains (e.g., V H 1 and V H 2) Combine to produce a product comprising two binding "arms" (V H 1-V L 1 and V H 2-V L 1) bispecific antibody. L The segments reduce the complexity of the system, thereby simplifying and increasing the efficiency of the cloning, expression and purification methods for producing bispecific antibodies (see, e.g., USSN 13 / 022759 and US 2010 / 0331527).

[0278] In addition, antibodies that bind to RET and a second target (such as, but not limited to, tumor antigens) can be prepared in a bispecific format using the techniques described herein or other techniques known to those of ordinary skill in the art. Antibody variable regions that bind to different regions can be linked together with variable regions that bind to, for example, related sites on different antigens to confer dual antigen specificity within a single binding molecule. Properly designed bispecific antibodies of this nature have dual functions. For example, in the case of a bispecific antibody that binds to RET and one of its ligands, the bispecific antibody may be able to better inhibit tumor cell growth without the need to administer a composition containing two separate antibodies. A variable region specific for RET is combined with a variable region specific for one of its ligands and paired in a structural framework that allows each variable region to bind to a separate antigen.

[0279] In any of the analyses described above for antibodies, the binding and functional blocking of the bispecific binder to the target antigen (e.g., RET) is tested. For example, standard methods for measuring soluble protein binding are used to assess bispecific interactions, such as Biacore, ELISA, size exclusion chromatography, multi-angle laser scattering, direct scanning calorimetry, and other methods. The binding of the bispecific antibody to RET and one of its ligands is determined by using an ELISA binding assay, in which synthetic peptides representing different antigens are coated on the wells of a microtiter plate, and the binding of the bispecific antibody is determined by using a secondary detection antibody. Binding experiments can also be performed using surface plasmon resonance experiments, in which the real-time binding interaction of the peptide and the antibody is measured by flowing the peptide or bispecific antibody on the sensor surface where the peptide or bispecific antibody is captured, respectively, on the bispecific antibody or peptide. The functional in vitro blocking of the bispecific antibody to RET and one of its ligands is determined using any biological assay (e.g., an assay described herein) or by in vivo protection studies in an appropriate animal model (e.g., an animal model bearing a tumor). Sequence Listing <110> Razerne Pharmaceuticals C. Daly G. Thurston N. Papadopoulos <120> Human antibodies that bind RET and methods of use thereof <130> 10582WO01 <140> TBD <141> 2020-04-09 <150> 62 / 832,218 <151> 2019-04-10 <160> 313 <170> PatentIn Version 3.5 <210> 1 <211> 345 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 1 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgtag tgtctggatt caccttcagt aactatggca tgcactgggt ccgccagggt 120 ccaggcaggg gcctggagtg gttggcactt atatggtatg atggaagtga taaatactat 180 gcagagtccg tgaggggccg attcaccatc tccagagaca attccaagaa cacggtgtat 240 ctgcaaatga acagcctgag agccgaggac acggctatgt attactgtac gagagatcgg 300 atttttgact actggggcca gggaaccctg gtcaccgtct cctca 345 <210> 2 <211> 115 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 2 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Val Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Gly Met His Trp Val Arg Gln Gly Pro Gly Arg Gly Leu Glu Trp Leu 35 40 45 Ala Leu Ile Trp Tyr Asp Gly Ser Asp Lys Tyr Tyr Ala Glu Ser Val 50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Thr Arg Asp Arg Ile Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr 100 105 110 Val Ser Ser 115 <210> 3 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 3 ggattcacct tcagtaacta tggc 24 <210> 4 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 4 Gly Phe Thr Phe Ser Asn Tyr Gly 1 5 <210> 5 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 5 atatggtatg atggaagtga taaa 24 <210> 6 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 6 Ile Trp Tyr Asp Gly Ser Asp Lys 1 5 <210> 7 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 7 acgagagatc ggatttttga ctac 24 <210> 8 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 8 Thr Arg Asp Arg Ile Phe Asp Tyr 1 5 <210> 9 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 9 gccatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtcggaga cagagtcacc 60 atcacttgcc gggcaagtca ggacattaga aatgatttag gctggtatca gcataatcca 120 gggaaagccc ctaacctcct aatctatgct gcgtccactt tacaaattgg ggtcccatca 180 aggttccgcg gcagtggatc tggcacagat ttcactctca ccatcagcag cctgcagcct 240 gaagattttg caacttatta ctgtctacaa gattttgatt acccgctctc tttcggcgga 300 gggaccaagg tggagatcag a 321 <210> 10 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 10 Ala Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg Asn Asp 20 25 30 Leu Gly Trp Tyr Gln His Asn Pro Gly Lys Ala Pro Asn Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ile Gly Val Pro Ser Arg Phe Arg Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln Asp Phe Asp Tyr Pro Leu 85 90 95 Ser Phe Gly Gly Gly Thr Lys Val Glu Ile Arg 100 105 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 11 caggacatta gaaatgat 18 <210> 12 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 12 Gln Asp Ile Arg Asn Asp 1 5 <210> 13 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 13 gctgcgtcc 9 <210> 14 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 14 Ala Ala Ser 1 <210> 15 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 15 ctacaagatt ttgattaccc gctctct 27 <210> 16 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 16 Leu Gln Asp Phe Asp Tyr Pro Leu Ser 1 5 <210> 17 <211> 384 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 17 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cgtctggatt caccttcagt ggctctggca tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcagtt atatgggaag atggaagtaa taaatactac 180 gcagactccg tgaggggccg attcaccatc tccagagaca atttcaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagacagact 300 atggttcggg gagttatccg cttttactac tactactacg gtatggacgt ctggggccaa 360 gggaccacgg tcaccgtctc ctca 384 <210> 18 <211> 128 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 18 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Gly Ser 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Glu Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Phe Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gln Thr Met Val Arg Gly Val Ile Arg Phe Tyr Tyr Tyr Tyr 100 105 110 Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 19 <211> 24 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 19 ggattcacct tcagtggctc tggc 24 <210> 20 <211> 8 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 20 Gly Phe Thr Phe Ser Gly Ser Gly 1 5 <210> 21 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> twenty one atatgggaag atggaagtaa taaa 24 <210> twenty two <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> twenty two Ile Trp Glu Asp Gly Ser Asn Lys 1 5 <210> twenty three <211> 63 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> twenty three gcgagacaga ctatggttcg gggagttatc cgcttttat actactacta cggtatggac 60 gtc 63 <210> twenty four <211> twenty one <212> PRT <213> Artificial sequence <220> <223> synthesis <400> twenty four Ala Arg Gln Thr Met Val Arg Gly Val Ile Arg Phe Tyr Tyr Tyr Tyr 1 5 10 15 Tyr Gly Met Asp Val 20 <210> 25 <211> 336 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 25 gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgca ggtctagtca gagcctcctg tatagtaatg gatacaacta tttggattgg 120 tacctgcaga agccagggca gtctccacag ctcctgatct atttgggttc taatcgggcc 180 tccggggtcc ctgacaggtt cagtggcagt ggatcaggca cagattttac actgaaaatc 240 agcagagtgg aggctgagga tgttgggttt tattactgca tgcaggctct acaaactcct 300 ccgacgttcg gccaagggac caaggtggag atcaaa 336 <210> 26 <211> 112 <212> PRT <213> Artificial Sequence <220> <223> Synthesis <400> 26 Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10 15 Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Phe Tyr Tyr Cys Met Gln Ala 85 90 95 Leu Gln Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 110 <210> 27 <211> 33 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 27 cagagcctcc tgtatagtaa tggatacaac tat 33 <210> 28 <211> 11 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 28 Gln Ser Leu Leu Tyr Ser Asn Gly Tyr Asn Tyr 1 5 10 <210> 29 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 29 ttgggttct 9 <210> 30 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 30 Leu Gly Ser 1 <210> 31 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 31 atgcaggctc tacaaactcc tccgacg 27 <210> 32 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 32 Met Gln Ala Leu Gln Thr Pro Pro Thr 1 5 <210> 33 <211> 354 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 33 gaggtgcagc tggtggagtc tgggggagcc ttggttcagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc aactatgcca tgacctgggt ccgccaggct 120 ccagggatgg gactggagtg ggtctcaggt attagtagta gtggtgctag cactttctac 180 gcagactccg tgaagggccg gttcaccatt tccagagaca attccaagaa cacgctgtat 240 ctacaaatga acagcctgag agccgaggac acggccgtat attattgtgc gaaagaagac 300 tattggggat ggtttgacta ctggggccag ggaaccctgg tcaccgtctc ctca 354 <210> 34 <211> 118 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 34 Glu Val Gln Leu Val Glu Ser Gly Gly Ala Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Ala Met Thr Trp Val Arg Gln Ala Pro Gly Met Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Ser Ser Gly Ala Ser Thr Phe Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Glu Asp Tyr Trp Gly Trp Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 35 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 35 ggattcacct ttagcaacta tgcc 24 <210> 36 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 36 Gly Phe Thr Phe Ser Asn Tyr Ala 1 5 <210> 37 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 37 attagtagta gtggtgctag cact 24 <210> 38 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 38 Ile Ser Ser Ser Gly Ala Ser Thr 1 5 <210> 39 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 39 gcgaaagaag actattgggg atggtttgac tac 33 <210> 40 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 40 Ala Lys Glu Asp Tyr Trp Gly Trp Phe Asp Tyr 1 5 10 <210> 41 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 41 gacatccagt tgacccagtc tccatccttc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgct gggccagtca ggacgttagc agttatttag cctggtatca gcaagaacca 120 gggaaagccc ctaaggtcct gatctatgat gcatccactt tgcaaagtgg ggtcccatca 180 aggttcagcg gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct 240 gaagattttg caccttatta ctgtcaacag cttaatagtt acccgtacac ttttggccag 300 gggaccaagc tggagatcaa a 321 <210> 42 <211> 107 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 42 Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Trp Ala Ser Gln Asp Val Ser Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Glu Pro Gly Lys Ala Pro Lys Val Leu Ile 35 40 45 Tyr Asp Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Pro Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Tyr 85 90 95 Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 43 <211> 18 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 43 caggacgtta gcagttat 18 <210> 44 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 44 Gln Asp Val Ser Ser Tyr 1 5 <210> 45 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 45 gatgcatcc 9 <210> 46 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 46 Asp Ala Ser 1 <210> 47 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 47 caacagctta atagttaccc gtacact 27 <210> 48 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 48 Gln Gln Leu Asn Ser Tyr Pro Tyr Thr 1 5 <210> 49 <211> 363 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 49 caggttcagc tggtgcagtc tagagatgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctggtta cacctttacc acctatggaa tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg atcaacactt acaatggtga cacaaactat 180 gcacagaagg tccaggacag agtcatcatg accacagaca catccacgag cacagcctac 240 atggagctga ggagcctgag atctgacgac acggccgtat atttttgtgc gggggcaaga 300 ccactaggtg gacggagggc ttttgatatc tggggccaag ggacaatggt caccgtctct 360 tca 363 <210> 50 <211> 121 <212> PRT <213> Artificial Sequence <220> <223> Synthesis <400> 50 Gln Val Gln Leu Val Gln Ser Arg Asp Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Thr Tyr 20 25 30 Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Ile Asn Thr Tyr Asn Gly Asp Thr Asn Tyr Ala Gln Lys Val 50 55 60 Gln Asp Arg Val Ile Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95 Ala Gly Ala Arg Pro Leu Gly Gly Arg Arg Ala Phe Asp Ile Trp Gly 100 105 110 Gln Gly Thr Met Val Thr Val Ser Ser 115 120 <210> 51 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 51 ggttacacct ttaccaccta tgga 24 <210> 52 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 52 Gly Tyr Thr Phe Thr Thr Tyr Gly 1 5 <210> 53 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 53 atcaacactt acaatggtga caca 24 <210> 54 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 54 Ile Asn Thr Tyr Asn Gly Asp Thr 1 5 <210> 55 <211> 42 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 55 gcgggggcaa gaccactagg tggacggagg gcttttgata tc 42 <210> 56 <211> 14 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 56 Ala Gly Ala Arg Pro Leu Gly Gly Arg Arg Ala Phe Asp Ile 1 5 10 <210> 57 <211> 321 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 57 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggcgagtca gggcattagc cattatttag cctggtatca gcagaaacca 120 gggaaagttc ctaaactcct aatctatgct gcatccactt tacaatcagg ggtcccatct 180 cggttcagtg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240 gaagatgttg caacttatta ctgtcaaaag tataacagtg tcccgtggac gttcggccaa 300 gggaccaagg tggaaatcaa a 321 <210> 58 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 58 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser His Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Val Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Gln Lys Tyr Asn Ser Val Pro Trp 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 59 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 59 cagggcatta gccattat 18 <210> 60 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 60 Gln Gly Ile Ser His Tyr 1 5 <210> 61 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 61 gctgcatcc 9 <210> 62 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 62 Ala Ala Ser 1 <210> 63 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 63 caaaagtata acagtgtccc gtggacg 27 <210> 64 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Synthesis <400> 64 Gln Lys Tyr Asn Ser Val Pro Trp Thr 1 5 <210> 65 <211> 357 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 65 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cgtctggatt caccttcagt aattatggca tggtctgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcattt atatggtatg atggaagtga taaatactat 180 gtagacgccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt atttctgtgc gagaagcggc 300 ccgtccagac atgtttttga tatctggggc caagggacaa tggtcaccgt ctcttca 357 <210> 66 <211> 119 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 66 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Gly Met Val Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Phe Ile Trp Tyr Asp Gly Ser Asp Lys Tyr Tyr Val Asp Ala Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Phe Cys 85 90 95 Ala Arg Ser Gly Pro Ser Arg His Val Phe Asp Ile Trp Gly Gln Gly 100 105 110 Thr Met Val Thr Val Ser Ser 115 <210> 67 <211> 24 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 67 ggattcacct tcagtaatta tggc 24 <210> 68 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 68 Gly Phe Thr Phe Ser Asn Tyr Gly 1 5 <210> 69 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 69 atatggtatg atggaagtga taaa 24 <210> 70 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 70 Ile Trp Tyr Asp Gly Ser Asp Lys 1 5 <210> 71 <211> 36 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 71 gcgagaagcg gcccgtccag acatgttttt gatatc 36 <210> 72 <211> 12 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 72 Ala Arg Ser Gly Pro Ser Arg His Val Phe Asp Ile 1 5 10 <210> 73 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 73 gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggccagtca gagtattagt agttggttgg cctggtatca gcagaaacca 120 gggaaagccc ctaaactcct gatctataag gcgtctagtt tagaaagtgg ggtcccatca 180 aggttcagcg gcagtggatc tgggacagaa ttcactctca ccatcagcag cctgcagcct 240 gatgattttg caacttatta ctgccaacag tataatagtt attcgtacac ttttggccag 300 gggaccaagc tggagatcaa a 321 <210> 74 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 74 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Ser Tyr Ser Tyr 85 90 95 Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 75 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 75 cagagtatta gtagttgg 18 <210> 76 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 76 Gln Ser Ile Ser Ser Trp 1 5 <210> 77 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 77 aaggcgtct 9 <210> 78 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 78 Lys Ala Ser 1 <210> 79 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 79 caacagtata atagttattc gtacact 27 <210> 80 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 80 Gln Gln Tyr Asn Ser Tyr Ser Tyr Thr 1 5 <210> 81 <211> 360 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 81 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cgtctggatt caccttcaga aactatggca tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcagtt aaacggtatg atggaagtga tgaatatttt 180 gtagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgcttttt 240 ctgcaaatga acagcctgag agtcgacgac acggctgtat attattgtgc gagagaaact 300 cctataactg gaactacgct tgactactgg ggccagggaa ccctggtcac cgtctcctca 360 <210> 82 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 82 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Asn Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Lys Arg Tyr Asp Gly Ser Asp Glu Tyr Phe Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Val Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Thr Pro Ile Thr Gly Thr Thr Leu Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 83 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 83 ggattcacct tcagaaacta tggc 24 <210> 84 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 84 Gly Phe Thr Phe Arg Asn Tyr Gly 1 5 <210> 85 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 85 aaacggtatg atggaagtga tgaa 24 <210> 86 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 86 Lys Arg Tyr Asp Gly Ser Asp Glu 1 5 <210> 87 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 87 gcgagagaaa ctcctataac tggaactacg cttgactac 39 <210> 88 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 88 Ala Arg Glu Thr Pro Ile Thr Gly Thr Thr Leu Asp Tyr 1 5 10 <210> 89 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 89 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc ggacaagtca gagcattacc aactatttaa attggtatca acagaaacca 120 gggaaagccc ctaagctcct gatctatgct gcatccaggt cacaaagtgg ggtcccatca 180 aggttcagtg gcagtggatc tgggacagat ttcactctca ccatcagcag tctgcaacct 240 gaagattttg caacttacta ctgtcaacag agttacagta ccccgctcac tttcggcgga 300 gggaccaagg tggagatcaa a 321 <210> 90 <211> 107 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 90 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Ile Thr Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Arg Ser Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 91 <211> 18 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 91 cagagcatta ccaactat 18 <210> 92 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 92 Gln Ser Ile Thr Asn Tyr 1 5 <210> 93 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 93 gctgcatcc 9 <210> 94 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 94 Ala Ala Ser 1 <210> 95 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 95 caacagagtt acagtacccc gctcact 27 <210> 96 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 96 Gln Gln Ser Tyr Ser Thr Pro Leu Thr 1 5 <210> 97 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 97 caggtgcagc tggtggagtc tgggggaggc gtgggccagc ctgggaggtc cctgagactc 60 tcctgtgtag cgtctggatt caccttcaga aactatggca tgcactgggt ccgccaggct 120 ccaggcaagg ggctggactg ggtggcaatt ataggatatg atggaagtaa agaatacaat 180 gtagactccg tgaagggccg ttttaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagtctggg agccgaggac acggctatat attactgtgc gagagaaagt 300 cctataactg gaactacgtt tgactactgg ggccagggaa ccctggtcac cgtctcctca 360 <210> 98 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 98 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Gly Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Arg Asn Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Asp Trp Val 35 40 45 Ala Ile Ile Gly Tyr Asp Gly Ser Lys Glu Tyr Asn Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Gly Ala Glu Asp Thr Ala Ile Tyr Tyr Cys 85 90 95 Ala Arg Glu Ser Pro Ile Thr Gly Thr Thr Phe Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 99 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 99 ggattcacct tcagaaacta tggc 24 <210> 100 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 100 Gly Phe Thr Phe Arg Asn Tyr Gly 1 5 <210> 101 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 101 ataggatatg atggaagtaa agaa 24 <210> 102 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 102 Ile Gly Tyr Asp Gly Ser Lys Glu 1 5 <210> 103 <211> 39 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 103 gcgagagaaa gtcctataac tggaactacg tttgactac 39 <210> 104 <211> 13 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 104 Ala Arg Glu Ser Pro Ile Thr Gly Thr Thr Phe Asp Tyr 1 5 10 <210> 105 <211> 321 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 105 gacatccaga tgacccagtc tccaccctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggcaagtca gagcattggc aattatttaa attggtatca gcagaaacca 120 ggaaaagccc ctaagatcct gatctatgct gcatcccgtt tgcaaagtgg ggtcccatca 180 aggttcagtg gcagtggatc tgggacagat ttcactctca ccatcagtag tctgcaacct 240 gaagattttg caacttacta ctgtcaacag agttacagta ccccgctcac tttcggcgga 300 gggaccaagg tggagatcaa a 321 <210> 106 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 106 Asp Ile Gln Met Thr Gln Ser Pro Pro Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Ile Leu Ile 35 40 45 Tyr Ala Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 107 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 107 cagagcattg gcaattat 18 <210> 108 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 108 Gln Ser Ile Gly Asn Tyr 1 5 <210> 109 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 109 gctgcatcc 9 <210> 110 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 110 Ala Ala Ser 1 <210> 111 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 111 caacagagtt acagtacccc gctcact 27 <210> 112 <211> 9 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 112 Gln Gln Ser Tyr Ser Thr Pro Leu Thr 1 5 <210> 113 <211> 375 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 113 caggtcacct tgaaggagtc tggtcctgtg ctggtgaaac ccacagagac cctcacgctg 60 acctgcaccg tctctgggtt ctcactcagc agtgctagaa tgggtgtgag ttggatccgt 120 cagcccccag ggaaggccct ggagtggctt gcacacattt tttcgactga cgaaaaatcc 180 tacagcacat ctctgaagag caggctctcc atctccaagg acacctccct aagccaggtg 240 gtccttatta tgaccaacat ggaccctgta gacacagcca catattactg tgcacggcgt 300 acaactatgg cccctacta ttactactac ggtatggacg tctggggcca cgggaccacg 360 gtcaccgtct cctca 375 <210> 114 <211> 125 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 114 Gln Val Thr Leu Lys Glu Ser Gly Pro Val Leu Val Lys Pro Thr Glu 1 5 10 15 Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Ser Ala 20 25 30 Arg Met Gly Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu 35 40 45 Trp Leu Ala His Ile Phe Ser Thr Asp Glu Lys Ser Tyr Ser Thr Ser 50 55 60 Leu Lys Ser Arg Leu Ser Ile Ser Lys Asp Thr Ser Leu Ser Gln Val 65 70 75 80 Val Leu Ile Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr 85 90 95 Cys Ala Arg Arg Thr Thr Met Ala Pro Tyr Tyr Tyr Tyr Tyr Gly Met 100 105 110 Asp Val Trp Gly His Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 115 <211> 30 <212> DNA <213> artificial sequence <220> <223> Synthesis <400> 115 gggttctcac tcagcagtgc tagaatgggt 30 <210> 116 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Synthesis <400> 116 Gly Phe Ser Leu Ser Ser Ala Arg Met Gly 1 5 10 <210> 117 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 117 attttttcga ctgacgaaaa a 21 <210> 118 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Synthesis <400> 118 Ile Phe Ser Thr Asp Glu Lys 1 5 <210> 119 <211> 51 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 119 gcacggcgta caactatggc cccttactat tactactacg gtatggacgt c 51 <210> 120 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 120 Ala Arg Arg Thr Thr Met Ala Pro Tyr Tyr Tyr Tyr Tyr Gly Met Asp 1 5 10 15 Val <210> 121 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 121 gccatccaga tgacccagtc tccagcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggcaagtca gggcattaga aatgatttag gttggtatca gcagaaacca 120 gggaaagccc ctaagctcct gatctctgct gcatccagtt tgcaaagtgg ggtcccatca 180 aggttcagcg gcagtggatc tggcacagat ttcactctca ccatcagcag cctgcagcct 240 gaagattttg caacttatta ctgtctacaa gattacaagt atccgtggac gttcggccaa 300 gggaccaagg tggaaatcaa a 321 <210> 122 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 122 Ala Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp 20 25 30 Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Ser Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln Asp Tyr Lys Tyr Pro Trp 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 123 <211> 18 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 123 cagggcatta gaaatgat 18 <210> 124 <211> 6 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 124 Gln Gly Ile Arg Asn Asp 1 5 <210> 125 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 125 gctgcatcc 9 <210> 126 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 126 Ala Ala Ser 1 <210> 127 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 127 ctacaagatt acaagtatcc gtggacg 27 <210> 128 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 128 Leu Gln Asp Tyr Lys Tyr Pro Trp Thr 1 5 <210> 129 <211> 363 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 129 gaggtgcagc tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly tcctgttcag tctctggatt catctttaaa aactatgcca tgaggtgggt ccgccaggct 120 Ser Leu Arg Leu Ser Cys Ser Val Ser Gly Phe Ile Phe Lys Asn Tyr Ala Met Arg Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val ccagggaagg ggctggagtg ggtctcagga attagcggca gtggtggtat cacatactac 180 Pro Gly Lys Gly Leu Glu Trp Val Ser Arg Ile Ser Gly Ser Gly Gly Tyr His Tyr Tyr gccgactccg tgaggggccg ggtcaccatt tccagagaca attccaagaa caccctagat 240 Ala Asp Ser Val Arg Gly Arg Val Thr Ile Ser Arg Asp Asn Pro Lys Asn Thr Leu Asp cttcaaatga ccaacctgag agccgaggac acggccgttt attactgtgc gaaagctgaa 300 Leu Gln Met Thr Asn Leu Glu Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ser Glu tatagcagct cgggtgccta ctttgactac tggggccagg gaaccctggt cactgtctcc 360 Tyr Ser Ser Gly Ala Tyr Leu Asp Tyr Trp Gly Pro Gly Asn Pro Gly Thr Cys Ser tca 363 Ser <210> 130<210> 130 <211> 121<211> 121 <212> PRT<212> PRT <213> 人工序列<213> Artificial Sequence <220><220> <223> 合成 <223> Synthetic <400> 130 <400> 130 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 1 5 10 15 Ser Leu Arg Leu Ser Cys Ser Val Ser Gly Phe Ile Phe Lys Asn Tyr Ser Leu Arg Leu Ser Cys Ser Val Ser Gly Phe Ile Phe Lys Asn Tyr 20 25 30 20 25 30 Ala Met Arg Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Met Arg Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 35 40 45 Ser Gly Ile Ser Gly Ser Gly Gly Ile Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Arg Gly Arg Val Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Asp 65 70 75 80 Leu Gln Met Thr Asn Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Ala Glu Tyr Ser Ser Ser Gly Ala Tyr Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 131 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 131 ggattcatct ttaaaaacta tgcc 24 <210> 132 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 132 Gly Phe Ile Phe Lys Asn Tyr Ala 1 5 <210> 133 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 133 attagcggca gtggtggtat caca 24 <210> 134 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 134 Ile Ser Gly Ser Gly Gly Ile Thr 1 5 <210> 135 <211> 42 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 135 gcgaaagctg aatatagcag ctcgggtgcc tactttgact ac 42 <210> 136 <211> 14 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 136 Ala Lys Ala Glu Tyr Ser Ser Ser Gly Ala Tyr Phe Asp Tyr 1 5 10 <210> 137 <211> 321 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 137 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggcaagtca gagcattcac aactatttaa attggtatct gcagagacca 120 gggaaagccc ctaagctcct ggtctatgct gcatccagtt tgcaaagtgg ggtcccgtca 180 aggttcagtg gccgtggatc tgggacagat ttcactctca ccatcagcag tctgcaacct 240 gaagattttg caacttacta ctgtcaacag agttacagtg ccccgtacag ttttggccag 300 gggaccaagc tggagatcaa a 321 <210> 138 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 138 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile His Asn Tyr 20 25 30 Leu Asn Trp Tyr Leu Gln Arg Pro Gly Lys Ala Pro Lys Leu Leu Val 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Arg Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Ala Pro Tyr 85 90 95 Ser Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 139 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 139 cagagcattc acaactat 18 <210> 140 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 140 Gln Ser Ile His Asn Tyr 1 5 <210> 141 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 141 gctgcatcc 9 <210> 142 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 142 Ala Ala Ser 1 <210> 143 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 143 caacagagtt acagtgcccc gtacagt 27 <210> 144 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Synthesis <400> 144 Gln Gln Ser Tyr Ser Ala Pro Tyr Ser 1 5 <210> 145 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 145 gaggtgcagc tggtggagtc tgggggaggc ttggtacagc cgggggggtc cctgagactc 60 tcctgtgaag cctctggatt cacctttagc agatatgcca tgacctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcaggt attagtggta gtggtggtag cacattctac 180 gtagactccc tgcagggccg gttcaccctc tccagagaca attccaagca cacgctgttt 240 ctgcaaatga acagcctgag agccgaggac acggccatat attactgtgc gaaagagaac 300 acctatggtc actttgacta ctggggccag ggaaccctgg tcaccgtctc ctca 354 <210> 146 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 146 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Thr Phe Ser Arg Tyr 20 25 30 Ala Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Gly Ser Gly Gly Ser Thr Phe Tyr Val Asp Ser Leu 50 55 60 Gln Gly Arg Phe Thr Leu Ser Arg Asp Asn Ser Lys His Thr Leu Phe 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Ile Tyr Tyr Cys 85 90 95 Ala Lys Glu Asn Thr Tyr Gly His Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 147 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 147 ggattcacct ttagcagata tgcc 24 <210> 148 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 148 Gly Phe Thr Phe Ser Arg Tyr Ala 1 5 <210> 149 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 149 attagtggta gtggtggtag caca 24 <210> 150 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 150 Ile Ser Gly Ser Gly Gly Ser Thr 1 5 <210> 151 <211> 33 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 151 gcgaaagaga acacctatgg tcactttgac tac 33 <210> 152 <211> 11 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 152 Ala Lys Glu Asn Thr Tyr Gly His Phe Asp Tyr 1 5 10 <210> 153 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 153 gacatccagt tgacccagtc tccatccttc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgct gggccagtca ggacattagc acttatttag cctggtatca gcaaaaacca 120 gggaaagccc ctcaggtcct gatctatgct gcttcctctt tgcaatatgg ggtcccatct 180 aggttcagcg gcagtggatc tgggacagaa ttcactctca caatcaccag cctgcagcct 240 gaagattttg caacttatta ctgtcaacaa cttattggtt acccgtacat ttttggccag 300 gggaccaagc tggagatcaa a 321 <210> 154 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 154 Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Trp Ala Ser Gln Asp Ile Ser Thr Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Gln Val Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Tyr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Thr Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Ile Gly Tyr Pro Tyr 85 90 95 Ile Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 155 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 155 caggacatta gcacttat 18 <210> 156 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 156 Gln Asp Ile Ser Thr Tyr 1 5 <210> 157 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 157 gctgcttcc 9 <210> 158 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 158 Ala Ala Ser 1 <210> 159 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 159 caacaactta ttggttaccc gtacatt 27 <210> 160 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 160 Gln Gln Leu Ile Gly Tyr Pro Tyr Ile 1 5 <210> 161 <211> 345 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 161 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgtag cgtctggatt taccttcagt aactatggca tgcactgggt ccgccaggct 120 ccaggcaagg gactggagtg ggtggcactt atatggtatg atggaagtaa taaatacttt 180 gcagactccg tgaagggccg attcaccatc tccagagaca attccaagag aatgatgttt 240 ctggaaatga acagcctgag agccgaggac acggctatat attactgtac gcgggatcga 300 ttgtttgact tctggggcca gggaaccctg gtcactgtct cctca 345 <210> 162 <211> 115 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 162 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Leu Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Phe Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Arg Met Met Phe 65 70 75 80 Leu Glu Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Ile Tyr Tyr Cys 85 90 95 Thr Arg Asp Arg Leu Phe Asp Phe Trp Gly Gln Gly Thr Leu Val Thr 100 105 110 Val Ser Ser 115 <210> 163 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 163 ggatttacct tcagtaacta tggc 24 <210> 164 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 164 Gly Phe Thr Phe Ser Asn Tyr Gly 1 5 <210> 165 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 165 atatggtatg atggaagtaa taaa 24 <210> 166 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 166 Ile Trp Tyr Asp Gly Ser Asn Lys 1 5 <210> 167 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 167 acgcgggatc gattgtttga cttc 24 <210> 168 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 168 Thr Arg Asp Arg Leu Phe Asp Phe 1 5 <210> 169 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 169 gccatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtgggaga cagagtcagc 60 atcacttgcc gggcaagtca ggacattaga catgatctag gttggtttca tcagaaacca 120 gggaaagccc ctaaactcct gatctatgct gcatccactt tacaaagtgg ggtcccatca 180 aggtttggcg gcagtggatc tggcacagat ttcactctca ccatcaccag cctgcagcct 240 gaggattttg gaacttatta ctgtctacaa gattacaatt atccggccac cttcggccaa 300 gggacacgac tggagattaa a 321 <210> 170 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 170 Ala Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Ser Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg His Asp 20 25 30 Leu Gly Trp Phe His Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Gly Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Thr Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Gly Thr Tyr Tyr Cys Leu Gln Asp Tyr Asn Tyr Pro Ala 85 90 95 Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 <210> 171 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 171 caggacatta gacatgat 18 <210> 172 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 172 Gln Asp Ile Arg His Asp 1 5 <210> 173 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 173 gctgcatcc 9 <210> 174 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 174 Ala Ala Ser 1 <210> 175 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 175 ctacaagatt acaattatcc ggccacc 27 <210> 176 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 176 Leu Gln Asp Tyr Asn Tyr Pro Ala Thr 1 5 <210> 177 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 177 gaggtgcagc tggtggagtc tgggggaggc ttggttcagc ctggggggtc cctaagactc 60 tcctgtgcag cctctggatt cacctttacc acatatttca tgagttgggt ccgccaggct 120 ccagggaagg gactggagtg ggtctcaggt attagtggta gtgggactag tacattctat 180 gtagactcca tgaagggccg gttcaccatc tccagagaca attccaagaa tacgctatat 240 ctgcaaatga acagtctgag agtcgaggac acggccgtat atttctgtgc gaaagagaac 300 acctatggtc attttgactt ctggggccag ggaaccctgg tcactgtctc ctca 354 <210> 178 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 178 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Thr Tyr 20 25 30 Phe Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Gly Ser Gly Thr Ser Thr Phe Tyr Val Asp Ser Met 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Val Glu Asp Thr Ala Val Tyr Phe Cys 85 90 95 Ala Lys Glu Asn Thr Tyr Gly His Phe Asp Phe Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 179 <211> 24 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 179 ggattcacct ttaccacata tttc 24 <210> 180 <211> 8 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 180 Gly Phe Thr Phe Thr Thr Tyr Phe 1 5 <210> 181 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 181 attagtggta gtgggactag taca 24 <210> 182 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 182 Ile Ser Gly Ser Gly Thr Ser Thr 1 5 <210> 183 <211> 33 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 183 gcgaaagaga acacctatgg tcattttgac ttc 33 <210> 184 <211> 11 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 184 Ala Lys Glu Asn Thr Tyr Gly His Phe Asp Phe 1 5 10 <210> 185 <211> 321 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 185 gacatccagt tgacccagtc tccatccttc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgct gggccagtca ggacattagc agtcatttag cctggtatca gcaaaaacca 120 gggaaagccc ctaaggtcct gatctatgat gcatccactt tgcaaagtgg ggtcccatca 180 aggatcagcg gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct 240 gaagattttg cagcttatta ctgtcaacag cttgatggtt acccgtacac ttttggccag 300 gggaccaagc tggagatcaa a 321 <210> 186 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 186 Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Trp Ala Ser Gln Asp Ile Ser Ser His 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Val Leu Ile 35 40 45 Tyr Asp Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Ile Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Ala Tyr Tyr Cys Gln Gln Leu Asp Gly Tyr Pro Tyr 85 90 95 Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 187 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 187 caggacatta gcagtcat 18 <210> 188 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 188 Gln Asp Ile Ser Ser His 1 5 <210> 189 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 189 gatgcatcc 9 <210> 190 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 190 Asp Ala Ser 1 <210> 191 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 191 caacagcttg atggttaccc gtacact 27 <210> 192 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 192 Gln Gln Leu Asp Gly Tyr Pro Tyr Thr 1 5 <210> 193 <211> 369 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 193 caggtacagc tgcagcagtc aggtccagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccgggga cagtgtctct agcaacagtg ttgcttggaa ctggatcagg 120 cagtccccat cgagaggcct tgagtggctg ggaaggactt actacaggtc caactggtat 180 aatacttatg cagtatctgt gaaaagtcga ataaccatcg acccagacac atccaagaac 240 cagttctccc tgcagctgaa ctctgtgact cccgaggaca cggctctgta ttactgtgca 300 agagggcacc ggtatagtgg gagctacttt gactactggg gccagggaac cctggtcacc 360 gtctcctca 369 <210> 194 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 194 Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Val Ala Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Asn Trp Tyr Asn Thr Tyr Ala 50 55 60 Val Ser Val Lys Ser Arg Ile Thr Ile Asp Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Leu 85 90 95 Tyr Tyr Cys Ala Arg Gly His Arg Tyr Ser Gly Ser Tyr Phe Asp Tyr 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 195 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 195 ggggacagtg tctctagcaa cagtgttgct 30 <210> 196 <211> 10 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 196 Gly Asp Ser Val Ser Ser Asn Ser Val Ala 1 5 10 <210> 197 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 197 acttactaca ggtccaactg gtataat 27 <210> 198 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 198 Thr Tyr Tyr Arg Ser Asn Trp Tyr Asn 1 5 <210> 199 <211> 39 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 199 gcaagagggc accggtatag tgggagctac tttgactac 39 <210> 200 <211> 13 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 200 Ala Arg Gly His Arg Tyr Ser Gly Ser Tyr Phe Asp Tyr 1 5 10 <210> 201 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 201 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtagggga cagagtcacc 60 atcacttgcc gggcaagtca gaacattaac agctatttca attggtatca gcagaaacca 120 gggaaagccc ctaagctcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180 aggttcagtg gcggtggatc tgggacagat ttcactctca ccatcagcag tctgcaacct 240 gaagattttg caacttacta ctgtcaacag acttacacta tcccgtggac gttcggccaa 300 gggaccaagg tggaaatcaa a 321 <210> 202 <211> 107 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 202 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Asn Ser Tyr 20 25 30 Phe Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Gly Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Tyr Thr Ile Pro Trp 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 203 <211> 18 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 203 cagaacatta acagctat 18 <210> 204 <211> 6 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 204 Gln Asn Ile Asn Ser Tyr 1 5 <210> 205 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 205 gctgcatcc 9 <210> 206 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 206 Ala Ala Ser 1 <210> 207 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 207 caacagactt acactatccc gtggacg 27 <210> 208 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 208 Gln Gln Thr Tyr Thr Ile Pro Trp Thr 1 5 <210> 209 <211> 363 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 209 gaggtgcagc tggtggagtc tgggggaggc ttggtaaagc ctggggggtc ccttagactc 60 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly tcctgtgcag cctctggatt cactttcagt aacgcctgga tgagttgggt ccgccaggct 120 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ala ccagggaagg gactggagtg ggttggccgt attaaaagca aaactgatgg tgggacatca 180 Pro Gly Lys Gly Leu Glu Trp Val Gly Trp Pro Tyr Lys Ala Lys Thr Asp Gly Gly Asp Ile gaatacgctg cacccgtgaa aggcagattc accatctcaa gagacgattc aaaaaacacg 240 Glu Tyr Ala Cys Pro Val Lys Ala Asp Ser His Ser Lys Arg Asp Phe Lys Asn Thr ctgtttctgc aaatgaatag cctgaaaagc gaggacgcgg ccgtgtatta ctgcaccaca 300 Leu Phe Ser Ala Asn Glu Ile Ala Glu Lys Ala Asp Ala Ala Val Tyr Tyr Cys Thr Thr ggacgcagct ggtctgacta ctttgacttc tggggccagg gaaccctggt caccgtctcc 360 Gly Thr Ala Ala Val Leu Thr Thr Phe Asp Phe Trp Gly Pro Gly Asn Pro Gly Thr Arg Ser tca 363 Ser <210> 210 <211> 121 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 210 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ala 20 25 30 Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Gly Arg Ile Lys Ser Lys Thr Asp Gly Gly Thr Ser Glu Tyr Ala Ala 50 55 60 Pro Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr 65 70 75 80 Leu Phe Leu Gln Met Asn Ser Leu Lys Ser Glu Asp Ala Ala Val Tyr 85 90 95 Tyr Cys Thr Thr Gly Arg Ser Trp Ser Asp Tyr Phe Asp Phe Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 211 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 211 ggattcactt tcagtaacgc ctgg 24 <210> 212 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 212 Gly Phe Thr Phe Ser Asn Ala Trp 1 5 <210> 213 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 213 attaaaagca aaactgatgg tgggacatca 30 <210> 214 <211> 10 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 214 Ile Lys Ser Lys Thr Asp Gly Gly Thr Ser 1 5 10 <210> 215 <211> 36 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 215 accacaggac gcagctggtc tgactacttt gacttc 36 <210> 216 <211> 12 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 216 Thr Thr Gly Arg Ser Trp Ser Asp Tyr Phe Asp Phe 1 5 10 <210> 217 <211> 321 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 217 gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc aggcgagtca ggacattagc aactatttaa attggtatca gcagaaacca 120 gggaaagccc ctaagctcct gatctacgat gcatccaact tggaaacagg ggtcccatca 180 aggttcagtg gaagtggatt tgcgacagat tttactttca ccatcagcag cctgcagcct 240 gaagatattg caacatatta ctgtcaacac tatgatgatc tcccattcac tttcggccct 300 gggaccaaag tggatatcaa a 321 <210> 218 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 218 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Asp Ala Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Phe Ala Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Ile Ala Thr Tyr Tyr Cys Gln His Tyr Asp Asp Leu Pro Phe 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 <210> 219 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 219 caggacatta gcaactat 18 <210> 220 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 220 Gln Asp Ile Ser Asn Tyr 1 5 <210> 221 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 221 gatgcatcc 9 <210> 222 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 222 Asp Ala Ser 1 <210> 223 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 223 caacactatg atgatctccc attcact 27 <210> 224 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Synthesis <400> 224 Gln His Tyr Asp Asp Leu Pro Phe Thr 1 5 <210> 225 <211> 366 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 225 gaggtgcagc tggtggagtc tgggggaggc ttggtacagt ctggggggtc cctgagactc 60 tcttgtgtag cctctggatt cacctttagc acctatgcca tgacctgggt ccgccaggct 120 ccagggaggg ggctggagtg ggtctcagct attagtggta gtggtgctag cacatactac 180 gcagactcct tgaagggccg gttcaccgtc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggccgtat attactgttc gaaagatcac 300 cggaactacg actccgacta cgacatggac gtctggggcc aaggaaccac ggtcaccgtc 360 tcctca 366 <210> 226 <211> 122 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 226 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ser Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Thr Tyr 20 25 30 Ala Met Thr Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Ala Ser Thr Tyr Tyr Ala Asp Ser Leu 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ser Lys Asp His Arg Asn Tyr Asp Ser Asp Tyr Asp Met Asp Val Trp 100 105 110 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 227 <211> 24 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 227 ggattcacct ttagcaccta tgcc 24 <210> 228 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 228 Gly Phe Thr Phe Ser Thr Tyr Ala 1 5 <210> 229 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 229 attagtggta gtggtgctag caca 24 <210> 230 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 230 Ile Ser Gly Ser Gly Ala Ser Thr 1 5 <210> 231 <211> 45 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 231 tcgaaagatc accggaacta cgactccgac tacgacatgg acgtc 45 <210> 232 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Synthesis <400> 232 Ser Lys Asp His Arg Asn Tyr Asp Ser Asp Tyr Asp Met Asp Val 1 5 10 15 <210> 233 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 233 gacatccaga tgacccagtc tccatcctcc ctgtctgctt ctgtaggaga cagagtcacc 60 atcacttgcc gggcaagtca gggcattaga aattatttag gctggtatca gcagaaacca 120 gggaaagccc ctaagcgcct gatctatact gcatccagtt tgcagagtgg ggtcccatca 180 agattccgcg gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct 240 gaagattttg caacttatta ctgtctacaa cataatagtt acccgtacac ttttggccag 300 gggaccaagc tggagatcaa a 321 <210> 234 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Synthesis <400> 234 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Tyr 20 25 30 Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu Ile 35 40 45 Tyr Thr Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Arg Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Tyr 85 90 95 Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 235 <211> 18 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 235 cagggcatta gaaattat 18 <210> 236 <211> 6 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 236 Gln Gly Ile Arg Asn Tyr 1 5 <210> 237 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 237 actgcatcc 9 <210> 238 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 238 Thr Ala Ser 1 <210> 239 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 239 ctacaacata atagttaccc gtacact 27 <210> 240 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 240 Leu Gln His Asn Ser Tyr Pro Tyr Thr 1 5 <210> 241 <211> 372 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 241 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cgtctggatt caccttcaat aactatgtta tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcactt atatggtatg atggaagtaa taaatactat 180 gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cgcgctgaat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt atttttgtgc gagagtctct 300 atagcagctc gaaactacta ctacggcggt ttggacgtct ggggccaagg aaccacggtc 360 accgtctcct ca 372 <210> 242 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 242 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn Asn Tyr 20 25 30 Val Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Leu Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Ala Leu Asn 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Phe Cys 85 90 95 Ala Arg Val Ser Ile Ala Ala Arg Asn Tyr Tyr Tyr Gly Gly Leu Asp 100 105 110 Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 243 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 243 ggattcacct tcaataacta tgtt 24 <210> 244 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 244 Gly Phe Thr Phe Asn Asn Tyr Val 1 5 <210> 245 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 245 atatggtatg atggaagtaa taaa 24 <210> 246 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 246 Ile Trp Tyr Asp Gly Ser Asn Lys 1 5 <210> 247 <211> 51 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 247 gcgagagtct ctatagcagc tcgaaactac tactacggcg gtttggacgt c 51 <210> 248 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 248 Ala Arg Val Ser Ile Ala Ala Arg Asn Tyr Tyr Tyr Gly Gly Leu Asp 1 5 10 15 Val <210> 249 <211> 324 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 249 gaaatagtgt tgacacagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgca gggccagtca gagtgttagc agcacctact tagcctggta ccaacagaaa 120 cctggccagg ctcccaggct cctcatctat ggtgcatcca gcagggccac tggcatccca 180 gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cattatggtg gctcaccgct cactttcggc 300 ggagggacca aggtggagat caaa 324 <210> 250 <211> 108 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 250 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Thr 20 25 30 Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45 Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu 65 70 75 80 Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Tyr Gly Gly Ser Pro 85 90 95 Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 251 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 251 cagagtgtta gcagcaccta c 21 <210> 252 <211> 7 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 252 Gln Ser Val Ser Ser Thr Tyr 1 5 <210> 253 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 253 ggtgcatcc 9 <210> 254 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 254 Gly Ala Ser 1 <210> 255 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 255 cagcattatg gtggctcacc gctcact 27 <210> 256 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 256 Gln His Tyr Gly Gly Ser Pro Leu Thr 1 5 <210> 257 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 257 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgaag cgtctggatt caccttccgt aactatggca tgcactgggt ccgccaggct 120 ccaggcaagg ggctggactg ggtgtcaact atttactatg atggaagtga tgaatactat 180 tcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240 ttgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagagatccc 300 cctagttttc ggtactttga ctactggggc cagggaaccc tggtcaccgt ctcctca 357 <210> 258 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> synthesis <400> 258 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Thr Phe Arg Asn Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Asp Trp Val 35 40 45 Ser Thr Ile Tyr Tyr Asp Gly Ser Asp Glu Tyr Tyr Ser Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Pro Pro Ser Phe Arg Tyr Phe Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser 115 <210> 259 <211> 24 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 259 ggattcacct tccgtaacta tggc 24 <210> 260 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 260 Gly Phe Thr Phe Arg Asn Tyr Gly 1 5 <210> 261 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 261 atttactatg atggaagtga tgaa 24 <210> 262 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 262 Ile Tyr Tyr Asp Gly Ser Asp Glu 1 5 <210> 263 <211> 36 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 263 gcgagagatc cccctagttt tcggtacttt gactac 36 <210> 264 <211> 12 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 264 Ala Arg Asp Pro Pro Ser Phe Arg Tyr Phe Asp Tyr 1 5 10 <210> 265 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 265 gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggccagtca gagcattcgt agctggttga cctggtatca gcagaaacca 120 gggaaagccc ctaaggtcct gatctataag gcgtctactt tagaacgtgg ggtcccatca 180 aggttcagtg gcagtggatc tgggacagaa ttcactctca ccatcagcag cctgcagcct 240 gaggattttg caacttatta ctgccatcag tacagtagtt attcgtacac ttttggccag 300 gggaccaagc tggagatcaa a 321 <210> 266 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 266 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Arg Ser Trp 20 25 30 Leu Thr Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Val Leu Ile 35 40 45 Tyr Lys Ala Ser Thr Leu Glu Arg Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys His Gln Tyr Ser Ser Tyr Ser Tyr 85 90 95 Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 267 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 267 cagagcattc gtagctgg 18 <210> 268 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 268 Gln Ser Ile Arg Ser Trp 1 5 <210> 269 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 269 aaggcgtct 9 <210> 270 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 270 Lys Ala Ser 1 <210> 271 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 271 catcagtaca gtagttattc gtacact 27 <210> 272 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 272 His Gln Tyr Ser Ser Tyr Ser Tyr Thr 1 5 <210> 273 <211> 369 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 273 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtacag cctctggatt caccttcgat aactatggca tgcactgggt ccgccaggct 120 ccaggcaaag gcctggagtg ggtggcagtt atttcatatg atggaagtaa tacattctat 180 gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cgcgctgtat 240 ctgcaaatga acagcctgag agctgaggac acggctgttt attactgtgc gaaagatctt 300 gaattcgata ttttgattgg ttatcccttt gactcctggg gccggggaac cctggtcact 360 gtctcctca 369 <210> 274 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 274 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Thr Phe Asp Asn Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Asp Gly Ser Asn Thr Phe Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Ala Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Asp Leu Glu Phe Asp Ile Leu Ile Gly Tyr Pro Phe Asp Ser 100 105 110 Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 275 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 275 ggattcacct tcgataacta tggc 24 <210> 276 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 276 Gly Phe Thr Phe Asp Asn Tyr Gly 1 5 <210> 277 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 277 atttcatatg atggaagtaa taca 24 <210> 278 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 278 Ile Ser Tyr Asp Gly Ser Asn Thr 1 5 <210> 279 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 279 gcgaaagatc ttgaattcga tattttgatt ggttatccct ttgactcc 48 <210> 280 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 280 Ala Lys Asp Leu Glu Phe Asp Ile Leu Ile Gly Tyr Pro Phe Asp Ser 1 5 10 15 <210> 281 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 281 gacatccagt tgacccagtc tccatccttc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgct gggccagtca ggacattagt cgttatttag cctggtatca gcaaaaacca 120 gggaaagccc ctaacctcct gatctatgct gcatccactt tgcaaagtgg ggtcccatca 180 aggttcagcg gcagtggatc tgggacagaa ttcactctca caatcaacag cctgcagcct 240 gaagattttg caacttatta ctgtcaacag ctttttagtt accctcggac gttcggccaa 300 gggaccaagg tggaaatcaa a 321 <210> 282 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 282 Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Trp Ala Ser Gln Asp Ile Ser Arg Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Asn Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Phe Ser Tyr Pro Arg 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 283 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 283 caggacatta gtcgttat 18 <210> 284 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 284 Gln Asp Ile Ser Arg Tyr 1 5 <210> 285 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 285 gctgcatcc 9 <210> 286 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 286 Ala Ala Ser 1 <210> 287 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 287 caacagctttttagttaccctcggacg 27 <210> 288 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 288 Gln Gln Leu Phe Ser Tyr Pro Arg Thr 1 5 <210> 289 <211> 366 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 289 caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cgtctggatt cagtttcagt agttatggca tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcagtg atgtggtatg atggaagtaa tgaatattat 180 gcagactccg tgaagggtcg attcatcatc tccagagaca attccaagag tacgctgtat 240 ctggaaatga acagcctgag agccgaggac acggctctgt attactgtgc gagagaggac 300 tgggacgagg gctactatta cggtatggac gtctggggcc aagggaccac ggtcaccgtc 360 tcctca 366 <210> 290 <211> 122 <212> PRT <213> Artificial sequence <220> <223> Synthetic <400> 290 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Ser Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Met Trp Tyr Asp Gly Ser Asn Glu Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Ile Ile Ser Arg Asp Asn Ser Lys Ser Thr Leu Tyr 65 70 75 80 Leu Glu Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Ala Arg Glu Asp Trp Asp Glu Gly Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 291 <211> 24 <212> DNA <213> artificial sequence <220> <223> synthesis <400> 291 ggattcagtt tcagtagtta tggc 24 <210> 292 <211> 8 <212> PRT <213> artificial sequence <220> <223> synthesis <400> 292 Gly Phe Ser Phe Ser Ser Tyr Gly 1 5 <210> 293 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 293 atgtggtatg atggaagtaa tgaa 24 <210> 294 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 294 Met Trp Tyr Asp Gly Ser Asn Glu 1 5 <210> 295 <211> 45 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 295 gcgagagg actgggacga gggctactat tacggtatgg acgtc 45 <210> 296 <211> 15 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 296 Ala Arg Glu Asp Trp Asp Glu Gly Tyr Tyr Tyr Gly Met Asp Val 1 5 10 15 <210> 297 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Synthesis <400> 297 gacatccaga tgacccagtc tccatcctcc ctgtttgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggcaagtca ggacattaga tatgatttag gctggtatca gcagaaacca 120 gggaaagccc ctaagcgcct gatatatgct tcatccattt tggaaagtgg ggtcccatca 180 aggttcagcg gcagtggatc tgggacagaa tacactctca caatcagcac cctgcagtct 240 gaagattttg caatttatta ctgtctacag cataatagtt tcccgtggac gttcggccaa 300 gggaccaagg tggaaatcaa a 321 <210> 298 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthesis <400> 298 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Phe Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg Tyr Asp 20 25 30 Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu Ile 35 40 45 Tyr Ala Ser Ser Ile Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Thr Leu Gln Ser 65 70 75 80 Glu Asp Phe Ala Ile Tyr Tyr Cys Leu Gln His Asn Ser Phe Pro Trp 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 299 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 299 caggacatta gatatgat 18 <210> 300 <211> 6 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 300 Gln Asp Ile Arg Tyr Asp 1 5 <210> 301 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 301 gcttcatcc 9 <210> 302 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 302 Ala Ser Ser 1 <210> 303 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 303 ctacagcata atagtttccc gtggacg 27 <210> 304 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthesis <400> 304 Leu Gln His Asn Ser Phe Pro Trp Thr 1 5 <210> 305 <211> 664 <212> PRT <213> Artificial sequence <220> <223> mROR1(M1-A29)-hRET(L29-R635)-mycmychis6 <400> 305 Met His Arg Pro Arg Arg Arg Gly Thr Arg Pro Pro Pro Leu Ala Leu 1 5 10 15 Leu Ala Ala Leu Leu Leu Ala Ala Arg Gly Ala Asp Ala Leu Tyr Phe 20 25 30 Ser Arg Asp Ala Tyr Trp Glu Lys Leu Tyr Val Asp Gln Ala Ala Gly 35 40 45 Thr Pro Leu Leu Tyr Val His Ala Leu Arg Asp Ala Pro Glu Glu Val 50 55 60 Pro Ser Phe Arg Leu Gly Gln His Leu Tyr Gly Thr Tyr Arg Thr Arg 65 70 75 80 Leu His Glu Asn Asn Trp Ile Cys Ile Gln Glu Asp Thr Gly Leu Leu 85 90 95 Tyr Leu Asn Arg Ser Leu Asp His Ser Ser Trp Glu Lys Leu Ser Val 100 105 110 Arg Asn Arg Gly Phe Pro Leu Leu Thr Val Tyr Leu Lys Val Phe Leu 115 120 125 Ser Pro Thr Ser Leu Arg Glu Gly Glu Cys Gln Trp Pro Gly Cys Ala 130 135 140 Arg Val Tyr Phe Ser Phe Phe Asn Thr Ser Phe Pro Ala Cys Ser Ser 145 150 155 160 Leu Lys Pro Arg Glu Leu Cys Phe Pro Glu Thr Arg Pro Ser Phe Arg 165 170 175 Ile Arg Glu Asn Arg Pro Pro Gly Thr Phe His Gln Phe Arg Leu Leu 180 185 190 Pro Val Gln Phe Leu Cys Pro Asn Ile Ser Val Ala Tyr Arg Leu Leu 195 200 205 Glu Gly Glu Gly Leu Pro Phe Arg Cys Ala Pro Asp Ser Leu Glu Val 210 215 220 Ser Thr Arg Trp Ala Leu Asp Arg Glu Gln Arg Glu Lys Tyr Glu Leu 225 230 235 240 Val Ala Val Cys Thr Val His Ala Gly Ala Arg Glu Glu Val Val Met 245 250 255 Val Pro Phe Pro Val Thr Val Tyr Asp Glu Asp Asp Ser Ala Pro Thr 260 265 270 Phe Pro Ala Gly Val Asp Thr Ala Ser Ala Val Val Glu Phe Lys Arg 275 280 285 Lys Glu Asp Thr Val Val Ala Thr Leu Arg Val Phe Asp Ala Asp Val 290 295 300 Val Pro Ala Ser Gly Glu Leu Val Arg Arg Tyr Thr Ser Thr Leu Leu 305 310 315 320 Pro Gly Asp Thr Trp Ala Gln Gln Thr Phe Arg Val Glu His Trp Pro 325 330 335 Asn Glu Thr Ser Val Gln Ala Asn Gly Ser Phe Val Arg Ala Thr Val 340 345 350 His Asp Tyr Arg Leu Val Leu Asn Arg Asn Leu Ser Ile Ser Glu Asn 355 360 365 Arg Thr Met Gln Leu Ala Val Leu Val Asn Asp Ser Asp Phe Gln Gly 370 375 380 Pro Gly Ala Gly Val Leu Leu Leu His Phe Asn Val Ser Val Leu Pro 385 390 395 400 Val Ser Leu His Leu Pro Ser Thr Tyr Ser Leu Ser Val Ser Arg Arg 405 410 415 Ala Arg Arg Phe Ala Gln Ile Gly Lys Val Cys Val Glu Asn Cys Gln 420 425 430 Ala Phe Ser Gly Ile Asn Val Gln Tyr Lys Leu His Ser Ser Gly Ala 435 440 445 Asn Cys Ser Thr Leu Gly Val Val Thr Ser Ala Glu Asp Thr Ser Gly 450 455 460 Ile Leu Phe Val Asn Asp Thr Lys Ala Leu Arg Arg Pro Lys Cys Ala 465 470 475 480 Glu Leu His Tyr Met Val Val Ala Thr Asp Gln Gln Thr Ser Arg Gln 485 490 495 Ala Gln Ala Gln Leu Leu Val Thr Val Glu Gly Ser Tyr Val Ala Glu 500 505 510 Glu Ala Gly Cys Pro Leu Ser Cys Ala Val Ser Lys Arg Arg Leu Glu 515 520 525 Cys Glu Glu Cys Gly Gly Leu Gly Ser Pro Thr Gly Arg Cys Glu Trp 530 535 540 Arg Gln Gly Asp Gly Lys Gly Ile Thr Arg Asn Phe Ser Thr Cys Ser 545 550 555 560 Pro Ser Thr Lys Thr Cys Pro Asp Gly His Cys Asp Val Val Glu Thr 565 570 575 Gln Asp Ile Asn Ile Cys Pro Gln Asp Cys Leu Arg Gly Ser Ile Val 580 585 590 Gly Gly His Glu Pro Gly Glu Pro Arg Gly Ile Lys Ala Gly Tyr Gly 595 600 605 Thr Cys Asn Cys Phe Pro Glu Glu Glu Lys Cys Phe Cys Glu Pro Glu 610 615 620 Asp Ile Gln Asp Pro Leu Cys Asp Glu Leu Cys Arg Glu Gln Lys Leu 625 630 635 640 Ile Ser Glu Glu Asp Leu Gly Gly Glu Gln Lys Leu Ile Ser Glu Glu 645 650 655 Asp Leu His His His His His His 660 <210> 306 <211> 664 <212> PRT <213> Artificial Sequence <220> <223> mROR1(M1-A29)-MfRET(L30-R636)-mycmychis6 <400> 306 Met His Arg Pro Arg Arg Arg Gly Thr Arg Pro Pro Pro Leu Ala Leu 1 5 10 15 Leu Ala Ala Leu Leu Leu Ala Ala Arg Gly Ala Asp Ala Leu Tyr Phe 20 25 30 Ser Arg Asp Ala Tyr Trp Glu Lys Leu Tyr Val Asp Gln Pro Ala Gly 35 40 45 Thr Pro Leu Leu Tyr Val His Ala Leu Arg Asp Ala Pro Glu Glu Val 50 55 60 Pro Ser Phe Arg Leu Gly Gln His Leu Tyr Gly Thr Tyr Arg Thr Arg 65 70 75 80 Leu His Glu Asn Asn Trp Ile Cys Ile Gln Glu Asp Thr Gly Leu Leu 85 90 95 Tyr Leu Asn Arg Ser Leu Asp Arg Ser Ser Trp Glu Lys Leu Ser Gly 100 105 110 Arg Asn Arg Gly Phe Pro Leu Leu Thr Val Tyr Leu Lys Val Phe Leu 115 120 125 Ser Pro Thr Ser Leu Arg Glu Gly Glu Cys Gln Trp Pro Gly Cys Ala 130 135 140 Arg Val Tyr Phe Ser Phe Phe Asn Thr Ser Phe Pro Ala Cys Thr Ser 145 150 155 160 Leu Lys Pro Arg Glu Leu Cys Phe Pro Glu Thr Arg Pro Ser Phe Arg 165 170 175 Ile Arg Glu Asn Arg Pro Pro Gly Thr Phe His Gln Phe Arg Leu Leu 180 185 190 Pro Val Gln Phe Leu Cys Pro Asn Ile Ser Val Ala Tyr Arg Leu Leu 195 200 205 Glu Gly Glu Gly Leu Pro Phe Arg Cys Ala Pro Asp Ser Leu Glu Val 210 215 220 Ser Thr Arg Trp Ala Leu Asp Arg Glu Gln Arg Glu Lys Tyr Glu Leu 225 230 235 240 Val Ala Val Cys Thr Val His Ala Gly Ala Arg Glu Glu Val Val Met 245 250 255 Val Pro Phe Pro Val Thr Val Tyr Asp Glu Asp Asp Ser Ala Pro Thr 260 265 270 Phe Pro Ala Gly Val Asp Thr Ala Ser Ala Val Val Glu Phe Lys Arg 275 280 285 Lys Glu Asp Thr Val Val Ala Thr Leu Arg Val Phe Asp Ala Asp Val 290 295 300 Val Pro Ala Ser Gly Glu Leu Val Arg Arg Tyr Thr Ser Thr Leu Leu 305 310 315 320 Pro Gly Asp Thr Trp Thr Gln Gln Thr Phe Arg Val Glu His Trp Pro 325 330 335 Asn Glu Thr Ser Val Gln Ala Asn Gly Ser Phe Val Arg Ala Thr Val 340 345 350 His Asp Tyr Arg Leu Val Leu Asn Arg Asn Leu Ser Ile Ser Glu Asn 355 360 365 Arg Thr Met Gln Leu Ala Val Leu Val Asn Asp Ser Asp Phe Gln Gly 370 375 380 Pro Gly Ala Gly Val Leu Leu Leu His Phe Asn Val Ser Val Leu Pro 385 390 395 400 Val Ser Leu His Leu Pro Ser Ser Tyr Ser Leu Ser Val Ser Arg Arg 405 410 415 Ala Arg Arg Phe Ala Gln Ile Gly Lys Val Cys Val Glu Asn Cys Gln 420 425 430 Ala Phe Ser Gly Ile Asn Val Gln Tyr Glu Leu His Ser Ser Gly Ala 435 440 445 Asn Cys Ser Thr Leu Gly Val Val Thr Ser Ala Glu Asp Thr Ser Gly 450 455 460 Ile Leu Phe Val Asn Asp Thr Lys Ala Leu Arg Arg Pro Lys Cys Ala 465 470 475 480 Glu Leu His Tyr Met Val Val Ala Thr Asn His Gln Thr Ser Arg Gln 485 490 495 Ala Gln Ala Gln Leu Leu Val Thr Val Glu Gly Leu Tyr Val Ala Glu 500 505 510 Glu Ala Gly Cys Pro Leu Ser Cys Ala Val Ser Lys Arg Arg Pro Glu 515 520 525 Cys Glu Glu Cys Gly Gly Leu Gly Ser Pro Thr Gly Arg Cys Glu Trp 530 535 540 Arg Gln Gly Asp Gly Lys Gly Ile Thr Arg Asn Phe Ser Thr Cys Ser 545 550 555 560 Pro Ser Thr Lys Thr Cys Pro Asp Gly His Cys Asp Val Val Glu Thr 565 570 575 Gln Asp Ile Asn Ile Cys Pro Gln Asp Cys Leu Arg Gly Ser Ile Val 580 585 590 Gly Gly His Glu Pro Gly Glu Pro Arg Gly Ile Lys Ala Gly Tyr Gly 595 600 605 Thr Cys Asn Cys Phe Pro Glu Glu Glu Lys Cys Phe Cys Glu Pro Glu 610 615 620 Asp Ile Gln Asp Pro Leu Cys Asp Glu Leu Cys Arg Glu Gln Lys Leu 625 630 635 640 Ile Ser Glu Glu Asp Leu Gly Gly Glu Gln Lys Leu Ile Ser Glu Glu 645 650 655 Asp Leu His His His His His His 660 <210> 307 <211> 869 <212> PRT <213> Artificial Sequence <220> <223> mROR1(M1-A29)-hRET(L29-R635)-mIgG2aFc <400> 307 Met His Arg Pro Arg Arg Arg Gly Thr Arg Pro Pro Pro Leu Ala Leu 1 5 10 15 Leu Ala Ala Leu Leu Leu Ala Ala Arg Gly Ala Asp Ala Leu Tyr Phe 20 25 30 Ser Arg Asp Ala Tyr Trp Glu Lys Leu Tyr Val Asp Gln Ala Ala Gly 35 40 45 Thr Pro Leu Leu Tyr Val His Ala Leu Arg Asp Ala Pro Glu Glu Val 50 55 60 Pro Ser Phe Arg Leu Gly Gln His Leu Tyr Gly Thr Tyr Arg Thr Arg 65 70 75 80 Leu His Glu Asn Asn Trp Ile Cys Ile Gln Glu Asp Thr Gly Leu Leu 85 90 95 Tyr Leu Asn Arg Ser Leu Asp His Ser Ser Trp Glu Lys Leu Ser Val 100 105 110 Arg Asn Arg Gly Phe Pro Leu Leu Thr Val Tyr Leu Lys Val Phe Leu 115 120 125 Ser Pro Thr Ser Leu Arg Glu Gly Glu Cys Gln Trp Pro Gly Cys Ala 130 135 140 Arg Val Tyr Phe Ser Phe Phe Asn Thr Ser Phe Pro Ala Cys Ser Ser 145 150 155 160 Leu Lys Pro Arg Glu Leu Cys Phe Pro Glu Thr Arg Pro Ser Phe Arg 165 170 175 Ile Arg Glu Asn Arg Pro Pro Gly Thr Phe His Gln Phe Arg Leu Leu 180 185 190 Pro Val Gln Phe Leu Cys Pro Asn Ile Ser Val Ala Tyr Arg Leu Leu 195 200 205 Glu Gly Glu Gly Leu Pro Phe Arg Cys Ala Pro Asp Ser Leu Glu Val 210 215 220 Ser Thr Arg Trp Ala Leu Asp Arg Glu Gln Arg Glu Lys Tyr Glu Leu 225 230 235 240 Val Ala Val Cys Thr Val His Ala Gly Ala Arg Glu Glu Val Val Met 245 250 255 Val Pro Phe Pro Val Thr Val Tyr Asp Glu Asp Asp Ser Ala Pro Thr 260 265 270 Phe Pro Ala Gly Val Asp Thr Ala Ser Ala Val Val Glu Phe Lys Arg 275 280 285 Lys Glu Asp Thr Val Val Ala Thr Leu Arg Val Phe Asp Ala Asp Val 290 295 300 Val Pro Ala Ser Gly Glu Leu Val Arg Arg Tyr Thr Ser Thr Leu Leu 305 310 315 320 Pro Gly Asp Thr Trp Ala Gln Gln Thr Phe Arg Val Glu His Trp Pro 325 330 335 Asn Glu Thr Ser Val Gln Ala Asn Gly Ser Phe Val Arg Ala Thr Val 340 345 350 His Asp Tyr Arg Leu Val Leu Asn Arg Asn Leu Ser Ile Ser Glu Asn 355 360 365 Arg Thr Met Gln Leu Ala Val Leu Val Asn Asp Ser Asp Phe Gln Gly 370 375 380 Pro Gly Ala Gly Val Leu Leu Leu His Phe Asn Val Ser Val Leu Pro 385 390 395 400 Val Ser Leu His Leu Pro Ser Thr Tyr Ser Leu Ser Val Ser Arg Arg 405 410 415 Ala Arg Arg Phe Ala Gln Ile Gly Lys Val Cys Val Glu Asn Cys Gln 420 425 430 Ala Phe Ser Gly Ile Asn Val Gln Tyr Lys Leu His Ser Ser Gly Ala 435 440 445 Asn Cys Ser Thr Leu Gly Val Val Thr Ser Ala Glu Asp Thr Ser Gly 450 455 460 Ile Leu Phe Val Asn Asp Thr Lys Ala Leu Arg Arg Pro Lys Cys Ala 465 470 475 480 Glu Leu His Tyr Met Val Val Ala Thr Asp Gln Gln Thr Ser Arg Gln 485 490 495 Ala Gln Ala Gln Leu Leu Val Thr Val Glu Gly Ser Tyr Val Ala Glu 500 505 510 Glu Ala Gly Cys Pro Leu Ser Cys Ala Val Ser Lys Arg Arg Leu Glu 515 520 525 Cys Glu Glu Cys Gly Gly Leu Gly Ser Pro Thr Gly Arg Cys Glu Trp 530 535 540 Arg Gln Gly Asp Gly Lys Gly Ile Thr Arg Asn Phe Ser Thr Cys Ser 545 550 555 560 Pro Ser Thr Lys Thr Cys Pro Asp Gly His Cys Asp Val Val Glu Thr 565 570 575 Gln Asp Ile Asn Ile Cys Pro Gln Asp Cys Leu Arg Gly Ser Ile Val 580 585 590 Gly Gly His Glu Pro Gly Glu Pro Arg Gly Ile Lys Ala Gly Tyr Gly 595 600 605 Thr Cys Asn Cys Phe Pro Glu Glu Glu Lys Cys Phe Cys Glu Pro Glu 610 615 620 Asp Ile Gln Asp Pro Leu Cys Asp Glu Leu Cys Arg Glu Pro Arg Gly 625 630 635 640 Pro Thr Ile Lys Pro Cys Pro Pro Cys Lys Cys Pro Ala Pro Asn Leu 645 650 655 Leu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Ile Lys Asp Val 660 665 670 Leu Met Ile Ser Leu Ser Pro Ile Val Thr Cys Val Val Val Asp Val 675 680 685 Ser Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val 690 695 700 Glu Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser 705 710 715 720 Thr Leu Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Met 725 730 735 Ser Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ala 740 745 750 Pro Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly Ser Val Arg Ala Pro 755 760 765 Gln Val Tyr Val Leu Pro Pro Pro Glu Glu Glu Met Thr Lys Lys Gln 770 775 780 Val Thr Leu Thr Cys Met Val Thr Asp Phe Met Pro Glu Asp Ile Tyr 785 790 795 800 Val Glu Trp Thr Asn Asn Gly Lys Thr Glu Leu Asn Tyr Lys Asn Thr 805 810 815 Glu Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe Met Tyr Ser Lys Leu 820 825 830 Arg Val Glu Lys Lys Asn Trp Val Glu Arg Asn Ser Tyr Ser Cys Ser 835 840 845 Val Val His Glu Gly Leu His Asn His His Thr Thr Lys Ser Phe Ser 850 855 860 Arg Thr Pro Gly Lys 865 <210> 308 <211> 667 <212> PRT <213> Artificial Sequence <220> <223> mROR1(M1-A29)-hGFRalpha1(D25-S429)-mIgG2aFc <400> 308 Met His Arg Pro Arg Arg Arg Gly Thr Arg Pro Pro Pro Leu Ala Leu 1 5 10 15 Leu Ala Ala Leu Leu Leu Ala Ala Arg Gly Ala Asp Ala Asp Arg Leu 20 25 30 Asp Cys Val Lys Ala Ser Asp Gln Cys Leu Lys Glu Gln Ser Cys Ser 35 40 45 Thr Lys Tyr Arg Thr Leu Arg Gln Cys Val Ala Gly Lys Glu Thr Asn 50 55 60 Phe Ser Leu Ala Ser Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala 65 70 75 80 Met Glu Ala Leu Lys Gln Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg 85 90 95 Gly Met Lys Lys Glu Lys Asn Cys Leu Arg Ile Tyr Trp Ser Met Tyr 100 105 110 Gln Ser Leu Gln Gly Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro 115 120 125 Val Asn Ser Arg Leu Ser Asp Ile Phe Arg Val Val Pro Phe Ile Ser 130 135 140 Asp Val Phe Gln Gln Val Glu His Ile Pro Lys Gly Asn Asn Cys Leu 145 150 155 160 Asp Ala Ala Lys Ala Cys Asn Leu Asp Asp Ile Cys Lys Tyr Arg 165 170 175 Ser Ala Tyr Ile Thr Pro Cys Thr Thr Ser Val Ser Asn Val Cys 180 185 190 Asn Arg Arg Lys Cys His Lys Ala Leu Arg Gln Phe Phe Asp Lys Val 195 200 205 Pro Ala Lys His Ser Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp Ile 210 215 220 Only Cys Thr Glu Arg Arg Arg Gln Thr Ile Val Pro Val Cys Ser Tyr 225 230 235 240 Glu Glu Arg Glu Lys Pro Asn Cys Leu Asn Leu Gln Asp Ser Cys Lys 245 250 255 Thr Asn Tyr Ile Cys Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys 260 265 270 Gln Pro Glu Ser Arg Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala 275 280 285 Asp Cys Leu Leu Ala Tyr Ser Gly Leu Ile Gly Thr Val Met Thr Pro 290 295 300 Asn Tyr Ile Asp Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys 305 310 315 320 Ser Asn Ser Gly Asn Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe 325 330 335 Phe Lys Asp Asn Thr Cys Leu Lys Asn Ala Ile Gln Ala Phe Gly Asn 340 345 350 Gly Ser Asp Val Thr Val Trp Gln Pro Ala Phe Pro Val Gln Thr Thr 355 360 365 Thr Ala Thr Thr Thr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly 370 375 380 Pro Ala Gly Ser Glu Asn Glu Ile Pro Thr His Val Leu Pro Pro Cys 385 390 395 400 Ala Asn Leu Gln Ala Gln Lys Leu Lys Ser Asn Val Ser Gly Asn Thr 405 410 415 His Leu Cys Ile Ser Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala 420 425 430 Ser Ser Glu Pro Arg Gly Pro Thr Ile Lys Pro Cys Pro Pro Cys Lys 435 440 445 Cys Pro Ala Pro Asn Leu Leu Gly Gly Pro Ser Val Phe Ile Phe Pro 450 455 460 Pro Lys Ile Lys Asp Val Leu Met Ile Ser Leu Ser Pro Ile Val Thr 465 470 475 480 Cys Val Val Val Asp Val Ser Glu Asp Asp Pro Asp Val Gln Ile Ser 485 490 495 Trp Phe Val Asn Asn Val Glu Val His Thr Ala Gln Thr Gln Thr His 500 505 510 Arg Glu Asp Tyr Asn Ser Thr Leu Arg Val Val Ser Ala Leu Pro Ile 515 520 525 Gln His Gln Asp Trp Met Ser Gly Lys Glu Phe Lys Cys Lys Val Asn 530 535 540 Asn Lys Asp Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys Pro Lys 545 550 555 560 Gly Ser Val Arg Ala Pro Gln Val Tyr Val Leu Pro Pro Pro Glu Glu 565 570 575 Glu Met Thr Lys Lys Gln Val Thr Leu Thr Cys Met Val Thr Asp Phe 580 585 590 Methionine, Proline, Glutamic acid, Aspartic acid, Isoleucine, Tyrosine, Valine, Glutamic acid, Tryptophan, Threonine, Asparagine, Asparagine, Glycine, Lysine, Threonine, Glutamic acid 595 600 605 Leucine, Asparagine, Tyrosine, Lysine, Asparagine, Threonine, Glutamic acid, Proline, Valine, Leucine, Aspartic acid, Serine, Aspartic acid, Glycine, Serine, Tyrosine 610 615 620 Phenylalanine, Methionine, Tyrosine, Serine, Lysine, Leucine, Arginine, Valine, Glutamic acid, Lysine, Lysine, Asparagine, Tryptophan, Valine, Glutamic acid, Arginine 625 630 635 640 Asparagine, Serine, Tyrosine, Serine, Cysteine, Serine, Valine, Valine, Histidine, Glutamic acid, Glycine, Leucine, Histidine, Asparagine, Histidine, Histidine 645 650 655 Threonine, Threonine, Lysine, Serine, Phenylalanine, Serine, Arginine, Threonine, Proline, Glycine, Lysine 660 665 <210> 309 <211> 5629 <212> DNA <213> Artificial Sequence <220> <223> Based on Homo sapiens sequence - hRET cDNA, isoform a (RET51), NM_020975.4 <400> 309 agtcccgcga ccgaagcagg gcgcgcagca gcgctgagtg ccccggaacg tgcgtcgcgc 60 ccccagtgtc cgtcgcgtcc gccgcgcccc gggcggggat ggggcggcca gactgagcgc 120 cgcacccgcc atccagaccc gccggcccta gccgcagtcc ctccagccgt ggccccagcg 180 cgcacgggcg atggcgaagg cgacgtccgg tgccgcgggg ctgcgtctgc tgttgctgct 240 gctgctgccg ctgctaggca aagtggcatt gggcctctac ttctcgaggg atgcttactg 300 ggagaagctg tatgtggacc aggcggccgg cacgcccttg ctgtacgtcc atgccctgcg 360 ggacgcccct gaggaggtgc ccagcttccg cctgggccag catctctacg gcacgtaccg 420 cacacggctg catgagaaca actggatctg catccaggag gacaccggcc tcctctacct 480 taaccggagc ctggaccata gctcctggga gaagctcagt gtccgcaacc gcggctttcc 540 cctgctcacc gtctacctca aggtcttcct gtcacccaca tcccttcgtg agggcgagtg 600 ccagtggcca ggctgtgccc gcgtatactt ctccttcttc aacacctcct ttccagcctg 660 cagctccctc aagccccggg agctctgctt cccagagaca aggccctcct tccgcattcg 720 ggagaaccga cccccaggca ccttccacca gttccgcctg ctgcctgtgc agttcttgtg 780 ccccaacatc agcgtggcct acaggctcct ggagggtgag ggtctgccct tccgctgcgc 840 cccggacagc ctggaggtga gcacgcgctg ggccctggac cgcgagcagc gggagaagta 900 cgagctggtg gccgtgtgca ccgtgcacgc cggcgcgcgc gaggaggtgg tgatggtgcc 960 cttcccggtg accgtgtacg acgaggacga ctcggcgccc accttccccg cgggcgtcga 1020 caccgccagc gccgtggtgg agttcaagcg gaaggaggac accgtggtgg ccacgctgcg 1080 tgtcttcgat gcagacgtgg tacctgcatc aggggagctg gtgaggcggt acacaagcac 1140 gctgctcccc ggggacacct gggcccagca gaccttccgg gtggaacact ggcccaacga 1200 gacctcggtc caggccaacg gcagcttcgt gcgggcgacc gtacatgact ataggctggt 1260 tctcaaccgg aacctctcca tctcggagaa ccgcaccatg cagctggcgg tgctggtcaa 1320 tgactcagac ttccagggcc caggagcggg cgtcctcttg ctccacttca acgtgtcggt 1380 gctgccggtc agcctgcacc tgcccagtac ctactccctc tccgtgagca ggagggctcg 1440 ccgatttgcc cagatcggga aagtctgtgt ggaaaactgc caggcattca gtggcatcaa 1500 cgtccagtac aagctgcatt cctctggtgc caactgcagc acgctagggg tggtcacctc 1560 agccgaggac acctcgggga tcctgtttgt gaatgacacc aaggccctgc ggcggcccaa 1620 gtgtgccgaa cttcactaca tggtggtggc caccgaccag cagacctcta ggcaggccca ggcccagctg cttgtaacag tggaggggtc atatgtggcc gaggaggcgg gctgccccct 1740 gtcctgtgca gtcagcaaga gacggctgga gtgtgaggag tgtggcggcc tgggctcccc aacaggcagg tgtgagtgga ggcaaggaga tggcaaaggg atcaccagga acttctccac ctgctctccc cctgccccga cggccactgc gatgttgtgg 1920s catcaacatt tgccctcagg actgcctccg gggcagcatt gttgggggac acgagcctgg ggagccccgg gggattaaag ctggctatgg cacctgcaac tgcttccctg aggaggaga gtgcttctgc gagcccgag acatccagga tccactgtgc gacgagctgt gccgcacggt gatcgcagcc gctgtcctct tctccttcat cgtctcggtg ctgctgtctg ccttctgcat 2160 ccactgctac cacaagtttg cccacaagcc acccatctcc tcagctgaga tgaccttccg gaggcccgcc caggccttcc cggtcagcta ctcctcttcc ggtgcccgcc ggccctcgct 2280 2340. ggactccatg gagaaccagg tctccgtgga tgccttcaag atcctggagg atccaaagtg ggaattccct cggaagaact tggttcttgg aaaaactcta ggagaaggcg aatttggaaa 2400 agtggtcaag gcaacggcct tccatctgaa aggcagagca gggtacacca cggtggccgt 2460 gaagatgctg aaagagaacg cctccccgag tgagcttcga gacctgctgt cagagttcaa 2520 cgtcctgaag caggtcaacc acccacatgt catcaaattg tatggggcct gcagccagga 2580 tggcccgctc ctcctcatcg tggagtacgc caaatacggc tccctgcggg gcttcctccg 2640 cgagagccgc aaagtggggc ctggctacct gggcagtgga ggcagccgca actccagctc 2700 cctggaccac ccggatgagc gggccctcac catgggcgac ctcatctcat ttgcctggca 2760 gatctcacag gggatgcagt atctggccga gatgaagctc gttcatcggg acttggcagc 2820 cagaaacatc ctggtagctg aggggcggaa gatgaagatt tcggatttcg gcttgtcccg 2880 agatgtttat gaagaggatt cctacgtgaa gaggagccag ggtcggattc cagttaaatg 2940 gatggcaatt gaatcccttt ttgatcatat ctacaccacg caaagtgatg tatggtcttt 3000 tggtgtcctg ctgtgggaga tcgtgaccct agggggaaac ccctatcctg ggattcctcc 3060 tgagcggctc ttcaaccttc tgaagaccgg ccaccggatg gagaggccag acaactgcag cgaggagatg taccgcctga tgctgcaatg ctggaagcag gagccggaca aaaggccggt gtttgcggac atcagcaaag acctggagaa gatgatggtt aagaggagag actacttgga ccttgcggcg tccactccat ctgactccct gatttatgac gacggcctct rich gacaccgctg gtggactgta ataatgcccc cctccctcga gccctccctt ccacatggat 3420. tgaaaacaaa ctctatggca tgtcagaccc gaactggcct ggagagagtc ctgtaccact cacgagagct gatggcacta acactgggtt tccaagatat ccaaatgata gtgtatatgc taactggatg ctttcaccct cagcggcaaa attatggac acgtttgata gttaacattt ctttgtgaaa ggtaatggac tcacaagggg aagaaacatg ctgagaatgg aaagtctacc ggccctttct ttgtgaacgt cacattggcc gagccgtgtt cagttcccag gtggcagact 3660. cgtttttggt agtttgtttt aacttccaag gtggttttac ttctgatagc cggtgatttt 3720 ccctcctagc agacatgcca caccgggtaa gagctctgag tcttagtggt tagcattcc tttctcttca gtgcccagca gcacccagtg ttggtctgtg tccatcagtg accaccaaca 3840 ttctgtgttc acatgtgtgg gtccaacact tactacctgg tgtatgaaat tggacctgaa ctgttggatt tttctagttg ccgccaaaca aggcaaaaaa atttaaacat gaagcacaca cacaaaaaag gcagtagga aaatgctggc cctgatgacc tgtccttatt cagatgaga gactgcgggg ggggcctggg ggtagtgtca atgcccctcc agggctggag gggaagaggg 4080. gccccgagga tgggcctggg ctcagcattc gagatcttga gaatgatttt tttttaatca tgcaaccttt ccttaggaag acatttggtt ttcatcatga ttaagatgat tcctagattt agcacaatgg aggattcca tgccatcttt actatgtgga tggtggtatc agggagagg 4260 gctcacaaga cacatttgtc ccccggggccc accacatcat cctcacgtgt tcggtactga gcagccacta cccctgatga gaacagtatg aagaaagggg gctgttggag tcccagaatt gctgacagca gaggctttgc tgctgtgaat cccacctgcc accagcctgc agcacacccc 4440 acagccaagt agaggcgaaa gcagtggctc atcctacctg ttaggagcag gtagggcttg tactcacttt aatttgaatc ttatcaactt actcataaag ggacaggcta gctagctgtg 4560 ttagaagtag caatgacaat gaccaaggac tgctacacct ctgattacaa ttctgatgtg 4620 aaaaagatgg tgtttggctc ttatagagcc tgtgtgaaag gcccatggat cagctcttcc 4680 tgtgtttgta atttaatgct gctacaagat gtttctgttt cttagattct gaccatgact 4740 cataagcttc ttgtcattct tcattgcttg tttgtggtca cagatgcaca acactcctcc 4800 agtcttgtgg gggcagcttt tgggaagtct cagcagctct tctggctgtg ttgtcagcac 4860 tgtaacttcg cagaaaagag tcggattacc aaaacactgc ctgctcttca gacttaaagc 4920 actgatagga cttaaaatag tctcattcaa atactgtatt ttatataggc atttcacaaa 4980 aacagcaaaa ttgtggcatt ttgtgaggcc aaggcttgga tgcgtgtgta atagagcctt 5040 gtggtgtgtg cgcacacacc cagagggaga gtttgaaaaa tgcttattgg acacgtaacc 5100 tggctctaat ttgggctgtt tttcagatac actgtgataa gttcttttac aaatatctat 5160 agacatggta aacttttggt tttcagatat gcttaatgat agtcttacta aatgcagaaa 5220 taagaataaa ctttctcaaa ttattaaaaa tgcctacaca gtaagtgtga attgctgcaa 5280 caggtttgtt ctcaggaggg taagaactcc aggtctaaac agctgaccca gtgatgggga 5340 atttatcctt gaccaattta tccttgacca ataacctaat tgtctattcc tgagttataa 5400 aagtccccat ccttattagc tctactggaa ttttcataca cgtaaatgca gaagttacta 5460 agtattaagt attactgagt attaagtagt aatctgtcag ttattaaaat ttgtaaaatc 5520 tatttatgaa aggtcattaa accagatcat gttccttttt ttgtaatcaa ggtgactaag 5580 aaaatcagtt gtgtaaataa aatcatgtat cataaaaaaa aaaaaaaaa 5629 <210> 310 <211> 1114 <212> PRT <213> Artificial Sequence <220> <223> Based on Homo sapiens sequence - hRET isoform a (RET51), NP_066124.1 <400> 310 Met Ala Lys Ala Thr Ser Gly Ala Ala Gly Leu Arg Leu Leu Leu Leu 1 5 10 15 Leu Leu Leu Pro Leu Leu Gly Lys Val Ala Leu Gly Leu Tyr Phe Ser 20 25 30 Arg Asp Ala Tyr Trp Glu Lys Leu Tyr Val Asp Gln Ala Ala Gly Thr 35 40 45 Pro Leu Leu Tyr Val His Ala Leu Arg Asp Ala Pro Glu Glu Val Pro 50 55 60 Ser Phe Arg Leu Gly Gln His Leu Tyr Gly Thr Tyr Arg Thr Arg Leu 65 70 75 80 His Glu Asn Asn Trp Ile Cys Ile Gln Glu Asp Thr Gly Leu Leu Tyr 85 90 95 Leu Asn Arg Ser Leu Asp His Ser Ser Trp Glu Lys Leu Ser Val Arg 100 105 110 Asn Arg Gly Phe Pro Leu Leu Thr Val Tyr Leu Lys Val Phe Leu Ser 115 120 125 Pro Thr Ser Leu Arg Glu Gly Glu Cys Gln Trp Pro Gly Cys Ala Arg 130 135 140 Val Tyr Phe Ser Phe Phe Asn Thr Ser Phe Pro Ala Cys Ser Ser Leu 145 150 155 160 Lys Pro Arg Glu Leu Cys Phe Pro Glu Thr Arg Pro Ser Phe Arg Ile 165 170 175 Arg Glu Asn Arg Pro Pro Gly Thr Phe His Gln Phe Arg Leu Leu Pro 180 185 190 Val Gln Phe Leu Cys Pro Asn Ile Ser Val Ala Tyr Arg Leu Leu Glu 195 200 205 Gly Glu Gly Leu Pro Phe Arg Cys Ala Pro Asp Ser Leu Glu Val Ser 210 215 220 Thr Arg Trp Ala Leu Asp Arg Glu Gln Arg Glu Lys Tyr Glu Leu Val 225 230 235 240 Ala Val Cys Thr Val His Ala Gly Ala Arg Glu Glu Val Val Met Val 245 250 255 Pro Phe Pro Val Thr Val Tyr Asp Glu Asp Asp Ser Ala Pro Thr Phe 260 265 270 Pro Ala Gly Val Asp Thr Ala Ser Ala Val Val Glu Phe Lys Arg Lys 275 280 285 Glu Asp Thr Val Val Ala Thr Leu Arg Val Phe Asp Ala Asp Val Val 290 295 300 Pro Ala Ser Gly Glu Leu Val Arg Arg Tyr Thr Ser Thr Leu Leu Pro 305 310 315 320 Gly Asp Thr Trp Ala Gln Gln Thr Phe Arg Val Glu His Trp Pro Asn 325 330 335 Glu Thr Ser Val Gln Ala Asn Gly Ser Phe Val Arg Ala Thr Val His 340 345 350 Asp Tyr Arg Leu Val Leu Asn Arg Asn Leu Ser Ile Ser Glu Asn Arg 355 360 365 Thr Met Gln Leu Ala Val Leu Val Asn Asp Ser Asp Phe Gln Gly Pro 370 375 380 Gly Ala Gly Val Leu Leu Leu His Phe Asn Val Ser Val Leu Pro Val 385 390 395 400 Ser Leu His Leu Pro Ser Thr Tyr Ser Leu Ser Val Ser Arg Arg Ala 405 410 415 Arg Arg Phe Ala Gln Ile Gly Lys Val Cys Val Glu Asn Cys Gln Ala 420 425 430 Phe Ser Gly Ile Asn Val Gln Tyr Lys Leu His Ser Ser Gly Ala Asn 435 440 445 Cys Ser Thr Leu Gly Val Val Thr Ser Ala Glu Asp Thr Ser Gly Ile 450 455 460 Leu Phe Val Asn Asp Thr Lys Ala Leu Arg Arg Pro Lys Cys Ala Glu 465 470 475 480 Leu His Tyr Met Val Val Ala Thr Asp Gln Gln Thr Ser Arg Gln Ala 485 490 495 Gln Ala Gln Leu Leu Val Thr Val Glu Gly Ser Tyr Val Ala Glu Glu 500 505 510 Ala Gly Cys Pro Leu Ser Cys Ala Val Ser Lys Arg Arg Leu Glu Cys 515 520 525 Glu Glu Cys Gly Gly Leu Gly Ser Pro Thr Gly Arg Cys Glu Trp Arg 530 535 540 Gln Gly Asp Gly Lys Gly Ile Thr Arg Asn Phe Ser Thr Cys Ser Pro 545 550 555 560 Ser Thr Lys Thr Cys Pro Asp Gly His Cys Asp Val Val Glu Thr Gln 565 570 575 Asp Ile Asn Ile Cys Pro Gln Asp Cys Leu Arg Gly Ser Ile Val Gly 580 585 590 Gly His Glu Pro Gly Glu Pro Arg Gly Ile Lys Ala Gly Tyr Gly Thr 595 600 605 Cys Asn Cys Phe Pro Glu Glu Glu Lys Cys Phe Cys Glu Pro Glu Asp 610 615 620 Ile Gln Asp Pro Leu Cys Asp Glu Leu Cys Arg Thr Val Ile Ala Ala 625 630 635 640 Ala Val Leu Phe Ser Phe Ile Val Ser Val Leu Leu Ser Ala Phe Cys 645 650 655 Ile His Cys Tyr His Lys Phe Ala His Lys Pro Pro Ile Ser Ser Ala 660 665 670 Glu Met Thr Phe Arg Arg Pro Ala Gln Ala Phe Pro Val Ser Tyr Ser 675 680 685 Ser Ser Gly Ala Arg Arg Pro Ser Leu Asp Ser Met Glu Asn Gln Val 690 695 700 Ser Val Asp Ala Phe Lys Ile Leu Glu Asp Pro Lys Trp Glu Phe Pro 705 710 715 720 Arg Lys Asn Leu Val Leu Gly Lys Thr Leu Gly Glu Gly Glu Phe Gly 725 730 735 Lys Val Val Lys Ala Thr Ala Phe His Leu Lys Gly Arg Ala Gly Tyr 740 745 750 Thr Thr Val Ala Val Lys Met Leu Lys Glu Asn Ala Ser Pro Ser Glu 755 760 765 Leu Arg Asp Leu Leu Ser Glu Phe Asn Val Leu Lys Gln Val Asn His 770 775 780 Pro His Val Ile Lys Leu Tyr Gly Ala Cys Ser Gln Asp Gly Pro Leu 785 790 795 800 Leu Leu Ile Val Glu Tyr Ala Lys Tyr Gly Ser Leu Arg Gly Phe Leu 805 810 815 Arg Glu Ser Arg Lys Val Gly Pro Gly Tyr Leu Gly Ser Gly Gly Ser 820 825 830 Arg Asn Ser Ser Ser Leu Asp His Pro Asp Glu Arg Ala Leu Thr Met 835 840 845 Gly Asp Leu Ile Ser Phe Ala Trp Gln Ile Ser Gln Gly Met Gln Tyr 850 855 860 Leu Ala Glu Met Lys Leu Val His Arg Asp Leu Ala Ala Arg Asn Ile 865 870 875 880 Leu Val Ala Glu Gly Arg Lys Met Lys Ile Ser Asp Phe Gly Leu Ser 885 890 895 Arg Asp Val Tyr Glu Glu Asp Ser Tyr Val Lys Arg Ser Gln Gly Arg 900 905 910 Ile Pro Val Lys Trp Met Ala Ile Glu Ser Leu Phe Asp His Ile Tyr 915 920 925 Thr Thr Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile 930 935 940 Val Thr Leu Gly Gly Asn Pro Tyr Pro Gly Ile Pro Pro Glu Arg Leu 945 950 955 960 Phe Asn Leu Leu Lys Thr Gly His Arg Met Glu Arg Pro Asp Asn Cys 965 970 975 Ser Glu Glu Met Tyr Arg Leu Met Leu Gln Cys Trp Lys Gln Glu Pro 980 985 990 Asp Lys Arg Pro Val Phe Ala Asp Ile Ser Lys Asp Leu Glu Lys Met 995 1000 1005 Met Val Lys Arg Arg Asp Tyr Leu Asp Leu Ala Ala Ser Thr Pro 1010 1015 1020 Ser Asp Ser Leu Ile Tyr Asp Asp Gly Leu Ser Glu Glu Glu Thr 1025 1030 1035 Pro Leu Val Asp Cys Asn Asn Ala Pro Leu Pro Arg Ala Leu Pro 1040 1045 1050 Ser Thr Trp Ile Glu Asn Lys Leu Tyr Gly Met Ser Asp Pro Asn 1055 1060 1065 Trp Pro Gly Glu Ser Pro Val Pro Leu Thr Arg Ala Asp Gly Thr 1070 1075 1080 Asn Thr Gly Phe Pro Arg Tyr Pro Asn Asp Ser Val Tyr Ala Asn 1085 1090 1095 Trp Met Leu Ser Pro Ser Ala Ala Lys Leu Met Asp Thr Phe Asp 1100 1105 1110 Looking <210> 311 <211> 4174 <212> DNA <213> artificial sequence <220> <223> Based on the Homo sapiens sequence - hRET cDNA, isoform c (RET9), NM_020630.4 <400> 311 agtcccgcga ccgaagcagg gcgcgcagca gcgctgagtg ccccggaacg tgcgtcgcgc 60 ccccagtgtc cgtcgcgtcc gccgcgcccc gggcggggat ggggcggcca gactgagcgc 120 cgcacccgcc atccagaccc gccggcccta gccgcagtcc ctccagccgt ggccccagcg 180 cgcacgggcg atggcgaagg cgacgtccgg tgccgcgggg ctgcgtctgc tgttgctgct 240 gctgctgccg ctgctaggca aagtggcatt gggcctctac ttctcgaggg atgcttactg 300 ggagaagctg tatgtggacc aggcggccgg cacgcccttg ctgtacgtcc atgccctgcg 360 ggacgcccct gaggaggtgc ccagcttccg cctgggccag catctctacg gcacgtaccg 420 cacacggctg catgagaaca actggatctg catccaggag gacaccggcc tcctctacct 480 taaccggagc ctggaccata gctcctggga gaagctcagt gtccgcaacc gcggctttcc 540 cctgctcacc gtctacctca aggtcttcct gtcacccaca tcccttcgtg agggcgagtg 600 ccagtggcca ggctgtgccc gcgtatactt ctccttcttc aacacctcct ttccagcctg 660 cagctccctc aagccccggg agctctgctt cccagagaca aggccctcct tccgcattcg 720 ggagaaccga cccccaggca ccttccacca gttccgcctg ctgcctgtgc agttcttgtg 780 ccccaacatc agcgtggcct acaggctcct ggagggtgag ggtctgccct tccgctgcgc 840 cccggacagc ctggaggtga gcacgcgctg ggccctggac cgcgagcagc gggagaagta 900 cgagctggtg gccgtgtgca ccgtgcacgc cggcgcgcgc gaggaggtgg tgatggtgcc 960 cttcccggtg accgtgtacg acgaggacga ctcggcgccc accttccccg cgggcgtcga 1020 caccgccagc gccgtggtgg agttcaagcg gaaggaggac accgtggtgg ccacgctgcg 1080 tgtcttcgat gcagacgtgg tacctgcatc aggggagctg gtgaggcggt acacaagcac 1140 gctgctcccc ggggacacct gggcccagca gaccttccgg gtggaacact ggcccaacga 1200 gacctcggtc caggccaacg gcagcttcgt gcgggcgacc gtacatgact ataggctggt 1260 tctcaaccgg aacctctcca tctcggagaa ccgcaccatg cagctggcgg tgctggtcaa 1320 tgactcagac ttccagggcc caggagcggg cgtcctcttg ctccacttca acgtgtcggt 1380 gctgccggtc agcctgcacc tgcccagtac ctactccctc tccgtgagca ggagggctcg 1440 ccgatttgcc cagatcggga aagtctgtgt ggaaaactgc caggcattca gtggcatcaa cgtccagtac aagctgcatt cctctggtgc caactgcagc acgctagggg tggtcacctc agccgaggac acctcgggga tcctgtttgt gaatgacacc aaggccctgc ggcggcccaa gtgtgccgaa cttcactaca tggtggtggc caccgaccag cagacctcta ggcaggccca ggcccagctg cttgtaacag tggaggggtc atatgtggcc gaggaggcgg gctgccccct 1740 gtcctgtgca gtcagcaaga gacggctgga gtgtgaggag tgtggcggcc tgggctcccc aacaggcagg tgtgagtgga ggcaaggaga tggcaaaggg atcaccagga acttctccac ctgctctccc cctgccccga cggccactgc gatgttgtgg 1920s catcaacatt tgccctcagg actgcctccg gggcagcatt gttgggggac acgagcctgg ggagccccgg gggattaaag ctggctatgg cacctgcaac tgcttccctg aggaggaga gtgcttctgc gagcccgag acatccagga tccactgtgc gacgagctgt gccgcacggt gatcgcagcc gctgtcctct tctccttcat cgtctcggtg ctgctgtctg ccttctgcat 2160 ccactgctac cacaagtttg cccacaagcc acccatctcc tcagctgaga tgaccttccg 2220 gaggcccgcc caggccttcc cggtcagcta ctcctcttcc ggtgcccgcc ggccctcgct 2280 ggactccatg gagaaccagg tctccgtgga tgccttcaag atcctggagg atccaaagtg 2340 ggaattccct cggaagaact tggttcttgg aaaaactcta ggagaaggcg aatttggaaa 2400 agtggtcaag gcaacggcct tccatctgaa aggcagagca gggtacacca cggtggccgt 2460 gaagatgctg aaagagaacg cctccccgag tgagcttcga gacctgctgt cagagttcaa 2520 cgtcctgaag caggtcaacc acccacatgt catcaaattg tatggggcct gcagccagga 2580 tggcccgctc ctcctcatcg tggagtacgc caaatacggc tccctgcggg gcttcctccg 2640 cgagagccgc aaagtggggc ctggctacct gggcagtgga ggcagccgca actccagctc 2700 cctggaccac ccggatgagc gggccctcac catgggcgac ctcatctcat ttgcctggca 2760 gatctcacag gggatgcagt atctggccga gatgaagctc gttcatcggg acttggcagc 2820 cagaaacatc ctggtagctg aggggcgga gatgaagatt tcggatttcg gcttgtcccg agatgtttat gaagaggatt cctacgtgaa gaggagccag ggtcggattc cagttaaatg gatggcaatt gatcccttt ttgatcatat ctacaccacg caaagtgatg tatggtcttt tggtgtcctg ctgtggggaga tcgtgaccct agggggaac ccctatcctg ggattcctcc 3060 tgagcggctc ttcaaccttc tgaagaccgg ccaccggatg gagaggccag acaactgcag cgaggagatg taccgcctga tgctgcaatg ctggaagcag gagccggaca aaaggccggt gtttgcggac atcagcaaag acctggagaa gatgatggtt aagaggagag actacttgga ccttgcggcg tccactccat ctgactccct gatttatgac gacggcctct rich gacaccgctg gtggactgta ataatgcccc cctccctcga gccctccctt ccacatggat tgaaaacaaa ctctatggta gaatttccca tgcatttact agattctagc accgctgtcc cctctgcact atccttcctc tctgtgatgc tttttaaaaa tgtttctggt ctgaacaaaa 3480 ccaaagtctg ctctgaacct ttttatttgt aaatgtctga ctttgcatcc agtttacatt taggcattat tgcaactatg tttttctaaa aggaagtgaa aataagtgta attaccacat 3600 tgcccagcaa cttaggatgg tagaggaaaa aacagatcag ggcggaactc tcaggggaga 3660 ccaagaacag gttgaataag gcgcttctgg ggtgggaatc aagtcatagt acttctactt 3720 taactaagtg gataaatata caaatctggg gaggtattca gttgagaaag gagccaccag 3780 caccactcag cctgcactgg gagcacagcc aggttccccc agacccctcc tgggcaggca 3840 ggtgcctctc agaggccacc cggcactggc gagcagccac tggccaagcc tcagccccag 3900 tcccagccac atgtcctcca tcaggggtag cgaggttgca ggagctggct ggccctggga 3960 ggacgcaccc ccactgctgt tttcacatcc tttcccttac ccaccttcag gacggttgtc 4020 acttatgaag tcagtgctaa agctggagca gttgcttttt gaaagaacat ggtctgtggt 4080 gctgtggtct tacaatggac agtaaatatg gttcttgcca aaactccttc ttttgtcttt 4140 gattaaatac tagaaattta aaaaaaaaaa aaaa 4174 <210> 312 <211> 1072 <212> PRT <213> Artificial Sequence <220> <223> Based on the Homo sapiens sequence - hRET isoform c (RET9), NP_065681.1 <400> 312 Met Ala Lys Ala Thr Ser Gly Ala Ala Gly Leu Arg Leu Leu Leu Leu 1 5 10 15 Leu Leu Leu Pro Leu Leu Gly Lys Val Ala Leu Gly Leu Tyr Phe Ser 20 25 30 Arg Asp Ala Tyr Trp Glu Lys Leu Tyr Val Asp Gln Ala Ala Gly Thr 35 40 45 Pro Leu Leu Tyr Val His Ala Leu Arg Asp Ala Pro Glu Glu Val Pro 50 55 60 Ser Phe Arg Leu Gly Gln His Leu Tyr Gly Thr Tyr Arg Thr Arg Leu 65 70 75 80 His Glu Asn Asn Trp Ile Cys Ile Gln Glu Asp Thr Gly Leu Leu Tyr 85 90 95 Leu Asn Arg Ser Leu Asp His Ser Ser Trp Glu Lys Leu Ser Val Arg 100 105 110 Asn Arg Gly Phe Pro Leu Leu Thr Val Tyr Leu Lys Val Phe Leu Ser 115 120 125 Pro Thr Ser Leu Arg Glu Gly Glu Cys Gln Trp Pro Gly Cys Ala Arg 130 135 140 Val Tyr Phe Ser Phe Phe Asn Thr Ser Phe Pro Ala Cys Ser Ser Leu 145 150 155 160 Lys Pro Arg Glu Leu Cys Phe Pro Glu Thr Arg Pro Ser Phe Arg Ile 165 170 175 Arg Glu Asn Arg Pro Pro Gly Thr Phe His Gln Phe Arg Leu Leu Pro 180 185 190 Val Gln Phe Leu Cys Pro Asn Ile Ser Val Ala Tyr Arg Leu Leu Glu 195 200 205 Gly Glu Gly Leu Pro Phe Arg Cys Ala Pro Asp Ser Leu Glu Val Ser 210 215 220 Thr Arg Trp Ala Leu Asp Arg Glu Gln Arg Glu Lys Tyr Glu Leu Val 225 230 235 240 Ala Val Cys Thr Val His Ala Gly Ala Arg Glu Glu Val Val Met Val 245 250 255 Pro Phe Pro Val Thr Val Tyr Asp Glu Asp Asp Ser Ala Pro Thr Phe 260 265 270 Pro Ala Gly Val Asp Thr Ala Ser Ala Val Val Glu Phe Lys Arg Lys 275 280 285 Glu Asp Thr Val Val Ala Thr Leu Arg Val Phe Asp Ala Asp Val Val 290 295 300 Pro Ala Ser Gly Glu Leu Val Arg Arg Tyr Thr Ser Thr Leu Leu Pro 305 310 315 320 Gly Asp Thr Trp Ala Gln Gln Thr Phe Arg Val Glu His Trp Pro Asn 325 330 335 Glu Thr Ser Val Gln Ala Asn Gly Ser Phe Val Arg Ala Thr Val His 340 345 350 Asp Tyr Arg Leu Val Leu Asn Arg Asn Leu Ser Ile Ser Glu Asn Arg 355 360 365 Thr Met Gln Leu Ala Val Leu Val Asn Asp Ser Asp Phe Gln Gly Pro 370 375 380 Gly Ala Gly Val Leu Leu Leu His Phe Asn Val Ser Val Leu Pro Val 385 390 395 400 Ser Leu His Leu Pro Ser Thr Tyr Ser Leu Ser Val Ser Arg Arg Ala 405 410 415 Arg Arg Phe Ala Gln Ile Gly Lys Val Cys Val Glu Asn Cys Gln Ala 420 425 430 Phe Ser Gly Ile Asn Val Gln Tyr Lys Leu His Ser Ser Gly Ala Asn 435 440 445 Cys Ser Thr Leu Gly Val Val Thr Ser Ala Glu Asp Thr Ser Gly Ile 450 455 460 Leu Phe Val Asn Asp Thr Lys Ala Leu Arg Arg Pro Lys Cys Ala Glu 465 470 475 480 Leu His Tyr Met Val Val Ala Thr Asp Gln Gln Thr Ser Arg Gln Ala 485 490 495 Gln Ala Gln Leu Leu Val Thr Val Glu Gly Ser Tyr Val Ala Glu Glu 500 505 510 Ala Gly Cys Pro Leu Ser Cys Ala Val Ser Lys Arg Arg Leu Glu Cys 515 520 525 Glu Glu Cys Gly Gly Leu Gly Ser Pro Thr Gly Arg Cys Glu Trp Arg 530 535 540 Gln Gly Asp Gly Lys Gly Ile Thr Arg Asn Phe Ser Thr Cys Ser Pro 545 550 555 560 Ser Thr Lys Thr Cys Pro Asp Gly His Cys Asp Val Val Glu Thr Gln 565 570 575 Asp Ile Asn Ile Cys Pro Gln Asp Cys Leu Arg Gly Ser Ile Val Gly 580 585 590 Gly His Glu Pro Gly Glu Pro Arg Gly Ile Lys Ala Gly Tyr Gly Thr 595 600 605 Cys Asn Cys Phe Pro Glu Glu Glu Lys Cys Phe Cys Glu Pro Glu Asp 610 615 620 Ile Gln Asp Pro Leu Cys Asp Glu Leu Cys Arg Thr Val Ile Ala Ala 625 630 635 640 Ala Val Leu Phe Ser Phe Ile Val Ser Val Leu Phe Cys 645,650,655 Ile His Cys Tyr His Lys Phe Ala His Lys Pro Pro Ile Ser Ser Ala 660,665,670 Glu Met Thr Phe Arg Arg Pro Ala Gln Ala Phe Pro Val Ser Tyr Ser 675,680,685 Ser Ser Gly Ala Arg Arg Ser Ser Leu Asp Ser Met Glu Asn Gln Val 690,695,700 Ser Val Asp Ala Phe Lys Ile Leu Glu Asp Pro Lys Trp Glu Phe Pro 705 710 715 720 Arg Lys Asn Leu Val Leu Gly Lys Thr Leu Gly Glu Gly Glu Phe Gly 725 730 735 Lys Val Val Lys Ala Thr Ala Phe His Leu Lys Gly Arg Ala Gly Tyr 740,745,750 Thr Thr Val Ala Val Lys Met Leu Lys Glu Asn Ala Ser Pro Ser Glu 755,760,765 Leu Arg Asp Leu Leu Ser Glu Phe Asn Val Leu Lys Gln Val Asn His 770 775 780 Pro His Val Ile Lys Leu Tyr Gly Ala Cys Ser Gln Asp Gly Pro Leu 785 790 795 800 Leu Leu Ile Val Glu Tyr Ala Lys Tyr Gly Ser Leu Arg Gly Phe Leu 805 810 815 Arg Glu Ser Arg Lys Val Gly Pro Gly Tyr Leu Gly Ser Gly Gly Ser 820 825 830 Arg Asn Ser Ser Ser Leu Asp His Pro Asp Glu Arg Ala Leu Thr Met 835 840 845 Gly Asp Leu Ile Ser Phe Ala Trp Gln Ile Ser Gln Gly Met Gln Tyr 850 855 860 Leu Ala Glu Met Lys Leu Val His Arg Asp Leu Ala Ala Arg Asn Ile 865 870 875 880 Leu Val Ala Glu Gly Arg Lys Met Lys Ile Ser Asp Phe Gly Leu Ser 885 890 895 Arg Asp Val Tyr Glu Glu Asp Ser Tyr Val Lys Arg Ser Gln Gly Arg 900 905 910 Ile Pro Val Lys Trp Met Ala Ile Glu Ser Leu Phe Asp His Ile Tyr 915 920 925 Thr Thr Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile 930 935 940 Val Thr Leu Gly Gly Asn Pro Tyr Pro Gly Ile Pro Pro Glu Arg Leu 945 950 955 960 Phe Asn Leu Leu Lys Thr Gly His Arg Met Glu Arg Pro Asp Asn Cys 965 970 975 Ser Glu Glu Met Tyr Arg Leu Met Leu Gln Cys Trp Lys Gln Glu Pro 980 985 990 Asp Lys Arg Pro Val Phe Ala Asp Ile Ser Lys Asp Leu Glu Lys Met 995 1000 1005 Met Val Lys Arg Arg Asp Tyr Leu Asp Leu Ala Ala Ser Thr Pro 1010 1015 1020 Ser Asp Ser Leu Ile Tyr Asp Asp Gly Leu Ser Glu Glu Glu Thr 1025 1030 1035 Pro Leu Val Asp Cys Asn Asn Ala Pro Leu Pro Arg Ala Leu Pro 1040 1045 1050 Ser Thr Trp Ile Glu Asn Lys Leu Tyr Gly Arg Ile Ser His Ala 1055 1060 1065 Phe Thr Arg Phe 1070 <210> 313 <211> 868 <212> PRT <213> Artificial Sequence <220> <223> NP_066124.1 hRET extracellular domain (amino acids 1 - 635)-mouse Fc <400> 313 Met Ala Lys Ala Thr Ser Gly Ala Ala Gly Leu Arg Leu Leu Leu Leu 1 5 10 15 Leu Leu Leu Pro Leu Leu Gly Lys Val Ala Leu Gly Leu Tyr Phe Ser 20 25 30 Arg Asp Ala Tyr Trp Glu Lys Leu Tyr Val Asp Gln Ala Ala Gly Thr 35 40 45 Pro Leu Leu Tyr Val His Ala Leu Arg Asp Ala Pro Glu Glu Val Pro 50 55 60 Ser Phe Arg Leu Gly Gln His Leu Tyr Gly Thr Tyr Arg Thr Arg Leu 65 70 75 80 His Glu Asn Asn Trp Ile Cys Ile Gln Glu Asp Thr Gly Leu Leu Tyr 85 90 95 Leu Asn Arg Ser Leu Asp His Ser Ser Trp Glu Lys Leu Ser Val Arg 100 105 110 Asn Arg Gly Phe Pro Leu Leu Thr Val Tyr Leu Lys Val Phe Leu Ser 115 120 125 Pro Thr Ser Leu Arg Glu Gly Glu Cys Gln Trp Pro Gly Cys Ala Arg 130 135 140 Val Tyr Phe Ser Phe Phe Asn Thr Ser Phe Pro Ala Cys Ser Ser Leu 145 150 155 160 Lys Pro Arg Glu Leu Cys Phe Pro Glu Thr Arg Pro Ser Phe Arg Ile 165 170 175 Arg Glu Asn Arg Pro Pro Gly Thr Phe His Gln Phe Arg Leu Leu Pro 180 185 190 Val Gln Phe Leu Cys Pro Asn Ile Ser Val Ala Tyr Arg Leu Leu Glu 195 200 205 Gly Glu Gly Leu Pro Phe Arg Cys Ala Pro Asp Ser Leu Glu Val Ser 210 215 220 Thr Arg Trp Ala Leu Asp Arg Glu Gln Arg Glu Lys Tyr Glu Leu Val 225 230 235 240 Ala Val Cys Thr Val His Ala Gly Ala Arg Glu Glu Val Val Met Val 245 250 255 Pro Phe Pro Val Thr Val Tyr Asp Glu Asp Asp Ser Ala Pro Thr Phe 260 265 270 Pro Ala Gly Val Asp Thr Ala Ser Ala Val Val Glu Phe Lys Arg Lys 275 280 285 Glu Asp Thr Val Val Ala Thr Leu Arg Val Phe Asp Ala Asp Val Val 290 295 300 Pro Ala Ser Gly Glu Leu Val Arg Arg Tyr Thr Ser Thr Leu Leu Pro 305 310 315 320 Gly Asp Thr Trp Ala Gln Gln Thr Phe Arg Val Glu His Trp Pro Asn 325 330 335 Glu Thr Ser Val Gln Ala Asn Gly Ser Phe Val Arg Ala Thr Val His 340 345 350 Asp Tyr Arg Leu Val Leu Asn Arg Asn Leu Ser Ile Ser Glu Asn Arg 355 360 365 Thr Met Gln Leu Ala Val Leu Val Asn Asp Ser Asp Phe Gln Gly Pro 370 375 380 Gly Ala Gly Val Leu Leu Leu His Phe Asn Val Ser Val Leu Pro Val 385 390 395 400 Ser Leu His Leu Pro Ser Thr Tyr Ser Leu Ser Val Ser Arg Arg Ala 405 410 415 Arg Arg Phe Ala Gln Ile Gly Lys Val Cys Val Glu Asn Cys Gln Ala 420 425 430 Phe Ser Gly Ile Asn Val Gln Tyr Lys Leu His Ser Ser Gly Ala Asn 435 440 445 Cys Ser Thr Leu Gly Val Val Thr Ser Ala Glu Asp Thr Ser Gly Ile 450 455 460 Leu Phe Val Asn Asp Thr Lys Ala Leu Arg Arg Pro Lys Cys Ala Glu 465 470 475 480 Leu His Tyr Met Val Val Ala Thr Asp Gln Gln Thr Ser Arg Gln Ala 485 490 495 Gln Ala Gln Leu Leu Val Thr Val Glu Gly Ser Tyr Val Ala Glu Glu 500 505 510 Ala Gly Cys Pro Leu Ser Cys Ala Val Ser Lys Arg Arg Leu Glu Cys 515 520 525 Glu Glu Cys Gly Gly Leu Gly Ser Pro Thr Gly Arg Cys Glu Trp Arg 530 535 540 Gln Gly Asp Gly Lys Gly Ile Thr Arg Asn Phe Ser Thr Cys Ser Pro 545 550 555 560 Ser Thr Lys Thr Cys Pro Asp Gly His Cys Asp Val Val Glu Thr Gln 565 570 575 Asp Ile Asn Ile Cys Pro Gln Asp Cys Leu Arg Gly Ser Ile Val Gly 580 585 590 Gly His Glu Pro Gly Glu Pro Arg Gly Ile Lys Ala Gly Tyr Gly Thr 595 600 605 Cys Asn Cys Phe Pro Glu Glu Glu Lys Cys Phe Cys Glu Pro Glu Asp 610 615 620 Ile Gln Asp Pro Leu Cys Asp Glu Leu Cys Arg Glu Pro Arg Gly Pro 625 630 635 640 Thr Ile Lys Pro Cys Pro Pro Cys Lys Cys Pro Ala Pro Asn Leu Leu 645 650 655 Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Ile Lys Asp Val Leu 660 665 670 Met Ile Ser Leu Ser Pro Ile Val Thr Cys Val Val Val Asp Val Ser 675 680 685 Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu 690 695 700 Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr 705 710 715 720 Leu Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Met Ser 725 730 735 Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ala Pro 740 745 750 Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly Ser Val Arg Ala Pro Gln 755 760 765 Val Tyr Val Leu Pro Pro Pro Glu Glu Glu Met Thr Lys Lys Gln Val 770 775 780 Thr Leu Thr Cys Met Val Thr Asp Phe Met Pro Glu Asp Ile Tyr Val 785 790 795 800 Glu Trp Thr Asn Asn Gly Lys Thr Glu Leu Asn Tyr Lys Asn Thr Glu 805 810 815 Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe Met Tyr Ser Lys Leu Arg 820 825 830 Val Glu Lys Lys Asn Trp Val Glu Arg Asn Ser Tyr Ser Cys Ser Val 835 840 845 Val His Glu Gly Leu His Asn His His Thr Thr Lys Ser Phe Ser Arg 850 855 860 Thr Pro Gly Lys 865

Claims

1. An antibody or antigen-binding fragment thereof that specifically binds to the RET (Rearranged during Transfection) receptor tyrosine kinase, wherein the antibody or antigen-binding fragment thereof comprises: A heavy chain variable region (HCVR) that comprises three heavy chain complementarity determining regions (CDRs): HCDR1, HCDR2, and HCDR3, wherein HCDR1 consists of the amino acid sequence shown in SEQ ID NO: 148, HCDR2 consists of the amino acid sequence shown in SEQ ID NO: 150, and HCDR3 consists of the amino acid sequence shown in SEQ ID NO: 152; and A light chain variable region (LCVR) that comprises three light chain CDRs: LCDR1, LCDR2, and LCDR3, wherein LCDR1 consists of the amino acid sequence shown in SEQ ID NO: 156, LCDR2 consists of the amino acid sequence shown in SEQ ID NO: 158, and LCDR3 consists of the amino acid sequence shown in SEQ ID NO:

160.

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein the HCVR consists of the amino acid sequence shown in SEQ ID NO: 146, and the LCVR consists of the amino acid sequence shown in SEQ ID NO:

154.

3. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment is a monoclonal antibody.

4. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment is a fully human antibody.

5. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment comprises a human IgG1 heavy chain constant region.

6. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment comprises a human IgG4 heavy chain constant region.

7. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, and a pharmaceutically acceptable carrier or diluent.

8. A pair of isolated polynucleotide molecules, which respectively comprise a polynucleotide sequence encoding the HCVR of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, and a polynucleotide sequence encoding the LCVR of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 6.

9. A pair of expression vectors, which respectively comprise the pair of isolated polynucleotide molecules according to claim 8.

10. An isolated polynucleotide molecule, which comprises a polynucleotide sequence encoding the HCVR and LCVR of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 6.

11. An expression vector, which comprises the polynucleotide molecule according to claim 10.

12. An isolated host cell, which comprises the pair of isolated polynucleotide molecules according to claim 8, the pair of expression vectors according to claim 9, the polynucleotide molecule according to claim 10, or the expression vector according to claim 11.

13. A method for preparing an antibody or an antigen-binding fragment thereof according to any one of claims 1 to 6, the method comprising culturing the host cell according to claim 12 under conditions that permit the production of the antibody or an antigen-binding fragment thereof, and recovering the antibody or an antigen-binding fragment thereof so produced.

14. The method according to claim 13, the method further comprises: formulating the antibody or an antigen-binding fragment thereof into a pharmaceutical composition comprising an acceptable carrier.

15. Use of an antibody or an antigen-binding fragment thereof according to any one of claims 1 to 6, or a pharmaceutical composition according to claim 7, in the preparation of a medicament for inhibiting the growth of RET-expressing tumors or tumor cells in a patient, wherein the RET-expressing tumors or tumor cells are present in a patient suffering from a disease or disorder selected from the group consisting of thyroid cancer, lung cancer, pancreatic cancer, skin cancer, breast cancer, and hematogenous cancer.

16. The use according to claim 15, wherein the thyroid cancer is papillary thyroid carcinoma (PTC) or medullary thyroid carcinoma (MTC).

17. The use according to claim 16, wherein the MTC is hereditary MTC, which is selected from the group consisting of multiple endocrine neoplasia type 2 or 3 and familial medullary thyroid carcinoma syndrome, or wherein the MTC is sporadic MTC.

18. The use according to claim 15, wherein the lung cancer is lung adenocarcinoma.

19. The use according to claim 15, wherein the lung cancer is non-small cell lung cancer.

20. The use according to claim 15, wherein the skin cancer is melanoma.

21. The use according to claim 15, wherein the hematogenous cancer is leukemia.

22. The use according to claim 21, wherein the leukemia is chronic myelomonocytic leukemia.

23. The use according to any one of claims 15 to 22, wherein the medicament is administered to the patient in combination with a second therapeutic agent.

24. The use according to claim 23, wherein the second therapeutic agent is selected from the group consisting of small molecule tyrosine kinase inhibitors, anti-tumor agents, siRNAs specific for RET, and analgesics.

25. Use according to claim 24, wherein the small molecule tyrosine kinase inhibitor is selected from the group consisting of vandetanib, cediranib, AZD2171, gefitinib, erlotinib, SU14813, vatalanib, sorafenib, sorafenib, BAY 43-9006, sunitinib, cabozantinib, motesanib, XL-647, XL-999, AG-013736, BIBF 1120, TSU68, GW786034, AEE788, CP-547632, KRN951, CHIR258, CEP-7055, OSI-930, ABT-869, E7080, ZK-304709, BAY 57-9352, L-21649, BMS582664, XL-880, XL-184, XL-820, RPI-1, PP-1, and NVP-AST478.

26. Use according to claim 24, wherein the anti-tumor agent is selected from the group consisting of chemotherapeutic agents, radionuclides, and antibody-drug conjugates.

27. The use according to claim 24, wherein the analgesic is selected from the group consisting of: nerve growth factor inhibitors, aspirin or another NSAID, morphine, steroids, anti-Na v 1.7 antibody or Na v 1.7 small molecule inhibitor, Na v 1.8 antagonist, Na v 1.9 antagonist, cytokine inhibitor, small molecule interleukin-1 antagonist, anti-interleukin-1 antibody; interleukin-18 inhibitor, interleukin-6 inhibitor, interleukin-6R inhibitor, caspase-1 inhibitor, p38 inhibitor, IKK1 / 2 inhibitor, CTLA-4Ig inhibitor or opioid.

Images