Miscarriage markers and their application in the diagnosis and prediction of recurrent miscarriage and pathological pregnancy
By using the circular RNA hsa_circ_0008362 as a specific biomarker, the expression level in serum and chorionic villus tissue was detected, solving the problem of diagnosis and prediction of recurrent miscarriage. This achieved a high-sensitivity and specific diagnostic effect and provided a new biomarker for the study of recurrent miscarriage.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-08-27
- Publication Date
- 2026-03-10
AI Technical Summary
There is a lack of effective methods for diagnosing and predicting recurrent miscarriage (RSA) in the current technology, especially in the lack of early diagnostic means, and the etiology is complex and difficult to determine.
Using circular RNA hsa_circ_0008362 as a specific biomarker, a diagnostic kit was developed for the diagnosis and prediction of RSA by detecting the expression level of circular RNA in serum and chorionic villus tissue samples and performing quantitative analysis using PCR primer pairs.
It achieves highly sensitive and specific RSA diagnosis, especially early diagnosis, and provides new biomarkers for RSA research and prediction, improving the accuracy and reliability of diagnosis.
Smart Images

Figure BDA0002654189710000111 
Figure BDA0002654189710000121 
Figure HDA0002654189720000011
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and medicine, and more specifically, to miscarriage markers and their application in the diagnosis and prediction of pathological pregnancies with recurrent miscarriage (RSA). Background Technology
[0002] Recurrent spontaneous abortion (RSA) is defined as at least two spontaneous abortions in a woman with the same sexual partner. [1] The vast majority of RSA occurs in early pregnancy, generally within the first 10 weeks of gestation. [2] The causes of RSA are diverse and complex, including known causes such as endocrine dysfunction, anatomical factors, genetic factors, immunological factors, infectious diseases, and advanced age of both parents; approximately 50% of RSA cases have unknown causes. [3] However, clinical research on how to diagnose and / or predict the occurrence of RSA remains lacking.
[0003] Circular RNAs (circRNAs) are a novel class of competitive endogenous non-coding RNA molecules with regulatory functions, widely distributed in the cytoplasm of eukaryotic cytokines. Unlike traditional linear RNA (containing 5' and 3' ends), circRNAs have a closed circular structure, are less susceptible to degradation by exonucleases, exhibit more stable expression, and are characterized by high abundance, structural stability, and tissue specificity. [4] Functionally, recent studies have shown that circRNA molecules are rich in microRNA (miRNA) binding sites, acting as miRNA sponges in cells. This relieves the inhibitory effect of miRNAs on their target genes, thereby increasing the expression level of target genes. This mechanism is known as the competitive endogenous RNA (ceRNA) mechanism. [4,5] .
[0004] circRNAs play important regulatory roles in diseases through interactions with disease-associated miRNAs. Their applications in clinical diseases such as diabetes, cancer, cardiovascular diseases, and neurological disorders are increasing. [6-9]circRNAs offer important new research ideas and therapeutic targets for disease treatment. Furthermore, the widespread availability, conservation, tissue specificity, and stability of circRNAs make them highly promising biomarkers for disease screening and treatment. With the rapid development of high-throughput sequencing and molecular bioinformatics technologies, they are expected to become novel biomarkers in the future. Current research has found that the expression of circRNAs exhibits significant dynamic changes during embryonic development, and their abundant presence in human embryos is closely related to processes such as DNA damage repair, organelle and chromosome structure, cell cycle progression, and metabolic regulation.
[10] circRNAs may be involved in the pathological process of embryo implantation failure.
[11] Significant differences were found in circRNAs between RSA patients and normal villous tissue.
[12] Multiple studies have suggested that circRNAs may play a unique and important role in embryonic development and pregnancy establishment. Although their exact mechanisms of action remain to be elucidated, circRNAs have shown great promise as candidate molecules for identifying RSA in clinical applications.
[0005] In summary, existing research shows that our understanding of diagnostic and / or predictive methods for RSA is still very limited. Therefore, there is an urgent need in this field for molecular biomarkers that can be used for the diagnosis and / or prediction of RSA, and also to provide new perspectives for the study of RSA pathogenesis and the screening and identification of its biomarker molecules. Summary of the Invention
[0006] The purpose of this invention is to provide specific biomarkers and detection methods for diagnosing and / or predicting recurrent miscarriage (RSA) with high sensitivity and specificity.
[0007] Specifically, this invention provides the application of circular RNA hsa_circ_0008362 as a biomarker for diagnosing and / or predicting pathological pregnancies with recurrent miscarriage.
[0008] In a first aspect, the present invention provides the use of a circular RNA or a detection reagent for a pathological pregnancy marker of recurrent miscarriage (RSA), wherein the circular RNA is hsa_circ_0008362, for the preparation of a diagnostic reagent or kit for (a) diagnosing recurrent miscarriage RSA and / or (b) predicting the occurrence of recurrent miscarriage RSA.
[0009] In another preferred embodiment, the detection reagent includes:
[0010] (a) RSA marker circular RNA hsa_circ_0008362 or its cDNA; and / or
[0011] (b) Primers or primer pairs, probes or chips (such as nucleic acid chips) for specific amplification of the RSA marker circular RNA hsa_circ_0008362.
[0012] In another preferred embodiment, the diagnosis includes early diagnosis, auxiliary diagnosis, or a combination thereof.
[0013] In another preferred embodiment, the RSA marker circular RNA hsa_circ_0008362 is derived from mammals.
[0014] In another preferred embodiment, the mammals include humans and non-human mammals, preferably including primates (such as humans).
[0015] In another preferred embodiment, the RSA marker circular RNA hsa_circ_0008362 is derived from human.
[0016] In another preferred embodiment, the nucleotide sequence of the RSA marker circular RNA hsa_circ_0008362 is shown in SEQ ID NO:1.
[0017] In another preferred embodiment, the detection is performed on an ex vivo sample.
[0018] In another preferred embodiment, the ex vivo sample is selected from the group consisting of serum samples, tissue samples, or combinations thereof.
[0019] In another preferred embodiment, the tissue sample is a villous tissue sample.
[0020] In another preferred embodiment, the detection is to detect the presence and / or expression level of circular RNA hsa_circ_0008362 in serum and / or tissue samples.
[0021] In another preferred embodiment, if the expression level of the biomarker is significantly higher than that of the normal population, it indicates that the subject has RSA.
[0022] In another preferred embodiment, if the concentration of the RSA marker C1 in the tested sample is significantly higher than the control reference value C0, then the probability of the tested subject having RSA is greater than that of the general population.
[0023] In another preferred embodiment, "significantly higher than" means that the ratio of C1 / C0 is ≥1.5, preferably ≥2, and more preferably ≥3.
[0024] In another preferred embodiment, the detection reagent is a PCR primer pair.
[0025] In another preferred embodiment, the PCR primer pair is:
[0026] 5'-GTCCATTGCTATCAGCCCATTA-3', SEQ ID NO: 2; and
[0027] 5'-TCCACTTCAGCAGAATCCC-3', SEQ ID NO: 3.
[0028] In another preferred embodiment, the upstream primer has a GC content of 45.5% and a TM value of 59.5.
[0029] In another preferred embodiment, the downstream primer has a GC content of 52.6% and a TM value of 55.2.
[0030] The GC content refers to the ratio of guanine and cytosine among the four bases in DNA.
[0031] In a second aspect of the invention, a kit for diagnosing recurrent miscarriage (RSA) is provided, the kit comprising a detection reagent for detecting the RSA marker circular RNA hsa_circ_0008362; and instructions, wherein the instructions indicate that the kit is used for (a) diagnosing RSA and / or (b) predicting the occurrence of RSA.
[0032] In another preferred embodiment, the kit contains the RSA marker circular RNA hsa_circ_0008362 as a control or quality control.
[0033] In another preferred embodiment, the reference standard or quality control is RNA or DNA.
[0034] In another preferred embodiment, the reference or quality control sample is selected from the group consisting of: full-length SEQ ID No:1 or fragment P1 thereof, full-length SEQ ID No:4 or fragment P2 thereof, wherein fragments P1 and P2 both contain splicing sites (preferably containing TCA). GG ATG, where GG is the nucleotide at the splicing site.
[0035] In another preferred embodiment, the reference standard or quality control standard is SEQ ID No:5.
[0036] In another preferred embodiment, the reagent is a PCR primer pair, and the primer pair is used to amplify the circular RNA hsa_circ_0008362.
[0037] In another preferred embodiment, the detection reagent is a PCR primer pair, wherein the primer pair is SEQ ID No:2 and SEQ ID No:3.
[0038] In another preferred embodiment, the instruction manual includes the following: if the expression level of circular RNA hsa_circ_0008362 in the serum and / or tissue samples of the test subject is significantly higher than the control reference value, the test subject can be preliminarily judged to be an RSA patient or have a higher probability of developing RSA than the general population.
[0039] In another preferred embodiment, the control reference value is the expression level of circular RNA hsa_circ_0008362 in serum and / or tissue samples from healthy individuals and / or individuals undergoing induced abortion.
[0040] In a third aspect of the present invention, a detection method is provided, comprising the following steps:
[0041] (a) Provide an ex vivo test sample from the subject of the test, said test sample being a serum sample and / or a tissue sample;
[0042] (b) Detect the expression level or intensity of the circular RNA hsa_circ_0008362 in the test sample; and
[0043] (c) The expression level or intensity of the RSA marker circular RNA hsa_circ_0008362 is compared with the control reference value; wherein, if the expression level or intensity of RNA hsa_circ_0008362 in the test sample is significantly higher than the control reference value, it suggests that the test subject is an RSA patient or has a higher probability of developing RSA than the general population.
[0044] In another preferred embodiment, the sample is from a test object.
[0045] In another preferred embodiment, the object of detection is a person.
[0046] In another preferred embodiment, the expression level is detected using quantitative PCR.
[0047] In another preferred embodiment, if the expression level of the RSA marker circular RNA hsa_circ_0008362 is significantly higher than the control reference value, the probability of the tested subject having RSA is greater than that of the general population.
[0048] In another preferred embodiment, the control reference value is the expression level of the RSA marker circular RNA hsa_circ_0008362 in the same sample from a healthy population.
[0049] In another preferred embodiment, the control reference value is the expression level of the RSA marker circular RNA hsa_circ_0008362 in the same sample from the general induced abortion population.
[0050] In another preferred embodiment, the sample is a serum sample.
[0051] In another preferred embodiment, the sample is a tissue sample.
[0052] In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.
[0053] In a fourth aspect of the present invention, a method for diagnosing RSA is provided, comprising the following steps:
[0054] a) Provide a test sample from the subject to be tested, said test sample being selected from the group consisting of serum samples, tissue samples, or combinations thereof;
[0055] b) Detect the expression level of the RSA marker circular RNA hsa_circ_0008362 in the test samples; and
[0056] c) The expression level of the RSA marker circular RNA hsa_circ_0008362 was compared with the control reference value.
[0057] If the expression level of the RSA marker circular RNA hsa_circ_0008362 in the sample is significantly higher than the control reference value, it indicates that the subject is an RSA patient or has a higher probability of developing RSA than the general population.
[0058] In another preferred embodiment, in step (b), the detection includes PCR (such as Q-PCR, ddPCR), sequencing, or a combination thereof.
[0059] In another preferred embodiment, the diagnosis includes early diagnosis, auxiliary diagnosis, or a combination thereof.
[0060] In another preferred embodiment, the test subject includes humans and non-human mammals.
[0061] In another preferred embodiment, the general population includes healthy individuals and / or individuals undergoing induced abortion.
[0062] In another preferred embodiment, the subject of the test is an adult female.
[0063] In another preferred embodiment, the test subject is a subject that has not experienced a miscarriage.
[0064] In another preferred embodiment, the test subject is a subject who has experienced a miscarriage.
[0065] In another preferred embodiment, the expression level of the circular RNA hsa_circ_0008362 is detected by quantitative PCR and the data is processed. The data processing determines whether the subject is an RSA patient based on the expression level of the circular RNA hsa_circ_0008362 in the subject.
[0066] In a fifth aspect of the invention, the use of the RSA biomarker circular RNA hsa_circ_0008362 is provided as a biomarker for diagnosing RSA and / or predicting the occurrence of RSA is provided.
[0067] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0068] Figure 1 The structure of hsa_circ_0008362 and its splicing relationship with the genomic sequence are shown, along with the sequencing results of the PCR amplification product containing the splicing site. CDS indicates that the circular RNA originates from the coding region. F and R represent the positions of the gene-specific primers, and the arrows indicate the direction of primer initiation.
[0069] Figure 2 The differential expression of hsa_circ_0008362 in chorionic villus tissue of RSA patients and chorionic villus tissue of induced abortion patients is shown in the graph. N represents the number of samples.
[0070] Figure 3 The ROC curve of hsa_circ_0008362 detection results in villous tissue of RSA patients is shown.
[0071] Figure 4 The differential expression of hsa_circ_0008362 in the serum of patients with RSA and patients with induced abortion is shown in the graph. N represents the number of samples.
[0072] Figure 5 The ROC curve of the detection results of hsa_circ_0008362 in the serum of RSA patients is shown.
[0073] Figure 6 The image shows the DNA sequence (SEQ ID No:4) corresponding to hsa_circ_0008362 and the positions of the primers (SEQ ID No:2 and 3), where the underlined positions are the primer positions.
[0074] Figure 7 The sequence of the amplification product obtained using SEQ ID No:2 and 3 is shown (SEQ ID No:5). This amplification product contains the sequence of the splicing site of hsa_circ_0008362 (SEQ ID No:1 or 4). Detailed Implementation
[0075] Through extensive and in-depth research, the inventors unexpectedly discovered for the first time a class of RSA biomarkers present in serum and / or chorionic villus tissue, namely, the circular RNA hsa_circ_0008362. This RSA biomarker is specifically highly expressed in the serum and / or chorionic villus tissue of RSA patients, and therefore can be used as a specific biomarker for RSA diagnosis (especially early diagnosis and / or auxiliary diagnosis). Experimental results show that, compared with the normal population, the expression level of circular RNA hsa_circ_0008362 is significantly increased in RSA patients, and can serve as a biomarker for diagnosing RSA. Based on this, the present invention was completed.
[0076] Terminology Explanation
[0077] As used in this article, the term "sample" or "sample" refers to material specifically associated with a subject from which specific information relating to the subject can be determined, calculated, or inferred. A sample may consist wholly or partially of biological material from the subject.
[0078] As used in this article, the term “expression” refers to the production of circular RNA from a gene or a portion of a gene.
[0079] As used in this article, the term "RSA" refers to recurrent spontaneous abortion.
[0080] RSA markers
[0081] As used herein, the terms "marker of the present invention," "RSA marker of the present invention," "circular RNA marker of the present invention," or "circular RNA marker hsa_circ_0008362 of the present invention" are used interchangeably to refer to the circular RNA hsa_circ_0008362 or its corresponding nucleic acid sequence. The term includes the full-length hsa_circ_0008362 or a fragment thereof (as long as the fragment can distinguish hsa_circ_0008362 from other nucleic acids). Furthermore, the term also includes nucleic acid molecules in RNA form, or in cDNA or DNA form. Furthermore, the term also includes nucleic acid molecules in single-stranded or double-stranded, sense and antisense strand form. Furthermore, the term also includes circular or linear marker nucleic acid molecules. Furthermore, the term also includes full-length or partial-length RNA hsa_circ_0008362, wherein the partial-length sequence contains splicing sites (e.g., containing TCA). GG ATG (where GG is the nucleotide at the splicing site) is typically longer than 20 bp.
[0082] Preferably, “circular RNA hsa_circ_0008362” refers to a type of closed circular non-coding RNA, especially hsa_circ_0008362 in human chorionic villus tissue or serum.
[0083] In one specific embodiment of the present invention, hsa_circ_0008362 is hsa_circ_0008362 in a human villous tissue sample.
[0084] In another specific embodiment of the present invention, hsa_circ_0008362 is hsa_circ_0008362 in a human serum sample.
[0085] In one specific embodiment of the present invention, the nucleotide sequence of the circular RNA is shown in SEQ ID NO:1, with the first two nucleotides and the last two nucleotides being the loop binding sites.
[0086] The full-length nucleotide sequence of the circular RNA hsa_circ_0008362 is 510 bp, as shown in SEQ ID No:1.
[0087] GAUGACCAGUGUCCCAGUGAAGGAACGAGUGAAGGUGUCUCAGAACUGGAGACUGGGGCGCUGCCGAGAGGGGAUUCUGCUGAAGUGGAGAUGCAGUCAGAUGCCCUGGAUGCAGCUAGAGGAUGAUUCUCUGUACAUAUCCCAGGCUAAUUUCAUCCUGGCCUACCAGUUCCGUCCAGAUGGUGCCAGCUUGAAUCGUCGGCCUCUGGGAGUCUUUGCUGGGCAUGAUGAGGACGUUUGCCACUUUGUGCUGGCCAACUCGCAUAUUGUUAGUGCAGGAGGGGAUGGGAAGAUUGGCAUUCAUAAGAUUCACAGCACCUUCACUGUCAAGUACUCGGCUCAUGAACAGGAGGUGAACUGUGUGGAUUGCAAAGGGGGCAUCAUUGUGAGUGGCUCCAGGGACAGGACGGCCAAGGUGUGGCCUUUGGCCUCAGGCCGGCUGGGGCAGUGCUUACACACCAUCCAGACUGAAGACCGAGUCUGGUCCAUUGCUAUCAGCCCAUUACUCAG(SEQ ID No:1)
[0088] Its corresponding DNA sequence corresponds to SEQ ID No:1 (U is changed to T), as shown in SEQ ID No:4:
[0089] GATGACCAGTGTCCCAGTGAAGGAACGAGTGAAGGTGTCTCAGAACTGGAGACTGGGGCGCTGCCGAGAGGGGATTCTGCTGAAGTGGAGATGCAGTCAGATGCCCTGGATGCAGCTAGAGGATGATT CTCTGTACATATCCCAGGCTAATTTCATCCTGGCCTACCAGTTCCGTCCAGATGGTGCCAGCTTGAATCGTCGGCCTCTGGGAGTCTTTGCTGGGCATGATGAGGACGTTTGCCACTTTGTGCTGGCCA ACTCGCATATTGTTAGTGCAGGAGGGGATGGGAAGATTGGCATTCATAAGATTCACAGCACCTTCACTGTCAAGTACTCGGCTCATGAACAGGAGGTGAACTGTGTGGATTGCAAAGGGGGCATCATT GTGAGTGGCTCCAGGGACAGGACGGCCAAGGTGTGGCCTTTGGCCTCAGGCCGGCTGGGGCAGTGCTTACACACCATCCAGACTGAAGACCGAGTCTGGTCCATTGCTATCAGCCCATTACTCAG(SEQ ID No:4)
[0090] The splicing relationship and structure of the circular RNA hsa_circ_0008362 with the genome sequence are as follows: Figure 1 As shown. The circular RNA hsa_circ_0008362 is formed by circularization of exons 2-5 of the FBXW4 gene. The DNA sequence corresponding to the circular RNA hsa_circ_0008362 is derived from chr10:103427642-103436193 on the antisense strand of human chromosome 10.
[0091] The FBXW4 gene is located on the long arm of human chromosome 10 and encodes F-Box / WD repeat protein 4. Through its WD-40 protein-protein binding domain, it recruits specific target proteins for ubiquitin-mediated degradation. F-Box / WD repeat protein 4 may be involved in key signaling pathways crucial for normal limb development, such as Wnt signaling.
[0092] Detection methods
[0093] Based on the high expression of the RSA marker circular RNA hsa_circ_0008362 in serum and / or tissue samples, this invention also provides a corresponding method for diagnosing RSA.
[0094] This invention relates to a diagnostic assay method for quantitatively detecting the expression level of the human RSA marker circular RNA hsa_circ_0008362. These assays are well known in the art. The expression level of the human RSA marker circular RNA hsa_circ_0008362 detected in the assay can be used to diagnose (including as an adjunct to diagnosis) the presence of RSA.
[0095] A preferred method is to perform quantitative PCR detection on RNA or cDNA.
[0096] According to the experimental results of the present invention, a preferred method for diagnosing RSA patients is based on the expression level of circular RNA hsa_circ_0008362. Preferably, the method includes the following judgment method: if the expression level of circular RNA hsa_circ_0008362 in the serum and / or tissue samples of the test subject is significantly higher than that in the normal population and / or the general induced abortion population, then the test subject can be preliminarily judged to have RSA.
[0097] Test kit
[0098] Based on the correlation between RSA biomarkers and RSA, the RSA biomarker circular RNA hsa_circ_0008362 can be used as a diagnostic biomarker for RSA.
[0099] The present invention also provides a kit for diagnosing RSA, the kit containing a detection reagent for detecting the RSA biomarker circular RNA hsa_circ_0008362. Preferably, the kit contains the RSA biomarker circular RNA hsa_circ_0008362 of the present invention; or contains primers or primer pairs, probes, or chips that specifically amplify the RSA biomarker circular RNA hsa_circ_0008362.
[0100] In another preferred embodiment, the kit further includes instructions specifying that the kit is used to diagnose RSA and / or predict the occurrence of RSA.
[0101] ROC curve
[0102] ROC curve, short for Receiver Operating Characteristic curve, is widely used in the medical field to determine the diagnostic value of a factor for a particular disease. The ROC curve reflects the relationship between sensitivity and specificity. The horizontal axis (X-axis) represents 1 - specificity, also known as the false positive rate; the closer the X-axis is to zero, the higher the accuracy. The vertical axis (Y-axis) represents sensitivity, also known as the true positive rate; a larger Y-axis value indicates better accuracy. Based on the curve's position, the graph is divided into two parts. The area under the curve is called AUC (Area Under Curve), used to represent predictive accuracy. A higher AUC value, i.e., a larger area under the curve, indicates higher predictive accuracy. The closer the curve is to the upper left corner (smaller X, larger Y), the higher the predictive accuracy.
[0103] The main advantages of this invention are:
[0104] 1. The inventors have discovered for the first time that the circular RNA hsa_circ_0008362 is associated with RSA pathological pregnancy and can serve as a specific biomarker for recurrent miscarriage (RSA).
[0105] 2. The expression of the ring-specific marker of the present invention can be obtained by detecting serum and / or chorionic villus tissue samples, thereby being used to diagnose and / or predict RSA pathological pregnancy.
[0106] 3. The circular RNA molecule of the present invention for the diagnosis and / or prediction of RSA provides a new perspective for the study of the pathogenesis of RSA and the screening and identification of its biomarker molecules.
[0107] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.
[0108] Unless otherwise specified, all materials, reagents, instruments, etc. used in the embodiments are commercially available.
[0109] Materials and Methods
[0110] Research subjects
[0111] Patients with recurrent miscarriages who visited the family planning clinic of a hospital were selected as study participants according to the following inclusion criteria:
[0112] Recurrent miscarriage group (RSA group): Two or more consecutive spontaneous abortions with the same sexual partner (including the current pregnancy); no abdominal pain, vaginal bleeding or vaginal discharge during the current pregnancy; infection, anatomical, endocrine and chromosomal karyotype abnormalities of the couple have been ruled out in previous or subsequent diagnosis and treatment, female autoimmune diseases, thrombotic diseases and related family history of diseases have been ruled out, and male semen abnormalities have been ruled out.
[0113] After obtaining informed consent from the study participants, chorionic villus tissue was collected from patients with recurrent miscarriage and induced abortion, as well as serum from patients with recurrent spontaneous abortion (RSA) and induced abortion. The collected chorionic villus tissue and serum samples were frozen at -80°C.
[0114] RNA extraction from villous tissue
[0115] Patient villous tissue pre-collected in TRIZOL was removed from a -80°C freezer and ground in a mortar and pestle in liquid nitrogen until it became liquid. The tissue was then allowed to stand at room temperature for 5 minutes. The liquid was aspirated and centrifuged at 12,000 rpm for 5 minutes at 4°C. The supernatant was collected, and 200 μl of chloroform was added at TRIZOL / ml. The mixture was vigorously shaken for 15 seconds, allowed to stand at room temperature for 2-3 minutes, and then centrifuged at 12,000 rpm for 15 minutes at 4°C. The upper aqueous phase was aspirated, and 500 μl of isopropanol was added at TRIZOL / ml. The mixture was allowed to stand at room temperature for 10 minutes. After standing, the mixture was centrifuged at 12,000 rpm for 10 minutes at 4°C. The supernatant was discarded, and RNA was observed to settle at the bottom of the tube. 1 ml of 75% ethanol was added at TRIZOL / ml, and the precipitate was resuspended using a Vortex mixer. The mixture was centrifuged at 12,000 rpm for 5 minutes at 4°C. The supernatant was discarded, and the precipitate was allowed to dry at room temperature for 5-10 minutes. RNA precipitate was dissolved in water using 50 μl of DEPC, and its concentration and OD260 / 280 values were measured for quantification and quality analysis.
[0116] Blood RNA extraction
[0117] RNA was extracted using the miRNeasy Serum / Plasma kit (Qiagen) according to the kit instructions. First, thaw the serum sample. Take 200 μl of the sample and add 5 volumes of QIAzol lysis reagent. Vortex or pipette mix and incubate at room temperature (15-25℃) for 5 minutes. Add an equal volume of chloroform to the serum, cap, shake vigorously for 15 seconds, incubate at room temperature for 2-3 minutes, then centrifuge at 12000g for 15 minutes at 4℃. Aspirate the supernatant and add 1.5 volumes of anhydrous ethanol, mixing thoroughly by pipetting. Transfer 700 μl of the solution to an RNeasy MinElute centrifuge column and centrifuge at 8000g for 15 seconds at room temperature, discarding the eluent. Add 500 μl of BufferRPE and centrifuge at 8000g for 15 seconds at room temperature, discarding the eluent. Add 500 μl of 80% ethanol and centrifuge at 8000g for 2 minutes at room temperature, discarding the eluent and the collection tube. Transfer the centrifuge column to a new 2 ml collection tube and centrifuge at full speed for 5 minutes, discarding the eluent and the collection tube. Transfer the centrifuge column to a new 2 ml collection tube and centrifuge at full speed for 5 minutes, discarding the eluent and the collection tube. Transfer the centrifuge column to a new 1.5 ml EP tube, add 14 μl of RNase-free water to the center of the column, and centrifuge at full speed for 1 minute to elute the RNA. Measure the RNA concentration and OD 260 / 280 value, and perform quantification and quality analysis on the obtained RNA.
[0118] RT-PCR reaction
[0119] The reaction system was prepared and RT-PCR was performed according to the instructions of the reverse transcription kit (Thermo Scientific, catalog number: K1682). All operations were performed in an ice bath. Specific reaction system preparation and operating procedures are shown in Table 1.
[0120] Table 1
[0121]
[0122] Real-time quantitative PCR reaction
[0123] The RT product of chorionic villus RNA was diluted 10-fold with ddH2O, i.e., 2 μl RT product + 18 μl ddH2O; the RT product of serum RNA was diluted 1.5-fold with ddH2O, i.e., 20 μl RT product + 10 μl ddH2O. Primers (SEQ ID No:2 and SEQ ID No:3) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Following the manufacturer's instructions, the lyophilized powder was prepared into a 100 μM primer stock solution with RNase-free water and then aliquoted for storage. Before use, the primers were diluted 10-fold (45 μl water + 5 μl stock solution) to prepare a 10 μM working solution. A 20 μl PCR reaction system was established according to Table 2.
[0124] Table 2
[0125] Diluted RT products 1.0μl SYBR Green Mix 10μl Forward primer (10µm) 0.4μl Reverse primer (10µm) 0.4μl <![CDATA[ddH2O]]> 8.2μl Total volume 20μl
[0126] To reduce or avoid sample loading errors, in practice, the mixture is prepared first, and then different primers are added separately. Three replicates are set up. The thermal cycling parameters are set according to Table 3.
[0127] Table 3
[0128]
[0129] After the program finishes, the data is stored and the software and instrument are closed. The real-time quantitative PCR instrument used in this invention is from Roche, Switzerland. 480II Real-Time PCR System.
[0130] Data processing
[0131] The raw data obtained from Real-Time quantitative PCR reactions were processed according to the following formula:
[0132] ΔCt = (Target gene Ct value - Internal reference Ct value) average value
[0133] ΔCt = (ΔCt of target gene in RSA group - ΔCt of target gene in control group)
[0134] Relative expression level = (2 -ΔΔCt The average value of ).
[0135] Statistical analysis
[0136] Statistical analysis was performed using SPSS version 21.0 (SPSS Inc., IL, USA) combined with GraphPad Prism version 6 (Inc., San Diego, CA, USA). Normality of the data was analyzed using the Shapiro-Wilk test. For cases and controls where the data conformed to a normal distribution, an independent samples t-test was used; otherwise, a nonparametric Mann-Whitney U test was employed. Data are expressed as mean ± standard error, and P < 0.05 (two-tailed) was considered statistically significant.
[0137] Example 1
[0138] Real-time quantitative PCR detection of expression level of circular RNA hsa_circ_0008362 in villous tissue
[0139] Following the above recruitment criteria, chorionic villus tissue samples were collected from 26 patients with recurrent miscarriage and 24 patients with induced abortion. RNA was extracted from these chorionic villus tissues, and the expression level of circular RNA hsa_circ_0008362 in the 50 chorionic villus tissue samples from both groups was detected using real-time quantitative PCR. The relative expression levels of circular RNA hsa_circ_0008362 in the two groups of chorionic villus tissues were calculated based on the detection results, and statistical analysis was performed.
[0140] The amplification product obtained using primers SEQ ID No:2 and 3 was 116 bp in length, and its sequence was verified by sequencing as shown in SEQ ID No:5 and SEQ ID No:3. Figure 7 As shown. Sequence analysis indicates that the amplification product corresponds to RNA hsa_circ_0008362 (SEQ ID No: 1 or 4), and the positional relationship between SEQ ID No: 2 and 3 and SEQ ID No: 4 is shown in the figure. Figure 6 .
[0141] Further research indicates that RNA hsa_circ_0008362 originates from chr10:103427642-103436193 on the antisense strand of human chromosome 10.
[0142] The results are as follows Figure 2 As shown, the relative expression level of circular RNA hsa_circ_0008362 in chorionic villus tissue from recurrent miscarriage was significantly higher than that in chorionic villus tissue from induced abortion (P = 0.0027), indicating a statistically significant difference.
[0143] Simultaneously, ROC curve analysis was performed on the results, revealing that the area under the ROC curve was 0.744. Figure 3 As shown.
[0144] Example 2
[0145] Real-time quantitative PCR detection of serum circular RNA hsa_circ_0008362 expression level
[0146] Following the above recruitment criteria, serum samples were collected from 11 patients with recurrent miscarriage and 14 patients with induced abortion. RNA was extracted from these serum samples, and the expression level of circular RNA hsa_circ_0008362 in chorionic villus tissue samples from both groups (25 samples in total) was detected using real-time quantitative PCR. The relative expression levels of circular RNA hsa_circ_0008362 in the two groups of serum samples were calculated based on the detection results, and statistical analysis was performed.
[0147] The amplification product obtained using primers SEQ ID No:2 and 3 was 116 bp in length, and its sequence was verified by sequencing as shown in SEQ ID No:5 and SEQ ID No:3. Figure 7 As shown.
[0148] The results are as follows Figure 4 As shown, the relative expression level of circular RNA hsa_circ_0008362 in serum from recurrent miscarriage was significantly higher than that in serum from induced abortion (P = 0.0242), indicating a statistically significant difference.
[0149] Simultaneously, ROC curve analysis was performed on the results, revealing that the area under the ROC curve was 0.734. Figure 5 As shown.
[0150] In summary, the results indicate that the amplification product obtained using the specific amplification primers provided in this application is a single band with no non-specific amplification. The specific amplification primers can serve as specific biomarkers for this type of detection, and the circular RNA hsa_circ_0008362 can be used as a molecular biomarker for RSA identification. The detection sensitivity in tissues reaches 76.9%, and the specificity reaches 62.5%. The detection sensitivity in serum reaches 63.6%, and the specificity reaches 92.9%.
[0151] Example 3
[0152] Kits for detecting recurrent miscarriage (RSA)
[0153] Prepare a kit containing primers for specifically amplifying the circular RNA hsa_circ_0008362 and instructions:
[0154] 5'-GTCCATTGCTATCAGCCCATTA-3', SEQ ID NO: 2; and
[0155] 5'-TCCACTTCAGCAGAATCCC-3', SEQ ID NO: 3.
[0156] The instructions therein state that the kit is used for (a) diagnosing RSA and / or (b) predicting the occurrence of RSA.
[0157] References
[0158] [1]Practice Committee of American Society for ReproductiveMedicine.Definitions of infertility and recurrent pregnancy loss:a committeeopinion.Fertil Steril.2013;99(1):63.
[0159] [2]Branch DW,Gibson M,Silver RM.Clinical practice.Recurrentmiscarriage.N Engl J Med.2010;363(18):1740-7.
[0160] [3] Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, etal. Discovery of novel microRNAs in female reproductive tract using nextgeneration sequencing. PLoS One 2010;5:e9637.
[0161] [4]Jeck WR, Sorrentino JA, Wang K, et al. Circular RNAs are abundant, conserved, and associated with ALU repeats[J]. RNA, 2013, 19(2):141-157.
[0162] [5]Salzman J. Circular RNA Expression: Its Potential Regulation and Function. Trends Genet. 2016May; 32(5):309-316.
[0163] [6]Zhao Z,Li X,Jian D,et al.Hsa_circ_0054633in peripheral blood canbe used as a diagnostic biomarker of pre-diabetes and type 2diabetes mellitus[J].Acta Diabetol,2017,54(3):237-245.
[0164] [7]Sun H,Tang W,Rong D,et al.Hsa_circ_0000520,a potential newcircular RNA biomarker,is involved in gastric carcinoma.CancerBiomark.2018Feb 6;21(2):299-306.
[0165] [8]Zhao Z,Li X,Gao C,et al.Peripheral blood circular RNA hsa_circ_0124644can be used as a diagnostic biomarker of coronary artery disease[J].Sci Rep,2017,7:39918.
[0166] [9]Lukiw WJ.Circular RNA(circRNA)in Alzheimer's disease(AD).FrontGenet.2013;4:307.
[0167]
[10] Dang Y,Yan L,Hu B,et al.Tracing the expression of circular RNAsin human pre-implantation embryos.Genome Biol.2016;17(1):130.
[0168]
[11] Liu L,Li L,Ma X,et al.Altered Circular RNA expression in patientswith Repeated Implantation Failure[J].Cell Physiol Biochem,2017,44(1):303-313.
[0169]
[12] Qian Y, Wang
[0170] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> Shanghai Institute of Family Planning Science <120> Miscarriage markers and their application in the diagnosis and prediction of recurrent miscarriage and pathological pregnancy <130> P2020-0006 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 510 <212> RNA <213> Homo sapiens <400> 1 gaugaccagu guccaguga aggaacgagu gaaggugucu cagaacugga gacuggggcg 60 cugccgagag gggauucugc ugaaguggag augcagucag augcccugga ugcagcuaga 120 ggaugauucu cuguacauau cccaggcuaa uuucauccug gccuaccagu uccguccaga 180 uggugccagc uugaaucguc ggccucuggg agucuuugcu gggcaugaug aggacguuug 240 ccacuuugug cuggccaacu cgcauauugu uagugcagga ggggauggga agauuggcau 300 ucauaagauu cacagcaccu ucacugucaa guacucggcu caugaacagg aggugaacug 360 uguggauugc aaagggggca ucauugugag uggcuccagg gacaggacgg ccaaggugug 420 gccuuuggcc ucaggccggc uggggcagug cuuacacacc auccagacug aagaccgagu 480 cugguccauu gcuaucagcc cauuacucag 510 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <400> 2 gtccattgct atcagcccat ta 22 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 tccacttcag cagaatccc 19 <210> 4 <211> 510 <212> DNA <213> Homo sapiens <400> 4 gatgaccagt gtcccagtga aggaacgagt gaaggtgtct cagaactgga gactggggcg 60 ctgccgagag gggattctgc tgaagtggag atgcagtcag atgccctgga tgcagctaga 120 ggatgattct ctgtacatat cccaggctaa tttcatcctg gcctaccagt tccgtccaga 180 tggtgccagc ttgaatcgtc ggcctctggg agtctttgct gggcatgatg aggacgtttg 240 ccactttgtg ctggccaact cgcatattgt tagtgcagga ggggatggga agattggcat 300 tcataagatt cacagcacct tcactgtcaa gtactcggct catgaacagg aggtgaactg 360 tgtggattgc aaagggggca tcattgtgag tggctccagg gacaggacgg ccaaggtgtg 420 gcctttggcc tcaggccggc tggggcagtg cttacacacc atccagactg aagaccgagt 480 ctggtccatt gctatcagcc cattactcag 510 <210> 5 <211> 116 <212> DNA <213> Homo sapiens <400> 5 gtccattgct atcagcccat tactcaggat gaccagtgtc ccagtgaagg aacgagtgaa 60 ggtgtctcag aactggagac tggggcgctg ccgagagggg attctgctga agtgga 116
Claims
1. Use of a recurrent spontaneous abortion (RSA) pathologic pregnancy marker circular RNA or a detection reagent thereof, characterized in that, The circular RNA is hsa_circ_0008362, and is used for preparing a diagnostic reagent or kit for (a) diagnosing recurrent spontaneous abortion (RSA), and / or (b) predicting the occurrence of RSA.
2. Use according to claim 1, characterized in that, The detection reagent comprises: (a) RSA marker circular RNA hsa_circ_0008362 or a cDNA thereof; and / or (b) primers or a primer pair, a probe or a chip specifically amplifying the RSA marker circular RNA hsa_circ_0008362.
3. Use according to claim 2, characterized in that, The nucleotide sequence of the RSA marker circular RNA hsa_circ_0008362 is shown as SEQ ID NO:
1.
4. The use according to claim 1, characterized in that, The diagnosis comprises early diagnosis, auxiliary diagnosis, or a combination thereof.
5. The use according to claim 1, characterized in that, The detection is a detection on an ex vivo sample.
6. Use according to claim 5, characterized in that, The ex vivo sample is selected from the group consisting of a serum sample, a tissue sample, or a combination thereof.
7. Use according to claim 6, characterized in that, The tissue sample is a chorionic villus sample.
8. Use according to claim 6, characterized in that, The detection is a detection on the presence and / or expression amount of the circular RNA hsa_circ_0008362 in the serum and / or tissue sample.
9. Use according to claim 8, characterized in that, If the expression amount of the circular RNA hsa_circ_0008362 in the sample is significantly higher than a control reference value, it indicates that the subject is an RSA patient or has a higher probability of RSA than the general population.
10. The use according to claim 1, characterized in that, The detection reagent is a PCR primer pair.
11. Use according to claim 10, characterized in that, The PCR primer pair is: 5'-GTCCATTGCTATCAGCCCATTA-3', SEQ ID NO: 2; and 5'-TCCACTTCAGCAGAATCCC-3', SEQ ID NO: 3.
Citation Information
Patent Citations
circRNA small molecular marker indicating key pathways of healthy aging and application
CN111363802A